WorldWideScience

Sample records for socs wright-patterson afb

  1. (Environmental investigation of ground water contamination at Wright-Patterson Air Force Base, Ohio)

    1991-10-01

    This report presents information concerning field procedures employed during the monitoring, well construction, well purging, sampling, and well logging at the Wright-Patterson Air Force Base. Activities were conducted in an effort to evaluate ground water contamination.

  2. (Environmental investigation of ground water contamination at Wright- Patterson Air Force Base, Ohio)

    1991-10-01

    This Health and Safety Plan (HSP) was developed for the Environmental Investigation of Ground-water Contamination Investigation at Wright-Patterson Air Force Base near Dayton, Ohio, based on the projected scope of work for the Phase 1, Task 4 Field Investigation. The HSP describes hazards that may be encountered during the investigation, assesses the hazards, and indicates what type of personal protective equipment is to be used for each task performed. The HSP also addresses the medical monitoring program, decontamination procedures, air monitoring, training, site control, accident prevention, and emergency response.

  3. Survey Analysis of Military Parishes: The Wright-Patterson AFB Catholic Parish Example.

    1980-08-01

    had scores which varied from mass to mass--sense of prayerfulness, singing, sense of community, and performance of guitar group--shown in Table 14. 17...significance is that the 1980 ratings were better than the 1978 ratings for all liturgy planning areas. An overall average liturgy planning score was...calculated for each indi- vidual who rated any of the topics. Those scores indicate generally positive perceptions of the liturgies. Eighty-six

  4. [Environmental investigation of ground water contamination at Wright-Patterson Air Force Base, Ohio

    1992-04-01

    This Removal Action System Design has been prepared as a Phase I Volume for the implementation of the Phase II removal action at Wright-Patterson Air Force Base (WPAFB) near Dayton, Ohio. The objective of the removal action is to prevent, to the extent practicable, the migration of ground water contaminated with chlorinated volatile organic compounds (VOCS) across the southwest boundary of Area C. The Phase 1, Volume 9 Removal Action System Design compiles the design documents prepared for the Phase II Removal Action. These documents, which are presented in Appendices to Volume 9, include: Process Design, which presents the 30 percent design for the ground water treatment system (GWTS); Design Packages 1 and 2 for Earthwork and Road Construction, and the Discharge Pipeline, respectively; no drawings are included in the appendix; Design Package 3 for installation of the Ground Water Extraction Well(s); Design Package 4 for installation of the Monitoring Well Instrumentation; and Design Package 5 for installation of the Ground Water Treatment System; this Design Package is incorporated by reference because of its size

  5. (Environmental investigation of ground water contamination at Wright-Patterson Air Force Base, Ohio)

    1992-03-01

    An environmental investigation of ground water conditions has been undertaken at Wright-Patterson Air Force Base (WPAFB), Ohio to obtain data to assist in the evaluation of a potential removal action to prevent, to the extent practicable, migration of the contaminated ground water across Base boundaries. Field investigations were limited to the central section of the southwestern boundary of Area C and the Springfield Pike boundary of Area B. Further, the study was limited to a maximum depth of 150 feet below grade. Three primary activities of the field investigation were: (1) installation of 22 monitoring wells, (2) collection and analysis of ground water from 71 locations, (3) measurement of ground water elevations at 69 locations. Volatile organic compounds including trichloroethylene, perchloroethylene, and/or vinyl chloride were detected in concentrations exceeding Maximum Contaminant Levels (MCL) at three locations within the Area C investigation area. Ground water at the Springfield Pike boundary of Area B occurs in two primary units, separated by a thicker-than-expected clay layers. One well within Area B was determined to exceed the MCL for trichloroethylene.

  6. Environmental Assessment for the National Museum of the United States Air Force Addition, Wright-Patterson Air Force Base, Ohio

    2013-02-01

    AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) United States Air Force 88th...Air Base Wing Wright-Patterson Air Force Base, Ohio 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES...visitors nationwide and from foreign countries. Softball and soccer fields are located adjacent to the Museum grounds and are operated by the 88 Air

  7. Technical and economic assessment for asbestos abatement within Facility 20470, Wright-Patterson Air Force Base, Ohio

    Gibson, S.M.; Ogle, R.B.

    1988-03-01

    This report presents the results of a technical and economic assessment of available alternatives for asbestos abatement within Facility 20470 at the Wright-Patterson Air Force Base in Dayton, Ohio. Each alternative was screened on the basis of technical feasibility, environmental impact, economics, and fulfillment of the IRP goals. Four alternatives for study are: establishing a special operations and maintenance program; enclosure; encapsulation with sealants; and removal, disposal, and replacement. Each of these alternatives was assessed for capability to control the release of asbestos fibers within Facility 20470. Alternatives 1 and 4 were determined to be acceptable, while Alternatives 2 and 3 were found to be unacceptable. 2 refs., 6 figs

  8. Hydrogeology, simulated ground-water flow, and ground-water quality, Wright-Patterson Air Force Base, Ohio

    Dumouchelle, D.H.; Schalk, C.W.; Rowe, G.L.; De Roche, J.T.

    1993-01-01

    Ground water is the primary source of water in the Wright-Patterson Air Force Base area. The aquifer consists of glacial sands and gravels that fill a buried bedrock-valley system. Consolidated rocks in the area consist of poorly permeable Ordovician shale of the Richmondian stage, in the upland areas, the Brassfield Limestone of Silurian age. The valleys are filled with glacial sediments of Wisconsinan age consisting of clay-rich tills and coarse-grained outwash deposits. Estimates of hydraulic conductivity of the shales based on results of displacement/recovery tests range from 0.0016 to 12 feet per day; estimates for the glacial sediments range from less than 1 foot per day to more than 1,000 feet per day. Ground water flow from the uplands towards the valleys and the major rivers in the region, the Great Miami and the Mad Rivers. Hydraulic-head data indicate that ground water flows between the bedrock and unconsolidated deposits. Data from a gain/loss study of the Mad River System and hydrographs from nearby wells reveal that the reach of the river next to Wright-Patterson Air Force Base is a ground-water discharge area. A steady-state, three-dimensional ground-water-flow model was developed to simulate ground-water flow in the region. The model contains three layers and encompasses about 100 square miles centered on Wright-Patterson Air Force Base. Ground water enters the modeled area primarily by river leakage and underflow at the model boundary. Ground water exits the modeled area primarily by flow through the valleys at the model boundaries and through production wells. A model sensitivity analysis involving systematic changes in values of hydrologic parameters in the model indicates that the model is most sensitive to decreases in riverbed conductance and vertical conductance between the upper two layers. The analysis also indicates that the contribution of water to the buried-valley aquifer from the bedrock that forms the valley walls is about 2 to 4

  9. Wright-Patterson AFB, Ohio Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    1985-09-01

    LSTI: ISO -1700 ............. [..........................................NO" ........". OT5...................................................... I WIND...90.3 91.1 91.3 91.4 91.6 92.6 91.b 9i.T 91.7 91.7 91.7 E iso 51.i8 - 76.9 82.1 8b. 90.7 90.7 92.s 92.7 92.8 93.0 93.0 93.0 93.1 93.1 93.1 93.1 FE 2000...97.4 91.4 97.% 91.4 97.4 GE 27003 55.1 79.4 84.4 90.1 95.7 96.8 97.1 98.0 88.1 98.1 98.1 98.1 91.3 98.1 98.1 98.1 UE 18001 55.1 79.5 84.5 90.? 95.8 96.9

  10. [Environmental investigation of ground water contamination at Wright-Patterson Air Force Base, Ohio]. Volume 3, Appendix A, Draft standard operating procedures and elements: Sampling and Analysis Plan (SAP): Phase 1, Task 4, Field Investigation, Draft

    1991-10-01

    This report presents information concerning field procedures employed during the monitoring, well construction, well purging, sampling, and well logging at the Wright-Patterson Air Force Base. Activities were conducted in an effort to evaluate ground water contamination.

  11. [Environmental investigation of ground water contamination at Wright-Patterson Air Force Base, Ohio]. Volume 5, Field Investigation report

    1992-03-01

    An environmental investigation of ground water conditions has been undertaken at Wright-Patterson Air Force Base (WPAFB), Ohio to obtain data to assist in the evaluation of a potential removal action to prevent, to the extent practicable, migration of the contaminated ground water across Base boundaries. Field investigations were limited to the central section of the southwestern boundary of Area C and the Springfield Pike boundary of Area B. Further, the study was limited to a maximum depth of 150 feet below grade. Three primary activities of the field investigation were: (1) installation of 22 monitoring wells, (2) collection and analysis of ground water from 71 locations, (3) measurement of ground water elevations at 69 locations. Volatile organic compounds including trichloroethylene, perchloroethylene, and/or vinyl chloride were detected in concentrations exceeding Maximum Contaminant Levels (MCL) at three locations within the Area C investigation area. Ground water at the Springfield Pike boundary of Area B occurs in two primary units, separated by a thicker-than-expected clay layers. One well within Area B was determined to exceed the MCL for trichloroethylene.

  12. [Environmental investigation of ground water contamination at Wright- Patterson Air Force Base, Ohio]. Volume 4, Health and Safety Plan (HSP); Phase 1, Task 4 Field Investigation report: Draft

    1991-10-01

    This Health and Safety Plan (HSP) was developed for the Environmental Investigation of Ground-water Contamination Investigation at Wright-Patterson Air Force Base near Dayton, Ohio, based on the projected scope of work for the Phase 1, Task 4 Field Investigation. The HSP describes hazards that may be encountered during the investigation, assesses the hazards, and indicates what type of personal protective equipment is to be used for each task performed. The HSP also addresses the medical monitoring program, decontamination procedures, air monitoring, training, site control, accident prevention, and emergency response.

  13. Defense Base Realignment and Closure Budget Data for the Closure of Gentile Air Force Station, Dayton, Ohio, and Realignment of Defense Logistics Agency Components to Wright-Patterson Air Force Base, Ohio

    1996-01-01

    .... This report provides the results of the audit of two projects, valued at $5.5 million, for the closure of Gentile Air Force Station, Dayton, Ohio, and realignment to Wright-Patterson Air Force Base, Ohio, of two Defense Logistics Agency components...

  14. Proceedings of the Annual Conference on Manual Control (10th) held at Wright-Patterson AFB, Ohio on 9-11 April 1974

    1974-04-01

    427 R. E. Fenton , R. D. Gilson, and R. W. Ventola Simulator Evaluation of Three Situation and Guidance Displays for V/STOL Zero-Zero Landings...prostheses is a factor that may lead some amputees to abandon their prostheses shortly after fitting, or to use them primarily for cosmetic purposes...PRESENTATION VIA DUAL KINESTHETIC-TACTUAL DISPLAYS lüTn w *rr ,-.-r Robert E. Fenton Richard D. 611 son Dept. of Electrical Engineering Dept. of

  15. Proceedings of the Conference on Toxicology: Applications of Advances in Toxicology to Risk Assessment. Held at Wright-Patterson AFB, Ohio on 19-21 May 1992

    1993-01-01

    assay is cellular inhibition. Cellular proliferation is essential to normal development and its interruption could lead to depressed growth and possibly...such as the FOB. One major conclusion from motor activity is that the acute effect of many chemicals is a depression of motor activity. Some... Acetylcysteine of cigarrette smoke- induced "bronchitis" in the rat. Exp. Lung Res. 10:267-283. 262 15. Snider, G.L., E.C. Lucey, T.G. Christensen, P.J. Stone

  16. Proceedings of the Government Neural Network Applications Workshop Held at Wright-Patterson AFB, Ohio on August 24-26, 1992. Volume 1

    1992-08-01

    W. Hubbard and LD. lackel. Backpropagation applied to handwritm zip code recognitio Neral Comptaion. vol. I pages 541-551.1989 I LFh*udaima. Neual...vision system onto one face of the wheel as a 3 cm x 3 cm image. This face of the wheel is finished as a fine-grain ground-glass diffusing surface...sensor system described above actually computes 3 sets of features per wheel rotation as shown in Figure 5. A third of the wheel’s image input face is

  17. Aerospace medicine at Brooks AFB, TX: hail and farewell.

    Nunneley, Sarah A; Webb, James T

    2011-05-01

    With the impending termination of USAF operations at Brooks Air Force Base (AFB) in San Antonio, TX, it is time to consider its historic role in Aerospace Medicine. The base was established in 1917 as a flight training center for the U.S. Army Air Service and in 1926 became home to its School of Aviation Medicine. The school moved to San Antonio's Randolph Field in 1931, but in 1959 it returned to Brooks where it occupied new facilities to support its role as a national center for U.S. Air Force aerospace medicine, including teaching, clinical medicine, and research. The mission was then expanded to encompass support of U.S. military and civilian space programs. With the abrupt termination of the military space program in 1969, research at Brooks focused on clinical aviation medicine and support of advanced military aircraft while continuing close cooperation with NASA in support of orbital spaceflight and the journey to the Moon. Reorganization in the 1990s assigned all research functions at Brooks to the Human Systems Division and its successors, leaving to USAFSAM the missions related to clinical work and teaching. In 2002 the USAF and the city of San Antonio implemented shared operation of Brooks as a "City-Base" in the hope of deflecting threatened closure. Nevertheless, under continuing pressure to consolidate military facilities in the United States, the 2005 Base Closure and Realignment Commission ordered Brooks closed by 2011, with its aerospace medicine functions relocated to new facilities at Wright-Patterson AFB in Dayton, OH.

  18. Wright-Patterson Air Force Base: The First Century

    2015-01-01

    aside in 1934 to house a Transient Camp for temporary workers employed under Depression -era programs. During 1934 and 1935, these men labored on...The 445th Airlift Wing upgraded from C-141s to C-5As between 2005 and 2007, before transitioning to C-17s in 2012. The Centennial of Flight was a...December 2002 on Wright Brothers Hill. The event initiated the nation’s commemoration of the Centennial of Flight. These actions symbolized the

  19. Aerospace Transparency Research Compendium

    Pinkus, Alan

    2003-01-01

    ... (ARRL), located at Wright-Patterson AFB OH, has advanced aerospace transparency technology through the investigative research of numerous optical and visual parameters inherent in aerospace transparencies...

  20. Proceedings of the Technical Forum (3rd) on the F-16 MIL-STD-1750A Microprocessor and the F-16 MIL-STD-1589B Compiler Held at Wright-Patterson AFB, OH on May 5-6, 1982. Volume 1. Papers,

    1982-05-06

    BUS MKS Fucioa Diagram ~ALAOAR *RSAU TT E E 0E U D*iQ MKSXQ16 Microinstruction Word 1 ~ ~5 .6 a7 . 6 1 1,I 1,. 151li "" SP*D ACCA CONTROL JASNTJ EX...result CALLSF 4F FA Call with ID in register GETSID 4F F9 Get re-time ID of function Data Forwarding FWD 4F F6 Forward integer DFWD 4F F5 Forward

  1. Surface Observation Climatic Summaries (SOCS) For Mather AFB, California

    1992-02-01

    1100 SPEND (RTS) CE14 GEIS GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS CATEGORY A 1.7 .5 .1 930 1.6 .6 .1 930 1.6 .4 930 3.4 1.0...ITS) GE14 0E18 GE25 ORS GE14 GEIS GE25 OS GE14 GEl8 GE25 OBS GE14 GE18 GE25 OBS CATEGORY A 5.7 2.4 930 5.2 1.3 .2 930 1.7 .5 .2 930 1.5 .5 .1 930...TIME (LST) 0600 - 2000 ALL HOURS SPEED K75 GE14 GEl8 GE25 OBS GE14 GEl8 UE25 OS CAT Y A 3.5 1.1 .1 4650 2.8 .9

  2. Acute Dermal Irritation Study of Six Jet Fuels in New Zealand White Rabbits: Comparison of Four Bio-Based Jet Fuels with Two Petroleum JP-8 Fuels

    2014-02-01

    Shafer University of Dayton Research Institute Wright-Patterson AFB OH David R. Mattie Bioeffects Division Molecular Bioeffects Branch February...master schedule for the company. Metasys DDC Electronic Environmental Control System Controls and monitors animal room environmental conditions

  3. 77 FR 75616 - Procurement List; Additions

    2012-12-21

    .... 611, 1919 E Grange Ave., Milwaukee, WI NPA: Easter Seals Southeast Wisconsin, Inc., South Milwaukee... B, Bldg. 39, Wright-Patterson AFB, Dayton, OH NPA: Goodwill Easter Seals Miami Valley, Dayton, OH...

  4. Quantitative Methods for Determining U.S. Air Force Crew Cushion Comfort

    2006-09-01

    Directorate Biosciences and Protection Division Biomechanics Branch Wright Patterson AFB OH 45433-7947 Form Approved REPORT DOCUMENTATION PAGE OMB No...Division Biomechanics Branch Wright-Patterson AFB OH 45433-7947 9. SPONSORING I MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S...workstations were constructed utilizing ejection seat long-term flight. mockups and foot pedal assemblies modified to simulate the ACES II seat in the F-16

  5. Department of Defense Expenditure Plans

    2009-03-20

    317 Aberdeen Proving Ground MD Replace Windows and Renovate Lounge Area, 4508 700 B 318 Aberdeen Proving Ground MD Replace Three Boilers, 525 500 E ...Rt 235 630 O 1137 Wright Patterson AFB OH Replace Perimeter Fence - Gate 26c Along E Bank of Mad River 644 O 1138 Wright Patterson AFB OH Replacec...Energy E Roofs R Utilities U Pavement/roads/grounds P Barracks B Quality of Life Q Operations O Medical M Family Housing F American Recovery and

  6. Environmental Assessment, Glide Slope/Clear Zone Obstructions, Wright-Patterson Air Force Base, Ohio

    2013-06-01

    the Integrated Cultural Resources Managemen t Plan. Historic resou rces determined to be eligible fo r listing on the National Register of Histo ric... Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington VA 22202-4302. Respondents should be aware that notwithstanding any other...and clear zones (CZs) at WPAr B in order to protect human hea lth and safety by providing adequate clearance for aircraft operations . The existing

  7. An Analysis of Shelf Space Allocation at the Wright-Patterson Air Force Base Commissary.

    1987-09-01

    Company performed a major shelf space allocation study involving 59 of their stores. The study involved planning and executing a shelf by shelf reset...Betty Crocker Chocolate .a9 2 Betty CrocKer Yellow .93 3 Betty Crocker Devils Food .92 4 Betty Crocker Choc . Choc . Chip .94 5 Betty Crocker German...Headquarters Air Force Commissary Services. ACOS Executive Summary. 28 January 19d6. 12. deadquarters Air Force Commissary Services. Store _Layout

  8. Environmental Assessment for New Veterinary Clinic at Wright Patterson Air Force Base, Dayton, Ohio

    2007-08-01

    English sparrow (Passer domesticus), mockingbird (Mimus polyglottos), and red- winged black bird (Agelaius phoeniceus). 3.3.3 Threatened and...addition, airfield safety zones have been established under AICUZ to minimize the number of people who would be injured or killed if an aircraft

  9. Environmental Assessment for the Hilltop Community Services District, Wright-Patterson Air Force Base, Ohio

    2012-03-01

    land  complexes. Small areas of residual soils over  limestone  and shale  bedrock  exist on steep slopes in the  eastern portion of Area B.  The two...cultural resources, environmental justice/protection of children, geology , land use, water resources, infrastructure, and visual resources...disproportionately or adversely affected by the action. Geology and Soils (EA Se1ction 4.4): There would be no excess fill excavated during site preparation and

  10. Environmental Assessment for BRAC Facilities and Remote Field Training Site, Wright-Patterson Air Force Base

    2008-03-01

    survey (BHE, 2001). Radio tracking of these two bats confirmed the presence of a maternity colony in a dead slippery elm (Ulmus rubra) in a woodlot...The most common trees observed were black walnut (Juglans nigra), elm (Ulmus spp.), eastern cottonwood, willow, ash (Fraxinus americana), sycamore

  11. Environmental Assessment for the Aeromedical Evacuation Formal Training Unit, Wright-Patterson Air Force Base

    2012-05-01

    pennsylvanica), White Ash (Fraxinus americana), Shingle Oak (Quercus imbricaria), Northern Red Oak (Quercus rubra), Slippery Elm (Ulmus rubra...American Elm (Ulmus americana), Eastern Cottonwood (Populus deltoides), Silver Maple (Acer saccharinum), Sassafras (Sassafras albidum), Post Oak (Quercus

  12. NTP Radioisotopes SOC Ltd

    Letule, T.

    2017-01-01

    NTP Radioisotopes SOC Ltd, a wholly owned subsidiary of the South African Nuclear Energy Corporation (NECSA). Supplies around 20% of the world's medical radioisotopes used. NTP is a pioneer in the introduction and growth of nuclear medicine as in South Africa. Nuclear medicine is the medical specialty that involves the use of radioactive isotopes in the diagnosis and treatment of diseases. Nuclear medicine contributes to enhancing the lives of the society. There is a compelling need for nuclear medicine to be promoted and utilized in the rest of Africa, due to the increasing prevalence of cancer. Cancer is rapidly becoming a public health crisis in low-income and middle-income countries. In sub-Saharan Africa, patients often present with advanced disease

  13. Proceedings of the Triservice Corrosion of Military Equipment Conference (1974) Held at Dayton, Ohio on 29-31 Oct 1974. Volume 1. Sessions 1 through 3

    1975-09-01

    Wright-Patterson AFB, Ohio 45433 A. L. Jackman P. 0. Box 98 Magna, Utah 84044 Elwln L. Jang Sacramento ALC/NANCA McClellan AFB, California 95652...Ttje Project Manager was Mr. Fredric H. Harf and the Research Adviser was Dr. Hugh R. Gray of the Materials and Structures Division, NASA Lewis

  14. Environmental Assessment for the Expansion and Renovation of Dog Kennels, Wright-Patterson Air Force Base, Ohio

    2006-12-01

    leucocephala), killdeer (Charities vociferous), English sparrow (Passer domesticus), mockingbird (Mimus polyglottos), and red-winged blackbird (Agelaius...or killed . The project site should be examined daily for snakes, and if any eastern massasaugas are found, all work shall cease and the USFWS shall...airfield safety zones were established under AICUZ to minimize the number of people who would be injured or killed if an aircraft crashed. Three safety

  15. Environmental Assessment for Explosives Ordnance Disposal Proficiency Training Range at Wright-Patterson Air Force Base, Ohio

    2010-06-01

    ANTIOCH UNIVERSITY V1E1N JOE LEASING SPECIALIST EXCEL PM VIEW JOB NEWS PHOTOS & VIDEOS i~.-... --: i\\ ... I ,. j ... ’TouchdoW"n Jesus ’ i n...t Bald Eoglr - Wloll!rwll’/ c::::J Blllllng Star Skm Bom 209 Commttr=t Plrtwav P.D.Bax12B CottageGrovt.WI SJ$27·0128 phone: 606-839~1998 fu...line and the base hospital . The views of the residents of the Brick Quarters were solicited through the public notice put in the Dayton Daily News and

  16. Installation Restoration Program. Phase II. Confirmation/Quantification Stage I for Wright-Patterson Air Force Base, Dayton, Ohio.

    1985-09-01

    nitrate, chlor- ide, sulfate, boron, iron manga - nese, sodium, TOC, TOX, and phenol. Sample six leachate seeps for specific conductance, chlor- ide...Primary Drinking Water Standard of 10 mg/l for nitrate. No boron, iron or manga - nese were found in MW-17. Sodium was detected at 35 mg/l in the well...Thomas, 1976, "Control Pro- Leis, W., and A. Metry, " Multimedia Pathways of Con- gram for Leachate Affecting a Multiple Aquifer System, taminant

  17. Environmental Assessment for the AFIT Master Plan, Wright-Patterson Air Force Base, Ohio, 88th Air Base Wing

    2011-05-20

    Creek during a base-wide mist net survey (BHE 2001). Radio tracking of these two bats confirmed the presence of a maternity colony in a dead slippery ... elm (Ulmus rubra) in a woodlot on the campus of Wright State University. No sightings of Indiana bats have been reported within the area of the

  18. Methylation profiling of SOCS1, SOCS2, SOCS3, CISH and SHP1 in Philadelphia-negative myeloproliferative neoplasm.

    Zhang, Min Yue; Fung, Tsz Kin; Chen, Fang Yuan; Chim, Chor Sang

    2013-10-01

    Janus kinase-signal transducer and activator of transcription (JAK/STAT) signalling, pivotal in Philadelphia-negative (Ph-ve) myeloproliferative neoplasm (MPN), is negatively regulated by molecules including SOCSs, CISH and SHP1. SOCS1, SOCS2 and SOCS3 methylation have been studied in MPN with discordant results. Herein, we studied the methylation status of SOCS1, SOCS2 and SOCS3, CISH and SHP1 by methylation-specific polymerase chain reaction (MSP) in cell lines and 45 diagnostic marrow samples of Ph-ve MPN. Moreover, we attempted to explain the discordance of methylation frequency by mapping the studied MSP primers to the respective genes. Methylation was detected in normal controls using SOCS2 MSP primers in the 3'translated exonic sequence, but not primers around the transcription start site in the 5' untranslated regions (5'UTR). SOCS1, SOCS2, SOCS3 and CISH were completely unmethylated in primary MPN samples and cell lines. In contrast, methylation of SHP1 was detected in 8.9% primary marrow samples. Moreover, SHP1 was completely methylated in K562 cell line, leading to reversible SHP1 silencing. A review of methylation studies of SOCS1 and SOCS3 showed that spuriously high rates of SOCS methylation had been reported using MSP primers targeting CpG sites in the 3'translated exonic sequence, which is also methylated in normal controls. However, using MSP primers localized to the 5'UTR, methylation of SOCS1, SOCS2 and SOCS3 is infrequent across all studies. In summary, methylation of SOCS1, SOCS2, SOCS3 and CISH is infrequent in Ph-ve MPN. Appropriate MSP primers are important for accurate estimation of the methylation frequency. The role of SHP1 methylation in the pathogenesis of MPN warrants further investigation. © 2013 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  19. IGF-1 induces SOCS-2 but not SOCS-1 and SOCS-3 transcription in juvenile Nile tilapia (Oreochromis niloticus).

    Liu, Cai-Zhi; Luo, Yuan; Limbu, Samwel Mchele; Chen, Li-Qiao; Du, Zhen-Yu

    2018-05-20

    Insulin-like growth factor-1 (IGF-1) plays a crucial role in regulating growth in vertebrates whereas suppressors of cytokine signaling (SOCS) act as feedback inhibitors of the GH/IGF-1 axis. Although SOCS-2 binds the IGF-1 receptor and inhibits IGF-1-induced STAT3 activation, presently there is no clear evidence as to whether IGF-1 could induce SOCS gene expression. The current study aimed to determine whether IGF-1 could induce the transcription of SOCS in juvenile Nile tilapia ( Oreochromis niloticus ). We show that there is a common positive relationship between the mRNA expression of IGF-I and SOCS-2 under different nutritional statuses and stimulants, but not the mRNA expression of SOCS-1 and SOCS-3 Furthermore, rhIGF-1 treatment and transcriptional activity assay confirmed the hypothesis that IGF-1 could induce SOCS-2 expression, whereas it had no effect or even decreased the expression of SOCS-1 and SOCS-3 Overall, we obtained evidence that the transcription of SOCS-2, but not SOCS-1 or SOCS-3, could be induced by IGF signaling, suggesting that SOCS-2 serves as a feedback suppressor of the IGF-1 axis in juvenile Nile tilapia. © 2018. Published by The Company of Biologists Ltd.

  20. Quantum Confined Semiconductors - In-House Interim Research

    2013-04-01

    Laboratory, Materials & Manufacturing Directorate, Wright Patterson AFB, OH 45433-7707, USA blnstituto de Ciencias Fisicas, Universidad Nacional Aut6noma...111is work was supported by the Ai1· Force Office of Scientific Research (AFRU RS E, Dr. Kitt Reinhardt). • Also with lnstituto de Ciencias Fisicas

  1. 76 FR 55933 - Federal Property Suitable as Facilities To Assist the Homeless

    2011-09-09

    ... written expression of interest to HHS, addressed to Theresa Ritta, Division of Property Management... Management Division, Naval Facilities Engineering Command, Washington Navy Yard, 1330 Patterson Ave., SW... Area Ohio Facility 30089 5490 Pearson Wright Patterson AFB OH 45433 Landholding Agency: Air Force...

  2. Closing the Gap: An Analysis of Options for Improving the USAF Fighter Fleet from 2105 to 2035

    2015-10-01

    Lanchester Equations. Graduate Research Paper, (Wright Patterson AFB: Air Force Institute of Technology, 2011), 45 58 John P. Geiss,. et al. Blue...Gilbert, Ronald E. Strategic Implications of US Fighter Force Reductions: Air to Air Combat Modelling Using Lanchester Equations. Graduate Research Paper

  3. A Methodology for Conus APOE Reception Planning.

    1982-09-01

    mentioned, the reception process is a service-type system, which produces services to be rendered to the personnel and cargo flowing through it. The... Heizer , Ramon N. Chief, Supply Systems Branch, Dir- ectorate of Distribution, DCS/Logistics Operations, HQ AFLC, Wright-Patterson AFB OH. Personal inter

  4. 77 FR 22298 - Intent To Grant an Exclusive Patent License

    2012-04-13

    ... Public Law 96-517, as amended; the Department of the Air Force announces its intention to grant PS Engineering, Inc., a corporation of the State of Tennessee, having a place of business at 9800 Martel Road... Command Law Office, AFMCLO/JAZ, 2240 B Street, Rm D-14, Wright-Patterson AFB, OH 45433-7109; Facsimile...

  5. Jet Fuel Exacerbated Noise-Induced Hearing Loss: Focus on Prediction of Central Auditory Processing Dysfunction

    2017-09-01

    standard deviation). 4.3.3 Lipid Class Determination for Partition Coefficient Prediction. Research was conducted on methods to quantify...Advancement of Military Medicine Aeromedical Research Department United States Air Force School of Aerospace Medicine Wright-Patterson AFB OH...Report for Oct 2015 to Mar 2017 Air Force Research Laboratory 711th Human Performance Wing Airman Systems Directorate Bioeffects Division

  6. Er: YLF Laser Development

    1975-12-01

    Force Wright Aeronautical Laboratory, AFAL/DHO, Wright-Patterson AFB, OH 45433. WL/AFSC( IST ) ltr, 12 Apr 1991 UNCLASSIFIED AD NUMBER LIMITATION CHANGES TO...ju^i^zs.^iu •Lbbrtbataafetiu.*. i ! mtotfffiflaiai WP1— 1 ’ »■■■«I HIU I I .1 III ll.lll. VIH IWII

  7. Aircraft Fire Sentry. Volume 2. Appendices

    1993-01-01

    including New Mexico Engineering Research Institute (NMERI), National Institute of Standards and Technology (NIST), Wright-Patterson AFB, and AFESC at...Installation Remove the mounting bracket from the smoke alarm by depresing the release tab marked "PRESS" (see Figure 1. pg. 5). Pivot the bracket awey from and

  8. The Pilot Staffing Conundrum: A Delphi Study

    2009-06-01

    Project, AFIT/ GMO /LAL/98J-2. School of Logistics and Acquisition Management, Air Force Institute of Technology (AU), Wright Patterson AFB, OH, June...Kafer, John H. Relationship of Airline Pilot Demand and Air Force Pilot Retention. Graduate Research Project, AFIT/ GMO /LAL/98J-11. School of Logistics

  9. Programmed Control of Optical Grating Scales for Visual Research.

    1980-12-01

    A -AOO .9 AIR FORCE INST OF TECH WRIGHT-PATTERSON AFB OH SCHOO--ETC F/6 14/2 PROGRAMMED CONTROL OF OPTI CAL GRATING SCALES FOR VISUAL RESEARC --ETC(fl...custom system for AMRL. The cost in memory parts alone was $40,000, a good indication that the market is not over-priced. Ca-? western Reserve

  10. A Study of Facilities and Infrastructure Planning, Prioritization, and Assessment at Federal Security Laboratories (Revised)

    2013-02-01

    Engineer Support Agency Air Force Real Property Agency Wright-Patterson Air Force Base (AFB), OH; Kirtland AFB, New Mexico ; Eglin AFB, Florida...emergency response to their site. • Sandia works with the State of New Mexico Finance Authority to finance the development of a new facility...algorithms specific to an F&I type to generate the modernization requirement based on Replacement Plant Value, depreciation , expected service life, and

  11. A Study of Facilities and Infrastructure Planning, Prioritization, and Assessment at Federal Security Laboratories

    2012-11-01

    Support Agency Air Force Real Property Agency Wright-Patterson Air Force Base (AFB), OH; Kirtland AFB, New Mexico ; Eglin AFB, Florida; Edwards...with the State of New Mexico Finance Authority to finance the development of a new facility. Laboratories communicated frequently with State and...modernization requirement based on Replacement Plant Value, depreciation , expected service life, and residual value at the end of the expected service life

  12. SOCS proteins in development and disease

    Trengove, Monique C; Ward, Alister C

    2013-01-01

    Cytokine and growth factor signaling mediates essential roles in the differentiation, proliferation, survival and function of a number of cell lineages. This is achieved via specific receptors located on the surface of target cells, with ligand binding activating key intracellular signal transduction cascades to mediate the requisite cellular outcome. Effective resolution of receptor signaling is also essential, with excessive signaling having the potential for pathological consequences. The Suppressor of cytokine signaling (SOCS) family of proteins represent one important mechanism to extinguish cytokine and growth factor receptor signaling. There are 8 SOCS proteins in mammals; SOCS1-7 and the alternatively named Cytokine-inducible SH2-containing protein (CISH). SOCS1-3 and CISH are predominantly associated with the regulation of cytokine receptor signaling, while SOCS4-7 are more commonly involved in the control of Receptor tyrosine kinase (RTK) signaling. Individual SOCS proteins are typically induced by specific cytokines and growth factors, thereby generating a negative feedback loop. As a consequence of their regulatory properties, SOCS proteins have important functions in development and homeostasis, with increasing recognition of their role in disease, particularly their tumor suppressor and anti-inflammatory functions. This review provides a synthesis of our current understanding of the SOCS family, with an emphasis on their immune and hematopoietic roles. PMID:23885323

  13. Interleaved Subtask Scheduling on Multi Processor SOC

    Zhe, M.

    2006-01-01

    The ever-progressing semiconductor processing technique has integrated more and more embedded processors on a single system-on-achip (SoC). With such powerful SoC platforms, and also due to the stringent time-to-market deadlines, many functionalities which used to be implemented in ASICs are

  14. Environmental Assessment, Minuteman III and Peacekeeper Silo Elimination, Malmstrom AFB, Montana; F. E. Warren AFB, Wyoming; and Vandenberg AFB, California

    2013-05-01

    Baccharis pilularis), California sagebrush (Artemisia californica), and poison hemlock ( Conium maculatum ) are common species in the area (Vandenberg AFB...spotted bat (Euderma maculatum ) and Preble’s shrew (Sorex preblei). Habitat for the spotted bat is most often in rough, rocky, semiarid, and arid

  15. A Study of Cumulative Trauma Disorders of the Upper Extremities and Occupation in Wright-Patterson Adir Force Base Civilian Personnel.

    1995-09-01

    Workers: Individual, Ergonomie and Work Organizational Factors," Ergonomics, 38: 763- 776 (April 1995). Brogmus, G.E. and R. Marko. "The...Naval Health Research Center, San Diego CA, June 1988 (AD-A199920). Keyserling, W. M. and others. "A Checklist For Evaluating Ergonomie Risk Factors

  16. Final Environmental Assessment for National Air & Space Intelligence Center and US Air Force School of Aerospace Medicine Field Training Activities at Wright-Patterson Air Force Base, Ohio

    2011-04-14

    1997. Flushing Responses to Wintering Bald Eagles to Military Activity. Journal of Wildlife Management. 61(4):1307-1313. Telesco, D.J. and F.T. van ... Manen . 2006. Do black bears respond to military weapons training? The Journal of Wildlife Management. 70(1): 222-229. Whittaker, D. and R.L...patrol use. The dog may be on or offleash in the rear seat, on a stable platform, only. 2. l. 7. Assigning the dog team a cargo van or three-pack pickup

  17. Environmental Assessment of the 445th Airlift Wing Conversion from C-5 to C-17 Aircraft at Wright-Patterson Air Force Base

    2010-12-01

    prefabricated clean room with a 15-foot ceiling . Additional renovation requirements for this shop area 22 include providing a self-contained heating...construction and demolition debris. Recycling programs for various 21 waste categories (e.g., glass , metals, and papers) reduce reliance on landfills...from Defense Fuel Support Point – Lebanon . The 21 Bulk Fuels Storage tank farm is comprised of ten 420,000-gallon JP-8 ASTs and one 840,000-gallon JP

  18. An Application of a Costing Methodology to Waste-to-Energy Power Generating Units at Remote Sites and Wright-Patterson Air Force Base.

    1983-09-01

    which were based on off-season, summer prices and demand C4 143-8], and placed mandatory controls on all petroleum product prices s6:136]. These...Service, September 1982. Hausman , J. A., and P. L. Joskow. "Evaluating the Costs and Benefits of Appliance Efficiency Standards," American Economic...Department of Agriculture, Washington: United States Government Printing Office, March 4, 1989. Zoch, Lawrence L., Jr., Jack J. Rusch, and Edward L. Springer

  19. Environmental Assessment for Construction of BRAC Infrastructure Upgrades and the Human Performance Wing Complex in the Area B Hilltop District, Wright-Patterson Air Force Base

    2007-09-01

    leucocephala), killdeer, English sparrow (Passer domesticus), mockingbird (Mimus polyglottos), and red-winged blackbird also are often observed within...people who would be injured or killed if an aircraft crashed. Three safety zones are designated at the end of all active runways: Clear Zone, APZ I

  20. A Study of the Linen and Laundry Control Procedures at the U.S. Air Force Medical Center, Wright-Patterson Air Force Base, Ohio.

    1980-08-01

    effective accounting system for "tracking" of inventory and its ccsts is a very real requirement. S ecurity A matter of considerable concern should be...The Wash. Modern Nursing Home; March 1971. Danks , R.T. Automation For A New Central Laundry. Hospitals; J.A.TI.A.; 16 September 1971. Durham, R.C

  1. Survey of Wastewater Discharge, Eielson AFB, Alaska, EHL(K) 73-24

    Thomas, Jerry F; Pauls, Chester F

    1973-01-01

    This report contains the results of a wastewater survey at Eielson AFB, Alaska, conducted by the USAF Environmental Health Laboratories, Kelly AFB, Texas and McClellan AFB, CA, between 22 and 27 June 1973...

  2. Respiratory Syncytial Virus Nonstructural Proteins Upregulate SOCS1 and SOCS3 in the Different Manner from Endogenous IFN Signaling

    Junwen Zheng

    2015-01-01

    Full Text Available Respiratory syncytial virus (RSV infection upregulates genes of the suppressor of cytokine signaling (SOCS family, which utilize a feedback loop to inhibit type I interferon dependent antiviral signaling pathway. Here, we reconstituted RSV nonstructural (NS protein expression plasmids (pNS1, pNS2, and pNS1/2 and tested whether NS1 or NS2 would trigger SOCS1 and SOCS3 protein expression. These NS proteins inhibited interferon- (IFN- α signaling through a mechanism involving the induction of SOCS1 and SOCS3, which appeared to be different from autocrine IFN dependent. NS1 induced both SOCS1 and SOCS3 upregulation, while NS2 only induced SOCS1 expression. The induced expression of SOCS1 and SOCS3 preceded endogenous IFN-signaling activation and inhibited the IFN-inducible antiviral response as well as chemokine induction. Treatments with INF-α and NS proteins both induced SOCS1 expression; however, they had opposing effects on IFN-α-dependent antiviral gene expression. Our results indicate that NS1 and NS2, which induce the expression of SOCS1 or SOCS3, might represent an independent pathway of stimulating endogenous IFN signaling.

  3. Level II Ergonomic Analyses, Dover AFB, DE

    1999-02-01

    IERA-RS-BR-TR-1999-0002 UNITED STATES AIR FORCE IERA Level II Ergonomie Analyses, Dover AFB, DE Andrew Marcotte Marilyn Joyce The Joyce...Project (070401881, Washington, DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE 4. TITLE AND SUBTITLE Level II Ergonomie Analyses, Dover...1.0 INTRODUCTION 1-1 1.1 Purpose Of The Level II Ergonomie Analyses : 1-1 1.2 Approach 1-1 1.2.1 Initial Shop Selection and Administration of the

  4. The Impact of Goal Setting and Empowerment on Governmental Matrix Organizations

    1993-09-01

    shared. In a study of matrix management, Eduardo Vasconcellos further describes various matrix structures in the Galbraith model. In a functional...Technology/LAR, Wright-Patterson AFB OH, 1992. Vasconcellos , Eduardo . "A Model For a Better Understanding of the Matrix Structure," IEEE Transactions on...project matrix, the project manager maintains more influence and the structure lies to the right-of center ( Vasconcellos , 1979:58). Different Types of

  5. A Review of Selected Literature on Stresses Affecting Soldiers in Combat

    1979-05-01

    14 W. D. Chiles . Psycho logicat Stress as a Theoretical Concept, WADC Technical Report 57-457, Wright Air Development Center, Wright- Patterson AFB...placing the bulb of the thermometer in a water saturated 1M. J. Duke, N. Findikyan, J. Anderson, and S. B. Sells. Stress /N Vih ,:;. [I. ’Aheriarn7...to stress. Concern with fatigue and its effects have led to a considerable amount of work in the past two decades. Chiles , Alluisi, and Adams 30

  6. Developing Reliable Telemedicine Platforms with Unreliable and Limited Communication Bandwidth

    2017-10-01

    AFRL-SA-WP-TR-2017-0019 Developing Reliable Telemedicine Platforms with Unreliable and Limited Communication Bandwidth Peter F...Wright-Patterson AFB, OH 45433-7913 DISTRIBUTION STATEMENT A. Approved for public release. Distribution is unlimited. STINFO COPY NOTICE AND...invention that may relate to them. Qualified requestors may obtain copies of this report from the Defense Technical Information Center (DTIC) (http

  7. Information Analysis Centers in the Department of Defense. Revision

    1987-07-01

    Combat Data Information Center (CDIC) and the Aircraft Survivability Model Repository ( ASMR ) into the Survivability/Vulnerability Information Analysis...Information Center (CDIC) and the Aircraft Survivability Model Respository ( ASMR ). The CDIC was a central repository for combat and test data related to...and ASMR were operated under the technical monitorship of the Flight Dynamics Laboratory at Wright-Patterson AFB, Ohio and were located in Flight

  8. Interaction of Jet Fuel Hydrocarbon Components with Red Blood Cells and Hemoglobin

    2014-06-24

    Directorate (RHDJ), Wright-Patterson AFB, OH. The authors would like to thank Maj. Paul Eden, Nicole Schaeublin, Christin Grabinski, Dr. Jeff Gearhart...We would also like to thank LtCol. Norman Fox (Laboratory Flight Commander), Mrs. Nersa Loh (Supervisor, Transfusion Services), and Mr. Dan Fischer ...Approximately 7.8 mg of hemoglobin sample was concentrated into a total volume of 5 mL of Fischer PBS pH 7.5 buffer using an Amicon Centrifugal Filter Unit

  9. Evaluation of a Damage Accumulation Monitoring System as an Individual Aircraft Tracking Concept

    1982-05-01

    series of cinematic picture frames. The real life situation is even more complicated because the aircraft experiences intermediate loading states as...Fighter Attack Spectrum on Crack Growth, Air Force Flight Dynamics Laboratory (FBE), Wright- Patterson AFB, Ohio, 45433, AFFDL-TR-76-112, March 1977...Pennsylvania, 19874, Report Number NADC-77194-60, March 29, 1980. 209 10. G. E. Lambert and D. F. Bryan, The Influence of Fleet Variability on Crack Growth

  10. An Analysis of Measures Used to Evaluate the Air Force Critical Item Program

    1991-09-01

    example of a histogram. Cause & Effect Diagram. The cause and effect diagram was introduced in 1953 by Dr. Kaoru Ishikawa in summarizing the opinions of...Personal Interview. Air Force Institute of Technology, School of Engineering, Wright-Patterson AFB OH, 24 April 1991. 31. Ishikawa , Dr. Kaoru . Guide to...collected. How the data are collected will determine which measurement techniques are appropriate. Ishikawa classifies data collection into five categories

  11. De-Dopplerization of Acoustic Measurements

    2017-08-10

    accurate measurement of aircraft location to resample the time signal to account for the compression and expansion of acoustic wavefronts. Correcting...AFRL-RH-WP-TR-2017-0043 DE-DOPPLERIZATION OF ACOUSTIC MEASUREMENTS Frank Mobley, PhD 711 HPW/RHCB Wright-Patterson AFB OH...TITLE AND SUBTITLE DE-DOPPLERIZATION OF ACOUSTIC MEASUREMENTS 5a. CONTRACT NUMBER In-House 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER

  12. Information Processing and Collective Behavior in a Model Neuronal System

    2014-03-28

    were invited to visit the 711th Human Performance Wing at Wright Patterson AFB to give a briefing on our work. We also presented our work at AFRL in...for an AFOSR project headed by Steve Reppert on Monarch Butterfly navigation. We visited the Reppert lab at the UMASS Medical School and have had many...the requested briefing at the 711th Human Performance Wing . It is a natural extension of the original aims of the grant, as the suprachiasmatic

  13. 5th International Conference on Cryocoolers

    1989-01-01

    The Cryocoolers 5 proceedings archives the contributions of leading international experts at the 5th International Cryocooler Conference that was held in Monterey, California on August 18-19, 1988. The authors submitted twenty six papers describing advancements and applications of cryocoolers in the temperature range below 80K. This year's conference was hosted by the U.S. Naval Postgraduate School in Monterey, California, and the conference proceedings reproduced here were published by the Wright-Patterson AFB in Ohio.

  14. Damage Tolerant Repair Techniques for Pressurized Aircraft Fuselages

    1994-01-01

    RepoW Techniques for Prwurized Aircraft AXWdOg 4.9 Summary and Conclusions The basics of adhesive bonded repairs for aluminum aircraft fuselages have... of cruise altitude and bending stresses in the plate at the tip of one-sided reinforcements (chapter 5). The expanded Rose model was transformed into a...DEPARTMEN1 OF THE AIR FORCE AGENCY REPORT NUMBER AFIT/CI 2950 P STREET WRIGHT-PATTERSON AFB OH 45433-7765 11. SUPPLEMENTARY NOTES Usa. DISTRUISUIOII

  15. Human Resources Data in Weapon System Design: An Initial Plan for Development of a Unified Data Base.

    1980-11-01

    tems such as D-195, D-220, etc. 11. Provides a standardized methodology for the selection of systems, subsystems to be used as the historical baseline...Graham, R. S., & Hilgeman, .1. B. A methodological approach to the analysis and automatic handling of task information for systems in the conceptual phase...AMRL- TR-63-78 AD-419 018, Wright-Patterson AFB, Ohio: Aerospace Medical Reserach Laboratories, August 1963. 46. Reed, L. E., Snyder, M. T., Baran, H

  16. Respiratory Highlights, 2016 - 2017 Influenza Season (2 October 2016 - 31 September 2017)

    2018-02-21

    Medicine Public Health and Preventive Medicine Dept/PHR 2510 Fifth St., Bldg. 840 Wright-Patterson AFB, OH 45433-7913 8. PERFORMING ORGANIZATION...Surveillance Program Cleared, 88PA, Case # 2018-1051, 5 Mar 2018. 1 USAF School of Aerospace Medicine & Defense Health Agency...influenza from an infected child with a history of swine contact at an agricultural event in Texas. The HA gene from select influenza positives was

  17. C-130J Breathing Resistance Study

    2016-05-01

    scientific and technical information exchange , and its publication does not constitute the Government’s approval or disapproval of its ideas or findings...regulator and MBU- 20/P oxygen mask, was supplied gaseous Aviators’ Breathing Oxygen (ABO). The regulator was operated in various operating modes, at...Generating System (OBOGS) Laboratory, Area B, Wright-Patterson AFB OH. The CRU-73 oxygen regulator was supplied with 50 pounds/square inch of gaseous

  18. A Wind Tunnel Investigation of Joined Wing Scissor Morphing

    2006-06-01

    would use the low sweep for carrier landing and subsonic cruise, and use the high sweep for 12 supersonic flight [13]. According to Raymer [19...Wright-Patterson AFB, Ohio: Air Force Institute of Technology, 2005. 12. Katz, Joseph, Shaun Byrne, and Robert Hahl. "Stall Resistance Features of...Lifting-Body Airplane Configurations." Journal of Aircraft 2nd ser. 36 (1999): 471-474. 13. Kress, Robert W. "Variable Sweep Wing Design." AIAA 83

  19. Training Affects Variability in Training Performance both Within and Across Jobs

    2016-03-01

    was measured by a verbal/ math composite derived from the US military enlistment test, the Armed Services Vocational Aptitude Battery. Training...performance was assessed by written tests of job-related knowledge content. Predictive validity of the verbal/ math composite ranged from .124 to .836...146, Room 122 Wright-Patterson AFB, OH 45433-7511 Malcolm James Ree Department of Leadership Studies School of Business and Leadership Our

  20. A Policy Analysis of Using Unit Costs as a Means of Performance Measurement in the Air Force Science and Technology Program

    1991-09-01

    demonstrate, is that there is more than one way to account for S &T costs and evaluate its program performance. The first option evaluated considers...Personal Communication. Wright Laboratory, Wright-Patterson AFB OH, 14 May 1991. Horngren , Charles T. and George Foster. Cost Accounting A Managerial...78 Programmatic Feedback ........ 79 S &T as Overhead............79 Scoring the Options............80 Unit Costs ................8 Programmatic

  1. An Assessment of the Uniform Funding Policy of DoD Directive 3200.11.

    1980-09-01

    34 Unpublished master’s thesis. GSM/SM/73-10, AFIT/EN, Wright-Patterson AFB OH 45433, 7 January 1974. Horngren , Charles T. Cost Accounting : A Management...reverse side if noceeeary aid identify by block number) Uniform Funding Policy Test Facilities Test and Evaluation Cost Accounting Accounting 20...segregated from overhead as a cost accounting device in both Government and industry. Historically, this distinc- tion has merely aided distribution of total

  2. Life-Cycle Costs of Alternative ICBM Second Stage Designs

    1992-09-01

    of Logistics, Air Force Institute of Technology (AU), Wright-Patterson AFB OH, 1992. 34. Horngren , Charles T. and George Foster. Cost Accounting ; A...Managerial Emphasis (Sixth Edition). Englewood Cliffs NJ: Prentice-Hall, Inc., 1987. 35. Horngren , Charles T. and George Foster. Cost Accounting ; A...our research. We would also like to thank those involved with the 1991 Small ICBM Operations and Support cost estimate. Your assistance with the O& S

  3. Formation of the U.S. Air Force Aviator Post Traumatic Stress Disorder Study Group

    2016-11-15

    Wood, III, John Heaton, Mark Hubner, Nicole Rhodes 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION... Questionnaire -9 PIQ performance intelligence quotient PTSD post-traumatic stress disorder RPA remotely piloted aircraft USAF U.S. Air Force VIQ verbal intelligence quotient ...Human Performance Wing U.S. Air Force School of Aerospace Medicine Aerospace Medicine Department 2510 Fifth St., Bldg. 840 Wright-Patterson AFB, OH

  4. Assisting Defense Conversion Technology Transfer Efforts. A Case Study of Ohio’s Miami Valley.

    1995-09-01

    Contracting Division, Wright-Patterson AFB OH. Official Letter Correspondence. 24 January 1994. Bryman , Alan. Research Methods and Organization Studies...Washington DC: 22 February 1993. Cooper, Donald R. and C. William Emory. Business Research Methods (Tifth Edition). Chicago: Richard D. Irwin, Inc...data was collected to address the research objective through a case study methodology. First, it describes and justifies the specific method used

  5. Molecular Verification of Cryptops hortensis (Scolopendromorpha: Cryptopidae) in theNearctic Region

    2018-01-29

    Journal Article 3. DATES COVERED (From – To) March – April 2016 4. TITLE AND SUBTITLE Molecular Verification of Cryptops hortensis...PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) USAF School of Aerospace Medicine ...Public Health and Preventive Medicine Dept/PHR 2510 Fifth St., Bldg. 840 Wright-Patterson AFB, OH 45433-7913 8. PERFORMING ORGANIZATION REPORT

  6. Consistency of the Relations of Cognitive Ability and Personality Traits to Pilot Training Performance

    2014-08-22

    MAB-II scores. The univariate Case II correction ( Thorndike , 1949) was used for the NEO-PI-R scores due to a lack of sufficient data to apply the...pilot training, AFRL-RH-WP-TR-2013-0081. Wright-Patterson AFB, OH: Air Force Research Laboratory, Decision Making Division. Thorndike , R. L...NEO domain scores were corrected using the univariate Case 2 ( Thorndike , 1949) method. Correlations in the column labeled rfc were corrected for both

  7. Variation tolerant SoC design

    Kozhikkottu, Vivek J.

    performance distribution. This task is particularly complex and challenging due to the inter-dependencies between components' execution, indirect effects of shared resources, and interactions between multiple system-level "execution paths". We argue that accurate variation-aware performance analysis requires Monte-Carlo based repeated system execution. Our proposed analysis framework leverages emulation to significantly speedup performance analysis without sacrificing the generality and accuracy achieved by Monte-Carlo based simulations. Our experiments show performance improvements of around 60x compared to state-of-the-art hardware-software co-simulation tools and also underscore the framework's potential to enable variation-aware design and exploration at the system level. Our second contribution addresses the problem of designing variation-tolerant SoCs using recovery based design, a popular circuit design paradigm that addresses variations by eliminating guard-bands and operating circuits at close to "zero margins" while detecting and recovering from timing errors. While previous efforts have demonstrated the potential benefits of recovery based design, we identify several challenges that need to be addressed in order to apply this technique to SoCs. We present a systematic design framework to apply recovery based design at the system level. We propose to partition SoCs into "recovery islands", wherein each recovery island consists of one or more SoC components that can recover independent of the rest of the SoC. We present a variation-aware design methodology that partitions a given SoC into recovery islands and computes the optimal operating points for each island, taking into account the various trade-offs involved. Our experiments demonstrate that the proposed design framework achieves an average of 32% energy savings over conventional worst-case designs, with negligible losses in performance. The third contribution of this thesis introduces disproportionate

  8. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    Theumer, M.G.; Lopez, A.G.; Masih, D.T.; Chulze, S.N.; Rubinstein, H.R.

    2003-01-01

    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H 2 O 2 , while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H 2 O 2 . These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins

  9. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    Theumer, M G; Lopez, A G; Masih, D T; Chulze, S N; Rubinstein, H R

    2003-04-15

    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H{sub 2}O{sub 2}, while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H{sub 2}O{sub 2}. These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins.

  10. Research on SOC Calibration of Large Capacity Lead Acid Battery

    Ye, W. Q.; Guo, Y. X.

    2018-05-01

    Large capacity lead-acid battery is used in track electric locomotive, and State of Charge (SOC) is an important quantitative parameter of locomotive power output and operating mileage of power emergency recovery vehicle. But State of Charge estimation has been a difficult part in the battery management system. In order to reduce the SOC estimation error better, this paper uses the linear relationship of Open Circuit Voltage (OCV) and State of Charge to fit the SOC-OCV curve equation by MATLAB. The method proposed in this paper is small, easy to implement and can be used in the battery non-working state SOC estimation correction, improve the estimation accuracy of SOC.

  11. Expression of the SOCS family in human chronic wound tissues: Potential implications for SOCS in chronic wound healing

    Feng, Yi; Sanders, Andrew J.; Ruge, Fiona; Morris, Ceri-Ann; Harding, Keith G.; Jiang, Wen G.

    2016-01-01

    Cytokines play important roles in the wound healing process through various signalling pathways. The JAK-STAT pathway is utilised by most cytokines for signal transduction and is regulated by a variety of molecules, including suppressor of cytokine signalling (SOCS) proteins. SOCS are associated with inflammatory diseases and have an impact on cytokines, growth factors and key cell types involved in the wound-healing process. SOCS, a negative regulator of cytokine signalling, may hold the potential to regulate cytokine-induced signalling in the chronic wound-healing process. Wound edge tissues were collected from chronic venous leg ulcer patients and classified as non-healing and healing wounds. The expression pattern of seven SOCSs members, at the transcript and protein level, were examined in these tissues using qPCR and immunohistochemistry. Significantly higher levels of SOCS3 (P=0.0284) and SOCS4 (P=0.0376) in non-healing chronic wounds compared to the healing/healed chronic wounds were observed at the transcript level. Relocalisation of SOCS3 protein in the non-healing wound environment was evident in the investigated chronic biopsies. Thus, the results show that the expression of SOCS transcript indicated that SOCS members may act as a prognostic biomarker of chronic wounds. PMID:27635428

  12. SOCS2 and SOCS3 expression in ulcerative colitis and their correlation with inflammatory response and immune response

    Le Huang1

    2017-05-01

    Full Text Available Objective: To study the correlation of SOCS2 and SOCS3 expression in ulcerative colitis tissue with inflammatory response and immune response. Methods: Ulcerative colitis lesions and normal mucosa from colonoscopic biopsy in Central Hospital of Zibo Mining Refco Group Ltd between May 2014 and July 2016 were selected and enrolled in UC group and control group respectively. RNA was extracted to determine mRNA expression of SOCS2 and SOCS3 as well as inflammatory response JAKs/STATs pathway molecules; protein was extracted to determine the contents of immune response cytokines. Results: SOCS2 mRNA expression in intestinal mucosa of UC group was not significantly different from that of control group, and SOCS3 mRNA expression was significantly lower than that of control group; JAK1, JAK2, JAK3, STAT1, STAT3 and STAT5 mRNA expression as well as IFN-γ and IL-17 protein contents in intestinal mucosa of UC group were significantly higher than those of control group while IL-4 and IL-10 protein contents were significantly lower than those of control group; JAK1, JAK2, JAK3, STAT1, STAT3 and STAT5 mRNA expression as well as IFN-γ and IL-17 protein contents in UC group of intestinal mucosa with low SOCS3 expression were significantly higher than those of intestinal mucosa with high SOCS3 expression while IL-4 and IL-10 protein contents were significantly lower than those of intestinal mucosa with high SOCS3 expression. Conclusion: Low expression of SOCS3 in ulcerative colitis can aggravate the inflammatory reaction and cause the imbalance of Th1/Th2 and Th17/Treg immune response.

  13. AFB/open cycle gas turbine conceptual design study

    Dickinson, T. W.; Tashjian, R.

    1983-09-01

    Applications of coal fired atmospheric fluidized bed gas turbine systems in industrial cogeneration are identified. Based on site-specific conceptual designs, the potential benefits of the AFB/gas turbine system were compared with an atmospheric fluidized design steam boiler/steam turbine system. The application of these cogeneration systems at four industrial plant sites is reviewed. A performance and benefit analysis was made along with a study of the representativeness of the sites both in regard to their own industry and compared to industry as a whole. A site was selected for the conceptual design, which included detailed site definition, AFB/gas turbine and AFB/steam turbine cogeneration system designs, detailed cost estimates, and comparative performance and benefit analysis. Market and benefit analyses identified the potential market penetration for the cogeneration technologies and quantified the potential benefits.

  14. Settling-velocity specific SOC distribution on hillslopes

    Hu, Yaxian; Berhe, Asmeret Asefaw; Fogel, Marilyn L.

    The net effect of soil erosion by water, as a sink or source of atmospheric CO2, is determined by the spatial (re-)distribution and stability of eroded soil organic carbon (SOC). The depositional position of eroded SOC is a function of the transport distances of soil fractions where the SOC...... fractions. Eroding sandy soils and sediment were sampled after a series of rainfall events along a slope on a freshly seeded cropland in Jutland, Denmark. All the soil samples were fractionated into five settling classes using a settling tube apparatus. The spatial distribution of soil settling classes...... shows a coarsening effect immediately below the eroding slope, followed by a fining trend at the slope tail. The 13C values of soil fractions were more positive at the footslope than on the slope shoulder or at the slope tail, suggesting enhanced decomposition rate of fresh SOC input at the footslope...

  15. The simple art of SoC design

    Keating, Michael

    2011-01-01

    This book tackles head-on the challenges of digital design in the era of billion-transistor SoCs. It discusses fundamental design concepts in design and coding required to produce robust, functionally correct designs. It also provides specific techniques for measuring and minimizing complexity in RTL code. Finally, it discusses the tradeoff between RTL and high-level (C-based) design and how tools and languages must progress to address the needs of tomorrow's SoC designs.

  16. Impact of vegetation types on soil organic carbon stocks SOC-S in Mediterranean natural areas

    Parras-Alcántara, Luis; Lozano-García, Beatriz; Cantudo-Pérez, Marta

    2015-04-01

    Soils play a key role in the carbon geochemical cycle because they can either emit large quantities of CO2 or on the contrary they can act as a store for carbon. Agriculture and forestry are the only activities that can achieve this effect through photosynthesis and the carbon incorporation into carbohydrates (Parras-Alcántara et al., 2013). The Mediterranean evergreen oak Woodland (MEOW - dehesa) is a type of pasture with scattered evergreen and deciduous oak stands in which cereals are often grown under the tree cover. It is a system dedicated to the combined production of Iberian swine, sheep, fuel wood, coal and cork as well as to hunting. These semi-natural areas still preserve some of the primitive vegetation of the Mediterranean oak forests. The dehesa is a pasture where the herbaceous layer is comprised of either cultivated cereals such as oat, barley and wheat or native vegetation dominated by annual species, which are used as grazing resources. These Iberian open woodland rangelands (dehesas) have been studied from different points of view: hydrologically, with respect to soil organic matter content, as well as in relation to gully erosion, topographical thresholds, soil erosion and runoff production, soil degradation and management practices…etc, among others. The soil organic carbon stock capacity depends not only on abiotic factors such as the mineralogical composition and the climate, but also on soil use and management (Parras et al., 2014 and 2015). In Spanish soils, climate, use and management strongly affect the carbon variability, mainly in soils in dry Mediterranean climates characterized by low organic carbon content, weak structure and readily degradable soils. Hontoria et al. (2004) emphasized that the climate and soil use are two factors that greatly influence carbon content in the Mediterranean climate. This research sought to analyze the SOC stock (SOCS) variability in MEOW - dehesa with cereals, olive grove and Mediterranean oak forest

  17. EXPRESSION OF SOCS3 AND SOCS5 MRNAS IN PERIPHERAL BLOOD MONONUCLEARS FROM THE PATIENTS WITH BRONCHIAL ASTHMA

    V. V. Lim

    2014-01-01

    Full Text Available We observed sixty patients with allergic bronchial asthma (ABA and 54 with non-allergic bronchial asthma (NABA. Quantitative SOCS3 and SOCS5 mRNA expression was evaluated by means of real-time PCR. Eighteen healthy persons served as a control group. In patients with bronchial asthma (irrespectively of pathogenetic form, a significant increase of SOCS3 transcription factor expression was detected in peripheral blood mononuclears, as compared with control group. This increase was more pronounced in NABA group. The mRNA SOCS5 level was significantly decreased in bronchial asthma patients, as compared to control group, especially, in ABA subgroup rather than in NABA patients. Thus, an increased expression of SOCS3 mRNA in BA patients could be regarded as a protective antiinflammatory response Decrease of SOCS5 mRNA expression in patients with bronchial asthma (being more pronounced in ABA, may be indicative for a deficiency in negative feedback regulation of gene transcription in allergic bronchial asthma.

  18. CloudSat Safety Operations at Vandenberg AFB

    Greenberg, Steve

    2006-01-01

    CloudSat safety operations at Vendenberg AFB is given. The topics include: 1) CloudSat Project Overview; 2) Vandenberg Ground Operations; 3) Delta II Launch Vehicle; 4) The A-Train; 5) System Safety Management; 6) CALIPSO Hazards Assessment; 7) CALIPSO Supplemental Safeguards; 8) Joint System Safety Operations; 9) Extended Stand-down; 10) Launch Delay Safety Concerns; and 11) Lessons Learned.

  19. Environmental Assessment of Beale AFB Grazing Lease Program

    2012-12-01

    Beale AFB will use livestock (cattle, sheep and goats ) on its properties throughout the year as needed for the control of noxious weeds, reduction...initiating a wildfire. California Farm Bureau Federation policy recognizes that grazing is the most practical and environmentally acceptable way to...Site Monitoring Well Installation and Annual Targeted Goat Grazing Project, Placer County, California. 21 September 2011.  

  20. Selection of key terrain attributes for SOC model

    Greve, Mogens Humlekrog; Adhikari, Kabindra; Chellasamy, Menaka

    As an important component of the global carbon pool, soil organic carbon (SOC) plays an important role in the global carbon cycle. SOC pool is the basic information to carry out global warming research, and needs to sustainable use of land resources. Digital terrain attributes are often use...... was selected, total 2,514,820 data mining models were constructed by 71 differences grid from 12m to 2304m and 22 attributes, 21 attributes derived by DTM and the original elevation. Relative importance and usage of each attributes in every model were calculated. Comprehensive impact rates of each attribute...

  1. SOCS-1 localizes to the microtubule organizing complex-associated 20S proteasome.

    Vuong, Bao Q; Arenzana, Teresita L; Showalter, Brian M; Losman, Julie; Chen, X Peter; Mostecki, Justin; Banks, Alexander S; Limnander, Andre; Fernandez, Neil; Rothman, Paul B

    2004-10-01

    The regulation of cytokine signaling is critical for controlling cellular proliferation and activation during an immune response. SOCS-1 is a potent inhibitor of Jak kinase activity and of signaling initiated by several cytokines. SOCS-1 protein levels are tightly regulated, and recent data suggest that SOCS-1 may regulate the protein levels of some signaling proteins by the ubiquitin proteasome pathway; however, the cellular mechanism by which SOCS-1 directs proteins for degradation is unknown. In this report, SOCS-1 is found to colocalize and biochemically copurify with the microtubule organizing complex (MTOC) and its associated 20S proteasome. The SOCS-1 SH2 domain is required for the localization of SOCS-1 to the MTOC. Overexpression of SOCS-1 targets Jak1 in an SH2-dependent manner to a perinuclear distribution resembling the MTOC-associated 20S proteasome. Analysis of MTOCs fractionated from SOCS-1-deficient cells demonstrates that SOCS-1 may function redundantly to regulate the localization of Jak1 to the MTOC. Nocodazole inhibits the protein turnover of SOCS-1, demonstrating that the minus-end transport of SOCS-1 to the MTOC-associated 20S proteasome is required to regulate SOCS-1 protein levels. These data link SOCS-1 directly with the proteasome pathway and suggest another function for the SH2 domain of SOCS-1 in the regulation of Jak/STAT signaling.

  2. Correct-by-construction approaches for SoC design

    Sinha, Roopak; Basu, Samik

    2013-01-01

    This book describes an approach for designing Systems-on-Chip such that the system meets precise mathematical requirements. The methodologies presented enable embedded systems designers to reuse intellectual property (IP) blocks from existing designs in an efficient, reliable manner, automatically generating correct SoCs from multiple, possibly mismatching, components.

  3. Building Energy Audit Report, for Hickam AFB, HI

    Chvala, William D.; De La Rosa, Marcus I.; Brown, Daryl R.; Dixon, Douglas R.

    2010-09-30

    A building energy assessment was performed by a team of engineers from Pacific Northwest National Laboratory (PNNL) under contract to the Department of Energy/Federal Energy Management program (FEMP). The effort used the Facility Energy Decision System (FEDS) model to determine how energy is consumed at Hickam AFB, identify the most cost-effective energy retrofit measures, and calculate the potential energy and cost savings. This documents reports the results of that assessment.

  4. Final Environmental Assessment: Replace Hanscom AFB Middle School

    2012-04-01

    2012 iv RFTA Reserve Forces Training Area SAPS Satellite Accumulation Points SF Square feet SIP State Implementation Plan SO2 Sulfur dioxide...Restoration Program (IRP), now called the Environmental Restoration Program ( ERP ). Subsequent discoveries increased the number of sites to 22. Each...EPA under CERCLA or by the Commonwealth of Massachusetts. No sites listed in the ERP for Hanscom AFB are located on or near the existing Middle

  5. A Generalized SOC-OCV Model for Lithium-Ion Batteries and the SOC Estimation for LNMCO Battery

    Caiping Zhang

    2016-11-01

    Full Text Available A state-of-charge (SOC versus open-circuit-voltage (OCV model developed for batteries should preferably be simple, especially for real-time SOC estimation. It should also be capable of representing different types of lithium-ion batteries (LIBs, regardless of temperature change and battery degradation. It must therefore be generic, robust and adaptive, in addition to being accurate. These challenges have now been addressed by proposing a generalized SOC-OCV model for representing a few most widely used LIBs. The model is developed from analyzing electrochemical processes of the LIBs, before arriving at the sum of a logarithmic, a linear and an exponential function with six parameters. Values for these parameters are determined by a nonlinear estimation algorithm, which progressively shows that only four parameters need to be updated in real time. The remaining two parameters can be kept constant, regardless of temperature change and aging. Fitting errors demonstrated with different types of LIBs have been found to be within 0.5%. The proposed model is thus accurate, and can be flexibly applied to different LIBs, as verified by hardware-in-the-loop simulation designed for real-time SOC estimation.

  6. Process modeling of a reversible solid oxide cell (r-SOC) energy storage system utilizing commercially available SOC reactor

    Mottaghizadeh, Pegah; Santhanam, Srikanth; Heddrich, Marc P.; Friedrich, K. Andreas; Rinaldi, Fabio

    2017-01-01

    Highlights: • An electric energy storage system was developed based on a commercially available SOC reactor. • Heat generated in SOFC mode of r-SOC is utilized in SOEC operation of r-SOC using latent heat storage. • A round trip efficiency of 54.3% was reached for the reference system at atmospheric pressure. • An improved process system design achieved a round-trip efficiency of 60.4% at 25 bar. - Abstract: The increase of intermittent renewable energy contribution in power grids has urged us to seek means for temporal decoupling of electricity production and consumption. A reversible solid oxide cell (r-SOC) enables storage of surplus electricity through electrochemical reactions when it is in electrolysis mode. The reserved energy in form of chemical compounds is then converted to electricity when the cell operates as a fuel cell. A process system model was implemented using Aspen Plus® V8.8 based on a commercially available r-SOC reactor experimentally characterized at DLR. In this study a complete self-sustaining system configuration is designed by optimal thermal integration and balance of plant. Under reference conditions a round trip efficiency of 54.3% was achieved. Generated heat in fuel cell mode is exploited by latent heat storage tanks to enable endothermic operation of reactor in its electrolysis mode. In total, out of 100 units of thermal energy stored in heat storage tanks during fuel cell mode, 90% was utilized to offset heat demand of system in its electrolysis mode. Parametric analysis revealed the significance of heat storage tanks in thermal management even when reactor entered its exothermic mode of electrolysis. An improved process system design demonstrates a system round-trip efficiency of 60.4% at 25 bar.

  7. A microprocessor from AVR to embedded SoC

    Jeong, Geum Seoh

    2005-01-01

    This book was divided into two parts. The first part consists of ten chapter, which are basic knowledge, code vision AVR compiler, analysis on code vision, introduction and characteristic of AVR, I/O ports, interrupt and timer/counter, LCD, serial communication, analog comparator and stepping Motor and digital control of DC Motor. In the second part, it introduces Embedded Soc including application field, its characteristic, general description, functional description, designs with Quartus II.

  8. Cache Performance Optimization for SoC Vedio Applications

    Lei Li; Wei Zhang; HuiYao An; Xing Zhang; HuaiQi Zhu

    2014-01-01

    Chip Multiprocessors (CMPs) are adopted by industry to deal with the speed limit of the single-processor. But memory access has become the bottleneck of the performance, especially in multimedia applications. In this paper, a set of management policies is proposed to improve the cache performance for a SoC platform of video application. By analyzing the behavior of Vedio Engine, the memory-friendly writeback and efficient prefetch policies are adopted. The experiment platform is simulated by ...

  9. An Analysis of Contract Management Processes at the Space and Missile Systems Center and the Air Force Life Cycle Management Center (Wright-Patterson) Using the Contract Management Maturity Model

    2012-11-28

    graduation, Capt Chang’s next assignment is at Los Angeles Air Force Base in the Space and Missile Systems Center (SMC). Capt Chang is unmarried with... married to the former Ms. Laura Hazzard, and they have three children, Madden, and twins Aubrey and Tyler. Captain Keith V. Philaphandeth is an Air...2012 SPONSORED RESEARCH TOPICS Acquisition Management  Acquiring Combat Capability via Public-Private Partnerships (PPPs)  BCA: Contractor vs

  10. SOCS-1 deficiency does not prevent diet-induced insulin resistance

    Emanuelli, Brice; Macotela, Yazmin; Boucher, Jérémie

    2008-01-01

    Obesity is associated with inflammation and increased expression of suppressor of cytokine signaling (SOCS) proteins, which inhibit cytokine and insulin signaling. Thus, reducing SOCS expression could prevent the development of obesity-induced insulin resistance. Using SOCS-1 knockout mice, we...... investigated the contribution of SOCS-1 in the development of insulin resistance induced by a high-fat diet (HFD). SOCS-1 knockout mice on HFD gained 70% more weight, displayed a 2.3-fold increase in epididymal fat pads mass and increased hepatic lipid content. This was accompanied by increased mRNA expression...... of leptin and the macrophage marker CD68 in white adipose tissue and of SREBP1c and FAS in liver. HFD also induced hyperglycemia in SOCS-1 deficient mice with impairment of glucose and insulin tolerance tests. Thus, despite the role of SOCS proteins in obesity-related insulin resistance, SOCS-1 deficiency...

  11. Essential issues in SOC design designing complex systems-on-chip

    Lin, Youn-long Steve

    2007-01-01

    Covers issues related to system-on-chip (SoC) design. This book covers IP development, verification, integration, chip implementation, testing and software. It contains valuable academic and industrial examples for those involved with the design of complex SOCs.

  12. SOCS-1 Localizes to the Microtubule Organizing Complex-Associated 20S Proteasome

    Vuong, Bao Q.; Arenzana, Teresita L.; Showalter, Brian M.; Losman, Julie; Chen, X. Peter; Mostecki, Justin; Banks, Alexander S.; Limnander, Andre; Fernandes, Neil; Rothman, Paul B.

    2005-01-01

    The regulation of cytokine signaling is critical for controlling cellular proliferation and activation during an immune response. SOCS-1 is a potent inhibitor of Jak kinase activity and of signaling initiated by several cytokines. SOCS-1 protein levels are tightly regulated, and recent data suggest that SOCS-1 may regulate the protein levels of some signaling proteins by the ubiquitin proteasome pathway; however, the cellular mechanism by which SOCS-1 directs proteins for degradation is unkno...

  13. DMPD: Regulation of cytokine signaling by SOCS family molecules. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 14644140 Regulation of cytokine signaling by SOCS family molecules. Fujimoto M, Nak...a T. Trends Immunol. 2003 Dec;24(12):659-66. (.png) (.svg) (.html) (.csml) Show Regulation of cytokine signaling by SOCS family... molecules. PubmedID 14644140 Title Regulation of cytokine signaling by SOCS family molec

  14. 33 CFR 334.1130 - Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones.

    2010-07-01

    ... Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones. 334.1130 Section 334.1130 Navigation and... RESTRICTED AREA REGULATIONS § 334.1130 Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB... (WSMC) at Vandenberg AFB, California. (3) The impacting of missile debris from launch operations will...

  15. Modulation of SOCS protein expression influences the interferon responsiveness of human melanoma cells

    Lesinski, Gregory B; Zimmerer, Jason M; Kreiner, Melanie; Trefry, John; Bill, Matthew A; Young, Gregory S; Becknell, Brian; Carson, William E III

    2010-01-01

    Endogenously produced interferons can regulate the growth of melanoma cells and are administered exogenously as therapeutic agents to patients with advanced cancer. We investigated the role of negative regulators of interferon signaling known as suppressors of cytokine signaling (SOCS) in mediating interferon-resistance in human melanoma cells. Basal and interferon-alpha (IFN-α) or interferon-gamma (IFN-γ)-induced expression of SOCS1 and SOCS3 proteins was evaluated by immunoblot analysis in a panel of n = 10 metastatic human melanoma cell lines, in human embryonic melanocytes (HEM), and radial or vertical growth phase melanoma cells. Over-expression of SOCS1 and SOCS3 proteins in melanoma cells was achieved using the PINCO retroviral vector, while siRNA were used to inhibit SOCS1 and SOCS3 expression. Tyr 701 -phosphorylated STAT1 (P-STAT1) was measured by intracellular flow cytometry and IFN-stimulated gene expression was measured by Real Time PCR. SOCS1 and SOCS3 proteins were expressed at basal levels in melanocytes and in all melanoma cell lines examined. Expression of the SOCS1 and SOCS3 proteins was also enhanced following stimulation of a subset of cell lines with IFN-α or IFN-γ. Over-expression of SOCS proteins in melanoma cell lines led to significant inhibition of Tyr 701 -phosphorylated STAT1 (P-STAT1) and gene expression following stimulation with IFN-α (IFIT2, OAS-1, ISG-15) or IFN-γ (IRF1). Conversely, siRNA inhibition of SOCS1 and SOCS3 expression in melanoma cells enhanced their responsiveness to interferon stimulation. These data demonstrate that SOCS proteins are expressed in human melanoma cell lines and their modulation can influence the responsiveness of melanoma cells to IFN-α and IFN-γ

  16. An Investigation of the Relationship between Stressful Life Events and Psychological, Behavioral and Physiological Outcomes

    1984-09-01

    LOU DEcISIO LATITUDE *Figure 2-2. Demand vs Control Model. 4roa ’Jb Psychological Factors and Coronarý Heart Disease" by Karasek . Theorell . Schwartz...Wright-Patterson AFB OH, AD A134381- Karasek , R.A., Baker, D., Marxer, F., Ahebom, A., & Theorell , T. (1981). Job Decision Latitude, Job Demands, and...hormones have been shown to promote CHD in "* •animal experiments (Kornitzer et al., 1982). Applying this process to the job environment scenario, Karasek

  17. Revisions to the PETROS 4 Shell Response Code.

    1984-02-01

    change in the corresponding curvature tensor 𔃿’. DD(JLA) ftA cl &y()j * -. ,:"DD2(J,LA) DEL See ZETA 146,156 DELBAR 71 See ZETA 409 DELNOR See EQUIL2...Cleveland, OH 44135 1 AFML (LLN, Dr. Nicholas) 1 Bell Helicopter Textron Wright-Patterson AFB, OH 45433 ATTN: Mr. Nile Fischer P.O. Box 482 I ASD/ENFTV, Mr...2406A 1 Texas A&M University 1000 Western Avenue Dept Aerospace Eng West Lynn, MA 01905 ATTN: Dr. W. Haisler College Station, TX 77843 I Kaman Tempo

  18. Multisensory Integration for Pilot Spatial Orientation

    2006-09-01

    1993-0022). Wright-Patterson AFB, OH: Air Force Armstrong Laboratories. Gilson, R.D., Ventola, R.W., & Fenton , R.E. (1975). A kinesthetic...Ventola, R.W., & Fenton , R.E. (1975). A kinesthetic-tactual display for stall deterrence. In Eleventh Annual Conference on Manual Control (NASA TM...M., L) 2 = Impact (H, M, L) 3 = Persistence/Difficulty to work-around (H, M., L) 4 = Overall Severity: 1=Severe, 2=Major, 3=Minor, 4= Cosmetic

  19. Beamed Energy Propulsion by Means of Target Ablation

    Rosenberg, Benjamin A.

    2004-01-01

    This paper describes hundreds of pendulum tests examining the beamed energy conversion efficiency of different metal targets coated with multiple liquid enhancers. Preliminary testing used a local laser with photographic paper targets, with no liquid, water, canola oil, or methanol additives. Laboratory experimentation was completed at Wright-Patterson AFB using a high-powered laser, and ballistic pendulums of aluminum, titanium, or copper. Dry targets, and those coated with water, methanol and oil were repeatedly tested in laboratory conditions. Results were recorded on several high-speed digital video cameras, and the conversion efficiency was calculated. Paper airplanes successfully launched using BEP were likewise recorded

  20. Very Low Cost Expendable Harassment System Design Study. Volume 3

    1975-12-01

    testing involves placing a pitot tube rake in the plane of the propeller to determine C-22 iJi;.^*.^^^...--^ ;:„.-:■. ■ ■.■■.VI:-I ^v ?sammaa*mmwm i...ii^.Maj!iiiilH||^,J)||IHi|KI^ Henry , George 1975b Personal Interviews. Foreign Technology Divlsion/ETTS, Wright-Patterson AFB, OH, 15 June - 25...E-Systems, Inc., Melpar Division, Falls Church, VA: 8 July - 15 September 1975. Rose, Henry , Engineer 1975b Telephone Conversation. Sensenich

  1. A Study of USN Aircrew Attitudes Regarding Technology’s Ability to Replace the Naval Flight Officer on Typical Combat Missions Carrier Based Aircraft are Tasked to Perform

    1993-09-01

    Management, Air Force Institute of Technology (AU), Wright Patterson AFB CH, 1991. Horngren , Charles T. and George Foster. Cost Accounting : A Managerial...Submit - TotalCastOPnperewldSubmnit * s ((I eEnter this figure in column 13(c)(1) SHORE ESTAILISHMENT COST TO PREPARE AND SUBMIT PAY GRADE No OR ORYRT...W’IC QUALIT’Y TI15?SrTF-* AFIT/GSM/LAR/93S- 1 A SILMY OF USN AIRCREW ATTIU2 RECARDING TE*L ’ S ABILITY TO REPLACE THE NAVAL FLICHT OFFICER ON TYPICAL

  2. SOCS proteins in regulation of receptor tyrosine kinase signaling

    Kazi, Julhash U.; Kabir, Nuzhat N.; Flores Morales, Amilcar

    2014-01-01

    Receptor tyrosine kinases (RTKs) are a family of cell surface receptors that play critical roles in signal transduction from extracellular stimuli. Many in this family of kinases are overexpressed or mutated in human malignancies and thus became an attractive drug target for cancer treatment....... The signaling mediated by RTKs must be tightly regulated by interacting proteins including protein-tyrosine phosphatases and ubiquitin ligases. The suppressors of cytokine signaling (SOCS) family proteins are well-known negative regulators of cytokine receptors signaling consisting of eight structurally similar...

  3. STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell lymphoma

    Brender, C; Nielsen, M; Kaltoft, K

    2001-01-01

    ) obtained from affected skin from a patient with mycosis fungoides (MF) and from peripheral blood from a patient with Sezary syndrome (SS). In contrast, constitutive SOCS-3 expression is not found in the leukemic Jurkat T-cell line, the MOLT-4 acute lymphoblastic leukemia cell line, and the monocytic......, it has been hypothesized that an aberrant SOCS expression plays a role in neoplastic transformation. This study reports on a constitutive SOCS-3 expression in cutaneous T-cell lymphoma (CTCL) cell lines. SOCS-3 protein is constitutively expressed in tumor cell lines (but not in nonmalignant T cells...... leukemic cell line U937. Expression of SOCS-3 coincides with a constitutive activation of STAT3 in CTCL tumor cells, and stable transfection of CTCL tumor cells with a dominant negative STAT3 strongly inhibits SOCS-3 expression, whereas transfection with wild-type STAT3 does not. Moreover, the reduced SOCS...

  4. AFB-NETT - business opportunities for European biomass industry

    Higham, I.

    1997-01-01

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  5. AFB-NETT - business opportunities for European biomass industry

    Higham, I. [ETSU, Oxfordshire (United Kingdom)

    1997-12-31

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  6. AFB-NETT - business opportunities for European biomass industry

    Higham, I [ETSU, Oxfordshire (United Kingdom)

    1998-12-31

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  7. Correlation between the model accuracy and model-based SOC estimation

    Wang, Qianqian; Wang, Jiao; Zhao, Pengju; Kang, Jianqiang; Yan, Few; Du, Changqing

    2017-01-01

    State-of-charge (SOC) estimation is a core technology for battery management systems. Considerable progress has been achieved in the study of SOC estimation algorithms, especially the algorithm on the basis of Kalman filter to meet the increasing demand of model-based battery management systems. The Kalman filter weakens the influence of white noise and initial error during SOC estimation but cannot eliminate the existing error of the battery model itself. As such, the accuracy of SOC estimation is directly related to the accuracy of the battery model. Thus far, the quantitative relationship between model accuracy and model-based SOC estimation remains unknown. This study summarizes three equivalent circuit lithium-ion battery models, namely, Thevenin, PNGV, and DP models. The model parameters are identified through hybrid pulse power characterization test. The three models are evaluated, and SOC estimation conducted by EKF-Ah method under three operating conditions are quantitatively studied. The regression and correlation of the standard deviation and normalized RMSE are studied and compared between the model error and the SOC estimation error. These parameters exhibit a strong linear relationship. Results indicate that the model accuracy affects the SOC estimation accuracy mainly in two ways: dispersion of the frequency distribution of the error and the overall level of the error. On the basis of the relationship between model error and SOC estimation error, our study provides a strategy for selecting a suitable cell model to meet the requirements of SOC precision using Kalman filter.

  8. Applying transport-distance specific SOC distribution to calibrate soil erosion model WaTEM

    Hu, Yaxian; Heckrath, Goswin J.; Kuhn, Nikolaus J.

    2016-04-01

    Slope-scale soil erosion, transport and deposition fundamentally decide the spatial redistribution of eroded sediments in terrestrial and aquatic systems, which further affect the burial and decomposition of eroded SOC. However, comparisons of SOC contents between upper eroding slope and lower depositional site cannot fully reflect the movement of eroded SOC in-transit along hillslopes. The actual transport distance of eroded SOC is decided by its settling velocity. So far, the settling velocity distribution of eroded SOC is mostly calculated from mineral particle specific SOC distribution. Yet, soil is mostly eroded in form of aggregates, and the movement of aggregates differs significantly from individual mineral particles. This urges a SOC erodibility parameter based on actual transport distance distribution of eroded fractions to better calibrate soil erosion models. Previous field investigation on a freshly seeded cropland in Denmark has shown immediate deposition of fast settling soil fractions and the associated SOC at footslopes, followed by a fining trend at the slope tail. To further quantify the long-term effects of topography on erosional redistribution of eroded SOC, the actual transport-distance specific SOC distribution observed on the field was applied to a soil erosion model WaTEM (based on USLE). After integrating with local DEM, our calibrated model succeeded in locating the hotspots of enrichment/depletion of eroded SOC on different topographic positions, much better corresponding to the real-world field observation. By extrapolating into repeated erosion events, our projected results on the spatial distribution of eroded SOC are also adequately consistent with the SOC properties in the consecutive sample profiles along the slope.

  9. Clock generators for SOC processors circuits and architectures

    Fahim, Amr

    2004-01-01

    This book explores the design of fully-integrated frequency synthesizers suitable for system-on-a-chip (SOC) processors. The text takes a more global design perspective in jointly examining the design space at the circuit level as well as at the architectural level. The comprehensive coverage includes summary chapters on circuit theory as well as feedback control theory relevant to the operation of phase locked loops (PLLs). On the circuit level, the discussion includes low-voltage analog design in deep submicron digital CMOS processes, effects of supply noise, substrate noise, as well device noise. On the architectural level, the discussion includes PLL analysis using continuous-time as well as discrete-time models, linear and nonlinear effects of PLL performance, and detailed analysis of locking behavior. The book provides numerous real world applications, as well as practical rules-of-thumb for modern designers to use at the system, architectural, as well as the circuit level.

  10. The Impact of Strong Cathodic Polarization on SOC Electrolyte Materials

    Kreka, Kosova; Hansen, Karin Vels; Jacobsen, Torben

    2016-01-01

    One of the most promising reversible energy conversion/storage technologies is that of Solid Oxide Fuel/Electrolysis Cells (SOFC/SOEC, collectively termed SOC). Long term durability is typically required for such devises to become economically feasible, hence considerable amount of work has...... of impurities at the grain boundaries, electrode poisoning, delamination or cracks of the electrolyte etc., have been observed in cells operated at such conditions, lowering the lifetime of the cell1,2. High polarizations are observed at the electrolyte/cathode interface of an electrolysis cell operated at high...... current density. In case of a cell voltage above 1.6 V, p-type and n-type electronic conductivity are often observed at the anode and cathode respectively3. Hence, a considerable part of the current is lost as leakage through the electrolyte, thus lowering the efficiency of the cell considerably....

  11. SOCS3 inhibiting migration of A549 cells correlates with PYK2 signaling in vitro

    Zhang Qingfu

    2008-05-01

    Full Text Available Abstract Background Suppressor of cytokine signaling 3 (SOCS3 is considered to inhibit cytokine responses and play a negative role in migration of various cells. Proline-rich tyrosine kinase 2 (PYK2 is a non-receptor kinase and has been found crucial to cell motility. However, little is known about whether SOCS3 could regulate PYK2 pro-migratory function in lung cancer. Methods The methylation status of SOCS3 was investigated in HBE and A549 cell lines by methylation-specific PCR. A549 cells were either treated with a demethylation agent 5-aza-2'-deoxycytidine or transfected with three SOCS3 mutants with various functional domains deleted. Besides, cells were pretreated with a proteasome inhibitor β-lactacystin where indicated. The effects of SOCS3 up-regulation on PYK2 expression, PYK2 and ERK1/2 phosphorylations were assessed by western blot using indicated antibodies. RT-PCR was used to estimate PYK2 mRNA levels. Transwell experiments were performed to evaluate cell migration. Results SOCS3 expression was found impaired in A549 cells and higher PYK2 activity was correlated with enhanced cell migration. We identified that SOCS3 was aberrantly methylated in the exon 2, and 5-aza-2'-deoxycytidine restored SOCS3 expression. Reactivation of SOCS3 attenuated PYK2 expression and phosphorylation, cell migration was inhibited as well. Transfection studies indicated that exogenous SOCS3 interacted with PYK2, and both the Src homology 2 (SH2 and the kinase inhibitory region (KIR domains of SOCS3 contributed to PYK2 binding. Furthermore, SOCS3 was found to inhibit PYK2-associated ERK1/2 activity in A549 cells. SOCS3 possibly promoted degradation of PYK2 in a SOCS-box-dependent manner and interfered with PYK2-related signaling events, such as cell migration. Conclusion These data indicate that SOCS3 negatively regulates cell motility and decreased SOCS3 induced by methylation may confer a migration advantage to A549 cells. These results also suggest a

  12. Defective interleukin-4/Stat6 activity correlates with increased constitutive expression of negative regulators SOCS-3, SOCS-7, and CISH in colon cancer cells.

    Liu, Xiao Hong; Xu, Shuang Bing; Yuan, Jia; Li, Ben Hui; Zhang, Yan; Yuan, Qin; Li, Pin Dong; Li, Feng; Zhang, Wen Jie

    2009-12-01

    Interleukin-4 (IL-4)-induced Stat6 activities (phenotypes) vary among human cancer cells, of which the HT-29 cell line carries an active Stat6(high) phenotype, while Caco-2 carries a defective Stat6(null) phenotype, respectively. Cancer cells with Stat6(high) show resistance to apoptosis and exaggerated metastasis, suggesting the clinical significance of Stat6 phenotypes. We previously showed that Stat6(high) HT-29 cells exhibited low constitutive expression of Stat6-negative regulators SOCS-1 and SHP-1 because of gene hypermethylation. This study further examined the constitutive expression of other closely related SOCS family numbers including SOCS-3, SOCS-5, SOCS-7, and CISH using RT-PCR. Similar to SOCS-1 and SHP-1, Stat6(high) HT-29 cells expressed low constitutive mRNA of SOCS-3, SOCS-7, and CISH than Stat6(null) Caco-2 cells. Interestingly, DNA demethylation using 5-aza-2'-deoxycytidine in HT-29 cells up-regulated mRNA expression of the above genes, indicating a hypermethylation status, which was confirmed by methylation-specific sequencing in selected SOCS-3 gene. Furthermore, defective Stat6(null) Caco-2 exhibited impaired phosphorylation of Stat6 after IL-4 stimulation by flow cytometry, in keeping with the notion of an over-performed negative regulation. The findings that IL-4/Stat6 phenotypes show differential expression of multiple negative regulators suggest a model that a collective force of powerful negative regulators, directly and indirectly, acts on Stat6 activation, which may result in differential Stat6 phenotypes.

  13. SOCS5 is expressed in primary B and T lymphoid cells but is dispensable for lymphocyte production and function

    Brender, Christine; Columbus, Ruth; Metcalf, Donald

    2004-01-01

    the importance of SOCS5 in T helper cell responses. Unexpectedly, SOCS5-deficient CD4 T cells showed no abnormalities in Th1/Th2 differentiation and Socs5(-/-) mice showed normal resistance to infection with Leishmania major. Therefore, although SOCS5 is expressed in primary B and T cells, it appears...

  14. NIRS as an alternative to conventional soil analysis for Greenland soils (focus on SOC)

    Knadel, Maria; Ogric, Mateja; Adhikari, Kabindra

    Soil organic carbon (SOC) is an important soil property. It is the main constituents of soil organic matter and a good indicator of soil quality. The estimation and mapping of SOC content could be used to select potential agricultural areas in the Arctic areas. However, conventional analysis of SOC...... are time consuming and expensive. They involve a lot of sample preparation, and chemicals and are destructive. Near infrared spectroscopy (NIRS) in the range between 400 and 2500 nm is an alternative method for SOC analysis. It is fast and non-destructive. The aims of this study where to test...... the feasibility of using NIRS to estimate SOC content on a landscape and field scale in Greenland. Partial Least squares regression models were built to correlated soil spectra and their reference SOC data to develop calibration models. Very good predictive ability for both landscape and field scale were obtained...

  15. Suppressor of cytokine signaling (SOCS)5 ameliorates influenza infection via inhibition of EGFR signaling.

    Kedzierski, Lukasz; Tate, Michelle D; Hsu, Alan C; Kolesnik, Tatiana B; Linossi, Edmond M; Dagley, Laura; Dong, Zhaoguang; Freeman, Sarah; Infusini, Giuseppe; Starkey, Malcolm R; Bird, Nicola L; Chatfield, Simon M; Babon, Jeffrey J; Huntington, Nicholas; Belz, Gabrielle; Webb, Andrew; Wark, Peter Ab; Nicola, Nicos A; Xu, Jianqing; Kedzierska, Katherine; Hansbro, Philip M; Nicholson, Sandra E

    2017-02-14

    Influenza virus infections have a significant impact on global human health. Individuals with suppressed immunity, or suffering from chronic inflammatory conditions such as COPD, are particularly susceptible to influenza. Here we show that suppressor of cytokine signaling (SOCS) five has a pivotal role in restricting influenza A virus in the airway epithelium, through the regulation of epidermal growth factor receptor (EGFR). Socs5 -deficient mice exhibit heightened disease severity, with increased viral titres and weight loss. Socs5 levels were differentially regulated in response to distinct influenza viruses (H1N1, H3N2, H5N1 and H11N9) and were reduced in primary epithelial cells from COPD patients, again correlating with increased susceptibility to influenza. Importantly, restoration of SOCS5 levels restricted influenza virus infection, suggesting that manipulating SOCS5 expression and/or SOCS5 targets might be a novel therapeutic approach to influenza.

  16. Estimation of power lithium-ion battery SOC based on fuzzy optimal decision

    He, Dongmei; Hou, Enguang; Qiao, Xin; Liu, Guangmin

    2018-06-01

    In order to improve vehicle performance and safety, need to accurately estimate the power lithium battery state of charge (SOC), analyzing the common SOC estimation methods, according to the characteristics open circuit voltage and Kalman filter algorithm, using T - S fuzzy model, established a lithium battery SOC estimation method based on the fuzzy optimal decision. Simulation results show that the battery model accuracy can be improved.

  17. Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering

    Jared B. Fudge

    2018-04-01

    Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.

  18. Very High-Performance Advanced Filter Bank Analog-to-Digital Converter (AFB ADC) Project

    Velazquez, Scott

    1999-01-01

    ... of the art by using a parallel array of individual commercial off the shelf converters. The significant performance improvements afforded by the Advanced Filter Bank Analog to Digital Converter (AFB ADC...

  19. Purification of SOCS (Suppressor of Cytokine Signaling) SH2 Domains for Structural and Functional Studies.

    Liau, Nicholas P D; Laktyushin, Artem; Babon, Jeffrey J

    2017-01-01

    Src Homology 2 (SH2) domains are protein domains which have a high binding affinity for specific amino acid sequences containing a phosphorylated tyrosine residue. The Suppressors of Cytokine Signaling (SOCS) proteins use an SH2 domain to bind to components of certain cytokine signaling pathways to downregulate the signaling cascade. The recombinantly produced SH2 domains of various SOCS proteins have been used to undertake structural and functional studies elucidating the method of how such targeting occurs. Here, we describe the protocol for the recombinant production and purification of SOCS SH2 domains, with an emphasis on SOCS3.

  20. IL-10 and socs3 Are Predictive Biomarkers of Dengue Hemorrhagic Fever

    Lilian Karem Flores-Mendoza

    2017-01-01

    Full Text Available Background. Cytokines play important roles in the physiopathology of dengue infection; therefore, the suppressors of cytokine signaling (socs that control the type and timing of cytokine functions could be involved in the origin of immune alterations in dengue. Objective. To explore the association of cytokine and socs levels with disease severity in dengue patients. Methods. Blood samples of 48 patients with confirmed dengue infection were analyzed. Amounts of interleukins IL-2, IL-4, IL-6, and IL-10, interferon- (IFN- γ, and tumor necrosis factor- (TNF- α were quantified by flow cytometry, and the relative expression of socs1 and socs3 mRNA was quantified by real-time RT-PCR. Results. Increased levels of IL-10 and socs3 and lower expression of socs1 were found in patients with dengue hemorrhagic fever (DHF with respect to those with dengue fever (DF (p199.8-fold, socs1 (134 pg/ml have the highest sensitivity and specificity to discriminate between DF and DHF. Conclusion. Simultaneous changes in IL-10 and socs1/socs3 could be used as prognostic biomarkers of dengue severity.

  1. Favorable prognostic value of SOCS2 and IGF-I in breast cancer

    Haffner, Michael C; Petridou, Barbara; Peyrat, Jean Phillipe; Révillion, Françoise; Müller-Holzner, Elisabeth; Daxenbichler, Günter; Marth, Christian; Doppler, Wolfgang

    2007-01-01

    Suppressor of cytokine signaling (SOCS) proteins comprise a protein family, which has initially been described as STAT induced inhibitors of the Jak/Stat pathway. Recent in vivo and in vitro studies suggest that SOCS proteins are also implicated in cancer. The STAT5 induced IGF-I acts as an endocrine and para/autocrine growth and differentiation factor in mammary gland development. Whereas high levels of circulating IGF-I have been associated with increased cancer risk, the role of autocrine acting IGF-I is less clear. The present study is aimed to elucidate the clinicopathological features associated with SOCS1, SOCS2, SOCS3, CIS and IGF-I expression in breast cancer. We determined the mRNA expression levels of SOCS1, SOCS2, SOCS3, CIS and IGF-I in 89 primary breast cancers by reverse transcriptase PCR. SOCS2 protein expression was further evaluated by immuno-blot and immunohistochemistry. SOCS2 expression inversely correlated with histopathological grade and ER positive tumors exhibited higher SOCS2 levels. Patients with high SOCS2 expression lived significantly longer (108.7 vs. 77.7 months; P = 0.015) and high SOCS2 expression proved to be an independent predictor for good prognosis (HR = 0.45, 95% CI 0.23 – 0.91, P = 0.026). In analogy to SOCS2, high IGF-I expression was an independent predictor for good prognosis in the entire patient cohort. In the subgroup of patients with lymph-node negative disease, high IGF-I was a strong predictor for favorable outcome in terms of overall survival and relapse free survival (HR = 0.075, 95% CI 0.014 – 0.388, P = 0.002). This is the first report on the favorable prognostic value of high SOCS2 expression in primary mammary carcinomas. Furthermore a strong association of high IGF-I expression levels with good prognosis was observed especially in lymph-node negative patients. Our results suggest that high expression of the STAT5 target genes SOCS2 and IGF-I is a feature of differentiated and less malignant tumors

  2. Favorable prognostic value of SOCS2 and IGF-I in breast cancer

    Daxenbichler Günter

    2007-07-01

    Full Text Available Abstract Background Suppressor of cytokine signaling (SOCS proteins comprise a protein family, which has initially been described as STAT induced inhibitors of the Jak/Stat pathway. Recent in vivo and in vitro studies suggest that SOCS proteins are also implicated in cancer. The STAT5 induced IGF-I acts as an endocrine and para/autocrine growth and differentiation factor in mammary gland development. Whereas high levels of circulating IGF-I have been associated with increased cancer risk, the role of autocrine acting IGF-I is less clear. The present study is aimed to elucidate the clinicopathological features associated with SOCS1, SOCS2, SOCS3, CIS and IGF-I expression in breast cancer. Methods We determined the mRNA expression levels of SOCS1, SOCS2, SOCS3, CIS and IGF-I in 89 primary breast cancers by reverse transcriptase PCR. SOCS2 protein expression was further evaluated by immuno-blot and immunohistochemistry. Results SOCS2 expression inversely correlated with histopathological grade and ER positive tumors exhibited higher SOCS2 levels. Patients with high SOCS2 expression lived significantly longer (108.7 vs. 77.7 months; P = 0.015 and high SOCS2 expression proved to be an independent predictor for good prognosis (HR = 0.45, 95% CI 0.23 – 0.91, P = 0.026. In analogy to SOCS2, high IGF-I expression was an independent predictor for good prognosis in the entire patient cohort. In the subgroup of patients with lymph-node negative disease, high IGF-I was a strong predictor for favorable outcome in terms of overall survival and relapse free survival (HR = 0.075, 95% CI 0.014 – 0.388, P = 0.002. Conclusion This is the first report on the favorable prognostic value of high SOCS2 expression in primary mammary carcinomas. Furthermore a strong association of high IGF-I expression levels with good prognosis was observed especially in lymph-node negative patients. Our results suggest that high expression of the STAT5 target genes SOCS2 and IGF

  3. An Overview and Comparison of Online Implementable SOC Estimation Methods for Lithium-ion Battery

    Meng, Jinhao; Ricco, Mattia; Luo, Guangzhao

    2018-01-01

    . Many SOC estimation methods have been proposed in the literature. However, only a few of them consider the real-time applicability. This paper reviews recently proposed online SOC estimation methods and classifies them into five categories. Their principal features are illustrated, and the main pros...... and cons are provided. The SOC estimation methods are compared and discussed in terms of accuracy, robustness, and computation burden. Afterward, as the most popular type of model based SOC estimation algorithms, seven nonlinear filters existing in literature are compared in terms of their accuracy...

  4. TARGETED ANALYSIS OF JAK-STAT-SOCS GENES IN DAIRY CATTLE

    Arun Sondur Jayappa

    2015-12-01

    Full Text Available The Janus kinase and signal transducer and activator of transcription (JAK-STAT pathway genes along with suppressors of cytokine signalling (SOCS family genes play a crucial role in controlling cytokine signals in the mammary gland and thus mammary gland development. Mammary gene expression studies showed differential expression patterns for all the JAK-STAT pathway genes. Gene expression studies using qRT-PCR revealed differential expression of SOCS2, SOCS4 and SOCS5 genes across the lactation cycle in dairy cows. Using genotypes from 1,546 Australian Holstein- Friesian bulls, a statistical model based on SNPs within 500kb of JAK-STAT pathway genes, and SOCS genes alone was carried out. The analysis suggested that these genes and pathways make a significant contribution to the Australian milk production traits. Selection of 24 SNPs close to SOCS1, SOCS3, SOCS5, SOCS7 and CISH genes were significantly associated with, Australian Profit Ranking (APR, Australian Selection Index (ASI and protein yield (PY. This study supports the view that there may be some merit in choosing SNPs around functionally relevant genes for the selection and genetic improvement schemes for dairy production traits.

  5. Fish Suppressors of Cytokine Signaling (SOCS): Gene Discovery, Modulation of Expression and Function

    Wang, Tiehui; Gorgoglione, Bartolomeo; Maehr, Tanja; Holland, Jason W.; Vecino, Jose L. González; Wadsworth, Simon; Secombes, Christopher J.

    2011-01-01

    The intracellular suppressors of cytokine signaling (SOCS) family members, including CISH and SOCS1 to 7 in mammals, are important regulators of cytokine signaling pathways. So far, the orthologues of all the eight mammalian SOCS members have been identified in fish, with several of them having multiple copies. Whilst fish CISH, SOCS3, and SOCS5 paralogues are possibly the result of the fish-specific whole genome duplication event, gene duplication or lineage-specific genome duplication may also contribute to some paralogues, as with the three trout SOCS2s and three zebrafish SOCS5s. Fish SOCS genes are broadly expressed and also show species-specific expression patterns. They can be upregulated by cytokines, such as IFN-γ, TNF-α, IL-1β, IL-6, and IL-21, by immune stimulants such as LPS, poly I:C, and PMA, as well as by viral, bacterial, and parasitic infections in member- and species-dependent manners. Initial functional studies demonstrate conserved mechanisms of fish SOCS action via JAK/STAT pathways. PMID:22203897

  6. Burrowing Owl and Other Migratory Bird Mitigation for a Runway Construction Project at Edwards AFB

    Hoehn, Amber L.; Hagan, Mark; Bratton, Mark

    2009-01-01

    Edwards Air Force Base (AFB) scheduled the construction of a runway in the spring of 2007. The runway would be in an area that contained migratory birds and their habitat. The construction project would be near Edwards AFB main runway and had the potential not only to impact species protected under the Migratory Bird Treaty Act (MBTA), including the burrowing owl (Athene cunicularia), but also to increase bird and wildlife–aircraft strike hazards in the active flightline areas. To discourage ...

  7. Effect of SOCS1 overexpression on RPE cell activation by proinflammatory cytokines.

    Bazewicz, Magdalena; Draganova, Dafina; Makhoul, Maya; Chtarto, Abdel; Elmaleh, Valerie; Tenenbaum, Liliane; Caspers, Laure; Bruyns, Catherine; Willermain, François

    2016-09-06

    The purpose of this study was to investigate the in vitro effect of Suppressor Of Cytokine Signaling 1 (SOCS1) overexpression in retinal pigment epithelium (RPE) cells on their activation by pro-inflammatory cytokines IFNγ, TNFα and IL-17. Retinal pigment epithelium cells (ARPE-19) were stably transfected with the control plasmid pIRES2-AcGFP1 or the plasmid pSOCS1-IRES2-AcGFP1. They were stimulated by IFNγ (150ng/ml), TNFα (30ng/ml) or IL-17 (100ng/ml). The levels of SOCS1 mRNA were measured by real-time PCR. Signal Transducer and Activator of Transcription 1 (STAT1) phosphorylation and IκBα expression were analysed by western Blot (WB). IL-8 secretion was analysed by ELISA and expression of MHCII molecules and ICAM-1/CD54 by flow cytometry. Our data show that SOCS1 mRNA overexpression in RPE cells prevents IFNγ-induced SOCS1 mRNA increase and IFNγ-mediated STAT1 phosphorylation. Moreover, SOCS1 overexpression in RPE cells inhibits IFNγ-induced decrease of IL-8 secretion and prevents IFNγ-induced MHC II and ICAM1/CD54 upregulation. However, SOCS1 overexpression does not affect TNFα-induced IκBα degradation nor block TNFα-induced or IL-17-induced IL-8 secretion. On the contrary, IL-17-induced secretion is increased by SOCS1 overexpression. In conclusion, SOCS1 overexpression in RPE cells inhibits some IFNγ-mediated responses that lead to uveitis development. This notion raises the possibility that SOCS1 overexpression could be a novel target for treating non-infectious uveitis. However, some proinflammatory effects of TNFα and IL-17 stimulation on RPE are not blocked by SOCS1 overexpression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. SoC Design Approach Using Convertibility Verification

    Basu Samik

    2008-01-01

    Full Text Available Abstract Compositional design of systems on chip from preverified components helps to achieve shorter design cycles and time to market. However, the design process is affected by the issue of protocol mismatches, where two components fail to communicate with each other due to protocol differences. Convertibility verification, which involves the automatic generation of a converter to facilitate communication between two mismatched components, is a collection of techniques to address protocol mismatches. We present an approach to convertibility verification using module checking. We use Kripke structures to represent protocols and the temporal logic to describe desired system behavior. A tableau-based converter generation algorithm is presented which is shown to be sound and complete. We have developed a prototype implementation of the proposed algorithm and have used it to verify that it can handle many classical protocol mismatch problems along with SoC problems. The initial idea for -based convertibility verification was presented at SLA++P '07 as presented in the work by Roopak Sinha et al. 2008.

  9. Shemya AFB, Alaska 1992 IRP field investigation report

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.

  10. Shemya AFB, Alaska 1992 IRP field investigation report

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  11. Shemya AFB, Alaska 1992 IRP field investigation report

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  12. Environmental Assessment: Conversion of the 820th Security Forces Group at Moody AFB, Georgia to a Contingency Response Group

    2003-08-01

    Contingency Response Group (CRG) at Moody Air Force Base (AFB), GA . DESCRIPTION OF THE PROPOSED ACTION AND ALTERNATIVES. The United States Air Force...sinkhole formation. 3.5.3.3 Soils Moody AFB Moody AFB is located in the Tifton Upland District of the Lower Coastal Plain. In general, soils on...base. Arsenic, barium, chromium, copper, iron, selenium, and zinc have been found to be naturally occurring in the area. Predominant soils are Tifton

  13. Synthesis of highly monodispersed Ga-soc-MOF hollow cubes, colloidosomes and nanocomposites

    Cai, Xuechao

    2016-07-06

    Ga-soc-MOF hollow cubes with an average size of about 300 nm were prepared by a polyvinylpyrrolidone (PVP) assisted acid etching process. Colloidosomes with sizes of around 5-10 mu m composed of single-layer tetrakaidecahedron building blocks (BBs) were synthesized for the first time. Au@Ga-soc-MOF nanocomposites with excellent catalytic properties were obtained.

  14. Synthesis of highly monodispersed Ga-soc-MOF hollow cubes, colloidosomes and nanocomposites

    Cai, Xuechao; Deng, Xiaoran; Xie, Zhongxi; Bao, Shouxin; Shi, Yanshu; Lin, Jun; Pang, Maolin; Eddaoudi, Mohamed

    2016-01-01

    Ga-soc-MOF hollow cubes with an average size of about 300 nm were prepared by a polyvinylpyrrolidone (PVP) assisted acid etching process. Colloidosomes with sizes of around 5-10 mu m composed of single-layer tetrakaidecahedron building blocks (BBs) were synthesized for the first time. Au@Ga-soc-MOF nanocomposites with excellent catalytic properties were obtained.

  15. Boosted gain programmable OpAmp with embedded gain monitor for dependable SoCs

    Wan, J.; Kerkhoff, Hans G.

    2011-01-01

    SoCs used in safety-critical applications need to be dependable. However in the deep-submicron region, different kinds of aging effects like negative bias temperature instability (NBTI) make the SoCs, especially the analog/mixed-signal parts, undependable. In this paper, a dependability-improved

  16. Over-expression of KdSOC1 gene affected plantlet morphogenesis in Kalanchoe daigremontiana.

    Zhu, Chen; Wang, Li; Chen, Jinhua; Liu, Chenglan; Zeng, Huiming; Wang, Huafang

    2017-07-17

    Kalanchoe daigremontiana reproduces asexually by producing plantlets along the leaf margin. The aim of this study was to identify the function of the SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 gene in Kalanchoe daigremontiana (KdSOC1) during plantlet morphogenesis. In this study, KdSOC1 gene expression was detected at stem cell niche during in vitro somatic embryogenesis and plantlet morphogenesis. Disrupting endogenous auxin transportation suppressed the KdSOC1 gene response. Knockdown of the KdSOC1 gene caused a defect in cotyledon formation during the early heart stage of somatic embryogenesis. Over-expression (OE) of the KdSOC1 gene resulted in asymmetric plantlet distribution, a reduced number of plantlets, thicker leaves, and thicker vascular fibers. Higher KdPIN1 gene expression and auxin content were found in OE plant compared to those of wild-type plant leaves, which indicated possible KdSOC1 gene role in affecting auxin distribution and accumulation. KdSOC1 gene OE in DR5-GUS Arabidopsis reporting lines resulted in an abnormal auxin response pattern during different stages of somatic embryogenesis. In summary, the KdSOC1 gene OE might alter auxin distribution and accumulation along leaf margin to initiate plantlet formation and distribution, which is crucial for plasticity during plantlet formation under various environmental conditions.

  17. SPAD array based TOF SoC design for unmanned vehicle

    Pan, An; Xu, Yuan; Xie, Gang; Huang, Zhiyu; Zheng, Yanghao; Shi, Weiwei

    2018-03-01

    As for the requirement of unmanned-vehicle mobile Lidar system, this paper presents a SoC design based on pulsed TOF depth image sensor. This SoC has a detection range of 300m and detecting resolution of 1.5cm. Pixels are made of SPAD. Meanwhile, SoC adopts a structure of multi-pixel sharing TDC, which significantly reduces chip area and improve the fill factor of light-sensing surface area. SoC integrates a TCSPC module to achieve the functionality of receiving each photon, measuring photon flight time and processing depth information in one chip. The SOC is designed in the SMIC 0.13μm CIS CMOS technology

  18. What are the effects of agricultural management on soil organic carbon (SOC) stocks?

    Söderström, Bo; Hedlund, Katarina; Jackson, Louise E.

    2014-01-01

    the physical and biological properties of the soil. Intensification of agriculture and land-use change from grasslands to croplands are generally known to deplete SOC stocks. The depletion is exacerbated through agricultural practices with low return of organic material and various mechanisms......Changes in soil organic carbon (SOC) stocks significantly influence the atmospheric C concentration. Agricultural management practices that increase SOC stocks thus may have profound effects on climate mitigation. Additional benefits include higher soil fertility since increased SOC stocks improve......, such as oxidation/mineralization, leaching and erosion. However, a systematic review comparing the efficacy of different agricultural management practices to increase SOC stocks has not yet been produced. Since there are diverging views on this matter, a systematic review would be timely for framing policies...

  19. A multiscale framework with extended Kalman filter for lithium-ion battery SOC and capacity estimation

    Hu, Chao; Youn, Byeng D.; Chung, Jaesik

    2012-01-01

    Highlights: ► We develop a mutiscale framework with EKF to estimate SOC and capacity. ► The framework is a hybrid of coulomb counting and adaptive filtering techniques. ► It decouples SOC and capacity estimation in terms of measurement and time-scale. ► Results verify the framework achieves higher accuracy and efficiency than dual EKF. -- Abstract: State-of-charge (SOC) and capacity estimation plays an essential role in many battery-powered applications, such as electric vehicle (EV) and hybrid electric vehicle (HEV). However, commonly used joint/dual extended Kalman filter (EKF) suffers from the lack of accuracy in the capacity estimation since (i) the cell voltage is the only measurable data for the SOC and capacity estimation and updates and (ii) the capacity is very weakly linked to the cell voltage. The lack of accuracy in the capacity estimation may further reduce the accuracy in the SOC estimation due to the strong dependency of the SOC on the capacity. Furthermore, although the capacity is a slowly time-varying quantity that indicates cell state-of-health (SOH), the capacity estimation is generally performed on the same time-scale as the quickly time-varying SOC, resulting in high computational complexity. To resolve these difficulties, this paper proposes a multiscale framework with EKF for SOC and capacity estimation. The proposed framework comprises two ideas: (i) a multiscale framework to estimate SOC and capacity that exhibit time-scale separation and (ii) a state projection scheme for accurate and stable capacity estimation. Simulation results with synthetic data based on a valid cell dynamic model suggest that the proposed framework, as a hybrid of coulomb counting and adaptive filtering techniques, achieves higher accuracy and efficiency than joint/dual EKF. Results of the cycle test on Lithium-ion prismatic cells further verify the effectiveness of our framework.

  20. Suppressor of cytokine signaling (SOCS genes are silenced by DNA hypermethylation and histone deacetylation and regulate response to radiotherapy in cervical cancer cells.

    Moon-Hong Kim

    Full Text Available Suppressor of cytokine signaling (SOCS family is an important negative regulator of cytokine signaling and deregulation of SOCS has been involved in many types of cancer. All cervical cancer cell lines tested showed lower expression of SOCS1, SOCS3, and SOCS5 than normal tissue or cell lines. The immunohistochemistry result for SOCS proteins in human cervical tissue also confirmed that normal tissue expressed higher level of SOCS proteins than neighboring tumor. Similar to the regulation of SOCS in other types of cancer, DNA methylation contributed to SOCS1 downregulation in CaSki, ME-180, and HeLa cells. However, the expression of SOCS3 or SOCS5 was not recovered by the inhibition of DNA methylation. Histone deacetylation may be another regulatory mechanism involved in SOCS1 and SOCS3 expression, however, SOCS5 expression was neither affected by DNA methylation nor histone deacetylation. Ectopic expression of SOCS1 or SOCS3 conferred radioresistance to HeLa cells, which implied SOCS signaling regulates the response to radiation in cervical cancer. In this study, we have shown that SOCS expression repressed by, in part, epigenetically and altered SOCS1 and SOCS3 expression could contribute to the radiosensitive phenotype in cervical cancer.

  1. Research on State-of-Charge (SOC) estimation using current integration based on temperature compensation

    Yin, J.; Shen, Y.; Liu, X. T.; Zeng, G. J.; Liu, D. C.

    2017-11-01

    The traditional current integral method for the state-of-charge (SOC) estimation has an unusable estimation accuracy because of the current measuring error. This paper proposed a closed-loop temperature compensation method to improve the SOC estimation accuracy of current integral method by eliminating temperature drift. Through circuit simulation result in Multisim, the stability of current measuring accuracy is improved by more than 10 times. In a designed 70 charge-discharge experimental circle, the SOC estimation error with temperature compensation had 30 times less than error in normal situation without compensation.

  2. Mapping SOC in a river catchment by integrating laboratory spectra wavelength with remote sensing spectra

    Peng, Yi; Xiong, Xiong; Knadel, Maria

    There is potential to use soil ·-proximal and remote sensing derived spectra concomitantly to develop soil organic carbon (SOC) models. Yet mixing spectral data from different sources and technologies to improve soil models is still in its infancy. The objective of this study was to incorporate...... soil spectral features indicative of SOC from laboratory visible near-infrared reflectance (vis-NlR) spectra and incorporate them with remote sensing (RS) images to improve predictions of top SOC in the Skjem river catchment, Denmark. The secondary objective was to improve prediction results...

  3. Low-Power Differential SRAM design for SOC Based on the 25-um Technology

    Godugunuri, Sivaprasad; Dara, Naveen; Sambasiva Nayak, R.; Nayeemuddin, Md; Singh, Yadu, Dr.; Veda, R. N. S. Sunil

    2017-08-01

    In recent, the SOC styles area unit the vast complicated styles in VLSI these SOC styles having important low-power operations problems, to comprehend this we tend to enforced low-power SRAM. However these SRAM Architectures critically affects the entire power of SOC and competitive space. To beat the higher than disadvantages, during this paper, a low-power differential SRAM design is planned. The differential SRAM design stores multiple bits within the same cell, operates at minimum in operation low-tension and space per bit. The differential SRAM design designed supported the 25-um technology using Tanner-EDA Tool.

  4. Identification of suppressor of cytokine signalling (SOCS) 6, 7, 9 and CISH in rainbow trout Oncorhynchus mykiss and analysis of their expression in relation to other known trout SOCS.

    Wang, Tiehui; Gao, Qian; Nie, Pin; Secombes, Christopher J

    2010-10-01

    Four new members of the SOCS family of molecules in rainbow trout (Oncorhynchus mykiss), CISH and SOCS6, 7 and 9, are described for the first time in this species. The genes had a wide tissue distribution in trout, and were detected in gills, skin, muscle, liver, spleen, head kidney, intestine and brain, with brain having the highest expression levels. Stimulation of a rainbow trout leucocyte cell line, RTS-11, (mononuclear/macrophage-like cells) with LPS or Poly I:C had no effect on the expression of these genes, although in both cases the previously identified SOCS1-3 genes were up-regulated. Similarly, stimulation of RTS-11 or RTG-2 (fibroblasts) cells with the trout recombinant cytokines IFN-gamma or IL-1beta had no effect on CISH or SOCS6, 7 and 9 expression. However, PMA stimulation did impact on SOCS6 and SOCS9 expression, and LPS stimulation of primary cultures or bacterial infection (Yersinia ruckeri) increased significantly CISH expression (as well as SOCS1 and SOCS2 or SOCS3 respectively). It is apparent that the type II SOCS genes (CISH, SOCS1-3) are particularly relevant to immune regulation in fish, although the intriguing expansion of the SOCS4/5 subgroup in fish requires further investigation as to their role and functional divergence. Copyright 2010 Elsevier Ltd. All rights reserved.

  5. Installation Restoration Program. Phase 1. Records Search, Hazardous Materials Disposal Sites, Eglin AFB, Florida

    1981-10-01

    Okaloosa Co. 3-12 Crestview South Quadrangle, Florida-Okaloosa Co. -13 Mossy ead Quadrangle, Florida-Walton Co 3-14 E-1 EGUN AFB 4,h aa V, WRAMATIO...I) Um AYPM hIN1DS SP * So". AM T 0 Tou A is a O I. h E-2 ES ENGINEERING -SCIENCE V%777-7NN7 .7-7 EGUN AFB 0.4 .m ... (1) WMg LAN DOSAMU *Y* CO u...r Oumm *p S(S Ann~ Il~~O 0*aAMa 2-3 ES ENGINEER ING - SCIENCE EGUN AFB %Tt MAR ESTHER * : . . - . - ~ - ~ r W R G H T L A N D F I L L 3 SITE 0296

  6. The mechanisms behind the formation of a strong Sense of Coherence (SOC): The role of migration and integration

    Slootjes, J.; Keuzenkamp, Saskia; Saharso, S.

    2017-01-01

    Considering how much we know about the impact of the Sense of Coherence (SOC) on different health-related outcomes, we know surprisingly little about how a strong SOC actually develops. In this study we examine the mechanisms behind the formation of a strong SOC and study the role of migration,

  7. SOCS2 deletion protects against hepatic steatosis but worsens insulin resistance in high-fat-diet-fed mice

    Zadjali, Fahad; Santana-Farre, Ruyman; Vesterlund, Mattias

    2012-01-01

    in the development of diet-induced hepatic steatosis and insulin resistance. SOCS2-knockout (SOCS2(-/-)) mice and wild-type littermates were fed for 4 mo with control or high-fat diet, followed by assessment of insulin sensitivity, hepatic lipid content, and expression of inflammatory cytokines. SOCS2(-/-) mice...

  8. DMPD: Suppressor of cytokine signaling (SOCS) 2, a protein with multiple functions. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 17070092 Suppressor of cytokine signaling (SOCS) 2, a protein with multiple function...Epub 2006 Oct 27. (.png) (.svg) (.html) (.csml) Show Suppressor of cytokine signaling (SOCS) 2, a protein with multiple function...SOCS) 2, a protein with multiple functions. Authors Rico-Bautista E, Flores-Morales A, Fernandez-Perez L. Pu

  9. Biological evidence that SOCS-2 can act either as an enhancer or suppressor of growth hormone signaling

    Greenhalgh, Christopher J; Metcalf, Donald; Thaus, Anne L

    2002-01-01

    Suppressor of cytokine signaling (SOCS)-2 is a member of a family of intracellular proteins implicated in the negative regulation of cytokine signaling. The generation of SOCS-2-deficient mice, which grow to one and a half times the size of their wild-type littermates, suggests that SOCS-2 may at...

  10. Growth hormone preferentially induces the rapid, transient expression of SOCS-3, a novel inhibitor of cytokine receptor signaling

    Adams, T E; Hansen, J A; Starr, R

    1998-01-01

    Four members (SOCS-1, SOCS-2, SOCS-3, and CIS) of a family of cytokine-inducible, negative regulators of cytokine receptor signaling have recently been identified. To address whether any of these genes are induced in response to growth hormone (GH), serum-starved 3T3-F442A fibroblasts were incuba...

  11. DMPD: Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 18406369 Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins...svg) (.html) (.csml) Show Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins. ...PubmedID 18406369 Title Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins

  12. Deletion of skeletal muscle SOCS3 prevents insulin resistance in obesity

    Beck Jørgensen, Sebastian; O'Neill, Hayley M; Sylow, Lykke

    2013-01-01

    Obesity is associated with chronic low-grade inflammation that contributes to defects in energy metabolism and insulin resistance. Suppressor of cytokine signaling (SOCS)-3 expression is increased in skeletal muscle of obese humans. SOCS3 inhibits leptin signaling in the hypothalamus and insulin...... of hyperinsulinemia and insulin resistance because of enhanced skeletal muscle insulin receptor substrate 1 (IRS1) and Akt phosphorylation that resulted in increased skeletal muscle glucose uptake. These data indicate that skeletal muscle SOCS3 does not play a critical role in regulating muscle development or energy...... expenditure, but it is an important contributing factor for inhibiting insulin sensitivity in obesity. Therapies aimed at inhibiting SOCS3 in skeletal muscle may be effective in reversing obesity-related glucose intolerance and insulin resistance....

  13. The impact of soil redistribution on SOC pools in a Mediterranean agroforestry catchment

    Quijano, Laura; Gaspar, Leticia; Lizaga, Iván; Navas, Ana

    2017-04-01

    Soil redistribution processes play an important role influencing the spatial distribution patterns of soil and associated soil organic carbon (SOC) at landscape scale. Information on drivers of SOC dynamics is key for evaluating both soil degradation and SOC stability that can affect soil quality and sustainability. 137Cs measurements provide a very effective tool to infer spatial patterns of soil redistribution and quantify soil redistribution rates in different landscapes, but to date these data are scarce in mountain Mediterranean agroecosystems. We evaluate the effect of soil redistribution on SOC and SOC pools in relation to land use in a Mediterranean mountain catchment (246 ha). To this purpose, two hundred and four soil bulk cores were collected on a 100 m grid in the Estaña lakes catchment located in the central sector of the Spanish Pyrenees (31T 4656250N 295152E). The study area is an agroforestry and endorheic catchment characterized by the presence of evaporite dissolution induced dolines, some of which host permanent lakes. The selected landscape is representative of rainfed areas of Mediterranean continental climate with erodible lithology and shallow soils, and characterized by an intense anthropogenic activity through cultivation and water management. The cultivated and uncultivated areas are heterogeneously distributed. SOC and SOC pools (the active and decomposable fraction, ACF and the stable carbon fraction SCF) were measured by the dry combustion method and soil redistribution rates were derived from 137Cs measurements. The results showed that erosion predominated in the catchment, most of soil samples were identified as eroded sites (n=114) with an average erosion rate of 26.9±51.4 Mg ha-1 y-1 whereas the mean deposition rate was 13.0±24.2 Mg ha-1 y-1. In cultivated soils (n=54) the average of soil erosion rate was significantly higher (78.5±74.4 Mg ha-1 y-1) than in uncultivated soils (6.8±10.4 Mg ha-1 y-1). Similarly, the mean of soil

  14. SOCS2 mediates the cross talk between androgen and growth hormone signaling in prostate cancer

    Iglesias Gato, Diego; Chuan, Yin Choy; Wikström, Pernilla

    2014-01-01

    ) as mediator of the cross talk between androgens and GH signals in the prostate and its potential role as tumor suppressor in prostate cancer (PCa). We observed that SOCS2 protein levels assayed by immunohistochemistry are elevated in hormone therapy-naive localized prostatic adenocarcinoma in comparison...... of transcription 5 protein (STAT5) and androgen receptor-dependent transcription. Consequentially, SOCS2 inhibits GH activation of Janus kinase 2, Src and STAT5 as well as both cell invasion and cell proliferation in vitro. In vivo, SOCS2 limits proliferation and production of IGF-1 in the prostate in response......Anabolic signals such as androgens and the growth hormone/insulin-like growth factor 1 (GH/IGF-1) axis play an essential role in the normal development of the prostate but also in its malignant transformation. In this study, we investigated the role of suppressor of cytokine signaling 2 (SOCS2...

  15. Comparison Study on the Battery SoC Estimation with EKF and UKF Algorithms

    Hongwen He

    2013-09-01

    Full Text Available The battery state of charge (SoC, whose estimation is one of the basic functions of battery management system (BMS, is a vital input parameter in the energy management and power distribution control of electric vehicles (EVs. In this paper, two methods based on an extended Kalman filter (EKF and unscented Kalman filter (UKF, respectively, are proposed to estimate the SoC of a lithium-ion battery used in EVs. The lithium-ion battery is modeled with the Thevenin model and the model parameters are identified based on experimental data and validated with the Beijing Driving Cycle. Then space equations used for SoC estimation are established. The SoC estimation results with EKF and UKF are compared in aspects of accuracy and convergence. It is concluded that the two algorithms both perform well, while the UKF algorithm is much better with a faster convergence ability and a higher accuracy.

  16. Kepler: A Search for Terrestrial Planets - SOC 9.3 DR25 Pipeline Parameter Configuration Reports

    Campbell, Jennifer R.

    2017-01-01

    This document describes the manner in which the pipeline and algorithm parameters for the Kepler Science Operations Center (SOC) science data processing pipeline were managed. This document is intended for scientists and software developers who wish to better understand the software design for the final Kepler codebase (SOC 9.3) and the effect of the software parameters on the Data Release (DR) 25 archival products.

  17. Space Operations Center system analysis. Volume 3, book 2: SOC system definition report, revision A

    1982-01-01

    The Space Operations Center (SOC) orbital space station program operations are described. A work breakdown structure for the general purpose support equipment, construction and transportation support, and resupply and logistics support systems is given. The basis for the design of each element is presented, and a mass estimate for each element supplied. The SOC build-up operation, construction, flight support, and satellite servicing operations are described. Detailed programmatics and cost analysis are presented.

  18. A step toward 'plug and play' robotics with SoC technology

    Sørensen, Anders Stengaard; Falsig, Simon; Ugilt, Rolf

    p, li { white-space: pre-wrap; } This article describe our progress toward simplifying and streamlining the low level systems integration of experimental robots, combining a System on Chip (SoC) approach with conventional modular approaches. The combined approach has increased flexibility, improved...... the embedded integration, and decreased the complexity of programming, compared to conventional modular approaches. We show the impact of the SoC approach in a simple demonstration and teaching model of a walking robot....

  19. Synergy of SOCS-1 Inhibition and Microbial-Based Cancer Vaccines

    2013-09-01

    SH2 domain; a docking motif for interaction with tyrosine...IL‐ 4, IL‐7, IL‐15), IFN‐α, IFN‐γ, and IL‐12. While the SH2 domain targets the SOCS proteins to specific molecules within the JAK‐ STAT pathway, the...SOCS‐box functions as an E3 ubiquitin ligase, promoting degradation of the cytokine receptor complex. SOCS1 also contains a kinase inhibitory

  20. Evaluation of SOC for the presumptive identification of Candida albicans and Cryptococcus neoformans.

    Fleming, W H; Knezek, K L; Dorn, G L

    1987-01-01

    SOC, a fungal growth medium composed of Solryth, oxgall, and caffeic acid, was evaluated as a medium to provide rapid, differential identification of Candida albicans and Cryptococcus neoformans. Using a variety of common isolation media to produce the yeast inocula, the germ tube methods tested ranked in the following order of decreasing sensitivity: SOC (97% +/- 1), serum (92% +/- 5), rabbit coagulase plasma with EDTA in combination with tryptic soy broth (89% +/- 5), TOC (89% +/- 6), and rabbit coagulase plasma with EDTA (83% +/- 4). In chlamydospore production, SOC also proved to be the most sensitive after 24 h incubation: SOC (96% +/- 2), TOC (80% +/- 2), and cornmeal-Tween 80 agar (14% +/- 3). Other medically important yeasts showed normal patterns of growth within 24 h on SOC, thus assisting in their identification. Eighty strains of Cryptococcus neoformans showed characteristic brown pigmentation on SOC and TOC within 18 h, while all other species of the genus Cryptococcus and 229 Candida isolates did not show a change in pigmentation.

  1. A Bayesian Belief Network framework to predict SOC stock change: the Veneto region (Italy) case study

    Dal Ferro, Nicola; Quinn, Claire Helen; Morari, Francesco

    2017-04-01

    A key challenge for soil scientists is predicting agricultural management scenarios that combine crop productions with high standards of environmental quality. In this context, reversing the soil organic carbon (SOC) decline in croplands is required for maintaining soil fertility and contributing to mitigate GHGs emissions. Bayesian belief networks (BBN) are probabilistic models able to accommodate uncertainty and variability in the predictions of the impacts of management and environmental changes. By linking multiple qualitative and quantitative variables in a cause-and-effect relationships, BBNs can be used as a decision support system at different spatial scales to find best management strategies in the agroecosystems. In this work we built a BBN to model SOC dynamics (0-30 cm layer) in the low-lying plain of Veneto region, north-eastern Italy, and define best practices leading to SOC accumulation and GHGs (CO2-equivalent) emissions reduction. Regional pedo-climatic, land use and management information were combined with experimental and modelled data on soil C dynamics as natural and anthropic key drivers affecting SOC stock change. Moreover, utility nodes were introduced to determine optimal decisions for mitigating GHGs emissions from croplands considering also three different IPCC climate scenarios. The network was finally validated with real field data in terms of SOC stock change. Results showed that the BBN was able to model real SOC stock changes, since validation slightly overestimated SOC reduction (+5%) at the expenses of its accumulation. At regional level, probability distributions showed 50% of SOC loss, while only 17% of accumulation. However, the greatest losses (34%) were associated with low reduction rates (100-500 kg C ha-1 y-1), followed by 33% of stabilized conditions (-100 < SOC < 100 kg ha-1 y-1). Land use management (especially tillage operations and soil cover) played a primary role to affect SOC stock change, while climate conditions

  2. Surface to 90 km winds for Kennedy Space Center, Florida, and Vandenberg AFB, California

    Johnson, D. L.; Brown, S. C.

    1979-01-01

    Bivariate normal wind statistics for a 90 degree flight azimuth, from 0 through 90 km altitude, for Kennedy Space Center, Florida, and Vandenberg AFB, California are presented. Wind probability distributions and statistics for any rotation of axes can be computed from the five given parameters.

  3. Finding No Significant Impact: Aircraft Weather Shelter at Laughlin AFB, TX

    2004-06-01

    surface water flow is southeast into the Ro Grande and down toward the Gulf of Mexico. Lake Amistad reservoir, located approximately 12 miles northwest...characterized Lake Amistad reservoir as having excellent water quality (USAF, 1997). Laughlin AFB contains a total of 19 acres of surface water

  4. Relocation of the Air National Guard 176th Wing to Elmendorf AFB, Alaska

    2007-09-01

    Park. Between 20 and 70 moose are estimated by Alaska Fish and Game to live on Elmendorf AFB, depending on the time of year, as portions of the herd ...also supports populations of small mammals including beaver (Castor canadensis), muskrat (Ondatra zibethicus), porcupine (Erethizon dorsatum), red

  5. Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

    Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2008-08-01

    The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

  6. NEW EPICS/RTEMS IOC BASED ON ALTERA SOC AT JEFFERSON LAB

    Yan, Jianxun [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Seaton, Chad [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Allison, Trent L. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Bevins, Brian S. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Cuffe, Anthony W. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States)

    2018-02-01

    A new EPICS/RTEMS IOC based on the Altera System-on-Chip (SoC) FPGA is being designed at Jefferson Lab. The Altera SoC FPGA integrates a dual ARM Cortex-A9 Hard Processor System (HPS) consisting of processor, peripherals and memory interfaces tied seamlessly with the FPGA fabric using a high-bandwidth interconnect backbone. The embedded Altera SoC IOC has features of remote network boot via U-Boot from SD card or QSPI Flash, 1Gig Ethernet, 1GB DDR3 SDRAM on HPS, UART serial ports, and ISA bus interface. RTEMS for the ARM processor BSP were built with CEXP shell, which will dynamically load the EPICS applications at runtime. U-Boot is the primary bootloader to remotely load the kernel image into local memory from a DHCP/TFTP server over Ethernet, and automatically run RTEMS and EPICS. The first design of the SoC IOC will be compatible with Jefferson Lab’s current PC104 IOCs, which have been running in CEBAF 10 years. The next design would be mounting in a chassis and connected to a daughter card via standard HSMC connectors. This standard SoC IOC will become the next generation of low-level IOC for the accelerator controls at Jefferson Lab.

  7. An Online SOC and SOH Estimation Model for Lithium-Ion Batteries

    Shyh-Chin Huang

    2017-04-01

    Full Text Available The monitoring and prognosis of cell degradation in lithium-ion (Li-ion batteries are essential for assuring the reliability and safety of electric and hybrid vehicles. This paper aims to develop a reliable and accurate model for online, simultaneous state-of-charge (SOC and state-of-health (SOH estimations of Li-ion batteries. Through the analysis of battery cycle-life test data, the instantaneous discharging voltage (V and its unit time voltage drop, V′, are proposed as the model parameters for the SOC equation. The SOH equation is found to have a linear relationship with 1/V′ times the modification factor, which is a function of SOC. Four batteries are tested in the laboratory, and the data are regressed for the model coefficients. The results show that the model built upon the data from one single cell is able to estimate the SOC and SOH of the three other cells within a 5% error bound. The derived model is also proven to be robust. A random sampling test to simulate the online real-time SOC and SOH estimation proves that this model is accurate and can be potentially used in an electric vehicle battery management system (BMS.

  8. Effects of SOC-dependent electrolyte viscosity on performance of vanadium redox flow batteries

    Xu, Q.; Zhao, T.S.; Zhang, C.

    2014-01-01

    Highlights: • The correlations of electrolyte viscosity and SOC are obtained. • Effect of SOC-dependent electrolyte viscosity is considered in this model. • This model enables a more realistic simulation of variable distributions. • It provides accurate estimations of pumping work and system efficiency. - Abstract: The viscosity of the electrolyte in vanadium redox flow batteries (VRFBs) varies during charge and discharge as the concentrations of acid and vanadium ions in the electrolyte continuously change with the state of charge (SOC). In previous VRFB models, however, the electrolyte has been treated as a constant-viscosity solution. In this work, a mass-transport and electrochemical model taking account of the effect of SOC-dependent electrolyte viscosity is developed. The comparison between the present model and the model with the constant-viscosity simplification indicates that the consideration of the SOC-dependent electrolyte viscosity enables (i) a more realistic simulation of the distributions of overpotential and current density in the electrodes, and (ii) more accurate estimations of pumping work and the system efficiency of VRFBs

  9. Key KdSOC1 gene expression profiles during plantlet morphogenesis under hormone, photoperiod, and drought treatments.

    Liu, C; Zhu, C; Zeng, H M

    2016-02-11

    Kalanchoe daigremontiana utilizes plantlet formation between its zigzag leaf margins as its method of asexual reproduction. In this study, K. daigremontiana SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (KdSOC1), a key intermediate in the transition from vegetative to asexual growth, was cloned. Furthermore, its expression profiles during plantlet formation under different environmental and hormone induction conditions were analyzed. The full-KdSOC1 cDNA sequence length was 1410 bp with 70% shared homology with Carya cathayensis SOC1. The conserved domain search of KdSOC1 showed the absence of I and C domains, which might indicate novel biological functions in K. daigremontiana. The full-KdSOC1 promoter sequence was 1401 bp long and contained multiple-hormone-responsive cis-acting elements. Hormone induction assays showed that gibberellins and salicylic acid mainly regulated KdSOC1 expression. The swift change from low to high KdSOC1 expression levels during long-day induction was accompanied by the rapid emergence of plantlets. Drought stress stimulated KdSOC1 expression in leaves both with and without plantlet formation. Together, the results suggested that KdSOC1 was closely involved in environmental stimulation signal perception and the transduction of K. daigremontiana plantlet formation. Therefore, future identification of KdSOC1 functions might reveal key information that will help elucidate the transition network between embryogenesis and organogenesis during plantlet formation.

  10. Role of Ubiquitylation in Controlling Suppressor of Cytokine Signalling 3 (SOCS3 Function and Expression

    Jamie J. L. Williams

    2014-05-01

    Full Text Available The realisation that unregulated activation of the Janus kinase–signal transducer and activator of transcription (JAK–STAT pathway is a key driver of a wide range of diseases has identified its components as targets for therapeutic intervention by small molecule inhibitors and biologicals. In this review, we discuss JAK-STAT signalling pathway inhibition by the inducible inhibitor “suppressor of cytokine signaling 3 (SOCS3, its role in diseases such as myeloproliferative disorders, and its function as part of a multi-subunit E3 ubiquitin ligase complex. In addition, we highlight potential applications of these insights into SOCS3-based therapeutic strategies for management of conditions such as vascular re-stenosis associated with acute vascular injury, where there is strong evidence that multiple processes involved in disease progression could be attenuated by localized potentiation of SOCS3 expression levels.

  11. EpSoc: Social-Based Epidemic-Based Routing Protocol in Opportunistic Mobile Social Network

    Halikul Lenando

    2018-01-01

    Full Text Available In opportunistic networks, the nature of intermittent and disruptive connections degrades the efficiency of routing. Epidemic routing protocol is used as a benchmark for most of routing protocols in opportunistic mobile social networks (OMSNs due to its high message delivery and latency. However, Epidemic incurs high cost in terms of overhead and hop count. In this paper, we propose a hybrid routing protocol called EpSoc which utilizes the Epidemic routing forwarding strategy and exploits an important social feature, that is, degree centrality. Two techniques are used in EpSoc. Messages’ TTL is adjusted based on the degree centrality of nodes, and the message blocking mechanism is used to control replication. Simulation results show that EpSoc increases the delivery ratio and decreases the overhead ratio, the average latency, and the hop counts as compared to Epidemic and Bubble Rap.

  12. Study on SOC wavelet analysis for LiFePO4 battery

    Liu, Xuepeng; Zhao, Dongmei

    2017-08-01

    Improving the prediction accuracy of SOC can reduce the complexity of the conservative and control strategy of the strategy such as the scheduling, optimization and planning of LiFePO4 battery system. Based on the analysis of the relationship between the SOC historical data and the external stress factors, the SOC Estimation-Correction Prediction Model based on wavelet analysis is established. Using wavelet neural network prediction model is of high precision to achieve forecast link, external stress measured data is used to update parameters estimation in the model, implement correction link, makes the forecast model can adapt to the LiFePO4 battery under rated condition of charge and discharge the operating point of the variable operation area. The test results show that the method can obtain higher precision prediction model when the input and output of LiFePO4 battery are changed frequently.

  13. Fundamentals of IP and SoC security design, verification, and debug

    Ray, Sandip; Sur-Kolay, Susmita

    2017-01-01

    This book is about security in embedded systems and it provides an authoritative reference to all aspects of security in system-on-chip (SoC) designs. The authors discuss issues ranging from security requirements in SoC designs, definition of architectures and design choices to enforce and validate security policies, and trade-offs and conflicts involving security, functionality, and debug requirements. Coverage also includes case studies from the “trenches” of current industrial practice in design, implementation, and validation of security-critical embedded systems. Provides an authoritative reference and summary of the current state-of-the-art in security for embedded systems, hardware IPs and SoC designs; Takes a "cross-cutting" view of security that interacts with different design and validation components such as architecture, implementation, verification, and debug, each enforcing unique trade-offs; Includes high-level overview, detailed analysis on implementation, and relevant case studies on desi...

  14. Final Confirmation Sampling and Analysis Report for the POL Yard, Sites SS-06 and ST-40, Wurtsmith AFB, Michigan

    1999-01-01

    .... Wurtsmith AFBCA and AFCEE/ERT had no comments on the draft final report. This report represents the final contract deliverable for the AFCEE Extended Bioventing Project at the Wurtsmith AFB POL Yard...

  15. Matching soil grid unit resolutions with polygon unit scales for DNDC modelling of regional SOC pool

    Zhang, H. D.; Yu, D. S.; Ni, Y. L.; Zhang, L. M.; Shi, X. Z.

    2015-03-01

    Matching soil grid unit resolution with polygon unit map scale is important to minimize uncertainty of regional soil organic carbon (SOC) pool simulation as their strong influences on the uncertainty. A series of soil grid units at varying cell sizes were derived from soil polygon units at the six map scales of 1:50 000 (C5), 1:200 000 (D2), 1:500 000 (P5), 1:1 000 000 (N1), 1:4 000 000 (N4) and 1:14 000 000 (N14), respectively, in the Tai lake region of China. Both format soil units were used for regional SOC pool simulation with DeNitrification-DeComposition (DNDC) process-based model, which runs span the time period 1982 to 2000 at the six map scales, respectively. Four indices, soil type number (STN) and area (AREA), average SOC density (ASOCD) and total SOC stocks (SOCS) of surface paddy soils simulated with the DNDC, were attributed from all these soil polygon and grid units, respectively. Subjecting to the four index values (IV) from the parent polygon units, the variation of an index value (VIV, %) from the grid units was used to assess its dataset accuracy and redundancy, which reflects uncertainty in the simulation of SOC. Optimal soil grid unit resolutions were generated and suggested for the DNDC simulation of regional SOC pool, matching with soil polygon units map scales, respectively. With the optimal raster resolution the soil grid units dataset can hold the same accuracy as its parent polygon units dataset without any redundancy, when VIV indices was assumed as criteria to the assessment. An quadratic curve regression model y = -8.0 × 10-6x2 + 0.228x + 0.211 (R2 = 0.9994, p < 0.05) was revealed, which describes the relationship between optimal soil grid unit resolution (y, km) and soil polygon unit map scale (1:x). The knowledge may serve for grid partitioning of regions focused on the investigation and simulation of SOC pool dynamics at certain map scale.

  16. Advanced Technology for Ultra-Low Power System-on-Chip (SoC)

    2017-06-01

    was proposed for lower power applications with Ioff=10pA/μm and VDD=0.5V. In this project, the optimized structure shows great potential in both Lg...AFRL-RY-WP-TR-2017-0115 ADVANCED TECHNOLOGY FOR ULTRA-LOW POWER SYSTEM-ON-CHIP (SoC) Jason Woo, Weicong Li, and Peng Lu University of California...September 2015 – 31 March 2017 4. TITLE AND SUBTITLE ADVANCED TECHNOLOGY FOR ULTRA-LOW POWER SYSTEM-ON- CHIP (SoC) 5a. CONTRACT NUMBER FA8650-15-1-7574 5b

  17. Socs36E Controls Niche Competition by Repressing MAPK Signaling in the Drosophila Testis.

    Marc Amoyel

    2016-01-01

    Full Text Available The Drosophila testis is a well-established system for studying stem cell self-renewal and competition. In this tissue, the niche supports two stem cell populations, germ line stem cells (GSCs, which give rise to sperm, and somatic stem cells called cyst stem cells (CySCs, which support GSCs and their descendants. It has been established that CySCs compete with each other and with GSCs for niche access, and mutations have been identified that confer increased competitiveness to CySCs, resulting in the mutant stem cell and its descendants outcompeting wild type resident stem cells. Socs36E, which encodes a negative feedback inhibitor of the JAK/STAT pathway, was the first identified regulator of niche competition. The competitive behavior of Socs36E mutant CySCs was attributed to increased JAK/STAT signaling. Here we show that competitive behavior of Socs36E mutant CySCs is due in large part to unbridled Mitogen-Activated Protein Kinase (MAPK signaling. In Socs36E mutant clones, MAPK activity is elevated. Furthermore, we find that clonal upregulation of MAPK in CySCs leads to their outcompetition of wild type CySCs and of GSCs, recapitulating the Socs36E mutant phenotype. Indeed, when MAPK activity is removed from Socs36E mutant clones, they lose their competitiveness but maintain self-renewal, presumably due to increased JAK/STAT signaling in these cells. Consistently, loss of JAK/STAT activity in Socs36E mutant clones severely impairs their self-renewal. Thus, our results enable the genetic separation of two essential processes that occur in stem cells. While some niche signals specify the intrinsic property of self-renewal, which is absolutely required in all stem cells for niche residence, additional signals control the ability of stem cells to compete with their neighbors. Socs36E is node through which these processes are linked, demonstrating that negative feedback inhibition integrates multiple aspects of stem cell behavior.

  18. Longevity of contributions to SOC stocks from roots and aboveground plant litter below a Miscanthus plantation

    Robertson, Andrew; Smith, Pete; Davies, Christian; Bottoms, Emily; McNamara, Niall

    2013-04-01

    Miscanthus is a lignocellulosic crop that uses the Hatch-Slack (C4) photosynthetic pathway as opposed to most C3 vegetation native to the UK. Miscanthus can be grown for a number of practical end-uses but recently interest has increased in its viability as a bioenergy crop; both providing a renewable source of energy and helping to limit climate change by improving the carbon (C) budgets associated with energy generation. Recent studies have shown that Miscanthus plantations may increase stocks of soil organic carbon (SOC), however the longevity and origin of this 'new' SOC must be assessed. Consequently, we combined an input manipulation experiment with physio-chemical soil fractionation to quantify new SOC and CO2 emissions from Miscanthus roots, decomposing plant litter and soil individually. Further, fractionation of SOC from the top 30 cm gave insight into the longevity of that SOC. In January 2009 twenty-five 2 m2 plots were set up in a three-year old 11 hectare Miscanthus plantation in Lincolnshire, UK; with five replicates of five treatments. These treatments varied plant input to the soil by way of controlled exclusion techniques. Treatments excluded roots only ("No Roots"), surface litter only ("No Litter"), both roots and surface litter ("No Roots or Litter") or had double the litter amount added to the soil surface ("Double Litter"). A fifth treatment was a control with undisturbed roots and an average amount of litter added. Monthly measurements of CO2 emissions were taken at the soil surface from each treatment between March 2009 and March 2013, and soil C from the top 30 cm was monitored in all plots over the same period. Miscanthus-derived SOC was determined using the isotopic discrimination between C4 plant matter and C3 soil, and soil fractionation was then used to establish the longevity of that Miscanthus-derived SOC. Ongoing results for CO2 emissions indicate a strong seasonal variation; litter decomposition forms a large portion of the CO2

  19. Environmental Assessment Construction of a New Hazardous Cargo Pad Davis-Monthan AFB

    2002-11-07

    PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 355th Civil Engineer Squadron (CES/CEVA),710 Third Street,Davis-Monthan AFB,AZ,85707 8. PERFORMING...agency for certain projects. Details of the preparation of this EA are mandated by the Council of Enviromental Quality (CEQ) in the series of...Base, Tucson, Arizona." October 1996. James M. Montgomery, Consulting Engineers for US army Corps of Engineers , Omaha Dist., Apri11990

  20. Williams AFB, Arizona Revised Uniform Summary of Surface Weather Observations (RUSSWO) Parts A-F.

    1981-10-21

    N;I 1-L 9AL CLIMATOLOGY BRANCH ~.w~ .’ ETAC LJS. H A~(I EATV UMDT 2 f wEATHER SERVICE/MAC SEE FIRST HUMDIT 2 114 1 LLIAMS AFB AZ 69-70,73-80 JUL...4622 USAPETAC ’ol 0-87-5(01.A) , I roFql CL,-RAL CLIMATOLOGY BRANCH EATV 2 AFETAC SRVIE/ACATIVE UUTO HUMIDITY SEE FIRST PAGE Z Cl)4 AILLIAMS AFS AZ

  1. SoC Estimation for Lithium-ion Batteries: Review and Future Challenges

    Juan Pablo Rivera-Barrera

    2017-11-01

    Full Text Available Energy storage emerged as a top concern for the modern cities, and the choice of the lithium-ion chemistry battery technology as an effective solution for storage applications proved to be a highly efficient option. State of charge (SoC represents the available battery capacity and is one of the most important states that need to be monitored to optimize the performance and extend the lifetime of batteries. This review summarizes the methods for SoC estimation for lithium-ion batteries (LiBs. The SoC estimation methods are presented focusing on the description of the techniques and the elaboration of their weaknesses for the use in on-line battery management systems (BMS applications. SoC estimation is a challenging task hindered by considerable changes in battery characteristics over its lifetime due to aging and to the distinct nonlinear behavior. This has led scholars to propose different methods that clearly raised the challenge of establishing a relationship between the accuracy and robustness of the methods, and their low complexity to be implemented. This paper publishes an exhaustive review of the works presented during the last five years, where the tendency of the estimation techniques has been oriented toward a mixture of probabilistic techniques and some artificial intelligence.

  2. A Flexible ADC Approach for Mixed-signal SoC Platforms

    Zanikopoulos, A.; Harpe, P.J.A.; Hegt, J.A.; Roermund, van A.H.M.

    2005-01-01

    Time-to-market pressure and increased design complexity created what is called a "design gap" [1] in the design of systems-on-chip (SoC). As a solution to that problem the Platform-Based Design (PBD), based on the design-reuse methodology, has been proposed [2], and successfully applied to digital

  3. E-CMIRC - towards a model for the integration of services between SOCs and CSIRTs

    Jacobs, P

    2015-07-01

    Full Text Available , including governments. While the focus of a SOC is on the monitoring of technical security controls and critical assets, and the response to attacks and threats, CSIRTs’ main focus is on response and incident management. One postulation is that a CSIRT...

  4. Computational model of 18650 lithium-ion battery with coupled strain rate and SOC dependencies

    Xu, Jun; Liu, Binghe; Wang, Xinyi; Hu, Dayong

    2016-01-01

    Highlights: • An anisotropic model to describe mechanical behaviors of LIB is established. • SOC dependency is included in the mechanical model of the jellyroll. • Dynamic effect is considered in the model for LIB. - Abstract: Highly nonlinear structures and constituent materials and hazardous experiment situations have resulted in a pressing need for a numerical mechanical model for lithium-ion battery (LIB). However, such a model is still not well established. In this paper, an anisotropic homogeneous model describing the jellyroll and the battery shell is established and validated through compression, indentation, and bending tests at quasi-static loadings. In this model, state-of-charge (SOC) dependency of the LIB is further included through an analogy with the strain-rate effect. Moreover, with consideration of the inertia and strain-rate effects, the anisotropic homogeneous model is extended into the dynamic regime and proven capable of predicting the dynamic response of the LIB using the drop-weight test. The established model may help to predict extreme cases with high SOCs and crashing speeds with an over 135% improved accuracy compared to traditional models. The established coupled strain rate and SOC dependencies of the numerical mechanical model for the LIB aims to provide a solid step toward unraveling and quantifying the complicated problems for research on LIB mechanical integrity.

  5. 3D integration for NoC-based SoC architectures

    Sheibanyrad, Abbas; Pétrot, Frédéric

    2011-01-01

    3D-Integration for NoC-based SoC Architectures gathers the recent advances in the whole domain by renowned experts in the field to build a comprehensive and consistent book around the hot topics of three-dimensional architectures and micro-architectures.

  6. Increasing SoC Dependability via Known Good Tile NoC Testing

    Kerkhoff, Hans G.; Kuiken, O.J.; Zhang, X.

    2008-01-01

    Advanced CMOS technology possibilities, power, communication and flexibility issues as well as the design gap are directing System-on-Chip (SoC) platforms towards Network-on-Chip (NoC) interconnected identical processing tiles (PT) such as the Montium processor [1]. It is broadly acknowledged that

  7. Analysis of Suppressor of Cytokine Signaling 2 Gene (SOCS2 Polymorphism in Different Dog Breeds

    Martina Miluchová

    2011-05-01

    Full Text Available SOCS2 is a negative regulator of growth hormone signaling. The deletion of SOCS2 in mice results in a 30-50% increase in post-natal growth. The aim of the paper was to identify of suppressor of cytokine signaling 2 gene (SOCS2 polymorphism in different dog breeds. The material involved 77 dogs from 14 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® (Molecular Research Center and linear polyacrylamide (LPA carrier and from blood by using NucleospinBlood (Macherey-Nagel and used in order to estimate SOCS2 genotypes by PCR-RFLP method. The PCR products were digested with TaqI restriction enzyme. The T allele was distributed among large dog breeds (Czech pointer, Golden retriever, Rottweiler with an allele frequency ranging from 0.2857 to 1.00. In the population of Czech pointer we detected all genotypes. There were detected homozygote genotype GG with frequency 0.5476, heterozygote genotype GT with frequency 0.3333 and homozygote genotype TT with frequency 0.1191. Results point out that frequency of G allele was high and was represented 0.7143. Frequency of T allele was 0.2857. In Rottweiler was detected homozygote genotype TT. Genotypes GG and GT has not been observed. In Golden retriever we detected only heterozygote genotype GT.

  8. Modeling of SOC-700 Hyperspectral Imagery with the CAMEO-SIM Code

    2007-10-26

    Yannick, 2001, “SOC-700 and HS-Analysis 2 User’s Manual”, Surface Optics, San Diego [2] Cohen, Michael F. and Wallace, John R., 1993, “ Radiosity ...and Realistic Image Synthesis”, Academic Press, San Francisco [3] Sillion, Francois X. and Puech, Claude, 1994, “ Radiosity and Global Illumination

  9. An overview of online implementable SOC estimation methods for Lithium-ion batteries

    Jinhao, Meng; Ricco, Mattia; Guangzhao, Luo

    2017-01-01

    With the popularity of Electrical Vehicles (EVs), Lithium-ion battery industry is also developing rapidly. To ensure the battery safety usage and reduce the average lifecycle cost, accurate State Of Charge (SOC) tracking algorithms for real-time implementation are required in different applications...

  10. An Overview and Comparison of Online Implementable SOC Estimation Methods for Lithium-ion Battery

    Meng, Jinhao; Ricco, Mattia; Luo, Guangzhao

    2018-01-01

    With the popularity of Electrical Vehicles (EVs), Lithium-ion battery industry is developing rapidly. To ensure the battery safe usage and to reduce its average lifecycle cost, an accurate State of Charge (SOC) tracking algorithms for real-time implementation are required for different applications...

  11. Dynamics and fate of SOC in tidal marshes along a salinity gradient (Scheldt estuary, Belgium)

    Van de Broek, Marijn; Temmermann, Stijn; Merckx, Roel; Wang, Zhengang; Govers, Gerard

    2016-04-01

    Coastal ecosystems have been attributed the potential to store large amounts of organic carbon (OC), often referred to as blue carbon, of which a considerable amount is stored in tidal marsh soils. Large uncertainties still exist with respect to the amount and controlling factors of soil organic carbon (SOC) stored in these ecosystems. Moreover, most research has focused on SOC dynamics of saltmarshes, while brackish and freshwater marshes are often even more productive and thus receive even larger organic carbon inputs. Therefore, in this study the OC dynamics of tidal marsh soils along an estuarine gradient are studied in order to contribute to our knowledge of 1) the stocks, 2) the controlling factors and 3) the fate of SOC in tidal marshes with different environmental characteristics. This research thus contributes to a better understanding of the potential of coastal environments to store organic carbon under future climatic changes. Soil and vegetation samples are collected in tidal salt-, brackish- and freshwater marshes in the Scheldt estuary (Belgium - The Netherlands). At each tidal marsh, three replicate soil cores up to 1.5m depth in 0.03m increments are collected at locations with both a low and a high elevation. These cores are analyzed for OC, stable C and N isotopes, bulk density and texture. Incubation experiments of topsoil samples were conducted and both aboveground and belowground biomass were collected. The results show that SOC stocks (range: 13,5 - 35,4 kg OC m-2), standing biomass (range: 2000 - 7930 g DW m-2) and potential soil respiration of CO2 (range: 0,03 - 0,12 % per unit OC per day) decrease with increasing salinity. This shows that both the amount of OC from local macrophytes and the quality of the organic matter are important factors controlling the SOC stocks. In addition, based on the analysis of stable C and N isotopes, it appears that when a significant fraction of SOC is derived from local macrophytes, higher SOC stocks are

  12. The Immunohistochemical Analysis of SOCS3 Protein Identifies a Subgroup of Prostatic Cancer Biopsies With Aggressive Behavior.

    Pierconti, Francesco; Martini, Maurizio; Cenci, Tonia; Larocca, Luigi M

    Recently, we demonstrated that hypermethylation of SOCS3 determines a significant reduction of its mRNA and protein expression and identifies a subgroup of prostate cancer with aggressive behavior. In this paper, our objective was to investigate whether the immunohistochemical expression of the SOCS3 protein could represent an alternative method to molecular analysis for the individualization of aggressive prostate carcinoma. We analyzed the SOCS3 immunohistochemical expression in 65 patients undergoing biopsies at the Institute of Urology of our hospital between September 2011 and October 2011 (median age, 66.4 y; range, 50 to 73 y), and in 35 cases, a subset of 65 cases originally used for the immunohistochemical study, we studied the methylation status of the SOCS3 promoter. We found that the percentage of cases with SOCS3 negativity (-) or with SOCS3 weak staining in <50% of the neoplastic glands (+/-) correlated to the worst prognosis in terms of the Gleason score (P=0.0001; Fisher's exact test), the pT stage (P=0.012; Fisher's exact test), and progression-free survival (P=0.0334; hazard ratio, 0.34; and 95% confidence interval, from 0.1261 to 0.9188). Moreover, some cases with an SOCS3 unmethylated pattern showed SOCS3-negative immunostaining (-) or SOCS3-negative glands with weak cytoplasmatic staining in <50% of the neoplastic glands (+/-). Our data suggest that in prostatic cancer biopsies, the immunohistochemical analysis of SOCS3 protein expression may provide a method that is less expensive and easier to apply than SOCS3 methylation analysis for the distinction of a subgroup of prostate cancer with a more aggressive behavior.

  13. Trichostatin A, a histone deacetylase inhibitor, suppresses JAK2/STAT3 signaling via inducing the promoter-associated histone acetylation of SOCS1 and SOCS3 in human colorectal cancer cells.

    Xiong, Hua; Du, Wan; Zhang, Yan-Jie; Hong, Jie; Su, Wen-Yu; Tang, Jie-Ting; Wang, Ying-Chao; Lu, Rong; Fang, Jing-Yuan

    2012-02-01

    Aberrant janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling is involved in the oncogenesis of several cancers. Suppressors of cytokine signaling (SOCS) genes and SH2-containing protein tyrosine phosphatase 1 (SHP1) proteins, which are negative regulators of JAK/STAT signaling, have been reported to have tumor suppressor functions. However, in colorectal cancer (CRC) cells, the mechanisms that regulate SOCS and SHP1 genes, and the cause of abnormalities in the JAK/STAT signaling pathway, remain largely unknown. The present study shows that trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, leads to the hyperacetylation of histones associated with the SOCS1 and SOCS3 promoters, but not the SHP1 promoter in CRC cells. This indicates that histone modifications are involved in the regulation of SOCS1 and SOCS3. Moreover, upregulation of SOCS1 and SOCS3 expression was achieved using TSA, which also significantly downregulated JAK2/STAT3 signaling in CRC cells. We also demonstrate that TSA suppresses the growth of CRC cells, and induces G1 cell cycle arrest and apoptosis through the regulation of downstream targets of JAK2/STAT3 signaling, including Bcl-2, survivin and p16(ink4a) . Therefore, our data demonstrate that TSA may induce SOCS1 and SOCS3 expression by inducing histone modifications and consequently inhibits JAK2/STAT3 signaling in CRC cells. These results also establish a mechanistic link between the inhibition of JAK2/STAT3 signaling and the anticancer action of TSA in CRC cells. Copyright © 2011 Wiley Periodicals, Inc.

  14. Structural basis for c-KIT inhibition by the suppressor of cytokine signaling 6 (SOCS6) ubiquitin ligase

    Zadjali, Fahad; Pike, Ashley C W; Vesterlund, Mattias

    2011-01-01

    to substrate residue position pY+6 and envelopes the c-KIT phosphopeptide with a large BG loop insertion that contributes significantly to substrate interaction. We demonstrate that SOCS6 has ubiquitin ligase activity toward c-KIT and regulates c-KIT protein turnover in cells. Our data support a role of SOCS6...

  15. Robustness of SOC Estimation Algorithms for EV Lithium-Ion Batteries against Modeling Errors and Measurement Noise

    Xue Li

    2015-01-01

    Full Text Available State of charge (SOC is one of the most important parameters in battery management system (BMS. There are numerous algorithms for SOC estimation, mostly of model-based observer/filter types such as Kalman filters, closed-loop observers, and robust observers. Modeling errors and measurement noises have critical impact on accuracy of SOC estimation in these algorithms. This paper is a comparative study of robustness of SOC estimation algorithms against modeling errors and measurement noises. By using a typical battery platform for vehicle applications with sensor noise and battery aging characterization, three popular and representative SOC estimation methods (extended Kalman filter, PI-controlled observer, and H∞ observer are compared on such robustness. The simulation and experimental results demonstrate that deterioration of SOC estimation accuracy under modeling errors resulted from aging and larger measurement noise, which is quantitatively characterized. The findings of this paper provide useful information on the following aspects: (1 how SOC estimation accuracy depends on modeling reliability and voltage measurement accuracy; (2 pros and cons of typical SOC estimators in their robustness and reliability; (3 guidelines for requirements on battery system identification and sensor selections.

  16. Suppressor of cytokine signaling 4 (SOCS4 protects against severe cytokine storm and enhances viral clearance during influenza infection.

    Lukasz Kedzierski

    2014-05-01

    Full Text Available Suppressor of cytokine signaling (SOCS proteins are key regulators of innate and adaptive immunity. There is no described biological role for SOCS4, despite broad expression in the hematopoietic system. We demonstrate that mice lacking functional SOCS4 protein rapidly succumb to infection with a pathogenic H1N1 influenza virus (PR8 and are hypersusceptible to infection with the less virulent H3N2 (X31 strain. In SOCS4-deficient animals, this led to substantially greater weight loss, dysregulated pro-inflammatory cytokine and chemokine production in the lungs and delayed viral clearance. This was associated with impaired trafficking of influenza-specific CD8 T cells to the site of infection and linked to defects in T cell receptor activation. These results demonstrate that SOCS4 is a critical regulator of anti-viral immunity.

  17. Mapping SOC (Soil Organic Carbon) using LiDAR-derived vegetation indices in a random forest regression model

    Will, R. M.; Glenn, N. F.; Benner, S. G.; Pierce, J. L.; Spaete, L.; Li, A.

    2015-12-01

    Quantifying SOC (Soil Organic Carbon) storage in complex terrain is challenging due to high spatial variability. Generally, the challenge is met by transforming point data to the entire landscape using surrogate, spatially-distributed, variables like elevation or precipitation. In many ecosystems, remotely sensed information on above-ground vegetation (e.g. NDVI) is a good predictor of below-ground carbon stocks. In this project, we are attempting to improve this predictive method by incorporating LiDAR-derived vegetation indices. LiDAR provides a mechanism for improved characterization of aboveground vegetation by providing structural parameters such as vegetation height and biomass. In this study, a random forest model is used to predict SOC using a suite of LiDAR-derived vegetation indices as predictor variables. The Reynolds Creek Experimental Watershed (RCEW) is an ideal location for a study of this type since it encompasses a strong elevation/precipitation gradient that supports lower biomass sagebrush ecosystems at low elevations and forests with more biomass at higher elevations. Sagebrush ecosystems composed of Wyoming, Low and Mountain Sagebrush have SOC values ranging from .4 to 1% (top 30 cm), while higher biomass ecosystems composed of aspen, juniper and fir have SOC values approaching 4% (top 30 cm). Large differences in SOC have been observed between canopy and interspace locations and high resolution vegetation information is likely to explain plot scale variability in SOC. Mapping of the SOC reservoir will help identify underlying controls on SOC distribution and provide insight into which processes are most important in determining SOC in semi-arid mountainous regions. In addition, airborne LiDAR has the potential to characterize vegetation communities at a high resolution and could be a tool for improving estimates of SOC at larger scales.

  18. Research on SEU hardening of heterogeneous Dual-Core SoC

    Huang, Kun; Hu, Keliu; Deng, Jun; Zhang, Tao

    2017-08-01

    The implementation of Single-Event Upsets (SEU) hardening has various schemes. However, some of them require a lot of human, material and financial resources. This paper proposes an easy scheme on SEU hardening for Heterogeneous Dual-core SoC (HD SoC) which contains three techniques. First, the automatic Triple Modular Redundancy (TMR) technique is adopted to harden the register heaps of the processor and the instruction-fetching module. Second, Hamming codes are used to harden the random access memory (RAM). Last, a software signature technique is applied to check the programs which are running on CPU. The scheme need not to consume additional resources, and has little influence on the performance of CPU. These technologies are very mature, easy to implement and needs low cost. According to the simulation result, the scheme can satisfy the basic demand of SEU-hardening.

  19. A Framework for Hardware-Accelerated Services Using Partially Reconfigurable SoCs

    MACHIDON, O. M.

    2016-05-01

    Full Text Available The current trend towards ?Everything as a Service? fosters a new approach on reconfigurable hardware resources. This innovative, service-oriented approach has the potential of bringing a series of benefits for both reconfigurable and distributed computing fields by favoring a hardware-based acceleration of web services and increasing service performance. This paper proposes a framework for accelerating web services by offloading the compute-intensive tasks to reconfigurable System-on-Chip (SoC devices, as integrated IP (Intellectual Property cores. The framework provides a scalable, dynamic management of the tasks and hardware processing cores, based on dynamic partial reconfiguration of the SoC. We have enhanced security of the entire system by making use of the built-in detection features of the hardware device and also by implementing active counter-measures that protect the sensitive data.

  20. Functional SOCS1 polymorphisms are associated with variation in obesity in whites

    Gylvin, T; Ek, J; Nolsøe, R.

    2009-01-01

    . A total of more than 8100 individuals were genotyped. RESULTS: Eight variations were identified in the 5' untranslated region (UTR) region. Two of these had allele frequencies below 1% and were not further examined. The six other variants were analysed in groups of T1D families (n = 1461 subjects) and T2D...... of both the rs33977706 and the rs243330 (-1656G > A) variants to obesity were found (p = 0.047 and p = 0.015) respectively. The rs33977706 affected both binding of a nuclear protein to and the transcriptional activity of the SOCS1 promoter, indicating a relationship between this polymorphism and gene...... regulation. CONCLUSIONS/INTERPRETATION: This study demonstrates that functional variations in the SOCS1 promoter may associate with alterations in BMI in the general white population....

  1. Digital approach for the design of statistical analog data acquisition on SoCs

    Adao Antonio de Souza Junior

    2005-01-01

    With the current demand for mixed-signal SoCs, an increasing number of designers are looking for ADC architectures that can be easily implemented over digital substrates. Since ADC performance is strongly dependent upon physical and electrical features, it gets more difficult for them to benefit from more recent technologies, where these features are more variable. This way, analog signal acquisition is not allowed to follow an evolutionary trend compatible with Moore’s Law. In fact, such tre...

  2. Common variants in SOCS7 gene predict obesity, disturbances in lipid metabolism and insulin resistance.

    Tellechea, M L; Steinhardt, A Penas; Rodriguez, G; Taverna, M J; Poskus, E; Frechtel, G

    2013-05-01

    Specific Suppressor of Cytokine Signaling (SOCS) members, such as SOCS7, may play a role in the development of insulin resistance (IR) owing to their ability to inhibit insulin signaling pathways. The objective was to explore the association between common variants and related haplotypes in SOCS7 gene and metabolic traits related to obesity, lipid metabolism and IR. 780 unrelated men were included in a cross-sectional study. We selected three tagged SNPs that capture 100% of SNPs with minor allele frequency ≥ 0.10. Analyses were done separately for each SNP and followed up by haplotype analysis. rs8074124C was associated with both obesity (p = 0.005) and abdominal obesity (p = 0.002) and allele C carriers showed, in comparison with TT carriers, lower BMI (p = 0.001) and waist circumference (p = 0.001). rs8074124CC- carriers showed lower fasting insulin (p = 0.017) and HOMA-IR (p = 0.018) than allele T carriers. rs12051836C was associated with hypertriglyceridemia (p = 0.009) and hypertriglyceridemic waist (p = 0.006). rs12051836CC- carriers showed lower fasting insulin (p = 0.043) and HOMA-IR (p = 0.042). Haplotype-based association analysis (rs8074124 and rs12051836 in that order) showed associations with lipid and obesity -related phenotypes, consistent with single locus analysis. Haplotype analysis also revealed association between haplotype CT and both decreased HDL-C (p = 0.026) and HDL-C (p = 0.014) as a continuous variable. We found, for the first time, significant associations between SOCS7 common variants and related haplotypes and obesity, IR and lipid metabolism disorders. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  3. An improved PNGV modeling and SOC estimation for lithium iron phosphate batteries

    Li, Peng

    2017-11-01

    Because lithium iron phosphate battery has many advantages, it has been used more and more widely in the field of electric vehicle. The lithium iron phosphate battery, presents the improved PNGV model, and the batteries charge discharge characteristics and pulse charge discharge experiments, identification of parameters of the battery model by interpolation and least square fitting method, to achieve a more accurate modeling of lithium iron phosphate battery, and the extended Calman filter algorithm (EKF) is completed state nuclear power battery (SOC) estimate.

  4. Functional network analysis of genes differentially expressed during xylogenesis in soc1ful woody Arabidopsis plants.

    Davin, Nicolas; Edger, Patrick P; Hefer, Charles A; Mizrachi, Eshchar; Schuetz, Mathias; Smets, Erik; Myburg, Alexander A; Douglas, Carl J; Schranz, Michael E; Lens, Frederic

    2016-06-01

    Many plant genes are known to be involved in the development of cambium and wood, but how the expression and functional interaction of these genes determine the unique biology of wood remains largely unknown. We used the soc1ful loss of function mutant - the woodiest genotype known in the otherwise herbaceous model plant Arabidopsis - to investigate the expression and interactions of genes involved in secondary growth (wood formation). Detailed anatomical observations of the stem in combination with mRNA sequencing were used to assess transcriptome remodeling during xylogenesis in wild-type and woody soc1ful plants. To interpret the transcriptome changes, we constructed functional gene association networks of differentially expressed genes using the STRING database. This analysis revealed functionally enriched gene association hubs that are differentially expressed in herbaceous and woody tissues. In particular, we observed the differential expression of genes related to mechanical stress and jasmonate biosynthesis/signaling during wood formation in soc1ful plants that may be an effect of greater tension within woody tissues. Our results suggest that habit shifts from herbaceous to woody life forms observed in many angiosperm lineages could have evolved convergently by genetic changes that modulate the gene expression and interaction network, and thereby redeploy the conserved wood developmental program. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

  5. A Cryptographic SoC for Robust Protection of Secret Keys in IPTV DRM Systems

    Lee, Sanghan; Yang, Hae-Yong; Yeom, Yongjin; Park, Jongsik

    The security level of an internet protocol television (IPTV) digital right management (DRM) system ultimately relies on protection of secret keys. Well known devices for the key protection include smartcards and battery backup SRAMs (BB-SRAMs); however, these devices could be vulnerable to various physical attacks. In this paper, we propose a secure and cost-effective design of a cryptographic system on chip (SoC) that integrates the BB-SRAM with a cell-based design technique. The proposed SoC provides robust safeguard against the physical attacks, and satisfies high-speed and low-price requirements of IPTV set-top boxes. Our implementation results show that the maximum encryption rate of the SoC is 633Mb/s. In order to verify the data retention capabilities, we made a prototype chip using 0.18µm standard cell technology. The experimental results show that the integrated BB-SRAM can reliably retain data with a 1.4µA leakage current.

  6. Transport-distance specific SOC distribution: Does it skew erosion induced C fluxes?

    Hu, Yaxian; Berbe, Asmerat Asefaw; Fogel, Marilyn L.

    2016-01-01

    Abstract The net effect of soil erosion by water, as a sink or source of atmospheric carbon dioxide (CO2), is determined by the spatial (re-)distribution and stability of eroded soil organic carbon (SOC), and the dynamic replacement of eroded C by the production of new photosynthate. The depositi......Abstract The net effect of soil erosion by water, as a sink or source of atmospheric carbon dioxide (CO2), is determined by the spatial (re-)distribution and stability of eroded soil organic carbon (SOC), and the dynamic replacement of eroded C by the production of new photosynthate...... the actual movement of eroded soil fractions along hillslopes, let alone the re-distribution pattern of SOC fractions. Eroding sandy soils and sediment were sampled after a series of rainfall events along a slope on a freshly seeded cropland in Jutland, Denmark. All the soil samples were fractionated...... into five settling classes using a settling tube apparatus. The spatial distribution of soil settling classes shows a coarsening effect immediately below the eroding slope, followed by a fining trend at the slope tail. These findings support the validity of the conceptual model proposed by Starr et al...

  7. A configurable and low-power mixed signal SoC for portable ECG monitoring applications.

    Kim, Hyejung; Kim, Sunyoung; Van Helleputte, Nick; Artes, Antonio; Konijnenburg, Mario; Huisken, Jos; Van Hoof, Chris; Yazicioglu, Refet Firat

    2014-04-01

    This paper describes a mixed-signal ECG System-on-Chip (SoC) that is capable of implementing configurable functionality with low-power consumption for portable ECG monitoring applications. A low-voltage and high performance analog front-end extracts 3-channel ECG signals and single channel electrode-tissue-impedance (ETI) measurement with high signal quality. This can be used to evaluate the quality of the ECG measurement and to filter motion artifacts. A custom digital signal processor consisting of 4-way SIMD processor provides the configurability and advanced functionality like motion artifact removal and R peak detection. A built-in 12-bit analog-to-digital converter (ADC) is capable of adaptive sampling achieving a compression ratio of up to 7, and loop buffer integration reduces the power consumption for on-chip memory access. The SoC is implemented in 0.18 μm CMOS process and consumes 32 μ W from a 1.2 V while heart beat detection application is running, and integrated in a wireless ECG monitoring system with Bluetooth protocol. Thanks to the ECG SoC, the overall system power consumption can be reduced significantly.

  8. Parametric dense stereovision implementation on a system-on chip (SoC).

    Gardel, Alfredo; Montejo, Pablo; García, Jorge; Bravo, Ignacio; Lázaro, José L

    2012-01-01

    This paper proposes a novel hardware implementation of a dense recovery of stereovision 3D measurements. Traditionally 3D stereo systems have imposed the maximum number of stereo correspondences, introducing a large restriction on artificial vision algorithms. The proposed system-on-chip (SoC) provides great performance and efficiency, with a scalable architecture available for many different situations, addressing real time processing of stereo image flow. Using double buffering techniques properly combined with pipelined processing, the use of reconfigurable hardware achieves a parametrisable SoC which gives the designer the opportunity to decide its right dimension and features. The proposed architecture does not need any external memory because the processing is done as image flow arrives. Our SoC provides 3D data directly without the storage of whole stereo images. Our goal is to obtain high processing speed while maintaining the accuracy of 3D data using minimum resources. Configurable parameters may be controlled by later/parallel stages of the vision algorithm executed on an embedded processor. Considering hardware FPGA clock of 100 MHz, image flows up to 50 frames per second (fps) of dense stereo maps of more than 30,000 depth points could be obtained considering 2 Mpix images, with a minimum initial latency. The implementation of computer vision algorithms on reconfigurable hardware, explicitly low level processing, opens up the prospect of its use in autonomous systems, and they can act as a coprocessor to reconstruct 3D images with high density information in real time.

  9. Monolithic distributed power management for systems-on-chip (SoC); Gestion monolithique distribuee de puissance pour les systemes sur puce (SOC)

    Abedinpour, S. [Motorola, Semiconductor Products Sector, Tempe (United States); Bakkaloglu, B. [Texas Instruments, Broadband Communications Group, Dallas, Texas (United States); Kiaei, S. [Arizona State Univ., Connection one Research Center, Tempe (United States)

    2004-08-01

    With increasing drive towards higher level of integration, lower cost, and longer battery life in wireless applications, there is a need for efficient monolithic DC-DC power converters. This tutorial paper summarizes the topology tradeoffs that are involved in the implementation of monolithic distributed power management in the future generations of SoCs for portable wireless applications. These circuits have a broad range of requirements including high power density, high energy efficiency, low noise, small size, and low cost. The advantages and disadvantages of each of the competing topologies, namely low-dropout linear, switched capacitor, and switched-mode DC-DC converters are examined in light of these requirements. (authors)

  10. SOCS3 promoter hypermethylation is a favorable prognosticator and a novel indicator for G-CIMP-positive GBM patients.

    Feng, Ying; Wang, Zheng; Bao, Zhaoshi; Yan, Wei; You, Gan; Wang, Yinyan; Hu, Huimin; Zhang, Wei; Zhang, Quangeng; Jiang, Tao

    2014-01-01

    Hypermethylation of the suppressor of cytokine signaling 3(SOCS3) promoter has been reported to predict a poor prognosis in several cancers including glioblastoma multiforme (GBM). We explored the function of SOCS3 promoter hypermethylation in GBM cohorts, including analysis of the CpG island methylator phenotype (CIMP), when a large number of gene loci are simultaneously hypermethylated. A whole genome promoter methylation profile was performed in a cohort of 33 GBM samples, with 13 long-term survivors (LTS; overall survival ≥ 18 months) and 20 short-term survivors (STS; overall survival ≤ 9 months). The SOCS3 promoter methylation status was compared between the two groups. In addition, we investigated the relationship of SOCS3 promoter methylation and G-CIMP status. Interestingly, in our present study, we found that SOCS3 promoter methylation was statistically significantly higher in the 13 LTS than that in the 20 STS. Furthermore, high SOCS3 promoter methylation detected via pyro-sequencing predicted a better prognosis in an independent cohort containing 62 GBM patients. This correlation was validated by the dataset from the Cancer Genome Atlas(TCGA) and the Chinese Cancer Genome Atlas(CGGA). In addition, we found that hypermethylation of the SOCS3 promoter was tightly associated with the G-CIMP-positive GBM patients. Using a total of 359 clinical samples, we demonstrate that SOCS3 promoter hypermethylation status has a favorable prognostic value in GBM patients because of whole genome methylation status. Particularly, the hypermethylation of the SOCS3 promoter indicates positive G-CIMP status.

  11. Cardiac-Specific SOCS3 Deletion Prevents In Vivo Myocardial Ischemia Reperfusion Injury through Sustained Activation of Cardioprotective Signaling Molecules.

    Takanobu Nagata

    Full Text Available Myocardial ischemia reperfusion injury (IRI adversely affects cardiac performance and the prognosis of patients with acute myocardial infarction. Although myocardial signal transducer and activator of transcription (STAT 3 is potently cardioprotective during IRI, the inhibitory mechanism responsible for its activation is largely unknown. The present study aimed to investigate the role of the myocardial suppressor of cytokine signaling (SOCS-3, an intrinsic negative feedback regulator of the Janus kinase (JAK-STAT signaling pathway, in the development of myocardial IRI. Myocardial IRI was induced in mice by ligating the left anterior descending coronary artery for 1 h, followed by different reperfusion times. One hour after reperfusion, the rapid expression of JAK-STAT-activating cytokines was observed. We precisely evaluated the phosphorylation of cardioprotective signaling molecules and the expression of SOCS3 during IRI and then induced myocardial IRI in wild-type and cardiac-specific SOCS3 knockout mice (SOCS3-CKO. The activation of STAT3, AKT, and ERK1/2 rapidly peaked and promptly decreased during IRI. This decrease correlated with the induction of SOCS3 expression up to 24 h after IRI in wild-type mice. The infarct size 24 h after reperfusion was significantly reduced in SOCS3-CKO compared with wild-type mice. In SOCS3-CKO mice, STAT3, AKT, and ERK1/2 phosphorylation was sustained, myocardial apoptosis was prevented, and the expression of anti-apoptotic Bcl-2 family member myeloid cell leukemia-1 (Mcl-1 was augmented. Cardiac-specific SOCS3 deletion led to the sustained activation of cardioprotective signaling molecules including and prevented myocardial apoptosis and injury during IRI. Our findings suggest that SOCS3 may represent a key factor that exacerbates the development of myocardial IRI.

  12. SOCS3 promoter hypermethylation is a favorable prognosticator and a novel indicator for G-CIMP-positive GBM patients.

    Ying Feng

    Full Text Available Hypermethylation of the suppressor of cytokine signaling 3(SOCS3 promoter has been reported to predict a poor prognosis in several cancers including glioblastoma multiforme (GBM. We explored the function of SOCS3 promoter hypermethylation in GBM cohorts, including analysis of the CpG island methylator phenotype (CIMP, when a large number of gene loci are simultaneously hypermethylated.A whole genome promoter methylation profile was performed in a cohort of 33 GBM samples, with 13 long-term survivors (LTS; overall survival ≥ 18 months and 20 short-term survivors (STS; overall survival ≤ 9 months. The SOCS3 promoter methylation status was compared between the two groups. In addition, we investigated the relationship of SOCS3 promoter methylation and G-CIMP status.Interestingly, in our present study, we found that SOCS3 promoter methylation was statistically significantly higher in the 13 LTS than that in the 20 STS. Furthermore, high SOCS3 promoter methylation detected via pyro-sequencing predicted a better prognosis in an independent cohort containing 62 GBM patients. This correlation was validated by the dataset from the Cancer Genome Atlas(TCGA and the Chinese Cancer Genome Atlas(CGGA. In addition, we found that hypermethylation of the SOCS3 promoter was tightly associated with the G-CIMP-positive GBM patients.Using a total of 359 clinical samples, we demonstrate that SOCS3 promoter hypermethylation status has a favorable prognostic value in GBM patients because of whole genome methylation status. Particularly, the hypermethylation of the SOCS3 promoter indicates positive G-CIMP status.

  13. Increased linear bone growth by GH in the absence of SOCS2 is independent of IGF-1.

    Dobie, Ross; Ahmed, Syed F; Staines, Katherine A; Pass, Chloe; Jasim, Seema; MacRae, Vicky E; Farquharson, Colin

    2015-11-01

    Growth hormone (GH) signaling is essential for postnatal linear bone growth, but the relative importance of GHs actions on the liver and/or growth plate cartilage remains unclear. The importance of liver derived insulin like-growth factor-1 (IGF-1) for endochondral growth has recently been challenged. Here, we investigate linear growth in Suppressor of Cytokine Signaling-2 (SOCS2) knockout mice, which have enhanced growth despite normal systemic GH/IGF-1 levels. Wild-type embryonic ex vivo metatarsals failed to exhibit increased linear growth in response to GH, but displayed increased Socs2 transcript levels (P growth over a 12 day period. Despite this increase, IGF-1 transcript and protein levels were not increased in response to GH. In accordance with these data, IGF-1 levels were unchanged in GH-challenged postnatal Socs2(-/-) conditioned medium despite metatarsals showing enhanced linear growth. Growth-plate Igf1 mRNA levels were not elevated in juvenile Socs2(-/-) mice. GH did however elevate IGF-binding protein 3 levels in conditioned medium from GH challenged metatarsals and this was more apparent in Socs2(-/-) metatarsals. GH did not enhance the growth of Socs2(-/-) metatarsals when the IGF receptor was inhibited, suggesting that IGF receptor mediated mechanisms are required. IGF-2 may be responsible as IGF-2 promoted metatarsal growth and Igf2 expression was elevated in Socs2(-/-) (but not WT) metatarsals in response to GH. These studies emphasise the critical importance of SOCS2 in regulating GHs ability to promote bone growth. Also, GH appears to act directly on the metatarsals of Socs2(-/-) mice, promoting growth via a mechanism that is independent of IGF-1. © 2014 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.

  14. Suppressor of cytokine signaling 2 (SOCS2) deletion protects against multiple low dose streptozotocin-induced type 1 diabetes in adult male mice

    Alkharusi, Amira; Mirecki-Garrido, Mercedes; Ma, Zuheng

    2016-01-01

    Background: Diabetes type 1 is characterized by the failure of beta cells to produce insulin. Suppressor of cytokine signaling (SOCS) proteins are important regulators of the Janus kinase/signal transducer and activator of transcription (JAK-STAT) pathway. Previous studies have shown that GH can...... prevent the development of type I diabetes in mice and that SOCS2 deficiency mimics a state of increased GH sensitivity. Methodology: The elevated sensitivity of SOCS2-/- mice to GH and possibly to PRL was the rationale to analyze the effects of multiple low dose streptozotocin (MLDSTZ)-induced diabetes...... in SOCS2-/- mice. Results: We show that 6-month-old SOCS2-/- mice, but not 2-month-old mice, were less sensitive to MLDSTZ-induced diabetes, compared to controls. MLDSTZ treatment induced glucose intolerance in both SOCS2+/+ and SOCS2-/- mice, as shown by glucose tolerance tests, with SOCS2+/+ mice...

  15. The fate of SOC during the processes of water erosion and subsequent deposition: a field study.

    van Hemelryck, H.; Govers, G.; van Oost, K.; Merckx, R.

    2009-04-01

    Globally soils are the largest terrestrial pool of carbon (C). A relatively small increase or decrease in soil carbon content due to changes in land use or management practices could therefore result in a significant net exchange of C between the soil C reservoir and the atmosphere. As such, the geomorphic processes of water and tillage erosion have been identified to significantly impact on this large pool of soil organic carbon (SOC). Soil erosion, transport and deposition not only result in redistribution of sediments and associated carbon within a landscape, but also affect the exchange of C between the pedosphere and the atmosphere. The direction and magnitude of an erosion-induced change in the global C balance is however a topic of much debate as opposing processes interact: i) At eroding sites a net uptake of C could be the result of reduced respiration rates and continued inputs of newly produced carbon. ii) Colluvial deposition of eroded sediment and SOC leads to the burial of the original topsoil and this may constrain the decomposition of its containing SOC. iii) Eroded sediment could be transported to distal depositional environments or fluvial systems where it will either be conserved or become rapidly mineralized. iv) Increased emission of CO2 due to erosion may result from the disruptive energy of erosive forces causing the breakdown of aggregates and exposing previously protected SOC to microbial decomposition. The above-mentioned processes show a large spatial and temporal variability and assessing their impact requires an integrated modeling approach. However uncertainties about the basic processes that accompany SOC displacement are still large. This study focuses on one of these large information gaps: the fate of eroded and subsequently deposited SOC. A preceding experimental study (Van Hemelryck et al., 2008) was used to identify controlling factors (erosional intensity, changes in soil structure,…). However this experimental research

  16. Constitutive expression of the K-domain of a Vaccinium corymbosum SOC1-like (VcSOC1-K) MADS-box gene is sufficient to promote flowering in tobacco.

    Song, Guo-qing; Walworth, Aaron; Zhao, Dongyan; Hildebrandt, Britton; Leasia, Michael

    2013-11-01

    The K-domain of a blueberry-derived SOC1 -like gene promotes flowering in tobacco without negatively impacting yield, demonstrating potential for manipulation of flowering time in horticultural crops. The SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) and SOC1-likes, belonging to the MIKC(c) (type II) MADS-box gene subfamily, are major floral activators and integrators of plant flowering. Both MADS-domains and K (Keratin)-domains are highly conserved in MIKC(c)-type MADS proteins. While there are many reports on overexpression of intact MIKC(c)-type MADS-box genes, few studies have been conducted to investigate the effects of the K-domains. In this report, a 474-bp K-domain of Vaccinium SOC1-like (VcSOC1-K) was cloned from the cDNA library of the northern highbush blueberry (Vaccinium corymbosum L.). Functional analysis of the VcSOC1-K was conducted by ectopically expressing of 35S:VcSOC1-K in tobacco. Reverse transcription PCR confirmed expression of the VcSOC1-K in T0 plants. Phenotypically, T1 transgenic plants (10 T1 plants/event) flowered sooner after seeding, and were shorter with fewer leaves at the time of flowering, than nontransgenic plants; but seed pod production of transgenic plants was not significantly affected. These results demonstrate that overexpression of the K-domain of a MIKC(c)-type MADS-box gene alone is sufficient to promote early flowering and more importantly without affecting seed production.

  17. Suppressor of cytokine signaling 1 (SOCS1) limits NFkappaB signaling by decreasing p65 stability within the cell nucleus.

    Strebovsky, Julia; Walker, Patrick; Lang, Roland; Dalpke, Alexander H

    2011-03-01

    Suppressor of cytokine signaling (SOCS) proteins are inhibitors of cytoplasmic Janus kinases (Jak) and signal transducer and activator of transcription (STAT) signaling pathways. Previously the authors surprisingly observed that SOCS1 translocated into the nucleus, which was because of the presence of a nuclear localization sequence. This report now hypothesizes that SOCS1 mediates specific functions within the nuclear compartment because it is instantly transported into the nucleus, as shown by photoactivation and live cell imaging in human HEK293 cells. The NFκB component p65 is identified as an interaction partner for SOCS1 but not for other members of the SOCS family. SOCS1 bound to p65 only within the nucleus. By means of its SOCS box domain, SOCS1 operated as a ubiquitin ligase, leading to polyubiquitination and proteasomal degradation of nuclear p65. Thus, SOCS1 limited prolonged p65 signaling and terminated expression of NFκB inducible genes. Using mutants that lack either nuclear translocation or a functional SOCS box, this report identifies genes that are regulated in a manner dependent on the nuclear availability of SOCS1. Data show that beyond its receptor-proximal function in Jak/STAT signaling, SOCS1 also regulates the duration of NFκB signaling within the cell nucleus, thus exerting a heretofore unrecognized function.

  18. Effects of land use change and management on SOC and soil quality in Mediterranean rangelands areas

    Parras-Alcántara, Luis; Lozano-García, Beatriz; Requejo, Ana; Zornoza, Raúl

    2017-04-01

    INTRODUCTION Rangelands in the Iberian Peninsula occupy more than 90,000 km2. These rangelands were created from the former Mediterranean oak forests, mainly composed of holm oak and cork oak (Quercus ilex rotundifolia and Quercus suber), by clear-cutting shrubs, removing selected trees and cultivating. These man-made landscapes are called 'dehesas' in Spain and 'montados' in Portugal. Between 1955 and 1981, more than 5,000 km2 of dehesas was converted from pastureland to cultivated land. This process has been accelerated since 1986 owing to subsidies from the European Common Agricultural Policy (Parras-Alcántara et al., 2015a). The role that natural rangelands play in the global carbon cycle is extremely important, accounting for 10-30% of the world's total soil organic carbon (SOC), in addition, SOC concentration is closely related to soil quality and vegetation productivity (Brevik, 2012). Therefore, to study the land use and management changes is important, particularly in Mediterranean soils, as they are characterized by low organic carbon content, furthermore, the continuous use of ploughing for grain production is the principal cause of soil degradation. Therefore, land use decisions and management systems can increase or decrease SOC content and stock (Corral-Fernández et al., 2013; Parras-Alcántara et al., 2014, 2015a and 2015b; Parras-Alcántara and Lozano-García, 2014) MATERIAL AND METHODS A field study was conducted to determine the land use change (Mediterranean evergreen oak woodland to olive grove and cereal, all of them managed under conventional tillage and under conservationist practices) effects on SOC stocks and the soil quality (Stratification Ratio) in Los Pedroches valley, southern Spain. RESULTS Results for the present study indicate that management practices had little effect on SOC storage in dehesas. The stratification ratio was >2 both under conventional tillage and under organic farming, so, soils under dehesa had high quality

  19. Laser diagnostics of atomic hydrogen and oxygen production in rf and microwave plasma discharges

    Preppernau, B.L.

    1993-01-01

    The research for this thesis involved the application of two-photon allowed laser-induced fluorescence (TALIF) to the study of atomic hydrogen and oxygen production in industrial scale radio-frequency and microwave plasma discharge apparatus. Absolute atomic hydrogen concentration profiles were measured in a Gaseous Electronics Conference Reference Cell installed at Wright-Patterson AFB, Ohio operating with a simple H 2 discharge. Two-dimensional atomic hydrogen concentration profiles were also measured in an ASTEX HPMM microwave plasma diamond deposition reactor during actual diamond growth. In addition absolute atomic oxygen concentrations were measured in the ASTEX system. Particular attention as paid to refining the concentration calibration technique and in determining a correction to account for the collisional quenching of excited state fluorescence in high pressure gases

  20. SOC Strategies and Organizational Citizenship Behaviors toward the Benefits of Co-workers: A Multi-Source Study

    Müller, Andreas; Weigl, Matthias

    2017-01-01

    Background: Individuals’ behavioral strategies like selection, optimization, and compensation (SOC) contribute to efficient use of available resources. In the work context, previous studies revealed positive associations between employees’ SOC use and favorable individual outcomes, like engagement and job performance. However, the social implications of self-directed behaviors like SOC that are favorable for the employee but may imply consequences for coworkers have not been investigated yet in an interpersonal work context. Objective: This study aimed to assess associations between employees’ use of SOC behaviors at work and their organizational citizenship behaviors (OCB) toward the benefits of co-workers rated by their peers at work. We further sought to identify age-specific associations between SOC use and OCB. Design and Method: A cross-sectional design combining multi-source data was applied in primary school teachers (age range: 23–58 years) who frequently teach in dyads. N = 114 dyads were finally included. Teachers reported on their SOC strategies at work. Their peer colleagues evaluated teachers’ OCB. Control variables were gender, workload, working hours, and perceived proximity of relationship between the dyads. Results: We observed a positive effect of loss-based selection behaviors on peer-rated OCB. Moreover, there was a significant two-way interaction effect between the use of compensation strategies and age on OCB, such that there was a positive association for older employees and a negative association for younger employees. There were no significant main and age-related interaction effects of elective selection, optimization, and of overall SOC strategies on OCB. Conclusion: Our study suggests that high use of loss-based selection and high use of compensation strategies in older employees is positively related with OCB as perceived by their colleagues. However, high use of compensation strategies in younger employees is perceived

  1. SOC Strategies and Organizational Citizenship Behaviors toward the Benefits of Co-workers: A Multi-Source Study.

    Müller, Andreas; Weigl, Matthias

    2017-01-01

    Background: Individuals' behavioral strategies like selection, optimization, and compensation (SOC) contribute to efficient use of available resources. In the work context, previous studies revealed positive associations between employees' SOC use and favorable individual outcomes, like engagement and job performance. However, the social implications of self-directed behaviors like SOC that are favorable for the employee but may imply consequences for coworkers have not been investigated yet in an interpersonal work context. Objective: This study aimed to assess associations between employees' use of SOC behaviors at work and their organizational citizenship behaviors (OCB) toward the benefits of co-workers rated by their peers at work. We further sought to identify age-specific associations between SOC use and OCB. Design and Method: A cross-sectional design combining multi-source data was applied in primary school teachers (age range: 23-58 years) who frequently teach in dyads. N = 114 dyads were finally included. Teachers reported on their SOC strategies at work. Their peer colleagues evaluated teachers' OCB. Control variables were gender, workload, working hours, and perceived proximity of relationship between the dyads. Results: We observed a positive effect of loss-based selection behaviors on peer-rated OCB. Moreover, there was a significant two-way interaction effect between the use of compensation strategies and age on OCB, such that there was a positive association for older employees and a negative association for younger employees. There were no significant main and age-related interaction effects of elective selection, optimization, and of overall SOC strategies on OCB. Conclusion: Our study suggests that high use of loss-based selection and high use of compensation strategies in older employees is positively related with OCB as perceived by their colleagues. However, high use of compensation strategies in younger employees is perceived negatively

  2. ORCHIDEE-SOM: modeling soil organic carbon (SOC) and dissolved organic carbon (DOC) dynamics along vertical soil profiles in Europe

    Camino-Serrano, Marta; Guenet, Bertrand; Luyssaert, Sebastiaan; Ciais, Philippe; Bastrikov, Vladislav; De Vos, Bruno; Gielen, Bert; Gleixner, Gerd; Jornet-Puig, Albert; Kaiser, Klaus; Kothawala, Dolly; Lauerwald, Ronny; Peñuelas, Josep; Schrumpf, Marion; Vicca, Sara; Vuichard, Nicolas; Walmsley, David; Janssens, Ivan A.

    2018-03-01

    Current land surface models (LSMs) typically represent soils in a very simplistic way, assuming soil organic carbon (SOC) as a bulk, and thus impeding a correct representation of deep soil carbon dynamics. Moreover, LSMs generally neglect the production and export of dissolved organic carbon (DOC) from soils to rivers, leading to overestimations of the potential carbon sequestration on land. This common oversimplified processing of SOC in LSMs is partly responsible for the large uncertainty in the predictions of the soil carbon response to climate change. In this study, we present a new soil carbon module called ORCHIDEE-SOM, embedded within the land surface model ORCHIDEE, which is able to reproduce the DOC and SOC dynamics in a vertically discretized soil to 2 m. The model includes processes of biological production and consumption of SOC and DOC, DOC adsorption on and desorption from soil minerals, diffusion of SOC and DOC, and DOC transport with water through and out of the soils to rivers. We evaluated ORCHIDEE-SOM against observations of DOC concentrations and SOC stocks from four European sites with different vegetation covers: a coniferous forest, a deciduous forest, a grassland, and a cropland. The model was able to reproduce the SOC stocks along their vertical profiles at the four sites and the DOC concentrations within the range of measurements, with the exception of the DOC concentrations in the upper soil horizon at the coniferous forest. However, the model was not able to fully capture the temporal dynamics of DOC concentrations. Further model improvements should focus on a plant- and depth-dependent parameterization of the new input model parameters, such as the turnover times of DOC and the microbial carbon use efficiency. We suggest that this new soil module, when parameterized for global simulations, will improve the representation of the global carbon cycle in LSMs, thus helping to constrain the predictions of the future SOC response to global

  3. PART I: Bioventing Pilot Test Work Plan for Fire Protection Training Area Site FY-03, Charleston AFB, South Carolina. PART II: Draft Interim Pilot Test Results Report for Fire Protection Training Area Site FT-03, Charleston AFB, South Carolina

    1993-01-01

    This site-specific work plan presents the scope of a bioventing pilot test for in situ treatment of fuel contaminated soils at the Fire Protection Training Area designated as Site FT-O3, Charleston Air Force Base (AFB), South Carolina...

  4. Insulin resistance, adipokine profile and hepatic expression of SOCS-3 gene in chronic hepatitis C.

    Wójcik, Kamila; Jabłonowska, Elżbieta; Omulecka, Aleksandra; Piekarska, Anna

    2014-08-14

    To analyze adipokine concentrations, insulin resistance and hepatic expression of suppressor of cytokine signaling 3 (SOCS-3) in patients with chronic hepatitis C genotype 1 with normal body weight, glucose and lipid profile. The study group consisted of 31 patients with chronic hepatitis C and 9 healthy subjects. Total levels of adiponectin, leptin, resistin, visfatin, omentin, osteopontin and insulin were measured using an ELISA kit. The hepatic expression of SOCS-3 was determined by the use of the reverse transcription polymerase chain reaction method. Homeostasis model assessment for insulin resistance (HOMA-IR) values were significantly higher in hepatitis C virus (HCV) infected patients without metabolic disorders compared to healthy controls (2.24 vs 0.59, P = 0.0003). Hepatic steatosis was observed in 32.2% of patients with HCV infection and was found in patients with increased HOMA-IR index (2.81 vs 1.99, P = 0.05) and reduced adiponectin level (5.96 vs 8.37, P = 0.04). Inflammatory activity (G ≥ 2) was related to increased osteopontin concentration (34.04 vs 23.35, P = 0.03). Advanced liver fibrosis (S ≥ 2) was associated with increased levels of omentin and osteopontin (436.94 vs 360.09, P = 0.03 and 32.84 vs 20.29, P = 0.03) and reduced resistin concentration (1.40 vs 1.74, P = 0.047). No correlations were reported between adipokine profile, HOMA-IR values and hepatic expression of the SOCS-3 gene. We speculated that no relationship between adipokines and HOMA-IR values may indicate that HCV can induce insulin resistance itself. Some adipokines appear to be biochemical markers of steatosis, inflammation and fibrosis in patients with chronic HCV infection. © 2014 Baishideng Publishing Group Inc. All rights reserved.

  5. Reduced expression of TAC1, PENK and SOCS2 in Hcrtr-2 mutated narcoleptic dog brain

    Mignot Emmanuel

    2007-05-01

    Full Text Available Abstract Background Narcolepsy causes dramatic behavioral alterations in both humans and dogs, with excessive sleepiness and cataplexy triggered by emotional stimuli. Deficiencies in the hypocretin system are well established as the origin of the condition; both from studies in humans who lack the hypocretin ligand (HCRT and in dogs with a mutation in hypocretin receptor 2 (HCRTR2. However, little is known about molecular alterations downstream of the hypocretin signals. Results By using microarray technology we have screened the expression of 29760 genes in the brains of Doberman dogs with a heritable form of narcolepsy (homozygous for the canarc-1 [HCRTR-2-2] mutation, and their unaffected heterozygous siblings. We identified two neuropeptide precursor molecules, Tachykinin precursor 1 (TAC1 and Proenkephalin (PENK, that together with Suppressor of cytokine signaling 2 (SOCS2, showed reduced expression in narcoleptic brains. The difference was particularly pronounced in the amygdala, where mRNA levels of PENK were 6.2 fold lower in narcoleptic dogs than in heterozygous siblings, and TAC1 and SOCS2 showed 4.4 fold and 2.8 fold decrease in expression, respectively. The results obtained from microarray experiments were confirmed by real-time RT-PCR. Interestingly, it was previously shown that a single dose of amphetamine-like stimulants able to increase wakefulness in the dogs, also produce an increase in the expression of both TAC1 and PENK in mice. Conclusion These results suggest that TAC1, PENK and SOCS2 might be intimately connected with the excessive daytime sleepiness not only in dogs, but also in other species, possibly including humans.

  6. Measurement of the complete core plasma flow across the LOC-SOC transition at ASDEX Upgrade

    Lebschy, A.; McDermott, R. M.; Angioni, C.; Geiger, B.; Prisiazhniuk, D.; Cavedon, M.; Conway, G. D.; Dux, R.; Dunne, M. G.; Kappatou, A.; Pütterich, T.; Stroth, U.; Viezzer, E.; the ASDEX Upgrade Team

    2018-02-01

    A newly installed core charge exchange recombination spectroscopy (CXRS) diagnostic at ASDEX Upgrade (AUG) enables the evaluation of the core poloidal rotation (upol ) through the inboard-outboard asymmetry of the toroidal rotation with an accuracy of 0.5 to 1 km s-1 . Using this technique, the total plasma flow has been measured in Ohmic L-mode plasmas across the transition from the linear to saturated ohmic confinement (LOC-SOC) regimes. The core poloidal rotation of the plasma around mid-radius is found to be always in the ion diamagnetic direction, in disagreement with neoclassical (NC) predictions. The edge rotation is found to be electron-directed and consistent with NC codes. This measurement provides as well the missing ingredient to evaluate the core E×B velocity (uE×B ) from data only, which can then be compared to measurements of the perpendicular velocity of the turbulent fluctuations (u\\perp ) to gain information on the turbulent phase velocity (vph ). The non neoclassical upol from CXRS leads to good agreement between uE×B and u\\perp indicating that vph is small and at similar values as found with gyrokinetic simulations. Moreover, the data shows a shift of vph in the ion-diamagnetic direction at the edge after the transition from LOC to SOC consistent with a change in the dominant turbulence regime. The upgrade of the core CXRS system provides as well a deeper insight into the intrinsic rotation. This paper shows that the reversal of the core toroidal rotation occurs clearly after the LOC-SOC transition and concomitant with the peaking of the electron density.

  7. Parametric Dense Stereovision Implementation on a System-on Chip (SoC

    Pablo Montejo

    2012-02-01

    Full Text Available This paper proposes a novel hardware implementation of a dense recovery of stereovision 3D measurements. Traditionally 3D stereo systems have imposed the maximum number of stereo correspondences, introducing a large restriction on artificial vision algorithms. The proposed system-on-chip (SoC provides great performance and efficiency, with a scalable architecture available for many different situations, addressing real time processing of stereo image flow. Using double buffering techniques properly combined with pipelined processing, the use of reconfigurable hardware achieves a parametrisable SoC which gives the designer the opportunity to decide its right dimension and features. The proposed architecture does not need any external memory because the processing is done as image flow arrives. Our SoC provides 3D data directly without the storage of whole stereo images. Our goal is to obtain high processing speed while maintaining the accuracy of 3D data using minimum resources. Configurable parameters may be controlled by later/parallel stages of the vision algorithm executed on an embedded processor. Considering hardware FPGA clock of 100 MHz, image flows up to 50 frames per second (fps of dense stereo maps of more than 30,000 depth points could be obtained considering 2 Mpix images, with a minimum initial latency. The implementation of computer vision algorithms on reconfigurable hardware, explicitly low level processing, opens up the prospect of its use in autonomous systems, and they can act as a coprocessor to reconstruct 3D images with high density information in real time.

  8. Design of a Bidirectional Energy Storage System for a Vanadium Redox Flow Battery in a Microgrid with SOC Estimation

    Qingwu Gong

    2017-03-01

    Full Text Available This paper used a Vanadium Redox flow Battery (VRB as the storage battery and designed a two-stage topology of a VRB energy storage system in which a phase-shifted full bridge dc-dc converter and three-phase inverter were used, considering the low terminal voltage of the VRB. Following this, a model of the VRB was simplified, according to the operational characteristics of the VRB in this designed topology of a VRB energy storage system (ESS. By using the simplified equivalent model of the VRB, the control parameters of the ESS were designed. For effectively estimating the state of charge (SOC of the VRB, a traditional method for providing the SOC estimation was simplified, and a simple and effective SOC estimation method was proposed in this paper. Finally, to illustrate the proper design of the VRB ESS and the proposed SOC estimation method, a corresponding simulation was designed by Simulink. The test results have demonstrated that this proposed SOC estimation method is feasible and effective for indicating the SOC of a VRB and the proper design of this VRB ESS is very reasonable for VRB applications.

  9. Energy efficient HPC on embedded SoCs : optimization techniques for mali GPU

    Grasso, Ivan; Radojkovic, Petar; Rajovic, Nikola; Gelado Fernandez, Isaac; Ramírez Bellido, Alejandro

    2014-01-01

    A lot of effort from academia and industry has been invested in exploring the suitability of low-power embedded technologies for HPC. Although state-of-the-art embedded systems-on-chip (SoCs) inherently contain GPUs that could be used for HPC, their performance and energy capabilities have never been evaluated. Two reasons contribute to the above. Primarily, embedded GPUs until now, have not supported 64-bit floating point arithmetic - a requirement for HPC. Secondly, embedded GPUs did not pr...

  10. An acceleration system for Laplacian image fusion based on SoC

    Gao, Liwen; Zhao, Hongtu; Qu, Xiujie; Wei, Tianbo; Du, Peng

    2018-04-01

    Based on the analysis of Laplacian image fusion algorithm, this paper proposes a partial pipelining and modular processing architecture, and a SoC based acceleration system is implemented accordingly. Full pipelining method is used for the design of each module, and modules in series form the partial pipelining with unified data formation, which is easy for management and reuse. Integrated with ARM processor, DMA and embedded bare-mental program, this system achieves 4 layers of Laplacian pyramid on the Zynq-7000 board. Experiments show that, with small resources consumption, a couple of 256×256 images can be fused within 1ms, maintaining a fine fusion effect at the same time.

  11. DMA Controller for LEON3 SoC:s Using AMBA

    Nilsson, Emelie

    2013-01-01

    A DMA Controller can offload a processor tremendously. A memory copy operation can be initiated by the processor and while the processor executes others tasks the memory copy can be fulfilled by the DMA Controller. An implementation of a DMA Controller for use in LEON3 SoC:s has been made during this master thesis. Problems that occurred while designing a controller of this type concerned AMBA buses, data transfers, alignment and interrupt handling. The DMA Controller supports AMBA and is att...

  12. Study of Reversible Logic Synthesis with Application in SOC: A Review

    Sharma, Chinmay; Pahuja, Hitesh; Dadhwal, Mandeep; Singh, Balwinder

    2017-08-01

    The prime concern in today’s SOC designs is the power dissipation which increases with technology scaling. The reversible logic possesses very high potential in reducing power dissipation in these designs. It finds its application in latest research fields such as DNA computing, quantum computing, ultra-low power CMOS design and nanotechnology. The reversible circuits can be easily designed using the conventional CMOS technology at a cost of a garbage output which maintains the reversibility. The purpose of this paper is to provide an overview of the developments that have occurred till date in this concept and how the new reversible logic gates are used to design the logic functions.

  13. Suppressor of Cytokine Signaling (SOCS 5 utilises distinct domains for regulation of JAK1 and interaction with the adaptor protein Shc-1.

    Edmond M Linossi

    Full Text Available Suppressor of Cytokine Signaling (SOCS5 is thought to act as a tumour suppressor through negative regulation of JAK/STAT and epidermal growth factor (EGF signaling. However, the mechanism/s by which SOCS5 acts on these two distinct pathways is unclear. We show for the first time that SOCS5 can interact directly with JAK via a unique, conserved region in its N-terminus, which we have termed the JAK interaction region (JIR. Co-expression of SOCS5 was able to specifically reduce JAK1 and JAK2 (but not JAK3 or TYK2 autophosphorylation and this function required both the conserved JIR and additional sequences within the long SOCS5 N-terminal region. We further demonstrate that SOCS5 can directly inhibit JAK1 kinase activity, although its mechanism of action appears distinct from that of SOCS1 and SOCS3. In addition, we identify phosphoTyr317 in Shc-1 as a high-affinity substrate for the SOCS5-SH2 domain and suggest that SOCS5 may negatively regulate EGF and growth factor-driven Shc-1 signaling by binding to this site. These findings suggest that different domains in SOCS5 contribute to two distinct mechanisms for regulation of cytokine and growth factor signaling.

  14. A new circuit for at-speed scan SoC testing

    Lin Wei; Shi Wenlong

    2013-01-01

    It is very important to detect transition-delay faults and stuck-at faults in system on chip (SoC) under 90 nm processing technology, and the transition-delay faults can only be detected by using an at-speed testing method. In this paper, an on-chip clock (OCC) controller with a bypass function based on an internal phase-locked loop is designed to test faults in SoC. Furthermore, a clock chain logic which can eliminate the metastable state is realized to generate an enable signal for the OCC controller, and then, the test pattern is generated by automatic test pattern generation (ATPG) tools. Next, the scan test pattern is simulated by using the Synopsys tool and the correctness of the design is verified. The result shows that the design of an at-speed scan test in this paper is highly efficient for detecting timing-related defects. Finally, the 89.29% transition-delay fault coverage and the 94.50% stuck-at fault coverage are achieved, and it is successfully applied to an integrated circuit design. (semiconductor integrated circuits)

  15. An ESL Approach for Energy Consumption Analysis of Cache Memories in SoC Platforms

    Abel G. Silva-Filho

    2011-01-01

    Full Text Available The design of complex circuits as SoCs presents two great challenges to designers. One is the speeding up of system functionality modeling and the second is the implementation of the system in an architecture that meets performance and power consumption requirements. Thus, developing new high-level specification mechanisms for the reduction of the design effort with automatic architecture exploration is a necessity. This paper proposes an Electronic-System-Level (ESL approach for system modeling and cache energy consumption analysis of SoCs called PCacheEnergyAnalyzer. It uses as entry a high-level UML-2.0 profile model of the system and it generates a simulation model of a multicore platform that can be analyzed for cache tuning. PCacheEnergyAnalyzer performs static/dynamic energy consumption analysis of caches on platforms that may have different processors. Architecture exploration is achieved by letting designers choose different processors for platform generation and different mechanisms for cache optimization. PCacheEnergyAnalyzer has been validated with several applications of Mibench, Mediabench, and PowerStone benchmarks, and results show that it provides analysis with reduced simulation effort.

  16. EtherBone - A Network Layer for the Wishbone SoC Bus

    Kreider, M; Lewis, J; Włostowski, T; Serrano, J

    2011-01-01

    Today, there are several System on a Chip (SoC) bus systems. Typically, these buses are confined on-chip and rely on higher level components to communicate with the outside world. Taking these systems a step further, we see the possibility of extending the reach of the SoC bus to remote FPGAs or processors. This leads to the idea of the EtherBone (EB) core, which connects a Wishbone (WB) Ver. 4 Bus via a Gigabit Ethernet based network link to remote peripheral devices. EB acts as a transparent interconnect module towards attached WB Bus devices. Address information and data from one or more WB bus cycles is preceded with a descriptive header and encapsulated in a UDP/IP packet. Because of this standard compliance, EB is able to traverse Wide Area Networks and is therefore not bound to a geographic location. Due to the low level nature of the WB bus, EB provides a sound basis for remote hardware tools like a JTAG debugger, In-System-Programmer (ISP), boundary scan interface or logic analyser module. EB was de...

  17. ETHERBONE - a network layer for the wishbone SoC bus

    Kreider, M.; Terpstra, W.; Lewis, J.; Serrano, J.; Wlostowski, T.

    2012-01-01

    Today, there are several System on a Chip (SoC) bus systems. Typically, these buses are confined on-chip and rely on higher level components to communicate with the outside world. Taking these systems a step further, we see the possibility of extending the reach of the SoC bus to remote FPGAs or processors. This leads to the idea of the EtherBone (EB) core, which connects a Wishbone (WB) Ver. 4 Bus via a Gigabit Ethernet based network link to remote peripheral devices. EB acts as a transparent interconnect module towards attached WB Bus devices. Address information and data from one or more WB bus cycles is preceded with a descriptive header and encapsulated in a UDP/IP packet. Because of this standard compliance, EB is able to traverse Wide Area Networks and is therefore not bound to a geographic location. Due to the low level nature of the WB bus, EB provides a sound basis for remote hardware tools like a JTAG debugger, In-System-Programmer (ISP), boundary scan interface or logic analyser module. EB was developed in the scope of the White-Rabbit Timing Project (WR) at CERN and GSI/FAIR, which employs GigaBit Ethernet technology to communicate with memory mapped slave devices. WR will make use of EB as means to issue commands to its timing nodes and control connected accelerator hardware. (authors)

  18. Observation of self-organized criticality (SOC) behavior during edge biasing experiment on TEXTOR

    Xu, Y.H.; Jachmich, S.; Weynants, R.R. [Ecole Royale Militaire/Koninklijke Militaire School, Laboratory for Plasma Physics, Euratom-Belgian State Association, Brussels, Belgium, Partner in the Trilateral Euregio Cluster (Belgium)

    2004-07-01

    The self-organized criticality (SOC) behavior of the edge plasma transport has been investigated using the fluctuation data measured in the plasma edge and the scrape-off layer of TEXTOR tokamak before and during the edge electrode biasing experiments. In the 'non-shear' discharge phase before biasing, both the potential and density fluctuations clearly exhibit some of the characteristics associated with SOC: (1) existence of f{sup -1} power-law dependence in the frequency spectrum, (2) slowly decaying long tails in the autocorrelation function, (3) values of Hurst parameters larger than 0.5 at all the detected radial locations, (4) non-Gaussian probability density function of fluctuations and (5) radial propagation of avalanche-like events in the edge plasma area. During the biasing phase, with the generation of an edge radial electric field E{sub r} and hence a sheared E{sub r} x B flow, the local turbulence is found to be well de-correlated by the E{sub r} x B velocity shear, consistent with theoretical predictions. Nevertheless, it is concomitantly found that the Hurst parameters are substantially enhanced in the negative flow shear region and in the scrape-off layer as well, which is contrary to theoretical expectation. Implication of these observations to our understanding of plasma transport mechanisms is discussed. (authors)

  19. SOCS3 inhibits the pathological effects of IL-22 in non-melanoma skin tumor-derived keratinocytes.

    Madonna, Stefania; Scarponi, Claudia; Morelli, Martina; Sestito, Rosanna; Scognamiglio, Pasqualina Liana; Marasco, Daniela; Albanesi, Cristina

    2017-04-11

    Basal cell carcinomas (BCC) and squamous-cell carcinomas (SCC) are common malignancies in humans, caused by neoplastic transformation of keratinocytes of the basal or suprabasal layers of epidermis, respectively. Tumor-infiltrating lymphocytes (TILs) are frequently found in BCC and SCC, and functionally promote epithelial carcinogenesis. TILs secreting IL-22, in particular, participate to BCC and SCC growth by inducing keratinocyte proliferation and migration, as well as the expression of inflammatory, anti-apoptotic and pro-angiogenic genes.In this study, we identified SOCS3 as a valid candidate to be manipulated for suppressing tumorigenic functions in BCC and SCC. We found that SOCS3 and SOCS1 expression was reduced in vivo, in tumor lesions of BCC and SCC, as compared to other skin inflammatory conditions such as psoriasis, despite the high number of IL-22-secreting TILs. Moreover, IL-22 was not able to induce in vitro the transcriptional expression of SOCS3 in BCC-or SCC-derived keratinocytes, contrarily to healthy cells. Aimed at rescuing SOCS3 activity in these tumor contexts, a SOCS3-derived peptide, named KIR-ESS, was synthesized, and its ability in suppressing IL-22-induced responses was evaluated in healthy and transformed keratinocytes. We found that KIR-ESS peptide efficiently suppressed the IL-22 molecular signaling in keratinocytes, by acting on STAT3 and Erk1/2 cascade, as well as on the expression of STAT3-dependent downstream genes. Interestingly, after treatment with peptide, both healthy and transformed keratinocytes could no longer aberrantly proliferate and migrate in response to IL-22. Finally, treatment of athymic nude mice bearing SCC xenografts with KIR-ESS peptide concomitantly reduced tumor growth and activated STAT3 levels. As a whole, these data provides the rationale for the use in BCC and SCC skin tumors of SOCS3 mimetics, being able to inhibit the deleterious effects of IL-22 in these contexts.

  20. Eielson AFB, Alaska. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    1983-07-22

    PERCENTACE FREQUENCY Of WIND DIRECTION AND SPEED (FROM HOURLY OBSERVATIONS) 7- 2650 EIELSON AF6 AK 73-8? *pp ALL WEATHER ISO -1 700 (KNEED I .3 4.6 7. 10...HOURLY OBSERVATIONS) 7 265C EIELSON AFB AX 73-82 DEC mn~y.. .y.rm,Io u ii. n~lu Sr.m ALL kEATHER ISO -1700 CLAm -- IL.S T.) SPEED i( MEA (KNTS) 1 - 3...fis r, i- &hS.2? q i- 7 &S2 kL%- &.S-2. fq 7Sf..7:p U8000 7Z.1 73. 73. 73. 73. ?6 73. 73. 38?8le 73.8 73.8 73.8 73.81 73., 27000 ’ ,i. L.bi~2~~ 800 I 8t

  1. Effects of different soil types in natural Mediterranean areas on soil organic carbon (SOC)

    Requejo Silva, Ana; Lozano García, Beatriz; Parras Alcántara, Luis

    2017-04-01

    Effects of different soil types in natural Mediterranean areas on soil organic carbon (SOC) Ana Requejo1, Beatriz Lozano-García1, Luis Parras Alcántara1 1 Department of Agricultural Chemistry and Soil Science, Faculty of Science, Agrifood Campus of International Excellence - ceiA3, University of Córdoba, Spain. The carbon content of the atmosphere can be influenced by soils, since they can store carbon or emit large quantities of CO2. C sequestration into soils is one of the most important ecosystems services because of its role in climate regulation (IPPC, 2007). Thereof, agriculture and forestry are the only activities that can contribute to C sequestration through photosynthesis and its carbon incorporation into carbohydrates (Parras Alcántara et al., 2013). Dehesa is a multifunctional agro-sylvo-pastoral system and typical landscape of southern and central Spain and southern Portugal. It is an anthropogenic system dedicated to the combined production of black iberian pigs, a variety of foods, fuel, coal, and cork. Besides, it acts as well in the production of endangered species as wildlife habitat and as sustainable hunting areas. These dehesa areas are defined by a relationship between productivity and conservation of forest oaks, providing environmental benefits such as carbon capture and storage. The area focused in this study is the Cardeña-Montoro Nature Reserve, located within the Sierra Morena (Córdoba, South Spain). The most representative soils in Cardeña-Montoro Nature Reserve are Cambisols, Regosols, Leptosols and Fluvisols according to IUSS Working Group WRB (2006). They are characterized by a low fertility, poor physical conditions and marginal capacity for agricultural use, along with low organic matter content due to climate conditions (semiarid Mediterranean climate) and soil texture (sandy). Several studies have shown that land use affects the SOC concentration (Lozano-García et al., 2016; Khaledian et al., 2016). Based on this

  2. Daily Socs1 rhythms alter with aging differentially in peripheral clocks in male Wistar rats: therapeutic effects of melatonin.

    Vinod, Ch; Jagota, Anita

    2017-06-01

    Suprachiasmatic nucleus (SCN) in synchronization with the peripheral clocks regulates the temporal oscillations leading to overt rhythms. Aging leads to attenuation of such circadian regulation, accompanied by increased inflammatory mediators prevalently the cytokines. Suppressors of cytokine signaling (SOCS) family of proteins such as SOCS 1, 3 and cytokine-inducible SH2-containing protein (CIS) negatively regulate the cytokine signaling pathway. The role of SOCS1 in aging and circadian system is obscure. We therefore studied the daily rhythms of rSocs1 mRNA expression at Zeitgeber time (ZT) -0, 6, 12 and 18 in peripheral clocks such as liver, kidney, intestine and heart of 3, 12 and 24 months (m) old male Wistar rats. Interestingly the peripheral clocks studied displayed a rhythmic rSocs1 gene expression in 3 months. In 12 months group, 12 h phase advance in liver and 12 h phase delay in kidney and heart was observed with abolition of rhythms in intestine. Aging (24 months group) resulted in a phase advance by 6 h in liver and heart with abolition of rhythms in intestine in 24 months group. Kidney was also significantly affected upon aging with significant decrease in the rSocs1 levels and abolition of rhythms. The decrease in melatonin levels with aging is associated with decreased immunity and increased oxidative stress. The exogenous administration of melatonin has been linked to play a role in re-synchronization of circadian rhythms, reducing oxidative stress and enhancing immune properties. We therefore had studied the effect of exogenous melatonin upon age induced changes in daily rSocs1 gene expression patterns. Melatonin treatment partially restored the rhythms and daily pulse (ratio of maximum:minimum levels) in liver and intestine in 12 months group. Melatonin administration resulted in a significant increase in mean 24 h rSocs1 expression in intestine and heart of 24 months group compared to that of 3 months. The melatonin administration

  3. Influenza A virus inhibits type I IFN signaling via NF-kappaB-dependent induction of SOCS-3 expression.

    Eva-K Pauli

    2008-11-01

    Full Text Available The type I interferon (IFN system is a first line of defense against viral infections. Viruses have developed various mechanisms to counteract this response. So far, the interferon antagonistic activity of influenza A viruses was mainly observed on the level of IFNbeta gene induction via action of the viral non-structural protein 1 (NS1. Here we present data indicating that influenza A viruses not only suppress IFNbeta gene induction but also inhibit type I IFN signaling through a mechanism involving induction of the suppressor of cytokine signaling-3 (SOCS-3 protein. Our study was based on the observation that in cells that were infected with influenza A virus and subsequently stimulated with IFNalpha/beta, phosphorylation of the signal transducer and activator of transcription protein 1 (STAT1 was strongly reduced. This impaired STAT1 activation was not due to the action of viral proteins but rather appeared to be induced by accumulation of viral 5' triphosphate RNA in the cell. SOCS proteins are potent endogenous inhibitors of Janus kinase (JAK/STAT signaling. Closer examination revealed that SOCS-3 but not SOCS-1 mRNA levels increase in an RNA- and nuclear factor kappa B (NF-kappaB-dependent but type I IFN-independent manner early in the viral replication cycle. This direct viral induction of SOCS-3 mRNA and protein expression appears to be relevant for suppression of the antiviral response since in SOCS-3 deficient cells a sustained phosphorylation of STAT1 correlated with elevated expression of type I IFN-dependent genes. As a consequence, progeny virus titers were reduced in SOCS-3 deficient cells or in cells were SOCS-3 expression was knocked-down by siRNA. These data provide the first evidence that influenza A viruses suppress type I IFN signaling on the level of JAK/STAT activation. The inhibitory effect is at least in part due to the induction of SOCS-3 gene expression, which results in an impaired antiviral response.

  4. Design of a Programmable Passive SoC for Biomedical Applications Using RFID ISO 15693/NFC5 Interface

    Mayukh Bhattacharyya

    2018-01-01

    Full Text Available Low power, low cost inductively powered passive biotelemetry system involving fully customized RFID/NFC interface base SoC has gained popularity in the last decades. However, most of the SoCs developed are application specific and lacks either on-chip computational or sensor readout capability. In this paper, we present design details of a programmable passive SoC in compliance with ISO 15693/NFC5 standard for biomedical applications. The integrated system consists of a 32-bit microcontroller, a sensor readout circuit, a 12-bit SAR type ADC, 16 kB RAM, 16 kB ROM and other digital peripherals. The design is implemented in a 0.18 μ m CMOS technology and used a die area of 1.52 mm × 3.24 mm. The simulated maximum power consumption of the analog block is 592 μ W. The number of external components required by the SoC is limited to an external memory device, sensors, antenna and some passive components. The external memory device contains the application specific firmware. Based on the application, the firmware can be modified accordingly. The SoC design is suitable for medical implants to measure physiological parameters like temperature, pressure or ECG. As an application example, the authors have proposed a bioimplant to measure arterial blood pressure for patients suffering from Peripheral Artery Disease (PAD.

  5. Improved OCV Model of a Li-Ion NMC Battery for Online SOC Estimation Using the Extended Kalman Filter

    Ines Baccouche

    2017-05-01

    Full Text Available Accurate modeling of the nonlinear relationship between the open circuit voltage (OCV and the state of charge (SOC is required for adaptive SOC estimation during the lithium-ion (Li-ion battery operation. Online SOC estimation should meet several constraints, such as the computational cost, the number of parameters, as well as the accuracy of the model. In this paper, these challenges are considered by proposing an improved simplified and accurate OCV model of a nickel manganese cobalt (NMC Li-ion battery, based on an empirical analytical characterization approach. In fact, composed of double exponential and simple quadratic functions containing only five parameters, the proposed model accurately follows the experimental curve with a minor fitting error of 1 mV. The model is also valid at a wide temperature range and takes into account the voltage hysteresis of the OCV. Using this model in SOC estimation by the extended Kalman filter (EKF contributes to minimizing the execution time and to reducing the SOC estimation error to only 3% compared to other existing models where the estimation error is about 5%. Experiments are also performed to prove that the proposed OCV model incorporated in the EKF estimator exhibits good reliability and precision under various loading profiles and temperatures.

  6. A 0.7-V 17.4- μ W 3-lead wireless ECG SoC.

    Khayatzadeh, Mahmood; Zhang, Xiaoyang; Tan, Jun; Liew, Wen-Sin; Lian, Yong

    2013-10-01

    This paper presents a fully integrated sub-1 V 3-lead wireless ECG System-on-Chip (SoC) for wireless body sensor network applications. The SoC includes a two-channel ECG front-end with a driven-right-leg circuit, an 8-bit SAR ADC, a custom-designed 16-bit microcontroller, two banks of 16 kb SRAM, and a MICS band transceiver. The microcontroller and SRAM blocks are able to operate at sub-/near-threshold regime for the best energy consumption. The proposed SoC has been implemented in a standard 0.13- μ m CMOS process. Measurement results show the microcontroller consumes only 2.62 pJ per instruction at 0.35 V . Both microcontroller and memory blocks are functional down to 0.25 V. The entire SoC is capable of working at single 0.7-V supply. At the best case, it consumes 17.4 μ W in heart rate detection mode and 74.8 μW in raw data acquisition mode under sampling rate of 500 Hz. This makes it one of the best ECG SoCs among state-of-the-art biomedical chips.

  7. 0.45 v and 18 μA/MHz MCU SOC with Advanced Adaptive Dynamic Voltage Control (ADVC

    Uzi Zangi

    2018-05-01

    Full Text Available An ultra-low-power MicroController Unit System-on-Chip (MCU SOC is described with integrated DC to DC power management and Adaptive Dynamic Voltage Control (ADVC mechanism. The SOC, designed and fabricated in a 40 nm ULP standard CMOS technology, includes the complete Synopsys ARC EM5D core MCU, featuring a full set of DSP instructions and minimizing energy consumption at a wide range of frequencies: 312 K–80 MHz. A number of unique low voltage digital libraries, comprising of approximately 300 logic cells and sequential elements, were used for the MCU SOC design. On-die silicon sensors were utilized to continuously change the operating voltage to optimize power/performance for a given frequency and environmental conditions, and also to resolve yield and life time problems, while operating at low voltages. A First Fail (FFail mechanism, which can be digitally and linearly controlled with up to 8 bits, detects the failing SOC voltage at a given frequency. The core operates between 0.45–1.1 V volts with a direct battery connection for an input voltage of 1.6–3.6 V. Measurement results show that the peak energy efficiency is 18μW/MHz. A comparison to state-of-the-art commercial SOCs is presented, showing a 3–5× improved current/DMIPS (Dhrystone Million Instructions per second compared to the next best chip.

  8. A project to study SOC evolution after land use change combining chronosequence and gradient methods

    Gabarron-Galeote, Miguel A.; van Wesemael, Bas

    2013-04-01

    In the last decades the interest in the global C budget has increased enormously and soils have a great importance in this issue since they contain about twice as much carbon as the atmosphere. Land use change (LUC) can cause a change in land cover and an associated change in carbon stocks in soils, so it has a major impact in the balance between inputs and outputs of soil organic carbon (SOC). Improved understanding of land-use impacts on the world's terrestrial carbon balance is thus a necessary part of the global effort to mitigate climate change. The aim of this project is to predict the effects of land use and land management change on (SOC) stocks, characterizing the soil organic carbon cycle and its relationship to the vegetal cover in croplands abandoned different years ago and under different Mediterranean climatic conditions in South of Spain. The study area is located in the Cordillera Bética Litoral, in South of Spain. In this area, a climatic gradient can be observed from West to East: from >1,500 mm year-1 in the Strait of Gibraltar to <250 mm year-1 in the Cabo de Gata. More specifically, the study is focussed on three different areas from the climatic conditions point of view: Gaucín (1010 mm year-1), Almogía, (576 mm year-1) and Gérgal (240 mm year-1). By means of the analyses of aerial photographs (1956, 1977, 1984, 1998 and 2009) all the experimental plots will be selected. After this procedure, the three study areas will be composed by experimental plots of these classes: a) Lands with natural vegetation since 1956. b) Abandoned lands between 1956 and 1977. c) Abandoned lands between 1977 and 1984. d) Abandoned lands between 1984 and 1998. e) Abandoned lands between 1998 and 2005. f) Cultivated lands since 1956. The main expected outcomes of the research project are the characterization of the temporal evolution of SOC in soils, the compilation of experimental areas under different Mediterranean climatic conditions, and the characterization

  9. Soc stock in different forest-related land-uses in central Stara planina mountain, Bulgaria

    Zhiyanski Miglena

    2009-01-01

    Full Text Available Forest conversions may lead to an accumulation of carbon in vegetation, but little is known about changes in soil C storage with establishment of plantation forests. Understanding these effects is important to addressing issues relevant to ecosystem function and productivity, and to global balance of carbon. The study investigated the effects of the created coniferous plantations on former beech and pasture sites on the soil organic carbon storage. The major forest-related land-uses in the high mountainous regions of central Stara Planina Mountain were investigated: mountainous pasture, coniferous plantations (planted on previous pasture and beech forests between four and five decades ago and natural beech forests. The experimental data of soil properties, conducted in 2005, 2006 and 2007, were used in determining the variations in organic carbon storage in forest litter and in mineral soil under different land-use patterns. At each site five representative soil profiles were opened and described giving a total 75 soil samples from the soil layers respectively at 0-10, 10-30 and 30-50 cm depth. A total of 55 samples from forest floor layers (Aol, Aof, Aoh and greensward were collected with 25:25 cm plastic frame. The main soil properties were determined in accordance with the standardized methods in the Laboratory of soil science at the Forest Research Institute - BAS. The IPCC Good Practice Guidance for Land Use, Land Use Change and Forestry was used to estimate the soil organic carbon stock in soil and litter. The results obtained showed that the SOC stock was quite similar among forest land-uses. The conversion of natural beech forests to coniferous plantations in studied region is related with slightly expressed decrease in soil carbon storage. The values of SOC stocks in 0-50 cm soil layer in these sites were 8.5 (±2.1 tones/ha for pine and 11.0 (±1.4 tones/ha for spruce, while under the natural beech forest it was 14.8 (±1.0 tones

  10. Algorithm & SoC design for automotive vision systems for smart safe driving system

    Shin, Hyunchul

    2014-01-01

    An emerging trend in the automobile industry is its convergence with information technology (IT). Indeed, it has been estimated that almost 90% of new automobile technologies involve IT in some form. Smart driving technologies that improve safety as well as green fuel technologies are quite representative of the convergence between IT and automobiles. The smart driving technologies include three key elements: sensing of driving environments, detection of objects and potential hazards, and the generation of driving control signals including warning signals. Although radar-based systems are primarily used for sensing the driving environments, the camera has gained importance in advanced driver assistance systems(ADAS). This book covers system-on-a-chip (SoC) designs—including both algorithms and hardware—related with image sensing and object detection by using the camera for smart driving systems. It introduces a variety of algorithms such as lens correction, super resolution, image enhancement, and object ...

  11. Untrimmed Low-Power Thermal Sensor for SoC in 22 nm Digital Fabrication Technology

    Ro'ee Eitan

    2014-12-01

    Full Text Available Thermal sensors (TS are essential for achieving optimized performance and reliability in the era of nanoscale microprocessor and system on chip (SoC. Compiling with the low-power and small die area of the mobile computing, the presented TS supports a wide range of sampling frequencies with an optimized power envelope. The TS supports up to 45 K samples/s, low average power consumption, as low as 20 μW, and small core Si area of 0.013 mm2. Advanced circuit techniques are used in order to overcome process variability, ensuring inaccuracy lower than ±2 °C without any calibration. All this makes the presented thermal sensor a cost-effective, low-power solution for 22 nm nanoscale digital process technology.

  12. 3D Embedded Reconfigurable SoC for Expediting Magnetometric Space Missions

    Dekoulis, George

    2016-07-01

    This paper describes the development of a state-of-the-art three-dimensional embedded reconfigurable System-on-Chip (SoC) for accelerating the design of future magnetometric space missions. This involves measurements of planetary magnetic fields or measurements of heliospheric physics events' signatures superimposed on the aggregate measurements of the stronger planetary fields. The functionality of the embedded core is fully customizable, therefore, its operation is independent of the magnetic sensor being used. Standard calibration procedures still apply for setting the magnetometer measurements to the desired initial state and removing any seriatim interference inferred by the adjacent environment. The system acts as a pathfinder for future high-resolution heliospheric space missions.

  13. Performance Evaluation of FIR Filter After Implementation on Different FPGA and SOC and Its Utilization in Communication and Network

    Pandey, Bishwajeet; Das, Bhagwan; Kaur, Amanpreet

    2017-01-01

    that will energy efficient as well as faster than traditional design. Three different FPGA and SOC are taken under consideration and our design is implemented on these four ICs and we find the most energy efficient architecture and also find the architecture that will deliver highest performance among these four...... FPGA then we conclude that Zynq 7000 All programmable SOC is power hungry architecture and Kintex ultrascale architecture is the most energy efficient architecture that dissipates 20.86% less power than Zynq 700 All programmable SOC. For performance evaluation, we have taken benchmark C code of FIR...... provide by Xilinx. We transform that C code into HDL using Vivado HLS 2016.2 before power analysis on Vivado 2016.2. Ultrascale FPGA is generally used for packet processing in 100G networking and heterogeneous wireless infrastructure....

  14. Proposed Expansion of German Air Force Operations at Holloman AFB, New Mexico. Final Environmental Impact Statement. Volume III: Comment Letters and Responses to Comments

    1998-01-01

    The Final Environmental Impact Statement analyzed the potential environmental consequences from the proposal to beddown 30 additional German Air Force Tornado aircraft and 640 personnel at Holloman Air Force Base (AFB) New Mexico...

  15. Monoclonal antibody anti-AFB1: scale-up in vitro for biotools development Anticorpo monoclonal antiAFB1: produção in vitro visando desenvolvimento de bioferramentas

    Eiko Nakagawa Itano

    2010-12-01

    Full Text Available Aflatoxin B1 (AFB1 is a mycotoxin classified as group 1 (human carcinogen by International Agency for Research on Cancer - IARC, causing hazardous contamination in a wide variety of food and feed, where the monitoring depends on precision and accuracy of analytical method. The culture of AFB1 specific monoclonal antibody (mAb secreting hybridoma was performed for further development of immunochemical methods. The growth of hybridoma AF2 was carried out in RPMI medium + 15 % fetal bovine serum (FBS, as well as the same medium gradually amended with H-SFM medium (25, 50, 75 and 100 % H-SFM. The protein concentration in the culture supernatant ranged from 1.80 to 10.88 mg/mL. The culture amended with FBS-free synthetic H-SFM medium reached production of reagent with higher degree of purity and lower risk, in addition to lower protein content (2.29 mg/mL reached with 100 % H-SFM, which approaches the real content of pure mAb. The indirect competitive enzyme-linked immunosorbent assay (ic-ELISA and SDS-polyacrylamide gel electrophoresis (SDS-PAGE showed anti-AFB1 activity and IgG corresponding bands, respectively, indicating feasible application of mAb produced in 100, 75 and 50 % H-SFM for further use in the development of AFB1 detecting biotools. This mAb production can be an initial step that can supply the self-sufficient immune-reagent in the rapid diagnosis at national condition, which is essential in the food quality and safety.Aflatoxina B1 (AFB1 é uma micotoxina classificada pela International Agency for Research on Cancer - IARC no Grupo 1 (carcinógeno ao humano, responsável pelo perigo de contaminação em ampla variedade de alimento e ração, cujo monitoramento depende de metodologia analítica precisa e exata. O trabalho visou cultivo do hibridoma secretor de anticorpo monoclonal (AcM específico para AFB1 visando desenvolvimento de métodos imunoquímicos. Hibridoma AF2 foi cultivado em meio RPMI + 15 % de soro fetal bovino (SFB

  16. Suppressor of cytokine signaling 2 (Socs2 deletion protects bone health of mice with DSS-induced inflammatory bowel disease

    Ross Dobie

    2018-01-01

    Full Text Available Individuals with inflammatory bowel disease (IBD often present with poor bone health. The development of targeted therapies for this bone loss requires a fuller understanding of the underlying cellular mechanisms. Although bone loss in IBD is multifactorial, the altered sensitivity and secretion of growth hormone (GH and insulin-like growth factor-1 (IGF-1 in IBD is understood to be a critical contributing mechanism. The expression of suppressor of cytokine signaling 2 (SOCS2, a well-established negative regulator of GH signaling, is stimulated by proinflammatory cytokines. Therefore, it is likely that SOCS2 expression represents a critical mediator through which proinflammatory cytokines inhibit GH/IGF-1 signaling and decrease bone quality in IBD. Using the dextran sodium sulfate (DSS model of colitis, we reveal that endogenously elevated GH function in the Socs2−/− mouse protects the skeleton from osteopenia. Micro-computed tomography assessment of DSS-treated wild-type (WT mice revealed a worsened trabecular architecture compared to control mice. Specifically, DSS-treated WT mice had significantly decreased bone volume, trabecular thickness and trabecular number, and a resulting increase in trabecular separation. In comparison, the trabecular bone of Socs2-deficient mice was partially protected from the adverse effects of DSS. The reduction in a number of parameters, including bone volume, was less, and no changes were observed in trabecular thickness or separation. This protected phenotype was unlikely to be a consequence of improved mucosal health in the DSS-treated Socs2−/− mice but rather a result of unregulated GH signaling directly on bone. These studies indicate that the absence of SOCS2 is protective against bone loss typical of IBD. This study also provides an improved understanding of the relative effects of GH/IGF-1 signaling on bone health in experimental colitis, information that is essential before these drugs are

  17. Methylation of SOCS3 is inversely associated with metabolic syndrome in an epigenome-wide association study of obesity.

    Ali, Omar; Cerjak, Diana; Kent, Jack W; James, Roland; Blangero, John; Carless, Melanie A; Zhang, Yi

    2016-09-01

    Epigenetic mechanisms, including DNA methylation, mediate the interaction between gene and environment and may play an important role in the obesity epidemic. We assessed the relationship between DNA methylation and obesity in peripheral blood mononuclear cells (PBMCs) at 485,000 CpG sites across the genome in family members (8-90 y of age) using a discovery cohort (192 individuals) and a validation cohort (1,052 individuals) of Northern European ancestry. After Bonferroni-correction (P α=0.05 = 1.31 × 10 -7 ) for genome-wide significance, we identified 3 loci, cg18181703 (SOCS3), cg04502490 (ZNF771), and cg02988947 (LIMD2), where methylation status was associated with body mass index percentile (BMI%), a clinical index for obesity in children, adolescents, and adults. These sites were also associated with multiple metabolic syndrome (MetS) traits, including central obesity, fat depots, insulin responsiveness, and plasma lipids. The SOCS3 methylation locus was also associated with the clinical definition of MetS. In the validation cohort, SOCS3 methylation status was found to be inversely associated with BMI% (P = 1.75 × 10 -6 ), waist to height ratio (P = 4.18 × 10 -7 ), triglycerides (P = 4.01 × 10 -4 ), and MetS (P = 4.01 × 10 -7 ), and positively correlated with HDL-c (P = 4.57 × 10 -8 ). Functional analysis in a sub cohort (333 individuals) demonstrated SOCS3 methylation and gene expression in PBMCs were inversely correlated (P = 2.93 × 10 -4 ) and expression of SOCS3 was positively correlated with status of MetS (P = 0.012). We conclude that epigenetic modulation of SOCS3, a gene involved in leptin and insulin signaling, may play an important role in obesity and MetS.

  18. [Characteristics of Soil Respiration along Eroded Sloping Land with Different SOC Background on the Hilly Loess Plateau].

    Chen, Gai; Xu, Ming-xiang; Zhang, Ya-feng; Wang, Chao-hua; Fan, Hui-min; Wang, Shan-shan

    2015-09-01

    This study aimed to characterize soil respiration along eroded sloping land at erosion and deposition area under different soil organic carbon(SOC) levels, and linked the relationship between soil respiration and soil temperature, soil moisture, SOC and slope position. Experiments were carried out in the plots of S type slopes include five different soil organic carbon levels in the Loess Hilly Region. The S type slopes were divided into control area at the top of the slope, erosion area at the middle of the slope and deposition area at the toe of the slope. We found that soil temperature had a greater impact on soil respiration in the deposition area, whereas soil moisture had a greater impact on soil respiration in the erosion area compared among control area, erosion area and deposition area. In addition, SOC was the most important factor affecting soil respiration, which can explain soil respiration variation 54. 72%, followed by soil moisture, slope position and soil temperature, which explain soil respiration variation 18. 86% , 16. 13% and 10. 29%, respectively. Soil respiration response to erosion showed obvious on-site and off-site effects along the eroded sloping land. Soil respiration in the erosion area was reduced by 21. 14% compared with control area, and soil respiration in the deposition area was increased by 21. 93% compared with control area. Erosion effect on source and sink of carbon emission was correlated with SOC content of the eroded sloping land. When SOC content was higher than 6. 82 g.kg-1, the slope. erosion tended to be a carbon sequestration process, and when SOC content was lower than 3.03 g.kg-1, the slope erosion tended to be a process of the carbon emission source. The model could reflect the relationship between soil respiration and independent variables of soil organic carbon content, soil temperature and moisture.

  19. SOC Strategies and Organizational Citizenship Behaviors toward the Benefits of Co-workers: A Multi-Source Study

    Andreas Müller

    2017-10-01

    Full Text Available Background: Individuals’ behavioral strategies like selection, optimization, and compensation (SOC contribute to efficient use of available resources. In the work context, previous studies revealed positive associations between employees’ SOC use and favorable individual outcomes, like engagement and job performance. However, the social implications of self-directed behaviors like SOC that are favorable for the employee but may imply consequences for coworkers have not been investigated yet in an interpersonal work context.Objective: This study aimed to assess associations between employees’ use of SOC behaviors at work and their organizational citizenship behaviors (OCB toward the benefits of co-workers rated by their peers at work. We further sought to identify age-specific associations between SOC use and OCB.Design and Method: A cross-sectional design combining multi-source data was applied in primary school teachers (age range: 23–58 years who frequently teach in dyads. N = 114 dyads were finally included. Teachers reported on their SOC strategies at work. Their peer colleagues evaluated teachers’ OCB. Control variables were gender, workload, working hours, and perceived proximity of relationship between the dyads.Results: We observed a positive effect of loss-based selection behaviors on peer-rated OCB. Moreover, there was a significant two-way interaction effect between the use of compensation strategies and age on OCB, such that there was a positive association for older employees and a negative association for younger employees. There were no significant main and age-related interaction effects of elective selection, optimization, and of overall SOC strategies on OCB.Conclusion: Our study suggests that high use of loss-based selection and high use of compensation strategies in older employees is positively related with OCB as perceived by their colleagues. However, high use of compensation strategies in younger employees is

  20. Transcriptome, antioxidant enzyme activity and histopathology analysis of hepatopancreas from the white shrimp Litopenaeus vannamei fed with aflatoxin B1(AFB1).

    Zhao, Wei; Wang, Lei; Liu, Mei; Jiang, Keyong; Wang, Mengqiang; Yang, Guang; Qi, Cancan; Wang, Baojie

    2017-09-01

    Aflatoxin produced by Aspergillus flavus or Aspergillus parasiticus fungi during grain and feed processing and storage. Aflatoxins cause severe health problems reducing the yield and profitability of shrimp cultures. We sought to understand the interaction between shrimp immunity and aflatoxin B1 (AFB1), analyzing transcriptome expression, antioxidant enzyme activity, and histological features of the hepatopancreas of shrimp fed with AFB1. From over 4 million high-quality reads, de novo unigene assembly produced 103,644 fully annotated genes. A total of 1024 genes were differentially expressed in shrimp fed with AFB1, being involved in functions, such as peroxidase metabolism, signal transduction, transcriptional control, apoptosis, proteolysis, endocytosis, and cell adhesion and cell junction. Upon AFB1 challenge, there were severe histological alterations in shrimp hepatopancreas. AFB1 challenge increased the activity of several antioxidant enzymes. Our data contribute to improve the current understanding of host-AFB1 interaction, providing an abundant source for identification of novel genes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Detection of serum AFB1-lysine adduct in Malaysia and its association with liver and kidney functions.

    Mohd Redzwan, S; Rosita, Jamaluddin; Mohd Sokhini, A M; Nurul 'Aqilah, A R; Wang, Jia-Sheng; Kang, Min-Su; Zuraini, Ahmad

    2014-01-01

    Aflatoxin is ubiquitously found in many foodstuffs and produced by Aspergillus species of fungi. Of many aflatoxin metabolites, AFB1 is classified by the International Agency for Research on Cancer (IARC) as group one carcinogen and linked to the development of hepatocellular carcinoma (HCC). The study on molecular biomarker of aflatoxin provides a better assessment on the extent of human exposure to aflatoxin. In Malaysia, the occurrences of aflatoxin-contaminated foods have been documented, but there is a lack of data on human exposure to aflatoxin. Hence, this study investigated the occurrence of AFB1-lysine adduct in serum samples and its association with liver and kidney functions. 5ml fasting blood samples were collected from seventy-one subjects (n=71) for the measurement of AFB1-lysine adduct, albumin, total bilirubin, AST (aspartate aminotransferase), ALT (alanine transaminase), ALP (alkaline phosphatase), GGT (gamma-glutamyl transpeptidase), creatinine and BUN (blood urea nitrogen). The AFB1-lysine adduct was detected in all serum samples (100% detection rate) with a mean of 6.85±3.20pg/mg albumin (range: 1.13-18.85pg/mg albumin). Male subjects (mean: 8.03±3.41pg/mg albumin) had significantly higher adduct levels than female subjects (mean: 5.64±2.46pg/mg albumin) (p6.85pg/mg albumin) had significantly elevated level of total bilirubin (pMalaysia. Given that aflatoxin can pose serious problem to the health, intervention strategies should be implemented to limit/reduce human exposure to aflatoxin. Besides, a study with a big sample size should be warranted in order to assess aflatoxin exposure in the general population of Malaysia. Copyright © 2013 Elsevier GmbH. All rights reserved.

  2. Response of Intestinal Bacterial Flora to the Long-term Feeding of Aflatoxin B1 (AFB1) in Mice.

    Yang, Xiai; Liu, Liangliang; Chen, Jing; Xiao, Aiping

    2017-10-12

    In order to investigate the influence of aflatoxin B1 (AFB1) on intestinal bacterial flora, 24 Kunming mice (KM mice) were randomly placed into four groups, which were labeled as control, low-dose, medium-dose, and high-dose groups. They were fed intragastrically with 0.4 mL of 0 mg/L, 2.5 mg/L, 4 mg/L, or 10 mg/L of AFB1 solutions, twice a day for 2 months. The hypervariable region V3 + V4 on 16S rDNA of intestinal bacterial flora was sequenced by the use of a high-flux sequencing system on a Miseq Illumina platform; then, the obtained sequences were analyzed. The results showed that, when compared with the control group, both genera and phyla of intestinal bacteria in the three treatment groups decreased. About one third of the total genera and one half of the total phyla remained in the high-dose group. The dominant flora were Lactobacillus and Bacteroides in all groups. There were significant differences in the relative abundance of intestinal bacterial flora among groups. Most bacteria decreased as a whole from the control to the high-dose groups, but several beneficial and pathogenic bacterial species increased significantly with increasing dose of AFB1. Thus, the conclusion was that intragastric feeding with 2.5~10 mg/mL AFB1 for 2 months could decrease the majority of intestinal bacterial flora and induce the proliferation of some intestinal bacteria flora.

  3. SoCRocket: A Virtual Platform for SoC Design

    Fossati, Luca; Schuster, Thomas; Meyer, Rolf; Berekovic, Mladen

    2013-08-01

    Both in the commercial and in the aerospace domain, the continuous increase of transistor density on a single die is leading towards the production of more and more complex systems on a single chip, with an increasing number of components. This brought to the introduction of the System-On-Chip (SoC) architecture, that integrates on a single circuit all the elements of a full system. This strive for efficient utilization of the available silicon has triggered several paradigm shifts in system design. Similarly to what happened in the early 1990s, when VHDL and Verilog took over from schematic design, today SystemC and Transaction Level Modeling [1] are about to further raise the design abstraction level. Such descriptions have to be accurate enough to describe the entire system throughout the phases of its development, and has to provide enough flexibility to be refined iteratively up to the point where the actual device can be produced using current process technology. Besides requiring new languages and methodologies, the complexity of current and future SoCs (SCOC3 [16] and NGMP [5] are example in the space domain) forces the SoC design process to rely on pre-designed or third party components. Components obtained from different providers, and even those designed by different teams of the same company, may be heterogeneous on several aspects: design domains, interfaces, abstraction levels, granularity, etc. Therefore, component integration is required at system level. Only by applying design re-use it is possible to successfully and timely design such complex SoCs. This transition to new languages and design methods is also motivated by the implementation with software of an increasing amount of system functionalities. Hence the need for methodologies to enable early software development and which allow the analysis of the performance of the combined Hw/Sw system, as their design and configuration cannot be performed separately. Virtual Prototyping is a key

  4. SOCS3 deficiency in leptin receptor-expressing cells mitigates the development of pregnancy-induced metabolic changes

    Thais T. Zampieri

    2015-03-01

    Conclusions: Our study identified the increased hypothalamic expression of SOCS3 as a key mechanism responsible for triggering pregnancy-induced leptin resistance and metabolic adaptations. These findings not only help to explain a common phenomenon of the mammalian physiology, but it may also aid in the development of approaches to prevent and treat gestational metabolic imbalances.

  5. An OCP Compliant Network Adapter for GALS-based SoC Design Using the MANGO Network-on-Chip

    Bjerregaard, Tobias; Mahadevan, Shankar; Olsen, Rasmus Grøndahl

    2005-01-01

    decouples communication and computation, providing memory-mapped OCP transactions based on primitive message-passing services of the network. Also, it facilitates GALS-type systems, by adapting to the clockless network. This helps leverage a modular SoC design flow. We evaluate performance and cost of 0...

  6. Comparison Study on Two Model-Based Adaptive Algorithms for SOC Estimation of Lithium-Ion Batteries in Electric Vehicles

    Yong Tian

    2014-12-01

    Full Text Available State of charge (SOC estimation is essential to battery management systems in electric vehicles (EVs to ensure the safe operations of batteries and providing drivers with the remaining range of the EVs. A number of estimation algorithms have been developed to get an accurate SOC value because the SOC cannot be directly measured with sensors and is closely related to various factors, such as ambient temperature, current rate and battery aging. In this paper, two model-based adaptive algorithms, including the adaptive unscented Kalman filter (AUKF and adaptive slide mode observer (ASMO are applied and compared in terms of convergence behavior, tracking accuracy, computational cost and estimation robustness against parameter uncertainties of the battery model in SOC estimation. Two typical driving cycles, including the Dynamic Stress Test (DST and New European Driving Cycle (NEDC are applied to evaluate the performance of the two algorithms. Comparison results show that the AUKF has merits in convergence ability and tracking accuracy with an accurate battery model, while the ASMO has lower computational cost and better estimation robustness against parameter uncertainties of the battery model.

  7. Architectures, Concepts and Architectures for Service Oriented Computing : proceedings of the 1st International Workshop - ACT4SOC 2007

    van Sinderen, Marten J.; Unknown, [Unknown

    2007-01-01

    This volume contains the proceedings of the First International Workshop on Architectures, Concepts and Technologies for Service Oriented Computing (ACT4SOC 2007), held on July 22 in Barcelona, Spain, in conjunction with the Second International Conference on Software and Data Technologies (ICSOFT

  8. IL-6 modulates hepatocyte proliferation via induction of HGF/p21cip1: Regulation by SOCS3

    Sun Rui; Jaruga, Barbara; Kulkarni, Shailin; Sun Haoyu; Gao Bin

    2005-01-01

    The precise role of IL-6 in liver regeneration and hepatocyte proliferation is controversial and the role of SOCS3 in liver regeneration remains unknown. Here we show that in vitro treatment with IL-6 inhibited primary mouse hepatocyte proliferation. IL-6 induced p21 cip1 protein expression in primary mouse hepatocytes. Disruption of the p21 cip1 gene abolished the inhibitory effect of IL-6 on cell proliferation. Co-culture with nonparenchymal liver cells diminished IL-6 inhibition of hepatocyte proliferation, which was likely due to IL-6 stimulation of nonparenchymal cells to produce HGF. Finally, IL-6 induced higher levels of p21 cip1 protein expression and a slightly stronger inhibition of cell proliferation in SOCS3 +/- mouse hepatocytes compared to wild-type hepatocytes, while liver regeneration was enhanced and prolonged in SOCS3 +/- mice. Our findings suggest that IL-6 directly inhibits hepatocyte proliferation via a p21 cip1 -dependent mechanism and indirectly enhances hepatocyte proliferation via stimulating nonparenchymal cells to produce HGF. SOCS3 negatively regulates liver regeneration

  9. Approche complète de développement des IPs pour les SoCs A ...

    CoFluent and Quartus II tools have helped us to get the different models. ... Key words : IPs – SoC - Design and Reuse – UML – System C ... nouvelles techniques de conception doivent- .... obtenir un prototype fabriqué et testé. ..... Information Technology and Control, ... A new logic circuit design methodology with UMLl.

  10. Gaining Insights on the H2–Sorbent Interactions: Robust soc-MOF Platform as a Case Study

    Cairns, Amy

    2016-09-18

    We report on the synthesis and gas adsorption properties (i.e., Ar and H2) of four robust 3-periodic metal–organic frameworks (MOFs) having the targeted soc topology. These cationic MOFs are isostructural to the parent indium-based MOF, In-soc-MOF-1a (for NO3–), previously reported by us, and likewise are constructed from the assembly of rigid μ3-oxygen-centered trinuclear metal carboxylate clusters, [M3O(O2C−)6], where M = In3+ or Fe3+. Each inorganic trinuclear molecular building block (MBB), generated in situ, is bridged by six 3,3′,5,5′-azobenzenetetracarboxylate (ABTC4–) ligands to give the extended (4,6)-connected MOF, soc-MOF. In our previous work, we confirmed that the parent soc-MOF, i.e., In-soc-MOF-1a, possesses unique structural characteristics (e.g., vacant In binding sites and narrow pores with higher localized charge density), which led to exceptional hydrogen (H2) storage capabilities. Therefore, charged MOFs with soc topology can be viewed collectively as an ideal prototypical platform to examine the impact of specific structural parameters on H2–MOF interactions via systematic gas adsorption studies. We infer that enhanced binding of molecular H2 is primarily governed by the presence and type of vacant metal centers (i.e., Fe was shown to exhibit stronger H2–MOF interactions at low H2 loading compared to the In analogues). These findings are evident from the associated isosteric heat of adsorption (Qst) at low loadings and inelastic neutron scattering (INS) experiments of the rotational transitions of sorbed H2, as well as, temperature-programmed desorption (TPD) studies (for a select compound). The importance of localized charge density is also highlighted, where the extra-framework nitrate anions in the Fe-soc-MOF-1a (for NO3–) facilitate enhanced binding affinities as compared to the chloride analogue.

  11. Land use changing SOC pool: A field investigation from four catchments on the Loess Plateau in China

    Guo, Shengli; Wang, Rui; Hu, Yaxian

    2017-04-01

    The Loess Plateau in China has long been known for severe erosion, a degraded ecosystem and heavy sediment delivery to the Yellow River. Apart from, the highly erodible loess soil and the hilly geomorphology, intensive cultivation has been caused such most destructive human activities. This made the Loess Plateau once the least fertile region in China with extreme poverty. To restore soil fertility and ecosystem sustainability, a national-level project was launched in 1990s to encourage land use changes via afforestation or conversion of cropland back to grassland or woodland. After nearly three decades of land use conversion, the SOC pool in the soil can be expected to have substantially changed. However, climate conditions, geomorphic types and soil properties were spatially distinctive across the Loess Plateau. Their individual as well interactive impacts on changes of soil carbon pool during land use conversions must thus be properly accounted for. In this study, four watersheds distributed over the Loess Plateau were investigated. The four watersheds mainly consisted of three geomorphic types: wide gully, loess ridge, and round knoll. On each geomorphic feature, three land use types prevailed: cropland, grassland and woodland. In total, 695 soil samples were taken from the top 20 cm of the four watersheds during 2010 and 2011. Our results show: 1) Degrees of erosion hugely differed among the four watersheds, with Catchment A (hilly) having three times more erosion modulus than the least eroded Catchment D (gully) (12000 vs. 1800 Mg per km2 per year). 2) The increasing SOC content from 4 mg g-1 at Catchment A to 8.1 mg g-1 at Catchment D agreed well with their decreasing erosion, suggesting that geomorphology induced erosion history was the predominant factor to set the general level of watershed-scale SOC reservoir. 3) Within each watershed, grassland and woodland consistently had at least 34% more SOC than cropland, demonstrating the influence of land use

  12. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 1: Final report

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  13. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 4, Appendixes E and F: Final report

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  14. Prediction of SOC content by Vis-NIR spectroscopy at European scale using a modified local PLS algorithm

    Nocita, M.; Stevens, A.; Toth, G.; van Wesemael, B.; Montanarella, L.

    2012-12-01

    In the context of global environmental change, the estimation of carbon fluxes between soils and the atmosphere has been the object of a growing number of studies. This has been motivated notably by the possibility to sequester CO2 into soils by increasing the soil organic carbon (SOC) stocks and by the role of SOC in maintaining soil quality. Spatial variability of SOC masks its slow accumulation or depletion, and the sampling density required to detect a change in SOC content is often very high and thus very expensive and labour intensive. Visible near infrared diffuse reflectance spectroscopy (Vis-NIR DRS) has been shown to be a fast, cheap and efficient tool for the prediction of SOC at fine scales. However, when applied to regional or country scales, Vis-NIR DRS did not provide sufficient accuracy as an alternative to standard laboratory soil analysis for SOC monitoring. Under the framework of Land Use/Cover Area Frame Statistical Survey (LUCAS) project of the European Commission's Joint Research Centre (JRC), about 20,000 samples were collected all over European Union. Soil samples were analyzed for several physical and chemical parameters, and scanned with a Vis-NIR spectrometer in the same laboratory. The scope of our research was to predict SOC content at European scale using LUCAS spectral library. We implemented a modified local partial least square regression (l-PLS) including, in addition to spectral distance, other potentially useful covariates (geography, texture, etc.) to select for each unknown sample a group of predicting neighbours. The dataset was split in mineral soils under cropland, mineral soils under grassland, mineral soils under woodland, and organic soils due to the extremely diverse spectral response of the four classes. Four every class training (70%) and test (30%) sets were created to calibrate and validate the SOC prediction models. The results showed very good prediction ability for mineral soils under cropland and mineral soils

  15. Plant growth controls short-term changes in soil organic carbon (SOC) stocks of croplands - new insights from the CarboZALF experiment

    Hoffmann, Mathias; Jurisch, Nicole; Garcia Alba, Joana; Albiac Borraz, Elisa; Schmidt, Marten; Verch, Gernot; Sommer, Michael; Augustin, Jürgen

    2016-04-01

    The long-term influence of crop rotations, climate conditions or soil type on soil organic carbon stock (SOC) patterns and gaseous C emissions of agricultural landscapes is widely recognized. However, the question of short-term seasonal changes in SOC within these areas remains unclear. A main reason for this is the detection problem of temporal and spatial variability in gaseous C exchange and thus, changes in SOC stocks (ΔSOC) in a high resolution. This study introduces dynamic C balances as a method to obtain seasonal changes in SOC stocks. Dynamic C balances were calculated by a combination of automatic chamber CO2 exchange measurements and empirical biomass models. Measurements were performed for three consecutive years at a colluvial depression (Colluvic Regosol) in the hummocky ground moraine landscape of NE Germany (CarboZALF experimental site). The investigated crop rotation was maize, winter fodder rye, maize, winter fodder rye, and sudangrass. The site is characterized by a gradient in ground water level (GWL) and related spatial heterogeneity in soil properties, such as SOC as well as soil nitrogen (Nt) stocks. Modelled dynamic C balances reveal that up to 79% of the standard deviation of estimated annual ΔSOC between single chambers emerged during the main period of crop growth (three months in summer). No significant changes in ΔSOC were detected outside the growing season. Instead, differences between chambers remain constant despite ΔSOC dynamics. Environmental variables (Nt stocks of Ap horizon and GWL), affecting plant-mediated C sequestration, explained up to 95% of temporal and spatial variability in CO2 exchange and ΔSOC. Thus, plant activities were the major catalyst for small scale differences in annual ΔSOC of croplands.

  16. Overexpression of DOSOC1, an ortholog of Arabidopsis SOC1, promotes flowering in the orchid Dendrobium Chao Parya Smile.

    Ding, Lihua; Wang, Yanwen; Yu, Hao

    2013-04-01

    SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 (SOC1) encodes a MADS-box protein that plays an essential role in integrating multiple flowering signals to regulate the transition from vegetative to reproductive development in the model plant Arabidopsis. Although SOC1-like genes have been isolated in various angiosperms, its orthologs in Orchidaceae, one of the largest families of flowering plants, are so far unknown. To investigate the regulatory mechanisms of flowering time control in orchids, we isolated a SOC1-like gene, DOSOC1, from Dendrobium Chao Praya Smile. DOSOC1 was highly expressed in reproductive organs, including inflorescence apices, pedicels, floral buds and open flowers. Its expression significantly increased in whole plantlets during the transition from vegetative to reproductive development, which usually occurred after 8 weeks of culture in Dendrobium Chao Praya Smile. In the shoot apex at the floral transitional stage, DOSOC1 was particularly expressed in emerging floral meristems. Overexpression of DOSOC1 in wild-type Arabidopsis plants resulted in early flowering, which was coupled with the up-regulation of two other flowering promoters, AGAMOUS-LIKE 24 and LEAFY. In addition, overexpression of DOSOC1 was able partially to complement the late-flowering phenotype of Arabidopsis soc1-2 loss-of-function mutants. Furthermore, we successfully created seven 35S:DOSOC1 transgenic Dendrobium orchid lines, which consistently exhibited earlier flowering than wild-type orchids. Our results suggest that SOC1-like genes play an evolutionarily conserved role in promoting flowering in the Orchidaceae family, and that DOSOC1 isolated from Dendrobium Chao Praya Smile could serve as an important target for genetic manipulation of flowering time in orchids.

  17. Co-verification of hardware and software for ARM SoC design

    Andrews, Jason

    2004-01-01

    Hardware/software co-verification is how to make sure that embedded system software works correctly with the hardware, and that the hardware has been properly designed to run the software successfully -before large sums are spent on prototypes or manufacturing. This is the first book to apply this verification technique to the rapidly growing field of embedded systems-on-a-chip(SoC). As traditional embedded system design evolves into single-chip design, embedded engineers must be armed with the necessary information to make educated decisions about which tools and methodology to deploy. SoC verification requires a mix of expertise from the disciplines of microprocessor and computer architecture, logic design and simulation, and C and Assembly language embedded software. Until now, the relevant information on how it all fits together has not been available. Andrews, a recognized expert, provides in-depth information about how co-verification really works, how to be successful using it, and pitfalls to avoid. H...

  18. Technology-design-manufacturing co-optimization for advanced mobile SoCs

    Yang, Da; Gan, Chock; Chidambaram, P. R.; Nallapadi, Giri; Zhu, John; Song, S. C.; Xu, Jeff; Yeap, Geoffrey

    2014-03-01

    How to maintain the Moore's Law scaling beyond the 193 immersion resolution limit is the key question semiconductor industry needs to answer in the near future. Process complexity will undoubtfully increase for 14nm node and beyond, which brings both challenges and opportunities for technology development. A vertically integrated design-technologymanufacturing co-optimization flow is desired to better address the complicated issues new process changes bring. In recent years smart mobile wireless devices have been the fastest growing consumer electronics market. Advanced mobile devices such as smartphones are complex systems with the overriding objective of providing the best userexperience value by harnessing all the technology innovations. Most critical system drivers are better system performance/power efficiency, cost effectiveness, and smaller form factors, which, in turns, drive the need of system design and solution with More-than-Moore innovations. Mobile system-on-chips (SoCs) has become the leading driver for semiconductor technology definition and manufacturing. Here we highlight how the co-optimization strategy influenced architecture, device/circuit, process technology and package, in the face of growing process cost/complexity and variability as well as design rule restrictions.

  19. Implementation of SoC Based Real-Time Electromagnetic Transient Simulator

    I. Herrera-Leandro

    2017-01-01

    Full Text Available Real-time electromagnetic transient simulators are important tools in the design stage of new control and protection systems for power systems. Real-time simulators are used to test and stress new devices under similar conditions that the device will deal with in a real network with the purpose of finding errors and bugs in the design. The computation of an electromagnetic transient is complex and computationally demanding, due to features such as the speed of the phenomenon, the size of the network, and the presence of time variant and nonlinear elements in the network. In this work, the development of a SoC based real-time and also offline electromagnetic transient simulator is presented. In the design, the required performance is met from two sides, (a using a technique to split the power system into smaller subsystems, which allows parallelizing the algorithm, and (b with specialized and parallel hardware designed to boost the solution flow. The results of this work have shown that for the proposed case studies, based on a balanced distribution of the node of subsystems, the proposed approach has decreased the total simulation time by up to 99 times compared with the classical approach running on a single high performance 32-bit embedded processor ARM-Cortex A9.

  20. An Elongin-Cullin-SOCS Box Complex Regulates Stress-Induced Serotonergic Neuromodulation

    Xicotencatl Gracida

    2017-12-01

    Full Text Available Neuromodulatory cells transduce environmental information into long-lasting behavioral responses. However, the mechanisms governing how neuronal cells influence behavioral plasticity are difficult to characterize. Here, we adapted the translating ribosome affinity purification (TRAP approach in C. elegans to profile ribosome-associated mRNAs from three major tissues and the neuromodulatory dopaminergic and serotonergic cells. We identified elc-2, an Elongin C ortholog, specifically expressed in stress-sensing amphid neuron dual ciliated sensory ending (ADF serotonergic sensory neurons, and we found that it plays a role in mediating a long-lasting change in serotonin-dependent feeding behavior induced by heat stress. We demonstrate that ELC-2 and the von Hippel-Lindau protein VHL-1, components of an Elongin-Cullin-SOCS box (ECS E3 ubiquitin ligase, modulate this behavior after experiencing stress. Also, heat stress induces a transient redistribution of ELC-2, becoming more nuclearly enriched. Together, our results demonstrate dynamic regulation of an E3 ligase and a role for an ECS complex in neuromodulation and control of lasting behavioral states.

  1. Transformación de la aflatoxina B1 de alimentos, en el cancerígeno humano, aducto AFB1-ADN

    Magda Carvajal

    2013-01-01

    Full Text Available Las aflatoxinas (AF son metabolitos secundarios tóxicos principalmente de los hongos Aspergillus flavus y A. parasiticus, son potentes mutágenos y cancerígenos de alimentos y la exposición del hombre a ellas es continuo. Las AF se ligan al ADN, ARN y proteínas formando aductos AFB1-ADN que se acumulan por años y dañan desde los virus hasta el hombre. Es importante identificar y cuantificar estos aductos como biomarcadores de largo tiempo de riesgo de enfermedad, ya que originan mutaciones y cáncer, y están validados en animales y humanos. Las AF se activan en presencia del citocromo P450 como una molécula inestable 8,9 epóxido AFB1, que se liga al N7 de la guanina, y se transforma en los cancerígenos activos o aductos AFB1-Gua y, finalmente, en los aductos AFB1-FAPY y son una medida objetiva de la exposición humana a cancerígenos ambientales. Los aductos representan la exposición, absorción, distribución, metabolismo, reparación del ADN y cambio celular. Los temas tratados aquí son la formación de aductos AFB1-ADN, estudios in vitro e in vivo, exposición a una dieta con AFB1, efectos, desarrollo de cáncer y mutaciones en el gen supresor p53, rutas de exposición, vitaminas, tipos de aducto AFB1-ADN, metodología y su control.

  2. The ubiquitin ligase Cullin5SOCS2 regulates NDR1/STK38 stability and NF-κB transactivation

    Paul, Indranil; Batth, Tanveer S; Iglesias-Gato, Diego

    2017-01-01

    SOCS2 is a pleiotropic E3 ligase. Its deficiency is associated with gigantism and organismal lethality upon inflammatory challenge. However, mechanistic understanding of SOCS2 function is dismal due to our unawareness of its protein substrates. We performed a mass spectrometry based proteomic pro...

  3. Protein Interaction Screening for the Ankyrin Repeats and Suppressor of Cytokine Signaling (SOCS) Box (ASB) Family Identify Asb11 as a Novel Endoplasmic Reticulum Resident Ubiquitin Ligase

    Andresen, Christina Aaen; Smedegaard, Stine; Sylvestersen, Kathrine Beck

    2014-01-01

    The Ankyrin and SOCS (Suppressor of Cytokine Signaling) box (ASB) family of proteins function as the substrate recognition subunit in a subset of Elongin-Cullin-SOCS (ECS) E3 ubiquitin ligases. Despite counting with 18 members in humans, the identity of the physiological targets of the Asb protei...

  4. LCM-seq reveals the crucial role of LsSOC1 in heat-promoted bolting of lettuce (Lactuca sativa L.).

    Chen, Zijing; Zhao, Wensheng; Ge, Danfeng; Han, Yingyan; Ning, Kang; Luo, Chen; Wang, Shenglin; Liu, Renyi; Zhang, Xiaolan; Wang, Qian

    2018-05-17

    Lettuce (Lactuca sativa L.) is one of the most economically important vegetables. The floral transition in lettuce is accelerated under high temperatures, which can significantly decrease yields. However, the molecular mechanism underlying the floral tranition in lettuce is poorly known. Using laser capture microdissection coupled with RNA sequencing, we isolated shoot apical meristem cells from the bolting-sensitive lettuce line S39 at four critical stages of development. Subsequently, we screened specifically for the flowering-related gene LsSOC1 during the floral transition through comparative transcriptomic analysis. Molecular biology, developmental biology, and biochemical tools were combined to investigate the biological function of LsSOC1 in lettuce. LsSOC1 knockdown by RNA interference resulted in a significant delay in the timing of bolting and insensitivity to high temperature, which indicated that LsSOC1 functions as an activator during heat-promoted bolting in lettuce. We determined that two heat-shock transcription factors, HsfA1e and HsfA4c, bound to the promoter of LsSOC1 to confirm that LsSOC1 played an important role in heat-promoted bolting. This study indicates that LsSOC1 plays a crucial role in the heat-promoted bolting process in lettuce. Further investigation of LsSOC1 may be useful for clarification of the bolting mechanism in lettuce. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  5. Comments on "Precise model measurements versus theoretical prediction of barrier insertion loss in presence of the ground" [J. Acoust. Soc. Am. 73, 44–54 (1983)

    Rasmussen, Karsten Bo

    1983-01-01

    Some of the theoretical curves in the article by J. Nicolas et al. [J. Acoust. soc. Am. 73, 44–54 (1983)] appear to be erroneous.......Some of the theoretical curves in the article by J. Nicolas et al. [J. Acoust. soc. Am. 73, 44–54 (1983)] appear to be erroneous....

  6. Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L)

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango (Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5′ UTR and a 189 bp long 3′ UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems’ leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue –specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis. In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango. PMID:27965680

  7. Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L).

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango ( Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5' UTR and a 189 bp long 3' UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems' leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue -specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis . In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango.

  8. AFRL Materials and Manufacturing Directorate

    Flight Wright-Patterson Medical Clinic Contact Us Search Wright-Patterson Air Force Base: AFRL Logo AFRL follow in footsteps of legendary WWII flight nurse New satellite communication technology positioned for commanders with new decision making tools Public Health Education Division: Educating to Protect AFRL ENSPIRE

  9. Evaluation of bromide mass discharge in a sandy aquifer at Vandenberg AFB, CA

    Mackay, D. M.; Rasa, E.; Einarson, M.; Kaiser, P.; Chakraborty, I.; Scow, K. M.

    2009-12-01

    Side-by-side experiments were conducted by UC Davis research team at a former fuel station at Vandenberg Air Force Base (AFB) to evaluate the rate of transformation of methyl tert-butyl ether (MTBE) to tert-butyl alcohol (TBA) impacted by ethanol and to investigate evidence of TBA degradation under sulfate reducing conditions. On one side we injected groundwater amended with ethanol and MTBE. In the other lane we injected groundwater amended with TBA. On both sides, injected ground water was spiked with bromide tracer to provide estimates of groundwater flow direction variations, flow velocity, dispersion, and mobile mass loss resulting from diffusive sequestration into aquitards. 162 monitoring wells were aligned into seven transects located downgradient of the injection wells. The mass discharge approach was used to evaluate the natural attenuation of the injected constituents. In this talk we will focus on calculations of mass discharge of the bromide tracer at each of the seven monitoring well transects. The amount of bromide mass discharged through each transect was calculated for any sampling time using field measurements of break through curves. Cumulative mass discharges were estimated and, by iteration based on mass balance, the flow properties of the aquifer were estimated. The calibration process resulted in subtle but quantitatively important changes in our assumptions regarding key physical properties of the aquifer (thickness, porosity) which could be only approximately estimated by standard methods (coring, CPT, etc.). On the basis of this calibration, a more robust approach was devised for evaluating the source and fate of TBA in the aquifer.

  10. Soc para la identificación de variaciones morfológicas del eritrocito

    Danelia Matos Molina

    2011-03-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 st1:*{behavior:url(#ieooui } /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabla normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} En el presente se expone el diseño e implementación de un Sistema on Chip apropiado para el procesamiento de señales e imágenes. Este sistema puede representar parte importante en dispositivos médicos de apoyo en el diagnóstico de ciertas  enfermedades donde ocurran variaciones morfológicas en los eritrocitos, como es el caso de la Siklemia. El diseño está basado en un SoC de Plasma y un procesador MIPS Lite, se ha añadido además un núcleo FFT para el mejoramiento de los cálculos de la Transformada discreta de Fourier. Igualmente ha sido desarrollado un programa que calcula dada una imagen, la FFT de los bordes de los eritrocitos presentes.

  11. EVERYTHING MOVES NOTHING STANDS STILL. SOME ASPECTS ABOUT THE MEGASYSTEM EARTH ECO-SOC-ECO

    Negucioiu Aurel

    2012-12-01

    Full Text Available One of the most important moments of the start or restart of the academic activity has always been the opening of courses in each subject (discipline that would be studied. On these occasions each professor shows to the students the subject of the discipline, place and role that intellectual seizure of that object in the formation of their professional competence required by the exigencies of the time. Most teachers stop on the most important sources, sources of knowledge that young learners can turn to and would be better to turn. They indicate written sources, books, magazines and other publications available in classical libraries and add, especially now, the world’s largest library: the Internet. However, teachers advise students to seek permanently another source, a "book" - permanently opened, the book of reality that contains the most truth and what is very important - many problems waiting to be discovered and resolved. Leafing over "the first pages" of one of the "volumes" of this huge established "book", I found that the paradigm "Everything moves. Nothing stands still" as the paradigm "movement is absolute, and the repose - roughly" is far from having exhausted full knowledge of "everything". But knowledge can enrich through investigation of the unknown aspects. Substantially reducing the size of the unknown we have subscribed to communicate, stopping on several sides and objectives of the issues: Further examination of the main contents of the concept of development; Nominate a limited number of forms of movement in the "kingdom" of the Megasystem Eco-soc-eco; Further investigation of the causes of motion; Pace to and rhythm in which the different forms of movement develop; Which are the directions in which evolve different directions of movement forms.

  12. Perception SoC Based on an Ultrasonic Array of Sensors: Efficient DSP Core Implementation and Subsequent Experimental Results

    A. Haidar

    2005-05-01

    Full Text Available We are concerned with the design, implementation, and validation of a perception SoC based on an ultrasonic array of sensors. The proposed SoC is dedicated to ultrasonic echography applications. A rapid prototyping platform is used to implement and validate the new architecture of the digital signal processing (DSP core. The proposed DSP core efficiently integrates all of the necessary ultrasonic B-mode processing modules. It includes digital beamforming, quadrature demodulation of RF signals, digital filtering, and envelope detection of the received signals. This system handles 128 scan lines and 6400 samples per scan line with a 90° angle of view span. The design uses a minimum size lookup memory to store the initial scan information. Rapid prototyping using an ARM/FPGA combination is used to validate the operation of the described system. This system offers significant advantages of portability and a rapid time to market.

  13. Perception SoC Based on an Ultrasonic Array of Sensors: Efficient DSP Core Implementation and Subsequent Experimental Results

    Kassem, A.; Sawan, M.; Boukadoum, M.; Haidar, A.

    2005-12-01

    We are concerned with the design, implementation, and validation of a perception SoC based on an ultrasonic array of sensors. The proposed SoC is dedicated to ultrasonic echography applications. A rapid prototyping platform is used to implement and validate the new architecture of the digital signal processing (DSP) core. The proposed DSP core efficiently integrates all of the necessary ultrasonic B-mode processing modules. It includes digital beamforming, quadrature demodulation of RF signals, digital filtering, and envelope detection of the received signals. This system handles 128 scan lines and 6400 samples per scan line with a[InlineEquation not available: see fulltext.] angle of view span. The design uses a minimum size lookup memory to store the initial scan information. Rapid prototyping using an ARM/FPGA combination is used to validate the operation of the described system. This system offers significant advantages of portability and a rapid time to market.

  14. Frequency of sputum positive AFB cases among patients of pulmonary tuberculosis in tertiary care hospitals of northern Pakistan

    Khattak, M.I.; Zaman, M.; Ihsanullah; Muhammad, A.; Khan, N.

    2010-01-01

    Objective: This study was aimed to find out the frequency of sputum positive Acid Fast Bacilli (AFB) cases among pulmonary tuberculosis patients and to determine those patients who are the potential source of transmitting infection. Methods: This study was conducted in four medical units of Khyber Teaching Hospital, Peshawar and Chest Unit, Ayub Teaching Hospital, Abbottabad in collaboration with the pathology unit of Khyber Teaching Hospital, Peshawar, and Kohat Institute of Medical Sciences, Kohat. Three specimens of sputum were collected for three consecutive days in the morning and were transported immediately to the laboratory along with full details of the patients. Results: Out of two hundred total patients studied, 104 patients (52%) were sputum AFB positive. Among the 104 patients 60 patients (57.4%) were females. Sixty-four (61.52%) individuals were between 20-50 years. Majority of the patients were from poor, deprived and lower social class. Fifty-two (50%) patients had monthly income of less than Rs. 4,000; only 8 patients (7.67%) had monthly income of more than Rs. 12,000). Forty-eight patients <46.12% were house wives, 10 patients (9.61%) were unemployed. Most of the patients were under weight for their age and height. 24 patients (23.06%) were below 42 kg. The maximum (53.84%) number of patients was in weight range of 43-50 kg. Conclusion: Sputum AFB positive pulmonary tuberculosis is more in individuals of low socioeconomic group and in females. The patients put their children and family members at risk of tuberculosis infection. For the control of this disease early diagnosis of active disease and their treatment under supervision is important. (author)

  15. The effect of interferon treatment on STAT/SOCS status in normal and malignant human breast cells

    Součková Skalická, Kamila; Adámková, L.; Lauerová, L.; Krejčí, E.; Kovařík, Aleš; Fojtová, Miloslava; Matoušková, Eva; Buršíková, Eva; Kovařík, J.; Boudný, V.

    2006-01-01

    Roč. 17, č. 9 (2006), ix65-ix65 ISSN 0923-7534. [31st ESMO Congress. 29.09.2006-03.10.2006, Istanbul] R&D Projects: GA MZd(CZ) NR8341; GA ČR(CZ) GA301/06/0912; GA AV ČR(CZ) KJB502070601 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50520514 Keywords : interferon * breast * STAT/SOCS Subject RIV: BO - Biophysics

  16. Highly monodisperse M III-based soc -MOFs (M = in and Ga) with cubic and truncated cubic morphologies

    Pang, Maolin

    2012-08-15

    In this work, we carry out an investigation on shape-controlled growth of In III- and Ga III-based square-octahedral metal-organic frameworks (soc-MOFs). In particular, controllable crystal morphological evolution from simple cubes to complex octadecahedra has been achieved, and resultant highly uniform crystal building blocks promise new research opportunities for preparation of self-assembled MOF materials and related applications. © 2012 American Chemical Society.

  17. Inducibility of STAT 1/SOCS 3 transcripts and proteins by interferon-alpha/gamma in human melanoma cell lines

    Kovařík, Aleš; Fojtová, Miloslava; Boudný, V.; Adamková, L.; Kovařík, J.

    2004-01-01

    Roč. 14, Suppl. 1 (2004), s. S87 ISSN 1107-3756. [World Congress on Advances in Oncology /9./ and International Symposium on Molecular Medicine /7./. 14.10.2004-16.10.2004, Hersonissos] R&D Projects: GA MZd NC7139; GA ČR GA301/03/0370; GA AV ČR IBS5004010 Keywords : melanoma cells * STAT 1 * SOCS 3 Subject RIV: BO - Biophysics

  18. Highly monodisperse M III-based soc -MOFs (M = in and Ga) with cubic and truncated cubic morphologies

    Pang, Maolin; Cairns, Amy; Liu, Yunling; Belmabkhout, Youssef; Zeng, Huachun; Eddaoudi, Mohamed

    2012-01-01

    In this work, we carry out an investigation on shape-controlled growth of In III- and Ga III-based square-octahedral metal-organic frameworks (soc-MOFs). In particular, controllable crystal morphological evolution from simple cubes to complex octadecahedra has been achieved, and resultant highly uniform crystal building blocks promise new research opportunities for preparation of self-assembled MOF materials and related applications. © 2012 American Chemical Society.

  19. Combined action of taurine and cations of certain metals on post-irradiation survival of SOC cell culture

    Yartsev, E.I.; Aldonyasov, V.I.; Yakovlev, V.G.

    1975-01-01

    Effects of combined application of taurine and metals (potassium, magnesium, calcium and zinc) on the cell level have been studied. It has been found that various concentrations of taurine and potassium and zinc salts increase the survival of irradiated SOC cells up to 40% while addition of magnesium and calcium salts does not affect the taurine effectiveness. The highest effectiveness is obtained when potassium and taurine are added in equimolar amounts to the incubation medium

  20. Pope AFB, Fayetteville, North Carolina Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    1984-06-01

    SERVICE/HAC T23030 POPE AFB NC 7[-81111 STAT ION STATION lNA&Ayl MSSgll’ TemN. WIT SULS TEMPERATURE DEPRESSIO (F) TOTAL TOTAL (F) 0 1.2 3 - 5 - 1- 19...STATINASha T PAGE 1 TWET BULB TEMPERATURE DEPRESSIO (F) TOTAL TOTAL * (F) 0 1.2 3-4 3-6 7-8 9.10 11-12113-14 15.16 17-1 19-.20 21.22123-24 25.2627.3 29.n 30 l

  1. Use of 'sense of coherence (SOC)' scale to measure resilience in Eritrea: interrogating both the data and the scale.

    Almedom, Astier M; Tesfamichael, Berhe; Saeed Mohammed, Zein; Mascie-Taylor, C G N; Alemu, Zemui

    2007-01-01

    An adapted 'sense of coherence' scale short form (SOC-13) was administered in nine languages of Eritrea with a total of 265 participants (162 women and 103 men) in order to assess 'resilience' in quantitative terms. Statistical analysis yielded significant differences in SOC scores between the displaced and non-displaced: mean=54.84 (SD=6.48) in internally displaced person (IDP) camps, compared with mean=48.94 (SD=11.99) in urban and rural settlements (t=3.831, purban (non-displaced) residents. Those in rural but traditionally mobile (pastoralist or transhumant) communities scored more or less the same as the urban non-displaced - i.e. significantly higher than those in IDP camps (purban and pastoralist/transhumant groups are similar, while women in IDP camps are lower scoring (RR=0.268, p<0.001), Hamboka women being worst affected due to their experience of serial displacement. These findings are interpreted and discussed in the light of qualitative information gleaned from the study participants' interrogation of the content of the SOC scale; and in the wider context of historical, socio-political and cultural characteristics of Eritrea. The study's implications for humanitarian and public health policy are considered.

  2. Assessment of LabSOCS as a tool for the calculation of self-attenuation coefficients in gamma spectrometry

    Lopes, J.; De Medeiros, M. P.; Garcez, R.; Filgueiras, R.; Thalhofer, J.; Da Silva, A. X. [Universidade Federal do Rio de Janeiro, Programa de Engenharia Nuclear, Av. Horacio Macedo 2030, 21945-970 Rio de Janeiro (Brazil); Freitas R, W., E-mail: marqueslopez@yahoo.com.br [Instituto Militar de Engenharia, Secao de Engenharia Nuclear, Praca Gen. Tiburcio 80, 22290-270 Urca, Rio de Janeiro (Brazil)

    2017-10-15

    In spectrometry, the self-attenuation coefficients are fundamental to correct the efficiency of the detection of samples whose density is different from the radioactive standard. To facilitate the procedure of coefficient calculation, mathematical simulations have been widespread as a tool. In this paper, LabSOCS was used to calculate the self-attenuation coefficients for some geometries and the values found were compared to those obtained with MCNPX and experimental values. The percentage deviations found for the self-attenuation coefficient calculated by LabSOCS were below 1.6%, when compared to experimental values. In the extrapolation zone of the fitting curve of the experimental model, the deviations were below 1.9%. The results obtained show that the deviations increase proportionally to the amplitude between the density values of the radioactive standard and the sample. High percentage deviations were also obtained in simulations whose samples had high densities, complex geometries and low energy levels. However, the results indicate that LabSOCS is a tool which may be used in the calculation of self-attenuation coefficients. (Author)

  3. Implementation of QoSS (Quality-of-Security Service) for NoC-Based SoC Protection

    Sepúlveda, Johanna; Pires, Ricardo; Strum, Marius; Chau, Wang Jiang

    Many of the current electronic systems embedded in a SoC (System-on-Chip) are used to capture, store, manipulate and access critical data, as well as to perform other key functions. In such a scenario, security is considered as an important issue. The Network-on-chip (NoC), as the foreseen communication structure of next-generation SoC devices, can be used to efficiently incorporate security. Our work proposes the implementation of QoSS (Quality of Security Service) to overcome present SoC vulnerabilities. QoSS is a novel concept for data protection that introduces security as a dimension of QoS. In this paper, we present the implementation of two security services (access control and authentication), that may be configured to assume one from several possible levels, the implementation of a technique to avoid denial-of-service (DoS) attacks, evaluate their effectiveness and estimate their impact on NoC performance.

  4. System on chip (SoC) microcontrollers (μC) as digitisers for ion beam analysis (IBA) instruments

    Whitlow, Harry J., E-mail: harry.j@whitlow.se

    2016-09-15

    Data digitisation of the analogue signals from detectors to digital data is an essential process in ion beam analysis (IBA). The low-cost, easy availability and development environments that have a low learning threshold makes system-on-chip (SoC) microcontrollers (μC) attractive for this task. These μC combine, on one die, analogue and digital inputs and outputs with serial USB interfaces, which opens up simple implementation of tailor-made interfaces for specific IBA measurement systems. We have investigated the design and performance limitations based on development of three different digitisation interfaces for IBA. These were a two-channel nuclear instrumentation module (NIM) ADC event mode interface (EMI) for a high-resolution magnetic RBS spectrometer, a simple headless-multi-channel analyser (MCA) and a combined dual channel headless MCA and EMI. It is shown that SoC μC based interfaces for digitisation of analogue spectroscopy pulses in IBA systems can be implemented for material costs less than 100 €. The performance of the SoC devices for many IBA applications is close to what can be achieved with state-of-the-art instruments. The simple pulse spectroscopy interface circuit and software are included in the auxiliary archive.

  5. LOSS OF JAK2 REGULATION VIA VHL-SOCS1 E3 UBIQUITIN HETEROCOMPLEX UNDERLIES CHUVASH POLYCYTHEMIA

    Russell, Ryan C.; Sufan, Roxana I.; Zhou, Bing; Heir, Pardeep; Bunda, Severa; Sybingco, Stephanie S.; Greer, Samantha N.; Roche, Olga; Heathcote, Samuel A.; Chow, Vinca W.K.; Boba, Lukasz M.; Richmond, Terri D.; Hickey, Michele M.; Barber, Dwayne L.; Cheresh, David A.; Simon, M. Celeste; Irwin, Meredith S.; Kim, William Y.; Ohh, Michael

    2011-01-01

    SUMMARY Chuvash polycythemia (CP) is a rare congenital form of polycythemia caused by homozygous R200W and H191D mutations in the von Hippel-Lindau (VHL) gene whose gene product is the principal negative regulator of hypoxia-inducible factor. However, the molecular mechanisms underlying some of the hallmark features of CP such as hypersensitivity to erythropoietin are unclear. Here, we show that VHL directly binds suppressor of cytokine signalling 1 (SOCS1) to form a heterodimeric E3 ligase that targets phosphorylated (p)JAK2 for ubiquitin-mediated destruction. In contrast, CP-associated VHL mutants have altered affinity for SOCS1 and fail to engage and degrade pJAK2. Systemic administration of a highly selective JAK2 inhibitor, TG101209, reverses the disease phenotype in vhlR200W/R200W knock-in mice, a model that faithfully recapitulates human CP. These results reveal VHL as a SOCS1-cooperative negative regulator of JAK2 and provide compelling biochemical and preclinical evidence for JAK2- targeted therapy in CP patients. PMID:21685897

  6. Rapid Development of System-on-Chip (SoC for Network-Enabled Visible Light Communications

    Trio Adiono

    2018-03-01

    Full Text Available Visible Light Communication (VLC is an emerging optical communication technology with rapid development nowadays. VLC is considered as a compliment and successor of radio-frequency (RF wireless communication. There are various typical implementations of VLC in which one of them is for exchanging data TCP/IP packets, thus the user can browse the internet as in established Wireless fidelity (Wi-Fi technology. Briefly, we can call it by Light fidelity (Li-Fi. This paper described the design and implementation of System-on-Chip (SoC subsystem for Li-Fi application where the implemented SoC consists of hardware (H/W and software (S/W. In the H/W aspect, Physical Layer (PHY is made by using UART communication with Ethernet connection to communicate with Host/Device personal-computer (PC. In the S/W aspect, Xillinux operating system (OS is used. The H/W- as well as S/W-SoC, are realized in FPGA Zybo Zynq-7000 EPP development board. The functional test result shows (without optical channel or Zybo-to-Zybo only that the implemented SoC is working as expected. It is able to exchange TCP/IP packets between two PCs. Moreover, Ethernet connection has bandwidth up to 83.6 Mbps and PHY layer baud rate has bandwidth up to 921600 bps.

  7. SOCS3 Expression Correlates with Severity of Inflammation, Expression of Proinflammatory Cytokines, and Activation of STAT3 and p38 MAPK in LPS-Induced Inflammation In Vivo

    João Antônio Chaves de Souza

    2013-01-01

    Full Text Available SOCS3 is an inducible endogenous negative regulator of JAK/STAT pathway, which is relevant in inflammatory conditions. We used a model of LPS-induced periodontal disease in rats to correlate SOCS3 expression with the inflammatory status. In vitro we used a murine macrophage cell line to assess the physical interaction between SOCS3 and STAT3 by coimmunoprecipitation. 30 ug of LPS from Escherichia coli were injected in the gingival tissues on the palatal aspect of first molars of the animals 3x/week for up to 4 weeks. Control animals were injected with the vehicle (PBS. The rats were sacrificed at 7, 15, and 30 days. Inflammation and gene expression were assessed by stereometric analysis, immunohistochemistry, RT-qPCR, and western blot. LPS injections increased inflammation, paralleled by an upregulation of SOCS3, of the proinflammatory cytokines IL-1β, IL-6, and TNF-α and increased phosphorylation of STAT3 and p38 MAPK. SOCS3 expression accompanied the severity of inflammation and the expression of proinflammatory cytokines, as well as the activation status of STAT3 and p38 MAPK. LPS stimulation in a macrophage cell line in vitro induced transient STAT3 activation, which was inversely correlated with a dynamic physical interaction with SOCS3, suggesting that this may be a mechanism for SOCS3 regulatory function.

  8. Induction of CML28-specific cytotoxic T cell responses using co-transfected dendritic cells with CML28 DNA vaccine and SOCS1 small interfering RNA expression vector

    Zhou Hongsheng; Zhang Donghua; Wang Yaya; Dai Ming; Zhang Lu; Liu Wenli; Liu Dan; Tan Huo; Huang Zhenqian

    2006-01-01

    CML28 is an attractive target for antigen-specific immunotherapy. SOCS1 represents an inhibitory control mechanism for DC antigen presentation and the magnitude of adaptive immunity. In this study, we evaluated the potential for inducing CML28-specific cytotoxic T lymphocytes (CTL) responses by dendritic cells (DCs)-based vaccination. We constructed a CML28 DNA vaccine and a SOCS1 siRNA vector and then cotransfect monocyte-derived DCs. Flow cytometry analysis showed gene silencing of SOCS1 resulted in higher expressions of costimulative moleculars in DCs. Mixed lymphocyte reaction (MLR) indicated downregulation of SOCS1 stronger capability to stimulate proliferation of responder cell in DCs. The CTL assay revealed transfected DCs effectively induced autologous CML28-specific CTL responses and the lytic activities induced by SOCS1-silenced DCs were significantly higher compared with those induced by SOCS1-expressing DCs. These results in our study indicates gene silencing of SOCS1 remarkably enhanced the cytotoxicity efficiency of CML28 DNA vaccine in DCs

  9. MOF Crystal Chemistry Paving the Way to Gas Storage Needs: Aluminum Based soc-MOF for CH4, O2 and CO2 Storage

    Alezi, Dalal

    2015-09-28

    The molecular building block approach was employed effectively to construct a series of novel isoreticular, highly porous and stable, aluminum based Metal-Organic Frameworks with soc topology. From this platform, three compounds were experimentally isolated and fully characterized, namely, the parent Al-soc-MOF-1 and its naphthalene and anthracene analogues. Al-soc-MOF-1 exhibits outstanding gravimetric methane uptake (total and working capacity). It is shown experimentally, for the first time, that the Al-soc-MOF platform can address the challenging Department of Energy dual target of 0.5 g/g (gravimetric) and 264 cm3 (STP)/cm3 (volumetric) methane storage. Furthermore, Al-soc-MOF exhibited the highest total gravimetric and volumetric uptake for carbon dioxide and the utmost total and deliverable uptake for oxygen at relatively high pressures among all microporous MOFs. In order to correlate the MOF pore structure and functionality to the gas storage properties, to better understand the structure-properties relationship, we performed a molecular simulation study and evaluated the methane storage performance of Al-soc-MOF platform using diverse organic linkers. It was found that shortening the parent Al-soc-MOF-1 linker resulted in a noticeable enhancement in the working volumetric capacity at specific temperatures and pressures with amply conserved gravimetric uptake/working capacity. In contrast, further expansion of the organic linker (branches and/or core) led to isostructural Al-soc-MOFs with enhanced gravimetric uptake but noticeably lower volumetric capacity. The collective experimental and simulation studies indicated that the parent Al-soc-MOF-1 exhibits the best compromise between the volumetric and gravimetric total and working uptakes in a wide range of pressure and temperature conditions.

  10. MOF Crystal Chemistry Paving the Way to Gas Storage Needs: Aluminum Based soc-MOF for CH4, O2 and CO2 Storage

    Alezi, Dalal; Belmabkhout, Youssef; Suetin, Mikhail; Bhatt, Prashant; Weselinski, Lukasz Jan; Solovyeva, Vera; Adil, Karim; Spanopoulos, Ioannis; Trikalitis, Pantelis N.; Emwas, Abdul-Hamid M.; Eddaoudi, Mohamed

    2015-01-01

    The molecular building block approach was employed effectively to construct a series of novel isoreticular, highly porous and stable, aluminum based Metal-Organic Frameworks with soc topology. From this platform, three compounds were experimentally isolated and fully characterized, namely, the parent Al-soc-MOF-1 and its naphthalene and anthracene analogues. Al-soc-MOF-1 exhibits outstanding gravimetric methane uptake (total and working capacity). It is shown experimentally, for the first time, that the Al-soc-MOF platform can address the challenging Department of Energy dual target of 0.5 g/g (gravimetric) and 264 cm3 (STP)/cm3 (volumetric) methane storage. Furthermore, Al-soc-MOF exhibited the highest total gravimetric and volumetric uptake for carbon dioxide and the utmost total and deliverable uptake for oxygen at relatively high pressures among all microporous MOFs. In order to correlate the MOF pore structure and functionality to the gas storage properties, to better understand the structure-properties relationship, we performed a molecular simulation study and evaluated the methane storage performance of Al-soc-MOF platform using diverse organic linkers. It was found that shortening the parent Al-soc-MOF-1 linker resulted in a noticeable enhancement in the working volumetric capacity at specific temperatures and pressures with amply conserved gravimetric uptake/working capacity. In contrast, further expansion of the organic linker (branches and/or core) led to isostructural Al-soc-MOFs with enhanced gravimetric uptake but noticeably lower volumetric capacity. The collective experimental and simulation studies indicated that the parent Al-soc-MOF-1 exhibits the best compromise between the volumetric and gravimetric total and working uptakes in a wide range of pressure and temperature conditions.

  11. Universal interface on Zynq"® SoC with CAN, RS-232, Ethernet and AXI GPIO for instrumentation & control

    Kumar, Abhijeet; Rajpal, Rachana; Pujara, Harshad; Mandaliya, Hitesh; Edappala, Praveenalal

    2016-01-01

    Highlights: • We have designed Universal Interface on Zynq"® SoC with CAN, RS-232, Ethernet and AXI GPIO for Instrumentation & Control. This project is based on Zynq"®-7000 family xc7z020clg484-1 chip. • We explored the full design flow starting from the hardware development in Vivado to software development in SDK using APIs in C language and then interfacing the host application developed in LabVIEW. • We also explored how to make custom IP with AXI bus interface in Vivado. • Useful for those who wants to make custom hardware on Zynq"® SoC. - Abstract: This paper describes an application developed on the latest Zynq"®-7000 All Programmable SoC (AP SoC) [1] devices which integrate the software programmability of an ARM"®-based processor with the hardware programmability of an FPGA, on a single device. In this paper we have implemented application which uses various interfaces like CAN, RS-232, Ethernet and AXI GPIO, so that our host application running on PC in LabVIEW can communicates with any hardware which has at least any one of the available interface. Zynq-7000 All Programmable SoCs (System On Chip) infuse customizable intelligence into today’s embedded systems to suit your unique application requirements. This family of FPGA is meant for high end application because it has huge resources on single chip. It offers you to make your own custom hardware IP, in fact we have made our custom IP called myIP in our design. The beauty of this chip is that it can write drivers for your custom IP which has AXI bus layer attached. After exporting the hardware information to the Software Development Kit (SDK), the tool is able to write drivers for your custom IP. This simplifies your development to a great extent. In a way this application provides the universal interfacing option to user. User can also write the digital data on the GPIO (General Purpose Input Output) through LabVIEW Test application GUI. This project can be used for remote control and

  12. Assessing SOC labile fractions through respiration test, density-size fractionation and thermal analysis - A comparison of methods

    Soucemarianadin, Laure; Cécillon, Lauric; Chenu, Claire; Baudin, François; Nicolas, Manuel; Savignac, Florence; Barré, Pierre

    2017-04-01

    Soil organic matter (SOM) is the biggest terrestrial carbon reservoir, storing 3 to 4 times more carbon than the atmosphere. However, despite its major importance for climate regulation SOM dynamics remains insufficiently understood. For instance, there is still no widely accepted method to assess SOM lability. Soil respiration tests and particulate organic matter (POM) obtained by different fractionation schemes have been used for decades and are now considered as classical estimates of very labile and labile soil organic carbon (SOC), respectively. But the pertinence of these methods to characterize SOM turnover can be questioned. Moreover, they are very time-consuming and their reproducibility might be an issue. Alternate ways of determining the labile SOC component are thus well-needed. Thermal analyses have been used to characterize SOM among which Rock-Eval 6 (RE6) analysis of soil has shown promising results in the determination of SOM biogeochemical stability (Gregorich et al., 2015; Barré et al., 2016). Using a large set of samples of French forest soils representing contrasted pedoclimatic conditions, including deep samples (up to 1 m depth), we compared different techniques used for SOM lability assessment. We explored whether results from soil respiration test (10-week laboratory incubations), SOM size-density fractionation and RE6 thermal analysis were comparable and how they were correlated. A set of 222 (respiration test and RE6), 103 (SOM fractionation and RE6) and 93 (respiration test, SOM fractionation and RE6) forest soils samples were respectively analyzed and compared. The comparison of the three methods (n = 93) using a principal component analysis separated samples from the surface (0-10 cm) and deep (40-80 cm) layers, highlighting a clear effect of depth on the short-term persistence of SOC. A correlation analysis demonstrated that, for these samples, the two classical methods of labile SOC determination (respiration and SOM fractionation

  13. Label Free QCM Immunobiosensor for AFB1 Detection Using Monoclonal IgA Antibody as Recognition Element

    Özlem Ertekin

    2016-08-01

    Full Text Available This study introduces the use of an IgA isotype aflatoxin (AF specific monoclonal antibody for the development of a highly sensitive Quartz Crystal Microbalance (QCM immunobiosensor for the detection of AF in inhibitory immunoassay format. The higher molecular weight of IgA antibodies proved an advantage over commonly used IgG antibodies in label free immunobiosensor measurements. IgA and IgG antibodies with similar affinity for AF were used in the comparative studies. Sensor surface was prepared by covalent immobilization of AFB1, using self assembled monolayer (SAM formed on gold coated Quartz Crystal, with 1-Ethyl-3-(3-dimethylaminopropyl carbodiimide/N-hydroxy succinimide (EDC/NHS method using a diamine linker. Nonspecific binding to the surface was decreased by minimizing the duration of EDC/NHS activation. Sensor surface was chemically blocked after AF immobilization without any need for protein blocking. This protein free sensor chip endured harsh solutions with strong ionic detergent at high pH, which is required for the regeneration of the high affinity antibody-antigen interaction. According to the obtained results, the detection range with IgA antibodies was higher than IgG antibodies in QCM immunosensor developed for AFB1.

  14. Detecting small-scale spatial differences and temporal dynamics of soil organic carbon (SOC) stocks: a comparison between automatic chamber-derived C budgets and repeated soil inventories

    Hoffmann, Mathias; Jurisch, Nicole; Garcia Alba, Juana; Albiac Borraz, Elisa; Schmidt, Marten; Huth, Vytas; Rogasik, Helmut; Rieckh, Helene; Verch, Gernot; Sommer, Michael; Augustin, Jürgen

    2017-04-01

    Carbon (C) sequestration in soils plays a key role in the global C cycle. It is therefore crucial to adequately monitor dynamics in soil organic carbon (ΔSOC) stocks when aiming to reveal underlying processes and potential drivers. However, small-scale spatial and temporal changes in SOC stocks, particularly pronounced on arable lands, are hard to assess. The main reasons for this are limitations of the well-established methods. On the one hand, repeated soil inventories, often used in long-term field trials, reveal spatial patterns and trends in ΔSOC but require a longer observation period and a sufficient number of repetitions. On the other hand, eddy covariance measurements of C fluxes towards a complete C budget of the soil-plant-atmosphere system may help to obtain temporal ΔSOC patterns but lack small-scale spatial resolution. To overcome these limitations, this study presents a reliable method to detect both short-term temporal as well as small-scale spatial dynamics of ΔSOC. Therefore, a combination of automatic chamber (AC) measurements of CO2 exchange and empirically modeled aboveground biomass development (NPPshoot) was used. To verify our method, results were compared with ΔSOC observed by soil resampling. AC measurements were performed from 2010 to 2014 under a silage maize/winter fodder rye/sorghum-Sudan grass hybrid/alfalfa crop rotation at a colluvial depression located in the hummocky ground moraine landscape of NE Germany. Widespread in large areas of the formerly glaciated Northern Hemisphere, this depression type is characterized by a variable groundwater level (GWL) and pronounced small-scale spatial heterogeneity in soil properties, such as SOC and nitrogen (Nt). After monitoring the initial stage during 2010, soil erosion was experimentally simulated by incorporating topsoil material from an eroded midslope soil into the plough layer of the colluvial depression. SOC stocks were quantified before and after soil manipulation and at the end

  15. High organic inputs explain shallow and deep SOC storage in a long-term agroforestry system – combining experimental and modeling approaches

    R. Cardinael

    2018-01-01

    Full Text Available Agroforestry is an increasingly popular farming system enabling agricultural diversification and providing several ecosystem services. In agroforestry systems, soil organic carbon (SOC stocks are generally increased, but it is difficult to disentangle the different factors responsible for this storage. Organic carbon (OC inputs to the soil may be larger, but SOC decomposition rates may be modified owing to microclimate, physical protection, or priming effect from roots, especially at depth. We used an 18-year-old silvoarable system associating hybrid walnut trees (Juglans regia  ×  nigra and durum wheat (Triticum turgidum L. subsp. durum and an adjacent agricultural control plot to quantify all OC inputs to the soil – leaf litter, tree fine root senescence, crop residues, and tree row herbaceous vegetation – and measured SOC stocks down to 2 m of depth at varying distances from the trees. We then proposed a model that simulates SOC dynamics in agroforestry accounting for both the whole soil profile and the lateral spatial heterogeneity. The model was calibrated to the control plot only. Measured OC inputs to soil were increased by about 40 % (+ 1.11 t C ha−1 yr−1 down to 2 m of depth in the agroforestry plot compared to the control, resulting in an additional SOC stock of 6.3 t C ha−1 down to 1 m of depth. However, most of the SOC storage occurred in the first 30 cm of soil and in the tree rows. The model was strongly validated, properly describing the measured SOC stocks and distribution with depth in agroforestry tree rows and alleys. It showed that the increased inputs of fresh biomass to soil explained the observed additional SOC storage in the agroforestry plot. Moreover, only a priming effect variant of the model was able to capture the depth distribution of SOC stocks, suggesting the priming effect as a possible mechanism driving deep SOC dynamics. This result questions the potential of soils to

  16. High organic inputs explain shallow and deep SOC storage in a long-term agroforestry system - combining experimental and modeling approaches

    Cardinael, Rémi; Guenet, Bertrand; Chevallier, Tiphaine; Dupraz, Christian; Cozzi, Thomas; Chenu, Claire

    2018-01-01

    Agroforestry is an increasingly popular farming system enabling agricultural diversification and providing several ecosystem services. In agroforestry systems, soil organic carbon (SOC) stocks are generally increased, but it is difficult to disentangle the different factors responsible for this storage. Organic carbon (OC) inputs to the soil may be larger, but SOC decomposition rates may be modified owing to microclimate, physical protection, or priming effect from roots, especially at depth. We used an 18-year-old silvoarable system associating hybrid walnut trees (Juglans regia × nigra) and durum wheat (Triticum turgidum L. subsp. durum) and an adjacent agricultural control plot to quantify all OC inputs to the soil - leaf litter, tree fine root senescence, crop residues, and tree row herbaceous vegetation - and measured SOC stocks down to 2 m of depth at varying distances from the trees. We then proposed a model that simulates SOC dynamics in agroforestry accounting for both the whole soil profile and the lateral spatial heterogeneity. The model was calibrated to the control plot only. Measured OC inputs to soil were increased by about 40 % (+ 1.11 t C ha-1 yr-1) down to 2 m of depth in the agroforestry plot compared to the control, resulting in an additional SOC stock of 6.3 t C ha-1 down to 1 m of depth. However, most of the SOC storage occurred in the first 30 cm of soil and in the tree rows. The model was strongly validated, properly describing the measured SOC stocks and distribution with depth in agroforestry tree rows and alleys. It showed that the increased inputs of fresh biomass to soil explained the observed additional SOC storage in the agroforestry plot. Moreover, only a priming effect variant of the model was able to capture the depth distribution of SOC stocks, suggesting the priming effect as a possible mechanism driving deep SOC dynamics. This result questions the potential of soils to store large amounts of carbon, especially at depth. Deep

  17. Rock-Eval analysis of French forest soils: the influence of depth, soil and vegetation types on SOC thermal stability and bulk chemistry

    Soucemarianadin, Laure; Cécillon, Lauric; Baudin, François; Cecchini, Sébastien; Chenu, Claire; Mériguet, Jacques; Nicolas, Manuel; Savignac, Florence; Barré, Pierre

    2017-04-01

    Soil organic matter (SOM) is the largest terrestrial carbon pool and SOM degradation has multiple consequences on key ecosystem properties like nutrients cycling, soil emissions of greenhouse gases or carbon sequestration potential. With the strong feedbacks between SOM and climate change, it becomes particularly urgent to develop reliable routine methodologies capable of indicating the turnover time of soil organic carbon (SOC) stocks. Thermal analyses have been used to characterize SOM and among them, Rock-Eval 6 (RE6) analysis of soil has shown promising results in the determination of in-situ SOC biogeochemical stability. This technique combines a phase of pyrolysis followed by a phase of oxidation to provide information on both the SOC bulk chemistry and thermal stability. We analyzed with RE6 a set of 495 soils samples from 102 permanent forest sites of the French national network for the long-term monitoring of forest ecosystems (''RENECOFOR'' network). Along with covering pedoclimatic variability at a national level, these samples include a range of 5 depths up to 1 meter (0-10 cm, 10-20 cm, 20-40 cm, 40-80 cm and 80-100 cm). Using RE6 parameters that were previously shown to be correlated to short-term (hydrogen index, HI; T50 CH pyrolysis) or long-term (T50 CO2 oxidation and HI) SOC persistence, and that characterize SOM bulk chemical composition (oxygen index, OI and HI), we tested the influence of depth (n = 5), soil class (n = 6) and vegetation type (n = 3; deciduous, coniferous-fir, coniferous-pine) on SOM thermal stability and bulk chemistry. Results showed that depth was the dominant discriminating factor, affecting significantly all RE6 parameters. With depth, we observed a decrease of the thermally labile SOC pool and an increase of the thermally stable SOC pool, along with an oxidation and a depletion of hydrogen-rich moieties of the SOC. Soil class and vegetation type had contrasted effects on the RE6 parameters but both affected significantly T

  18. Online cell SOC estimation of Li-ion battery packs using a dual time-scale Kalman filtering for EV applications

    Dai, Haifeng; Wei, Xuezhe; Sun, Zechang; Wang, Jiayuan; Gu, Weijun

    2012-01-01

    Highlights: ► We use an equivalent circuit model to describe the characteristics of battery. ► A dual time-scale estimator is used to calculate pack average SOC and cell SOC. ► The estimator is based on the dynamic descriptions and extended Kalman filter. ► Three different test cases are designed to validate the proposed method. ► Test results indicate a good performance of the method for EV applications. -- Abstract: For the vehicular operation, due to the voltage and power/energy requirements, the battery systems are usually composed of up to hundreds of cells connected in series or parallel. To accommodate the operation conditions, the battery management system (BMS) should estimate State of Charge (SOC) to facilitate safe and efficient utilization of the battery. The performance difference among the cells makes a pure pack SOC estimation hardly provide sufficient information, which at last affects the computation of available energy and power and the safety of the battery system. So for a reliable and accurate management, the BMS should “know” the SOC of each individual cell. Several possible solutions on this issue have been reported in the recent years. This paper studies a method to determine online all individual cell SOCs of a series-connected battery pack. This method, with an equivalent circuit based “averaged cell” model, estimates the battery pack’s average SOC first, and then incorporates the performance divergences between the “averaged cell” and each individual cell to generate the SOC estimations for all cells. This method is developed based on extended Kalman filter (EKF), and to reduce the computation cost, a dual time-scale implementation is designed. The method is validated using results obtained from the measurements of a Li-ion battery pack under three different tests, and analysis indicates the good performance of the algorithm.

  19. Matrine suppresses airway inflammation by downregulating SOCS3 expression via inhibition of NF-κB signaling in airway epithelial cells and asthmatic mice

    Sun, Daqing [Department of Respiration, Xi’an Children’s Hospital, Xi’an 710003 (China); Wang, Jing [Department of Neonatology, Xi’an Children’s Hospital, Xi’an 710003 (China); Yang, Niandi [Outpatient Department, School of Aerospace Engineering, Air Force Engineering University, Xi’an 710038 (China); Ma, Haixin, E-mail: drhaixinma@163.com [Department of Quality Control, Xi’an Children’s Hospital, Xi’an 710003 (China)

    2016-08-12

    Matrine has been demonstrated to attenuate allergic airway inflammation. Elevated suppressor of cytokine signaling 3 (SOCS3) was correlated with the severity of asthma. The aim of this study was to investigate the effect of matrine on SOCS3 expression in airway inflammation. In this study, we found that matrine significantly inhibited OVA-induced AHR, inflammatory cell infiltration, goblet cell differentiation, and mucous production in a dose-dependent manner in mice. Matrine also abrogated the level of interleukin (IL)-4 and IL-13, but enhanced interferon (IFN)-γ expression, both in BALF and in lung homogenates. Furthermore, matrine impeded TNF-α-induced the expression of IL-6 and adhesion molecules in airway epithelial cells (BEAS-2B and MLE-12). Additionally, we found that matrine inhibited SOCS3 expression, both in asthmatic mice and TNF-α-stimulated epithelial cells via suppression of the NF-κB signaling pathway by using pcDNA3.1-SOCS3 plasmid, SOCS3 siRNA, or nuclear factor kappa-B (NF-κB) inhibitor PDTC. Conclusions: Matrine suppresses airway inflammation by downregulating SOCS3 expression via inhibition of NF-κB signaling in airway epithelial cells and asthmatic mice. - Highlights: • Matrine attenuates asthmatic symptoms and regulates Th1/Th2 balance in vivo. • Matrine suppresses inflammation responses in vitro. • Matrine decreases SOCS3 expression both in vivo and in vitro. • Matrine inhibits SOCS3 expression by suppressing NF-κB signaling.

  20. Gas-particle partitioning of semivolatile organic compounds (SOCs) on mixtures of aerosols in a smog chamber.

    Chandramouli, Bharadwaj; Jang, Myoseon; Kamens, Richard M

    2003-09-15

    The partitioning behavior of a set of diverse SOCs on two and three component mixtures of aerosols from different sources was studied using smog chamber experimental data. A set of SOCs of different compound types was introduced into a system containing a mixture of aerosols from two or more sources. Gas and particle samples were taken using a filter-filter-denuder sampling system, and a partitioning coefficient Kp was estimated using Kp = Cp/(CgTSP). Particle size distributions were measured using a differential mobility analyzer and a light scattering detector. Gas and particle samples were analyzed using GCMS. The aerosol composition in the chamber was tracked chemically using a combination of signature compounds and the organic matter mass fraction (f(om)) of the individual aerosol sources. The physical nature of the aerosol mixture in the chamber was determined using particle size distributions, and an aggregate Kp was estimated from theoretically calculated Kp on the individual sources. Model fits for Kp showed that when the mixture involved primary sources of aerosol, the aggregate Kp of the mixture could be successfully modeled as an external mixture of the Kp on the individual aerosols. There were significant differences observed for some SOCs between modeling the system as an external and as an internal mixture. However, when one of the aerosol sources was secondary, the aggregate model Kp required incorporation of the secondary aerosol products on the preexisting aerosol for adequate model fits. Modeling such a system as an external mixture grossly overpredicted the Kp of alkanes in the mixture. Indirect evidence of heterogeneous, acid-catalyzed reactions in the particle phase was also seen, leading to a significant increase in the polarity of the resulting aerosol mix and a resulting decrease in the observed Kp of alkanes in the chamber. The model was partly consistent with this decrease but could not completely explain the reduction in Kp because of

  1. What can we learn from field experiments about the development of SOC and GHG emissions under different management practices?

    Spiegel, Heide; Lehtinen, Taru; Schlatter, Norman; Haslmayr, Hans-Peter; Baumgarten, Andreas; ten Berge, Hein

    2015-04-01

    Successful agricultural management practices are required to maintain or enhance soil quality; at the same time climate change mitigation is becoming increasingly important. Within the EU project CATCH-C we analysed the effects of different agricultural practices not only on crop productivity, but also on soil quality indicators (e.g. soil organic carbon (SOC)) and climate change (CC) mitigation indicators (e.g. CO2, CH4, N2O emissions). European data sets and associated literature, mainly from long-term experiments were evaluated. This evaluation of agricultural management practices was carried out comparing a set of improved ("best") and often applied ("current") management practices. Positive and negative effects occurred when best management practices are adopted. As expected, none of the investigated practices could comply with all objectives simultaneously, i.e. maintaining high yields, mitigating climate change and improving chemical, physical and biological soil quality. The studied soil management practices "non-inversion tillage", "organic fertilisation" (application of farm yard manure, slurry, compost) and "incorporation of crop residues" represent important management practices for farmers to increase SOC, thus improving soil quality. However, CO2 and, especially, N2O emissions may rise as well. The evaluation of CC mitigation is often limited by the lack of data from - preferably - continuous GHG emission measurements. Thus, more long-term field studies are needed to better assess the CO2, CH4 and, especially, N2O emissions following the above mentioned favorably rated MPs. Only if SOC and GHG emissions are measured in the same field experiments, it will be possible to compute overall balances of necessary CO2-C equivalent emissions. CATCH-C is funded within the 7th Framework Programme for Research, Technological Development and Demonstration, Theme 2 - Biotechnologies, Agriculture & Food. (Grant Agreement N° 289782).

  2. Using SoC Online Correction Method Based on Parameter Identification to Optimize the Operation Range of NI-MH Battery for Electric Boat

    Bumin Meng

    2018-03-01

    Full Text Available This paper discusses a design of a Battery Management System (BMS solution for extending the life of Nickel-Metal Hydride (NI-MH battery. Combined with application of electric boat, a State of Charge (SoC optimal operation range control method based on high precision energy metering and online SoC correction is proposed. Firstly, a power metering scheme is introduced to reduce the original energy measurement error. Secondly, by establishing a model based parameter identification method and combining with Extended Kalman Filter (EKF method, the estimation accuracy of SoC is guaranteed. Finally, SoC optimal operation range control method is presented to make battery running in the optimal range. After two years of operation, the battery managed by proposed method has much better status, compared to batteries that use AH integral method and fixed SoC operating range. Considering the SoC estimation of NI-MH battery is more difficult becausing special electrical characteristics, proposed method also would have a very good reference value for other types of battery management.

  3. Pengaruh Variasi Jumlah Tembakan Nanosecond Pulsed Electric Fields (Nspefs Terhadap Ekspresi Gen Socs3 pada Sel Kanker Serviks Hela S3

    Martina Kurnia Rohmah

    2017-12-01

    Abstract Nanosecond Pulsed Electric Fields (NsPEFs is bioelectric that was developed by electroporation technology. NsPEFs use high intensity in short time exposure (1 – 300 nanosecond. NsPEFs have biological effect and was developed in cancer therapy. In cervical cancer, viral protein of HPV depresses some tumor suppressors like Socs3 gene. This research aims to investigate the effect of short variation in Socs3 gene expression. HeLa S3 cells were cultured in α-MEM with FBS 10%. NsPEFs as much as 20 kV/cm and 80 nano seconds was exposure over HeLa S3 cell in 4 mm cuvette. Wave of NsPEFs was detected by high voltage probe in oscilloscope. NsPEFs was exposure at 0 (control, 5, 10, 20, 30, 40, 50, and 60 shots. Socs3 gene expression was analyzed using real time PCR and RT-PCR. Quantitative data was analyzed by Kolmogorov-Smirnov, Anova, and HSD Tuker (p<0.05. This research show that NsPEFs is significantly increase Socs3 gene expression (p=0.000. The optimal shot 20 and 30 shots increase Socs3 gene expression subsequently = 2.779 and = 3.105 times. This expression decrease in higher than 30 shots of NsPEFs exposure.   Keywords: NsPEFs, shot, expression, Socs3

  4. Environmental Assessment Preparation for Air Force Test Mission in the 21st Century: Upgrade and Improve the Test Capability at the Edwards AFB Test Complex

    2015-04-01

    waste NAA Nonattainment Area NAAQS National Ambient Air Quality Standards NAGPRA Native American Graves Protection and Repatriation Act NDMA N...nitrate, and N- Nitrosodimethylamine ( NDMA ) plumes exist in these OUs. Locations of groundwater plumes at Edwards AFB are indicated by their respective

  5. Pure neuritic leprosy: Resolving diagnostic issues in acid fast bacilli (AFB)-negative nerve biopsies: A single centre experience from South India.

    Hui, Monalisa; Uppin, Megha S; Challa, Sundaram; Meena, A K; Kaul, Subhash

    2015-01-01

    Demonstration of lepra bacilli is essential for definite or unequivocal diagnosis of pure neuritic leprosy (PNL) on nerve biopsy. However, nerves always do not show bacilli owing to the changes of previous therapy or due to low bacillary load in tuberculoid forms. In absence of granuloma or lepra bacilli, other morphologic changes in endoneurium and perineurium can be of help in making a probable diagnosis of PNL and treating the patient with multidrug therapy. Forty-six biopsies of PNL were retrospectively reviewed and histologic findings were compared with 25 biopsies of non leprosy neuropathies (NLN) including vasculitic neuropathy and chronic inflammatory demyelinating polyneuropathy (CIDP). The distribution of endoneurial infiltrate and fibrosis, perineurial thickening, and myelin abnormalities were compared between PNL and NLN biopsies and analyzed by Chi-square test. Out of 46 PNL casses, 24 (52.17 %) biopsies were negative for acid fast bacilli (AFB). In these cases, the features which favor a diagnosis of AFB-negative PNL were endoneurial infiltrate (51.1%), endoneurial fibrosis (54.2%), perineurial thickening (70.8%), and reduced number of myelinated nerve fibers (75%). Nerve biopsy is an efficient tool to diagnose PNL and differentiate it from other causes of NLN. In absence of AFB, the diagnosis of PNL is challenging. In this article, we have satisfactorily evaluated the various hisopthological features and found that endoneurial inflammation, dense fibrosis, and reduction in the number of myelinated nerve fibers are strong supportive indicators of PNL regardless of AFB positivity.

  6. Clinical value of whole-blood interferon-gamma assay in patients with suspected pulmonary tuberculosis and AFB smear- and polymerase chain reaction-negative bronchial aspirates.

    Lee, Jaehee; Lee, Shin Yup; Yoo, Seung Soo; Cha, Seung Ick; Won, Dong Il; Park, Jae Yong; Lee, Won-Kil; Kim, Chang Ho

    2012-07-01

    Combining a polymerase chain reaction (PCR) test with bronchoscopy is frequently performed to allow a rapid diagnosis of smear-negative pulmonary tuberculosis (PTB). However, limited data are available concerning clinical judgment in patients with suspected PTB and AFB smear- and PCR-negative bronchial aspirates (BA). The present study evaluated the usefulness of whole-blood QuantiFERON-TB Gold In-Tube (QFT) testing in these patients. Of 166 patients with suspected PTB who had undergone bronchoscopy because of smear-negative sputum or inadequate sputum production, 93 (56%) were diagnosed with culture-positive PTB. Seventy-four patients were either AFB smear- or PCR-positive. In the 75 patients whose BA AFB smear and PCR results were both negative, 19 were finally diagnosed with PTB by culture. The QFT test had a negative predictive value of 91% for PTB. The QFT test may be useful for excluding PTB in patients with suspected PTB whose BA AFB smear and PCR results are both negative. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Novel sampling methods for atmospheric semi-volatile organic compounds (SOCs) in a high altitude alpine environment.

    Offenthaler, I; Jakobi, G; Kaiser, A; Kirchner, M; Kräuchi, N; Niedermoser, B; Schramm, K-W; Sedivy, I; Staudinger, M; Thanner, G; Weiss, P; Moche, W

    2009-12-01

    High- and low-volume active air samplers as well as bulk deposition samplers were developed to sample atmospheric SOCs under the adverse conditions of a mountain environment. Active sampling employed separate filters for different European source regions. Filters were switched depending on daily trajectory forecasts, whose accuracy was evaluated post hoc. The sampling continued on three alpine summits over five periods of four months. The prevailing trajectories varied stronger between sampling periods than between stations. The sampling equipment (active and bulk deposition) proved dependable for operation in a mountain environment, with idle times being mainly due to non-routine manipulations and connectivity.

  8. Detecting small-scale spatial heterogeneity and temporal dynamics of soil organic carbon (SOC) stocks: a comparison between automatic chamber-derived C budgets and repeated soil inventories

    Hoffmann, Mathias; Jurisch, Nicole; Garcia Alba, Juana; Albiac Borraz, Elisa; Schmidt, Marten; Huth, Vytas; Rogasik, Helmut; Rieckh, Helene; Verch, Gernot; Sommer, Michael; Augustin, Jürgen

    2017-03-01

    Carbon (C) sequestration in soils plays a key role in the global C cycle. It is therefore crucial to adequately monitor dynamics in soil organic carbon (ΔSOC) stocks when aiming to reveal underlying processes and potential drivers. However, small-scale spatial (10-30 m) and temporal changes in SOC stocks, particularly pronounced in arable lands, are hard to assess. The main reasons for this are limitations of the well-established methods. On the one hand, repeated soil inventories, often used in long-term field trials, reveal spatial patterns and trends in ΔSOC but require a longer observation period and a sufficient number of repetitions. On the other hand, eddy covariance measurements of C fluxes towards a complete C budget of the soil-plant-atmosphere system may help to obtain temporal ΔSOC patterns but lack small-scale spatial resolution. To overcome these limitations, this study presents a reliable method to detect both short-term temporal dynamics as well as small-scale spatial differences of ΔSOC using measurements of the net ecosystem carbon balance (NECB) as a proxy. To estimate the NECB, a combination of automatic chamber (AC) measurements of CO2 exchange and empirically modeled aboveground biomass development (NPPshoot) were used. To verify our method, results were compared with ΔSOC observed by soil resampling. Soil resampling and AC measurements were performed from 2010 to 2014 at a colluvial depression located in the hummocky ground moraine landscape of northeastern Germany. The measurement site is characterized by a variable groundwater level (GWL) and pronounced small-scale spatial heterogeneity regarding SOC and nitrogen (Nt) stocks. Tendencies and magnitude of ΔSOC values derived by AC measurements and repeated soil inventories corresponded well. The period of maximum plant growth was identified as being most important for the development of spatial differences in annual ΔSOC. Hence, we were able to confirm that AC-based C budgets are able

  9. Development of control system for multi-converter High voltage Power supply using programmable SoC

    Dave, Rasesh; Dharangutti, Jagruti; Singh, N. P.; Thakar, Aruna; Dhola, Hitesh; Gajjar, Sandip; Parmar, Darshan; Zaveri, Tanish; Baruah, Ujjwal

    2017-04-01

    Multi-converter based High Voltage Power Supplies (HVPSs) find application in multi-megawatt accelerators, RF systems. Control system for HVPS must be a combination of superior parallel processing, real time performance, fast computation and versatile connectivity. The hardware platform is expected to be robust, easily scalable for future developments with minimal overheads. This paper describes development of control system on Zynq All Programmable SoC (System on Chip) for HVPS. Typical HVPS control mechanism involves communication, generation of precise control signals/pulses for few hundred numbers of chopper and closed loop control in microsecond range for regulated output. Such kind of requirements can be met with Zynq All Programmable SoC, which is a combination of Dual core ARM Cortex A-9 Processing System (PS) and Xilinx 7 series FPGA based Programmable Logic (PL). Deterministic functions of power supply control system such as generation of control signals with precise inter-channel delay of nanosecond range and communication with individual chopper at 100kbps can be implemented on PL. PS should implement corrective tasks based on field feedback received from individual chopper, user interface and OS management that allows to take full advantage of system capabilities. PS and PL are connected with on-chip AXI-4 interface with low latency and higher bandwidth through 9 AXI ports. Typically PS boots first, this ensures secure booting and prevents external environment from tampering PL.

  10. Design and implementation of a reconfigurable mixed-signal SoC based on field programmable analog arrays

    Liu, Lintao; Gao, Yuhan; Deng, Jun

    2017-11-01

    This work presents a reconfigurable mixed-signal system-on-chip (SoC), which integrates switched-capacitor-based field programmable analog arrays (FPAA), analog-to-digital converter (ADC), digital-to-analog converter, digital down converter , digital up converter, 32-bit reduced instruction-set computer central processing unit (CPU) and other digital IPs on a single chip with 0.18 μm CMOS technology. The FPAA intellectual property could be reconfigured as different function circuits, such as gain amplifier, divider, sine generator, and so on. This single-chip integrated mixed-signal system is a complete modern signal processing system, occupying a die area of 7 × 8 mm 2 and consuming 719 mW with a clock frequency of 150 MHz for CPU and 200 MHz for ADC/DAC. This SoC chip can help customers to shorten design cycles, save board area, reduce the system power consumption and depress the system integration risk, which would afford a big prospect of application for wireless communication. Project supported by the National High Technology and Development Program of China (No. 2012AA012303).

  11. Development of control system for multi-converter high voltage power supply using programmable SoC

    Dave, Rasesh; Singh, N.P.; Thakar, Aruna; Dhola, Hitesh; Gajjar, Sandip; Parmar, Darshan Kumar; Baruah, Ujjwal Kumar; Dharangutti, Jagruti; Zaveri, Tanish

    2015-01-01

    Multi-converter based High Voltage Power Supplies (HVPSs) find application in multi-megawatt accelerators, RF systems. Control system for HVPS must be a combination of superior parallel processing, real time performance, fast computation and versatile connectivity. The hardware platform is expected to be robust, easily scalable for future developments without any cost overhead. Typical HVPS control mechanism involves communication, generation of precise control signals/pulses for few hundred Nos of chopper and closed loop control in microsecond range for regulated output. Such kind of requirements can be met with Zynq All Programmable SoC, which is a combination of Dual core ARM Cortex A-9 Processing System (PS) and Xilinx 7 series FPGA based Programmable Logic (PL). Deterministic functions of power supply control system such as generation of control signals with precise inter-channel delay of nanosecond range and communication with individual chopper at 100kbps can be implemented on PL. PS should implement corrective tasks based on field feedback received from individual chopper, user interface and OS management that allows to take full advantage of system capabilities. PS and PL are connected with on-chip AXI-4 interface with low latency and higher bandwidth through 9 AXI ports. Typically PS boots first, this ensures secure booting and prevents external environment from tampering PL. This paper describes development of control system on Zynq All Programmable SoC for HVPS. (author)

  12. One-chip Integrated Module of MEMS Shock Sensor and Sensing Amplifier LSI using Pseudo-SOC Technology

    Iida, Atsuko; Onozuka, Yutaka; Nishigaki, Michihiko; Yamada, Hiroshi; Funaki, Hideyuki; Itaya, Kazuhiko

    We have been developing the pseudo-SOC technology for one-chip module integration of heterogeneous devices that realizes high electrical performance and high density of devices embodying the advantages of both SOC technology and SIP technology. Especially, this technology is available for MEMS-LSI integration. We developed a 0.2mm-thickness one-chip module integrating a MEMS shock sensor and a sensing amplifier LSI by applying this technology. The MEMS shock sensor and the sensing amplifier LSI were connected by high-rigidity epoxy resin optimized the material constants to reduce the stress and the warpage resulting from resin shrinkage due to curing. Then the planar insulating layer and the redistributed conducting layer were formed on it for the global layer. The MEMS shock sensor was preformed to be modularized with a glass cap. Electrical contacts were achieved by bonding of Au bumps on the MEMS fixed electrodes and via holes filled with Ag paste of the glass cap. Functional performance was confirmed by obtaining signal corresponding to the reference signal of the pick-up sensor. Furthermore, stress analysis was performed using the FEM model simulation considering the resin shrinkage.

  13. A 10-bit 200-kS/s SAR ADC IP core for a touch screen SoC

    Tong Xingyuan; Yang Yintang; Zhu Zhangming; Sheng Wenfang

    2010-01-01

    Based on a 5 MSBs (most-significant-bits)-plus-5 LSBs (least-significant-bits) C-R hybrid D/A conversion and low-offset pseudo-differential comparison approach, with capacitor array axially symmetric layout topology and resistor string low gradient mismatch placement method, an 8-channel 10-bit 200-kS/s SAR ADC (successive-approximation-register analog-to-digital converter) IP core for a touch screen SoC (system-on-chip) is implemented in a 0.18 μm 1P5M CMOS logic process. Design considerations for the touch screen SAR ADC are included. With a 1.8 V power supply, the DNL (differential non-linearity) and INL (integral non-linearity) of this converter are measured to be about 0.32 LSB and 0.81 LSB respectively. With an input frequency of 91 kHz at 200-kS/s sampling rate, the spurious-free dynamic range and effective-number-of-bits are measured to be 63.2 dB and 9.15 bits respectively, and the power is about 136 μW. This converter occupies an area of about 0.08 mm 2 . The design results show that it is very suitable for touch screen SoC applications. (semiconductor integrated circuits)

  14. Inflammation and linear bone growth: the inhibitory role of SOCS2 on GH/IGF-1 signaling.

    Farquharson, Colin; Ahmed, S Faisal

    2013-04-01

    Linear bone growth is widely recognized to be adversely affected in children with chronic kidney disease (CKD) and other chronic inflammatory disorders. The growth hormone (GH)/insulin-like growth factor-1 (IGF-1) pathway is anabolic to the skeleton and inflammatory cytokines compromise bone growth through a number of different mechanisms, which include interference with the systemic as well as the tissue-level GH/IGF-1 axis. Despite attempts to promote growth and control disease, there are an increasing number of reports of the persistence of poor growth in a substantial proportion of patients receiving rhGH and/or drugs that block cytokine action. Thus, there is an urgent need to consider better and alternative forms of therapy that are directed specifically at the mechanism of the insult which leads to abnormal bone health. Suppressor of cytokine signaling 2 (SOCS2) expression is increased in inflammatory conditions including CKD, and is a recognized inhibitor of GH signaling. Therefore, in this review, we will focus on the premise that SOCS2 signaling represents a critical pathway in growth plate chondrocytes through which pro-inflammatory cytokines alter both GH/IGF-1 signaling and cellular function.

  15. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    De Guzman, Zenaida M. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Cervancia, Cleofas R. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Feliciano, Chitho P., E-mail: cpfeliciano@pnri.dost.gov.ph [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Institute of Biology, College of Science, University of the Philippines, Diliman, Quezon City (Philippines)

    2011-10-15

    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a {sup 60}Co source. Surviving spores were counted and used to estimate the decimal reduction (D{sub 10}) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10{sup 5}-9x10{sup 3} spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D{sub min}) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to {gamma}-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: > We characterized Paenibacillus larvae and determined its radiation sensitivity. > We investigated the effectiveness of gamma rays in inactivating P. larvae. > Gamma radiation inactivates P. larvae. > 15 kGy is effective for the sterilization of P. larvae-infected hives. > Irradiation produces no visible changes in the hives' body, waxes and frames.

  16. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    De Guzman, Zenaida M.; Cervancia, Cleofas R.; Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C.; Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C.; Feliciano, Chitho P.

    2011-01-01

    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a 60 Co source. Surviving spores were counted and used to estimate the decimal reduction (D 10 ) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10 5 -9x10 3 spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D min ) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to γ-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: → We characterized Paenibacillus larvae and determined its radiation sensitivity. → We investigated the effectiveness of gamma rays in inactivating P. larvae. → Gamma radiation inactivates P. larvae. → 15 kGy is effective for the sterilization of P. larvae-infected hives. → Irradiation produces no visible changes in the hives' body, waxes and frames.

  17. IL-8 induces miR-424-5p expression and modulates SOCS2/STAT5 signaling pathway in oral squamous cell carcinoma.

    Peng, Hsuan-Yu; Jiang, Shih-Sheng; Hsiao, Jenn-Ren; Hsiao, Michael; Hsu, Yuan-Ming; Wu, Guan-Hsun; Chang, Wei-Min; Chang, Jang-Yang; Jin, Shiow-Lian Catherine; Shiah, Shine-Gwo

    2016-06-01

    Suppressor of cytokine signaling (SOCS) proteins are negative feedback regulators of the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. Dysregulation of SOCS protein expression in cancers can be one of the mechanisms that maintain STAT activation, but this mechanism is still poorly understood in oral squamous cell carcinoma (OSCC). Here, we report that SOCS2 protein is significantly downregulated in OSCC patients and its levels are inversely correlated with miR-424-5p expression. We identified the SOCS2 protein, which modulates STAT5 activity, as a direct target of miR-424-5p. The miR-424-5p-induced STAT5 phosphorylation, matrix metalloproteinases (MMPs) expression, and cell migration and invasion were blocked by SOCS2 restoration, suggesting that miR-424-5p exhibits its oncogenic activity through negatively regulating SOCS2 levels. Furthermore, miR-424-5p expression could be induced by the cytokine IL-8 primarily through enhancing STAT5 transcriptional activity rather than NF-κB signaling. Antagomir-mediated inactivation of miR-424-5p prevented the IL-8-induced cell migration and invasion, indicating that miR-424-5p is required for IL-8-induced cellular invasiveness. Taken together, these data indicate that STAT5-dependent expression of miR-424-5p plays an important role in mediating IL-8/STAT5/SOCS2 feedback loop, and scavenging miR-424-5p function using antagomir may have therapeutic potential for the treatment of OSCC. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Neighborhood-resources for the development of a strong SOC and the importance of understanding why and how resources work: a grounded theory approach.

    Maass, Ruca; Lindström, Bengt; Lillefjell, Monica

    2017-09-12

    Providing individuals with psychosocial resources such as sense of coherence (SOC) seems a beneficial strategy for health promotion in the neighborhood. In order to become a supporting theory for health promotion, Salutogenesis should renew its focus on resources for health, and explore how the development of a strong SOC can be facilitated. Relevant issues were explored using a Grounded Theory- approach. Three focus-group-sessions and three in-depth interviews were conducted with strategically sampled participants. The transcripts of the focus groups were initially analyzed line-by-line to ensure that insights emerged from the data. We then applied focused and systemic analyses to achieve axial coding, and to include insights into how social interactions during focus groups may reveal social processes in real-life-neighborhoods. The data from the in-depth interviews were used to validate and fill emerging categories, as well as to ensure data-saturation. Findings indicate the importance of repeated experiences with resources and every-day-challenges to develop a strong SOC. Active engagement with resources is a favorable condition for significant experiences, which enhance the internalization of resources. Core experiences are characterized by a re-organization of resources. Participation in intellectual meaning-making through equal power dialogue seems to broaden perspectives and promote the strengthening of SOC. A strong SOC can also be described as a deeper understanding of how and why resources work, which allows for a more flexible use of resources, including replacing missing resources. A new understanding of SOC as an intuitive understanding of how, why and under which circumstances resources work, as well as a new focus on everyday life and repeated experiences might facilitate new approaches to a purposeful strengthening of SOC through the planning and implementation of public measures.

  19. Soil organic carbon (SOC) accumulation in rice paddies under long-term agro-ecosystem experiments in southern China - VI. Changes in microbial community structure and respiratory activity

    Liu, D.; Liu, X.; Liu, Y.; Li, L.; Pan, G.; Crowley, D.; Tippkötter, R.

    2011-02-01

    Biological stabilization within accumulated soil organic carbon (SOC) has not been well understood, while its role in physical and chemical protection as well as of chemical recalcitrance had been addressed in Chinese rice paddies. In this study, topsoil samples were collected and respiratory activity measured in situ following rice harvest under different fertilization treatments of three long-term experimental sites across southern China in 2009. The SOC contents, microbial biomass carbon (SMBC) and nitrogen (SMBN) were analysed using chemical digestion and microbial community structure assessment via clony dilute plate counting methods. While SOC contents were consistently higher under compound chemical fertilization (Comp-Fert) or combined organic and inorganic fertilization (Comb-Fert) compared to N fertilization only (N-Fert), there was significantly higher fungal-bacterial ratio under Comb-Fert than under N-Fert and Comp-Fert. When subtracting the background effect under no fertilization treatment (Non-Fert), the increase both in SMBC and SMBN under fertilization treatment was found very significantly correlated to the increase in SOC over controls across the sites. Also, the ratio of culturable fungal to bacterial population numbers (F/B ratio) was well correlated with soil organic carbon contents in all samples across the sites studied. SOC accumulation favoured a build-up the microbial community with increasing fungal dominance in the rice paddies under fertilization treatments. While soil respiration rates were high under Comb-Fert as a result of enhanced microbial community build-up, the specific soil respiratory activity based on microbial biomass carbon was found in a significantly negatively correlation with the SOC contents for overall samples. Thus, a fungal-dominated microbial community seemed to slow SOC turnover, thereby favouring SOC accumulation under Comp-Fert or under Comb-Fert in the rice paddies. Therefore, the biological stabilization

  20. Calcineurin inhibitor-induced complement system activation via ERK1/2 signalling is inhibited by SOCS-3 in human renal tubule cells.

    Loeschenberger, Beatrix; Niess, Lea; Würzner, Reinhard; Schwelberger, Hubert; Eder, Iris E; Puhr, Martin; Guenther, Julia; Troppmair, Jakob; Rudnicki, Michael; Neuwirt, Hannes

    2018-02-01

    One factor that significantly contributes to renal allograft loss is chronic calcineurin inhibitor (CNI) nephrotoxicity (CIN). Among other factors, the complement (C-) system has been proposed to be involved CIN development. Hence, we investigated the impact of CNIs on intracellular signalling and the effects on the C-system in human renal tubule cells. In a qPCR array, CNI treatment upregulated C-factors and downregulated SOCS-3 and the complement inhibitors CD46 and CD55. Additionally, ERK1/-2 was required for these regulations. Following knock-down and overexpression of SOCS-3, we found that SOCS-3 inhibits ERK1/-2 signalling. Finally, we assessed terminal complement complex formation, cell viability and apoptosis. Terminal complement complex formation was induced by CNIs. Cell viability was significantly decreased, whereas apoptosis was increased. Both effects were reversed under complement component-depleted conditions. In vivo, increased ERK1/-2 phosphorylation and SOCS-3 downregulation were observed at the time of transplantation in renal allograft patients who developed a progressive decline of renal function in the follow-up compared to stable patients. The progressive cohort also had lower total C3 levels, suggesting higher complement activity at baseline. In conclusion, our data suggest that SOCS-3 inhibits CNI-induced ERK1/-2 signalling, thereby blunting the negative control of C-system activation. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. UD-DKF-based Parameters on-line Identification Method and AEKF-Based SOC Estimation Strategy of Lithium-ion Battery

    Xuanju Dang

    2014-09-01

    Full Text Available State of charge (SOC is a significant parameter for the Battery Management System (BMS. The accurate estimation of the SOC can not only guarantee the SOC remaining within a reasonable scope of work, but also prevent the battery from being over or deeply-charged to extend the lifespan of battery. In this paper, the third-order RC equivalent circuit model is adopted to describe cell characteristics and the dual Kalman filter (DKF is used online to identify model parameters for battery. In order to avoid the impacts of rounding error calculation leading to the estimation error matrix loss of non-negative qualitative which result in the filtering divergence phenomenon, the UD decomposition method is applied for filtering time and state updates simultaneously to enhance the stability of the algorithm, reduce the computational complexity and improve the high recognition accuracy. Based on the obtained model parameters, Adaptive Extended Kalman Filter (AEKF is introduced to online estimate the SOC of battery. The simulation and experimental results demonstrate that the established third-order RC equivalent circuit model is effective, and the SOC estimation has a higher precision.

  2. Transient receptor potential ion channel Trpm7 regulates exocrine pancreatic epithelial proliferation by Mg2+-sensitive Socs3a signaling in development and cancer

    Nelson S. Yee

    2011-03-01

    Genetic analysis of pancreatic development has provided new insights into the mechanisms underlying the formation of exocrine pancreatic neoplasia. Zebrafish sweetbread (swd mutants develop hypoplastic acini and dysmorphic ducts in the exocrine pancreas, with impeded progression of cell division cycle and of epithelial growth. Positional cloning and allelic complementation have revealed that the swd mutations affect the transient receptor potential melastatin-subfamily member 7 (trpm7 gene, which encodes a divalent cation-permeable channel with kinase activity. Supplementary Mg2+ partially rescued the exocrine pancreatic defects of the trpm7 mutants by improving cell-cycle progression and growth and repressing the suppressor of cytokine signaling 3a (socs3a gene. The role of Socs3a in Trpm7-mediated signaling is supported by the findings that socs3a mRNA level is elevated in the trpm7 mutants, and antisense inhibition of socs3a expression improved their exocrine pancreatic growth. TRPM7 is generally overexpressed in human pancreatic adenocarcinoma. TRPM7-deficient cells are impaired in proliferation and arrested in the G0-G1 phases of the cell division cycle. Supplementary Mg2+ rescued the proliferative defect of the TRPM7-deficient cells. Results of this study indicate that Trpm7 regulates exocrine pancreatic development via the Mg2+-sensitive Socs3a pathway, and suggest that aberrant TRPM7-mediated signaling contributes to pancreatic carcinogenesis.

  3. The SOC in cells’ living expectations of Conway’s Game of Life and its extended version

    Wei, Jinling; Zhou, Haiyan; Meng, Jun; Zhang, Fan; Chen, Yunmo; Zhou, Su

    2016-01-01

    In self-organized systems such as Conway’s Game of Life (CGL). Wikipedia, Conway’s game of the life, (https://en.wikipedia.org/wiki/Conway%27s-Game-of-Life)., though whether the single cell will survive or die seems unpredictable, the log–log distribution of all cells living frequency satisfies the 1/f linear law, thus meets the Self-organized Criticality(SOC) rule, which not only proves that CGL is a self-organized system, but more significantly, that the chance of living for each cell is spatial heterogeneous, and is statistical fractal. After carried out CGL, the specified iterative period which begins with a random initial condition and ends when it reaches the homeostasis, add up all the states which the living cells are marked by 1s, and the dead are marked by 0s. The resulted sum picture consisting of cells having its gray level representing the living times during the iterative process. By plotting the gray level distribution of the sum picture on log–log scale, the graph indicates the spatial living expectations distributions. Then we find the curve of the graph satisfies the Self-organized Criticality(SOC) rule, showing its linear feature in the intermediate zone, which also has name of 1/f feature. To examine its universality, we designed a more complicated self-organized cellular automata with each cell having five possible states thus the rule table becomes more complicated. As expected, the consequence shows the similar feature, and the linear feature is even more obvious when the similar experiments are carried out. To conclude, it is a new discovery of SOC from a new perspective. And with the self-organized systems expanding to other different rule tables, this feature may still be satisfied. More further, considering the natural self-organized systems of living creatures, the spatial living expectations of different phenotypes may satisfy the 1/f law, too. Though we regard this as an inspirational orientation, the supposition needs more

  4. Novel sampling methods for atmospheric semi-volatile organic compounds (SOCs) in a high altitude alpine environment

    Offenthaler, I. [Umweltbundesamt GmbH (Austria); Jakobi, G. [Helmholtz Zentrum Muenchen (German Research Centre for Environmental Health) (Germany); Kaiser, A. [ZAMG-Zentralanstalt fuer Meteorologie und Geo-dynamik (Austria); Kirchner, M. [Helmholtz Zentrum Muenchen (German Research Centre for Environmental Health) (Germany); Kraeuchi, N. [WSL-Swiss Federal Institute for Forest, Snow and Landscape Research (Switzerland); Niedermoser, B. [ZAMG-Zentralanstalt fuer Meteorologie und Geo-dynamik (Austria); Schramm, K.-W. [Helmholtz Zentrum Muenchen (German Research Centre for Environmental Health) (Germany); Sedivy, I. [WSL-Swiss Federal Institute for Forest, Snow and Landscape Research (Switzerland); Staudinger, M. [ZAMG-Zentralanstalt fuer Meteorologie und Geo-dynamik (Austria); Thanner, G.; Weiss, P. [Umweltbundesamt GmbH (Austria); Moche, W., E-mail: wolfgang.moche@umweltbundesamt.a [Umweltbundesamt GmbH (Austria)

    2009-12-15

    High- and low-volume active air samplers as well as bulk deposition samplers were developed to sample atmospheric SOCs under the adverse conditions of a mountain environment. Active sampling employed separate filters for different European source regions. Filters were switched depending on daily trajectory forecasts, whose accuracy was evaluated post hoc. The sampling continued on three alpine summits over five periods of four months. The prevailing trajectories varied stronger between sampling periods than between stations. The sampling equipment (active and bulk deposition) proved dependable for operation in a mountain environment, with idle times being mainly due to non-routine manipulations and connectivity. - Equipment for direction-specific air sampling and bulk deposition sampling in mountains was developed and tested.

  5. Black swans, power laws, and dragon-kings: Earthquakes, volcanic eruptions, landslides, wildfires, floods, and SOC models

    Sachs, M. K.; Yoder, M. R.; Turcotte, D. L.; Rundle, J. B.; Malamud, B. D.

    2012-05-01

    Extreme events that change global society have been characterized as black swans. The frequency-size distributions of many natural phenomena are often well approximated by power-law (fractal) distributions. An important question is whether the probability of extreme events can be estimated by extrapolating the power-law distributions. Events that exceed these extrapolations have been characterized as dragon-kings. In this paper we consider extreme events for earthquakes, volcanic eruptions, wildfires, landslides and floods. We also consider the extreme event behavior of three models that exhibit self-organized criticality (SOC): the slider-block, forest-fire, and sand-pile models. Since extrapolations using power-laws are widely used in probabilistic hazard assessment, the occurrence of dragon-king events have important practical implications.

  6. Sticker-type ECG/PPG concurrent monitoring system hybrid integration of CMOS SoC and organic sensor device.

    Yongsu Lee; Hyeonwoo Lee; Seunghyup Yoo; Hoi-Jun Yoo

    2016-08-01

    The sticker-type sensor system is proposed targeting ECG/PPG concurrent monitoring for cardiovascular diseases. The stickers are composed of two types: Hub and Sensor-node (SN) sticker. Low-power CMOS SoC for measuring ECG and PPG signal is hybrid integrated with organic light emitting diodes (OLEDs) and organic photo detector (OPD). The sticker has only 2g weight and only consumes 141μW. The optical calibration loop is adopted for maintaining SNR of PPG signal higher than 30dB. The pulse arrival time (PAT) and SpO2 value can be extracted from various body parts and verified comparing with the reference device from 20 people in-vivo experiments.

  7. Space power technology for the twenty-first century (SPT21)

    Borger, W.U.; Massie, L.D.

    1988-01-01

    During the spring and summer months of 1987, the Aero Propulsion Laboratory of the Air Force Wright Aeronautical Laboratories, Wright-Patterson AFB, Ohio in cooperation with the Air Force Space Technology Center at Kirtland AFB, New Mexico, undertook an initiative to develop a Strategic Plan for Space Power Technology Development. The initiative was called SPT21, Space Power Technology for the Twenty-First Century. The planning process involved the participation of other Government organizations (U.S. Army, Navy, DOE and NASA) along with major aerospace companies and universities. Following an SPT21 kickoff meeting on 28 May 1987, detailed strategic planning was accomplished through seven (7) Space Power Technology Discipline Workshops commencing in June 1987 and concluding in August 1987. Technology Discipline Workshops were conducted in the following areas: (1) Solar Thermal Dynamic Power Systems (2) Solar Photovoltaic Cells and Arrays (3) Thermal Management Technology (4) Energy Storage Technology (5) Nuclear Power Systems Technology (6) Power Conditioning, Distribution and Control and (7) Systems Technology/Advanced Concepts. This technical paper summarizes the planning process and describes the salient findings and conclusions of the workshops

  8. Community Readiness Within Systems of Care: The Validity and Reliability of the System of Care Readiness and Implementation Measurement Scale (SOC-RIMS).

    Rosas, Scott R; Behar, Lenore B; Hydaker, William M

    2016-01-01

    Establishing a system of care requires communities to identify ways to successfully implement strategies and support positive outcomes for children and their families. Such community transformation is complex and communities vary in terms of their readiness for implementing sustainable community interventions. Assessing community readiness and guiding implementation, specifically for the funded communities implementing a system of care, requires a well-designed tool with sound psychometric properties. This scale development study used the results of a previously published concept mapping study to create, administer, and assess the psychometric characteristics of the System of Care Readiness and Implementation Measurement Scale (SOC-RIMS). The results indicate the SOC-RIMS possesses excellent internal consistency characteristics, measures clearly discernible dimensions of community readiness, and demonstrates the target constructs exist within a broad network of content. The SOC-RIMS can be a useful part of a comprehensive assessment in communities where system of care practices, principles, and philosophies are implemented and evaluated.

  9. Time to Detection in Culture Supports Prediction of Low Transmissibility of Tuberculosis and Discontinuation of Isolation for Low-Risk Patients With A Single AFB-Negative and NAAT-Negative Respiratory Specimen.

    Khan, Saahir; Nakasone, Audrey; Ghajar, Minoo; Zhowandai, Mariam; Prabhu, Sunita; Alexander, Rick; Low, Julie; Peterson, Ellena; Thrupp, Lauri

    2018-05-01

    For 94 patients with culture-positive pulmonary tuberculosis, time-to-detection (TTD), acid-fast bacilli (AFB) smear, and nucleic acid amplification test (NAAT) results were reviewed. All 12 patients whose first specimen was negative by AFB smear and NAAT had prolonged TTD, indicating low transmissibility and supporting discontinuing isolation for low-risk patients.Infect Control Hosp Epidemiol 2018;39:619-621.

  10. Metal–organic frameworks to satisfy gas upgrading demands: fine-tuning the soc-MOF platform for the operative removal of H2S

    Belmabkhout, Youssef

    2017-01-06

    A cooperative experimental/modeling strategy was used to unveil the structure/gas separation performance relationship for a series of isostructural metal-organic frameworks (MOFs) with soc-topology (square-octahedral) hosting different extra-framework counter ions (NO3-, Cl- and Br-). In3+-, Fe3+-, Ga3+-and the newly isolated Al(III)-based isostructural soc-MOF were extensively studied and evaluated for the separation-based production of high-quality fuels (i.e., CH4, C3H8 and n-C4H10) and olefins. The structural/chemical fine-tuning of the soc-MOF platform promoted equilibrium-based selectivity toward C2+ (C2H6, C2H4, C3H6 C3H8 and n-C4H10) and conferred the desired chemical stability toward H2S. The noted dual chemical stability and gas/vapor selectivity, which have rarely been reported for equilibrium-based separation agents, are essential for the production of high-purity H-2, CH4 and C2+ fractions in high yields. Interestingly, the evaluated soc-MOF analogues exhibited high selectivity for C2H4, C3H6 and n-C4H10. In particular, the Fe, Ga and Al analogues presented relatively enhanced C2+/CH4 adsorption selectivities. Notably, the Ga and Al analogues were found to be technically preferable because their structural integrities and separation performances were maintained upon exposure to H2S, indicating that these materials are highly tolerant to H2S. Therefore, the Ga-soc-MOF was further examined for the selective adsorption of H2S in the presence of CO2-and CH4-containing streams, such as refinery-off gases (ROG) and natural gas (NG). Grand canonical Monte Carlo (GCMC) simulations based on a specific force field describing the interactions between the guest molecules and the Ga sites supported and confirmed the considerably higher affinity of the Ga-soc-MOF for C2+ (as exemplified by n-C4H10) than for CH4. The careful selection of an appropriate metal for the trinuclear inorganic molecular building block (MBB), i. e., a Ga metal center, imbues the soc

  11. Suppressor of cytokine signalling (SOCS)-3 protects beta cells against IL-1beta-mediated toxicity through inhibition of multiple nuclear factor-kappaB-regulated proapoptotic pathways

    Karlsen, Allan Ertman; Heding, P E; Frobøse, H

    2004-01-01

    The proinflammatory cytokine IL-1beta induces apoptosis in pancreatic beta cells via pathways dependent on nuclear factor-kappaB (NF-kappaB), mitogen-activated protein kinase, and protein kinase C. We recently showed suppressor of cytokine signalling (SOCS)-3 to be a natural negative feedback reg...... regulator of IL-1beta- and IFN-gamma-mediated signalling in rat islets and beta cell lines, preventing their deleterious effects. However, the mechanisms underlying SOCS-3 inhibition of IL-1beta signalling and prevention against apoptosis remain unknown....

  12. Statistical analysis of ground-water contamination at the alert apron and northern landfill areas of Wurtsmith AFB, Michigan. Final report

    Hunter, P.; Naber, S.; Verducci, J.

    1988-07-01

    Two plumes of contamination are analyzed to determine their extent, composition, and movement. The large number of ground-water monitoring wells sampled over the past eight years at Wurtsmith AFB allow this analysis to be performed directly from empirical data, with minimal assumptions about solute transport mechanisms. Conclusions are drawn about the likely sources of contamination in the two plumes, the adequacy of the data for making risk assessments, and the likely consequences of alternative programs of remediation.

  13. Environmental Assessment Addressing FTFA07-1174, Repair Approach Lighting System at the North End of Runway 01/19 at Eglin AFB, Florida

    2013-05-01

    Hyla andersonii Mammals American beaver Castor canadensis Florida black bear2 Ursus americanus floridanus Raccoon Procyon lotor Source: Eglin...water at a frequency and duration to support, and that under normal circumstances do support, a prevalence of vegetation typically adapted to life...virginiana American Beaver Castor canadensis Redbay Persea borbonia Little Blue Heron Egretta caerulea Source: USAF 2006 E-3 E.2 Eglin AFB

  14. Aflatoxin B1 inhibition in Aspergillus flavus by Aspergillus niger through down-regulating expression of major biosynthetic genes and AFB1 degradation by atoxigenic A. flavus.

    Xing, Fuguo; Wang, Limin; Liu, Xiao; Selvaraj, Jonathan Nimal; Wang, Yan; Zhao, Yueju; Liu, Yang

    2017-09-01

    Twenty Aspergillus niger strains were isolated from peanuts and 14 strains were able to completely inhibit AFB 1 production with co-cultivation. By using a Spin-X centrifuge system, it was confirmed that there are some soluble signal molecules or antibiotics involved in the inhibition by A. niger, although they are absent during the initial 24h of A. flavus growth when it is sensitive to inhibition. In A. flavus, 19 of 20 aflatoxin biosynthetic genes were down-regulated by A. niger. Importantly, the expression of aflS was significantly down-regulated, resulting in a reduction of AflS/AflR ratio. The results suggest that A. niger could directly inhibit AFB 1 biosynthesis through reducing the abundance of aflS to aflR mRNAs. Interestingly, atoxigenic A. flavus JZ2 and GZ15 effectively degrade AFB 1 . Two new metabolites were identified and the key toxic lactone and furofuran rings both were destroyed and hydrogenated, meaning that lactonase and reductase might be involved in the degradation process. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Factors which contributed for low quality sputum smears for the detection of acid fast bacilli (AFB) at selected health centers in Ethiopia: A quality control perspective.

    Mekonen, Ayehu; Ayele, Yeshi; Berhan, Yifru; Woldeyohannes, Desalegn; Erku, Woldaregay; Sisay, Solomon

    2018-01-01

    Quality of tuberculosis (TB) microscopy diagnosis is not a guarantee despite implementation of External Quality Assurance (EQA) service in all laboratories of health facilities. Hence, we aimed at evaluating the technical quality and the findings of sputum smear microscopy for acid fast bacilli (AFB) at health centers in Hararge Zone, Oromia Region, Ethiopia. A cross-sectional study was carried out between July 8, 2014 and July 7, 2015.A pre-tested structured questionnaire was used to collect data. Lot Quality Assurance Sampling (LQAS) method was put into practice for collecting all necessary sample slides. Data were analyzed by using SPSS (Statistical Package for Social Sciences) version 20 software. P-value quality, smear size, smear thickness, staining and evenness were indicated in 40 (72.7%), 39 (70.9%), 37 (67.3%), 27(49.1%) and 37 (67.3%) of the collected samples, respectively. False negative AFB findings were significantly associated with lack of Internal Quality Control (IQC) measures (AOR (Adjusted Odds Ratio): 2.90 (95% CI (Confidence Interval): 1.25,6.75) and poor staining procedures (AOR: 2.16(95% CI: 1.01, 5.11). The qualities of AFB smear microscopy reading and smearing were low in most of the laboratories of the health centers. Therefore, it is essential to strength EQA program through building the capacity of laboratory professionals.

  16. Vector wind and vector wind shear models 0 to 27 km altitude for Cape Kennedy, Florida, and Vandenberg AFB, California

    Smith, O. E.

    1976-01-01

    The techniques are presented to derive several statistical wind models. The techniques are from the properties of the multivariate normal probability function. Assuming that the winds can be considered as bivariate normally distributed, then (1) the wind components and conditional wind components are univariate normally distributed, (2) the wind speed is Rayleigh distributed, (3) the conditional distribution of wind speed given a wind direction is Rayleigh distributed, and (4) the frequency of wind direction can be derived. All of these distributions are derived from the 5-sample parameter of wind for the bivariate normal distribution. By further assuming that the winds at two altitudes are quadravariate normally distributed, then the vector wind shear is bivariate normally distributed and the modulus of the vector wind shear is Rayleigh distributed. The conditional probability of wind component shears given a wind component is normally distributed. Examples of these and other properties of the multivariate normal probability distribution function as applied to Cape Kennedy, Florida, and Vandenberg AFB, California, wind data samples are given. A technique to develop a synthetic vector wind profile model of interest to aerospace vehicle applications is presented.

  17. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 3, Appendixes B, C, and D: Final report

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.

  18. A COMMUNITY-BASED COLLEGE STUDY ON ADHERENCE TO DOTS AND RELATED DIAGNOSTIC INNOVATIONS ON AFB STAINING METHOD

    Nilotpal Banerjee

    2016-10-01

    Full Text Available BACKGROUND The geographically isolated underdeveloped state, Tripura of north-eastern region of India has been facing multidimensional problems like unemployment, lack of hygiene, illiteracy, lack of industrialisation, etc. So, it was intended to study the magnitude of reported tuberculosis in the community around the Tripura Medical College through RNTCP. MATERIALS AND METHODS Questionnaire, interrogative methods was primarily adopted. Inspection to different villages around and direct interrogation was done on awareness about the programme. Self-modified innovative method was also adopted to compare scientific reproducibility along with conventional method for AFB staining. RESULTS Analysis of results reveal 28% of people interrogated knew about RNTC programme. 16% of people had seen and heard about the TB staff. 56% of people said that no health staff enquired on other factors like drinking water, mosquito and hygiene, etc. The innovative method of staining proved 100% successful, which was also easier, cheaper and more rapid. CONCLUSION DMC and DOTs services had been quite good as evident from document records and on interrogation to the attendees. 80% of attendees said that they would complete the course of treatment. 83% were happy with the provisions of DOTs and DMC.

  19. Angiotensin II (AngII) induces the expression of suppressor of cytokine signaling (SOCS)-3 in rat hypothalamus - a mechanism for desensitization of AngII signaling.

    Torsoni, Márcio A; Carvalheira, José B; Calegari, Vivian C; Bezerra, Rosangela M N; Saad, Mário J A; Gontijo, José A; Velloso, Lício A

    2004-04-01

    Angiotensin II exerts a potent dypsogenic stimulus on the hypothalamus, which contributes to its centrally mediated participation in the control of water balance and blood pressure. Repetitive intracerebroventricular (i.c.v.) injections of angiotensin II lead to a loss of effect characterized as physiological desensitization to the peptide's action. In the present study, we demonstrate that angiotensin II induces the expression of suppressor of cytokine signaling (SOCS)-3 via angiotensin receptor 1 (AT1) and JAK-2, mostly located at the median preoptic lateral and anterodorsal preoptic nuclei. SOCS-3 produces an inhibitory effect upon the signal transduction pathways of several cytokines and hormones that employ members of the JAK/STAT families as intermediaries. The partial inhibition of SOCS-3 translation by antisense oligonucleotide was sufficient to significantly reduce the refractoriness of repetitive i.c.v. angiotensin II injections, as evaluated by water ingestion. Thus, by acting through AT1 on the hypothalamus, angiotensin II induces the expression of SOCS-3 which, in turn, blocks further activation of the pathway and consequently leads to desensitization to angiotensin II stimuli concerning its dypsogenic effect.

  20. Quantification of SOC and Clay Content Using Visible Near-Infrared Reflectance–Mid-Infrared Reflectance Spectroscopy With Jack-Knifing Partial Least Squares Regression

    Peng, Yi; Knadel, Maria; Gislum, René

    2014-01-01

    A total of 125 soil samples were collected from a Danish field varying in soil texture from sandy to loamy. Visible near-infrared reflectance (Vis-NIR) and mid-infrared reflectance (MIR) spectroscopy combined with chemometric methods were used to predict soil organic carbon (SOC) and clay content...

  1. Early secreted antigen ESAT-6 of Mycobacterium Tuberculosis promotes apoptosis of macrophages via targeting the microRNA155-SOCS1 interaction.

    Yang, Shaojun; Li, Fake; Jia, Shuangrong; Zhang, Kejun; Jiang, Wenbing; Shang, Ya; Chang, Kai; Deng, Shaoli; Chen, Ming

    2015-01-01

    The early secreted antigenic target 6-kDa protein (ESAT-6) of Mycobacterium tuberculosis (Mtb) not only acts as a key player for virulence but also exhibits a strong immunotherapeutic potential against Mtb. However, little is known about the molecular basis for its potential in immunotherapy. The present study was designed to unravel the role of miRNA-155 in ESAT-6-mediated enhancement of host immunity and apoptosis in macrophages. Lentivirus-mediated miR-155 sponge and miR-155 and SOCS1 overexpression vectors were developed in macrophages. TLR2- or p65-specific siRNA knockdown was employed to silence TLR2 or p65. Quantitative polymerase chain reaction and western blotting analyses were performed to determine mRNA and protein expression levels, respectively. Macrophage apoptosis was analyzed by flow cytometry. ESAT-6 significantly increased miR-155 expression, which was dependent on TLR2/NF-κB activation in macrophages. Induced expression of miRNA-155 was required for the ESAT-6-mediated protective immune response and macrophage apoptosis. ESAT-6 promoted macrophage apoptosis by targeting the miR-155-SOCS1 pathway. The differential expression levels of TLR2, BIC, and SOCS1 were involved in regulating the immune response in human peripheral blood mononuclear cells of patients with active tuberculosis (TB) and latent TB (LTB). ESAT-6 promotes apoptosis of macrophages via targeting the miRNA155-SOCS1 interaction. © 2015 S. Karger AG, Basel.

  2. Early Secreted Antigen ESAT-6 of Mycobacterium Tuberculosis Promotes Apoptosis of Macrophages via Targeting the MicroRNA155-SOCS1 Interaction

    Shaojun Yang

    2015-02-01

    Full Text Available Background: The early secreted antigenic target 6-kDa protein (ESAT-6 of Mycobacterium tuberculosis (Mtb not only acts as a key player for virulence but also exhibits a strong immunotherapeutic potential against Mtb. However, little is known about the molecular basis for its potential in immunotherapy. The present study was designed to unravel the role of miRNA-155 in ESAT-6-mediated enhancement of host immunity and apoptosis in macrophages. Methods: Lentivirus-mediated miR-155 sponge and miR-155 and SOCS1 overexpression vectors were developed in macrophages. TLR2- or p65-specific siRNA knockdown was employed to silence TLR2 or p65. Quantitative polymerase chain reaction and western blotting analyses were performed to determine mRNA and protein expression levels, respectively. Macrophage apoptosis was analyzed by flow cytometry. Results: ESAT-6 significantly increased miR-155 expression, which was dependent on TLR2/NF-κB activation in macrophages. Induced expression of miRNA-155 was required for the ESAT-6-mediated protective immune response and macrophage apoptosis. ESAT-6 promoted macrophage apoptosis by targeting the miR-155-SOCS1 pathway. The differential expression levels of TLR2, BIC, and SOCS1 were involved in regulating the immune response in human peripheral blood mononuclear cells of patients with active tuberculosis (TB and latent TB (LTB. Conclusion: ESAT-6 promotes apoptosis of macrophages via targeting the miRNA155-SOCS1 interaction.

  3. Metal–organic frameworks to satisfy gas upgrading demands: fine-tuning the soc-MOF platform for the operative removal of H2S

    Belmabkhout, Youssef; Pillai, Renjith S.; Alezi, Dalal; Shekhah, Osama; Bhatt, Prashant; Chen, Zhijie; Adil, Karim; Vaesen, Sebastien; De Weireld, Guy; Pang, Maolin; Suetin, Mikhail; Cairns, Amy; Solovyeva, Vera; Shkurenko, Aleksander; El Tall, Omar; Maurin, Guillaume; Eddaoudi, Mohamed

    2017-01-01

    -framework counter ions (NO3-, Cl- and Br-). In3+-, Fe3+-, Ga3+-and the newly isolated Al(III)-based isostructural soc-MOF were extensively studied and evaluated for the separation-based production of high-quality fuels (i.e., CH4, C3H8 and n-C4H10) and olefins

  4. Soil Organic Carbon (SOC) distribution in two differents soil types (Podzol and Andosol) under natural forest cover.

    Álvarez-Romero, Marta; Papa, Stefania; Verstraeten, Arne; Cools, Nathalie; Lozano-García, Beatriz; Parras-Alcántara, Luis; Coppola, Elio

    2017-04-01

    Andosols are young soils that shall know a successive evolution towards pedological types where the dominant pedogenetic processes are more evident. Vegetation and climate influence Andosols evolution to other order of soils. In cold and wet climates or on acid vulcanite under heavy leaching young Andosols could change into Podzols (Van Breemn and Buurman, 1998). Were investigated a Podzol soil (World References Base, 2014) at Zoniën (Belgium), were and an Andosol soil (World References Base, 2014) at Lago Laceno (Avellino, Italy). This study shows the data on the SOC (Soil Organic Carbon) fractionation in two profiles from two natural pine forest soils. Together with the conventional activities of sampling and analysis of soil profile were examined surveys meant to fractionation and characterization of SOC, in particular: Total Organic Carbon (TOC) and Total Extractable Carbon (TEC) soil contents were determined by Italian official method of soil analysis (Mi.P.A.F. (2000)). Different soil C fractions were also determined: Humic Acid Carbon (HAC), Fulvic Acid Carbon (FAC), Not Humic Carbon (NHC) and Humin Carbon (Huc) fractions were obtained by difference. In the whole profile, therefore, were also assayed cellulose and lignin contents. The aim of this work was to compare the distribution of different soil organic components in a podzol and a soil with andic properties. The data show great similarity, among the selected profiles, in the organic components distribution estudied. References: - Mi.P.A.F. - Ministero per le Politiche Agricole e Forestali - Osservatorio Nazionale Pedologico e per la Qualità del Suolo (2000): Metodi Ufficiali di Analisi Chimica del Suolo. In: Franco Angeli (Editor), Collana di metodi analitici per l'agricoltura diretta da Paolo Sequi, n. 1124.2, Milano, Italy. - Van Breemn N. and Buurman P. (1998) Chapter 12 Formation of Andisols. In: Soil formation. Kluwer Ed., Wageningen, The Netherlands, 271-289. -Ussiri D.A.N., Johnson C

  5. External quality assessment of AFB smear microscopy performances and its associated factors in selected private health facilities in Addis Ababa, Ethiopia.

    Mosissa, Lemi; Kebede, Abebaw; Mindaye, Tedla; Getahun, Muluwork; Tulu, Sisay; Desta, Kassu

    2016-01-01

    Tuberculosis (TB) is still a public health problem in sub Saharan African countries. In resource-limited settings, TB diagnosis relies on sputum smear microscopy, with low and variable sensitivities, especially in paucibacillary pediatric and HIV-associated TB patients. Tuberculosis microscopy centers have several weaknesses like overworking, insufficiently trained personnel, inconsistent reagent supplies, and poorly maintained equipments; thus, there is a critical need for investments in laboratory infrastructure, capacity building, and quality assurance schemes. The performance of TB microscopy centers in the private health facilities in Addis Ababa is not known so far. The main objective of the study was to assess laboratory performance of acid fast bacilli (AFB) smear microscopy and its associated factors in selected private health facilities in Addis Ababa, Ethiopia. A cross-sectional study was conducted in 33 selected private health facilities of Addis Ababa, Ethiopia comprising 7 hospitals, 2 NGO health centers, 23 higher clinics and 1 diagnostic laboratory that provide AFB smear microscopy services. The study was conducted from January to April 2014. A total of 283 stained sputum smears were randomly collected from participant laboratories for blinded rechecking, 320 panel slides were sent to 32 microscopy centers to evaluate their performance on AFB reading, staining and reporting. Checklists were used to assess quality issues of laboratories. Data were captured, cleaned, and analyzed using SPSS version 16.0; χ(2) tests, kappa statistics were used for comparison purpose. P value laboratories, 2-scored 100%, 15 scored 80-95% & the remaining 15 scored 50-75% for overall proficiency test performance. There were 10 (3.15%) major errors and 121 (37.8%) minor errors. The sensitivity, specificity, PPV and NPV of panel reading by microscopy centers were 89%, 96%, 96%, and 90% respectively. Out of 283 randomly selected slides for blind rechecking, 11 (3.9%) slides

  6. 60 GHz system-on-chip (SoC) with built-in memory and an on-chip antenna

    Ghaffar, Farhan A.; Arsalan, Muhammad; Cheema, Hammad; Salama, Khaled N.; Shamim, Atif

    2014-01-01

    A novel 60 GHz transmitter SoC with an on-chip antenna and integrated memory in CMOS 65 nm technology is presented in this paper. This highly integrated transmitter design can support a data rate of 2 GBPS with a transmission range of 1 m. The transmitter consists of a fundamental frequency 60 GHz PLL which covers the complete ISM band. The modulator following the PLL can support both BPSK and OOK modulation schemes. Both stored data on the integrated memory or directly from an external source can be transmitted. A tapered slot on chip antenna is integrated with the power amplifier to complete the front end of the transmitter design. Size of the complete transmitter with on-chip antenna is only 1.96 mm × 1.96 mm. The core circuits consume less than 100 mW of power. The high data rate capability of the design makes it extremely suitable for bandwidth hungry applications such as unencrypted HD video streaming and transmission.

  7. 60 GHz system-on-chip (SoC) with built-in memory and an on-chip antenna

    Ghaffar, Farhan A.

    2014-04-01

    A novel 60 GHz transmitter SoC with an on-chip antenna and integrated memory in CMOS 65 nm technology is presented in this paper. This highly integrated transmitter design can support a data rate of 2 GBPS with a transmission range of 1 m. The transmitter consists of a fundamental frequency 60 GHz PLL which covers the complete ISM band. The modulator following the PLL can support both BPSK and OOK modulation schemes. Both stored data on the integrated memory or directly from an external source can be transmitted. A tapered slot on chip antenna is integrated with the power amplifier to complete the front end of the transmitter design. Size of the complete transmitter with on-chip antenna is only 1.96 mm × 1.96 mm. The core circuits consume less than 100 mW of power. The high data rate capability of the design makes it extremely suitable for bandwidth hungry applications such as unencrypted HD video streaming and transmission.

  8. Implementation of a wireless ECG acquisition SoC for IEEE 802.15.4 (ZigBee) applications.

    Wang, Liang-Hung; Chen, Tsung-Yen; Lin, Kuang-Hao; Fang, Qiang; Lee, Shuenn-Yuh

    2015-01-01

    This paper presents a wireless biosignal acquisition system-on-a-chip (WBSA-SoC) specialized for electrocardiogram (ECG) monitoring. The proposed system consists of three subsystems, namely, 1) the ECG acquisition node, 2) the protocol for standard IEEE 802.15.4 ZigBee system, and 3) the RF transmitter circuits. The ZigBee protocol is adopted for wireless communication to achieve high integration, applicability, and portability. A fully integrated CMOS RF front end containing a quadrature voltage-controlled oscillator and a 2.4-GHz low-IF (i.e., zero-IF) transmitter is employed to transmit ECG signals through wireless communication. The low-power WBSA-SoC is implemented by the TSMC 0.18-μm standard CMOS process. An ARM-based displayer with FPGA demodulation and an RF receiver with analog-to-digital mixed-mode circuits are constructed as verification platform to demonstrate the wireless ECG acquisition system. Measurement results on the human body show that the proposed SoC can effectively acquire ECG signals.

  9. The pea branching RMS2 gene encodes the PsAFB4/5 auxin receptor and is involved in an auxin-strigolactone regulation loop.

    Ligerot, Yasmine; de Saint Germain, Alexandre; Waldie, Tanya; Troadec, Christelle; Citerne, Sylvie; Kadakia, Nikita; Pillot, Jean-Paul; Prigge, Michael; Aubert, Grégoire; Bendahmane, Abdelhafid; Leyser, Ottoline; Estelle, Mark; Debellé, Frédéric; Rameau, Catherine

    2017-12-01

    Strigolactones (SLs) are well known for their role in repressing shoot branching. In pea, increased transcript levels of SL biosynthesis genes are observed in stems of highly branched SL deficient (ramosus1 (rms1) and rms5) and SL response (rms3 and rms4) mutants indicative of negative feedback control. In contrast, the highly branched rms2 mutant has reduced transcript levels of SL biosynthesis genes. Grafting studies and hormone quantification led to a model where RMS2 mediates a shoot-to-root feedback signal that regulates both SL biosynthesis gene transcript levels and xylem sap levels of cytokinin exported from roots. Here we cloned RMS2 using synteny with Medicago truncatula and demonstrated that it encodes a putative auxin receptor of the AFB4/5 clade. Phenotypes similar to rms2 were found in Arabidopsis afb4/5 mutants, including increased shoot branching, low expression of SL biosynthesis genes and high auxin levels in stems. Moreover, afb4/5 and rms2 display a specific resistance to the herbicide picloram. Yeast-two-hybrid experiments supported the hypothesis that the RMS2 protein functions as an auxin receptor. SL root feeding using hydroponics repressed auxin levels in stems and down-regulated transcript levels of auxin biosynthesis genes within one hour. This auxin down-regulation was also observed in plants treated with the polar auxin transport inhibitor NPA. Together these data suggest a homeostatic feedback loop in which auxin up-regulates SL synthesis in an RMS2-dependent manner and SL down-regulates auxin synthesis in an RMS3 and RMS4-dependent manner.

  10. A Dictionary of Acquisition and Contracting Terms

    Colyer, Timothy

    1997-01-01

    This thesis is part of a joint research project between stndents of the Naval Postgraduate School in Monterey, CA and the Air Force Institute of Technology, Wright- Patterson Air Force Base, Dayton, OH...

  11. Management of Contracts for F110 Engine Procurements

    Granetto, Paul

    2001-01-01

    This audit was performed in response to an allegation to the Defense Hotline that the Wright-Patterson Air Force Base Procurement Contracting Office made poor procurement decisions on F110 aircraft engine contracts...

  12. Anàlisi i integració de models de programació paral·lels en SoC Tegra 2

    Prat Robles, David

    2011-01-01

    Anàlisi i integració de models de programació paral.lels en SoC Tegra 2 Instal·lació Linux i verificació del funcionament Benchmarks amb altres processadors Escalabilitat de Pthreads VS OpenMP Muntatge del clúster amb MPI Mesures des la xarxa Ethernet Portar StarSs amb NANOS++ a ARMv7 Mesures de consum i temperatura Conclusions i prediccions

  13. Postlingual deaf speech and the role of audition in speech production: comments on Waldstein's paper [R.S. Waldstein, J. Acoust. Soc. Am. 88, 2099-2114 (1990)].

    Sapir, S; Canter, G J

    1991-09-01

    Using acoustic analysis techniques, Waldstein [J. Acoust. Soc. Am. 88, 2099-2114 (1990] reported abnormal speech findings in postlingual deaf speakers. She interpreted her findings to suggest that auditory feedback is important in motor speech control. However, it is argued here that Waldstein's interpretation may be unwarranted without addressing the possibility of neurologic deficits (e.g., dysarthria) as confounding (or even primary) causes of the abnormal speech in her subjects.

  14. Egr2 enhances insulin resistance via JAK2/STAT3/SOCS-1 pathway in HepG2 cells treated with palmitate.

    Lu, Lin; Ye, Xinhua; Yao, Qing; Lu, Aijiao; Zhao, Zhen; Ding, Yang; Meng, Chuchen; Yu, Wenlong; Du, Yunfeng; Cheng, JinLuo

    2018-05-01

    Insulin resistance is generally responsible for the pathogenesis of type 2 diabetes mellitus (T2DM). Early growth response proteins-2 (Egr2) has been reported to be able to increase the expression of the suppressors of cytokine signaling-1 (SOCS-1), and impair insulin signaling pathway through suppression of insulin receptor substrates (IRS), including IRS-1 and IRS-2. However, whether Egr2 is directly involved in the development of insulin resistance, and how its potential contributions to insulin resistance still remain unknown. Here, our present investigation found that the expression levels of Egr2 were up-regulated when insulin resistance occurs, and knockdown of Egr2 abolished the effect of insulin resistance in HepG2 cells induced with palmitate (PA). Importantly, inhibition of Egr2 decreased the expression of SOCS-1 as well as reduced phosphorylation of JAK2 and STAT3. And, our data indicated that silencing of Egr2 accelerated hepatic glucose uptake and reversed the impaired lipid metabolism upon insulin resistance. In summary, the present study confirms that Egr2 could deteriorate insulin resistance via the pathway of JAK2/STAT3/SOCS-1 and may shed light on resolving insulin resistance and further the pathogenesis of T2DM. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Semivolatile Organic Compounds (SOCs) in Fine Particulate Matter (PM2.5) during Clear, Fog, and Haze Episodes in Winter in Beijing, China.

    Wang, Ting; Tian, Mi; Ding, Nan; Yan, Xiao; Chen, She-Jun; Mo, Yang-Zhi; Yang, Wei-Qiang; Bi, Xin-Hui; Wang, Xin-Ming; Mai, Bi-Xian

    2018-05-01

    Few efforts have been made to elucidate the influence of weather conditions on the fate of semivolatile organic compounds (SOCs). Here, daily fine particulate matter (PM 2.5 ) during clear, haze, and fog episodes collected in the winter in Beijing, China was analyzed for polycyclic aromatic hydrocarbons (PAHs), brominated flame retardants (BFRs), and organophosphate flame retardants (OPFRs). The total concentrations of PAHs, OPFRs, and BFRs had medians of 45.1 ng/m 3 and 1347 and 46.7 pg/m 3 , respectively. The temporal pattern for PAH concentrations was largely dependent on coal combustion for residential heating. OPFR compositions that change during colder period were related to enhanced indoor emissions due to heating. The mean concentrations of SOCs during haze and fog days were 2-10 times higher than those during clear days. We found that BFRs with lower octanol and air partition coefficients tended to increase during haze and fog episodes, be removed from PM 2.5 during clear episodes, or both. For PAHs and OPFRs, pollutants that are more recalcitrant to degradation were prone to accumulate during haze and fog days. The potential source contribution function (PSCF) model indicated that southern and eastern cities were major source regions of SOCs at this site.

  16. A 6.45 μW Self-Powered SoC With Integrated Energy-Harvesting Power Management and ULP Asymmetric Radios for Portable Biomedical Systems.

    Roy, Abhishek; Klinefelter, Alicia; Yahya, Farah B; Chen, Xing; Gonzalez-Guerrero, Luisa Patricia; Lukas, Christopher J; Kamakshi, Divya Akella; Boley, James; Craig, Kyle; Faisal, Muhammad; Oh, Seunghyun; Roberts, Nathan E; Shakhsheer, Yousef; Shrivastava, Aatmesh; Vasudevan, Dilip P; Wentzloff, David D; Calhoun, Benton H

    2015-12-01

    This paper presents a batteryless system-on-chip (SoC) that operates off energy harvested from indoor solar cells and/or thermoelectric generators (TEGs) on the body. Fabricated in a commercial 0.13 μW process, this SoC sensing platform consists of an integrated energy harvesting and power management unit (EH-PMU) with maximum power point tracking, multiple sensing modalities, programmable core and a low power microcontroller with several hardware accelerators to enable energy-efficient digital signal processing, ultra-low-power (ULP) asymmetric radios for wireless transmission, and a 100 nW wake-up radio. The EH-PMU achieves a peak end-to-end efficiency of 75% delivering power to a 100 μA load. In an example motion detection application, the SoC reads data from an accelerometer through SPI, processes it, and sends it over the radio. The SPI and digital processing consume only 2.27 μW, while the integrated radio consumes 4.18 μW when transmitting at 187.5 kbps for a total of 6.45 μW.

  17. Universal interface on Zynq{sup ®} SoC with CAN, RS-232, Ethernet and AXI GPIO for instrumentation & control

    Kumar, Abhijeet, E-mail: akumar@ipr.res.in; Rajpal, Rachana; Pujara, Harshad; Mandaliya, Hitesh; Edappala, Praveenalal

    2016-11-15

    Highlights: • We have designed Universal Interface on Zynq{sup ®} SoC with CAN, RS-232, Ethernet and AXI GPIO for Instrumentation & Control. This project is based on Zynq{sup ®}-7000 family xc7z020clg484-1 chip. • We explored the full design flow starting from the hardware development in Vivado to software development in SDK using APIs in C language and then interfacing the host application developed in LabVIEW. • We also explored how to make custom IP with AXI bus interface in Vivado. • Useful for those who wants to make custom hardware on Zynq{sup ®} SoC. - Abstract: This paper describes an application developed on the latest Zynq{sup ®}-7000 All Programmable SoC (AP SoC) [1] devices which integrate the software programmability of an ARM{sup ®}-based processor with the hardware programmability of an FPGA, on a single device. In this paper we have implemented application which uses various interfaces like CAN, RS-232, Ethernet and AXI GPIO, so that our host application running on PC in LabVIEW can communicates with any hardware which has at least any one of the available interface. Zynq-7000 All Programmable SoCs (System On Chip) infuse customizable intelligence into today’s embedded systems to suit your unique application requirements. This family of FPGA is meant for high end application because it has huge resources on single chip. It offers you to make your own custom hardware IP, in fact we have made our custom IP called myIP in our design. The beauty of this chip is that it can write drivers for your custom IP which has AXI bus layer attached. After exporting the hardware information to the Software Development Kit (SDK), the tool is able to write drivers for your custom IP. This simplifies your development to a great extent. In a way this application provides the universal interfacing option to user. User can also write the digital data on the GPIO (General Purpose Input Output) through LabVIEW Test application GUI. This project can be used

  18. Hypomethylation of inflammatory genes (COX2, EGR1, and SOCS3) and increased urinary 8-nitroguanine in arsenic-exposed newborns and children

    Phookphan, Preeyaphan; Navasumrit, Panida [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Laksi, Bangkok (Thailand); Post-graduate Program in Environmental Toxicology, Chulabhorn Graduate Institute, Laksi, Bangkok (Thailand); Center of Excellence on Environmental Health, Toxicology (EHT), Office of the Higher Education Commission, Ministry of Education (Thailand); Waraprasit, Somchamai; Promvijit, Jeerawan; Chaisatra, Krittinee; Ngaotepprutaram, Thitirat [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Laksi, Bangkok (Thailand); Ruchirawat, Mathuros, E-mail: mathuros@cri.or.th [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Laksi, Bangkok (Thailand); Center of Excellence on Environmental Health, Toxicology (EHT), Office of the Higher Education Commission, Ministry of Education (Thailand)

    2017-02-01

    Early-life exposure to arsenic increases risk of developing a variety of non-malignant and malignant diseases. Arsenic-induced carcinogenesis may be mediated through epigenetic mechanisms and pathways leading to inflammation. Our previous study reported that prenatal arsenic exposure leads to increased mRNA expression of several genes related to inflammation, including COX2, EGR1, and SOCS3. This study aimed to investigate the effects of arsenic exposure on promoter DNA methylation and mRNA expression of these inflammatory genes (COX2, EGR1, and SOCS3), as well as the generation of 8-nitroguanine, which is a mutagenic DNA lesion involved in inflammation-related carcinogenesis. Prenatally arsenic-exposed newborns had promoter hypomethylation of COX2, EGR1, and SOCS3 in cord blood lymphocytes (p < 0.01). A follow-up study in these prenatally arsenic-exposed children showed a significant hypomethylation of these genes in salivary DNA (p < 0.01). In vitro experiments confirmed that arsenite treatment at short-term high doses (10–100 μM) and long-term low doses (0.5–1 μM) in human lymphoblasts (RPMI 1788) caused promoter hypomethylation of these genes, which was in concordance with an increase in their mRNA expression. Additionally, the level of urinary 8-nitroguanine was significantly higher (p < 0.01) in exposed newborns and children, by 1.4- and 1.8-fold, respectively. Arsenic accumulation in toenails was negatively correlated with hypomethylation of these genes and positively correlated with levels of 8-nitroguanine. These results indicated that early-life exposure to arsenic causes hypomethylation of COX2, EGR1, and SOCS3, increases mRNA expression of these genes, and increases 8-nitroguanine formation. These effects may be linked to mechanisms of arsenic-induced inflammation and cancer development later in life. - Highlight: • Early-life arsenic exposure caused promoter hypomethylation of COX2, EGR1 and SOCS3. • Hypomethylation of these genes is

  19. Hypomethylation of inflammatory genes (COX2, EGR1, and SOCS3) and increased urinary 8-nitroguanine in arsenic-exposed newborns and children

    Phookphan, Preeyaphan; Navasumrit, Panida; Waraprasit, Somchamai; Promvijit, Jeerawan; Chaisatra, Krittinee; Ngaotepprutaram, Thitirat; Ruchirawat, Mathuros

    2017-01-01

    Early-life exposure to arsenic increases risk of developing a variety of non-malignant and malignant diseases. Arsenic-induced carcinogenesis may be mediated through epigenetic mechanisms and pathways leading to inflammation. Our previous study reported that prenatal arsenic exposure leads to increased mRNA expression of several genes related to inflammation, including COX2, EGR1, and SOCS3. This study aimed to investigate the effects of arsenic exposure on promoter DNA methylation and mRNA expression of these inflammatory genes (COX2, EGR1, and SOCS3), as well as the generation of 8-nitroguanine, which is a mutagenic DNA lesion involved in inflammation-related carcinogenesis. Prenatally arsenic-exposed newborns had promoter hypomethylation of COX2, EGR1, and SOCS3 in cord blood lymphocytes (p < 0.01). A follow-up study in these prenatally arsenic-exposed children showed a significant hypomethylation of these genes in salivary DNA (p < 0.01). In vitro experiments confirmed that arsenite treatment at short-term high doses (10–100 μM) and long-term low doses (0.5–1 μM) in human lymphoblasts (RPMI 1788) caused promoter hypomethylation of these genes, which was in concordance with an increase in their mRNA expression. Additionally, the level of urinary 8-nitroguanine was significantly higher (p < 0.01) in exposed newborns and children, by 1.4- and 1.8-fold, respectively. Arsenic accumulation in toenails was negatively correlated with hypomethylation of these genes and positively correlated with levels of 8-nitroguanine. These results indicated that early-life exposure to arsenic causes hypomethylation of COX2, EGR1, and SOCS3, increases mRNA expression of these genes, and increases 8-nitroguanine formation. These effects may be linked to mechanisms of arsenic-induced inflammation and cancer development later in life. - Highlight: • Early-life arsenic exposure caused promoter hypomethylation of COX2, EGR1 and SOCS3. • Hypomethylation of these genes is

  20. An engineering code to analyze hypersonic thermal management systems

    Vangriethuysen, Valerie J.; Wallace, Clark E.

    1993-01-01

    Thermal loads on current and future aircraft are increasing and as a result are stressing the energy collection, control, and dissipation capabilities of current thermal management systems and technology. The thermal loads for hypersonic vehicles will be no exception. In fact, with their projected high heat loads and fluxes, hypersonic vehicles are a prime example of systems that will require thermal management systems (TMS) that have been optimized and integrated with the entire vehicle to the maximum extent possible during the initial design stages. This will not only be to meet operational requirements, but also to fulfill weight and performance constraints in order for the vehicle to takeoff and complete its mission successfully. To meet this challenge, the TMS can no longer be two or more entirely independent systems, nor can thermal management be an after thought in the design process, the typical pervasive approach in the past. Instead, a TMS that was integrated throughout the entire vehicle and subsequently optimized will be required. To accomplish this, a method that iteratively optimizes the TMS throughout the vehicle will not only be highly desirable, but advantageous in order to reduce the manhours normally required to conduct the necessary tradeoff studies and comparisons. A thermal management engineering computer code that is under development and being managed at Wright Laboratory, Wright-Patterson AFB, is discussed. The primary goal of the code is to aid in the development of a hypersonic vehicle TMS that has been optimized and integrated on a total vehicle basis.

  1. Combustion chemical vapor deposition (CCVD) of LaPO4 monazite and beta-alumina on alumina fibers for ceramic matrix composites

    Hwang, T.J.; Hendrick, M.R.; Shao, H.; Hornis, H.G.; Hunt, A.T.

    1998-01-01

    This research used the low cost, open atmosphere combustion chemical vapor deposition (CCVD SM ) method to efficiently deposit protective coatings onto alumina fibers (3M Nextel TM 610) for use in ceramic matrix composites (CMCs). La-monazite (LaPO 4 ) and beta-alumina were the primary candidate debonding coating materials investigated. The coated fibers provide thermochemical stability, as well as desired debonding/sliding interface characteristics to the CMC. Dense and uniform La-phosphate coatings were obtained at deposition temperatures as low as 900-1000 C with minimal degradation of fibers. However, all of the β-alumina phases required high deposition temperatures and, thus, could not be applied onto the Nextel TM 610 alumina fibers. The fibers appeared to have complete and relatively uniform coatings around individual filaments when 420 and 1260 filament tows were coated via the CCVD process. Fibers up to 3 feet long were fed through the deposition flame in the laboratory of MicroCoating Technologies (MCT). TEM analyses performed at Wright-Patterson AFB on the CCVD coated fibers showed a 10-30 nm thick La-rich layer at the fiber/coating interface, and a layer of columnar monazite 0.1-1 μm thick covered with sooty carbon of <50 nm thick on the outside. A single strength test on CCVD coated fibers performed by 3M showed that the strength value fell in the higher end of data from other CVD coated samples. (orig.)

  2. Fitting modular reconnaissance systems into modern high-performance aircraft

    Stroot, Jacquelyn R.; Pingel, Leslie L.

    1990-11-01

    The installation of the Advanced Tactical Air Reconnaissance System (ATARS) in the F/A-18D(RC) presented a complex set of design challenges. At the time of the F/A-18D(RC) ATARS option exercise, the design and development of the ATARS subsystems and the parameters of the F/A-18D(RC) were essentially fixed. ATARS is to be installed in the gun bay of the F/A-18D(RC), taking up no additional room, nor adding any more weight than what was removed. The F/A-18D(RC) installation solution required innovations in mounting, cooling, and fit techniques, which made constant trade study essential. The successful installation in the F/A-18D(RC) is the result of coupling fundamental design engineering with brainstorming and nonstandard approaches to every situation. ATARS is sponsored by the Aeronautical Systems Division, Wright-Patterson AFB, Ohio. The F/A-18D(RC) installation is being funded to the Air Force by the Naval Air Systems Command, Washington, D.C.

  3. Femtosecond index change mechanisms and morphology of SiC crystalline materials

    DesAutels, Logan; Brewer, Christopher; Powers, Peter; Walker, Mark; Tomlin, David; Fratini, Albert; Juhl, Shane; Chen Weibin

    2009-01-01

    Femtosecond lasers have a unique ability of processing bulk transparent materials for various applications such as micromachining, waveguide manufacturing, and photonic bandgap structures just to name a few. These applications depend on the formation of micron or submicron size features that are known to be index modifications to the bulk substrate [H. Guo, H. Jiang, Y. Fang, C. Peng, H. Yang, Y. Li, Q. Gong, J. Opt. A: Pure Appl. Opt. 6 (2004) 787]. To the best of our knowledge the physical understanding of how these index-modified features are formed is still unknown, but many good theories exist such as Petite et al. [G. Petite, P. Daguzan, S. Guizard, P. Martin, in: IEEE Annual Report Conference on Electrical Insulation and Dielectric Phenomena, vol. 15, IEEE, 1995, pp. 40-44] or Tien et al. [A. Tien, S. Backus, H. Kapteyn, M. Murnane, G. Mourou, Phys. Rev. Lett. 82 (1999) 3883]. In this Letter the question on the physical cause for index changes is investigated by the combined efforts between Wright-Patterson AFB (WPAFB) and the University of Dayton (UD) using numerous imaging equipment such as TEM, AFM, NSOM, Nomarski microscopy, X-ray crystallography, Raman spectroscopy, and even diffraction efficiency experiments. With all the combined imaging equipment this research is able to present valuable data and deduce plausible theories of the physics of the index modification mechanism

  4. Lipopolysaccharide (LPS) stimulates adipokine and socs3 gene expression in mouse brain and pituitary gland in vivo, and in N-1 hypothalamic neurons in vitro.

    Brown, Russell; Imran, Syed A; Wilkinson, Michael

    2009-04-30

    Adipokines that modulate metabolic and inflammatory responses, such as resistin (rstn) and fasting-induced adipose factor (fiaf), are also expressed in mouse brain and pituitary gland. Since lipopolysaccharide (LPS)-induced endotoxinemia provokes an anorectic response via a hypothalamic-dependent mechanism we hypothesized that LPS would also modify hypothalamic adipokine expression. Challenging male CD-1 mice with LPS (5 mg/kg; s.c.) significantly reduced bodyweight (24 h) and realtime RT-PCR revealed time- and tissue-dependent increases in rstn, fiaf and suppressor of cytokine signaling-3 (socs-3) mRNA in hypothalamic, pituitary, cortical and adipose tissues. Gene expression was rapidly increased (3-6 h) in the hypothalamus and pituitary, but returned to normal within 24 h. In contrast, with the exception of rstn in fat, the expression of target genes remained elevated in cortex and visceral fat at 24 h post-injection. In order to more specifically examine the hypothalamic response to LPS we investigated its effects directly on N-1 hypothalamic neurons in vitro. LPS (25 microg/mL; 3 h) had no effect on rstn mRNA, but significantly stimulated fiaf and socs-3 expression. Although various toll-like receptor 4 (TLR4) antagonists (parthenolide, PD098059, and SB202190) did not prevent the LPS-induced increases in fiaf and socs-3, they did partially attenuate its stimulatory effects. We conclude that LPS treatment increases the expression of central, and possibly neuronal, adipokine genes which may influence local tissue repair and function, but could also have downstream consequences on the hypothalamic control of appetite and energy metabolism following an inflammatory insult.

  5. Ankyrin repeat and SOCS box containing protein 4 (Asb-4 colocalizes with insulin receptor substrate 4 (IRS4 in the hypothalamic neurons and mediates IRS4 degradation

    Xia Zefeng

    2011-09-01

    Full Text Available Abstract Background The arcuate nucleus of the hypothalamus regulates food intake. Ankyrin repeat and SOCS box containing protein 4 (Asb-4 is expressed in neuropeptide Y and proopiomelanocortin (POMC neurons in the arcuate nucleus, target neurons in the regulation of food intake and metabolism by insulin and leptin. However, the target protein(s of Asb-4 in these neurons remains unknown. Insulin receptor substrate 4 (IRS4 is an adaptor molecule involved in the signal transduction by both insulin and leptin. In the present study we examined the colocalization and interaction of Asb-4 with IRS4 and the involvement of Asb-4 in insulin signaling. Results In situ hybridization showed that the expression pattern of Asb-4 was consistent with that of IRS4 in the rat brain. Double in situ hybridization showed that IRS4 colocalized with Asb-4, and both Asb-4 and IRS4 mRNA were expressed in proopiomelanocortin (POMC and neuropeptide Y (NPY neurons within the arcuate nucleus of the hypothalamus. In HEK293 cells co-transfected with Myc-tagged Asb-4 and Flag-tagged IRS4, Asb-4 co-immunoprecipitated with IRS4; In these cells endogenous IRS4 also co-immunoprecipitated with transfected Myc-Asb-4; Furthermore, Asb-4 co-immunoprecipitated with IRS4 in rat hypothalamic extracts. In HEK293 cells over expression of Asb-4 decreased IRS4 protein levels and deletion of the SOCS box abolished this effect. Asb-4 increased the ubiquitination of IRS4; Deletion of SOCS box abolished this effect. Expression of Asb-4 decreased both basal and insulin-stimulated phosphorylation of AKT at Thr308. Conclusions These data demonstrated that Asb-4 co-localizes and interacts with IRS4 in hypothalamic neurons. The interaction of Asb-4 with IRS4 in cell lines mediates the degradation of IRS4 and decreases insulin signaling.

  6. Preliminary Electrochemical Characterization of Anode Supported Solid Oxide Cell (AS-SOC) Produced in the Institute of Power Engineering Operated in Electrolysis Mode (SOEC)

    Kupecki, Jakub; Motyliński, Konrad; Skrzypkiewicz, Marek; Wierzbicki, Michał; Naumovich, Yevgeniy

    2017-12-01

    The article discusses the operation of solid oxide electrochemical cells (SOC) developed in the Institute of Power Engineering as prospective key components of power-to-gas systems. The fundamentals of the solid oxide cells operated as fuel cells (SOFC - solid oxide fuel cells) and electrolysers (SOEC - solid oxide fuel cells) are given. The experimental technique used for electrochemical characterization of cells is presented. The results obtained for planar cell with anodic support are given and discussed. Based on the results, the applicability of the cells in power-to-gas systems (P2G) is evaluated.

  7. Pharmacogenetics of efficacy and safety of HCV treatment in HCV-HIV coinfected patients: significant associations with IL28B and SOCS3 gene variants.

    Francesc Vidal

    Full Text Available This was a safety and efficacy pharmacogenetic study of a previously performed randomized trial which compared the effectiveness of treatment of hepatitis C virus infection with pegylated interferon alpha (pegIFNα 2a vs. 2b, both with ribavirin, for 48 weeks, in HCV-HIV coinfected patients.The study groups were made of 99 patients (efficacy pharmacogenetic substudy and of 114 patients (safety pharmacogenetic substudy. Polymorphisms in the following candidate genes IL28B, IL6, IL10, TNFα, IFNγ, CCL5, MxA, OAS1, SOCS3, CTLA4 and ITPA were assessed. Genotyping was carried out using Sequenom iPLEX-Gold, a single-base extension polymerase chain reaction. Efficacy end-points assessed were: rapid, early and sustained virological response (RVR, EVR and SVR, respectively. Safety end-points assessed were: anemia, neutropenia, thrombocytopenia, flu-like syndrome, gastrointestinal disturbances and depression. Chi square test, Student's T test, Mann-Whitney U test and logistic regression were used for statistic analyses.As efficacy is concerned, IL28B and CTLA4 gene polymorphisms were associated with RVR (p<0.05 for both comparisons. Nevertheless, only polymorphism in the IL28B gene was associated with SVR (p = 0.004. In the multivariate analysis, the only gene independently associated with SVR was IL28B (OR 2.61, 95%CI 1.2-5.6, p = 0.01. With respect to safety, there were no significant associations between flu-like syndrome or depression and the genetic variants studied. Gastrointestinal disturbances were associated with ITPA gene polymorphism (p = 0.04. Anemia was associated with OAS1 and CTLA4 gene polymorphisms (p = 0.049 and p = 0.045, respectively, neutropenia and thromobocytopenia were associated with SOCS3 gene polymorphism (p = 0.02 and p = 0.002, respectively. In the multivariate analysis, the associations of the SOCS3 gene polymorphism with neutropenia (OR 0.26, 95%CI 0.09-0.75, p = 0.01 and thrombocytopenia (OR

  8. Diseño de una Red de Sensores Inalámbrica para un Sistema de Observación Costero (SOC)

    Albaladejo Pérez, Cristina

    2009-01-01

    Las Redes de Sensores Inalámbricas (Wireless Sensor Network, WSN) son un conjunto de dispositivos que permiten una comunicación sin cables, interconectados entre sí a través de una red inalámbrica y a su vez conectados a un sistema central en el que se recopilará la información recogida por cada uno de los sensores. En el presente Trabajo Fin de Máster se persigue realizar un estudio teórico sobre el diseño de una WSN para un Sistema de Observación Costero (SOC) cuyo objetivo es la monitoriz...

  9. A method for the densification of ceramic layers, especially ceramic layers within solid oxide cell (SOC) technology, and products obtained by the method

    2013-01-01

    A ceramic layer, especially for use in solid oxide cell (SOC) technology, is densified in a method comprising (a) providing a multilayer system by depositing the porous ceramic layer, which is to be densified, onto the selected system of ceramic layers on a support, (b) pre-sintering the resulting......(s) in the porous layer surface and (e) performing a thermal treatment at a temperature T2, where T2 > ?1, to obtain densification of and grain growth in the porous layer formed in step (b). The method makes it possible to obtain dense ceramic layers at temperatures, which are compatible with the other materials...... present in a ceramic multilayer system....

  10. Risk assessment of aflatoxins B1 (AFB1) in corn arepas in Colombia and chemical risk assessment case study mercury in Fish

    Correa Lizarazo, D.

    2013-01-01

    The power point presentation is about: Identify the pair substrate (corn, wheat and rice) - mycotoxin (DON, AFB1) higher risk for the Colombian population, based on the exposure assessment and mercury in freshwater fish from Colombia. This report answer some the following questions: what are the most consumed products in the country, which may create a risk for the Colombian population, what are the prevention and control recommendations to reduce potential contamination of the products selected, what are economic activities and their impact areas that contribute most to the incorporation of of mercury in freshwater fish from Colombia,what are the species that may pose greater accumulation of mercury and methylmercury identified , what is the risk associated with the consumption of the species, what are the preventive measures to minimize exposure from consumption of fish with mercury and methylmercury and possible intervention strategies

  11. Interaction of mammary bovine ABCG2 with AFB1 and its metabolites and regulation by PCB 126 in a MDCKII in vitro model.

    Manzini, L; Halwachs, S; Girolami, F; Badino, P; Honscha, W; Nebbia, C

    2017-12-01

    The ATP-binding cassette efflux transporter ABCG2 plays a key role in the mammary excretion of drugs and toxins in humans and animals. Aflatoxins (AF) are worldwide contaminants of food and feed commodities, while PCB 126 is a dioxin-like PCB which may contaminate milk and dairy products. Both compounds are known human carcinogens. The interactions between AF and bovine ABCG2 (bABCG2) as well as the effects of PCB 126 on its efflux activity have been investigated by means of the Hoechst H33342 transport assay in MDCKII cells stably expressing mammary bABCG2. Both AFB1 and its main milk metabolite AFM1 showed interaction with bABCG2 even at concentrations approaching the legal limits in feed and food commodities. Moreover, PCB 126 significantly enhanced bABCG2 functional activity. Specific inhibitors of either AhR (CH233191) or ABCG2 (Ko143) were able to reverse the PCB 126-induced increase in bABCG2 transport activity, showing the specific upregulation of the efflux protein by the AhR pathway. The incubation of PCB 126-pretreated cells with AFM1 was able to substantially reverse such effect, with still unknown mechanism(s). Overall, results from this study point to AFB1 and AFM1 as likely bABCG2 substrates. The PCB 126-dependent increased activity of the transporter could enhance the ABCG2-mediated excretion into dairy milk of chemicals (i.e., drugs and toxins) potentially harmful to neonates and consumers. © 2017 John Wiley & Sons Ltd.

  12. A fully integrated UHF RFID reader SoC for handheld applications in the 0.18 μm CMOS process

    Wang Jingchao; Zhang Chun; Wang Zhihua

    2010-01-01

    A low cost fully integrated single-chip UHF radio frequency identification (RFID) reader SoC for short distance handheld applications is presented. The SoC integrates all building blocks-including an RF transceiver, a PLL frequency synthesizer, a digital baseband and an MCU-in a 0.18 μm CMOS process. A high-linearity RX front-end is designed to handle the large self-interferer. A class-E power amplifier with high power efficiency is also integrated to fulfill the function of a UHF passive RFID reader. The measured maximum output power of the transmitter is 20.28 dBm and the measured receiver sensitivity is -60 dBm. The digital baseband including MCU core consumes 3.91 mW with a clock of 10 MHz and the analog part including power amplifier consumes 368.4 mW. The chip has a die area of 5.1 x 3.8 mm 2 including pads. (semiconductor integrated circuits)

  13. A fully integrated UHF RFID reader SoC for handheld applications in the 0.18 {mu}m CMOS process

    Wang Jingchao; Zhang Chun; Wang Zhihua, E-mail: wangjc@gmail.co [Institute of Microelectronics, Tsinghua University, Beijing 100084 (China)

    2010-08-15

    A low cost fully integrated single-chip UHF radio frequency identification (RFID) reader SoC for short distance handheld applications is presented. The SoC integrates all building blocks-including an RF transceiver, a PLL frequency synthesizer, a digital baseband and an MCU-in a 0.18 {mu}m CMOS process. A high-linearity RX front-end is designed to handle the large self-interferer. A class-E power amplifier with high power efficiency is also integrated to fulfill the function of a UHF passive RFID reader. The measured maximum output power of the transmitter is 20.28 dBm and the measured receiver sensitivity is -60 dBm. The digital baseband including MCU core consumes 3.91 mW with a clock of 10 MHz and the analog part including power amplifier consumes 368.4 mW. The chip has a die area of 5.1 x 3.8 mm{sup 2} including pads. (semiconductor integrated circuits)

  14. SEMICONDUCTOR INTEGRATED CIRCUITS A 10-bit 200-kS/s SAR ADC IP core for a touch screen SoC

    Xingyuan, Tong; Yintang, Yang; Zhangming, Zhu; Wenfang, Sheng

    2010-10-01

    Based on a 5 MSBs (most-significant-bits)-plus-5 LSBs (least-significant-bits) C-R hybrid D/A conversion and low-offset pseudo-differential comparison approach, with capacitor array axially symmetric layout topology and resistor string low gradient mismatch placement method, an 8-channel 10-bit 200-kS/s SAR ADC (successive-approximation-register analog-to-digital converter) IP core for a touch screen SoC (system-on-chip) is implemented in a 0.18 μm 1P5M CMOS logic process. Design considerations for the touch screen SAR ADC are included. With a 1.8 V power supply, the DNL (differential non-linearity) and INL (integral non-linearity) of this converter are measured to be about 0.32 LSB and 0.81 LSB respectively. With an input frequency of 91 kHz at 200-kS/s sampling rate, the spurious-free dynamic range and effective-number-of-bits are measured to be 63.2 dB and 9.15 bits respectively, and the power is about 136 μW. This converter occupies an area of about 0.08 mm2. The design results show that it is very suitable for touch screen SoC applications.

  15. Understanding Hydrogen Sorption in In- soc -MOF: A Charged Metal-Organic Framework with Open-Metal Sites, Narrow Channels, and Counterions

    Pham, Tony

    2015-03-04

    © 2015 American Chemical Society. Grand canonical Monte Carlo (GCMC) simulations of hydrogen sorption were performed in In-soc-MOF, a charged metal-organic framework (MOF) that contains In3O trimers coordinated to 5,5′-azobis(1,3-benzenedicarboxylate) linkers. The MOF contains nitrate counterions that are located in carcerand-like capsules of the framework. This MOF was shown to have a high hydrogen uptake at 77 K and 1.0 atm. The simulations were performed with a potential that includes explicit many-body polarization interactions, which were important for modeling gas sorption in a charged/polar MOF such as In-soc-MOF. The simulated hydrogen sorption isotherms were in good agreement with experiment in this challenging platform for modeling. The simulations predict a high initial isosteric heat of adsorption, Qst, value of about 8.5 kJ mol-1, which is in contrast to the experimental value of 6.5 kJ mol-1 for all loadings. The difference in the Qst behavior between experiment and simulation is attributed to the fact that, in experimental measurements, the sorbate molecules cannot access the isolated cages containing the nitrate ions, the most energetically favorable site in the MOF, at low pressures due to an observed diffusion barrier. In contrast, the simulations were able to capture the sorption of hydrogen onto the nitrate ions at low loading due to the equilibrium nature of GCMC simulations. The experimental Qst values were reproduced in simulation by blocking access to all of the nitrate ions in the MOF. Furthermore, at 77 K, the sorbed hydrogen molecules were reminiscent of a dense fluid in In-soc-MOF starting at approximately 5.0 atm, and this was verified by monitoring the isothermal compressibility, βT, values. The favorable sites for hydrogen sorption were identified from the polarization distribution as the nitrate ions, the In3O trimers, and the azobenzene nitrogen atoms. Lastly, the two-dimensional quantum rotational levels

  16. Overexpression of an orchid (Dendrobium nobile SOC1/TM3-like ortholog, DnAGL19, in Arabidopsis regulates HOS1-FT expression

    Xiao-ru eLiu

    2016-02-01

    Full Text Available Flowering in the appropriate season is critical for successful reproduction in angiosperms. The orchid species, Dendrobium nobile, requires vernalization to achieve flowering in the spring, but the underlying regulatory network has not been identified to date. The MADS-box transcription factor DnAGL19 was previously identified in a study of low-temperature treated D. nobile buds and was suggested to regulate vernalization-induced flowering. In this study, phylogenetic analysis of DnAGL9 and the MADS-box containing proteins showed that DnAGL19 is phylogenetically closely related to the SOC1-like protein from orchid Dendrobium Chao Parya Smile, DOSOC1. The orchid clade closed to but is not included into the SOC1-1/TM3 clades associated with either eudicots or monocots, suggesting that DnAGL19 is an SOC1-1/TM3-like ortholog. DnAGL19 was found to be highly expressed in pseudobulbs, leaves, roots and axillary buds but rarely in flowers, and to be substantially upregulated in axillary buds by prolonged low-temperature treatments. Overexpression of DnAGL19 in Arabidopsis thaliana resulted in a small but significantly reduced time to bolting, suggesting that flowering time was slightly accelerated under normal growth conditions. Consistent with this, the A. thaliana APETELA1 (AP1 gene was expressed at an earlier stage in transgenic lines than in wild type plants, while the FLOWERING LOCUS T (FT gene was suppressed, suggesting that altered regulations on these transcription factors caused the weak promotion of flowering. HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENE 1 (HOS1 was slightly activated under the same conditions, suggesting that the HOS1-FT module may be involved in the DnAGL19-related network. Under vernalization conditions, FT expression was significantly upregulated, whereas HOS1 expression in the transgenic A. thaliana has a level similar to that in wild type. Taken together, these results suggest that DnAGL19 controls the action of the

  17. The ZYNQ book embedded processing with the ARM Cortex-A9 on the Xilinx Zynq-7000 all programmable SoC

    Crockett, Louise H; Enderwitz, Martin A; Stewart, Robert W

    2014-01-01

    This book is about the Zynq-7000 All Programmable System on Chip, the family of devices from Xilinx that combines an application-grade ARM Cortex-A9 processor with traditional FPGA logic fabric. Catering for both new and experienced readers, it covers fundamental issues in an accessible way, starting with a clear overview of the device architecture, and an introduction to the design tools and processes for developing a Zynq SoC. Later chapters progress to more advanced topics such as embedded systems development, IP block design and operating systems. Maintaining a 'real-world' perspective, the book also compares Zynq with other device alternatives, and considers end-user applications. The Zynq Book is accompanied by a set of practical tutorials hosted on a companion website. These tutorials will guide the reader through first steps with Zynq, following on to a complete, audio-based embedded systems design.

  18. Dynamic Voltage-Frequency and Workload Joint Scaling Power Management for Energy Harvesting Multi-Core WSN Node SoC

    Xiangyu Li

    2017-02-01

    Full Text Available This paper proposes a scheduling and power management solution for energy harvesting heterogeneous multi-core WSN node SoC such that the system continues to operate perennially and uses the harvested energy efficiently. The solution consists of a heterogeneous multi-core system oriented task scheduling algorithm and a low-complexity dynamic workload scaling and configuration optimization algorithm suitable for light-weight platforms. Moreover, considering the power consumption of most WSN applications have the characteristic of data dependent behavior, we introduce branches handling mechanism into the solution as well. The experimental result shows that the proposed algorithm can operate in real-time on a lightweight embedded processor (MSP430, and that it can make a system do more valuable works and make more than 99.9% use of the power budget.

  19. Noise and Spurious Tones Management Techniques for Multi-GHz RF-CMOS Frequency Synthesizers Operating in Large Mixed Analog-Digital SOCs

    Maxim Adrian

    2006-01-01

    Full Text Available This paper presents circuit techniques and power supply partitioning, filtering, and regulation methods aimed at reducing the phase noise and spurious tones in frequency synthesizers operating in large mixed analog-digital system-on-chip (SOC. The different noise and spur coupling mechanisms are presented together with solutions to minimize their impact on the overall PLL phase noise performance. Challenges specific to deep-submicron CMOS integration of multi-GHz PLLs are revealed, while new architectures that address these issues are presented. Layout techniques that help reducing the parasitic noise and spur coupling between digital and analog blocks are described. Combining system-level and circuit-level low noise design methods, low phase noise frequency synthesizers were achieved which are compatible with the demanding nowadays wireless communication standards.

  20. Comment on "Relative variance of the mean squared pressure in multimode media: rehabilitating former approaches" [J. Acoust. Soc. Am. 136, 2621-2629 (2014)].

    Davy, John L; Weaver, Richard L

    2015-03-01

    Models for the statistics of responses in finite reverberant structures, and in particular, for the variance of the mean square pressure in reverberation rooms, have been studied for decades. It is therefore surprising that a recent communication has claimed that the literature has gotten the simplest of such calculations very wrong. Monsef, Cozza, Rodrigues, Cellard, and Durocher [(2014). J. Acoust. Soc. Am. 136, 2621-2629] have derived a modal-based expression for the relative variance that differs significantly from expressions that have been accepted since 1969. This Comment points out that the Monsef formula is clearly incorrect, and then for the interested reader, points out the subtle place where they made their mistake.

  1. A Point Mutation in Suppressor of Cytokine Signalling 2 (Socs2 Increases the Susceptibility to Inflammation of the Mammary Gland while Associated with Higher Body Weight and Size and Higher Milk Production in a Sheep Model.

    Rachel Rupp

    2015-12-01

    Full Text Available Mastitis is an infectious disease mainly caused by bacteria invading the mammary gland. Genetic control of susceptibility to mastitis has been widely evidenced in dairy ruminants, but the genetic basis and underlying mechanisms are still largely unknown. We describe the discovery, fine mapping and functional characterization of a genetic variant associated with elevated milk leukocytes count, or SCC, as a proxy for mastitis. After implementing genome-wide association studies, we identified a major QTL associated with SCC on ovine chromosome 3. Fine mapping of the region, using full sequencing with 12X coverage in three animals, provided one strong candidate SNP that mapped to the coding sequence of a highly conserved gene, suppressor of cytokine signalling 2 (Socs2. The frequency of the SNP associated with increased SCC was 21.7% and the Socs2 genotype explained 12% of the variance of the trait. The point mutation induces the p.R96C substitution in the SH2 functional domain of SOCS2 i.e. the binding site of the protein to various ligands, as well-established for the growth hormone receptor GHR. Using surface plasmon resonance we showed that the p.R96C point mutation completely abrogates SOCS2 binding affinity for the phosphopeptide of GHR. Additionally, the size, weight and milk production in p.R96C homozygote sheep, were significantly increased by 24%, 18%, and 4.4%, respectively, when compared to wild type sheep, supporting the view that the point mutation causes a loss of SOCS2 functional activity. Altogether these results provide strong evidence for a causal mutation controlling SCC in sheep and highlight the major role of SOCS2 as a tradeoff between the host's inflammatory response to mammary infections, and body growth and milk production, which are all mediated by the JAK/STAT signaling pathway.

  2. Smear-positive pulmonary tuberculosis and AFB examination practices according to the standard checklist of WHO's tuberculosis laboratory assessment tool in three governmental hospitals, Eastern Ethiopia.

    Mekonnen, Abiyu

    2014-05-13

    Using the Directly Observed Treatment-Short course (DOTS) program the World Health Organization's global target was to detect 70% of new sputum-smear positive PTB cases. Smear positive PTB cases are more infectious than the smear negative cases. The TB case detection rate remains very low in Ethiopia, but there are increases in smear-negative PTB diagnosis which could be attributed to several factors including poor quality of sputum smear-microscopy. A five years retrospective record review of data between September, 2007 and August, 2012 and an in-depth assessment of AFB staining practices of sputum smear using a standard checklist were made. The proportion of smear positive cases relative to overall Acid Fast Bacilli (AFB) screened was determined over a five year period to indicate the overall prevalence and the trend. Odds ratio with 95 percent confidence interval was calculated for categorical variables using multivariate Logistic Regression model to assess the strength of association. A total of 1266 individuals' data were reviewed. The majority of the study participants were male, 704 (55.6%), and rural residents, 690 (54.5%). The overall prevalence rate of smear positive PTB was 21.6%. Age categories between 15-24 and 25-34 years were independent predictors of smear positive PTB with adjusted odds ratio of 2.246 [95% CI (1.098-4.597)] and 2.267 [95% CI (1.107-4.642)], respectively. More males were affected by PTB than females with an adjusted odds ratio of 1.426 [95% CI (1.083-1.879)]. An in-depth interview with the respective laboratory chiefs showed that quality control measures for sputum smear microscopy were used at different levels of the testing activities; however, equipment function verification as a quality control measure was not accomplished regularly in all of the study hospital laboratories. The smear positive PTB case detection rate indicated in this study is significantly lower than the countries which met the 70% target of the World Health

  3. Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

    Nestani Tukvadze

    Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

  4. Evaluación de adsorbentes para la reducción de aflatoxina M1 en leche de vacas alimentadas con dietas contaminadas artificialmente con AFB

    Federico Rojo

    2014-01-01

    Full Text Available Los adsorbentes han sido utilizados ampliamente para prevenir las micotoxicosis y la transferencia d e toxinas o sus metabolitos dentro de la cadena alimentaria. Particularmente, se unen a las aflatoxinas dentro del tracto gastrointestinal de los rumiantes, disminuyendo su biodisponibilidad y la transferencia de aflatoxin a M 1 (AFM 1 a la leche. El presente estudio se desarrolló para evaluar dos métodos de exposición a aflatoxina B 1 en vacas Holstein y monitorear la transferencia AFM 1 a la leche. Adicionalmente, se analizó el potencial de tres adsorbentes de aflatoxinas en ambos experimentos. Los resultados mostraron una tasa de trasferencia de AFB 1 a AFM 1 / día de 3.35 y 1.8 % en los dos experimentos respectivamente. La transferencia estimada de AFM 1 en la leche observada en el segundo método fue cercana a las obtenidas de vacas alimentadas con alimentos natura lmente contaminados con aflatoxinas. A diferencia de los glucomananos de paredes cel ulares de levaduras, ambos adsorbentes de aluminosilicatos disminuyeron significativamente los niveles de AFM 1 en la leche ( P <0.05.

  5. Real-Time Control System for Improved Precision and Throughput in an Ultrafast Carbon Fiber Placement Robot Using a SoC FPGA Extended Processing Platform

    Gilberto Ochoa-Ruiz

    2017-01-01

    Full Text Available We present an architecture for accelerating the processing and execution of control commands in an ultrafast fiber placement robot. The system consists of a robotic arm designed by Coriolis Composites whose purpose is to move along a surface, on which composite fibers are deposed, via an independently controlled head. In first system implementation, the control commands were sent via Profibus by a PLC, limiting the reaction time and thus the precision of the fiber placement and the maximum throughput. Therefore, a custom real-time solution was imperative in order to ameliorate the performance and to meet the stringent requirements of the target industry (avionics, aeronautical systems. The solution presented in this paper is based on the use of a SoC FPGA processing platform running a real-time operating system (FreeRTOS, which has enabled an improved comamnd retrieval mechanism. The system’s placement precision was improved by a factor of 20 (from 1 mm to 0.05 mm, while the maximum achievable throughput was 1 m/s, compared to the average 30 cm/s provided by the original solution, enabling fabricating more complex and larger pieces in a significant fraction of the time.

  6. Use of LabSOCS for determination of specific concentrations of 40K, 238U and 232Th in fertilizer samples

    Garcez, Ricardo Washington Dutra; Lopes, Jose Marques; Silva, Ademir Xavier da; Domingues, Alessandro Mariano; Lima, Marco Frota

    2015-01-01

    Use of fertilizer is an established practice worldwide to promote agricultural productivity increased without increasing the planted area, resulting in native forests protection and increase of the food availability. Some kinds of fertilizer have in their chemical composition some radionuclides due the origin of its feedstock, such as 238 U, the 232 Th, and their descendants, beyond 40 K. Knowledge of the radioactivity levels in the environment is great importance to know the gamma radiation dose that the human being is exposed. For identification and quantitation of radionuclides, it was used gamma spectrometry where HPGe detector was used to obtain the spectra, and LabSOCS software for calculating the detection efficiency for each energy. The values of 232 Th specific concentrations ranged from 4.1 to 368.1 Bq.Kg -1 , the values of 238 U specific concentrations ranged from 16.0 to 647.7 Bq.Kg -1 and 40 K specific concentrations ranged from 19.1 to 12713 Bq.Kg -1 . Concentrations of values are consistent with those found in literature. (author)

  7. Paeoniflorin Suppressed High Glucose-Induced Retinal Microglia MMP-9 Expression and Inflammatory Response via Inhibition of TLR4/NF-κB Pathway Through Upregulation of SOCS3 in Diabetic Retinopathy.

    Zhu, Su-Hua; Liu, Bing-Qian; Hao, Mao-Juan; Fan, Yi-Xin; Qian, Cheng; Teng, Peng; Zhou, Xiao-Wei; Hu, Liang; Liu, Wen-Tao; Yuan, Zhi-Lan; Li, Qing-Ping

    2017-10-01

    Diabetic retinopathy (DR) is a serious-threatening complication of diabetes and urgently needed to be treated. Evidence has accumulated indicating that microglia inflammation within the retina plays a critical role in DR. Microglial matrix metalloproteinase 9 (MMP-9) has an important role in the destruction of the integrity of the blood-retinal barrier (BRB) associated with the development of DR. MMP-9 was also considered important for regulating inflammatory responses. Paeoniflorin, a monoterpene glucoside, has a potent immunomodulatory effect on microglia. We hypothesized that paeoniflorin could significantly suppress microglial MMP-9 activation induced by high glucose and further relieve DR. BV2 cells were used to investigate the effects and mechanism of paeoniflorin. The activation of MMP-9 was measured by gelatin zymography. Cell signaling was measured by western blot assay and immunofluorescence assay. High glucose increased the activation of MMP-9 in BV2 cells, which was abolished by HMGB1, TLR4, p38 MAPK, and NF-κB inhibition. Phosphorylation of p38 MAPK induced by high glucose was decreased by TLR4 inhibition in BV2 cells. Paeoniflorin induced suppressor of cytokine signaling 3 (SOCS3) expression and reduced MMP-9 activation in BV2 cells. The effect of paeoniflorin on SOCS3 was abolished by the TLR4 inhibitor. In streptozotocin (STZ)-induced diabetes mice, paeoniflorin induced SOCS3 expression and reduced MMP-9 activation. Paeoniflorin suppressed STZ-induced IBA-1 and IL-1β expression and decreased STZ-induced high blood glucose level. In conclusion, paeoniflorin suppressed high glucose-induced retinal microglia MMP-9 expression and inflammatory response via inhibition of the TLR4/NF-κB pathway through upregulation of SOCS3 in diabetic retinopathy.

  8. Ergonomic Survey, Hill AFB, UT

    1991-03-01

    Hygiene NIOSH a. CAPT Roger Jensen, Division of Safety Research b. LCDR Patricia Schnitzer, Division of Safety Research c. GS-14 Vern Putz-Anderson... Patricia Schnitzer was provided a current listing (October 1988-October 1990) of the CTD cases from the PHOENIX data base for review. There were a...MOTIVE AERO-MOTIVE U.K. LTD. RO. Box 2678 1090 Brevik Place Rassau Industrial Estate Kalamazoo, M1 49003 Mississauga, Ontario Ebbw Vale Gwent NP3 5SD Ph

  9. AFB Directory of Services Listings

    ... radio-talking-book/index.jsp Minnesota STAR Program Centennial Office Building Room 358 658 Cedar Street St. ... and Human Services Nebraska State Office Building 301 Centennial Mall South Lincoln, NE 68508 http://www.adrcnebraska. ...

  10. GPS Measurements at Vandenberg, AFB

    1993-02-22

    friorov, S A Ahic Aia.. SSSR DoAf US9. Ill𔃺 1113 I Iughison. J I (ec O Clmate chirie The 07CC scientific Assessment (Cambridge ni~v Pressý 16 snez. MC... Change or Climate (Wolo~ng GrOAI Viii eHefta Comm’ents 14 Timerev A A & Egorov S A A4lereotof G&droi lo 7 50-56 e91e .r condied 13 A A TsonoS...Complex. might easily be recovering from the mainshock accelerations An examination of the station displacements indicates that Comparing the changing

  11. Use of LabSOCS for determination of specific concentrations of {sup 40}K, {sup 238}U and {sup 232}Th in fertilizer samples; Uso de LabSOCS no calculo da eficiencia de detecao para determinacao da concentracao especifica de {sup 40}K, {sup 238}U e {sup 232}Th em amostras de fertilizantes

    Garcez, Ricardo Washington Dutra; Lopes, Jose Marques; Silva, Ademir Xavier da, E-mail: rgarcez@con.ufrj.br, E-mail: marqueslopez@yahoo.com.br [Coordenacao dos Programas de Pos-Graduacao em Engenharia (COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Programa de Engenharia Nuclear; Domingues, Alessandro Mariano; Lima, Marco Frota, E-mail: slessandrodomingues@fisica.if.uff.br, E-mail: marcofrotalima@yahoo.com.br [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Instituto de Biologia

    2015-07-01

    Use of fertilizer is an established practice worldwide to promote agricultural productivity increased without increasing the planted area, resulting in native forests protection and increase of the food availability. Some kinds of fertilizer have in their chemical composition some radionuclides due the origin of its feedstock, such as {sup 238}U, the {sup 232}Th, and their descendants, beyond {sup 40}K. Knowledge of the radioactivity levels in the environment is great importance to know the gamma radiation dose that the human being is exposed. For identification and quantitation of radionuclides, it was used gamma spectrometry where HPGe detector was used to obtain the spectra, and LabSOCS software for calculating the detection efficiency for each energy. The values of {sup 232}Th specific concentrations ranged from 4.1 to 368.1 Bq.Kg{sup -1} , the values of {sup 238}U specific concentrations ranged from 16.0 to 647.7 Bq.Kg{sup -1} and {sup 40}K specific concentrations ranged from 19.1 to 12713 Bq.Kg{sup -1} . Concentrations of values are consistent with those found in literature. (author)

  12. Mapping the variation of soil organic carbon (SOC) stock in time and space in Sicily, an extremely variable semi-arid Mediterranean region, highlighted that C was lost in area rich in organic C and gained in poor-C areas

    Schillaci, Calogero; Acutis, Marco; Lombardo, Luigi; Lipani, Aldo; Fantappiè, Maria; Märker, Michael; Saia, Sergio

    2017-04-01

    The stock of organic carbon in the soil (SOC) is an indicator of soil ability to support agro-ecosystems productivity and resilience to environmental changes (Schillaci et al. 2016; 2017). In addition, SOC stock change through space and especially time is a valuable indicator of the soil ability to sequester CO2 from the atmosphere and thus its potential to reduce the greenhouse gas effect. In the present work, we mapped (1-km resolution) the space-time variation of the SOC stock after 15 years (1993 to 2008) in a semi-arid Mediterranean area (25,286 km2) after modelling SOC concentration (0-0.4 m depth) with boosted regression trees (BRT) and computing the SOC stock after the application of the bulk density maps of ISRIC (soilgrid.com, Hengl et al., 2014). The area under study (Sicily, south of Italy) has a plenty of contrasting environments, with changing ecosystems, soils, and microclimatic regions. The BRT procedure was run with a set of 25 predictors per year, including land use, soil traits, morphometric indicators and remote sensing covariates (derived from Landsat5 data). The BRT output consisted of a high pseudo-R2(=0.71 for 1993 and 0.63 for 2008) of the SOC concentration, low uncertainty (standard deviation doi:10.1016/j.geoderma.2016.10.

  13. Comments on ''The optimization of electronic precision in ultrasonic velocity measurements: A comparison of the time interval averaging and sing around methods'' [J. Acoust. Soc. Am. 73, 1833--1837 (1983)

    Karplus, H.B.

    1984-01-01

    J. D. Aindow and R. C. Chivers [J. Acoust. Soc. Am. 73, 1833 (1983)] compared the precision of the direct ''time-of-flight'' technique with the ''sing-around'' method for sound velocity measurement. Their conclusion is changed by the newer, faster, commercial clocks (2 ns HP5345<0.1 ns HP5370), giving the advantage to the time of flight method. The analysis is herewith augmented by calculating the time jitter in terms of signal to noise ratio, which was correctly shown to be negligible with 100-ns clocks, but becomes increasingly more significant with faster clocks

  14. Papel de la proteína supresora de la señalización por citocinas-3 (SOCS 3 en la resistencia a la hormona de crecimiento inducida por malnutrición.

    Adriana Umaña

    2003-09-01

    Full Text Available La nutrición es un regulador importante de las acciones de la hormona de crecimiento (GH. Se ha demostrado que el déficit de nutrientes induce un estado de resistencia a la hormona, en el cual están involucrados, entre otros factores, alteraciones post-receptor en la vía de señalización, pero se desconocen los mecanismos responsables. En este trabajo se investigó la participación de algunos miembros de la familia de proteínas supresoras de la señalización por citocinas (SOCS en la resistencia causada por malnutrición, que inhibe la activación de la señalización a través de Janus cinasa 2/transductor de señal y activador de la transcripción 5 (JK2/STAT5. Se estudiaron los cambios en la expresión génica del receptor de GH (RGH, IGF-I y SOCS3 en el hígado de ratas alimentadas con una dieta baja en proteína (8% y estimuladas con GH. La restricción en el consumo de proteína disminuyó significativamente (p

  15. Toxic Hazards Research Unit Annual Technical Report: 1985

    1985-09-01

    varnish makers’ and painters’ naphtha, Toxicol. Appl. Pharmacol., 32:263-281. Carpenter, C. P.. E. R. Kinkead, D. L. Geary, L. J. Sullivan, Jr., and J...and Pharmacology of Inorganic and Fluorine Contairnin Compounds, AMRL-TR-67-224, Aerospace Medical Research Laboiatory, Wright-Patterson Air Force Base

  16. An Analysis of the Predicted Benefits of Multi-Year Procurement

    1982-09-01

    concerned with these issues. The researchers were especially concerned with model sensitivity to parameters used in the financial sector. Model validation is...TECHNOLOGY (ATC) WRIGHT-PATTERSON AIR FORCE BASE, OH 45433 qEK•Y TO RrNov O i 5 April 1982 suata Survey of Educacion With Industry Students To LS I fully

  17. Engineered Surfaces to Control Secondary Electron Yield for Multipactor Suppression

    2017-09-14

    Air Force Institute of Technology AFIT Scholar Theses and Dissertations 9-14-2017 Engineered Surfaces to Control Secondary Electron Yield for...Multipactor Suppression James M. Sattler Follow this and additional works at: https://scholar.afit.edu/etd Part of the Electrical and Electronics Commons... TECHNOLOGY Wright-Patterson Air Force Base, Ohio DISTRIBUTION STATEMENT A. APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED

  18. Ergonomic and anthropometric issues of the forward Apache crew station

    Oudenhuijzen, A.J.K.

    1999-01-01

    This paper describes the anthropometric accommodation in the Apache crew systems. These activities are part of a comprehensive project, in a cooperative effort from the Armstrong Laboratory at Wright Patterson Air Force Base (Dayton, Ohio, USA) and TNO Human Factors Research Institute (TNO HFRI) in

  19. Particulate Characterization and Control Evaluation for Carbon Fiber Composite Aircraft Crash Recovery Operations

    2010-03-01

    Advanced Composite Office, Wright-Patterson BEE Flight, and USAFSAM for their help procuring the materials and supplies needed to perform this study...that would occur during an aircraft crash. The JP-8 was then 26 ignited with a butane lighter and allowed to burn to extinction . A burning ACM

  20. Scientific Research Program for Power, Energy, and Thermal Technologies. Task Order 0001: Power, Thermal and Control Technologies and Processes Experimental Research

    2015-08-01

    a variable-speed screw compressor (Fairchild Controls Corporation) controlled by a Yaskawa A-1000 motor drive. Screw compressors are appropriate...public release; distribution unlimited. See additional restrictions described on inside pages STINFO COPY AIR FORCE...RESEARCH LABORATORY AEROSPACE SYSTEMS DIRECTORATE WRIGHT-PATTERSON AIR FORCE BASE, OH 45433-7541 AIR FORCE MATERIEL COMMAND UNITED STATES AIR FORCE

  1. Utilizing a Rapid Prototyping Approach in the Building of a Hypermedia-Based Reference Station.

    Sell, Dan

    This paper discusses the building of a hypermedia-based reference station at the Wright Laboratory Technical Library, Wright-Patterson Air Force Base, Ohio. Following this, the paper focuses on an electronic user survey from which data is collected and analysis is made. The survey data is used in a rapid prototyping approach, which is defined as…

  2. Electrically Reconfigurable Liquid Crystalline Mirrors (Postprint)

    2018-04-24

    focus on dynamic reconfiguration of the reflection band gap of polymer-stabilized cholesteric liquid crystals (PSCLCs). Recent research has reported the...public release: distribution unlimited. © 2018 AMERICAN CHEMICAL SOCIETY (STINFO COPY) AIR FORCE RESEARCH LABORATORY MATERIALS AND MANUFACTURING...MONITORING AGENCY ACRONYM(S) Air Force Research Laboratory Materials and Manufacturing Directorate Wright-Patterson Air Force Base, OH

  3. PODAAC-SMP20-2SOCS

    National Aeronautics and Space Administration — The version 2.0 SMAP-SSS, level 2C product contains the first release of the validated sea surface salinity orbital/swath data from the NASA Soil Moisture Active...

  4. Potential Impacts Related to the Air Training Command Realignments. Institutional Characteristics, Transportation, Civilian Community Utilities, Land Use for Craig AFB, Alabama, Webb AFB, Texas, Columbus AFB, Mississippi, Laughlin AFB, Texas, Reese AFB, Texas, Vance AFB, Oklahoma

    1976-12-30

    response and 70.4 percent civilian response, extend to 100 percent population, 1975; Counity Census Data, General Social =0 Economic Characteristics. 25...transportation problems exist and the alternative action is not txpected to disturb the situation in the future. 86 On-Base (AFERN 4.4.1.3) No major problema of...values could increase in specific residential areas that are perceived as meeting certain economic and social needs where current 7acancies are minimal

  5. Nonlocal collisionless and collisional electron transport in low temperature plasmas

    Kaganovich, Igor

    2009-10-01

    The purpose of the talk is to describe recent advances in nonlocal electron kinetics in low-pressure plasmas. A distinctive property of partially ionized plasmas is that such plasmas are always in a non-equilibrium state: the electrons are not in thermal equilibrium with the neutral species and ions, and the electrons are also not in thermodynamic equilibrium within their own ensemble, which results in a significant departure of the electron velocity distribution function from a Maxwellian. These non-equilibrium conditions provide considerable freedom to choose optimal plasma parameters for applications, which make gas discharge plasmas remarkable tools for a variety of plasma applications, including plasma processing, discharge lighting, plasma propulsion, particle beam sources, and nanotechnology. Typical phenomena in such discharges include nonlocal electron kinetics, nonlocal electrodynamics with collisionless electron heating, and nonlinear processes in the sheaths and in the bounded plasmas. Significant progress in understanding the interaction of electromagnetic fields with real bounded plasma created by this field and the resulting changes in the structure of the applied electromagnetic field has been one of the major achievements of the last decade in this area of research [1-3]. We show on specific examples that this progress was made possible by synergy between full scale particle-in-cell simulations, analytical models, and experiments. In collaboration with Y. Raitses, A.V. Khrabrov, Princeton Plasma Physics Laboratory, Princeton, NJ, USA; V.I. Demidov, UES, Inc., 4401 Dayton-Xenia Rd., Beavercreek, OH 45322, USA and AFRL, Wright-Patterson AFB, OH 45433, USA; and D. Sydorenko, University of Alberta, Edmonton, Canada. [4pt] [1] D. Sydorenko, A. Smolyakov, I. Kaganovich, and Y. Raitses, IEEE Trans. Plasma Science 34, 895 (2006); Phys. Plasmas 13, 014501 (2006); 14 013508 (2007); 15, 053506 (2008). [0pt] [2] I. D. Kaganovich, Y. Raitses, D. Sydorenko, and

  6. Baseline Noise Measurements at Vandenberg AFB, California.

    1988-01-01

    CCCMCC0ACC. 4 4;; l;1;9 4CPI* ACCA . 9 ; 4 1 4 #mr nvvr.&%0naof w# ed .4 in l-4P" a a .4 mIAPl~ PlC C4 toi v rm--0ow.in .4 m t a A Cr l %n .Cl w o m a m ww...cooo, O 999944444992144.4449999 9. 49999999994444444449944944 in- Is f5 If 4n % r, A : O IV .0 :, :,o t g Xw g V ;o oe a w I fft w q on f" 4 f 4 ’ i w

  7. Severe Weather Forecasting for Laughlin AFB, TX

    Cercone, Eric J

    2007-01-01

    .... Indices, including convective available potential energy (CAPE) and mean layer CAPE (MLCAPE), along with sounding parameters and combinations of such as 0-2 and 0-6 km bulk shear, 700-500 mb lapse rate, lifted condensation level...

  8. Historic Landscape Survey, Randolph AFB, Texas

    2013-09-01

    listed men. Throughout 1930 and 1931, construction at the base was steady in spite of the nation’s depressed economy.22 Figure 3. The road... centennial year of 1932, during which patriotic societies planted trees throughout the country in honor of the first president. During the next year, the

  9. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland AFB, White Sands Missile Range/ Holloman AFB, New Mexico; Edwards AFB, Vandenberg AFB, California

    2003-06-01

    Sneed pincushion cactus T Kuen_zler hedgehog cactus - Sacramento oricklv ooppy - I Sacramento Mountains checkerspot - ! butterfly . . Federal Status E...caiifomicus Coho salmon ~_j_Pncorhynchus kisutch , Unarmoured three- spined 1 C~asterosleus aculeatus- ----: stickleback , wi/liamsoni 1 E T E...septentrionalis) Kuenzler hedgehog cachts (Echinocereus fendleri var. kuenzleri) THREATENED Bald eagle (Haliaeetus /.:ucocephalus) Mexican spotted owl (Strix

  10. Herbicide Orange Site Characterization Study, Eglin AFB

    1987-01-01

    F THIS PAGE Availabilit o this r is sp f o.n" the reverse of fo cove* . - .’.r. 717 CSAT CO ES ’SU JEC TE MS Coninu onrevrseif ece~ar an idntiy b...of Hardstand 7 and Surface Water Drainages ......... 4 3 Hardstand 7 Herbicide Oran&e Storage Locations .............. 5 4 Concentrations (in ppb) of...insoluble in water . The formula contained an approximate 50/50 mixture of the herbicides 2,4-dichlorophenoxyacetic acid (2,4,-D) and 2,4,5

  11. Historic Landscape Survey, Maxwell AFB, Alabama

    2013-08-01

    signifies Maxwell AFB’s historic landscapes. 2.1 The pre-military landscape Prehistory in the southeastern United States is generally designated as...the period of Native American occupation before Spanish explorers made contact in the fifteenth and sixteenth centuries. In Alabama, the prehistory ... prehistory or history is made clear.56 A historic property is determined to be either significant or not significant by applying standardized National

  12. B-1 Systems Approach to Training. Volume 3. Appendix B. Bibliography and Data Collection Trips

    1975-07-01

    the Fourth Annual Symposium on Psychology in the Air Force, 1974, ~ •—- ~ - --- - Creelman , J.A., Evaluation of Approach Training Procedures...of Engineering Psychology , American Psychologist, 1972, 27 (7), 615-622. Adams, J.A., and Hufford, I.E., Effects of Programmed Perceptual Training on...Control, Wright-Patterson Air Force Base, Ohio, April 7-9, 1970. Aldrich, T.B., Proceedings of the Annual Symposium on Psychology in the Air Force (2nd

  13. Characterization and Modeling of a Control Moment Gyroscope

    2015-03-26

    pre- conditioner for the input state before passing into the inner loop, as shown in Figure 30. In Figure 30, m is the motor angle and x is the state...Characterization and Modeling of a Control Moment Gyroscope THESIS 2d Lt, Dylan Penn, B.S. AFIT-ENY-MS-15-M-235 DEPARTMENT OF THE AIR FORCE AIR ...UNIVERSITY AIR FORCE INSTITUTE OF TECHNOLOGY Wright-Patterson Air Force Base, Ohio DISTRIBUTION STATEMENT A APPROVED FOR PUBLIC RELEASE; DISTRIBUTION

  14. Pressure Scalings and Influence Region Research

    2018-01-01

    AFRL-RQ-WP-TP-2018-0015 PRESSURE SCALINGS AND INFLUENCE REGION RESEARCH James H. Miller High Speed Systems Division...inside pages STINFO COPY AIR FORCE RESEARCH LABORATORY AEROSPACE SYSTEMS DIRECTORATE WRIGHT-PATTERSON AIR FORCE BASE, OH... RESEARCH 5a. CONTRACT NUMBER In-house 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 62201F 6. AUTHOR(S) James H. Miller 5d. PROJECT NUMBER

  15. Challenges of Enterprise Wide AM for Air Force Sustainment

    2016-12-01

    processes for AM across the Air Force enterprise. The opportunity for cost-effective readiness is important, and using a value chain approach that takes...December 2016 Naguy is chief of the Air Force Life Cycle Management Center’s Product Support Engineering Division at Wright Patterson Air Force Base in...produc- tion that can address many current Air Force supply chain challenges. It also can reduce weight through lightweight design while potentially

  16. Toxic Hazards Research Unit Annual Technical Report: 1984

    1984-09-01

    exposed to TOCP exhibited the classic lesions of delayed neuropathy (Smith and Lillie, 1931; Barnes and Denz, 1953; (avanagh, 1954; and Fenton , 1955...Safety of *.i Chemicals in Food, Drugs, and Cosmetics , The staff of the Divi- sion of Pharmacology of the Federal Food and Drug Administration, Austin...Annual Technical Report: 1967, AMRL-TR-67-137 (AD 834723), Aerospace Medical Research Laboratory, Wright-Patterson Air Force Base, Ohio. Fenton , J. C

  17. Treatability Study in Support of the Intrinsic Remediation Option at the Current Fire Training Area, Westover Air Reserves Base, Chicopee, Massachusetts

    1997-02-01

    Winter, 1987, p. 64-71. Bartha , R., 1986, Biotechnology of petroleum pollutant biodegradation: Microbial Ecology , vol. 12, p. 155-172. Bauman, B., 1991...Prepared for Air Force Systems Command, Wright-Patterson Air Force Base, Ohio, June. Atlas , R.M., 1981, Microbial degradation of petroleum hydrocarbons...of jet fuel and gasoline, including the BTEX compounds (e.g., lamison et at., 1975; Atlas , 1981, 1984, 1988; Gibson and Subramanian, 1984; Reinhard et

  18. Integrated Life-Cycle Framework for Maintenance, Monitoring and Reliability of Naval Ship Structures

    2012-08-15

    uncertainty in quantitative risk and policy analysis, Cambridge Univer- sity Press. NEVES, L. C, FRANGOPOL, D. M., AND CRUZ , P. J. 2006 Probabilistic lifetime...L. C, FRANGOPOL, D. M., AND CRUZ , P. J. 2006 Probabilistic life- time-oriented multiobjective optimization of bridge maintenance: single...Wright Aeronautical Laboratory. Wright- Patterson Air Force Base, Dayton, Ohio; 1981. [5| Chung H-Y, Manuel L, Frank KH. Optimal inspection

  19. The Digital Thread as the Key Enabler

    2016-11-01

    Inject pivot points into acquisition allowing for programs to change direction based upon advances in technology, changes in threat environment...engineering and technical management for the Air Force Materiel Command at Wright-Patterson Air Force Base in Ohio. Y ou are down in the trenches trying to...workforce requires the right training, data, physics- based tools and facilities. Owning the technical baseline is one of the five priorities of the

  20. Air Force Officer Qualifying Test Form T: Initial Item-, Test-, Factor-, and Composite-Level Analyses

    2016-12-01

    used to qualify applicants for ROTC and OTS officer commissioning programs. The Pilot, Combat Systems Officer (CSO), and Air Battle Manager ( ABM ...AIR FORCE RESEARCH LABORATORY 711 HUMAN PERFORMANCE WING, AIRMAN SYSTEMS DIRECTORATE, WRIGHT-PATTERSON AIR FORCE BASE, OH 45433 AIR FORCE MATERIEL...Warfighter Interface Division Airman Systems Directorate This report is published in the interest of scientific and technical information exchange, and

  1. Examining U.S. Irregular Warfare Doctrine

    2008-06-01

    Muslim leaders, this manual also provides inspiration to the Al-Qaeda undercover member. These are especially useful in convincing the young...A “Air Power: An Enduring Illusion,” The Economist (24 August 2006). Accessed via: http://www.economist.com/world/displaystory.cfm?story_id...USA AFIT/ILM/ENS/08-04 DEPARTMENT OF THE AIR FORCE AIR UNIVERSITY AIR FORCE INSTITUTE OF TECHNOLOGY Wright-Patterson

  2. Cholesteric Liquid Crystal Glass Platinum Acetylides

    2014-06-01

    M. Krein AFRL/RXAP Ronald F. Ziolo, Eduardo Arias, and Ivana Moggio 2Centro de Investigacion en Quimica Aplicada(CIQA) Albert Fratini... Quimica Aplicada(CIQA), Boulevard Enrique Reyna Albert Fratini - Department of Chemistry, University of Dayton Yuriy Garbovskiy and Anatoliy...Force Research Laboratory Materials and Manufacturing Directorate Wright-Patterson Air Force Base, OH 45433-7750 Centro de Investigacion en Quimica

  3. KC-46A Tanker Modernization (KC-46A)

    2015-12-01

    Program Startup Workshop with the assistance from Defense Acquisition University at Wright-Patterson Air Force Base, Ohio. July 8 - 10, 2013: The KC-46A...Selected Acquisition Report (SAR) RCS: DD-A&T(Q&A)823-387 KC-46A Tanker Modernization (KC-46A) As of FY 2017 President’s Budget Defense Acquisition ...Deliveries and Expenditures 48 Operating and Support Cost 49 Common Acronyms and Abbreviations for MDAP Programs Acq O&M - Acquisition

  4. Comprehensive Clinical Phenotyping & Genetic Mapping for the Discovery of Autism Susceptibility Genes

    2012-12-05

    teaching students with autism spectrum disorders 4.52 Learn strategies for incorporating IEP goals and district standard into daily teaching...W403 Columbus, OH 43205 Final Report Comprehensive Clinical Phenotyping & Genetic Mapping for the Discovery of Autism Susceptibility Genes...QFOXGHDUHDFRGH 1.0 Summary In 2006, the Central Ohio Registry for Autism (CORA) was initiated as a collaboration between Wright-Patterson Air

  5. Fatigue Crack Growth and Fracture Behavior of As-Cast Ti-43.5Al-4Nb-1Mo-0.1B (TNM) Compared to Ti-48Al-2Nb-2Cr (4822) (Postprint)

    2017-11-22

    unlimited. © ELSEVIER LTD (STINFO COPY) AIR FORCE RESEARCH LABORATORY MATERIALS AND MANUFACTURING DIRECTORATE WRIGHT-PATTERSON AIR FORCE BASE, OH...published in Intermetallics, Vol. 91, 17 Sep 2017. © 2017 Elsevier Ltd. The U.S. Government is joint author of the work and has the right to use, modify...M.S. Dahar). Intermetallics 91 (2017) 158–168 Available online 17 September 2017 0966-9795/ © 2017 Elsevier Ltd. All rights reserved. MARK 1

  6. The Seated Soldier Study: Posture and Body Shape in Vehicle Seats

    2013-10-31

    lasers in four towers arranged in a square create a line on the subject as they move synchronously from top to bottom. Two cameras on each of the four...of the scanner being assembled and the scanner draped with curtains to control light and provide privacy. UNCLASSIFIED UNCLASSIFIED 22 Figure 16...with special reference to the limbs. WADC Technical Report No. 55-159. Wright-Patterson Air Force Base, OH: Wright Air Development Center

  7. Airplane crash

    Brunner, P.

    1975-01-01

    In May, 1974, a severe airplane crash occurred near Springfield, llinois; the crew of three and a courier were killed. The plane was carrying a large container of controlled water with a slight amount of 60 Co. A survey of the crash site by Air Force detectives and the radiological assistance team from Wright--Patterson Air Force Base indicated no radioactivity. Experiences of the incident were used to develop guidelines for future emergency preparedness

  8. Design and Characterization of a Secure Automatic Dependent Surveillance-Broadcast Prototype

    2015-03-26

    M-041 DEPARTMENT OF THE AIR FORCE AIR UNIVERSITY AIR FORCE INSTITUTE OF TECHNOLOGY Wright-Patterson Air Force Base, Ohio DISTRIBUTION STATEMENT A...of Engineering and Management Air Force Institute of Technology Air University Air Education and Training Command in Partial Fulfillment of the...Cyclic Redundancy Check CSV comma separated value CUT component under test DDC digital down conversion DF Downlink Format DUC digital up conversion

  9. A Comparison of the Usefulness of the Facilities Management Program in the Graduate School of Systems and Logistics and Similar Programs in Civilian Institutions as Perceived by Former Students

    1980-06-01

    8217 043FCCBCAAACCEGEFFEEEDGGFFEEGFFFFEGEECFFED6OGFEAFE’FIHBI 0441CC AABC ABA AA AA AA A AFEEAA AA AA A A AOF A A A AAG AA A A AAA FHAL’ 045 F C FAA A CAGOGGOA FF00 FOB El’C...thesis. SLSR 13-69, A"FT/SL, Wright-Patterson AFE Ofil, August, 1968. AD 846434. Hale, Captain Jerry W., and Captain Basil E. Rooney. "A Deter

  10. Application Development for Optimizing Patient Placement on Aeromedical Evacuation Flights: Proof-of-Concept

    2018-01-12

    PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Brittany Fouts, Jennifer Serres, Ray Hill, Frank Ciarallo 5d. PROJECT NUMBER 5e. TASK NUMBER 5f...APPENDIX A – Flowchart for Graphical Prototype ...................................................................... 9 APPENDIX B – Proof-of-Concept App...would like to thank the programming team at the Department of Operational Analysis at the Air Force Institute of Technology at Wright-Patterson Air

  11. Dover AFB Catchment Area TRICARE Marketing Plan, 436th Medical Group, Dover AFB, Delaware,

    1997-06-01

    cosmetic changes (Nadiu, Kleimenhagen, and Pillari 1992). Berkowitz classifies the debate in terms of eras. During the production era, the function was to...facilities in Smyrna and Fenton , Delaware. KGH has aggressive marketing and community education programs which include classes on: cardiopulmonary

  12. Bull. Chem. Soc. Ethiop. 1996, 10(2)

    fingerprint indices are recommended. INTRODUCTION. The ever-increasing discharges .... The gas chromatographic profiles of all the samples are identical, so it may be assumed that these oils are from the same source materials, formed under different geological conditions. The isoprenoid and n-paraffinic composition of ...

  13. Surface Observation Climatic Summaries (SOCS) for Fresno Air Terminal, California

    1989-09-01

    119 42 331 337 124 2 Same IUSO ISep 61 Jun 66 N 36 46 U 119 43 Same 330 24 3 Same IUSO IJun 66 Dec 85 Same Same 332 Same 24 4 Same uSO IJan 86 Jan 89...MONTH JAN I FEB IMAR I APR I MAY I JUN IJUL I AUG ISEP I OCT I NOV I DEC I ANN I YOR I MEAN MAX...VISIBILITY MONTH IJAN I FEB IMAR IAPR IMAY JUN IJUL IAUG ISEP jOCT INOV IDEC ANN IYOR 1 . o. ee. . lST I . I................I......... I...... I Io

  14. The ComSoc guide to managing telecommunications projects

    Desmond, Celia

    2010-01-01

    "This pocket guide provides an overview of the telecommunications environment as it has evolved over the past few years, illustrating the need for project management, the significance of project success to the companies, and the application of key project management processes within the telecom environment. Topics covered include: scope management, time management, cost management, procurement management, risk management, communications, quality, human resources, and Integration. It offers professionals a brief and accessible guide to managing telecommunication projects in the 21st century"--

  15. Surface Observation Climatic Summaries (SOCS) for Volk Field ANGB, Wisconsin.

    1989-05-01

    LIMIT(S), EITHER SEPARATELY OR IN ANY C󈧒RINATI"Pl. TOTALS PROGRESS FROM RIGHT Tl LEFT AND PRUM BOTTOM1 T2 TOP. TOJ OETER Iljt CEILINS ALINE, REFER TO...THE cATREME7 RIGTHAND CO]LUMN (ZER? VISI3ILITY). TO DETERM’INE VISIBI1LITY ALINE, R’EFER TO THE BOTTOM ROW (ZEkO CEILINGS). OETER 𔃾INE THE P9F THAT

  16. Bull.Chem.Soc.Ethiop.,4(1)

    axial coordination of halides stabilizes the copper(III) state of copper macrocyclic complexes. ... employed and tetraethylammonium perchlorate, or reagent grade acids were used as supporting electrolytes. RESULTS AND .... Summary of kinetic parameters for acid dependent Fe(phen)3+ oxidetions of b-diimine complexes.

  17. Hardware-Assisted System for Program Execution Security of SOC

    Wang Xiang

    2016-01-01

    Full Text Available With the rapid development of embedded systems, the systems’ security has become more and more important. Most embedded systems are at the risk of series of software attacks, such as buffer overflow attack, Trojan virus. In addition, with the rapid growth in the number of embedded systems and wide application, followed embedded hardware attacks are also increasing. This paper presents a new hardware assisted security mechanism to protect the program’s code and data, monitoring its normal execution. The mechanism mainly monitors three types of information: the start/end address of the program of basic blocks; the lightweight hash value in basic blocks and address of the next basic block. These parameters are extracted through additional tools running on PC. The information will be stored in the security module. During normal program execution, the security module is designed to compare the real-time state of program with the information in the security module. If abnormal, it will trigger the appropriate security response, suspend the program and jump to the specified location. The module has been tested and validated on the SOPC with OR1200 processor. The experimental analysis shows that the proposed mechanism can defence a wide range of common software and physical attacks with low performance penalties and minimal overheads.

  18. Realistically Rendering SoC Traffic Patterns with Interrupt Awareness

    Angiolini, Frederico; Mahadevan, Sharkar; Madsen, Jan

    2005-01-01

    to generate realistic test traffic. This paper presents a selection of applications using interrupt-based synchronization; a reference methodology to split such applications in execution subflows and to adjust the overall execution stream based upon hardware events; a reactive simulation device capable...... of correctly replicating such software behaviours in the MPSoC design phase. Additionally, we validate the proposed concept by showing cycle-accurate reproduction of a previously traced application flow....

  19. Enterprise interoperability ontology for SOC applied to logistics

    Hofman, W.J.

    2010-01-01

    The Service Oriented Architecture (SOA, [1]) can be applied to enterprise integration. It creates an Internet of services for enterprises. Service science [2] defines services in term of value propositions of enterprises to customers. Both service science and the Internet of services require a form

  20. Stochastic Modeling and Performance Analysis of Multimedia SoCs

    Raman, Balaji; Nouri, Ayoub; Gangadharan, Deepak

    2013-01-01

    solutions where each modeling technique has both the above mentioned characteristics. We present a probabilistic analytical framework and a statistical model checking approach to design system-on-chips for low-cost multimedia systems. We apply the modeling techniques to size the output buffer in a video......Reliability and flexibility are among the key required features of a framework used to model a system. Existing approaches to design resource-constrained, soft-real time systems either provide guarantees for output quality or account for loss in the system, but not both. We propose two independent...... decoder. The results shows that, for our stochastic design metric, the analytical framework upper bounds (and relatively accurate) compare to the statistical model checking technique. Also, we observed significant reduction in resource usage (such as output buffer size) with tolerable loss in output...

  1. Species of Concern (SOC) on Department of Defense Installations

    2002-07-15

    ARISTIDA STRICTA; DRY, UPLAND FLAT, FILTERED LIGHT; WITH BAPTISIA CINEREA, VIOLA PEDATA, DALEA PINNATA.* SUBPOP A=PINE/SCRUB OAK SANDHILL; FEW SCATTERED...DIOSPYROS VIRG., GAYLUSSACIA DUMOSA, EPIGAEA REPENS, ANDROPOGON SP., BAPTISIA TINCT., TEPHROSIA VIRG., VACCINIUM CRASS., LESPEDEZA SP., DALEA PINNATA...ADENOCAULON BICOLOR , PHACELIA NEMORALIS, CAREX HENDERSONII. CIRSIUM VULGARE COMMON WHERE DISTURBED.* Cedar-hemlock forest on lower slopes of logged

  2. Development of a stranded oil in coarse sediment (SOCS) model

    Humphrey, B.; Owens, E.; Sergy, G.

    1993-01-01

    Oil spills in Canadian waters have a high probability of impacting coarse sediment beaches, yet the ability to predict oil fate and estimate natural self-cleaning rates is less than adequate. Data is lacking to understand fully many oil sediment interactions. Historically, shoreline interactions have been considered using fairly simple concepts. The authors examined the processes that may occur on a coarse sediment beach, selected those which are important, and developed a fate and persistence model for stranded oil. The processes were divided into stages relative to the spill event, and the factors which affect each stage were evaluated. Three areas of special interest were the capacity of a beach to hold oil, the residual capacity of a beach for oil, and the long-term fate of the oil. After developing model algorithms, the outputs were compared to a data base of information collected during the Exxon Valdez oil spill. The stranded oil in coarse sediment model will provide information at two levels: a general level for planning and sensitivity mapping and a more detailed level intended for the prediction of oil fate on specific known beaches. The strengths and weaknesses of the model have been assessed in terms of data deficiencies. The type and nature of the data which are most useful to, and which need to be collected for, spill planning and spill monitoring were identified. The model shows that the important factors directing the fate of oil on coarse sediment beaches are porosity and permeability, determined by grain size and oil properties (composition, viscosity, etc.). The natural rate of removal of oil, modeled as a first-order (exponential) removal, is dependent on the stage of the spill process and on wave energy

  3. Environmental Assessment of Installation Development at Fairchild Air Force Base, Washington

    2012-12-01

    is an area of dune sand (FAFB 2006c). Soils. The NRCS has mapped nine soil types on Fairchild AFB in the 2006 update to the 1968 Soil Survey of...digynum None T Nuttall’s pussy- toes Antennaria parvifolia None S Palouse goldenweed Pyrrocoma liatriformis SOC T Prairie cordgrass Spartina

  4. Terminal Forecast Reference Notebook (TFRN) for Luke AFB, Arizona,

    1980-06-02

    due west of the base; the Sierra Estrella , 4,512 feet, about 12 miles to the south; the Phoenix Mountains, 2,740 feet, about 20 miles to the east...from any other direction will usually miss the base by more than 5 nautical miles because of the steering effect of the Sierra Estrella and the White...does the Sierra Estrella between 152 and 210 degrees. Most radar signal blocking can be eliminated, with the exception of the White Tanks, by raising

  5. Perseus B over Edwards AFB on a Development Flight

    1998-01-01

    A long, slender wing and a pusher propeller at the rear characterize the Perseus B remotely-piloted research aircraft, seen here during a test flight in April1998. Perseus B is a remotely piloted aircraft developed as a design-performance testbed under NASA's Environmental Research Aircraft and Sensor Technology (ERAST) project. Perseus is one of several flight vehicles involved in the ERAST project. A piston engine, propeller-powered aircraft, Perseus was designed and built by Aurora Flight Sciences Corporation, Manassas, Virginia. The objectives of Perseus B's ERAST flight tests have been to reach and maintain horizontal flight above altitudes of 60,000 feet and demonstrate the capability to fly missions lasting from 8 to 24 hours, depending on payload and altitude requirements. The Perseus B aircraft established an unofficial altitude record for a single-engine, propeller-driven, remotely piloted aircraft on June 27, 1998. It reached an altitude of 60,280 feet. In 1999, several modifications were made to the Perseus aircraft including engine, avionics, and flight-control-system improvements. These improvements were evaluated in a series of operational readiness and test missions at the Dryden Flight Research Center, Edwards, California. Perseus is a high-wing monoplane with a conventional tail design. Its narrow, straight, high-aspect-ratio wing is mounted atop the fuselage. The aircraft is pusher-designed with the propeller mounted in the rear. This design allows for interchangeable scientific-instrument payloads to be placed in the forward fuselage. The design also allows for unobstructed airflow to the sensors and other devices mounted in the payload compartment. The Perseus B that underwent test and development in 1999 was the third generation of the Perseus design, which began with the Perseus Proof-Of-Concept aircraft. Perseus was initially developed as part of NASA's Small High-Altitude Science Aircraft (SHASA) program, which later evolved into the ERAST project. The Perseus Proof-Of-Concept aircraft first flew in November 1991 and made three low-altitude flights within a month to validate the Perseus aerodynamic model and flight control systems. Next came the redesigned Perseus A, which incorporated a closed-cycle combustion system that mixed oxygen carried aboard the aircraft with engine exhaust to compensate for the thin air at high altitudes. The Perseus A was towed into the air by a ground vehicle and its engine started after it became airborne. Prior to landing, the engine was stopped, the propeller locked in horizontal position, and the Perseus A glided to a landing on its unique bicycle-type landing gear. Two Perseus A aircraft were built and made 21 flights in 1993-1994. One of the Perseus A aircraft reached over 50,000 feet in altitude on its third test flight. Although one of the Perseus A aircraft was destroyed in a crash after a vertical gyroscope failed in flight, the other aircraft completed its test program and remains on display at Aurora's facility in Manassas. Perseus B first flew Oct. 7, 1994, and made two flights in 1996 before being damaged in a hard landing on the dry lakebed after a propeller shaft failure. After a number of improvements and upgrades-including extending the original 58.5-foot wingspan to 71.5 feet to enhance high-altitude performance--the Perseus B returned to Dryden in the spring of 1998 for a series of four flights. Thereafter, a series of modifications were made including external fuel pods on the wing that more than doubled the fuel capacity to 100 gallons. Engine power was increased by more than 20 percent by boosting the turbocharger output. Fuel consumption was reduced with fuel control modifications and a leaner fuel-air mixture that did not compromise power. The aircraft again crashed on Oct. 1, 1999, near Barstow, California, suffering moderate damage to the aircraft but no property damage, fire, or injuries in the area of the crash. Perseus B is flown remotely by a pilot from a mobile flight control station on the ground. A Global Positioning System (GPS) unit provides navigation data for continuous and precise location during flight. The ground control station features dual independent consoles for aircraft control and systems monitoring. A flight termination system, required for all remotely piloted aircraft being flown in military-restricted airspace, includes a parachute system deployed on command plus a C-Band radar beacon and a Mode-C transponder to aid in location. Dryden has provided hanger and office space for the Perseus B aircraft and for the flight test development team when on site for flight or ground testing. NASA's ERAST project is developing aeronautical technologies for a new generation of remotely piloted and autonomous aircraft for a variety of upper-atmospheric science missions and commercial applications. Dryden is the lead center in NASA for ERAST management and operations. Perseus B is approximately 25 feet long, has a wingspan of 71.5 feet, and stands 12 feet high. Perseus B is powered by a Rotax 914, four-cylinder piston engine mounted in the mid-fuselage area and integrated with an Aurora-designed three-stage turbocharger, connected to a lightweight two-blade propeller.

  6. Results and Lessons Learned Interim Report: Altus AFB Site

    McHugh, Thomas

    2005-01-01

    ...) to address the critical groundwater-to-indoor-air vapor intrusion pathway. By increasing our understanding of this critical pathway, guidelines can be improved, thereby better focusing Department of Defense (DoD...

  7. Surface Observation Climatic Summaries for McChord AFB Washington

    1989-07-01

    0 .0 .0 .0 TRCE .0 f6 .6 __ 2_.. .. Q .. . __ .3 TR A n - _5.9 .- Z3, - ) 0 , (N T RA C: .9 .0 .3 .0 .0 .0 .2 .3...t 72-0 ....- 930 . .. . .. 7 .2 _ .. .....-3 .. .. i3 O_..... 1 72.) 1.0 7440 ...................... * aCCA *S& - . - -. & -- MO NLi AP-R iJR&j L

  8. Dicty_cDB: AFB241 [Dicty_cDB

    Full Text Available esis elongation factor 1-alpha (tef2) gene, partial cds. 682 0.0 2 AF157274 |AF157274.1 Phascolomyces arti...culosus translation elongation factor 1-alpha (EF-1alpha) gene, partial cds. 105 2e

  9. Surface Observation Climatic Summaries for Richards-Gebaur AFB, Missouri

    1991-04-01

    SUPERSEDES: N/A APR 91 LST TOUTC 406 I MONTH IJAN I FEB I MAR IAP IMAY I JUN I JUL IAUG ISEP IOCT INOV I DEC IANN IYOR- EXTRN MAX TERP(F) 71 82 85 92 94 104...ANDVSBILIT *JN I FEB IAR IM I JUN I JUL IAUG IsEP I OCT I V I DEC I YOR LST 00 - 02 10 03 - 05 10 CIG 06 - 08 23.8 31.5 31.0 22.1 24.0 15.0 12.7 17.4

  10. Waste Analysis Plan and Waste Characterization Survey, Barksdale AFB, Louisiana

    1991-03-01

    4C ;J4 c Ia’) La C; c) 0C\\Jc 8 "= "A -’O ’ 04 CŔ" c C’j C-J CAJe~ .- 44 C’) 0% C% 40w 0 l0 O LCD LA O L O 0 0 -IT~ LA 0 00- -T 0 0 0 0 rC 0 0 1- -C (D...r" 3flP1 7, r, ’. hrm Ai IP mn- 3f 1 f r1~r~~ r*NP m r.4 . 4 .-1- 1n i ito NP Mn.’ 3 12fl n 4f c;I rn’." ’, rfi 3I A’. 7 7?A I (>nd ht ~ HIM S)A R46 S

  11. Proposed Closure of Myrtle Beach AFB, South Carolina

    1990-07-01

    royal fern (Osmunda regalis), poison ivy (Toxicodendron radicans), and cane (Arundinaria gigantea). Common vines are yellow jasmine (Gelsemium... Ledbetter , Major, U.S. Air Force, Attorney, AFRCE-BMS/DES B.S., 1973, Mathematics, University of Georgia. Athens M.A., 1978, 1 ublic Administration...Richard Garthe F. Lee Howell Murray Geddes Sharon F. Howell Peggy J. Geddes Gary Hoyve Fred G. Gerty Greg Hucks C-5 Jeannine Hucks Jessie R. Lee Lacy K

  12. NOAA-L satellite arrives at Vandenberg AFB

    2000-01-01

    Outside the B16-10 spacecraft processing hangar at Vandenberg Air Force Base, Calif., a crated National Oceanic and Atmospheric Administration (NOAA-L) satellite is lowered to the ground before being moved inside. NOAA-L is part of the Polar-Orbiting Operational Environmental Satellite (POES) program that provides atmospheric measurements of temperature, humidity, ozone and cloud images, tracking weather patterns that affect the global weather and climate. The launch of the NOAA-L satellite is scheduled no earlier than Sept. 12 aboard a Lockheed Martin Titan II rocket. Installation Restoration Program. Phase 1. Records Search, Scott AFB, Illinois

    1985-04-01

    mission of defense of the United States, has long been engaged in a wide variety of opera- tions dealing with toxic and hazardous materials. Federal...Histopathology-Cytology Sewer Dental Clinic/Laboratory 1680 Yes Yes DPDO, Sanitary Sewer, Medical Logistics Radiology/X-Ray 1680 Yes Yes DPDO, Sanitary...disintegrate. HALOGEN: The class of chemical elements including fluorine , chlorine, i bromine, and iodine. HALON 1211: A fire extinguishing agent

  13. Installation Restoration Program. Phase 1. Records Search, Lackland AFB, Texas

    1985-02-01

    governmental environ- mental projects. Environmental Engineering Department Head (1973-1976). Supervised staff involved in auditing environmental practices...V. -4 a a ; to- w w M, 4-. c* a a M - ~ a -- ~= a a a a a aa as-au ’- aC aCca - ~~~ - aa:0 a 0 24 X4 JU 2 a -- a. -~a - .wZ 2kD.4 4 ob0 m C C w 4a

  14. Environmental Impact Statement Space Shuttle Program, Vandenberg AFB, California. Supplement.

    1983-07-01

    2 of the Northern Channel Islands, have been motivated in part by concerns identified through interaction between the Air Force and the Coastal...ofA.SrZ 64 0 /OC 2SS - So#e.e. V, f-rrAq ~ WA~oJsie4,e~4 A-I 4&Ajt4 A fLA1//.t"lJAde~ R-SeI~u- dw rwy. £A4Pcr SL3*p~j* ps4 .Prm Al-fdc6k -5)’-ArFkAJ /7

  15. Installation Restoration Program. Phase I. Records Search, Brooks AFB, Texas

    1985-03-01

    decay of the cadavers occurred. The waste was packaged in plastic bags, placed in seven 55-gallon drums and buried in a hole 7 to 8 feet deep. The drums...Receptors subscore (I x factor score subtotal/maximm score subtotal) 44 - II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity...subtotal) 44 II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity, the degree of hazard, and the confidence level of the

  16. Installation Restoration Program. Phase I. Records. Loring AFB, Maine.

    1984-01-01

    periphyton from rivers and streams. Publications Dr. Knight has authored several technical papers on ecosystem metabolism, phytoplankton ecology, and...should be made of glacial till and esker (ice contact) deposits along with the calcareous bedrock (Carys Mills Formation) as they relate to the base...material defects of aircraft struc- tures, component parts, and related ground equipment. Wastes generated by the processes involved include PD-680

  17. Dicty_cDB: AFB514 [Dicty_cDB

    Full Text Available TCACTGTTCATCCAAAATTCTTAACAACAAGAAGAAGCGGAACCAAGAACAAGAAGA ACA sequence update 2001. 6. 1 Translated Amino Acid sequence ---atsnnqlmip...skg*ihchrfshc*nq*treristsl rfirsnsreiclyf*fh*tnc*wycrqcfhlkii*cylsl*nhl*rchgyvqenhgkdlv ltvhpkflttrrsgtknkkn Frame B: ---atsnnqlmips

  18. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland Air Force Base (AFB) and White Sands Missile Range/Holloman AFB, NM, and Edwards AFB and Vandenberg AFB, CA

    2003-06-01

    californicus- _" -~ T ~ - 1" T - E I T Coho salmon Unarmoured three- spined stickleback I Tidewater goby 1 Eucyclogobius n e w b e p i ,.I...ENDANGERED Black-footed ferret (Mustela nigripes)"" Northern aplomado falcon (Falcofemoralis septentrionalis) Kuenzler hedgehog cachls (Echi...Empidonax traillii ertimus) Kuenzler hedgehog cactus (Echinocer~.~rendleri var. kuenzleri) Todsen’s pennyroyal (Hedeoma fodsenii) Sacramento

  19. Dicty_cDB: AFB744 [Dicty_cDB

    Full Text Available lqhpkripplpfsfxixrxyanfc*xlfxgktiplever***h*kcqsqnprqrry spxstxfhfxw*tixxwpxsl*lqhpkxipxpfsxxikrwxanxcknlxwx...xhxigsxrf **hxkcxxqnsxqxrysxrstxinfxwxtixxwxxxx*lqxskgixxpfsxxikrwxanx c*nfnr*nxpxgsxr***x*kc*sqxprqxrxspxst