
Sample records for small rna sequencing

  1. Small molecule alteration of RNA sequence in cells and animals. (United States)

    Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D


    RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. DSAP: deep-sequencing small RNA analysis pipeline. (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus


    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (; and (iv) known miRNA matching: detection of known miRNAs in miRBase ( based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at

  3. Identification of Bacterial Small RNAs by RNA Sequencing

    DEFF Research Database (Denmark)

    Gómez Lozano, María; Marvig, Rasmus Lykke; Molin, Søren


    sequencing (RNA-seq) is described that involves the preparation and analysis of three different sequencing libraries. As a signifi cant number of unique sRNAs are identifi ed in each library, the libraries can be used either alone or in combination to increase the number of sRNAs identifi ed. The approach......Small regulatory RNAs (sRNAs) in bacteria are known to modulate gene expression and control a variety of processes including metabolic reactions, stress responses, and pathogenesis in response to environmental signals. A method to identify bacterial sRNAs on a genome-wide scale based on RNA...... may be applied to identify sRNAs in any bacterium under different growth and stress conditions....

  4. Preparation of highly multiplexed small RNA sequencing libraries. (United States)

    Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos


    MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

  5. Deep-sequencing protocols influence the results obtained in small-RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Joern Toedling

    Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.

  6. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid


    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  7. Using small RNA (sRNA) deep sequencing to understand global virus distribution in plants (United States)

    Small RNAs (sRNAs), a class of regulatory RNAs, have been used to serve as the specificity determinants of suppressing gene expression in plants and animals. Next generation sequencing (NGS) uncovered the sRNA landscape in most organisms including their associated microbes. In the current study, w...

  8. Chimira: analysis of small RNA sequencing data and microRNA modifications. (United States)

    Vitsios, Dimitrios M; Enright, Anton J


    Chimira is a web-based system for microRNA (miRNA) analysis from small RNA-Seq data. Sequences are automatically cleaned, trimmed, size selected and mapped directly to miRNA hairpin sequences. This generates count-based miRNA expression data for subsequent statistical analysis. Moreover, it is capable of identifying epi-transcriptomic modifications in the input sequences. Supported modification types include multiple types of 3'-modifications (e.g. uridylation, adenylation), 5'-modifications and also internal modifications or variation (ADAR editing or single nucleotide polymorphisms). Besides cleaning and mapping of input sequences to miRNAs, Chimira provides a simple and intuitive set of tools for the analysis and interpretation of the results (see also Supplementary Material). These allow the visual study of the differential expression between two specific samples or sets of samples, the identification of the most highly expressed miRNAs within sample pairs (or sets of samples) and also the projection of the modification profile for specific miRNAs across all samples. Other tools have already been published in the past for various types of small RNA-Seq analysis, such as UEA workbench, seqBuster, MAGI, OASIS and CAP-miRSeq, CPSS for modifications identification. A comprehensive comparison of Chimira with each of these tools is provided in the Supplementary Material. Chimira outperforms all of these tools in total execution speed and aims to facilitate simple, fast and reliable analysis of small RNA-Seq data allowing also, for the first time, identification of global microRNA modification profiles in a simple intuitive interface. Chimira has been developed as a web application and it is accessible here: Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  9. Computational prediction of miRNA genes from small RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Wenjing eKang


    Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

  10. Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.

    Directory of Open Access Journals (Sweden)

    Thomas Birkballe Hansen

    Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.

  11. Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I. (United States)

    Lama, Lodoe; Ryan, Kevin


    Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. Oasis: online analysis of small RNA deep sequencing data. (United States)

    Capece, Vincenzo; Garcia Vizcaino, Julio C; Vidal, Ramon; Rahman, Raza-Ur; Pena Centeno, Tonatiuh; Shomroni, Orr; Suberviola, Irantzu; Fischer, Andre; Bonn, Stefan


    Oasis is a web application that allows for the fast and flexible online analysis of small-RNA-seq (sRNA-seq) data. It was designed for the end user in the lab, providing an easy-to-use web frontend including video tutorials, demo data and best practice step-by-step guidelines on how to analyze sRNA-seq data. Oasis' exclusive selling points are a differential expression module that allows for the multivariate analysis of samples, a classification module for robust biomarker detection and an advanced programming interface that supports the batch submission of jobs. Both modules include the analysis of novel miRNAs, miRNA targets and functional analyses including GO and pathway enrichment. Oasis generates downloadable interactive web reports for easy visualization, exploration and analysis of data on a local system. Finally, Oasis' modular workflow enables for the rapid (re-) analysis of data. Oasis is implemented in Python, R, Java, PHP, C++ and JavaScript. It is freely available at Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  13. sRNAnalyzer-a flexible and customizable small RNA sequencing data analysis pipeline. (United States)

    Wu, Xiaogang; Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J; Wang, Kai


    Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline-sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. sRNAnalyzer—a flexible and customizable small RNA sequencing data analysis pipeline (United States)

    Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J.


    Abstract Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline—sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: PMID:29069500

  15. DNApi: A De Novo Adapter Prediction Algorithm for Small RNA Sequencing Data. (United States)

    Tsuji, Junko; Weng, Zhiping


    With the rapid accumulation of publicly available small RNA sequencing datasets, third-party meta-analysis across many datasets is becoming increasingly powerful. Although removing the 3´ adapter is an essential step for small RNA sequencing analysis, the adapter sequence information is not always available in the metadata. The information can be also erroneous even when it is available. In this study, we developed DNApi, a lightweight Python software package that predicts the 3´ adapter sequence de novo and provides the user with cleansed small RNA sequences ready for down stream analysis. Tested on 539 publicly available small RNA libraries accompanied with 3´ adapter sequences in their metadata, DNApi shows near-perfect accuracy (98.5%) with fast runtime (~2.85 seconds per library) and efficient memory usage (~43 MB on average). In addition to 3´ adapter prediction, it is also important to classify whether the input small RNA libraries were already processed, i.e. the 3´ adapters were removed. DNApi perfectly judged that given another batch of datasets, 192 publicly available processed libraries were "ready-to-map" small RNA sequence. DNApi is compatible with Python 2 and 3, and is available at The 731 small RNA libraries used for DNApi evaluation were from human tissues and were carefully and manually collected. This study also provides readers with the curated datasets that can be integrated into their studies.

  16. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data. (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C


    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  17. CPSS: a computational platform for the analysis of small RNA deep sequencing data. (United States)

    Zhang, Yuanwei; Xu, Bo; Yang, Yifan; Ban, Rongjun; Zhang, Huan; Jiang, Xiaohua; Cooke, Howard J; Xue, Yu; Shi, Qinghua


    Next generation sequencing (NGS) techniques have been widely used to document the small ribonucleic acids (RNAs) implicated in a variety of biological, physiological and pathological processes. An integrated computational tool is needed for handling and analysing the enormous datasets from small RNA deep sequencing approach. Herein, we present a novel web server, CPSS (a computational platform for the analysis of small RNA deep sequencing data), designed to completely annotate and functionally analyse microRNAs (miRNAs) from NGS data on one platform with a single data submission. Small RNA NGS data can be submitted to this server with analysis results being returned in two parts: (i) annotation analysis, which provides the most comprehensive analysis for small RNA transcriptome, including length distribution and genome mapping of sequencing reads, small RNA quantification, prediction of novel miRNAs, identification of differentially expressed miRNAs, piwi-interacting RNAs and other non-coding small RNAs between paired samples and detection of miRNA editing and modifications and (ii) functional analysis, including prediction of miRNA targeted genes by multiple tools, enrichment of gene ontology terms, signalling pathway involvement and protein-protein interaction analysis for the predicted genes. CPSS, a ready-to-use web server that integrates most functions of currently available bioinformatics tools, provides all the information wanted by the majority of users from small RNA deep sequencing datasets. CPSS is implemented in PHP/PERL+MySQL+R and can be freely accessed at or

  18. Small RNA sequencing reveals metastasis-related microRNAs in lung adenocarcinoma

    DEFF Research Database (Denmark)

    Daugaard, Iben; Venø, Morten T.; Yan, Yan


    The majority of lung cancer deaths are caused by metastatic disease. MicroRNAs (miRNAs) are posttranscriptional regulators of gene expression and miRNA dysregulation can contribute to metastatic progression. Here, small RNA sequencing was used to profile the miRNA and piwi-interacting RNA (piRNA......) transcriptomes in relation to lung cancer metastasis. RNA-seq was performed using RNA extracted from formalin-fixed paraffin embedded (FFPE) lung adenocarcinomas (LAC) and brain metastases from 8 patients, and LACs from 8 patients without detectable metastatic disease. Impact on miRNA and piRNA transcriptomes...... was subtle with 9 miRNAs and 8 piRNAs demonstrating differential expression between metastasizing and non-metastasizing LACs. For piRNAs, decreased expression of piR-57125 was the most significantly associated with distant metastasis. Validation by RT-qPCR in a LAC cohort comprising 52 patients confirmed...

  19. StarScan: a web server for scanning small RNA targets from degradome sequencing data. (United States)

    Liu, Shun; Li, Jun-Hao; Wu, Jie; Zhou, Ke-Ren; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu


    Endogenous small non-coding RNAs (sRNAs), including microRNAs, PIWI-interacting RNAs and small interfering RNAs, play important gene regulatory roles in animals and plants by pairing to the protein-coding and non-coding transcripts. However, computationally assigning these various sRNAs to their regulatory target genes remains technically challenging. Recently, a high-throughput degradome sequencing method was applied to identify biologically relevant sRNA cleavage sites. In this study, an integrated web-based tool, StarScan (sRNA target Scan), was developed for scanning sRNA targets using degradome sequencing data from 20 species. Given a sRNA sequence from plants or animals, our web server performs an ultrafast and exhaustive search for potential sRNA-target interactions in annotated and unannotated genomic regions. The interactions between small RNAs and target transcripts were further evaluated using a novel tool, alignScore. A novel tool, degradomeBinomTest, was developed to quantify the abundance of degradome fragments located at the 9-11th nucleotide from the sRNA 5' end. This is the first web server for discovering potential sRNA-mediated RNA cleavage events in plants and animals, which affords mechanistic insights into the regulatory roles of sRNAs. The StarScan web server is available at © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. MicroRNA Expression Profile in Penile Cancer Revealed by Next-Generation Small RNA Sequencing.

    Directory of Open Access Journals (Sweden)

    Li Zhang

    Full Text Available Penile cancer (PeCa is a relatively rare tumor entity but possesses higher morbidity and mortality rates especially in developing countries. To date, the concrete pathogenic signaling pathways and core machineries involved in tumorigenesis and progression of PeCa remain to be elucidated. Several studies suggested miRNAs, which modulate gene expression at posttranscriptional level, were frequently mis-regulated and aberrantly expressed in human cancers. However, the miRNA profile in human PeCa has not been reported before. In this present study, the miRNA profile was obtained from 10 fresh penile cancerous tissues and matched adjacent non-cancerous tissues via next-generation sequencing. As a result, a total of 751 and 806 annotated miRNAs were identified in normal and cancerous penile tissues, respectively. Among which, 56 miRNAs with significantly different expression levels between paired tissues were identified. Subsequently, several annotated miRNAs were selected randomly and validated using quantitative real-time PCR. Compared with the previous publications regarding to the altered miRNAs expression in various cancers and especially genitourinary (prostate, bladder, kidney, testis cancers, the most majority of deregulated miRNAs showed the similar expression pattern in penile cancer. Moreover, the bioinformatics analyses suggested that the putative target genes of differentially expressed miRNAs between cancerous and matched normal penile tissues were tightly associated with cell junction, proliferation, growth as well as genomic instability and so on, by modulating Wnt, MAPK, p53, PI3K-Akt, Notch and TGF-β signaling pathways, which were all well-established to participate in cancer initiation and progression. Our work presents a global view of the differentially expressed miRNAs and potentially regulatory networks of their target genes for clarifying the pathogenic transformation of normal penis to PeCa, which research resource also

  1. Small RNA sequencing reveals a comprehensive miRNA signature of BRCA1-associated high-grade serous ovarian cancer

    NARCIS (Netherlands)

    Brouwer, Jan; Kluiver, Joost; de Almeida, Rodrigo C.; Modderman, Rutger; Terpstra, Martijn; Kok, Klaas; Withoff, Sebo; Hollema, Harry; Reitsma, Welmoed; de Bock, Geertruida H.; Mourits, Marian J. E.; van den Berg, Anke


    AimsBRCA1 mutation carriers are at increased risk of developing high-grade serous ovarian cancer (HGSOC), a malignancy that originates from fallopian tube epithelium. We aimed to identify differentially expressed known and novel miRNAs in BRCA1-associated HGSOC. Methods Small RNA sequencing was

  2. Elucidating the Small Regulatory RNA Repertoire of the Sea Anemone Anemonia viridis Based on Whole Genome and Small RNA Sequencing. (United States)

    Urbarova, Ilona; Patel, Hardip; Forêt, Sylvain; Karlsen, Bård Ove; Jørgensen, Tor Erik; Hall-Spencer, Jason M; Johansen, Steinar D


    Cnidarians harbor a variety of small regulatory RNAs that include microRNAs (miRNAs) and PIWI-interacting RNAs (piRNAs), but detailed information is limited. Here, we report the identification and expression of novel miRNAs and putative piRNAs, as well as their genomic loci, in the symbiotic sea anemone Anemonia viridis. We generated a draft assembly of the A. viridis genome with putative size of 313 Mb that appeared to be composed of about 36% repeats, including known transposable elements. We detected approximately equal fractions of DNA transposons and retrotransposons. Deep sequencing of small RNA libraries constructed from A. viridis adults sampled at a natural CO2 gradient off Vulcano Island, Italy, identified 70 distinct miRNAs. Eight were homologous to previously reported miRNAs in cnidarians, whereas 62 appeared novel. Nine miRNAs were recognized as differentially expressed along the natural seawater pH gradient. We found a highly abundant and diverse population of piRNAs, with a substantial fraction showing ping-pong signatures. We identified nearly 22% putative piRNAs potentially targeting transposable elements within the A. viridis genome. The A. viridis genome appeared similar in size to that of other hexacorals with a very high divergence of transposable elements resembling that of the sea anemone genus Exaiptasia. The genome encodes and expresses a high number of small regulatory RNAs, which include novel miRNAs and piRNAs. Differentially expressed small RNAs along the seawater pH gradient indicated regulatory gene responses to environmental stressors. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Modeling bias and variation in the stochastic processes of small RNA sequencing. (United States)

    Argyropoulos, Christos; Etheridge, Alton; Sakhanenko, Nikita; Galas, David


    The use of RNA-seq as the preferred method for the discovery and validation of small RNA biomarkers has been hindered by high quantitative variability and biased sequence counts. In this paper we develop a statistical model for sequence counts that accounts for ligase bias and stochastic variation in sequence counts. This model implies a linear quadratic relation between the mean and variance of sequence counts. Using a large number of sequencing datasets, we demonstrate how one can use the generalized additive models for location, scale and shape (GAMLSS) distributional regression framework to calculate and apply empirical correction factors for ligase bias. Bias correction could remove more than 40% of the bias for miRNAs. Empirical bias correction factors appear to be nearly constant over at least one and up to four orders of magnitude of total RNA input and independent of sample composition. Using synthetic mixes of known composition, we show that the GAMLSS approach can analyze differential expression with greater accuracy, higher sensitivity and specificity than six existing algorithms (DESeq2, edgeR, EBSeq, limma, DSS, voom) for the analysis of small RNA-seq data. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

    Directory of Open Access Journals (Sweden)

    Livia Donaire

    Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

  5. Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis (United States)

    Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min


    MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

  6. Application of small RNA sequencing to identify microRNAs in acute kidney injury and fibrosis

    Energy Technology Data Exchange (ETDEWEB)

    Pellegrini, Kathryn L. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Gerlach, Cory V. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States); Craciun, Florin L.; Ramachandran, Krithika [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Bijol, Vanesa [Department of Pathology, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Kissick, Haydn T. [Department of Surgery, Urology Division, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA (United States); Vaidya, Vishal S., E-mail: [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States)


    Establishing a microRNA (miRNA) expression profile in affected tissues provides an important foundation for the discovery of miRNAs involved in the development or progression of pathologic conditions. We conducted small RNA sequencing to generate a temporal profile of miRNA expression in the kidneys using a mouse model of folic acid-induced (250 mg/kg i.p.) kidney injury and fibrosis. From the 103 miRNAs that were differentially expressed over the time course (> 2-fold, p < 0.05), we chose to further investigate miR-18a-5p, which is expressed during the acute stage of the injury; miR-132-3p, which is upregulated during transition between acute and fibrotic injury; and miR-146b-5p, which is highly expressed at the peak of fibrosis. Using qRT-PCR, we confirmed the increased expression of these candidate miRNAs in the folic acid model as well as in other established mouse models of acute injury (ischemia/reperfusion injury) and fibrosis (unilateral ureteral obstruction). In situ hybridization confirmed high expression of miR-18a-5p, miR-132-3p and miR-146b-5p throughout the kidney cortex in mice and humans with severe kidney injury or fibrosis. When primary human proximal tubular epithelial cells were treated with model nephrotoxicants such as cadmium chloride (CdCl{sub 2}), arsenic trioxide, aristolochic acid (AA), potassium dichromate (K{sub 2}Cr{sub 2}O{sub 7}) and cisplatin, miRNA-132-3p was upregulated 4.3-fold after AA treatment and 1.5-fold after K{sub 2}Cr{sub 2}O{sub 7} and CdCl{sub 2} treatment. These results demonstrate the application of temporal small RNA sequencing to identify miR-18a, miR-132 and miR-146b as differentially expressed miRNAs during distinct phases of kidney injury and fibrosis progression. - Highlights: • We used small RNA sequencing to identify differentially expressed miRNAs in kidney. • Distinct patterns were found for acute injury and fibrotic stages in the kidney. • Upregulation of miR-18a, -132 and -146b was confirmed in mice

  7. Methods for small RNA preparation for digital gene expression profiling by next-generation sequencing

    NARCIS (Netherlands)

    Linsen, S.E.V.; Cuppen, E.


    Digital gene expression (DGE) profiling techniques are playing an eminent role in the detection, localization, and differential expression quantification of many small RNA species, including microRNAs (1-3). Procedures in small RNA library preparation techniques typically include adapter ligation by

  8. Small RNA and transcriptome deep sequencing proffers insight into floral gene regulation in Rosa cultivars

    Directory of Open Access Journals (Sweden)

    Kim Jungeun


    Full Text Available Abstract Background Roses (Rosa sp., which belong to the family Rosaceae, are the most economically important ornamental plants—making up 30% of the floriculture market. However, given high demand for roses, rose breeding programs are limited in molecular resources which can greatly enhance and speed breeding efforts. A better understanding of important genes that contribute to important floral development and desired phenotypes will lead to improved rose cultivars. For this study, we analyzed rose miRNAs and the rose flower transcriptome in order to generate a database to expound upon current knowledge regarding regulation of important floral characteristics. A rose genetic database will enable comprehensive analysis of gene expression and regulation via miRNA among different Rosa cultivars. Results We produced more than 0.5 million reads from expressed sequences, totalling more than 110 million bp. From these, we generated 35,657, 31,434, 34,725, and 39,722 flower unigenes from Rosa hybrid: ‘Vital’, ‘Maroussia’, and ‘Sympathy’ and Rosa rugosa Thunb. , respectively. The unigenes were assigned functional annotations, domains, metabolic pathways, Gene Ontology (GO terms, Plant Ontology (PO terms, and MIPS Functional Catalogue (FunCat terms. Rose flower transcripts were compared with genes from whole genome sequences of Rosaceae members (apple, strawberry, and peach and grape. We also produced approximately 40 million small RNA reads from flower tissue for Rosa, representing 267 unique miRNA tags. Among identified miRNAs, 25 of them were novel and 242 of them were conserved miRNAs. Statistical analyses of miRNA profiles revealed both shared and species-specific miRNAs, which presumably effect flower development and phenotypes. Conclusions In this study, we constructed a Rose miRNA and transcriptome database, and we analyzed the miRNAs and transcriptome generated from the flower tissues of four Rosa cultivars. The database provides a

  9. High throughput sequencing of small RNA component of leaves and inflorescence revealed conserved and novel miRNAs as well as phasiRNA loci in chickpea. (United States)

    Srivastava, Sangeeta; Zheng, Yun; Kudapa, Himabindu; Jagadeeswaran, Guru; Hivrale, Vandana; Varshney, Rajeev K; Sunkar, Ramanjulu


    Among legumes, chickpea (Cicer arietinum L.) is the second most important crop after soybean. MicroRNAs (miRNAs) play important roles by regulating target gene expression important for plant development and tolerance to stress conditions. Additionally, recently discovered phased siRNAs (phasiRNAs), a new class of small RNAs, are abundantly produced in legumes. Nevertheless, little is known about these regulatory molecules in chickpea. The small RNA population was sequenced from leaves and flowers of chickpea to identify conserved and novel miRNAs as well as phasiRNAs/phasiRNA loci. Bioinformatics analysis revealed 157 miRNA loci for the 96 highly conserved and known miRNA homologs belonging to 38 miRNA families in chickpea. Furthermore, 20 novel miRNAs belonging to 17 miRNA families were identified. Sequence analysis revealed approximately 60 phasiRNA loci. Potential target genes likely to be regulated by these miRNAs were predicted and some were confirmed by modified 5' RACE assay. Predicted targets are mostly transcription factors that might be important for developmental processes, and others include superoxide dismutases, plantacyanin, laccases and F-box proteins that could participate in stress responses and protein degradation. Overall, this study provides an inventory of miRNA-target gene interactions for chickpea, useful for the comparative analysis of small RNAs among legumes. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  10. Deep sequencing of Salmonella RNA associated with heterologous Hfq proteins in vivo reveals small RNAs as a major target class and identifies RNA processing phenotypes. (United States)

    Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg


    The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.

  11. Identification of multiple mRNA and DNA sequences from small tissue samples isolated by laser-assisted microdissection. (United States)

    Bernsen, M R; Dijkman, H B; de Vries, E; Figdor, C G; Ruiter, D J; Adema, G J; van Muijen, G N


    Molecular analysis of small tissue samples has become increasingly important in biomedical studies. Using a laser dissection microscope and modified nucleic acid isolation protocols, we demonstrate that multiple mRNA as well as DNA sequences can be identified from a single-cell sample. In addition, we show that the specificity of procurement of tissue samples is not compromised by smear contamination resulting from scraping of the microtome knife during sectioning of lesions. The procedures described herein thus allow for efficient RT-PCR or PCR analysis of multiple nucleic acid sequences from small tissue samples obtained by laser-assisted microdissection.

  12. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.


    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  13. Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench. (United States)

    Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent


    Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. © 2017 Beckers et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  14. DeAnnIso: a tool for online detection and annotation of isomiRs from small RNA sequencing data. (United States)

    Zhang, Yuanwei; Zang, Qiguang; Zhang, Huan; Ban, Rongjun; Yang, Yifan; Iqbal, Furhan; Li, Ao; Shi, Qinghua


    Small RNA (sRNA) Sequencing technology has revealed that microRNAs (miRNAs) are capable of exhibiting frequent variations from their canonical sequences, generating multiple variants: the isoforms of miRNAs (isomiRs). However, integrated tool to precisely detect and systematically annotate isomiRs from sRNA sequencing data is still in great demand. Here, we present an online tool, DeAnnIso (Detection and Annotation of IsomiRs from sRNA sequencing data). DeAnnIso can detect all the isomiRs in an uploaded sample, and can extract the differentially expressing isomiRs from paired or multiple samples. Once the isomiRs detection is accomplished, detailed annotation information, including isomiRs expression, isomiRs classification, SNPs in miRNAs and tissue specific isomiR expression are provided to users. Furthermore, DeAnnIso provides a comprehensive module of target analysis and enrichment analysis for the selected isomiRs. Taken together, DeAnnIso is convenient for users to screen for isomiRs of their interest and useful for further functional studies. The server is implemented in PHP + Perl + R and available to all users for free at: and © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences. (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan


    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  16. Sequencing of Isotope-Labeled Small RNA Using Femtosecond Laser Ablation Time-of-Flight Mass Spectrometry (United States)

    Kurata-Nishimura, Mizuki; Ando, Yoshinari; Kobayashi, Tohru; Matsuo, Yukari; Suzuki, Harukazu; Hayashizaki, Yoshihide; Kawai, Jun


    A novel method for the analysis of sequences of small RNAs using nucleotide triphosphates labeled with stable isotopes has been developed using time-of-flight mass spectroscopy combined with femtosecond laser ablation (fsLA-TOF-MS). Small RNAs synthesized with nucleotides enriched in 13C and 15N were efficiently atomized and ionized by single-shot fsLA and the isotope ratios 13C/12C and 15N/14N were evaluated using the TOF-MS method. By comparing the isotope ratios among four different configurations, the number of nucleotide contents of the control RNA sample were successfully reproduced.

  17. Assessment of small RNA sorting into different extracellular fractions revealed by high-throughput sequencing of breast cell lines (United States)

    Tosar, Juan Pablo; Gámbaro, Fabiana; Sanguinetti, Julia; Bonilla, Braulio; Witwer, Kenneth W.; Cayota, Alfonso


    Intercellular communication can be mediated by extracellular small regulatory RNAs (sRNAs). Circulating sRNAs are being intensively studied for their promising use as minimally invasive disease biomarkers. To date, most attention is centered on exosomes and microRNAs as the vectors and the secreted species, respectively. However, this field would benefit from an increased understanding of the plethora of sRNAs secreted by different cell types in different extracellular fractions. It is still not clear if specific sRNAs are selected for secretion, or if sRNA secretion is mostly passive. We sequenced the intracellular sRNA content (19–60 nt) of breast epithelial cell lines (MCF-7 and MCF-10A) and compared it with extracellular fractions enriched in microvesicles, exosomes and ribonucleoprotein complexes. Our results are consistent with a non-selective secretion model for most microRNAs, although a few showed secretion patterns consistent with preferential secretion. On the contrary, 5′ tRNA halves and 5′ RNA Y4-derived fragments of 31–33 were greatly and significantly enriched in the extracellular space (even in non-mammary cell lines), where tRNA halves were detected as part of ∼45 kDa ribonucleoprotein complexes. Overall, we show that different sRNA families have characteristic secretion patterns and open the question of the role of these sRNAs in the extracellular space. PMID:25940616

  18. Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera. (United States)

    Chen, X; Yu, X; Cai, Y; Zheng, H; Yu, D; Liu, G; Zhou, Q; Hu, S; Hu, F


    MicroRNAs (miRNAs) are key regulators in various physiological and pathological processes via post-transcriptional regulation of gene expression. The honey bee (Apis mellifera) is a key model for highly social species, and its complex social behaviour can be interpreted theoretically as changes in gene regulation, in which miRNAs are thought to be involved. We used the SOLiD sequencing system to identify the repertoire of miRNAs in the honey bee by sequencing a mixed small RNA library from different developmental stages. We obtained a total of 36,796,459 raw sequences; of which 5,491,100 short sequences were fragments of mRNA and other noncoding RNAs (ncRNA), and 1,759,346 reads mapped to the known miRNAs. We predicted 267 novel honey bee miRNAs representing 380,182 short reads, including eight miRNAs of other insects in 14,107,583 genome-mapped sequences. We verified 50 of them using stem-loop reverse-transcription PCR (RT-PCR), in which 35 yielded PCR products. Cross-species analyses showed 81 novel miRNAs with homologues in other insects, suggesting that they were authentic miRNAs and have similar functions. The results of this study provide a basis for studies of the miRNA-modulating networks in development and some intriguing phenomena such as caste differentiation in A. mellifera. © 2010 The Authors. Insect Molecular Biology © 2010 The Royal Entomological Society.

  19. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis. (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K


    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  20. viRome: an R package for the visualization and analysis of viral small RNA sequence datasets. (United States)

    Watson, Mick; Schnettler, Esther; Kohl, Alain


    RNA interference (RNAi) is known to play an important part in defence against viruses in a range of species. Second-generation sequencing technologies allow us to assay these systems and the small RNAs that play a key role with unprecedented depth. However, scientists need access to tools that can condense, analyse and display the resulting data. Here, we present viRome, a package for R that takes aligned sequence data and produces a range of essential plots and reports. viRome is released under the BSD license as a package for R available for both Windows and Linux Additional information and a tutorial is available on the ARK-Genomics website:

  1. Deep sequencing analysis of small noncoding RNA and mRNA targets of the global post-transcriptional regulator, Hfq

    DEFF Research Database (Denmark)

    Sittka, A; Lucchini, S; Papenfort, K


    would be rescued by overexpression of HilD and FlhDC, and we proved this to be correct. The combination of epitope-tagging and HTPS of immunoprecipitated RNA detected the expression of many intergenic chromosomal regions of Salmonella. Our approach overcomes the limited availability of high...

  2. CoLIde: A bioinformatics tool for CO-expression based small RNA Loci Identification using high-throughput sequencing data


    Mohorianu, Irina; Stocks, Matthew Benedict; Wood, John; Dalmay, Tamas; Moulton, Vincent


    Small RNAs (sRNAs) are 20–25 nt non-coding RNAs that act as guides for the highly sequence-specific regulatory mechanism known as RNA silencing. Due to the recent increase in sequencing depth, a highly complex and diverse population of sRNAs in both plants and animals has been revealed. However, the exponential increase in sequencing data has also made the identification of individual sRNA transcripts corresponding to biological units (sRNA loci) more challenging when based exclusively on the...

  3. Small RNA Sequencing Reveals Differential miRNA Expression in the Early Development of Broccoli (Brassica oleracea var. italica) Pollen. (United States)

    Li, Hui; Wang, Yu; Wu, Mei; Li, Lihong; Jin, Chuan; Zhang, Qingli; Chen, Chengbin; Song, Wenqin; Wang, Chunguo


    Pollen development is an important and complex biological process in the sexual reproduction of flowering plants. Although the cytological characteristics of pollen development are well defined, the regulation of its early stages remains largely unknown. In the present study, miRNAs were explored in the early development of broccoli ( Brassica oleracea var. italica ) pollen. A total of 333 known miRNAs that originated from 235 miRNA families were detected. Fifty-five novel miRNA candidates were identified. Sixty of the 333 known miRNAs and 49 of the 55 predicted novel miRNAs exhibited significantly differential expression profiling in the three distinct developmental stages of broccoli pollen. Among these differentially expressed miRNAs, miRNAs that would be involved in the developmental phase transition from uninucleate microspores to binucleate pollen grains or from binucleate to trinucleate pollen grains were identified. miRNAs that showed significantly enriched expression in a specific early stage of broccoli pollen development were also observed. In addition, 552 targets for 127 known miRNAs and 69 targets for 40 predicted novel miRNAs were bioinformatically identified. Functional annotation and GO (Gene Ontology) analysis indicated that the putative miRNA targets showed significant enrichment in GO terms that were related to plant organ formation and morphogenesis. Some of enriched GO terms were detected for the targets directly involved in plant male reproduction development. These findings provided new insights into the functions of miRNA-mediated regulatory networks in broccoli pollen development.

  4. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia. (United States)

    Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira


    Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

  5. High-throughput sequencing of small RNA transcriptome reveals salt stress regulated microRNAs in sugarcane.

    Directory of Open Access Journals (Sweden)

    Mariana Carnavale Bottino

    Full Text Available Salt stress is a primary cause of crop losses worldwide, and it has been the subject of intense investigation to unravel the complex mechanisms responsible for salinity tolerance. MicroRNA is implicated in many developmental processes and in responses to various abiotic stresses, playing pivotal roles in plant adaptation. Deep sequencing technology was chosen to determine the small RNA transcriptome of Saccharum sp cultivars grown on saline conditions. We constructed four small RNAs libraries prepared from plants grown on hydroponic culture submitted to 170 mM NaCl and harvested after 1 h, 6 hs and 24 hs. Each library was sequenced individually and together generated more than 50 million short reads. Ninety-eight conserved miRNAs and 33 miRNAs* were identified by bioinformatics. Several of the microRNA showed considerable differences of expression in the four libraries. To confirm the results of the bioinformatics-based analysis, we studied the expression of the 10 most abundant miRNAs and 1 miRNA* in plants treated with 170 mM NaCl and in plants with a severe treatment of 340 mM NaCl. The results showed that 11 selected miRNAs had higher expression in samples treated with severe salt treatment compared to the mild one. We also investigated the regulation of the same miRNAs in shoots of four cultivars grown on soil treated with 170 mM NaCl. Cultivars could be grouped according to miRNAs expression in response to salt stress. Furthermore, the majority of the predicted target genes had an inverse regulation with their correspondent microRNAs. The targets encode a wide range of proteins, including transcription factors, metabolic enzymes and genes involved in hormone signaling, probably assisting the plants to develop tolerance to salinity. Our work provides insights into the regulatory functions of miRNAs, thereby expanding our knowledge on potential salt-stressed regulated genes.

  6. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    International Nuclear Information System (INIS)

    Medina, Monica; Collins, Allen G.; Silberman, Jeffrey; Sogin, Mitchell L.


    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny

  7. Small RNA-Sequencing Links Physiological Changes and RdDM Process to Vegetative-to-Floral Transition in Apple

    Directory of Open Access Journals (Sweden)

    Xinwei Guo


    Full Text Available Transition from vegetative to floral buds is a critical physiological change during flower induction that determines fruit productivity. Small non-coding RNAs (sRNAs including microRNAs (miRNAs and small interfering RNAs (siRNAs are pivotal regulators of plant growth and development. Although the key role of sRNAs in flowering regulation has been well-described in Arabidopsis and some other annual plants, their relevance to vegetative-to-floral transition (hereafter, referred to floral transition in perennial woody trees remains under defined. Here, we performed Illumina sequencing of sRNA libraries prepared from vegetative and floral bud during flower induction of the apple trees. A large number of sRNAs exemplified by 33 previously annotated miRNAs and six novel members display significant differential expression (DE patterns. Notably, most of these DE-miRNAs in floral transition displayed opposite expression changes in reported phase transition in apple trees. Bioinformatics analysis suggests most of the DE-miRNAs targeted transcripts involved in SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL gene regulation, stress responses, and auxin and gibberellin (GA pathways, with further suggestion that there is an inherent link between physiological stress response and metabolism reprogramming during floral transition. We also observed significant changes in 24 nucleotide (nt sRNAs that are hallmarks for RNA-dependent DNA methylation (RdDM pathway, suggestive of the correlation between epigenetic modifications and the floral transition. The study not only provides new insight into our understanding of fundamental mechanism of poorly studied floral transition in apple and other woody plants, but also presents important sRNA resource for future in-depth research in the apple flowering physiology.

  8. Simultaneous sequencing of coding and noncoding RNA reveals a human transcriptome dominated by a small number of highly expressed noncoding genes. (United States)

    Boivin, Vincent; Deschamps-Francoeur, Gabrielle; Couture, Sonia; Nottingham, Ryan M; Bouchard-Bourelle, Philia; Lambowitz, Alan M; Scott, Michelle S; Abou-Elela, Sherif


    Comparing the abundance of one RNA molecule to another is crucial for understanding cellular functions but most sequencing techniques can target only specific subsets of RNA. In this study, we used a new fragmented ribodepleted TGIRT sequencing method that uses a thermostable group II intron reverse transcriptase (TGIRT) to generate a portrait of the human transcriptome depicting the quantitative relationship of all classes of nonribosomal RNA longer than 60 nt. Comparison between different sequencing methods indicated that FRT is more accurate in ranking both mRNA and noncoding RNA than viral reverse transcriptase-based sequencing methods, even those that specifically target these species. Measurements of RNA abundance in different cell lines using this method correlate with biochemical estimates, confirming tRNA as the most abundant nonribosomal RNA biotype. However, the single most abundant transcript is 7SL RNA, a component of the signal recognition particle. S tructured n on c oding RNAs (sncRNAs) associated with the same biological process are expressed at similar levels, with the exception of RNAs with multiple functions like U1 snRNA. In general, sncRNAs forming RNPs are hundreds to thousands of times more abundant than their mRNA counterparts. Surprisingly, only 50 sncRNA genes produce half of the non-rRNA transcripts detected in two different cell lines. Together the results indicate that the human transcriptome is dominated by a small number of highly expressed sncRNAs specializing in functions related to translation and splicing. © 2018 Boivin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  9. Small RNA sequence analysis of adenovirus VA RNA-derived miRNAs reveals an unexpected serotype-specific difference in structure and abundance.

    Directory of Open Access Journals (Sweden)

    Wael Kamel

    Full Text Available Human adenoviruses (HAds encode for one or two highly abundant virus-associated RNAs, designated VA RNAI and VA RNAII, which fold into stable hairpin structures resembling miRNA precursors. Here we show that the terminal stem of the VA RNAs originating from Ad4, Ad5, Ad11 and Ad37, all undergo Dicer dependent processing into virus-specific miRNAs (so-called mivaRNAs. We further show that the mivaRNA duplex is subjected to a highly asymmetric RISC loading with the 3'-strand from all VA RNAs being the favored strand, except for the Ad37 VA RNAII, where the 5'-mivaRNAII strand was preferentially assembled into RISC. Although the mivaRNA seed sequences are not fully conserved between the HAds a bioinformatics prediction approach suggests that a large fraction of the VA RNAII-, but not the VA RNAI-derived mivaRNAs still are able to target the same cellular genes. Using small RNA deep sequencing we demonstrate that the Dicer processing event in the terminal stem of the VA RNAs is not unique and generates 3'-mivaRNAs with a slight variation of the position of the 5' terminal nucleotide in the RISC loaded guide strand. Also, we show that all analyzed VA RNAs, except Ad37 VA RNAI and Ad5 VA RNAII, utilize an alternative upstream A start site in addition to the classical +1 G start site. Further, the 5'-mivaRNAs with an A start appears to be preferentially incorporated into RISC. Although the majority of mivaRNA research has been done using Ad5 as the model system our analysis demonstrates that the mivaRNAs expressed in Ad11- and Ad37-infected cells are the most abundant mivaRNAs associated with Ago2-containing RISC. Collectively, our results show an unexpected variability in Dicer processing of the VA RNAs and a serotype-specific loading of mivaRNAs into Ago2-based RISC.

  10. Unique phylogenetic position of Diplomonadida based on the complete small subunit ribosomal RNA sequence of Giardia ardeae, G. muris, G. duodenalis and Hexamita sp. (United States)

    van Keulen, H; Gutell, R R; Gates, M A; Campbell, S R; Erlandsen, S L; Jarroll, E L; Kulda, J; Meyer, E A


    Complete small-subunit rRNA (SSU-rRNA) coding region sequences were determined for two species of the intestinal parasite Giardia: G. ardeae and G. muris, both belonging to the order Diplomonadida, and a free-living member of this order, Hexamita sp. These sequences were compared to published SSU-rDNA sequences from a third member of the genus Giardia, G. duodenalis (often called G. intestinalis or G. lamblia) and various representative organisms from other taxa. Of the three Giardia sequences analyzed, the SSU-rRNA from G. muris is the smallest (1432 bases as compared to 1435 and 1453 for G. ardeae and G. duodenalis, respectively) and has the lowest G+C content (58.9%). The Hexamita SSU-rRNA is the largest in this group, containing 1550 bases. Because the sizes of the SSU-rRNA are prokaryotic rather than typically eukaryotic, the secondary structures of the SSU-rRNAs were constructed. These structures show a number of typically eukaryotic signature sequences. Sequence alignments based on constraints imposed by secondary structure were used for construction of a phylogenetic tree for these four taxa. The results show that of the four diplomonads represented, the Giardia species form a distinct group. The other diplomonad Hexamita and the microsporidium Vairimorpha necatrix appear to be distinct from Giardia.

  11. Insight into small RNA abundance and expression in high- and low-temperature stress response using deep sequencing in Arabidopsis. (United States)

    Baev, Vesselin; Milev, Ivan; Naydenov, Mladen; Vachev, Tihomir; Apostolova, Elena; Mehterov, Nikolay; Gozmanva, Mariyana; Minkov, Georgi; Sablok, Gaurav; Yahubyan, Galina


    Small RNA profiling and assessing its dependence on changing environmental factors have expanded our understanding of the transcriptional and post-transcriptional regulation of plant stress responses. Insufficient data have been documented earlier to depict the profiling of small RNA classes in temperature-associated stress which has a wide implication for climate change biology. In the present study, we report a comparative assessment of the genome-wide profiling of small RNAs in Arabidopsis thaliana using two conditional responses, induced by high- and low-temperature. Genome-wide profiling of small RNAs revealed an abundance of 21 nt small RNAs at low temperature, while high temperature showed an abundance of 21 nt and 24 nt small RNAs. The two temperature treatments altered the expression of a specific subset of mature miRNAs and displayed differential expression of a number of miRNA isoforms (isomiRs). Comparative analysis demonstrated that a large number of protein-coding genes can give rise to differentially expressed small RNAs following temperature shifts. Low temperature caused accumulation of small RNAs, corresponding to the sense strand of a number of cold-responsive genes. In contrast, high temperature stimulated the production of small RNAs of both polarities from genes encoding functionally diverse proteins. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  12. An optimised protocol for isolation of RNA from small sections of laser-capture microdissected FFPE tissue amenable for next-generation sequencing. (United States)

    Amini, Parisa; Ettlin, Julia; Opitz, Lennart; Clementi, Elena; Malbon, Alexandra; Markkanen, Enni


    Formalin-fixed paraffin embedded (FFPE) tissue constitutes a vast treasury of samples for biomedical research. Thus far however, extraction of RNA from FFPE tissue has proved challenging due to chemical RNA-protein crosslinking and RNA fragmentation, both of which heavily impact on RNA quantity and quality for downstream analysis. With very small sample sizes, e.g. when performing Laser-capture microdissection (LCM) to isolate specific subpopulations of cells, recovery of sufficient RNA for analysis with reverse-transcription quantitative PCR (RT-qPCR) or next-generation sequencing (NGS) becomes very cumbersome and difficult. We excised matched cancer-associated stroma (CAS) and normal stroma from clinical specimen of FFPE canine mammary tumours using LCM, and compared the commonly used protease-based RNA isolation procedure with an adapted novel technique that additionally incorporates a focused ultrasonication step. We successfully adapted a protocol that uses focused ultrasonication to isolate RNA from small amounts of deparaffinised, stained, clinical LCM samples. Using this approach, we found that total RNA yields could be increased by 8- to 12-fold compared to a commonly used protease-based extraction technique. Surprisingly, RNA extracted using this new approach was qualitatively at least equal if not superior compared to the old approach, as Cq values in RT-qPCR were on average 2.3-fold lower using the new method. Finally, we demonstrate that RNA extracted using the new method performs comparably in NGS as well. We present a successful isolation protocol for extraction of RNA from difficult and limiting FFPE tissue samples that enables successful analysis of small sections of clinically relevant specimen. The possibility to study gene expression signatures in specific small sections of archival FFPE tissue, which often entail large amounts of highly relevant clinical follow-up data, unlocks a new dimension of hitherto difficult-to-analyse samples which now

  13. Inhibition of Hepatitis C Virus in Mice by a Small Interfering RNA Targeting a Highly Conserved Sequence in Viral IRES Pseudoknot.

    Directory of Open Access Journals (Sweden)

    Jae-Su Moon

    Full Text Available The hepatitis C virus (HCV internal ribosome entry site (IRES that directs cap-independent viral translation is a primary target for small interfering RNA (siRNA-based HCV antiviral therapy. However, identification of potent siRNAs against HCV IRES by bioinformatics-based siRNA design is a challenging task given the complexity of HCV IRES secondary and tertiary structures and association with multiple proteins, which can also dynamically change the structure of this cis-acting RNA element. In this work, we utilized siRNA tiling approach whereby siRNAs were tiled with overlapping sequences that were shifted by one or two nucleotides over the HCV IRES stem-loop structures III and IV spanning nucleotides (nts 277-343. Based on their antiviral activity, we mapped a druggable region (nts 313-343 where the targets of potent siRNAs were enriched. siIE22, which showed the greatest anti-HCV potency, targeted a highly conserved sequence across diverse HCV genotypes, locating within the IRES subdomain IIIf involved in pseudoknot formation. Stepwise target shifting toward the 5' or 3' direction by 1 or 2 nucleotides reduced the antiviral potency of siIE22, demonstrating the importance of siRNA accessibility to this highly structured and sequence-conserved region of HCV IRES for RNA interference. Nanoparticle-mediated systemic delivery of the stability-improved siIE22 derivative gs_PS1 siIE22, which contains a single phosphorothioate linkage on the guide strand, reduced the serum HCV genome titer by more than 4 log10 in a xenograft mouse model for HCV replication without generation of resistant variants. Our results provide a strategy for identifying potent siRNA species against a highly structured RNA target and offer a potential pan-HCV genotypic siRNA therapy that might be beneficial for patients resistant to current treatment regimens.

  14. CoLIde: a bioinformatics tool for CO-expression-based small RNA Loci Identification using high-throughput sequencing data. (United States)

    Mohorianu, Irina; Stocks, Matthew Benedict; Wood, John; Dalmay, Tamas; Moulton, Vincent


    Small RNAs (sRNAs) are 20-25 nt non-coding RNAs that act as guides for the highly sequence-specific regulatory mechanism known as RNA silencing. Due to the recent increase in sequencing depth, a highly complex and diverse population of sRNAs in both plants and animals has been revealed. However, the exponential increase in sequencing data has also made the identification of individual sRNA transcripts corresponding to biological units (sRNA loci) more challenging when based exclusively on the genomic location of the constituent sRNAs, hindering existing approaches to identify sRNA loci. To infer the location of significant biological units, we propose an approach for sRNA loci detection called CoLIde (Co-expression based sRNA Loci Identification) that combines genomic location with the analysis of other information such as variation in expression levels (expression pattern) and size class distribution. For CoLIde, we define a locus as a union of regions sharing the same pattern and located in close proximity on the genome. Biological relevance, detected through the analysis of size class distribution, is also calculated for each locus. CoLIde can be applied on ordered (e.g., time-dependent) or un-ordered (e.g., organ, mutant) series of samples both with or without biological/technical replicates. The method reliably identifies known types of loci and shows improved performance on sequencing data from both plants (e.g., A. thaliana, S. lycopersicum) and animals (e.g., D. melanogaster) when compared with existing locus detection techniques. CoLIde is available for use within the UEA Small RNA Workbench which can be downloaded from:

  15. QNB: differential RNA methylation analysis for count-based small-sample sequencing data with a quad-negative binomial model. (United States)

    Liu, Lian; Zhang, Shao-Wu; Huang, Yufei; Meng, Jia


    As a newly emerged research area, RNA epigenetics has drawn increasing attention recently for the participation of RNA methylation and other modifications in a number of crucial biological processes. Thanks to high throughput sequencing techniques, such as, MeRIP-Seq, transcriptome-wide RNA methylation profile is now available in the form of count-based data, with which it is often of interests to study the dynamics at epitranscriptomic layer. However, the sample size of RNA methylation experiment is usually very small due to its costs; and additionally, there usually exist a large number of genes whose methylation level cannot be accurately estimated due to their low expression level, making differential RNA methylation analysis a difficult task. We present QNB, a statistical approach for differential RNA methylation analysis with count-based small-sample sequencing data. Compared with previous approaches such as DRME model based on a statistical test covering the IP samples only with 2 negative binomial distributions, QNB is based on 4 independent negative binomial distributions with their variances and means linked by local regressions, and in the way, the input control samples are also properly taken care of. In addition, different from DRME approach, which relies only the input control sample only for estimating the background, QNB uses a more robust estimator for gene expression by combining information from both input and IP samples, which could largely improve the testing performance for very lowly expressed genes. QNB showed improved performance on both simulated and real MeRIP-Seq datasets when compared with competing algorithms. And the QNB model is also applicable to other datasets related RNA modifications, including but not limited to RNA bisulfite sequencing, m 1 A-Seq, Par-CLIP, RIP-Seq, etc.

  16. MicroRNAs in Amoebozoa: deep sequencing of the small RNA population in the social amoeba Dictyostelium discoideum reveals developmentally regulated microRNAs. (United States)

    Avesson, Lotta; Reimegård, Johan; Wagner, E Gerhart H; Söderbom, Fredrik


    The RNA interference machinery has served as a guardian of eukaryotic genomes since the divergence from prokaryotes. Although the basic components have a shared origin, silencing pathways directed by small RNAs have evolved in diverse directions in different eukaryotic lineages. Micro (mi)RNAs regulate protein-coding genes and play vital roles in plants and animals, but less is known about their functions in other organisms. Here, we report, for the first time, deep sequencing of small RNAs from the social amoeba Dictyostelium discoideum. RNA from growing single-cell amoebae as well as from two multicellular developmental stages was sequenced. Computational analyses combined with experimental data reveal the expression of miRNAs, several of them exhibiting distinct expression patterns during development. To our knowledge, this is the first report of miRNAs in the Amoebozoa supergroup. We also show that overexpressed miRNA precursors generate miRNAs and, in most cases, miRNA* sequences, whose biogenesis is dependent on the Dicer-like protein DrnB, further supporting the presence of miRNAs in D. discoideum. In addition, we find miRNAs processed from hairpin structures originating from an intron as well as from a class of repetitive elements. We believe that these repetitive elements are sources for newly evolved miRNAs.

  17. Deep sequencing of small RNAs identifies canonical and non-canonical miRNA and endogenous siRNAs in mammalian somatic tissues. (United States)

    Castellano, Leandro; Stebbing, Justin


    MicroRNAs (miRNAs) are small RNA molecules that regulate gene expression. They are characterized by specific maturation processes defined by canonical and non-canonical biogenic pathways. Analysis of ∼0.5 billion sequences from mouse data sets derived from different tissues, developmental stages and cell types, partly characterized by either ablation or mutation of the main proteins belonging to miRNA processor complexes, reveals 66 high-confidence new genomic loci coding for miRNAs that could be processed in a canonical or non-canonical manner. A proportion of the newly discovered miRNAs comprises mirtrons, for which we define a new sub-class. Notably, some of these newly discovered miRNAs are generated from untranslated and open reading frames of coding genes, and we experimentally validate these. We also show that many annotated miRNAs do not present miRNA-like features, as they are neither processed by known processing complexes nor loaded on AGO2; this indicates that the current miRNA miRBase database list should be refined and re-defined. Accordingly, a group of them map on ribosomal RNA molecules, whereas others cannot undergo genuine miRNA biogenesis. Notably, a group of annotated miRNAs are Dgcr8 independent and DICER dependent endogenous small interfering RNAs that derive from a unique hairpin formed from a short interspersed nuclear element.

  18. Mirnovo: genome-free prediction of microRNAs from small RNA sequencing data and single-cells using decision forests. (United States)

    Vitsios, Dimitrios M; Kentepozidou, Elissavet; Quintais, Leonor; Benito-Gutiérrez, Elia; van Dongen, Stijn; Davis, Matthew P; Enright, Anton J


    The discovery of microRNAs (miRNAs) remains an important problem, particularly given the growth of high-throughput sequencing, cell sorting and single cell biology. While a large number of miRNAs have already been annotated, there may well be large numbers of miRNAs that are expressed in very particular cell types and remain elusive. Sequencing allows us to quickly and accurately identify the expression of known miRNAs from small RNA-Seq data. The biogenesis of miRNAs leads to very specific characteristics observed in their sequences. In brief, miRNAs usually have a well-defined 5' end and a more flexible 3' end with the possibility of 3' tailing events, such as uridylation. Previous approaches to the prediction of novel miRNAs usually involve the analysis of structural features of miRNA precursor hairpin sequences obtained from genome sequence. We surmised that it may be possible to identify miRNAs by using these biogenesis features observed directly from sequenced reads, solely or in addition to structural analysis from genome data. To this end, we have developed mirnovo, a machine learning based algorithm, which is able to identify known and novel miRNAs in animals and plants directly from small RNA-Seq data, with or without a reference genome. This method performs comparably to existing tools, however is simpler to use with reduced run time. Its performance and accuracy has been tested on multiple datasets, including species with poorly assembled genomes, RNaseIII (Drosha and/or Dicer) deficient samples and single cells (at both embryonic and adult stage). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    International Nuclear Information System (INIS)

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.


    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

  20. Research resources: comparative microRNA profiles in human corona radiata cells and cumulus oophorus cells detected by next-generation small RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Xian-Hong Tong

    Full Text Available During folliculogenesis, cumulus cells surrounding the oocyte differentiate into corona radiata cells (CRCs and cumulus oophorus cells (COCs, which are involved in gonadal steroidogenesis and the development of germ cells. Several studies suggested that microRNAs (miRNAs play an important regulatory role at the post-transcriptional level in cumulus cells. However, comparative miRNA profiles and associated processes in human CRCs and COCs have not been reported before. In this study, miRNA profiles were obtained from CRCs and COCs using next generation sequencing in women undergoing controlled ovarian stimulation for IVF. A total of 785 and 799 annotated miRNAs were identified in CRCs and COCs, while high expression levels of six novel miRNAs were detected both in CRCs and in COCs. In addition, different expression patterns in CRCs and COCs were detected in 72 annotated miRNAs. To confirm the miRNA profile in COCs and CRCs, quantitative real-time PCR was used to validate the expression of annotated miRNAs, differentially expressed miRNAs, and novel miRNAs. The miRNAs in the let-7 family were found to be involved in the regulation of a broad range of biological processes in both cumulus cell populations, which was accompanied by a large amount of miRNA editing. Bioinformatics analysis showed that amino acid and energy metabolism were targeted significantly by miRNAs that were differentially expressed between CRCs and COCs. Our work extends the current knowledge of the regulatory role of miRNAs and their targeted pathways in folliculogenesis, and provides novel candidates for molecular biomarkers in the research of female infertility.

  1. Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions.

    NARCIS (Netherlands)

    Nolte-'t Hoen, E.N.M.; Buermans, H.P.; Waasdorp, M.; Stoorvogel, W.; Wauben, M.H.M.; `t Hoen, P.A.C.


    Cells release RNA-carrying vesicles and membrane-free RNA/protein complexes into the extracellular milieu. Horizontal vesicle-mediated transfer of such shuttle RNA between cells allows dissemination of genetically encoded messages, which may modify the function of target cells. Other studies used

  2. Deep sequencing of small RNA libraries from human prostate epithelial and stromal cells reveal distinct pattern of microRNAs primarily predicted to target growth factors. (United States)

    Singh, Savita; Zheng, Yun; Jagadeeswaran, Guru; Ebron, Jey Sabith; Sikand, Kavleen; Gupta, Sanjay; Sunker, Ramanjulu; Shukla, Girish C


    Complex epithelial and stromal cell interactions are required during the development and progression of prostate cancer. Regulatory small non-coding microRNAs (miRNAs) participate in the spatiotemporal regulation of messenger RNA (mRNA) and regulation of translation affecting a large number of genes involved in prostate carcinogenesis. In this study, through deep-sequencing of size fractionated small RNA libraries we profiled the miRNAs of prostate epithelial (PrEC) and stromal (PrSC) cells. Over 50 million reads were obtained for PrEC in which 860,468 were unique sequences. Similarly, nearly 76 million reads for PrSC were obtained in which over 1 million were unique reads. Expression of many miRNAs of broadly conserved and poorly conserved miRNA families were identified. Sixteen highly expressed miRNAs with significant change in expression in PrSC than PrEC were further analyzed in silico. ConsensusPathDB showed the target genes of these miRNAs were significantly involved in adherence junction, cell adhesion, EGRF, TGF-β and androgen signaling. Let-7 family of tumor-suppressor miRNAs expression was highly pervasive in both, PrEC and PrSC cells. In addition, we have also identified several miRNAs that are unique to PrEC or PrSC cells and their predicted putative targets are a group of transcription factors. This study provides perspective on the miRNA expression in PrEC and PrSC, and reveals a global trend in miRNA interactome. We conclude that the most abundant miRNAs are potential regulators of development and differentiation of the prostate gland by targeting a set of growth factors. Additionally, high level expression of the most members of let-7 family miRNAs suggests their role in the fine tuning of the growth and proliferation of prostate epithelial and stromal cells. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Small RNA Sequencing Uncovers New miRNAs and moRNAs Differentially Expressed in Normal and Primary Myelofibrosis CD34+ Cells.

    Directory of Open Access Journals (Sweden)

    Paola Guglielmelli

    Full Text Available Myeloproliferative neoplasms (MPN are chronic myeloid cancers thought to arise at the level of CD34+ hematopoietic stem/progenitor cells. They include essential thrombocythemia (ET, polycythemia vera (PV and primary myelofibrosis (PMF. All can progress to acute leukemia, but PMF carries the worst prognosis. Increasing evidences indicate that deregulation of microRNAs (miRNAs might plays an important role in hematologic malignancies, including MPN. To attain deeper knowledge of short RNAs (sRNAs expression pattern in CD34+ cells and of their possible role in mediating post-transcriptional regulation in PMF, we sequenced with Illumina HiSeq2000 technology CD34+ cells from healthy subjects and PMF patients. We detected the expression of 784 known miRNAs, with a prevalence of miRNA up-regulation in PMF samples, and discovered 34 new miRNAs and 99 new miRNA-offset RNAs (moRNAs, in CD34+ cells. Thirty-seven small RNAs were differentially expressed in PMF patients compared with healthy subjects, according to microRNA sequencing data. Five miRNAs (miR-10b-5p, miR-19b-3p, miR-29a-3p, miR-379-5p, and miR-543 were deregulated also in PMF granulocytes. Moreover, 3'-moR-128-2 resulted consistently downregulated in PMF according to RNA-seq and qRT-PCR data both in CD34+ cells and granulocytes. Target predictions of these validated small RNAs de-regulated in PMF and functional enrichment analyses highlighted many interesting pathways involved in tumor development and progression, such as signaling by FGFR and DAP12 and Oncogene Induced Senescence. As a whole, data obtained in this study deepened the knowledge of miRNAs and moRNAs altered expression in PMF CD34+ cells and allowed to identify and validate a specific small RNA profile that distinguishes PMF granulocytes from those of normal subjects. We thus provided new information regarding the possible role of miRNAs and, specifically, of new moRNAs in this disease.

  4. Combined Targeted DNA Sequencing in Non-Small Cell Lung Cancer (NSCLC Using UNCseq and NGScopy, and RNA Sequencing Using UNCqeR for the Detection of Genetic Aberrations in NSCLC.

    Directory of Open Access Journals (Sweden)

    Xiaobei Zhao

    Full Text Available The recent FDA approval of the MiSeqDx platform provides a unique opportunity to develop targeted next generation sequencing (NGS panels for human disease, including cancer. We have developed a scalable, targeted panel-based assay termed UNCseq, which involves a NGS panel of over 200 cancer-associated genes and a standardized downstream bioinformatics pipeline for detection of single nucleotide variations (SNV as well as small insertions and deletions (indel. In addition, we developed a novel algorithm, NGScopy, designed for samples with sparse sequencing coverage to detect large-scale copy number variations (CNV, similar to human SNP Array 6.0 as well as small-scale intragenic CNV. Overall, we applied this assay to 100 snap-frozen lung cancer specimens lacking same-patient germline DNA (07-0120 tissue cohort and validated our results against Sanger sequencing, SNP Array, and our recently published integrated DNA-seq/RNA-seq assay, UNCqeR, where RNA-seq of same-patient tumor specimens confirmed SNV detected by DNA-seq, if RNA-seq coverage depth was adequate. In addition, we applied the UNCseq assay on an independent lung cancer tumor tissue collection with available same-patient germline DNA (11-1115 tissue cohort and confirmed mutations using assays performed in a CLIA-certified laboratory. We conclude that UNCseq can identify SNV, indel, and CNV in tumor specimens lacking germline DNA in a cost-efficient fashion.

  5. Isolation of Exosome-Like Nanoparticles and Analysis of MicroRNAs Derived from Coconut Water Based on Small RNA High-Throughput Sequencing. (United States)

    Zhao, Zhehao; Yu, Siran; Li, Min; Gui, Xin; Li, Ping


    In this study, the presence of microRNAs in coconut water was identified by real-time polymerase chain reaction (PCR) based on the results of high-throughput small RNA sequencing. In addition, the differences in microRNA content between immature and mature coconut water were compared. A total of 47 known microRNAs belonging to 25 families and 14 new microRNAs were identified in coconut endosperm. Through analysis using a target gene prediction software, potential microRNA target genes were identified in the human genome. Real-time PCR showed that the level of most microRNAs was higher in mature coconut water than in immature coconut water. Then, exosome-like nanoparticles were isolated from coconut water. After ultracentrifugation, some particle structures were seen in coconut water samples using 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate fluorescence staining. Subsequent scanning electron microscopy observation and dynamic light scattering analysis also revealed some exosome-like nanoparticles in coconut water, and the mean diameters of the particles detected by the two methods were 13.16 and 59.72 nm, respectively. In conclusion, there are extracellular microRNAs in coconut water, and their levels are higher in mature coconut water than in immature coconut water. Some exosome-like nanoparticles were isolated from coconut water, and the diameter of these particles was smaller than that of animal-derived exosomes.

  6. TargetRNA: a tool for predicting targets of small RNA action in bacteria


    Tjaden, Brian


    Many small RNA (sRNA) genes in bacteria act as posttranscriptional regulators of target messenger RNAs. Here, we present TargetRNA, a web tool for predicting mRNA targets of sRNA action in bacteria. TargetRNA takes as input a genomic sequence that may correspond to an sRNA gene. TargetRNA then uses a dynamic programming algorithm to search each annotated message in a specified genome for mRNAs that evince basepair-binding potential to the input sRNA sequence. Based on the calculated basepair-...

  7. Diversity of antisense and other non-coding RNAs in Archaea revealed by comparative small RNA sequencing in four Pyrobaculum species

    Directory of Open Access Journals (Sweden)

    David L Bernick


    Full Text Available A great diversity of small, non-coding RNA molecules with roles in gene regulation and RNA processing have been intensely studied in eukaryotic and bacterial model organisms, yet our knowledge of possible parallel roles for small RNAs in archaea is limited. We employed RNA-seq to identify novel small RNA across multiple species of the hyperthermophilic genus Pyrobaculum, known for unusual RNA gene characteristics. By comparing transcriptional data collected in parallel among four species, we were able to identify conserved RNA genes fitting into known and novel families. Among our findings, we highlight three novel cis-antisense small RNAs encoded opposite to key regulatory (ferric uptake regulator, metabolic (triose-phosphate isomerase, and core transcriptional apparatus genes (transcription factor B. We also found a large increase in the number of conserved C/D box small RNA genes over what had been previously recognized; many of these genes are encoded antisense to protein coding genes. The conserved opposition to orthologous genes across the Pyrobaculum genus suggests similarities to other cis-antisense regulatory systems. Furthermore, the genus-specific nature of these small RNAs indicates they are relatively recent, stable adaptations.

  8. Genome-wide transcriptome analysis between small-tail Han sheep and the Surabaya fur sheep using high-throughput RNA sequencing. (United States)

    Miao, Xiangyang; Luo, Qingmiao


    The small-tail Han sheep and the Surabaya fur sheep are two local breeds in north China, which are characterized by high-fecundity and low-prolificacy breed respectively. Significant genetic differences between these two breeds have provided increasing interests in the identification and utilization of major prolificacy genes in these sheep. High prolificacy is a complex trait, and it is difficult to comprehensively identify the candidate genes related to this trait using the single molecular biology technique. To understand the molecular mechanisms of fecundity and provide more information about high prolificacy candidate genes in high- and low-fecundity sheep, we explored the utility of next-generation sequencing technology in this work. A total of 1.8 Gb sequencing reads were obtained and resulted in more than 20 000 contigs that averaged ∼300 bp in length. Ten differentially expressed genes were further verified by quantitative real-time RT-PCR to confirm the reliability of RNA-seq results. Our work will provide a basis for the future research of the sheep reproduction.

  9. antaRNA: ant colony-based RNA sequence design. (United States)

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf


    RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. CONTACT: Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  10. Small Molecule Modifiers of the microRNA and RNA Interference Pathway


    Deiters, Alexander


    Recently, the RNA interference (RNAi) pathway has become the target of small molecule inhibitors and activators. RNAi has been well established as a research tool in the sequence-specific silencing of genes in eukaryotic cells and organisms by using exogenous, small, double-stranded RNA molecules of approximately 20 nucleotides. Moreover, a recently discovered post-transcriptional gene regulatory mechanism employs microRNAs (miRNAs), a class of endogenously expressed small RNA molecules, whic...

  11. Switching off small RNA regulation with trap-mRNA

    DEFF Research Database (Denmark)

    Overgaard, Martin; Johansen, Jesper; Møller-Jensen, Jakob


    to operate at the level of transcription initiation. By employing a highly sensitive genetic screen we uncovered a novel RNA-based regulatory principle in which induction of a trap-mRNA leads to selective degradation of a small regulatory RNA molecule, thereby abolishing the sRNA-based silencing of its...

  12. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision. (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu


    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  13. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids? (United States)

    Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)


    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  14. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing. (United States)

    Tan, M K


    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  15. Sequence and Secondary Structure of the Mitochondrial Small-Subunit rRNA V4, V6, and V9 Domains Reveal Highly Species-Specific Variations within the Genus Agrocybe


    Gonzalez, Patrice; Labarère, Jacques


    A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same specie...

  16. Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection.

    Directory of Open Access Journals (Sweden)

    Evgeny A Glazov

    Full Text Available MicroRNA (miRNA and other types of small regulatory RNAs play a crucial role in the regulation of gene expression in eukaryotes. Several distinct classes of small regulatory RNAs have been discovered in recent years. To extend the repertoire of small RNAs characterized in mammals and to examine relationship between host miRNA expression and viral infection we used Illumina's ultrahigh throughput sequencing approach. We sequenced three small RNA libraries prepared from cell line derived from the adult bovine kidney under normal conditions and upon infection of the cell line with Bovine herpesvirus 1. We used a bioinformatics approach to distinguish authentic mature miRNA sequences from other classes of small RNAs and short RNA fragments represented in the sequencing data. Using this approach we detected 219 out of 356 known bovine miRNAs and 115 respective miRNA* sequences. In addition we identified five new bovine orthologs of known mammalian miRNAs and discovered 268 new cow miRNAs many of which are not identifiable in other mammalian genomes and thus might be specific to the ruminant lineage. In addition we found seven new bovine mirtron candidates. We also discovered 10 small nucleolar RNA (snoRNA loci that give rise to small RNA with possible miRNA-like function. Results presented in this study extend our knowledge of the biology and evolution of small regulatory RNAs in mammals and illuminate mechanisms of small RNA biogenesis and function. New miRNA sequences and the original sequencing data have been submitted to miRNA repository (miRBase and NCBI GEO archive respectively. We envisage that these resources will facilitate functional annotation of the bovine genome and promote further functional and comparative genomics studies of small regulatory RNA in mammals.

  17. The UEA Small RNA Workbench: A Suite of Computational Tools for Small RNA Analysis. (United States)

    Mohorianu, Irina; Stocks, Matthew Benedict; Applegate, Christopher Steven; Folkes, Leighton; Moulton, Vincent


    RNA silencing (RNA interference, RNAi) is a complex, highly conserved mechanism mediated by short, typically 20-24 nt in length, noncoding RNAs known as small RNAs (sRNAs). They act as guides for the sequence-specific transcriptional and posttranscriptional regulation of target mRNAs and play a key role in the fine-tuning of biological processes such as growth, response to stresses, or defense mechanism.High-throughput sequencing (HTS) technologies are employed to capture the expression levels of sRNA populations. The processing of the resulting big data sets facilitated the computational analysis of the sRNA patterns of variation within biological samples such as time point experiments, tissue series or various treatments. Rapid technological advances enable larger experiments, often with biological replicates leading to a vast amount of raw data. As a result, in this fast-evolving field, the existing methods for sequence characterization and prediction of interaction (regulatory) networks periodically require adapting or in extreme cases, a complete redesign to cope with the data deluge. In addition, the presence of numerous tools focused only on particular steps of HTS analysis hinders the systematic parsing of the results and their interpretation.The UEA small RNA Workbench (v1-4), described in this chapter, provides a user-friendly, modular, interactive analysis in the form of a suite of computational tools designed to process and mine sRNA datasets for interesting characteristics that can be linked back to the observed phenotypes. First, we show how to preprocess the raw sequencing output and prepare it for downstream analysis. Then we review some quality checks that can be used as a first indication of sources of variability between samples. Next we show how the Workbench can provide a comparison of the effects of different normalization approaches on the distributions of expression, enhanced methods for the identification of differentially expressed

  18. High-Throughput Sequencing of Small RNA Transcriptomes in Maize Kernel Identifies miRNAs Involved in Embryo and Endosperm Development. (United States)

    Xing, Lijuan; Zhu, Ming; Zhang, Min; Li, Wenzong; Jiang, Haiyang; Zou, Junjie; Wang, Lei; Xu, Miaoyun


    Maize kernel development is a complex biological process that involves the temporal and spatial expression of many genes and fine gene regulation at a transcriptional and post-transcriptional level, and microRNAs (miRNAs) play vital roles during this process. To gain insight into miRNA-mediated regulation of maize kernel development, a deep-sequencing technique was used to investigate the dynamic expression of miRNAs in the embryo and endosperm at three developmental stages in B73. By miRNA transcriptomic analysis, we characterized 132 known miRNAs and six novel miRNAs in developing maize kernel, among which, 15 and 14 miRNAs were commonly differentially expressed between the embryo and endosperm at 9 days after pollination (DAP), 15 DAP and 20 DAP respectively. Conserved miRNA families such as miR159, miR160, miR166, miR390, miR319, miR528 and miR529 were highly expressed in developing embryos; miR164, miR171, miR393 and miR2118 were highly expressed in developing endosperm. Genes targeted by those highly expressed miRNAs were found to be largely related to a regulation category, including the transcription, macromolecule biosynthetic and metabolic process in the embryo as well as the vitamin biosynthetic and metabolic process in the endosperm. Quantitative reverse transcription-PCR (qRT-PCR) analysis showed that these miRNAs displayed a negative correlation with the levels of their corresponding target genes. Importantly, our findings revealed that members of the miR169 family were highly and dynamically expressed in the developing kernel, which will help to exploit new players functioning in maize kernel development.

  19. Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

    African Journals Online (AJOL)



    Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

  20. Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli. (United States)

    Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada


    Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.

  1. The RNA world, automatic sequences and oncogenetics

    Energy Technology Data Exchange (ETDEWEB)

    Tahir Shah, K


    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. (1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. (2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or ``accept`` other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs.

  2. The RNA world, automatic sequences and oncogenetics

    International Nuclear Information System (INIS)

    Tahir Shah, K.


    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. 1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. 2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or 'accept' other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs

  3. Small Rna Regulatory Networks In Pseudomonas Putida

    DEFF Research Database (Denmark)

    Bojanovic, Klara; Long, Katherine


    chemicals and has a potential to be used as an efficient cell factory for various products. P. putida KT2240 is a genome-sequenced strain and a well characterized pseudomonad. Our major aim is to identify small RNA molecules (sRNAs) and their regulatory networks. A previous study has identified 37 sRNAs...... in this strain, while in other pseudomonads many more sRNAs have been found so far.P. putida KT2440 has been grown in different conditions which are likely to be encountered in industrial fermentations with the aim of using sRNAs for generation of improved cell factories. For that, cells have been grown in LB......Pseudomonas putida is a ubiquitous Gram-negative soil bacterium with a versatile metabolism and ability to degrade various toxic compounds. It has a high tolerance to different future biobased building blocks and various other stringent conditions. It is used in industry to produce some important...

  4. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence

    NARCIS (Netherlands)

    Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.


    Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas

  5. Defining RNA-Small Molecule Affinity Landscapes Enables Design of a Small Molecule Inhibitor of an Oncogenic Noncoding RNA. (United States)

    Velagapudi, Sai Pradeep; Luo, Yiling; Tran, Tuan; Haniff, Hafeez S; Nakai, Yoshio; Fallahi, Mohammad; Martinez, Gustavo J; Childs-Disney, Jessica L; Disney, Matthew D


    RNA drug targets are pervasive in cells, but methods to design small molecules that target them are sparse. Herein, we report a general approach to score the affinity and selectivity of RNA motif-small molecule interactions identified via selection. Named High Throughput Structure-Activity Relationships Through Sequencing (HiT-StARTS), HiT-StARTS is statistical in nature and compares input nucleic acid sequences to selected library members that bind a ligand via high throughput sequencing. The approach allowed facile definition of the fitness landscape of hundreds of thousands of RNA motif-small molecule binding partners. These results were mined against folded RNAs in the human transcriptome and identified an avid interaction between a small molecule and the Dicer nuclease-processing site in the oncogenic microRNA (miR)-18a hairpin precursor, which is a member of the miR-17-92 cluster. Application of the small molecule, Targapremir-18a, to prostate cancer cells inhibited production of miR-18a from the cluster, de-repressed serine/threonine protein kinase 4 protein (STK4), and triggered apoptosis. Profiling the cellular targets of Targapremir-18a via Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP), a covalent small molecule-RNA cellular profiling approach, and other studies showed specific binding of the compound to the miR-18a precursor, revealing broadly applicable factors that govern small molecule drugging of noncoding RNAs.

  6. Conifers have a unique small RNA silencing signature. (United States)

    Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J


    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

  7. Reconstruction of ancestral RNA sequences under multiple structural constraints

    Directory of Open Access Journals (Sweden)

    Olivier Tremblay-Savard


    Full Text Available Abstract Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. Results We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Conclusions Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: .

  8. Reconstruction of ancestral RNA sequences under multiple structural constraints. (United States)

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldispühl, Jérôme


    Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: .

  9. Preparation of Small RNA NGS Libraries from Biofluids. (United States)

    Etheridge, Alton; Wang, Kai; Baxter, David; Galas, David


    Next generation sequencing (NGS) is a powerful method for transcriptome analysis. Unlike other gene expression profiling methods, such as microarrays, NGS provides additional information such as splicing variants, sequence polymorphisms, and novel transcripts. For this reason, NGS is well suited for comprehensive profiling of the wide range of extracellular RNAs (exRNAs) in biofluids. ExRNAs are of great interest because of their possible biological role in cell-to-cell communication and for their potential use as biomarkers or for therapeutic purposes. Here, we describe a modified protocol for preparation of small RNA libraries for NGS analysis. This protocol has been optimized for use with low-input exRNA-containing samples, such as plasma or serum, and has modifications designed to reduce the sequence-specific bias typically encountered with commercial small RNA library construction kits.

  10. Argonaute: The executor of small RNA function. (United States)

    Azlan, Azali; Dzaki, Najat; Azzam, Ghows


    The discovery of small non-coding RNAs - microRNA (miRNA), short interfering RNA (siRNA) and PIWI-interacting RNA (piRNA) - represents one of the most exciting frontiers in biology specifically on the mechanism of gene regulation. In order to execute their functions, these small RNAs require physical interactions with their protein partners, the Argonaute (AGO) family proteins. Over the years, numerous studies have made tremendous progress on understanding the roles of AGO in gene silencing in various organisms. In this review, we summarize recent progress of AGO-mediated gene silencing and other cellular processes in which AGO proteins have been implicated with a particular focus on progress made in flies, humans and other model organisms as compliment. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  11. Sequence and secondary structure of the mitochondrial small-subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe. (United States)

    Gonzalez, P; Labarère, J


    A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The

  12. RNA as a small molecule druggable target. (United States)

    Rizvi, Noreen F; Smith, Graham F


    Small molecule drugs have readily been developed against many proteins in the human proteome, but RNA has remained an elusive target for drug discovery. Increasingly, we see that RNA, and to a lesser extent DNA elements, show a persistent tertiary structure responsible for many diverse and complex cellular functions. In this digest, we have summarized recent advances in screening approaches for RNA targets and outlined the discovery of novel, drug-like small molecules against RNA targets from various classes and therapeutic areas. The link of structure, function, and small-molecule Druggability validates now for the first time that RNA can be the targets of therapeutic agents. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Unique small RNA signatures uncovered in the tammar wallaby genome

    Directory of Open Access Journals (Sweden)

    Lindsay James


    Full Text Available Abstract Background Small RNAs have proven to be essential regulatory molecules encoded within eukaryotic genomes. These short RNAs participate in a diverse array of cellular processes including gene regulation, chromatin dynamics and genome defense. The tammar wallaby, a marsupial mammal, is a powerful comparative model for studying the evolution of regulatory networks. As part of the genome sequencing initiative for the tammar, we have explored the evolution of each of the major classes of mammalian small RNAs in an Australian marsupial for the first time, including the first genome-scale analysis of the newest class of small RNAs, centromere repeat associated short interacting RNAs (crasiRNAs. Results Using next generation sequencing, we have characterized the major classes of small RNAs, micro (mi RNAs, piwi interacting (pi RNAs, and the centromere repeat associated short interacting (crasi RNAs in the tammar. We examined each of these small RNA classes with respect to the newly assembled tammar wallaby genome for gene and repeat features, salient features that define their canonical sequences, and the constitution of both highly conserved and species-specific members. Using a combination of miRNA hairpin predictions and co-mapping with miRBase entries, we identified a highly conserved cluster of miRNA genes on the X chromosome in the tammar and a total of 94 other predicted miRNA producing genes. Mapping all miRNAs to the tammar genome and comparing target genes among tammar, mouse and human, we identified 163 conserved target genes. An additional nine genes were identified in tammar that do not have an orthologous miRNA target in human and likely represent novel miRNA-regulated genes in the tammar. A survey of the tammar gonadal piRNAs shows that these small RNAs are enriched in retroelements and carry members from both marsupial and tammar-specific repeat classes. Lastly, this study includes the first in-depth analyses of the newly

  14. SearchSmallRNA: a graphical interface tool for the assemblage of viral genomes using small RNA libraries data. (United States)

    de Andrade, Roberto R S; Vaslin, Maite F S


    Next-generation parallel sequencing (NGS) allows the identification of viral pathogens by sequencing the small RNAs of infected hosts. Thus, viral genomes may be assembled from host immune response products without prior virus enrichment, amplification or purification. However, mapping of the vast information obtained presents a bioinformatics challenge. In order to by pass the need of line command and basic bioinformatics knowledge, we develop a mapping software with a graphical interface to the assemblage of viral genomes from small RNA dataset obtained by NGS. SearchSmallRNA was developed in JAVA language version 7 using NetBeans IDE 7.1 software. The program also allows the analysis of the viral small interfering RNAs (vsRNAs) profile; providing an overview of the size distribution and other features of the vsRNAs produced in infected cells. The program performs comparisons between each read sequenced present in a library and a chosen reference genome. Reads showing Hamming distances smaller or equal to an allowed mismatched will be selected as positives and used to the assemblage of a long nucleotide genome sequence. In order to validate the software, distinct analysis using NGS dataset obtained from HIV and two plant viruses were used to reconstruct viral whole genomes. SearchSmallRNA program was able to reconstructed viral genomes using NGS of small RNA dataset with high degree of reliability so it will be a valuable tool for viruses sequencing and discovery. It is accessible and free to all research communities and has the advantage to have an easy-to-use graphical interface. SearchSmallRNA was written in Java and is freely available at

  15. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion. (United States)

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David


    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  16. Primary and secondary structure of U8 small nuclear RNA

    International Nuclear Information System (INIS)

    Reddy, R.; Henning, D.; Busch, H.


    U8 small nuclear RNA is a new, capped, 140 nucleotides long RNA species found in Novikoff hepatoma cells. Its sequence is: m3GpppAmUmCGUCAGGA GGUUAAUCCU UACCUGUCCC UCCUUUCGGA GGGCAGAUAG AAAAUGAUGA UUGGAGCUUG CAUGAUCUGC UGAUUAUAGC AUUUCCGUGU AAUCAGGACC UGACAACAUC CUGAUUGCUU CUAUCUGAUUOH. This RNA is present in approximately 25,000 copies/cell, and it is enriched in nucleolar preparations. Like U1, U2, U4/U6, and U5 RNAs, U8 RNA was also present as a ribonucleoprotein associated with the Sm antigen. The rat U8 RNA was highly homologous (greater than 90%) to a recently characterized 5.4 S RNA from mouse cells infected with spleen focus-forming virus. In addition to the U8 RNA, three other U small nuclear RNAs were found in anti-Sm antibody immunoprecipitates from labeled rat and HeLa cells. Each of these contained a m3GpppAm cap structure; their apparent chain lengths were 60, 130, and 65 nucleotides. These U small nuclear RNAs are designated U7, U9, and U10 RNAs, respectively

  17. RISC RNA sequencing for context-specific identification of in vivo microRNA targets. (United States)

    Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W


    MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.

  18. Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling. (United States)

    Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk


    The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

  19. Integrated mRNA and microRNA transcriptome sequencing characterizes sequence variants and mRNA–microRNA regulatory network in nasopharyngeal carcinoma model systems

    Directory of Open Access Journals (Sweden)

    Carol Ying-Ying Szeto


    Full Text Available Nasopharyngeal carcinoma (NPC is a prevalent malignancy in Southeast Asia among the Chinese population. Aberrant regulation of transcripts has been implicated in many types of cancers including NPC. Herein, we characterized mRNA and miRNA transcriptomes by RNA sequencing (RNASeq of NPC model systems. Matched total mRNA and small RNA of undifferentiated Epstein–Barr virus (EBV-positive NPC xenograft X666 and its derived cell line C666, well-differentiated NPC cell line HK1, and the immortalized nasopharyngeal epithelial cell line NP460 were sequenced by Solexa technology. We found 2812 genes and 149 miRNAs (human and EBV to be differentially expressed in NP460, HK1, C666 and X666 with RNASeq; 533 miRNA–mRNA target pairs were inversely regulated in the three NPC cell lines compared to NP460. Integrated mRNA/miRNA expression profiling and pathway analysis show extracellular matrix organization, Beta-1 integrin cell surface interactions, and the PI3K/AKT, EGFR, ErbB, and Wnt pathways were potentially deregulated in NPC. Real-time quantitative PCR was performed on selected mRNA/miRNAs in order to validate their expression. Transcript sequence variants such as short insertions and deletions (INDEL, single nucleotide variant (SNV, and isomiRs were characterized in the NPC model systems. A novel TP53 transcript variant was identified in NP460, HK1, and C666. Detection of three previously reported novel EBV-encoded BART miRNAs and their isomiRs were also observed. Meta-analysis of a model system to a clinical system aids the choice of different cell lines in NPC studies. This comprehensive characterization of mRNA and miRNA transcriptomes in NPC cell lines and the xenograft provides insights on miRNA regulation of mRNA and valuable resources on transcript variation and regulation in NPC, which are potentially useful for mechanistic and preclinical studies.

  20. Small RNA Sequencing Reveals Dlk1-Dio3 Locus-Embedded MicroRNAs as Major Drivers of Ground-State Pluripotency. (United States)

    Moradi, Sharif; Sharifi-Zarchi, Ali; Ahmadi, Amirhossein; Mollamohammadi, Sepideh; Stubenvoll, Alexander; Günther, Stefan; Salekdeh, Ghasem Hosseini; Asgari, Sassan; Braun, Thomas; Baharvand, Hossein


    Ground-state pluripotency is a cell state in which pluripotency is established and maintained through efficient repression of endogenous differentiation pathways. Self-renewal and pluripotency of embryonic stem cells (ESCs) are influenced by ESC-associated microRNAs (miRNAs). Here, we provide a comprehensive assessment of the "miRNome" of ESCs cultured under conditions favoring ground-state pluripotency. We found that ground-state ESCs express a distinct set of miRNAs compared with ESCs grown in serum. Interestingly, most "ground-state miRNAs" are encoded by an imprinted region on chromosome 12 within the Dlk1-Dio3 locus. Functional analysis revealed that ground-state miRNAs embedded in the Dlk1-Dio3 locus (miR-541-5p, miR-410-3p, and miR-381-3p) promoted pluripotency via inhibition of multi-lineage differentiation and stimulation of self-renewal. Overall, our results demonstrate that ground-state pluripotency is associated with a unique miRNA signature, which supports ground-state self-renewal by suppressing differentiation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Characterization and comparative analysis of small RNAs in three small RNA libraries of the brown planthopper (Nilaparvata lugens). (United States)

    Chen, Qiuhong; Lu, Lin; Hua, Hongxia; Zhou, Fei; Lu, Liaoxun; Lin, Yongjun


    The brown planthopper (BPH), Nilaparvata lugens (Stå;l), which belongs to Homopteran, Delphacidae, is one of the most serious and destructive pests of rice. Feeding BPH with homologous dsRNA in vitro can lead to the death of BPH, which gives a valuable clue to the prevention and control of this pest, however, we know little about its small RNA world. Small RNA libraries for three developmental stages of BPH (CX-male adult, CC-female adult, CY-last instar female nymph) had been constructed and sequenced. It revealed a prolific small RNA world of BPH. We obtained a final list of 452 (CX), 430 (CC), and 381 (CY) conserved microRNAs (miRNAs), respectively, as well as a total of 71 new miRNAs in the three libraries. All the miRNAs had their own expression profiles in the three libraries. The phylogenic evolution of the miRNA families in BPH was consistent with other species. The new miRNA sequences demonstrated some base biases. Our study discovered a large number of small RNAs through deep sequencing of three small RNA libraries of BPH. Many animal-conserved miRNA families as well as some novel miRNAs have been detected in our libraries. This is the first achievement to discover the small RNA world of BPH. A lot of new valuable information about BPH small RNAs has been revealed which was helpful for studying insect molecular biology and insect resistant research.

  2. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei


    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.


    Peña-Castillo, Lourdes; Grüell, Marc; Mulligan, Martin E; Lang, Andrew S


    Small non-coding RNAs (sRNAs) are regulatory RNA molecules that have been identified in a multitude of bacterial species and shown to control numerous cellular processes through various regulatory mechanisms. In the last decade, next generation RNA sequencing (RNA-seq) has been used for the genome-wide detection of bacterial sRNAs. Here we describe sRNA-Detect, a novel approach to identify expressed small transcripts from prokaryotic RNA-seq data. Using RNA-seq data from three bacterial species and two sequencing platforms, we performed a comparative assessment of five computational approaches for the detection of small transcripts. We demonstrate that sRNA-Detect improves upon current standalone computational approaches for identifying novel small transcripts in bacteria.

  4. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles. (United States)

    Guo, Sijin; Li, Hui; Ma, Mengshi; Fu, Jian; Dong, Yizhou; Guo, Peixuan


    RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles

    Directory of Open Access Journals (Sweden)

    Sijin Guo


    Full Text Available RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants.

  6. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.


    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  7. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.


    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  8. Novel Approach to Analyzing MFE of Noncoding RNA Sequences. (United States)

    George, Tina P; Thomas, Tessamma


    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.

  9. Reconstruction of ancestral RNA sequences under multiple structural constraints


    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldisp?hl, J?r?me


    Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given...

  10. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  11. Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA (United States)

    Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong


    RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

  12. Annotating RNA motifs in sequences and alignments. (United States)

    Gardner, Paul P; Eldai, Hisham


    RNA performs a diverse array of important functions across all cellular life. These functions include important roles in translation, building translational machinery and maturing messenger RNA. More recent discoveries include the miRNAs and bacterial sRNAs that regulate gene expression, the thermosensors, riboswitches and other cis-regulatory elements that help prokaryotes sense their environment and eukaryotic piRNAs that suppress transposition. However, there can be a long period between the initial discovery of a RNA and determining its function. We present a bioinformatic approach to characterize RNA motifs, which are critical components of many RNA structure-function relationships. These motifs can, in some instances, provide researchers with functional hypotheses for uncharacterized RNAs. Moreover, we introduce a new profile-based database of RNA motifs--RMfam--and illustrate some applications for investigating the evolution and functional characterization of RNA. All the data and scripts associated with this work are available from: © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Methods to enable the design of bioactive small molecules targeting RNA. (United States)

    Disney, Matthew D; Yildirim, Ilyas; Childs-Disney, Jessica L


    RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including structure-activity relationships through sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome.

  14. Seeing the forest for the trees: annotating small RNA producing genes in plants. (United States)

    Coruh, Ceyda; Shahid, Saima; Axtell, Michael J


    A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.


    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  16. A cost-effective method for Illumina small RNA-Seq library preparation using T4 RNA ligase 1 adenylated adapters

    Directory of Open Access Journals (Sweden)

    Chen Yun-Ru


    Full Text Available Abstract Background Deep sequencing is a powerful tool for novel small RNA discovery. Illumina small RNA sequencing library preparation requires a pre-adenylated 3’ end adapter containing a 5’,5’-adenyl pyrophosphoryl moiety. In the absence of ATP, this adapter can be ligated to the 3’ hydroxyl group of small RNA, while RNA self-ligation and concatenation are repressed. Pre-adenylated adapters are one of the most essential and costly components required for library preparation, and few are commercially available. Results We demonstrate that DNA oligo with 5’ phosphate and 3’ amine groups can be enzymatically adenylated by T4 RNA ligase 1 to generate customized pre-adenylated adapters. We have constructed and sequenced a small RNA library for tomato (Solanum lycopersicum using the T4 RNA ligase 1 adenylated adapter. Conclusion We provide an efficient and low-cost method for small RNA sequencing library preparation, which takes two days to complete and costs around $20 per library. This protocol has been tested in several plant species for small RNA sequencing including sweet potato, pepper, watermelon, and cowpea, and could be readily applied to any RNA samples.

  17. Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them (United States)

    Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika


    The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

  18. Immunotherapy of hepatocellular carcinoma with small double-stranded RNA

    International Nuclear Information System (INIS)

    Kabilova, Tatyana O; Chernolovskaya, Elena L; Kovtonyuk, Larisa V; Zonov, Evgeniy V; Ryabchikova, Elena I; Popova, Nelly A; Nikolin, Valeriy P; Kaledin, Vasiliy I; Zenkova, Marina A; Vlassov, Valentin V


    Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide with limited therapeutic options. Since HCC has been shown to be immunogenic, immunotherapy is considered a promising therapeutic approach. Small interfering RNAs (siRNAs), depending on their structure and sequence, can trigger the innate immune system, which can potentially enhance the adaptive anticancer immune response in the tumor-bearing subjects. Immunostimulatory properties of nucleic acids can be applied to develop adjuvants for HCC treatment. The transplantable HCC G-29 tumor in male CBA/LacSto (CBA) mice was used to study the effects of immunostimulatory RNA on tumor growth. Tumor size, metastases area in different organs of mice and mouse survival rate were analyzed. Furthermore the mouse serum IFN-α levels were measured using ELISA. In the present study, we found that a 19-bp RNA duplex (ImmunoStimulattory RNA or isRNA) with 3-nt overhangs at the 3′-ends of specific sequence displays immunostimulatory, antitumor, and antimetastatic activities in mice bearing HCC G-29. Our results demonstrate that isRNA strongly increases the level of interferon-α (IFN-α) by up to 25-fold relative to the level in mice injected with Lipofectamine alone (Mock), and to a lesser extent increases the level of proinflammatory cytokine interleukin-6 (IL-6) (by up to 5.5-fold relative to the Mock level), in mice blood serum. We showed that isRNA reliably (P < 0.05) inhibits primary tumor growth in mice compared to the mock group. Furthermore, injections of isRNA significantly enhanced necrotic processes in the center of the primary tumor, and decreased by twofold the width of the undifferentiated peripheral zone and the number of mitotic cells in this zone. The results showed that isRNA efficiently reduces the area of metastases in the liver, kidneys, and heart of CBA/LacSto mice with HCC. The obtained results clearly demonstrate immunostimulatory and antimetastatic properties of the isRNAs in

  19. Rfam: annotating families of non-coding RNA sequences. (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W


    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  20. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts


    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  1. piRNA analysis framework from small RNA-Seq data by a novel cluster prediction tool - PILFER. (United States)

    Ray, Rishav; Pandey, Priyanka


    With the increasing number of studies focusing on PIWI-interacting RNA (piRNAs), it is now pertinent to develop efficient tools dedicated towards piRNA analysis. We have developed a novel cluster prediction tool called PILFER (PIrna cLuster FindER), which can accurately predict piRNA clusters from small RNA sequencing data. PILFER is an open source, easy to use tool, and can be executed even on a personal computer with minimum resources. It uses a sliding-window mechanism by integrating the expression of the reads along with the spatial information to predict the piRNA clusters. We have additionally defined a piRNA analysis pipeline incorporating PILFER to detect and annotate piRNAs and their clusters from raw small RNA sequencing data and implemented it on publicly available data from healthy germline and somatic tissues. We compared PILFER with other existing piRNA cluster prediction tools and found it to be statistically more accurate and superior in many aspects such as the robustness of PILFER clusters is higher and memory efficiency is more. Overall, PILFER provides a fast and accurate solution to piRNA cluster prediction. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe


    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....

  3. The chemical structure of DNA sequence signals for RNA transcription (United States)

    George, D. G.; Dayhoff, M. O.


    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  4. Recent advances in developing small molecules targeting RNA. (United States)

    Guan, Lirui; Disney, Matthew D


    RNAs are underexploited targets for small molecule drugs or chemical probes of function. This may be due, in part, to a fundamental lack of understanding of the types of small molecules that bind RNA specifically and the types of RNA motifs that specifically bind small molecules. In this review, we describe recent advances in the development and design of small molecules that bind to RNA and modulate function that aim to fill this void.

  5. Characterization and comparative analysis of small RNAs in three small RNA libraries of the brown planthopper (Nilaparvata lugens.

    Directory of Open Access Journals (Sweden)

    Qiuhong Chen

    Full Text Available BACKGROUND: The brown planthopper (BPH, Nilaparvata lugens (Stå;l, which belongs to Homopteran, Delphacidae, is one of the most serious and destructive pests of rice. Feeding BPH with homologous dsRNA in vitro can lead to the death of BPH, which gives a valuable clue to the prevention and control of this pest, however, we know little about its small RNA world. METHODOLOGY/PRINCIPAL FINDINGS: Small RNA libraries for three developmental stages of BPH (CX-male adult, CC-female adult, CY-last instar female nymph had been constructed and sequenced. It revealed a prolific small RNA world of BPH. We obtained a final list of 452 (CX, 430 (CC, and 381 (CY conserved microRNAs (miRNAs, respectively, as well as a total of 71 new miRNAs in the three libraries. All the miRNAs had their own expression profiles in the three libraries. The phylogenic evolution of the miRNA families in BPH was consistent with other species. The new miRNA sequences demonstrated some base biases. CONCLUSION: Our study discovered a large number of small RNAs through deep sequencing of three small RNA libraries of BPH. Many animal-conserved miRNA families as well as some novel miRNAs have been detected in our libraries. This is the first achievement to discover the small RNA world of BPH. A lot of new valuable information about BPH small RNAs has been revealed which was helpful for studying insect molecular biology and insect resistant research.

  6. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  7. Small RNA-directed epigenetic natural variation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jixian Zhai


    Full Text Available Progress in epigenetics has revealed mechanisms that can heritably regulate gene function independent of genetic alterations. Nevertheless, little is known about the role of epigenetics in evolution. This is due in part to scant data on epigenetic variation among natural populations. In plants, small interfering RNA (siRNA is involved in both the initiation and maintenance of gene silencing by directing DNA methylation and/or histone methylation. Here, we report that, in the model plant Arabidopsis thaliana, a cluster of approximately 24 nt siRNAs found at high levels in the ecotype Landsberg erecta (Ler could direct DNA methylation and heterochromatinization at a hAT element adjacent to the promoter of FLOWERING LOCUS C (FLC, a major repressor of flowering, whereas the same hAT element in ecotype Columbia (Col with almost identical DNA sequence, generates a set of low abundance siRNAs that do not direct these activities. We have called this hAT element MPF for Methylated region near Promoter of FLC, although de novo methylation triggered by an inverted repeat transgene at this region in Col does not alter its FLC expression. DNA methylation of the Ler allele MPF is dependent on genes in known silencing pathways, and such methylation is transmissible to Col by genetic crosses, although with varying degrees of penetrance. A genome-wide comparison of Ler and Col small RNAs identified at least 68 loci matched by a significant level of approximately 24 nt siRNAs present specifically in Ler but not Col, where nearly half of the loci are related to repeat or TE sequences. Methylation analysis revealed that 88% of the examined loci (37 out of 42 were specifically methylated in Ler but not Col, suggesting that small RNA can direct epigenetic differences between two closely related Arabidopsis ecotypes.

  8. RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments. (United States)

    Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A


    Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

  9. The small RNA complement of adult Schistosoma haematobium.

    Directory of Open Access Journals (Sweden)

    Andreas J Stroehlein


    Full Text Available Blood flukes of the genus Schistosoma cause schistosomiasis-a neglected tropical disease (NTD that affects more than 200 million people worldwide. Studies of schistosome genomes have improved our understanding of the molecular biology of flatworms, but most of them have focused largely on protein-coding genes. Small non-coding RNAs (sncRNAs have been explored in selected schistosome species and are suggested to play essential roles in the post-transcriptional regulation of genes, and in modulating flatworm-host interactions. However, genome-wide small RNA data are currently lacking for key schistosomes including Schistosoma haematobium-the causative agent of urogenital schistosomiasis of humans.MicroRNAs (miRNAs and other sncRNAs of male and female adults of S. haematobium and small RNA transcription levels were explored by deep sequencing, genome mapping and detailed bioinformatic analyses.In total, 89 transcribed miRNAs were identified in S. haematobium-a similar complement to those reported for the congeners S. mansoni and S. japonicum. Of these miRNAs, 34 were novel, with no homologs in other schistosomes. Most miRNAs (n = 64 exhibited sex-biased transcription, suggestive of roles in sexual differentiation, pairing of adult worms and reproductive processes. Of the sncRNAs that were not miRNAs, some related to the spliceosome (n = 21, biogenesis of other RNAs (n = 3 or ribozyme functions (n = 16, whereas most others (n = 3798 were novel ('orphans' with unknown functions.This study provides the first genome-wide sncRNA resource for S. haematobium, extending earlier studies of schistosomes. The present work should facilitate the future curation and experimental validation of sncRNA functions in schistosomes to enhance our understanding of post-transcriptional gene regulation and of the roles that sncRNAs play in schistosome reproduction, development and parasite-host cross-talk.

  10. The small RNA complement of adult Schistosoma haematobium. (United States)

    Stroehlein, Andreas J; Young, Neil D; Korhonen, Pasi K; Hall, Ross S; Jex, Aaron R; Webster, Bonnie L; Rollinson, David; Brindley, Paul J; Gasser, Robin B


    Blood flukes of the genus Schistosoma cause schistosomiasis-a neglected tropical disease (NTD) that affects more than 200 million people worldwide. Studies of schistosome genomes have improved our understanding of the molecular biology of flatworms, but most of them have focused largely on protein-coding genes. Small non-coding RNAs (sncRNAs) have been explored in selected schistosome species and are suggested to play essential roles in the post-transcriptional regulation of genes, and in modulating flatworm-host interactions. However, genome-wide small RNA data are currently lacking for key schistosomes including Schistosoma haematobium-the causative agent of urogenital schistosomiasis of humans. MicroRNAs (miRNAs) and other sncRNAs of male and female adults of S. haematobium and small RNA transcription levels were explored by deep sequencing, genome mapping and detailed bioinformatic analyses. In total, 89 transcribed miRNAs were identified in S. haematobium-a similar complement to those reported for the congeners S. mansoni and S. japonicum. Of these miRNAs, 34 were novel, with no homologs in other schistosomes. Most miRNAs (n = 64) exhibited sex-biased transcription, suggestive of roles in sexual differentiation, pairing of adult worms and reproductive processes. Of the sncRNAs that were not miRNAs, some related to the spliceosome (n = 21), biogenesis of other RNAs (n = 3) or ribozyme functions (n = 16), whereas most others (n = 3798) were novel ('orphans') with unknown functions. This study provides the first genome-wide sncRNA resource for S. haematobium, extending earlier studies of schistosomes. The present work should facilitate the future curation and experimental validation of sncRNA functions in schistosomes to enhance our understanding of post-transcriptional gene regulation and of the roles that sncRNAs play in schistosome reproduction, development and parasite-host cross-talk.

  11. Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa. (United States)

    Morin, Ryan D; Aksay, Gozde; Dolgosheina, Elena; Ebhardt, H Alexander; Magrini, Vincent; Mardis, Elaine R; Sahinalp, S Cenk; Unrau, Peter J


    The diversity of microRNAs and small-interfering RNAs has been extensively explored within angiosperms by focusing on a few key organisms such as Oryza sativa and Arabidopsis thaliana. A deeper division of the plants is defined by the radiation of the angiosperms and gymnosperms, with the latter comprising the commercially important conifers. The conifers are expected to provide important information regarding the evolution of highly conserved small regulatory RNAs. Deep sequencing provides the means to characterize and quantitatively profile small RNAs in understudied organisms such as these. Pyrosequencing of small RNAs from O. sativa revealed, as expected, approximately 21- and approximately 24-nt RNAs. The former contained known microRNAs, and the latter largely comprised intergenic-derived sequences likely representing heterochromatin siRNAs. In contrast, sequences from Pinus contorta were dominated by 21-nt small RNAs. Using a novel sequence-based clustering algorithm, we identified sequences belonging to 18 highly conserved microRNA families in P. contorta as well as numerous clusters of conserved small RNAs of unknown function. Using multiple methods, including expressed sequence folding and machine learning algorithms, we found a further 53 candidate novel microRNA families, 51 appearing specific to the P. contorta library. In addition, alignment of small RNA sequences to the O. sativa genome revealed six perfectly conserved classes of small RNA that included chloroplast transcripts and specific types of genomic repeats. The conservation of microRNAs and other small RNAs between the conifers and the angiosperms indicates that important RNA silencing processes were highly developed in the earliest spermatophytes. Genomic mapping of all sequences to the O. sativa genome can be viewed at

  12. Small catalytic RNA: Structure, function and application

    Energy Technology Data Exchange (ETDEWEB)

    Monforte, Joseph Albert [Univ. of California, Berkeley, CA (United States)


    We have utilized a combination of photochemical cross-linking techniques and site-directed mutagenesis to obtain secondary and tertiary structure information for the self-cleaving, self-ligating subsequence of RNA from the negative strand of Satellite Tobacco Ringspot Virus. We have found that the helical regions fold about a hinge to promoting four different possible tertiary interactions, creating a molecular of similar shape to a paperclip. A model suggesting that the ``paperclip`` and ``hammerhead`` RNAs share a similar three dimensional structure is proposed. We have used a self-cleaving RNA molecule related to a subsequence of plant viroids, a ``hammerhead,`` to study the length-dependent folding of RNA produced during transcription by RNA polymerase. We have used this method to determine the length of RNA sequestered within elongating E. coli and T7 RNA polymerase complexes. The data show that for E. coli RNA polymerase 121±s are sequestered within the ternary complex, which is consistent with the presence of an RNA-DNA hybrid within the transcription bubble, as proposed by others. The result for T7 RNA polymerase differs from E. coli RNA polymerase, with only 10{plus_minus}1 nucleotides sequestered within the ternary complex, setting a new upper limit for the minimum RNA-DNA required for a stable elongating complex. Comparisons between E. coli and T7 RNA polymerase are made. The relevance of the results to models or transcription termination, abortive initiation, and initiation to elongation mode transitions are discussed.

  13. miRge - A Multiplexed Method of Processing Small RNA-Seq Data to Determine MicroRNA Entropy.

    Directory of Open Access Journals (Sweden)

    Alexander S Baras

    Full Text Available Small RNA RNA-seq for microRNAs (miRNAs is a rapidly developing field where opportunities still exist to create better bioinformatics tools to process these large datasets and generate new, useful analyses. We built miRge to be a fast, smart small RNA-seq solution to process samples in a highly multiplexed fashion. miRge employs a Bayesian alignment approach, whereby reads are sequentially aligned against customized mature miRNA, hairpin miRNA, noncoding RNA and mRNA sequence libraries. miRNAs are summarized at the level of raw reads in addition to reads per million (RPM. Reads for all other RNA species (tRNA, rRNA, snoRNA, mRNA are provided, which is useful for identifying potential contaminants and optimizing small RNA purification strategies. miRge was designed to optimally identify miRNA isomiRs and employs an entropy based statistical measurement to identify differential production of isomiRs. This allowed us to identify decreasing entropy in isomiRs as stem cells mature into retinal pigment epithelial cells. Conversely, we show that pancreatic tumor miRNAs have similar entropy to matched normal pancreatic tissues. In a head-to-head comparison with other miRNA analysis tools (miRExpress 2.0, sRNAbench, omiRAs, miRDeep2, Chimira, UEA small RNA Workbench, miRge was faster (4 to 32-fold and was among the top-two methods in maximally aligning miRNAs reads per sample. Moreover, miRge has no inherent limits to its multiplexing. miRge was capable of simultaneously analyzing 100 small RNA-Seq samples in 52 minutes, providing an integrated analysis of miRNA expression across all samples. As miRge was designed for analysis of single as well as multiple samples, miRge is an ideal tool for high and low-throughput users. miRge is freely available at

  14. RNA sequencing: current and prospective uses in metabolic research. (United States)

    Vikman, Petter; Fadista, Joao; Oskolkov, Nikolay


    Previous global RNA analysis was restricted to known transcripts in species with a defined transcriptome. Next generation sequencing has transformed transcriptomics by making it possible to analyse expressed genes with an exon level resolution from any tissue in any species without any a priori knowledge of which genes that are being expressed, splice patterns or their nucleotide sequence. In addition, RNA sequencing is a more sensitive technique compared with microarrays with a larger dynamic range, and it also allows for investigation of imprinting and allele-specific expression. This can be done for a cost that is able to compete with that of a microarray, making RNA sequencing a technique available to most researchers. Therefore RNA sequencing has recently become the state of the art with regards to large-scale RNA investigations and has to a large extent replaced microarrays. The only drawback is the large data amounts produced, which together with the complexity of the data can make a researcher spend far more time on analysis than performing the actual experiment. © 2014 Society for Endocrinology.

  15. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy. (United States)

    Matkovich, Scot J; Dorn, Gerald W


    MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

  16. Genetic divergence of Asiatic Bdellocephala (Turbellaria, Tricladida, Paludicola) as revealed by partial 18S rRNA gene sequence comparisons. (United States)

    Kuznedelov, K D; Timoshkin, O A; Goldman, E


    Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.

  17. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  18. Detection of small interfering RNA (siRNA) by mass spectrometry procedures in doping controls. (United States)

    Thomas, Andreas; Walpurgis, Katja; Delahaut, Philippe; Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario


    Uncovering manipulation of athletic performance via small interfering (si)RNA is an emerging field in sports drug testing. Due to the potential to principally knock down every target gene in the organism by means of the RNA interference pathway, this facet of gene doping has become a realistic scenario. In the present study, two distinct model siRNAs comprising 21 nucleotides were designed as double strands which were perfect counterparts to a sequence of the respective messenger RNA coding the muscle regulator myostatin of Rattus norvegicus. Several modified nucleotides were introduced in both the sense and the antisense strand comprising phosphothioates, 2'-O-methylation, 2'-fluoro-nucleotides, locked nucleic acids and a cholesterol tag at the 3'-end. The model siRNAs were applied to rats at 1 mg/kg (i.v.) and blood as well as urine samples were collected. After isolation of the RNA by means of a RNA purification kit, the target analytes were detected by liquid chromatography - high resolution/high accuracy mass spectrometry (LC-HRMS). Analytes were detected as modified nucleotides after alkaline hydrolysis, as intact oligonucleotide strands (top-down) and by means of denaturing SDS-PAGE analysis. The gel-separated siRNA was further subjected to in-gel hydrolysis with different RNases and subsequent identification of the fragments by untargeted LC-HRMS analysis (bottom-up, 'experimental RNomics'). Combining the results of all approaches, the identification of several 3'-truncated urinary metabolites was accomplished and target analytes were detected up to 24 h after a single administration. Simultaneously collected blood samples yielded no promising results. The methods were validated and found fit-for-purpose for doping controls. Copyright © 2013 John Wiley & Sons, Ltd.

  19. MicroRNA of the fifth-instar posterior silk gland of silkworm identified by Solexa sequencing

    Directory of Open Access Journals (Sweden)

    Jisheng Li


    Full Text Available No special studies have been focused on the microRNA (miRNA in the fifth-instar posterior silk gland of Bombyx mori. Here, using next-generation sequencing, we acquired 93.2 million processed reads from 10 small RNA libraries. In this paper, we tried to thoroughly describe how our dataset generated from deep sequencing which was recently published in BMC genomics. Results showed that our findings are largely enriched silkworm miRNA depository and may benefit us to reveal the miRNA functions in the process of silk production.

  20. Small catalytic RNA: Structure, function and application

    Energy Technology Data Exchange (ETDEWEB)

    Monforte, J.A.


    We have utilized a combination of photochemical cross-linking techniques and site-directed mutagenesis to obtain secondary and tertiary structure information for the self-cleaving, self-ligating subsequence of RNA from the negative strand of Satellite Tobacco Ringspot Virus. We have found that the helical regions fold about a hinge to promoting four different possible tertiary interactions, creating a molecular of similar shape to a paperclip. A model suggesting that the paperclip'' and hammerhead'' RNAs share a similar three dimensional structure is proposed. We have used a self-cleaving RNA molecule related to a subsequence of plant viroids, a hammerhead,'' to study the length-dependent folding of RNA produced during transcription by RNA polymerase. We have used this method to determine the length of RNA sequestered within elongating E. coli and T7 RNA polymerase complexes. The data show that for E. coli RNA polymerase 12{plus minus}1 nucleotides are sequestered within the ternary complex, which is consistent with the presence of an RNA-DNA hybrid within the transcription bubble, as proposed by others. The result for T7 RNA polymerase differs from E. coli RNA polymerase, with only 10{plus minus}1 nucleotides sequestered within the ternary complex, setting a new upper limit for the minimum RNA-DNA required for a stable elongating complex. Comparisons between E. coli and T7 RNA polymerase are made. The relevance of the results to models or transcription termination, abortive initiation, and initiation to elongation mode transitions are discussed.

  1. High-Throughput Sequencing Based Methods of RNA Structure Investigation

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz Jan

    In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

  2. Pulmonary administration of small interfering RNA : The route to go?

    NARCIS (Netherlands)

    Ruigrok, Mitchel; Frijlink, Henderik W.; Hinrichs, Wouter


    Ever since the discovery of RNA interference (RNAi), which is a post-transcriptional gene silencing mechanism, researchers have been studying the therapeutic potential of using small interfering RNA (siRNA) to treat diseases that are characterized by excessive gene expression. Excessive gene

  3. (AAV)-mediated expression of small interfering RNA

    African Journals Online (AJOL)

    Effective inhibition of specific gene by adenoassociated virus (AAV)-mediated expression of small interfering RNA. ... To perform functional tests on siRNA, which was expressed by the viral vector, recombinant AAVs, coding for siRNA against exogenous gene, EGFP, and endogenous gene, p53, were established and ...

  4. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne


    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  5. Sequence analysis of L RNA of Lassa virus

    International Nuclear Information System (INIS)

    Vieth, Simon; Torda, Andrew E.; Asper, Marcel; Schmitz, Herbert; Guenther, Stephan


    The L RNA of three Lassa virus strains originating from Nigeria, Ghana/Ivory Coast, and Sierra Leone was sequenced and the data subjected to structure predictions and phylogenetic analyses. The L gene products had 2218-2221 residues, diverged by 18% at the amino acid level, and contained several conserved regions. Only one region of 504 residues (positions 1043-1546) could be assigned a function, namely that of an RNA polymerase. Secondary structure predictions suggest that this domain is very similar to RNA-dependent RNA polymerases of known structure encoded by plus-strand RNA viruses, permitting a model to be built. Outside the polymerase region, there is little structural data, except for regions of strong alpha-helical content and probably a coiled-coil domain at the N terminus. No evidence for reassortment or recombination during Lassa virus evolution was found. The secondary structure-assisted alignment of the RNA polymerase region permitted a reliable reconstruction of the phylogeny of all negative-strand RNA viruses, indicating that Arenaviridae are most closely related to Nairoviruses. In conclusion, the data provide a basis for structural and functional characterization of the Lassa virus L protein and reveal new insights into the phylogeny of negative-strand RNA viruses

  6. Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands. (United States)

    Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E


    Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

  7. RNA-DNA sequence differences spell genetic code ambiguities

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Michael L


    A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

  8. Finding the most significant common sequence and structure motifs in a set of RNA sequences

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.


    We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...

  9. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13. (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L


    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  10. Identification of the miRNA-mRNA regulatory network of small cell osteosarcoma based on RNA-seq. (United States)

    Xie, Lin; Liao, Yedan; Shen, Lida; Hu, Fengdi; Yu, Sunlin; Zhou, Yonghong; Zhang, Ya; Yang, Yihao; Li, Dongqi; Ren, Minyan; Yuan, Zhongqin; Yang, Zuozhang


    Small cell osteosarcoma (SCO) is a rare subtype of osteosarcoma characterized by highly aggressive progression and a poor prognosis. The miRNA and mRNA expression profiles of peripheral blood mononuclear cells (PBMCs) were obtained in 3 patients with SCO and 10 healthy individuals using high-throughput RNA-sequencing. We identified 37 dysregulated miRNAs and 1636 dysregulated mRNAs in patients with SCO compared to the healthy controls. Specifically, the 37 dysregulated miRNAs consisted of 27 up-regulated miRNAs and 10 down-regulated miRNAs; the 1636 dysregulated mRNAs consisted of 555 up-regulated mRNAs and 1081 down-regulated mRNAs. The target-genes of miRNAs were predicted, and 1334 negative correlations between miRNAs and mRNAs were used to construct an miRNA-mRNA regulatory network. Dysregulated genes were significantly enriched in pathways related to cancer, mTOR signaling and cell cycle signaling. Specifically, hsa-miR-26b-5p, hsa-miR-221-3p and hsa-miR-125b-2-3p were significantly dysregulated miRNAs and exhibited a high degree of connectivity with target genes. Overall, the expression of dysregulated genes in tumor tissues and peripheral blood samples of patients with SCO measured by quantitative real-time polymerase chain reaction corroborated with our bioinformatics analyses based on the expression profiles of PBMCs from patients with SCO. Thus, hsa-miR-26b-5p, hsa-miR-221-3p and hsa-miR-125b-2-3p may be involved in SCO tumorigenesis.

  11. Next Generation Sequencing Analysis of Human Platelet PolyA+ mRNAs and rRNA-Depleted Total RNA (United States)

    Kissopoulou, Antheia; Jonasson, Jon; Lindahl, Tomas L.; Osman, Abdimajid


    Background Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. Materials and Methods We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT) isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. Results Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. Conclusion The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components compared with other cell and

  12. Complete sequence of RNA1 of grapevine Anatolian ringspot virus. (United States)

    Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic


    The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

  13. Novel approaches for bioinformatic analysis of salivary RNA sequencing data for development. (United States)

    Kaczor-Urbanowicz, Karolina Elzbieta; Kim, Yong; Li, Feng; Galeev, Timur; Kitchen, Rob R; Gerstein, Mark; Koyano, Kikuye; Jeong, Sung-Hee; Wang, Xiaoyan; Elashoff, David; Kang, So Young; Kim, Su Mi; Kim, Kyoung; Kim, Sung; Chia, David; Xiao, Xinshu; Rozowsky, Joel; Wong, David T W


    Analysis of RNA sequencing (RNA-Seq) data in human saliva is challenging. Lack of standardization and unification of the bioinformatic procedures undermines saliva's diagnostic potential. Thus, it motivated us to perform this study. We applied principal pipelines for bioinformatic analysis of small RNA-Seq data of saliva of 98 healthy Korean volunteers including either direct or indirect mapping of the reads to the human genome using Bowtie1. Analysis of alignments to exogenous genomes by another pipeline revealed that almost all of the reads map to bacterial genomes. Thus, salivary exRNA has fundamental properties that warrant the design of unique additional steps while performing the bioinformatic analysis. Our pipelines can serve as potential guidelines for processing of RNA-Seq data of human saliva. Processing and analysis results of the experimental data generated by the exceRpt (v4.6.3) small RNA-seq pipeline ( are available from exRNA atlas ( Alignment to exogenous genomes and their quantification results were used in this paper for the analyses of small RNAs of exogenous origin. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email:

  14. Oasis 2: improved online analysis of small RNA-seq data. (United States)

    Rahman, Raza-Ur; Gautam, Abhivyakti; Bethune, Jörn; Sattar, Abdul; Fiosins, Maksims; Magruder, Daniel Sumner; Capece, Vincenzo; Shomroni, Orr; Bonn, Stefan


    Small RNA molecules play important roles in many biological processes and their dysregulation or dysfunction can cause disease. The current method of choice for genome-wide sRNA expression profiling is deep sequencing. Here we present Oasis 2, which is a new main release of the Oasis web application for the detection, differential expression, and classification of small RNAs in deep sequencing data. Compared to its predecessor Oasis, Oasis 2 features a novel and speed-optimized sRNA detection module that supports the identification of small RNAs in any organism with higher accuracy. Next to the improved detection of small RNAs in a target organism, the software now also recognizes potential cross-species miRNAs and viral and bacterial sRNAs in infected samples. In addition, novel miRNAs can now be queried and visualized interactively, providing essential information for over 700 high-quality miRNA predictions across 14 organisms. Robust biomarker signatures can now be obtained using the novel enhanced classification module. Oasis 2 enables biologists and medical researchers to rapidly analyze and query small RNA deep sequencing data with improved precision, recall, and speed, in an interactive and user-friendly environment. Oasis 2 is implemented in Java, J2EE, mysql, Python, R, PHP and JavaScript. It is freely available at

  15. Identification of microRNA-Like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing.

    Directory of Open Access Journals (Sweden)

    Kang Kang

    Full Text Available microRNAs (miRNAs are non-coding small RNAs (sRNAs capable of negatively regulating gene expression. Recently, microRNA-like small RNAs (milRNAs were discovered in several filamentous fungi but not yet in Trichoderma reesei, an industrial filamentous fungus that can secrete abundant hydrolases. To explore the presence of milRNA in T. reesei and evaluate their expression under induction of cellulose, two T. reesei sRNA libraries of cellulose induction (IN and non-induction (CON were generated and sequenced using Solexa sequencing technology. A total of 726 and 631 sRNAs were obtained from the IN and CON samples, respectively. Global expression analysis showed an extensively differential expression of sRNAs in T. reesei under the two conditions. Thirteen predicted milRNAs were identified in T. reesei based on the short hairpin structure analysis. The milRNA profiles obtained in deep sequencing were further validated by RT-qPCR assay. Computational analysis predicted a number of potential targets relating to many processes including regulation of enzyme expression. The presence and differential expression of T. reesei milRNAs imply that milRNA might play a role in T. reesei growth and cellulase induction. This work lays foundation for further functional study of fungal milRNAs and their industrial application.

  16. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian


    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  17. Conifers have a unique small RNA silencing signature


    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.


    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  18. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity. (United States)

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R


    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  19. Final report for ER65039, The Role of Small RNA in Biomass Deposition

    Energy Technology Data Exchange (ETDEWEB)

    Hudson, Matthew E. [Univ. of Illinois, Urbana, IL (United States)


    Our objective in this project was to discover the role of sRNA in regulating both biomass biosynthesis and perenniality in the Andropogoneae feedstock grasses. Our central hypothesis was that there is a time-and space specific sRNA network playing a crucial role in regulating processes associated with cell wall biosynthesis, flowering time control, overwintering/juvenility, and nutrient sequestration in the feedstock grasses. To address this, we performed a large scale biological project consisting of the growth of material, generation of Illumina libraries, sequencing and analysis for small RNA, mRNA and Degradome / cmRNA. Our subsidiary objectives included analysis of the biology of small RNAs and the cell wall composition of Miscanthus. These objectives have all been completed, one publication is in print, one is submitted and several more are in progress.

  20. RNA-Seq of the nucleolus reveals abundant SNORD44-derived small RNAs.

    Directory of Open Access Journals (Sweden)

    Baoyan Bai

    Full Text Available Small non-coding RNAs represent RNA species that are not translated to proteins, but which have diverse and broad functional activities in physiological and pathophysiological states. The knowledge of these small RNAs is rapidly expanding in part through the use of massive parallel (deep sequencing efforts. We present here the first deep sequencing of small RNomes in subcellular compartments with particular emphasis on small RNAs (sRNA associated with the nucleolus. The vast majority of the cellular, cytoplasmic and nuclear sRNAs were identified as miRNAs. In contrast, the nucleolar sRNAs had a unique size distribution consisting of 19-20 and 25 nt RNAs, which were predominantly composed of small snoRNA-derived box C/D RNAs (termed as sdRNA. Sequences from 47 sdRNAs were identified, which mapped to both 5' and 3' ends of the snoRNAs, and retained conserved box C or D motifs. SdRNA reads mapping to SNORD44 comprised 74% of all nucleolar sdRNAs, and were confirmed by Northern blotting as comprising both 20 and 25 nt RNAs. A novel 120 nt SNORD44 form was also identified. The expression of the SNORD44 sdRNA and 120 nt form was independent of Dicer/Drosha-mediated processing pathways but was dependent on the box C/D snoRNP proteins/sno-ribonucleoproteins fibrillarin and NOP58. The 120 nt SNORD44-derived RNA bound to fibrillarin suggesting that C/D sno-ribonucleoproteins are involved in regulating the stability or processing of SNORD44. This study reveals sRNA cell-compartment specific expression and the distinctive unique composition of the nucleolar sRNAs.

  1. Towards annotating the plant epigenome: the Arabidopsis thaliana small RNA locus map. (United States)

    Hardcastle, Thomas J; Müller, Sebastian Y; Baulcombe, David C


    Based on 98 public and internal small RNA high throughput sequencing libraries, we mapped small RNAs to the genome of the model organism Arabidopsis thaliana and defined loci based on their expression using an empirical Bayesian approach. The resulting loci were subsequently classified based on their genetic and epigenetic context as well as their expression properties. We present the results of this classification, which broadly conforms to previously reported divisions between transcriptional and post-transcriptional gene silencing small RNAs, and to PolIV and PolV dependencies. However, we are able to demonstrate the existence of further subdivisions in the small RNA population of functional significance. Moreover, we present a framework for similar analyses of small RNA populations in all species.

  2. Nucleotide sequence of tomato ringspot virus RNA-2. (United States)

    Rott, M E; Tremaine, J H; Rochon, D M


    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  3. The origin and effect of small RNA signaling in plants

    Directory of Open Access Journals (Sweden)

    Jean-Sébastien eParent


    Full Text Available Given their sessile condition, land plants need to integrate environmental cues rapidly and send signal throughout the organism to modify their metabolism accordingly. Small RNA (sRNA molecules are among the messengers that plant cells use to carry such signals. These molecules originate from fold-back stem-loops transcribed from endogenous loci or from perfect double-stranded RNA produced through the action of RNA-dependent RNA polymerases. Once produced, sRNAs associate with Argonaute and other proteins to form the RNA-induced silencing complex (RISC that executes silencing of complementary RNA molecules. Depending on the nature of the RNA target and the Argonaute protein involved, RISC triggers either DNA methylation and chromatin modification (leading to transcriptional gene silencing, TGS or RNA cleavage or translational inhibition (leading to post-transcriptional gene silencing, PTGS. In some cases, sRNAs move to neighboring cells and/or to the vascular tissues for long-distance trafficking. Many genes are involved in the biogenesis of sRNAs and recent studies have shown that both their origin and their protein partners have great influence on their activity and range. Here we summarize the work done to uncover the mode of action of the different classes of small RNA with special emphasis on their movement and how plants can take advantage of their mobility. We also review the various genetic requirements needed for production, movement and perception of the silencing signal.

  4. RNA targeting by small molecules: Binding of protoberberine ...

    Indian Academy of Sciences (India)


    Jun 25, 2012 ... Studies on RNA targeting by small molecules to specifically control certain cellular functions is an .... form secondary structures such as stem-loop, hairpin, etc. ..... paired third strand of the triplex without affecting the stability.

  5. iMir: an integrated pipeline for high-throughput analysis of small non-coding RNA data obtained by smallRNA-Seq. (United States)

    Giurato, Giorgio; De Filippo, Maria Rosaria; Rinaldi, Antonio; Hashim, Adnan; Nassa, Giovanni; Ravo, Maria; Rizzo, Francesca; Tarallo, Roberta; Weisz, Alessandro


    Qualitative and quantitative analysis of small non-coding RNAs by next generation sequencing (smallRNA-Seq) represents a novel technology increasingly used to investigate with high sensitivity and specificity RNA population comprising microRNAs and other regulatory small transcripts. Analysis of smallRNA-Seq data to gather biologically relevant information, i.e. detection and differential expression analysis of known and novel non-coding RNAs, target prediction, etc., requires implementation of multiple statistical and bioinformatics tools from different sources, each focusing on a specific step of the analysis pipeline. As a consequence, the analytical workflow is slowed down by the need for continuous interventions by the operator, a critical factor when large numbers of datasets need to be analyzed at once. We designed a novel modular pipeline (iMir) for comprehensive analysis of smallRNA-Seq data, comprising specific tools for adapter trimming, quality filtering, differential expression analysis, biological target prediction and other useful options by integrating multiple open source modules and resources in an automated workflow. As statistics is crucial in deep-sequencing data analysis, we devised and integrated in iMir tools based on different statistical approaches to allow the operator to analyze data rigorously. The pipeline created here proved to be efficient and time-saving than currently available methods and, in addition, flexible enough to allow the user to select the preferred combination of analytical steps. We present here the results obtained by applying this pipeline to analyze simultaneously 6 smallRNA-Seq datasets from either exponentially growing or growth-arrested human breast cancer MCF-7 cells, that led to the rapid and accurate identification, quantitation and differential expression analysis of ~450 miRNAs, including several novel miRNAs and isomiRs, as well as identification of the putative mRNA targets of differentially expressed mi

  6. Single-Cell RNA Sequencing of Glioblastoma Cells. (United States)

    Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G


    Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

  7. GLASSgo – Automated and Reliable Detection of sRNA Homologs From a Single Input Sequence

    Directory of Open Access Journals (Sweden)

    Steffen C. Lott


    Full Text Available Bacterial small RNAs (sRNAs are important post-transcriptional regulators of gene expression. The functional and evolutionary characterization of sRNAs requires the identification of homologs, which is frequently challenging due to their heterogeneity, short length and partly, little sequence conservation. We developed the GLobal Automatic Small RNA Search go (GLASSgo algorithm to identify sRNA homologs in complex genomic databases starting from a single sequence. GLASSgo combines an iterative BLAST strategy with pairwise identity filtering and a graph-based clustering method that utilizes RNA secondary structure information. We tested the specificity, sensitivity and runtime of GLASSgo, BLAST and the combination RNAlien/cmsearch in a typical use case scenario on 40 bacterial sRNA families. The sensitivity of the tested methods was similar, while the specificity of GLASSgo and RNAlien/cmsearch was significantly higher than that of BLAST. GLASSgo was on average ∼87 times faster than RNAlien/cmsearch, and only ∼7.5 times slower than BLAST, which shows that GLASSgo optimizes the trade-off between speed and accuracy in the task of finding sRNA homologs. GLASSgo is fully automated, whereas BLAST often recovers only parts of homologs and RNAlien/cmsearch requires extensive additional bioinformatic work to get a comprehensive set of homologs. GLASSgo is available as an easy-to-use web server to find homologous sRNAs in large databases.

  8. Unifying cancer and normal RNA sequencing data from different sources (United States)

    Wang, Qingguo; Armenia, Joshua; Zhang, Chao; Penson, Alexander V.; Reznik, Ed; Zhang, Liguo; Minet, Thais; Ochoa, Angelica; Gross, Benjamin E.; Iacobuzio-Donahue, Christine A.; Betel, Doron; Taylor, Barry S.; Gao, Jianjiong; Schultz, Nikolaus


    Driven by the recent advances of next generation sequencing (NGS) technologies and an urgent need to decode complex human diseases, a multitude of large-scale studies were conducted recently that have resulted in an unprecedented volume of whole transcriptome sequencing (RNA-seq) data, such as the Genotype Tissue Expression project (GTEx) and The Cancer Genome Atlas (TCGA). While these data offer new opportunities to identify the mechanisms underlying disease, the comparison of data from different sources remains challenging, due to differences in sample and data processing. Here, we developed a pipeline that processes and unifies RNA-seq data from different studies, which includes uniform realignment, gene expression quantification, and batch effect removal. We find that uniform alignment and quantification is not sufficient when combining RNA-seq data from different sources and that the removal of other batch effects is essential to facilitate data comparison. We have processed data from GTEx and TCGA and successfully corrected for study-specific biases, enabling comparative analysis between TCGA and GTEx. The normalized datasets are available for download on figshare. PMID:29664468

  9. Alterations in messenger RNA and small nuclear RNA metabolism resulting from fluorouracil incorporation

    International Nuclear Information System (INIS)

    Armstrong, R.D.; Cadman, E.C.


    Studies were completed to examine the effect of 5-fluorouracil (FUra) incorporation on messenger RNA (mRNA) and small molecular weight nuclear RNA (SnRNA) metabolism. Studies of mRNA were completed using cDNA-mRNA hybridization methods to specifically examine dihydrofolate reductase (DHFR) mRNA. C 3 -L5178Y murine leukemia cells which are gene-amplified for DHFR, were exposed to FUra for 6, 12 or 24 hr, and the nuclear and cytoplasmic levels of DHFR-mRNA determined by hybridization with 32 P-DHFR-cDNA. FUra produced a dose-dependent increase in nuclear DHFR-mRNA levels, while total cytoplasmic DHFR-mRNA levels appeared to be unchanged. To examine only mRNA synthesized during FUra exposure, cells were also treated concurrently with [ 3 H] cytidine, and the [ 3 H]mRNA-cDNA hybrids measured following S 1 -nuclease treatment. FUra produced a concentration-dependent increase in nascent nuclear DHFR-mRNA levels, and a decrease in nascent cytoplasmic DHFR-mRNAs levels. These results suggest that FUra produces either an inhibition of mRNA processing, or an inhibition of nuclear-cytoplasmic transport. Preliminary experiments to examine ATP-dependent mRNA transport were completed with isolated nuclei from cells treated with FUra for 1 or 24 hr and then pulse-labeled for 1 hr with [ 3 H] cytidine. The results demonstrate a FUra-concentration and time-dependent inhibition of ATP-mediated mRNA efflux

  10. SimFuse: A Novel Fusion Simulator for RNA Sequencing (RNA-Seq Data

    Directory of Open Access Journals (Sweden)

    Yuxiang Tan


    Full Text Available The performance evaluation of fusion detection algorithms from high-throughput sequencing data crucially relies on the availability of data with known positive and negative cases of gene rearrangements. The use of simulated data circumvents some shortcomings of real data by generation of an unlimited number of true and false positive events, and the consequent robust estimation of accuracy measures, such as precision and recall. Although a few simulated fusion datasets from RNA Sequencing (RNA-Seq are available, they are of limited sample size. This makes it difficult to systematically evaluate the performance of RNA-Seq based fusion-detection algorithms. Here, we present SimFuse to address this problem. SimFuse utilizes real sequencing data as the fusions’ background to closely approximate the distribution of reads from a real sequencing library and uses a reference genome as the template from which to simulate fusions’ supporting reads. To assess the supporting read-specific performance, SimFuse generates multiple datasets with various numbers of fusion supporting reads. Compared to an extant simulated dataset, SimFuse gives users control over the supporting read features and the sample size of the simulated library, based on which the performance metrics needed for the validation and comparison of alternative fusion-detection algorithms can be rigorously estimated.

  11. RNA deep sequencing reveals differential microRNA expression during development of sea urchin and sea star.

    Directory of Open Access Journals (Sweden)

    Sabah Kadri

    Full Text Available microRNAs (miRNAs are small (20-23 nt, non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin and Patiria miniata (sea star are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc. to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads. Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common. We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at

  12. RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star (United States)

    Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.


    microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at PMID:22216218

  13. TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences

    Directory of Open Access Journals (Sweden)

    Sharma Gaurav


    Full Text Available Abstract Background The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented. Results TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a

  14. A small RNA activates CFA synthase by isoform-specific mRNA stabilization. (United States)

    Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg


    Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5' end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5' untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability.

  15. Utility of RNA Sequencing for Analysis of Maize Reproductive Transcriptomes

    Directory of Open Access Journals (Sweden)

    Rebecca M. Davidson


    Full Text Available Transcriptome sequencing is a powerful method for studying global expression patterns in large, complex genomes. Evaluation of sequence-based expression profiles during reproductive development would provide functional annotation to genes underlying agronomic traits. We generated transcriptome profiles for 12 diverse maize ( L. reproductive tissues representing male, female, developing seed, and leaf tissues using high throughput transcriptome sequencing. Overall, ∼80% of annotated genes were expressed. Comparative analysis between sequence and hybridization-based methods demonstrated the utility of ribonucleic acid sequencing (RNA-seq for expression determination and differentiation of paralagous genes (∼85% of maize genes. Analysis of 4975 gene families across reproductive tissues revealed expression divergence is proportional to family size. In all pairwise comparisons between tissues, 7 (pre- vs. postemergence cobs to 48% (pollen vs. ovule of genes were differentially expressed. Genes with expression restricted to a single tissue within this study were identified with the highest numbers observed in leaves, endosperm, and pollen. Coexpression network analysis identified 17 gene modules with complex and shared expression patterns containing many previously described maize genes. The data and analyses in this study provide valuable tools through improved gene annotation, gene family characterization, and a core set of candidate genes to further characterize maize reproductive development and improve grain yield potential.

  16. An Efficient Method for Identifying Gene Fusions by Targeted RNA Sequencing from Fresh Frozen and FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Jonathan A Scolnick

    Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.

  17. Phytophthora have distinct endogenous small RNA populations that include short interfering and microRNAs.

    Directory of Open Access Journals (Sweden)

    Noah Fahlgren

    Full Text Available In eukaryotes, RNA silencing pathways utilize 20-30-nucleotide small RNAs to regulate gene expression, specify and maintain chromatin structure, and repress viruses and mobile genetic elements. RNA silencing was likely present in the common ancestor of modern eukaryotes, but most research has focused on plant and animal RNA silencing systems. Phytophthora species belong to a phylogenetically distinct group of economically important plant pathogens that cause billions of dollars in yield losses annually as well as ecologically devastating outbreaks. We analyzed the small RNA-generating components of the genomes of P. infestans, P. sojae and P. ramorum using bioinformatics, genetic, phylogenetic and high-throughput sequencing-based methods. Each species produces two distinct populations of small RNAs that are predominantly 21- or 25-nucleotides long. The 25-nucleotide small RNAs were primarily derived from loci encoding transposable elements and we propose that these small RNAs define a pathway of short-interfering RNAs that silence repetitive genetic elements. The 21-nucleotide small RNAs were primarily derived from inverted repeats, including a novel microRNA family that is conserved among the three species, and several gene families, including Crinkler effectors and type III fibronectins. The Phytophthora microRNA is predicted to target a family of amino acid/auxin permeases, and we propose that 21-nucleotide small RNAs function at the post-transcriptional level. The functional significance of microRNA-guided regulation of amino acid/auxin permeases and the association of 21-nucleotide small RNAs with Crinkler effectors remains unclear, but this work provides a framework for testing the role of small RNAs in Phytophthora biology and pathogenesis in future work.

  18. Phytophthora have distinct endogenous small RNA populations that include short interfering and microRNAs. (United States)

    Fahlgren, Noah; Bollmann, Stephanie R; Kasschau, Kristin D; Cuperus, Josh T; Press, Caroline M; Sullivan, Christopher M; Chapman, Elisabeth J; Hoyer, J Steen; Gilbert, Kerrigan B; Grünwald, Niklaus J; Carrington, James C


    In eukaryotes, RNA silencing pathways utilize 20-30-nucleotide small RNAs to regulate gene expression, specify and maintain chromatin structure, and repress viruses and mobile genetic elements. RNA silencing was likely present in the common ancestor of modern eukaryotes, but most research has focused on plant and animal RNA silencing systems. Phytophthora species belong to a phylogenetically distinct group of economically important plant pathogens that cause billions of dollars in yield losses annually as well as ecologically devastating outbreaks. We analyzed the small RNA-generating components of the genomes of P. infestans, P. sojae and P. ramorum using bioinformatics, genetic, phylogenetic and high-throughput sequencing-based methods. Each species produces two distinct populations of small RNAs that are predominantly 21- or 25-nucleotides long. The 25-nucleotide small RNAs were primarily derived from loci encoding transposable elements and we propose that these small RNAs define a pathway of short-interfering RNAs that silence repetitive genetic elements. The 21-nucleotide small RNAs were primarily derived from inverted repeats, including a novel microRNA family that is conserved among the three species, and several gene families, including Crinkler effectors and type III fibronectins. The Phytophthora microRNA is predicted to target a family of amino acid/auxin permeases, and we propose that 21-nucleotide small RNAs function at the post-transcriptional level. The functional significance of microRNA-guided regulation of amino acid/auxin permeases and the association of 21-nucleotide small RNAs with Crinkler effectors remains unclear, but this work provides a framework for testing the role of small RNAs in Phytophthora biology and pathogenesis in future work.

  19. Phytophthora Have Distinct Endogenous Small RNA Populations That Include Short Interfering and microRNAs (United States)

    Fahlgren, Noah; Bollmann, Stephanie R.; Kasschau, Kristin D.; Cuperus, Josh T.; Press, Caroline M.; Sullivan, Christopher M.; Chapman, Elisabeth J.; Hoyer, J. Steen; Gilbert, Kerrigan B.; Grünwald, Niklaus J.; Carrington, James C.


    In eukaryotes, RNA silencing pathways utilize 20-30-nucleotide small RNAs to regulate gene expression, specify and maintain chromatin structure, and repress viruses and mobile genetic elements. RNA silencing was likely present in the common ancestor of modern eukaryotes, but most research has focused on plant and animal RNA silencing systems. Phytophthora species belong to a phylogenetically distinct group of economically important plant pathogens that cause billions of dollars in yield losses annually as well as ecologically devastating outbreaks. We analyzed the small RNA-generating components of the genomes of P. infestans, P. sojae and P. ramorum using bioinformatics, genetic, phylogenetic and high-throughput sequencing-based methods. Each species produces two distinct populations of small RNAs that are predominantly 21- or 25-nucleotides long. The 25-nucleotide small RNAs were primarily derived from loci encoding transposable elements and we propose that these small RNAs define a pathway of short-interfering RNAs that silence repetitive genetic elements. The 21-nucleotide small RNAs were primarily derived from inverted repeats, including a novel microRNA family that is conserved among the three species, and several gene families, including Crinkler effectors and type III fibronectins. The Phytophthora microRNA is predicted to target a family of amino acid/auxin permeases, and we propose that 21-nucleotide small RNAs function at the post-transcriptional level. The functional significance of microRNA-guided regulation of amino acid/auxin permeases and the association of 21-nucleotide small RNAs with Crinkler effectors remains unclear, but this work provides a framework for testing the role of small RNAs in Phytophthora biology and pathogenesis in future work. PMID:24204767

  20. Intratracheal Administration of Small Interfering RNA Targeting Fas Reduces Lung Ischemia-Reperfusion Injury. (United States)

    Del Sorbo, Lorenzo; Costamagna, Andrea; Muraca, Giuseppe; Rotondo, Giuseppe; Civiletti, Federica; Vizio, Barbara; Bosco, Ornella; Martin Conte, Erica L; Frati, Giacomo; Delsedime, Luisa; Lupia, Enrico; Fanelli, Vito; Ranieri, V Marco


    Lung ischemia-reperfusion injury is the main cause of primary graft dysfunction after lung transplantation and results in increased morbidity and mortality. Fas-mediated apoptosis is one of the pathologic mechanisms involved in the development of ischemia-reperfusion injury. We hypothesized that the inhibition of Fas gene expression in lungs by intratracheal administration of small interfering RNA could reduce lung ischemia-reperfusion injury in an ex vivo model reproducing the procedural sequence of lung transplantation. Prospective, randomized, controlled experimental study. University research laboratory. C57/BL6 mice weighing 28-30 g. Ischemia-reperfusion injury was induced in lungs isolated from mice, 48 hours after treatment with intratracheal small interfering RNA targeting Fas, control small interfering RNA, or vehicle. Isolated lungs were exposed to 6 hours of cold ischemia (4°C), followed by 2 hours of warm (37°C) reperfusion with a solution containing 10% of fresh whole blood and mechanical ventilation with constant low driving pressure. Fas gene expression was significantly silenced at the level of messenger RNA and protein after ischemia-reperfusion in lungs treated with small interfering RNA targeting Fas compared with lungs treated with control small interfering RNA or vehicle. Silencing of Fas gene expression resulted in reduced edema formation (bronchoalveolar lavage protein concentration and lung histology) and improvement in lung compliance. These effects were associated with a significant reduction of pulmonary cell apoptosis of lungs treated with small interfering RNA targeting Fas, which did not affect cytokine release and neutrophil infiltration. Fas expression silencing in the lung by small interfering RNA is effective against ischemia-reperfusion injury. This approach represents a potential innovative strategy of organ preservation before lung transplantation.

  1. Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform. (United States)

    Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng


    Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

  2. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.


    Le Gall, O; Candresse, T; Brault, V; Dunez, J


    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  3. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.


    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R


    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

  4. Unravelling the complexity of microRNA-mediated gene regulation in black pepper (Piper nigrum L.) using high-throughput small RNA profiling. (United States)

    Asha, Srinivasan; Sreekumar, Sweda; Soniya, E V


    Analysis of high-throughput small RNA deep sequencing data, in combination with black pepper transcriptome sequences revealed microRNA-mediated gene regulation in black pepper ( Piper nigrum L.). Black pepper is an important spice crop and its berries are used worldwide as a natural food additive that contributes unique flavour to foods. In the present study to characterize microRNAs from black pepper, we generated a small RNA library from black pepper leaf and sequenced it by Illumina high-throughput sequencing technology. MicroRNAs belonging to a total of 303 conserved miRNA families were identified from the sRNAome data. Subsequent analysis from recently sequenced black pepper transcriptome confirmed precursor sequences of 50 conserved miRNAs and four potential novel miRNA candidates. Stem-loop qRT-PCR experiments demonstrated differential expression of eight conserved miRNAs in black pepper. Computational analysis of targets of the miRNAs showed 223 potential black pepper unigene targets that encode diverse transcription factors and enzymes involved in plant development, disease resistance, metabolic and signalling pathways. RLM-RACE experiments further mapped miRNA-mediated cleavage at five of the mRNA targets. In addition, miRNA isoforms corresponding to 18 miRNA families were also identified from black pepper. This study presents the first large-scale identification of microRNAs from black pepper and provides the foundation for the future studies of miRNA-mediated gene regulation of stress responses and diverse metabolic processes in black pepper.

  5. Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging. (United States)

    Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J


    Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the

  6. The Spot 42 RNA: A regulatory small RNA with roles in the central metabolism (United States)

    Bækkedal, Cecilie; Haugen, Peik


    The Spot 42 RNA is a 109 nucleotide long (in Escherichia coli) noncoding small regulatory RNA (sRNA) encoded by the spf (spot fourty-two) gene. spf is found in gamma-proteobacteria and the majority of experimental work on Spot 42 RNA has been performed using E. coli, and recently Aliivibrio salmonicida. In the cell Spot 42 RNA plays essential roles as a regulator in carbohydrate metabolism and uptake, and its expression is activated by glucose, and inhibited by the cAMP-CRP complex. Here we summarize the current knowledge on Spot 42, and present the natural distribution of spf, show family-specific secondary structural features of Spot 42, and link highly conserved structural regions to mRNA target binding. PMID:26327359

  7. The Spot 42 RNA: A regulatory small RNA with roles in the central metabolism. (United States)

    Bækkedal, Cecilie; Haugen, Peik


    The Spot 42 RNA is a 109 nucleotide long (in Escherichia coli) noncoding small regulatory RNA (sRNA) encoded by the spf (spot fourty-two) gene. spf is found in gamma-proteobacteria and the majority of experimental work on Spot 42 RNA has been performed using E. coli, and recently Aliivibrio salmonicida. In the cell Spot 42 RNA plays essential roles as a regulator in carbohydrate metabolism and uptake, and its expression is activated by glucose, and inhibited by the cAMP-CRP complex. Here we summarize the current knowledge on Spot 42, and present the natural distribution of spf, show family-specific secondary structural features of Spot 42, and link highly conserved structural regions to mRNA target binding.

  8. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon


    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  9. Next generation sequencing analysis of human platelet PolyA+ mRNAs and rRNA-depleted total RNA.

    Directory of Open Access Journals (Sweden)

    Antheia Kissopoulou

    Full Text Available BACKGROUND: Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. MATERIALS AND METHODS: We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. RESULTS: Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. CONCLUSION: The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components

  10. How to Tackle the Challenge of siRNA Delivery with Sequence-Defined Oligoamino Amides. (United States)

    Reinhard, Sören; Wagner, Ernst


    RNA interference (RNAi) as a mechanism of gene regulation provides exciting opportunities for medical applications. Synthetic small interfering RNA (siRNA) triggers the knockdown of complementary mRNA sequences in a catalytic fashion and has to be delivered into the cytosol of the targeted cells. The design of adequate carrier systems to overcome multiple extracellular and intracellular roadblocks within the delivery process has utmost importance. Cationic polymers form polyplexes through electrostatic interaction with negatively charged nucleic acids and present a promising class of carriers. Issues of polycations regarding toxicity, heterogeneity, and polydispersity can be overcome by solid-phase-assisted synthesis of sequence-defined cationic oligomers. These medium-sized highly versatile nucleic acid carriers display low cytotoxicity and can be modified and tailored in multiple ways to meet specific requirements of nucleic acid binding, polyplex size, shielding, targeting, and intracellular release of the cargo. In this way, sequence-defined cationic oligomers can mimic the dynamic and bioresponsive behavior of viruses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Mechanisms controlling mRNA processing and translation : decoding the regulatory layers defining gene expression through RNA sequencing

    NARCIS (Netherlands)

    Klerk, Eleonora de


    The work described in this thesis focuses on the mechanisms that give rise to alternative mRNAs and their alternative translation into proteins. Each of the described studies has been based on a specific set of high-throughput RNA sequencing technologies. An overview of the available RNA sequencing

  12. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data. (United States)

    Szymanski, Maciej; Karlowski, Wojciech M


    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  13. Viral Small-RNA Analysis of Bombyx mori Larval Midgut during Persistent and Pathogenic Cytoplasmic Polyhedrosis Virus Infection


    Zografidis, Aris; Van Nieuwerburgh, Filip; Kolliopoulou, Anna; Apostolou-Karampelis, Konstantinos; Head, Steven R.; Deforce, Dieter; Smagghe, Guy; Swevers, Luc


    The lepidopteran innate immune response against RNA viruses remains poorly understood, while in other insects several studies have highlighted an essential role for the exo-RNAi pathway in combating viral infection. Here, by using deep-sequencing technology for viral small-RNA (vsRNA) assessment, we provide evidence that exo-RNAi is operative in the silkworm Bombyx mori against both persistent and pathogenic infection of B. mori cytoplasmic polyhedrosis virus (BmCPV) which is characterized by...

  14. Deep sequencing analysis of the developing mouse brain reveals a novel microRNA

    Directory of Open Access Journals (Sweden)

    Piltz Sandra


    Full Text Available Abstract Background MicroRNAs (miRNAs are small non-coding RNAs that can exert multilevel inhibition/repression at a post-transcriptional or protein synthesis level during disease or development. Characterisation of miRNAs in adult mammalian brains by deep sequencing has been reported previously. However, to date, no small RNA profiling of the developing brain has been undertaken using this method. We have performed deep sequencing and small RNA analysis of a developing (E15.5 mouse brain. Results We identified the expression of 294 known miRNAs in the E15.5 developing mouse brain, which were mostly represented by let-7 family and other brain-specific miRNAs such as miR-9 and miR-124. We also discovered 4 putative 22-23 nt miRNAs: mm_br_e15_1181, mm_br_e15_279920, mm_br_e15_96719 and mm_br_e15_294354 each with a 70-76 nt predicted pre-miRNA. We validated the 4 putative miRNAs and further characterised one of them, mm_br_e15_1181, throughout embryogenesis. Mm_br_e15_1181 biogenesis was Dicer1-dependent and was expressed in E3.5 blastocysts and E7 whole embryos. Embryo-wide expression patterns were observed at E9.5 and E11.5 followed by a near complete loss of expression by E13.5, with expression restricted to a specialised layer of cells within the developing and early postnatal brain. Mm_br_e15_1181 was upregulated during neurodifferentiation of P19 teratocarcinoma cells. This novel miRNA has been identified as miR-3099. Conclusions We have generated and analysed the first deep sequencing dataset of small RNA sequences of the developing mouse brain. The analysis revealed a novel miRNA, miR-3099, with potential regulatory effects on early embryogenesis, and involvement in neuronal cell differentiation/function in the brain during late embryonic and early neonatal development.

  15. Analysis of small RNA production patterns among the two potato spindle tuber viroid variants in tomato plants

    Directory of Open Access Journals (Sweden)

    Charith Raj Adkar-Purushothama


    Full Text Available In order to analyze the production of small RNA (sRNA by viroids upon infecting the plants, the tomato plants (Solanum lycopersicum cultivar Rutgers were inoculated with the variants of Potato spindle tuber viroid (PSTVd. After 21-days of postinoculation, total RNA was extracted and subjected for deep-sequencing using Illumina HiSeq platform. The primers were trimmed and only 21- to 24-nt long sRNAs were filtered after quality check of the raw data. The filtered sRNA population was then mapped against both the genomic (+ and antigenomic (− strands of the respective PSTVd variants using standard pattern-matching algorithm. The profiling of viroid derived sRNA (vd-sRNA revealed that the viroids are susceptible to host RNA silencing mechanism. High-throughput sequence data linked to this project have been deposited in the Gene Expression Omnibus (GEO database under accession number GSE69225.

  16. Small RNA pathways and diversity in model legumes: lessons from genomics.

    Directory of Open Access Journals (Sweden)

    Pilar eBustos-Sanmamed


    Full Text Available Small non coding RNAs (smRNA participate in the regulation of development, cell differentiation, adaptation to environmental constraints and defense responses in plants. They negatively regulate gene expression by degrading specific mRNA targets, repressing their translation or modifying chromatin conformation through homologous interaction with target loci. MicroRNAs (miRNA and short-interfering RNAs (siRNA are generated from long double stranded RNA (dsRNA that are cleaved into 20- to 24-nucleotide dsRNAs by RNase III proteins called DICERs (DCL. One strand of the duplex is then loaded onto effective complexes containing different ARGONAUTE (AGO proteins. In this review, we explored smRNA diversity in model legumes and compiled available data from miRBAse, the miRNA database, and from 22 reports of smRNA deep sequencing or miRNA identification genome-wide in Medicago truncatula, Glycine max and Lotus japonicus. In addition to conserved miRNAs present in other plant species, 229, 179 and 35 novel miRNA families were identified respectively in these 3 legumes, among which several seems legume-specific. New potential functions of several miRNAs in the legume-specific nodulation process are discussed. Furthermore, a new category of siRNA, the phased siRNAs, which seems to mainly regulate disease-resistance genes, was recently discovered in legumes. Despite that the genome sequence of model legumes are not yet fully completed, further analysis was performed by database mining of gene families and protein characteristics of DCLs and AGOs in these genomes. Although most components of the smRNA pathways are conserved, identifiable homologs of key smRNA players from non-legumes could not yet be detected in M. truncatula available genomic and expressed sequence databases. In addition, an important gene diversification was observed in the three legumes. Functional significance of these variant isoforms may reflect peculiarities of smRNA biogenesis in

  17. SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing. (United States)

    Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi


    Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. Supplementary data are available

  18. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus. (United States)

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide


    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  19. Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

    DEFF Research Database (Denmark)

    Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.


    detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

  20. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis. (United States)

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert


    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

  1. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA? (United States)

    Schuster, W; Brennicke, A


    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  2. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1. (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J


    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  3. Modulations of RNA sequences by cytokinin in pumpkin cotyledons

    International Nuclear Information System (INIS)

    Chang, C.; Ertl, J.; Chen, C.


    Polyadenylated mRNAs from excised pumpkin cotyledons treated with or without 10 -4 M benzyladenine (BA) for various time periods in suspension culture were assayed by in vitro translation in the presence of [ 35 S] methionine. The radioactive polypeptides were analyzed by one- and two-dimensional polyacrylamide gel electrophoresis. Specific sequences of mRNAs were enhanced, reduced, induced, or suppressed by the hormone within 60 min of the application of BA to the cotyledons. Four independent cDNA clones of cytokinin-modulated mRNAs have been selected and characterized. RNA blot hybridization using the four cDNA probes also indicates that the levels of specific mRNAs are modulated upward or downward by the hormone

  4. Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in prostate cancer

    DEFF Research Database (Denmark)

    Martens-Uzunova, E S; Jalava, S E; Dits, N F


    Prostate cancer (PCa) is the most frequent male malignancy and the second most common cause of cancer-related death in Western countries. Current clinical and pathological methods are limited in the prediction of postoperative outcome. It is becoming increasingly evident that small non-coding RNA...... signatures of 102 fresh-frozen patient samples during PCa progression by miRNA microarrays. Both platforms were cross-validated by quantitative reverse transcriptase-PCR. Besides the altered expression of several miRNAs, our deep sequencing analyses revealed strong differential expression of small nucleolar...... RNAs (snoRNAs) and transfer RNAs (tRNAs). From microarray analysis, we derived a miRNA diagnostic classifier that accurately distinguishes normal from cancer samples. Furthermore, we were able to construct a PCa prognostic predictor that independently forecasts postoperative outcome. Importantly...

  5. psRNATarget: a plant small RNA target analysis server (2017 release). (United States)

    Dai, Xinbin; Zhuang, Zhaohong; Zhao, Patrick Xuechun


    Plant regulatory small RNAs (sRNAs), which include most microRNAs (miRNAs) and a subset of small interfering RNAs (siRNAs), such as the phased siRNAs (phasiRNAs), play important roles in regulating gene expression. Although generated from genetically distinct biogenesis pathways, these regulatory sRNAs share the same mechanisms for post-translational gene silencing and translational inhibition. psRNATarget was developed to identify plant sRNA targets by (i) analyzing complementary matching between the sRNA sequence and target mRNA sequence using a predefined scoring schema and (ii) by evaluating target site accessibility. This update enhances its analytical performance by developing a new scoring schema that is capable of discovering miRNA-mRNA interactions at higher 'recall rates' without significantly increasing total prediction output. The scoring procedure is customizable for the users to search both canonical and non-canonical targets. This update also enables transmitting and analyzing 'big' data empowered by (a) the implementation of multi-threading chunked file uploading, which can be paused and resumed, using HTML5 APIs and (b) the allocation of significantly more computing nodes to its back-end Linux cluster. The updated psRNATarget server has clear, compelling and user-friendly interfaces that enhance user experiences and present data clearly and concisely. The psRNATarget is freely available at

  6. Ancient and novel small RNA pathways compensate for the loss of piRNAs in multiple independent nematode lineages.

    Directory of Open Access Journals (Sweden)

    Peter Sarkies


    Full Text Available Small RNA pathways act at the front line of defence against transposable elements across the Eukaryota. In animals, Piwi interacting small RNAs (piRNAs are a crucial arm of this defence. However, the evolutionary relationships among piRNAs and other small RNA pathways targeting transposable elements are poorly resolved. To address this question we sequenced small RNAs from multiple, diverse nematode species, producing the first phylum-wide analysis of how small RNA pathways evolve. Surprisingly, despite their prominence in Caenorhabditis elegans and closely related nematodes, piRNAs are absent in all other nematode lineages. We found that there are at least two evolutionarily distinct mechanisms that compensate for the absence of piRNAs, both involving RNA-dependent RNA polymerases (RdRPs. Whilst one pathway is unique to nematodes, the second involves Dicer-dependent RNA-directed DNA methylation, hitherto unknown in animals, and bears striking similarity to transposon-control mechanisms in fungi and plants. Our results highlight the rapid, context-dependent evolution of small RNA pathways and suggest piRNAs in animals may have replaced an ancient eukaryotic RNA-dependent RNA polymerase pathway to control transposable elements.

  7. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences. (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A


    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Rtools: a web server for various secondary structural analyses on single RNA sequences. (United States)

    Hamada, Michiaki; Ono, Yukiteru; Kiryu, Hisanori; Sato, Kengo; Kato, Yuki; Fukunaga, Tsukasa; Mori, Ryota; Asai, Kiyoshi


    The secondary structures, as well as the nucleotide sequences, are the important features of RNA molecules to characterize their functions. According to the thermodynamic model, however, the probability of any secondary structure is very small. As a consequence, any tool to predict the secondary structures of RNAs has limited accuracy. On the other hand, there are a few tools to compensate the imperfect predictions by calculating and visualizing the secondary structural information from RNA sequences. It is desirable to obtain the rich information from those tools through a friendly interface. We implemented a web server of the tools to predict secondary structures and to calculate various structural features based on the energy models of secondary structures. By just giving an RNA sequence to the web server, the user can get the different types of solutions of the secondary structures, the marginal probabilities such as base-paring probabilities, loop probabilities and accessibilities of the local bases, the energy changes by arbitrary base mutations as well as the measures for validations of the predicted secondary structures. The web server is available at, which integrates software tools, CentroidFold, CentroidHomfold, IPKnot, CapR, Raccess, Rchange and RintD. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. The Pseudomonas aeruginosa transcriptome in planktonic cultures and static biofilms using RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Andreas Dötsch

    Full Text Available In this study, we evaluated how gene expression differs in mature Pseudomonas aeruginosa biofilms as opposed to planktonic cells by the use of RNA sequencing technology that gives rise to both quantitative and qualitative information on the transcriptome. Although a large proportion of genes were consistently regulated in both the stationary phase and biofilm cultures as opposed to the late exponential growth phase cultures, the global biofilm gene expression pattern was clearly distinct indicating that biofilms are not just surface attached cells in stationary phase. A large amount of the genes found to be biofilm specific were involved in adaptation to microaerophilic growth conditions, repression of type three secretion and production of extracellular matrix components. Additionally, we found many small RNAs to be differentially regulated most of them similarly in stationary phase cultures and biofilms. A qualitative analysis of the RNA-seq data revealed more than 3000 putative transcriptional start sites (TSS. By the use of rapid amplification of cDNA ends (5'-RACE we confirmed the presence of three different TSS associated with the pqsABCDE operon, two in the promoter of pqsA and one upstream of the second gene, pqsB. Taken together, this study reports the first transcriptome study on P. aeruginosa that employs RNA sequencing technology and provides insights into the quantitative and qualitative transcriptome including the expression of small RNAs in P. aeruginosa biofilms.

  10. Small interfering RNA delivery through positively charged polymer nanoparticles

    International Nuclear Information System (INIS)

    Dragoni, Luca; Cesana, Alberto; Moscatelli, Davide; Ferrari, Raffaele; Morbidelli, Massimo; Lupi, Monica; Falcetta, Francesca; Ubezio, Paolo; D’Incalci, Maurizio


    Small interfering RNA (siRNA) is receiving increasing attention with regard to the treatment of many genetic diseases, both acquired and hereditary, such as cancer and diabetes. Being a high molecular weight (MW) polyanion, siRNA is not able to cross a cell membrane, and in addition it is unstable in physiological conditions. Accordingly, a biocompatible nanocarrier able to deliver siRNA into cells is needed. In this work, we synthesized biocompatible positively charged nanoparticles (NPs) following a two-step process that involves ring opening polymerization (ROP) and emulsion free radical polymerization (EFRP). Firstly, we proved the possibility of fine tuning the NPs’ characteristics (e.g. size and surface charge) by changing the synthetic process parameters. Then the capability in loading and delivering undamaged siRNA into a cancer cell cytoplasm has been shown. This latter process occurs through the biodegradation of the polymer constituting the NPs, whose kinetics can be tuned by adjusting the polymer’s MW. Finally, the ability of NPs to carry siRNA inside the cells in order to inhibit their target gene has been demonstrated using green flourescent protein positive cells. (paper)

  11. Transcriptome sequencing of the Microarray Quality Control (MAQC RNA reference samples using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Thierry-Mieg Danielle


    Full Text Available Abstract Background Transcriptome sequencing using next-generation sequencing platforms will soon be competing with DNA microarray technologies for global gene expression analysis. As a preliminary evaluation of these promising technologies, we performed deep sequencing of cDNA synthesized from the Microarray Quality Control (MAQC reference RNA samples using Roche's 454 Genome Sequencer FLX. Results We generated more that 3.6 million sequence reads of average length 250 bp for the MAQC A and B samples and introduced a data analysis pipeline for translating cDNA read counts into gene expression levels. Using BLAST, 90% of the reads mapped to the human genome and 64% of the reads mapped to the RefSeq database of well annotated genes with e-values ≤ 10-20. We measured gene expression levels in the A and B samples by counting the numbers of reads that mapped to individual RefSeq genes in multiple sequencing runs to evaluate the MAQC quality metrics for reproducibility, sensitivity, specificity, and accuracy and compared the results with DNA microarrays and Quantitative RT-PCR (QRTPCR from the MAQC studies. In addition, 88% of the reads were successfully aligned directly to the human genome using the AceView alignment programs with an average 90% sequence similarity to identify 137,899 unique exon junctions, including 22,193 new exon junctions not yet contained in the RefSeq database. Conclusion Using the MAQC metrics for evaluating the performance of gene expression platforms, the ExpressSeq results for gene expression levels showed excellent reproducibility, sensitivity, and specificity that improved systematically with increasing shotgun sequencing depth, and quantitative accuracy that was comparable to DNA microarrays and QRTPCR. In addition, a careful mapping of the reads to the genome using the AceView alignment programs shed new light on the complexity of the human transcriptome including the discovery of thousands of new splice variants.

  12. MicroRNA Profiling in Aqueous Humor of Individual Human Eyes by Next-Generation Sequencing. (United States)

    Wecker, Thomas; Hoffmeier, Klaus; Plötner, Anne; Grüning, Björn Andreas; Horres, Ralf; Backofen, Rolf; Reinhard, Thomas; Schlunck, Günther


    Extracellular microRNAs (miRNAs) in aqueous humor were suggested to have a role in transcellular signaling and may serve as disease biomarkers. The authors adopted next-generation sequencing (NGS) techniques to further characterize the miRNA profile in single samples of 60 to 80 μL human aqueous humor. Samples were obtained at the outset of cataract surgery in nine independent, otherwise healthy eyes. Four samples were used to extract RNA and generate sequencing libraries, followed by an adapter-driven amplification step, electrophoretic size selection, sequencing, and data analysis. Five samples were used for quantitative PCR (qPCR) validation of NGS results. Published NGS data on circulating miRNAs in blood were analyzed in comparison. One hundred fifty-eight miRNAs were consistently detected by NGS in all four samples; an additional 59 miRNAs were present in at least three samples. The aqueous humor miRNA profile shows some overlap with published NGS-derived inventories of circulating miRNAs in blood plasma with high prevalence of human miR-451a, -21, and -16. In contrast to blood, miR-184, -4448, -30a, -29a, -29c, -19a, -30d, -205, -24, -22, and -3074 were detected among the 20 most prevalent miRNAs in aqueous humor. Relative expression patterns of miR-451a, -202, and -144 suggested by NGS were confirmed by qPCR. Our data illustrate the feasibility of miRNA analysis by NGS in small individual aqueous humor samples. Intraocular cells as well as blood plasma contribute to the extracellular aqueous humor miRNome. The data suggest possible roles of miRNA in intraocular cell adhesion and signaling by TGF-β and Wnt, which are important in intraocular pressure regulation and glaucoma.

  13. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.


    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  14. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson


    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  15. Novel microRNA-like viral small regulatory RNAs arising during human hepatitis A virus infection. (United States)

    Shi, Jiandong; Sun, Jing; Wang, Bin; Wu, Meini; Zhang, Jing; Duan, Zhiqing; Wang, Haixuan; Hu, Ningzhu; Hu, Yunzhang


    MicroRNAs (miRNAs), including host miRNAs and viral miRNAs, play vital roles in regulating host-virus interactions. DNA viruses encode miRNAs that regulate the viral life cycle. However, it is generally believed that cytoplasmic RNA viruses do not encode miRNAs, owing to inaccessible cellular miRNA processing machinery. Here, we provide a comprehensive genome-wide analysis and identification of miRNAs that were derived from hepatitis A virus (HAV; Hu/China/H2/1982), which is a typical cytoplasmic RNA virus. Using deep-sequencing and in silico approaches, we identified 2 novel virally encoded miRNAs, named hav-miR-1-5p and hav-miR-2-5p. Both of the novel virally encoded miRNAs were clearly detected in infected cells. Analysis of Dicer enzyme silencing demonstrated that HAV-derived miRNA biogenesis is Dicer dependent. Furthermore, we confirmed that HAV mature miRNAs were generated from viral miRNA precursors (pre-miRNAs) in host cells. Notably, naturally derived HAV miRNAs were biologically and functionally active and induced post-transcriptional gene silencing (PTGS). Genomic location analysis revealed novel miRNAs located in the coding region of the viral genome. Overall, our results show that HAV naturally generates functional miRNA-like small regulatory RNAs during infection. This is the first report of miRNAs derived from the coding region of genomic RNA of a cytoplasmic RNA virus. These observations demonstrate that a cytoplasmic RNA virus can naturally generate functional miRNAs, as DNA viruses do. These findings also contribute to improved understanding of host-RNA virus interactions mediated by RNA virus-derived miRNAs. © FASEB.

  16. Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida

    DEFF Research Database (Denmark)

    Bojanovic, Klara

    evolved numerous mechanisms to controlgene expression in response to specific environmental signals. In addition to two-component systems, small regulatory RNAs (sRNAs) have emerged as major regulators of gene expression. The majority of sRNAs bind to mRNA and regulate their expression. They often have...... multiple targets and are incorporated into large regulatory networks and the RNA chaper one Hfq in many cases facilitates interactions between sRNAs and their targets. Some sRNAs also act by binding to protein targets and sequestering their function. In this PhD thesis we investigated the transcriptional....... Detailed insights into the mechanisms through which P. putida responds to different stress conditions and increased understanding of bacterial adaptation in natural and industrial settings were gained. Additionally, we identified genome-wide transcription start sites, andmany regulatory RNA elements...

  17. Fast selection of miRNA candidates based on large-scale pre-computed MFE sets of randomized sequences. (United States)

    Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter


    Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.

  18. miRanalyzer: a microRNA detection and analysis tool for next-generation sequencing experiments. (United States)

    Hackenberg, Michael; Sturm, Martin; Langenberger, David; Falcón-Pérez, Juan Manuel; Aransay, Ana M


    Next-generation sequencing allows now the sequencing of small RNA molecules and the estimation of their expression levels. Consequently, there will be a high demand of bioinformatics tools to cope with the several gigabytes of sequence data generated in each single deep-sequencing experiment. Given this scene, we developed miRanalyzer, a web server tool for the analysis of deep-sequencing experiments for small RNAs. The web server tool requires a simple input file containing a list of unique reads and its copy numbers (expression levels). Using these data, miRanalyzer (i) detects all known microRNA sequences annotated in miRBase, (ii) finds all perfect matches against other libraries of transcribed sequences and (iii) predicts new microRNAs. The prediction of new microRNAs is an especially important point as there are many species with very few known microRNAs. Therefore, we implemented a highly accurate machine learning algorithm for the prediction of new microRNAs that reaches AUC values of 97.9% and recall values of up to 75% on unseen data. The web tool summarizes all the described steps in a single output page, which provides a comprehensive overview of the analysis, adding links to more detailed output pages for each analysis module. miRanalyzer is available at

  19. Spliceosomal small nuclear RNAs of Tetrahymena thermophila and some possible snRNA-snRNA base-pairing interactions

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J


    We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T....... thermophila snRNAs all have unique 5' ends, which start with an adenine residue. In contrast, with the exception of U6, their 3' ends show some size heterogeneity. The primary sequences of the T. thermophila snRNAs contain the sequence motifs shown, or proposed, to be of functional importance in other...

  20. Small RNA expression and strain specificity in the rat

    Directory of Open Access Journals (Sweden)

    de Bruijn Ewart


    Full Text Available Abstract Background Digital gene expression (DGE profiling has become an established tool to study RNA expression. Here, we provide an in-depth analysis of small RNA DGE profiles from two different rat strains (BN-Lx and SHR from six different rat tissues (spleen, liver, brain, testis, heart, kidney. We describe the expression patterns of known and novel micro (miRNAs and piwi-interacting (piRNAs. Results We confirmed the expression of 588 known miRNAs (54 in antisense orientation and identified 56 miRNAs homologous to known human or mouse miRNAs, as well as 45 new rat miRNAs. Furthermore, we confirmed specific A to I editing in brain for mir-376a/b/c and identified mir-377 as a novel editing target. In accordance with earlier findings, we observed a highly tissue-specific expression pattern for all tissues analyzed. The brain was found to express the highest number of tissue-specific miRNAs, followed by testis. Notably, our experiments also revealed robust strain-specific differential miRNA expression in the liver that is caused by genetic variation between the strains. Finally, we identified two types of germline-specific piRNAs in testis, mapping either to transposons or in strand-specific clusters. Conclusions Taken together, the small RNA compendium described here advances the annotation of small RNAs in the rat genome. Strain and tissue-specific expression patterns furthermore provide a strong basis for studying the role of small RNAs in regulatory networks as well as biological process like physiology and neurobiology that are extensively studied in this model system.

  1. MicroRNA and piRNA profiles in normal human testis detected by next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Qingling Yang

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are the class of small endogenous RNAs that play an important regulatory role in cells by negatively affecting gene expression at transcriptional and post-transcriptional levels. There have been extensive studies aiming to discover miRNAs and to analyze their functions in the cells from a variety of species. However, there are no published studies of miRNA profiles in human testis using next generation sequencing (NGS technology. RESULTS: We employed Solexa sequencing technology to profile miRNAs in normal human testis. Total 770 known and 5 novel human miRNAs, and 20121 piRNAs were detected, indicating that the human testis has a complex population of small RNAs. The expression of 15 known and 5 novel detected miRNAs was validated by qRT-PCR. We have also predicted the potential target genes of the abundant known and novel miRNAs, and subjected them to GO and pathway analysis, revealing the involvement of miRNAs in many important biological phenomenon including meiosis and p53-related pathways that are implicated in the regulation of spermatogenesis. CONCLUSIONS: This study reports the first genome-wide miRNA profiles in human testis using a NGS approach. The presence of large number of miRNAs and the nature of their target genes suggested that miRNAs play important roles in spermatogenesis. Here we provide a useful resource for further elucidation of the regulatory role of miRNAs and piRNAs in the spermatogenesis. It may also facilitate the development of prophylactic strategies for male infertility.

  2. MicroRNA-944 Affects Cell Growth by Targeting EPHA7 in Non-Small Cell Lung Cancer


    Minxia Liu; Kecheng Zhou; Yi Cao


    MicroRNAs (miRNAs) have critical roles in lung tumorigenesis and development. To determine aberrantly expressed miRNAs involved in non-small cell lung cancer (NSCLC) and investigate pathophysiological functions and mechanisms, we firstly carried out small RNA deep sequencing in NSCLC cell lines (EPLC-32M1, A549 and 801D) and a human immortalized cell line 16HBE, we then studied miRNA function by cell proliferation and apoptosis. cDNA microarray, luciferase reporter assay and miRNA transfectio...

  3. Exploration of small RNA-seq data for small non-coding RNAs in Human Colorectal Cancer. (United States)

    Koduru, Srinivas V; Tiwari, Amit K; Hazard, Sprague W; Mahajan, Milind; Ravnic, Dino J


    Background: Improved healthcare and recent breakthroughs in technology have substantially reduced cancer mortality rates worldwide. Recent advancements in next-generation sequencing (NGS) have allowed genomic analysis of the human transcriptome. Now, using NGS we can further look into small non-coding regions of RNAs (sncRNAs) such as microRNAs (miRNAs), Piwi-interacting-RNAs (piRNAs), long non-coding RNAs (lncRNAs), and small nuclear/nucleolar RNAs (sn/snoRNAs) among others. Recent studies looking at sncRNAs indicate their role in important biological processes such as cancer progression and predict their role as biomarkers for disease diagnosis, prognosis, and therapy. Results: In the present study, we data mined publically available small RNA sequencing data from colorectal tissue samples of eight matched patients (benign, tumor, and metastasis) and remapped the data for various small RNA annotations. We identified aberrant expression of 13 miRNAs in tumor and metastasis specimens [tumor vs benign group (19 miRNAs) and metastasis vs benign group (38 miRNAs)] of which five were upregulated, and eight were downregulated, during disease progression. Pathway analysis of aberrantly expressed miRNAs showed that the majority of miRNAs involved in colon cancer were also involved in other cancers. Analysis of piRNAs revealed six to be over-expressed in the tumor vs benign cohort and 24 in the metastasis vs benign group. Only two piRNAs were shared between the two cohorts. Examining other types of small RNAs [sn/snoRNAs, mt_rRNA, miscRNA, nonsense mediated decay (NMD), and rRNAs] identified 15 sncRNAs in the tumor vs benign group and 104 in the metastasis vs benign group, with only four others being commonly expressed. Conclusion: In summary, our comprehensive analysis on publicly available small RNA-seq data identified multiple differentially expressed sncRNAs during colorectal cancer progression at different stages compared to normal colon tissue. We speculate that

  4. Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals (United States)

    Thess, Andreas; Grund, Stefanie; Mui, Barbara L; Hope, Michael J; Baumhof, Patrick; Fotin-Mleczek, Mariola; Schlake, Thomas


    Being a transient carrier of genetic information, mRNA could be a versatile, flexible, and safe means for protein therapies. While recent findings highlight the enormous therapeutic potential of mRNA, evidence that mRNA-based protein therapies are feasible beyond small animals such as mice is still lacking. Previous studies imply that mRNA therapeutics require chemical nucleoside modifications to obtain sufficient protein expression and avoid activation of the innate immune system. Here we show that chemically unmodified mRNA can achieve those goals as well by applying sequence-engineered molecules. Using erythropoietin (EPO) driven production of red blood cells as the biological model, engineered Epo mRNA elicited meaningful physiological responses from mice to nonhuman primates. Even in pigs of about 20 kg in weight, a single adequate dose of engineered mRNA encapsulated in lipid nanoparticles (LNPs) induced high systemic Epo levels and strong physiological effects. Our results demonstrate that sequence-engineered mRNA has the potential to revolutionize human protein therapies. PMID:26050989

  5. Undesired small RNAs originate from an artificial microRNA precursor in transgenic petunia (Petunia hybrida.

    Directory of Open Access Journals (Sweden)

    Yulong Guo

    Full Text Available Although artificial microRNA (amiRNA technology has been used frequently in gene silencing in plants, little research has been devoted to investigating the accuracy of amiRNA precursor processing. In this work, amiRNAchs1 (amiRchs1, based on the Arabidopsis miR319a precursor, was expressed in order to suppress the expression of CHS genes in petunia. The transgenic plants showed the CHS gene-silencing phenotype. A modified 5' RACE technique was used to map small-RNA-directed cleavage sites and to detect processing intermediates of the amiRchs1 precursor. The results showed that the target CHS mRNAs were cut at the expected sites and that the amiRchs1 precursor was processed from loop to base. The accumulation of small RNAs in amiRchs1 transgenic petunia petals was analyzed using the deep-sequencing technique. The results showed that, alongside the accumulation of the desired artificial microRNAs, additional small RNAs that originated from other regions of the amiRNA precursor were also accumulated at high frequency. Some of these had previously been found to be accumulated at low frequency in the products of ath-miR319a precursor processing and some of them were accompanied by 3'-tailing variant. Potential targets of the undesired small RNAs were discovered in petunia and other Solanaceae plants. The findings draw attention to the potential occurrence of undesired target silencing induced by such additional small RNAs when amiRNA technology is used. No appreciable production of secondary small RNAs occurred, despite the fact that amiRchs1 was designed to have perfect complementarity to its CHS-J target. This confirmed that perfect pairing between an amiRNA and its targets is not the trigger for secondary small RNA production. In conjunction with the observation that amiRNAs with perfect complementarity to their target genes show high efficiency and specificity in gene silencing, this finding has an important bearing on future applications of ami

  6. Undesired small RNAs originate from an artificial microRNA precursor in transgenic petunia (Petunia hybrida). (United States)

    Guo, Yulong; Han, Yao; Ma, Jing; Wang, Huiping; Sang, Xianchun; Li, Mingyang


    Although artificial microRNA (amiRNA) technology has been used frequently in gene silencing in plants, little research has been devoted to investigating the accuracy of amiRNA precursor processing. In this work, amiRNAchs1 (amiRchs1), based on the Arabidopsis miR319a precursor, was expressed in order to suppress the expression of CHS genes in petunia. The transgenic plants showed the CHS gene-silencing phenotype. A modified 5' RACE technique was used to map small-RNA-directed cleavage sites and to detect processing intermediates of the amiRchs1 precursor. The results showed that the target CHS mRNAs were cut at the expected sites and that the amiRchs1 precursor was processed from loop to base. The accumulation of small RNAs in amiRchs1 transgenic petunia petals was analyzed using the deep-sequencing technique. The results showed that, alongside the accumulation of the desired artificial microRNAs, additional small RNAs that originated from other regions of the amiRNA precursor were also accumulated at high frequency. Some of these had previously been found to be accumulated at low frequency in the products of ath-miR319a precursor processing and some of them were accompanied by 3'-tailing variant. Potential targets of the undesired small RNAs were discovered in petunia and other Solanaceae plants. The findings draw attention to the potential occurrence of undesired target silencing induced by such additional small RNAs when amiRNA technology is used. No appreciable production of secondary small RNAs occurred, despite the fact that amiRchs1 was designed to have perfect complementarity to its CHS-J target. This confirmed that perfect pairing between an amiRNA and its targets is not the trigger for secondary small RNA production. In conjunction with the observation that amiRNAs with perfect complementarity to their target genes show high efficiency and specificity in gene silencing, this finding has an important bearing on future applications of amiRNAs in gene

  7. RCK: accurate and efficient inference of sequence- and structure-based protein-RNA binding models from RNAcompete data. (United States)

    Orenstein, Yaron; Wang, Yuhao; Berger, Bonnie


    Protein-RNA interactions, which play vital roles in many processes, are mediated through both RNA sequence and structure. CLIP-based methods, which measure protein-RNA binding in vivo, suffer from experimental noise and systematic biases, whereas in vitro experiments capture a clearer signal of protein RNA-binding. Among them, RNAcompete provides binding affinities of a specific protein to more than 240 000 unstructured RNA probes in one experiment. The computational challenge is to infer RNA structure- and sequence-based binding models from these data. The state-of-the-art in sequence models, Deepbind, does not model structural preferences. RNAcontext models both sequence and structure preferences, but is outperformed by GraphProt. Unfortunately, GraphProt cannot detect structural preferences from RNAcompete data due to the unstructured nature of the data, as noted by its developers, nor can it be tractably run on the full RNACompete dataset. We develop RCK, an efficient, scalable algorithm that infers both sequence and structure preferences based on a new k-mer based model. Remarkably, even though RNAcompete data is designed to be unstructured, RCK can still learn structural preferences from it. RCK significantly outperforms both RNAcontext and Deepbind in in vitro binding prediction for 244 RNAcompete experiments. Moreover, RCK is also faster and uses less memory, which enables scalability. While currently on par with existing methods in in vivo binding prediction on a small scale test, we demonstrate that RCK will increasingly benefit from experimentally measured RNA structure profiles as compared to computationally predicted ones. By running RCK on the entire RNAcompete dataset, we generate and provide as a resource a set of protein-RNA structure-based models on an unprecedented scale. Software and models are freely available at Supplementary data are available at Bioinformatics online. © The Author 2016. Published by

  8. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu


    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  9. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons. (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M


    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. Diverse evolutionary trajectories for small RNA biogenesis genes in the oomycete genus Phytophthora

    Directory of Open Access Journals (Sweden)

    Stephanie eBollmann


    Full Text Available Gene regulation by small RNA pathways is ubiquitous among eukaryotes, but little is known about small RNA pathways in the Stramenopile kingdom. Phytophthora, a genus of filamentous oomycetes, contains many devastating plant pathogens, causing multibillion-dollar damage to crops, ornamental plants, and natural environments. The genomes of several oomycetes including Phytophthora species such as the soybean pathogen P. sojae, have been sequenced, allowing evolutionary analysis of small RNA-processing enzymes. This study examined the evolutionary origins of the oomycete small RNA-related genes Dicer-like (DCL, and RNA-dependent RNA polymerase (RDR through broad phylogenetic analyses of the key domains. Two Dicer gene homologs, DCL1 and DCL2, and one RDR homolog were cloned and analyzed from P. sojae. Gene expression analysis revealed only minor changes in transcript levels among different life stages. Oomycete DCL1 homologs clustered with animal and plant Dicer homologs in evolutionary trees, whereas oomycete DCL2 homologs clustered basally to the tree along with Drosha homologs. Phylogenetic analysis of the RDR homologs confirmed a previous study that suggested the last common eukaryote ancestor possessed three RDR homologs, which were selectively retained or lost in later lineages. Our analysis clarifies the position of some Unikont and Chromalveolate RDR lineages within the tree, including oomycete homologs. Finally, we analyzed alterations in the domain structure of oomycete Dicer and RDR homologs, specifically focusing on the proposed domain transfer of the DEAD-box helicase domain from Dicer to RDR. Implications of the oomycete domain structure are discussed, and possible roles of the two oomycete Dicer homologs are proposed.

  11. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. (United States)

    Flores-Jasso, C Fabián; Salomon, William E; Zamore, Phillip D


    Small interfering RNAs (siRNAs) direct Argonaute proteins, the core components of the RNA-induced silencing complex (RISC), to cleave complementary target RNAs. Here, we describe a method to purify active RISC containing a single, unique small RNA guide sequence. We begin by capturing RISC using a complementary 2'-O-methyl oligonucleotide tethered to beads. Unlike other methods that capture RISC but do not allow its recovery, our strategy purifies active, soluble RISC in good yield. The method takes advantage of the finding that RISC partially paired to a target through its siRNA guide dissociates more than 300 times faster than a fully paired siRNA in RISC. We use this strategy to purify fly Ago1- and Ago2-RISC, as well as mouse AGO2-RISC. The method can discriminate among RISCs programmed with different guide strands, making it possible to deplete and recover specific RISC populations. Endogenous microRNA:Argonaute complexes can also be purified from cell lysates. Our method scales readily and takes less than a day to complete.

  12. Goodness-of-fit tests and model diagnostics for negative binomial regression of RNA sequencing data. (United States)

    Mi, Gu; Di, Yanming; Schafer, Daniel W


    This work is about assessing model adequacy for negative binomial (NB) regression, particularly (1) assessing the adequacy of the NB assumption, and (2) assessing the appropriateness of models for NB dispersion parameters. Tools for the first are appropriate for NB regression generally; those for the second are primarily intended for RNA sequencing (RNA-Seq) data analysis. The typically small number of biological samples and large number of genes in RNA-Seq analysis motivate us to address the trade-offs between robustness and statistical power using NB regression models. One widely-used power-saving strategy, for example, is to assume some commonalities of NB dispersion parameters across genes via simple models relating them to mean expression rates, and many such models have been proposed. As RNA-Seq analysis is becoming ever more popular, it is appropriate to make more thorough investigations into power and robustness of the resulting methods, and into practical tools for model assessment. In this article, we propose simulation-based statistical tests and diagnostic graphics to address model adequacy. We provide simulated and real data examples to illustrate that our proposed methods are effective for detecting the misspecification of the NB mean-variance relationship as well as judging the adequacy of fit of several NB dispersion models.

  13. A powerful and flexible approach to the analysis of RNA sequence count data. (United States)

    Zhou, Yi-Hui; Xia, Kai; Wright, Fred A


    A number of penalization and shrinkage approaches have been proposed for the analysis of microarray gene expression data. Similar techniques are now routinely applied to RNA sequence transcriptional count data, although the value of such shrinkage has not been conclusively established. If penalization is desired, the explicit modeling of mean-variance relationships provides a flexible testing regimen that 'borrows' information across genes, while easily incorporating design effects and additional covariates. We describe BBSeq, which incorporates two approaches: (i) a simple beta-binomial generalized linear model, which has not been extensively tested for RNA-Seq data and (ii) an extension of an expression mean-variance modeling approach to RNA-Seq data, involving modeling of the overdispersion as a function of the mean. Our approaches are flexible, allowing for general handling of discrete experimental factors and continuous covariates. We report comparisons with other alternate methods to handle RNA-Seq data. Although penalized methods have advantages for very small sample sizes, the beta-binomial generalized linear model, combined with simple outlier detection and testing approaches, appears to have favorable characteristics in power and flexibility. An R package containing examples and sample datasets is available at; Supplementary data are available at Bioinformatics online.

  14. iSRAP – a one-touch research tool for rapid profiling of small RNA-seq data (United States)

    Quek, Camelia; Jung, Chol-hee; Bellingham, Shayne A.; Lonie, Andrew; Hill, Andrew F.


    Small non-coding RNAs have been significantly recognized as the key modulators in many biological processes, and are emerging as promising biomarkers for several diseases. These RNA species are transcribed in cells and can be packaged in extracellular vesicles, which are small vesicles released from many biotypes, and are involved in intercellular communication. Currently, the advent of next-generation sequencing (NGS) technology for high-throughput profiling has further advanced the biological insights of non-coding RNA on a genome-wide scale and has become the preferred approach for the discovery and quantification of non-coding RNA species. Despite the routine practice of NGS, the processing of large data sets poses difficulty for analysis before conducting downstream experiments. Often, the current analysis tools are designed for specific RNA species, such as microRNA, and are limited in flexibility for modifying parameters for optimization. An analysis tool that allows for maximum control of different software is essential for drawing concrete conclusions for differentially expressed transcripts. Here, we developed a one-touch integrated small RNA analysis pipeline (iSRAP) research tool that is composed of widely used tools for rapid profiling of small RNAs. The performance test of iSRAP using publicly and in-house available data sets shows its ability of comprehensive profiling of small RNAs of various classes, and analysis of differentially expressed small RNAs. iSRAP offers comprehensive analysis of small RNA sequencing data that leverage informed decisions on the downstream analyses of small RNA studies, including extracellular vesicles such as exosomes. PMID:26561006

  15. iSRAP - a one-touch research tool for rapid profiling of small RNA-seq data. (United States)

    Quek, Camelia; Jung, Chol-Hee; Bellingham, Shayne A; Lonie, Andrew; Hill, Andrew F


    Small non-coding RNAs have been significantly recognized as the key modulators in many biological processes, and are emerging as promising biomarkers for several diseases. These RNA species are transcribed in cells and can be packaged in extracellular vesicles, which are small vesicles released from many biotypes, and are involved in intercellular communication. Currently, the advent of next-generation sequencing (NGS) technology for high-throughput profiling has further advanced the biological insights of non-coding RNA on a genome-wide scale and has become the preferred approach for the discovery and quantification of non-coding RNA species. Despite the routine practice of NGS, the processing of large data sets poses difficulty for analysis before conducting downstream experiments. Often, the current analysis tools are designed for specific RNA species, such as microRNA, and are limited in flexibility for modifying parameters for optimization. An analysis tool that allows for maximum control of different software is essential for drawing concrete conclusions for differentially expressed transcripts. Here, we developed a one-touch integrated small RNA analysis pipeline (iSRAP) research tool that is composed of widely used tools for rapid profiling of small RNAs. The performance test of iSRAP using publicly and in-house available data sets shows its ability of comprehensive profiling of small RNAs of various classes, and analysis of differentially expressed small RNAs. iSRAP offers comprehensive analysis of small RNA sequencing data that leverage informed decisions on the downstream analyses of small RNA studies, including extracellular vesicles such as exosomes.

  16. MicroRNA repertoire for functional genome research in tilapia identified by deep sequencing. (United States)

    Yan, Biao; Wang, Zhen-Hua; Zhu, Chang-Dong; Guo, Jin-Tao; Zhao, Jin-Liang


    The Nile tilapia (Oreochromis niloticus; Cichlidae) is an economically important species in aquaculture and occupies a prominent position in the aquaculture industry. MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression involved in diverse biological and metabolic processes. To increase the repertoire of miRNAs characterized in tilapia, we used the Illumina/Solexa sequencing technology to sequence a small RNA library using pooled RNA sample isolated from the different developmental stages of tilapia. Bioinformatic analyses suggest that 197 conserved and 27 novel miRNAs are expressed in tilapia. Sequence alignments indicate that all tested miRNAs and miRNAs* are highly conserved across many species. In addition, we characterized the tissue expression patterns of five miRNAs using real-time quantitative PCR. We found that miR-1/206, miR-7/9, and miR-122 is abundantly expressed in muscle, brain, and liver, respectively, implying a potential role in the regulation of tissue differentiation or the maintenance of tissue identity. Overall, our results expand the number of tilapia miRNAs, and the discovery of miRNAs in tilapia genome contributes to a better understanding the role of miRNAs in regulating diverse biological processes.

  17. Functional specialization of the small interfering RNA pathway in response to virus infection.

    Directory of Open Access Journals (Sweden)

    Joao Trindade Marques

    Full Text Available In Drosophila, post-transcriptional gene silencing occurs when exogenous or endogenous double stranded RNA (dsRNA is processed into small interfering RNAs (siRNAs by Dicer-2 (Dcr-2 in association with a dsRNA-binding protein (dsRBP cofactor called Loquacious (Loqs-PD. siRNAs are then loaded onto Argonaute-2 (Ago2 by the action of Dcr-2 with another dsRBP cofactor called R2D2. Loaded Ago2 executes the destruction of target RNAs that have sequence complementarity to siRNAs. Although Dcr-2, R2D2, and Ago2 are essential for innate antiviral defense, the mechanism of virus-derived siRNA (vsiRNA biogenesis and viral target inhibition remains unclear. Here, we characterize the response mechanism mediated by siRNAs against two different RNA viruses that infect Drosophila. In both cases, we show that vsiRNAs are generated by Dcr-2 processing of dsRNA formed during viral genome replication and, to a lesser extent, viral transcription. These vsiRNAs seem to preferentially target viral polyadenylated RNA to inhibit viral replication. Loqs-PD is completely dispensable for silencing of the viruses, in contrast to its role in silencing endogenous targets. Biogenesis of vsiRNAs is independent of both Loqs-PD and R2D2. R2D2, however, is required for sorting and loading of vsiRNAs onto Ago2 and inhibition of viral RNA expression. Direct injection of viral RNA into Drosophila results in replication that is also independent of Loqs-PD. This suggests that triggering of the antiviral pathway is not related to viral mode of entry but recognition of intrinsic features of virus RNA. Our results indicate the existence of a vsiRNA pathway that is separate from the endogenous siRNA pathway and is specifically triggered by virus RNA. We speculate that this unique framework might be necessary for a prompt and efficient antiviral response.

  18. Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing (United States)

    Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...

  19. BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data. (United States)

    Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun


    It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  20. Selective small-molecule inhibition of an RNA structural element

    Energy Technology Data Exchange (ETDEWEB)

    Howe, John A.; Wang, Hao; Fischmann, Thierry O.; Balibar, Carl J.; Xiao, Li; Galgoci, Andrew M.; Malinverni, Juliana C.; Mayhood, Todd; Villafania, Artjohn; Nahvi, Ali; Murgolo, Nicholas; Barbieri, Christopher M.; Mann, Paul A.; Carr, Donna; Xia, Ellen; Zuck, Paul; Riley, Dan; Painter, Ronald E.; Walker, Scott S.; Sherborne, Brad; de Jesus, Reynalda; Pan, Weidong; Plotkin, Michael A.; Wu, Jin; Rindgen, Diane; Cummings, John; Garlisi, Charles G.; Zhang, Rumin; Sheth, Payal R.; Gill, Charles J.; Tang, Haifeng; Roemer , Terry (Merck)


    Riboswitches are non-coding RNA structures located in messenger RNAs that bind endogenous ligands, such as a specific metabolite or ion, to regulate gene expression. As such, riboswitches serve as a novel, yet largely unexploited, class of emerging drug targets. Demonstrating this potential, however, has proven difficult and is restricted to structurally similar antimetabolites and semi-synthetic analogues of their cognate ligand, thus greatly restricting the chemical space and selectivity sought for such inhibitors. Here we report the discovery and characterization of ribocil, a highly selective chemical modulator of bacterial riboflavin riboswitches, which was identified in a phenotypic screen and acts as a structurally distinct synthetic mimic of the natural ligand, flavin mononucleotide, to repress riboswitch-mediated ribB gene expression and inhibit bacterial cell growth. Our findings indicate that non-coding RNA structural elements may be more broadly targeted by synthetic small molecules than previously expected.

  1. MicroRNA discovery and analysis of pinewood nematode Bursaphelenchus xylophilus by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Qi-Xing Huang

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are considered to be very important in regulating the growth, development, behavior and stress response in animals and plants in post-transcriptional gene regulation. Pinewood nematode, Bursaphelenchus xylophilus, is an important invasive plant parasitic nematode in Asia. To have a comprehensive knowledge about miRNAs of the nematode is necessary for further in-depth study on roles of miRNAs in the ecological adaptation of the invasive species. METHODS AND FINDINGS: Five small RNA libraries were constructed and sequenced by Illumina/Solexa deep-sequencing technology. A total of 810 miRNA candidates (49 conserved and 761 novel were predicted by a computational pipeline, of which 57 miRNAs (20 conserved and 37 novel encoded by 53 miRNA precursors were identified by experimental methods. Ten novel miRNAs were considered to be species-specific miRNAs of B. xylophilus. Comparison of expression profiles of miRNAs in the five small RNA libraries showed that many miRNAs exhibited obviously different expression levels in the third-stage dispersal juvenile and at a cold-stressed status. Most of the miRNAs exhibited obviously down-regulated expression in the dispersal stage. But differences among the three geographic libraries were not prominent. A total of 979 genes were predicted to be targets of these authentic miRNAs. Among them, seven heat shock protein genes were targeted by 14 miRNAs, and six FMRFamide-like neuropeptides genes were targeted by 17 miRNAs. A real-time quantitative polymerase chain reaction was used to quantify the mRNA expression levels of target genes. CONCLUSIONS: Basing on the fact that a negative correlation existed between the expression profiles of miRNAs and the mRNA expression profiles of their target genes (hsp, flp by comparing those of the nematodes at a cold stressed status and a normal status, we suggested that miRNAs might participate in ecological adaptation and behavior regulation of the

  2. RNA sequencing of the exercise transcriptome in equine athletes.

    Directory of Open Access Journals (Sweden)

    Stefano Capomaccio

    Full Text Available The horse is an optimal model organism for studying the genomic response to exercise-induced stress, due to its natural aptitude for athletic performance and the relative homogeneity of its genetic and environmental backgrounds. Here, we applied RNA-sequencing analysis through the use of SOLiD technology in an experimental framework centered on exercise-induced stress during endurance races in equine athletes. We monitored the transcriptional landscape by comparing gene expression levels between animals at rest and after competition. Overall, we observed a shift from coding to non-coding regions, suggesting that the stress response involves the differential expression of not annotated regions. Notably, we observed significant post-race increases of reads that correspond to repeats, especially the intergenic and intronic L1 and L2 transposable elements. We also observed increased expression of the antisense strands compared to the sense strands in intronic and regulatory regions (1 kb up- and downstream of the genes, suggesting that antisense transcription could be one of the main mechanisms for transposon regulation in the horse under stress conditions. We identified a large number of transcripts corresponding to intergenic and intronic regions putatively associated with new transcriptional elements. Gene expression and pathway analysis allowed us to identify several biological processes and molecular functions that may be involved with exercise-induced stress. Ontology clustering reflected mechanisms that are already known to be stress activated (e.g., chemokine-type cytokines, Toll-like receptors, and kinases, as well as "nucleic acid binding" and "signal transduction activity" functions. There was also a general and transient decrease in the global rates of protein synthesis, which would be expected after strenuous global stress. In sum, our network analysis points toward the involvement of specific gene clusters in equine exercise

  3. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  4. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing. (United States)

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C


    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  5. Improved annotation of 3' untranslated regions and complex loci by combination of strand-specific direct RNA sequencing, RNA-Seq and ESTs.

    Directory of Open Access Journals (Sweden)

    Nicholas J Schurch

    Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.


    Jeyapalan, Jennie N.; Jones, Tania A.; Tatevossian, Ruth G.; Qaddoumi, Ibrahim; Ellison, David W.; Sheer, Denise


    INTRODUCTION: MicroRNAs regulate gene expression by targeting mRNAs for translational repression or degradation at the post-transcriptional level. In paediatric low-grade gliomas a few key genetic mutations have been identified, including BRAF fusions, FGFR1 duplications and MYB rearrangements. Our aim in the current study is to profile aberrant microRNA expression in paediatric low-grade gliomas and determine the role of epigenetic changes in the aetiology and behaviour of these tumours. METHOD: MicroRNA profiling of tumour samples (6 pilocytic, 2 diffuse, 2 pilomyxoid astrocytomas) and normal brain controls (4 adult normal brain samples and a primary glial progenitor cell-line) was performed using small RNA sequencing. Bioinformatic analysis included sequence alignment, analysis of the number of reads (CPM, counts per million) and differential expression. RESULTS: Sequence alignment identified 695 microRNAs, whose expression was compared in tumours v. normal brain. PCA and hierarchical clustering showed separate groups for tumours and normal brain. Computational analysis identified approximately 400 differentially expressed microRNAs in the tumours compared to matched location controls. Our findings will then be validated and integrated with extensive genetic and epigenetic information we have previously obtained for the full tumour cohort. CONCLUSION: We have identified microRNAs that are differentially expressed in paediatric low-grade gliomas. As microRNAs are known to target genes involved in the initiation and progression of cancer, they provide critical information on tumour pathogenesis and are an important class of biomarkers.

  7. Messenger RNA biomarker signatures for forensic body fluid identification revealed by targeted RNA sequencing. (United States)

    Hanson, E; Ingold, S; Haas, C; Ballantyne, J


    The recovery of a DNA profile from the perpetrator or victim in criminal investigations can provide valuable 'source level' information for investigators. However, a DNA profile does not reveal the circumstances by which biological material was transferred. Some contextual information can be obtained by a determination of the tissue or fluid source of origin of the biological material as it is potentially indicative of some behavioral activity on behalf of the individual that resulted in its transfer from the body. Here, we sought to improve upon established RNA based methods for body fluid identification by developing a targeted multiplexed next generation mRNA sequencing assay comprising a panel of approximately equal sized gene amplicons. The multiplexed biomarker panel includes several highly specific gene targets with the necessary specificity to definitively identify most forensically relevant biological fluids and tissues (blood, semen, saliva, vaginal secretions, menstrual blood and skin). In developing the biomarker panel we evaluated 66 gene targets, with a progressive iteration of testing target combinations that exhibited optimal sensitivity and specificity using a training set of forensically relevant body fluid samples. The current assay comprises 33 targets: 6 blood, 6 semen, 6 saliva, 4 vaginal secretions, 5 menstrual blood and 6 skin markers. We demonstrate the sensitivity and specificity of the assay and the ability to identify body fluids in single source and admixed stains. A 16 sample blind test was carried out by one lab with samples provided by the other participating lab. The blinded lab correctly identified the body fluids present in 15 of the samples with the major component identified in the 16th. Various classification methods are being investigated to permit inference of the body fluid/tissue in dried physiological stains. These include the percentage of reads in a sample that are due to each of the 6 tissues/body fluids tested and

  8. RStrucFam: a web server to associate structure and cognate RNA for RNA-binding proteins from sequence information. (United States)

    Ghosh, Pritha; Mathew, Oommen K; Sowdhamini, Ramanathan


    RNA-binding proteins (RBPs) interact with their cognate RNA(s) to form large biomolecular assemblies. They are versatile in their functionality and are involved in a myriad of processes inside the cell. RBPs with similar structural features and common biological functions are grouped together into families and superfamilies. It will be useful to obtain an early understanding and association of RNA-binding property of sequences of gene products. Here, we report a web server, RStrucFam, to predict the structure, type of cognate RNA(s) and function(s) of proteins, where possible, from mere sequence information. The web server employs Hidden Markov Model scan (hmmscan) to enable association to a back-end database of structural and sequence families. The database (HMMRBP) comprises of 437 HMMs of RBP families of known structure that have been generated using structure-based sequence alignments and 746 sequence-centric RBP family HMMs. The input protein sequence is associated with structural or sequence domain families, if structure or sequence signatures exist. In case of association of the protein with a family of known structures, output features like, multiple structure-based sequence alignment (MSSA) of the query with all others members of that family is provided. Further, cognate RNA partner(s) for that protein, Gene Ontology (GO) annotations, if any and a homology model of the protein can be obtained. The users can also browse through the database for details pertaining to each family, protein or RNA and their related information based on keyword search or RNA motif search. RStrucFam is a web server that exploits structurally conserved features of RBPs, derived from known family members and imprinted in mathematical profiles, to predict putative RBPs from sequence information. Proteins that fail to associate with such structure-centric families are further queried against the sequence-centric RBP family HMMs in the HMMRBP database. Further, all other essential

  9. Deep sequencing of RNA from ancient maize kernels

    DEFF Research Database (Denmark)

    Fordyce, Sarah Louise; Avila Arcos, Maria del Carmen; Rasmussen, Morten


    The characterization of biomolecules from ancient samples can shed otherwise unobtainable insights into the past. Despite the fundamental role of transcriptomal change in evolution, the potential of ancient RNA remains unexploited - perhaps due to dogma associated with the fragility of RNA. We hy...... maize kernels. The results suggest that ancient seed transcriptomics may offer a powerful new tool with which to study plant domestication....

  10. Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing. (United States)

    Gangras, Pooja; Dayeh, Daniel M; Mabin, Justin W; Nakanishi, Kotaro; Singh, Guramrit


    Argonaute proteins (AGOs) are loaded with small RNAs as guides to recognize target mRNAs. Since the target specificity heavily depends on the base complementarity between two strands, it is important to identify small guide and long target RNAs bound to AGOs. For this purpose, next-generation sequencing (NGS) technologies have extended our appreciation truly to the nucleotide level. However, the identification of RNAs via NGS from scarce RNA samples remains a challenge. Further, most commercial and published methods are compatible with either small RNAs or long RNAs, but are not equally applicable to both. Therefore, a single method that yields quantitative, bias-free NGS libraries to identify small and long RNAs from low levels of input will be of wide interest. Here, we introduce such a procedure that is based on several modifications of two published protocols and allows robust, sensitive, and reproducible cloning and sequencing of small amounts of RNAs of variable lengths. The method was applied to the identification of small RNAs bound to a purified eukaryotic AGO. Following ligation of a DNA adapter to RNA 3'-end, the key feature of this method is to use the adapter for priming reverse transcription (RT) wherein biotinylated deoxyribonucleotides specifically incorporated into the extended complementary DNA. Such RT products are enriched on streptavidin beads, circularized while immobilized on beads and directly used for PCR amplification. We provide a stepwise guide to generate RNA-Seq libraries, their purification, quantification, validation, and preparation for next-generation sequencing. We also provide basic steps in post-NGS data analyses using Galaxy, an open-source, web-based platform.

  11. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  12. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations. (United States)

    Reid-Bayliss, Kate S; Loeb, Lawrence A


    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  13. Common 5S rRNA variants are likely to be accepted in many sequence contexts (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.


    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  14. A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization. (United States)

    Fossé, P; Motté, N; Roumier, A; Gabus, C; Muriaux, D; Darlix, J L; Paoletti, J


    Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5'-ends. Recently, two models have been proposed for RNA dimer formation on the basis of results obtained in vitro with human immunodeficiency virus type 1 RNA and Moloney murine leukemia virus RNA. It was first proposed that viral RNA dimerizes by forming an interstrand quadruple helix with purine tetrads. The second model postulates that RNA dimerization is initiated by a loop-loop interaction between the two RNA molecules. In order to better characterize the dimerization process of retroviral genomic RNA, we analyzed the in vitro dimerization of avian sarcoma-leukosis virus (ASLV) RNA using different transcripts. We determined the requirements for heterodimer formation, the thermal dissociation of RNA dimers, and the influence of antisense DNA oligonucleotides on dimer formation. Our results strongly suggest that purine tetrads are not involved in dimer formation. Data show that an autocomplementary sequence located upstream from the splice donor site and within a major packaging signal plays a crucial role in ASLV RNA dimer formation in vitro. This sequence is able to form a stem-loop structure, and phylogenetic analysis reveals that it is conserved in 28 different avian sarcoma and leukosis viruses. These results suggest that dimerization of ASLV RNA is initiated by a loop-loop interaction between two RNA molecules and provide an additional argument for the ubiquity of the dimerization process via loop-loop interaction.

  15. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2. (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J


    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  16. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses

    Directory of Open Access Journals (Sweden)

    Hironobu Yanagisawa


    Full Text Available The presence of high molecular weight double-stranded RNA (dsRNA within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV, a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.

  17. 3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing. (United States)

    Goldfarb, Katherine C; Cech, Thomas R


    Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.

  18. 3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing (United States)


    Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768

  19. miRBase: integrating microRNA annotation and deep-sequencing data. (United States)

    Kozomara, Ana; Griffiths-Jones, Sam


    miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at:

  20. Near-Complete Genome Sequence of a Novel Single-Stranded RNA Virus Discovered in Indoor Air. (United States)

    Rosario, Karyna; Fierer, Noah; Breitbart, Mya


    Viral metagenomic analysis of heating, ventilation, and air conditioning (HVAC) filters recovered the near-complete genome sequence of a novel virus, named HVAC-associated R NA v irus 1 (HVAC-RV1). The HVAC-RV1 genome is most similar to those of picorna-like viruses identified in arthropods but encodes a small domain observed only in negative-sense single-stranded RNA viruses. Copyright © 2018 Rosario et al.

  1. smallWig: parallel compression of RNA-seq WIG files. (United States)

    Wang, Zhiying; Weissman, Tsachy; Milenkovic, Olgica


    We developed a new lossless compression method for WIG data, named smallWig, offering the best known compression rates for RNA-seq data and featuring random access functionalities that enable visualization, summary statistics analysis and fast queries from the compressed files. Our approach results in order of magnitude improvements compared with bigWig and ensures compression rates only a fraction of those produced by cWig. The key features of the smallWig algorithm are statistical data analysis and a combination of source coding methods that ensure high flexibility and make the algorithm suitable for different applications. Furthermore, for general-purpose file compression, the compression rate of smallWig approaches the empirical entropy of the tested WIG data. For compression with random query features, smallWig uses a simple block-based compression scheme that introduces only a minor overhead in the compression rate. For archival or storage space-sensitive applications, the method relies on context mixing techniques that lead to further improvements of the compression rate. Implementations of smallWig can be executed in parallel on different sets of chromosomes using multiple processors, thereby enabling desirable scaling for future transcriptome Big Data platforms. The development of next-generation sequencing technologies has led to a dramatic decrease in the cost of DNA/RNA sequencing and expression profiling. RNA-seq has emerged as an important and inexpensive technology that provides information about whole transcriptomes of various species and organisms, as well as different organs and cellular communities. The vast volume of data generated by RNA-seq experiments has significantly increased data storage costs and communication bandwidth requirements. Current compression tools for RNA-seq data such as bigWig and cWig either use general-purpose compressors (gzip) or suboptimal compression schemes that leave significant room for improvement. To substantiate

  2. Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud.

    Directory of Open Access Journals (Sweden)

    Malachi Griffith


    Full Text Available Massively parallel RNA sequencing (RNA-seq has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at

  3. [Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer]. (United States)

    FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong


    To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (Ppathways may lead to new targeted therapies for non-small cell lung cancer.

  4. RNA sequencing atopic dermatitis transcriptome profiling provides insights into novel disease mechanisms with potential therapeutic implications

    DEFF Research Database (Denmark)

    Suárez-Fariñas, Mayte; Ungar, Benjamin; Correa da Rosa, Joel


    . These limitations might be lessened with next-generation RNA sequencing (RNA-seq). Objective: We sought to define the lesional AD transcriptome using RNA-seq and compare it using microarrays performed on the same cohort. Methods: RNA-seq and microarrays were performed to identify differentially expressed genes...... RNA-seq showed somewhat better agreement with RT-PCR (intraclass correlation coefficient, 0.57 and 0.70 for microarrays and RNA-seq vs RT-PCR, respectively), bias was not eliminated. Among genes uniquely identified by using RNA-seq were triggering receptor expressed on myeloid cells 1 (TREM-1......) signaling (eg, CCL2, CCL3, and single immunoglobulin domain IL1R1 related [SIGIRR]) and IL-36 isoform genes. TREM-1 is a surface receptor implicated in innate and adaptive immunity that amplifies infection-related inflammation. Conclusions: This is the first report of a lesional AD phenotype using RNA...

  5. Molecular Mechanisms of Mild and Severe Pneumonia: Insights from RNA Sequencing. (United States)

    Huang, Sai; Feng, Cong; Chen, Li; Huang, Zhi; Zhou, Xuan; Li, Bei; Wang, Li-Li; Chen, Wei; Lv, Fa-Qin; Li, Tan-Shi


    BACKGROUND This study aimed to uncover the molecular mechanisms underlying mild and severe pneumonia by use of mRNA sequencing (RNA-seq). MATERIAL AND METHODS RNA was extracted from the peripheral blood of patients with mild pneumonia, severe pneumonia, and healthy controls. Sequencing was performed on the HiSeq4000 platform. After filtering, clean reads were mapped to the human reference genome hg19. Differentially expressed genes (DEGs) were identified between the control group and the mild or severe group. A transcription factor-gene network was constructed for each group. Biological process (BP) terms enriched by DEGs in the network were analyzed and these genes were also mapped to the Connectivity map to search for small-molecule drugs. RESULTS A total of 199 and 560 DEGs were identified from the mild group and severe group, respectively. A transcription factor-gene network consisting of 215 nodes and another network consisting of 451 nodes were constructed in the mild group and severe group, respectively, and 54 DEGs (e.g., S100A9 and S100A12) were found to be common, with consistent differential expression changes in the 2 groups. Genes in the transcription factor-gene network for the mild group were mainly enriched in 13 BP terms, especially defense and inflammatory response (e.g., S100A8) and spermatogenesis, while the top BP terms enriched by genes in the severe group include response to oxidative stress (CCL5), wound healing, and regulation of cell differentiation (CCL5), and of the cellular protein metabolic process. CONCLUSIONS S100A9 and S100A12 may have a role in the pathogenesis of pneumonia: S100A9 and CXCL1 may contribute solely in mild pneumonia, and CCL5 and CXCL11 may contribute in severe pneumonia.

  6. Comprehensive microRNA profiling in B-cells of human centenarians by massively parallel sequencing

    Directory of Open Access Journals (Sweden)

    Gombar Saurabh


    Full Text Available Abstract Background MicroRNAs (miRNAs are small, non-coding RNAs that regulate gene expression and play a critical role in development, homeostasis, and disease. Despite their demonstrated roles in age-associated pathologies, little is known about the role of miRNAs in human aging and longevity. Results We employed massively parallel sequencing technology to identify miRNAs expressed in B-cells from Ashkenazi Jewish centenarians, i.e., those living to a hundred and a human model of exceptional longevity, and younger controls without a family history of longevity. With data from 26.7 million reads comprising 9.4 × 108 bp from 3 centenarian and 3 control individuals, we discovered a total of 276 known miRNAs and 8 unknown miRNAs ranging several orders of magnitude in expression levels, a typical characteristics of saturated miRNA-sequencing. A total of 22 miRNAs were found to be significantly upregulated, with only 2 miRNAs downregulated, in centenarians as compared to controls. Gene Ontology analysis of the predicted and validated targets of the 24 differentially expressed miRNAs indicated enrichment of functional pathways involved in cell metabolism, cell cycle, cell signaling, and cell differentiation. A cross sectional expression analysis of the differentially expressed miRNAs in B-cells from Ashkenazi Jewish individuals between the 50th and 100th years of age indicated that expression levels of miR-363* declined significantly with age. Centenarians, however, maintained the youthful expression level. This result suggests that miR-363* may be a candidate longevity-associated miRNA. Conclusion Our comprehensive miRNA data provide a resource for further studies to identify genetic pathways associated with aging and longevity in humans.

  7. Analysis of microRNA profile of Anopheles sinensis by deep sequencing and bioinformatic approaches. (United States)

    Feng, Xinyu; Zhou, Xiaojian; Zhou, Shuisen; Wang, Jingwen; Hu, Wei


    microRNAs (miRNAs) are small non-coding RNAs widely identified in many mosquitoes. They are reported to play important roles in development, differentiation and innate immunity. However, miRNAs in Anopheles sinensis, one of the Chinese malaria mosquitoes, remain largely unknown. We investigated the global miRNA expression profile of An. sinensis using Illumina Hiseq 2000 sequencing. Meanwhile, we applied a bioinformatic approach to identify potential miRNAs in An. sinensis. The identified miRNA profiles were compared and analyzed by two approaches. The selected miRNAs from the sequencing result and the bioinformatic approach were confirmed with qRT-PCR. Moreover, target prediction, GO annotation and pathway analysis were carried out to understand the role of miRNAs in An. sinensis. We identified 49 conserved miRNAs and 12 novel miRNAs by next-generation high-throughput sequencing technology. In contrast, 43 miRNAs were predicted by the bioinformatic approach, of which two were assigned as novel. Comparative analysis of miRNA profiles by two approaches showed that 21 miRNAs were shared between them. Twelve novel miRNAs did not match any known miRNAs of any organism, indicating that they are possibly species-specific. Forty miRNAs were found in many mosquito species, indicating that these miRNAs are evolutionally conserved and may have critical roles in the process of life. Both the selected known and novel miRNAs (asi-miR-281, asi-miR-184, asi-miR-14, asi-miR-nov5, asi-miR-nov4, asi-miR-9383, and asi-miR-2a) could be detected by quantitative real-time PCR (qRT-PCR) in the sequenced sample, and the expression patterns of these miRNAs measured by qRT-PCR were in concordance with the original miRNA sequencing data. The predicted targets for the known and the novel miRNAs covered many important biological roles and pathways indicating the diversity of miRNA functions. We also found 21 conserved miRNAs and eight counterparts of target immune pathway genes in An. sinensis

  8. Sample size calculation while controlling false discovery rate for differential expression analysis with RNA-sequencing experiments. (United States)

    Bi, Ran; Liu, Peng


    RNA-Sequencing (RNA-seq) experiments have been popularly applied to transcriptome studies in recent years. Such experiments are still relatively costly. As a result, RNA-seq experiments often employ a small number of replicates. Power analysis and sample size calculation are challenging in the context of differential expression analysis with RNA-seq data. One challenge is that there are no closed-form formulae to calculate power for the popularly applied tests for differential expression analysis. In addition, false discovery rate (FDR), instead of family-wise type I error rate, is controlled for the multiple testing error in RNA-seq data analysis. So far, there are very few proposals on sample size calculation for RNA-seq experiments. In this paper, we propose a procedure for sample size calculation while controlling FDR for RNA-seq experimental design. Our procedure is based on the weighted linear model analysis facilitated by the voom method which has been shown to have competitive performance in terms of power and FDR control for RNA-seq differential expression analysis. We derive a method that approximates the average power across the differentially expressed genes, and then calculate the sample size to achieve a desired average power while controlling FDR. Simulation results demonstrate that the actual power of several popularly applied tests for differential expression is achieved and is close to the desired power for RNA-seq data with sample size calculated based on our method. Our proposed method provides an efficient algorithm to calculate sample size while controlling FDR for RNA-seq experimental design. We also provide an R package ssizeRNA that implements our proposed method and can be downloaded from the Comprehensive R Archive Network ( ).

  9. MicroRNA sequence motifs reveal asymmetry between the stem arms

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Havgaard, Jakob Hull; Ensterö, M.


    The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature miRNAs in their gen......The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature mi...

  10. Development and Mechanism of Small Activating RNA Targeting CEBPA, a Novel Therapeutic in Clinical Trials for Liver Cancer. (United States)

    Voutila, Jon; Reebye, Vikash; Roberts, Thomas C; Protopapa, Pantelitsa; Andrikakou, Pinelopi; Blakey, David C; Habib, Robert; Huber, Hans; Saetrom, Pal; Rossi, John J; Habib, Nagy A


    Small activating RNAs (saRNAs) are short double-stranded oligonucleotides that selectively increase gene transcription. Here, we describe the development of an saRNA that upregulates the transcription factor CCATT/enhancer binding protein alpha (CEBPA), investigate its mode of action, and describe its development into a clinical candidate. A bioinformatically directed nucleotide walk around the CEBPA gene identified an saRNA sequence that upregulates CEBPA mRNA 2.5-fold in human hepatocellular carcinoma cells. A nuclear run-on assay confirmed that this upregulation is a transcriptionally driven process. Mechanistic experiments demonstrate that Argonaute-2 (Ago2) is required for saRNA activity, with the guide strand of the saRNA shown to be associated with Ago2 and localized at the CEBPA genomic locus using RNA chromatin immunoprecipitation (ChIP) assays. The data support a sequence-specific on-target saRNA activity that leads to enhanced CEBPA mRNA transcription. Chemical modifications were introduced in the saRNA duplex to prevent activation of the innate immunity. This modified saRNA retains activation of CEBPA mRNA and downstream targets and inhibits growth of liver cancer cell lines in vitro. This novel drug has been encapsulated in a liposomal formulation for liver delivery, is currently in a phase I clinical trial for patients with liver cancer, and represents the first human study of an saRNA therapeutic. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo

    NARCIS (Netherlands)

    Mook, Olaf R.; Baas, Frank; de Wissel, Marit B.; Fluiter, Kees


    RNA interference has become widely used as an experimental tool to study gene function. In addition, small interfering RNA (siRNA) may have great potential for the treatment of diseases. Recently, it was shown that siRNA can be used to mediate gene silencing in mouse models. Locally administered

  12. Molecular-Sized DNA or RNA Sequencing Machine | NCI Technology Transfer Center | TTC (United States)

    The National Cancer Institute's Gene Regulation and Chromosome Biology Laboratory is seeking statements of capability or interest from parties interested in collaborative research to co-develop a molecular-sized DNA or RNA sequencing machine.

  13. Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer (United States)


    AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . PRINCIPAL INVESTIGATOR...TITLE AND SUBTITLE Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . 5a. CONTRACT NUMBER 5b. GRANT NUMBER GRANT11489...institutional, NIH-funded study of genetic and epigenetic alterations of pre-invasive DCIS that did or did not progress to invasive breast cancer , with an

  14. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing


    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li


    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resoluti...

  15. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

    DEFF Research Database (Denmark)

    Nielsen, M; Hansen, J H; Hedegaard, J


    levels of 212 annotated miRNA genes, thereby providing a thorough account of the miRNA transcriptome in porcine muscle tissue. The expression levels displayed a very large range, as reflected by the number of sequence reads, which varied from single counts for rare miRNAs to several million reads...

  16. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E


    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  17. Sex chromosomes and germline transcriptomics explored by single-cell sequencing and RNA-tomography

    NARCIS (Netherlands)

    Vértesy, Ábel


    In our study of germ cell differentiation, we applied two recently developed technologies on the germline of various model organisms: single-cell mRNA sequencing and RNA-tomography. For the first time we could look at gene expression with such a high resolution, and this led us to discover the

  18. Body fluid identification of blood, saliva and semen using second generation sequencing of micro-RNA

    DEFF Research Database (Denmark)

    Petersen, Christel H.; Hjort, Benjamin Benn; Tvedebrink, Torben


    We report a new second generation sequencing method for identification micro-RNA (miRNA) that can be used to identify body fluids and tissues. Principal component analysis of 10 miRNAs with high expression in 16 samples of blood, saliva and semen showed clear differences in the expression of mi...

  19. Deep RNA Sequencing of the Skeletal Muscle Transcriptome in Swimming Fish

    NARCIS (Netherlands)

    Palstra, A.P.; Beltran, S.; Burgerhout, E.; Brittijn, S.A.; Magnoni, L.J.; Henkel, C.V.; Jansen, A.; Thillart, G.E.E.J.M.; Spaink, H.P.; Planas, J.V.


    Deep RNA sequencing (RNA-seq) was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss) with the specific objective to identify expressed genes and quantify the transcriptomic effects of

  20. Accurate identification of RNA editing sites from primitive sequence with deep neural networks. (United States)

    Ouyang, Zhangyi; Liu, Feng; Zhao, Chenghui; Ren, Chao; An, Gaole; Mei, Chuan; Bo, Xiaochen; Shu, Wenjie


    RNA editing is a post-transcriptional RNA sequence alteration. Current methods have identified editing sites and facilitated research but require sufficient genomic annotations and prior-knowledge-based filtering steps, resulting in a cumbersome, time-consuming identification process. Moreover, these methods have limited generalizability and applicability in species with insufficient genomic annotations or in conditions of limited prior knowledge. We developed DeepRed, a deep learning-based method that identifies RNA editing from primitive RNA sequences without prior-knowledge-based filtering steps or genomic annotations. DeepRed achieved 98.1% and 97.9% area under the curve (AUC) in training and test sets, respectively. We further validated DeepRed using experimentally verified U87 cell RNA-seq data, achieving 97.9% positive predictive value (PPV). We demonstrated that DeepRed offers better prediction accuracy and computational efficiency than current methods with large-scale, mass RNA-seq data. We used DeepRed to assess the impact of multiple factors on editing identification with RNA-seq data from the Association of Biomolecular Resource Facilities and Sequencing Quality Control projects. We explored developmental RNA editing pattern changes during human early embryogenesis and evolutionary patterns in Drosophila species and the primate lineage using DeepRed. Our work illustrates DeepRed's state-of-the-art performance; it may decipher the hidden principles behind RNA editing, making editing detection convenient and effective.

  1. A tale of two sequences: microRNA-target chimeric reads. (United States)

    Broughton, James P; Pasquinelli, Amy E


    In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

  2. Unusual loop-sequence flexibility of the proximal RNA replication element in EMCV.

    Directory of Open Access Journals (Sweden)

    Jan Zoll

    Full Text Available Picornaviruses contain stable RNA structures at the 5' and 3' ends of the RNA genome, OriL and OriR involved in viral RNA replication. The OriL RNA element found at the 5' end of the enterovirus genome folds into a cloverleaf-like configuration. In vivo SELEX experiments revealed that functioning of the poliovirus cloverleaf depends on a specific structure in this RNA element. Little is known about the OriL of cardioviruses. Here, we investigated structural aspects and requirements of the apical loop of proximal stem-loop SL-A of mengovirus, a strain of EMCV. Using NMR spectroscopy, we showed that the mengovirus SL-A apical loop consists of an octaloop. In vivo SELEX experiments demonstrated that a large number of random sequences are tolerated in the apical octaloop that support virus replication. Mutants in which the SL-A loop size and the length of the upper part of the stem were varied showed that both stem-length and stability of the octaloop are important determinants for viral RNA replication and virus reproduction. Together, these data show that stem-loop A plays an important role in virus replication. The high degree of sequence flexibility and the lack of selective pressure on the octaloop argue against a role in sequence specific RNA-protein or RNA-RNA interactions in which octaloop nucleotides are involved.

  3. "Transcriptomics": molecular diagnosis of inborn errors of metabolism via RNA-sequencing. (United States)

    Kremer, Laura S; Wortmann, Saskia B; Prokisch, Holger


    Exome wide sequencing techniques have revolutionized molecular diagnostics in patients with suspected inborn errors of metabolism or neuromuscular disorders. However, the diagnostic yield of 25-60% still leaves a large fraction of individuals without a diagnosis. This indicates a causative role for non-exonic regulatory variants not covered by whole exome sequencing. Here we review how systematic RNA-sequencing analysis (RNA-seq, "transcriptomics") lead to a molecular diagnosis in 10-35% of patients in whom whole exome sequencing failed to do so. Importantly, RNA-sequencing based discoveries cannot only guide molecular diagnosis but might also unravel therapeutic intervention points such as antisense oligonucleotide treatment for splicing defects as recently reported for spinal muscular atrophy.

  4. High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA. (United States)

    Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M


    Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Sequence analysis of mitochondrial 16S ribosomal RNA gene ...

    Indian Academy of Sciences (India)


    For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. ... been widely used for phylogenetic studies and sequence differences in ... In order to fill up the internal gap, a new set.

  6. Divergent homologs of the predicted small RNA BpCand697 in Burkholderia spp. (United States)

    Damiri, Nadzirah; Mohd-Padil, Hirzahida; Firdaus-Raih, Mohd


    The small RNA (sRNA) gene candidate, BpCand697 was previously reported to be unique to Burkholderia spp. and is encoded at 3' non-coding region of a putative AraC family transcription regulator gene. This study demonstrates the conservation of BpCand697 sequence across 32 Burkholderia spp. including B. pseudomallei, B. mallei, B. thailandensis and Burkholderia sp. by integrating both sequence homology and secondary structural analyses of BpCand697 within the dataset. The divergent sequence of BpCand697 was also used as a discriminatory power in clustering the dataset according to the potential virulence of Burkholderia spp., showing that B. thailandensis was clearly secluded from the virulent cluster of B. pseudomallei and B. mallei. Finally, the differential co-transcript expression of BpCand697 and its flanking gene, bpsl2391 was detected in Burkholderia pseudomallei D286 after grown under two different culture conditions using nutrient-rich and minimal media. It is hypothesized that the differential expression of BpCand697-bpsl2391 co-transcript between the two standard prepared media might correlate with nutrient availability in the culture media, suggesting that the physical co-localization of BpCand697 in B. pseudomallei D286 might be directly or indirectly involved with the transcript regulation of bpsl2391 under the selected in vitro culture conditions.

  7. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  8. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado


    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.; Navas-Castillo, Jesús


    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV).

  9. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado (United States)

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.


    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  10. microRNA Biomarker Discovery and High-Throughput DNA Sequencing Are Possible Using Long-term Archived Serum Samples. (United States)

    Rounge, Trine B; Lauritzen, Marianne; Langseth, Hilde; Enerly, Espen; Lyle, Robert; Gislefoss, Randi E


    The impacts of long-term storage and varying preanalytical factors on the quality and quantity of DNA and miRNA from archived serum have not been fully assessed. Preanalytical and analytical variations and degradation may introduce bias in representation of DNA and miRNA and may result in loss or corruption of quantitative data. We have evaluated DNA and miRNA quantity, quality, and variability in samples stored up to 40 years using one of the oldest prospective serum collections in the world, the Janus Serumbank, a biorepository dedicated to cancer research. miRNAs are present and stable in archived serum samples frozen at -25°C for at least 40 years. Long-time storage did not reduce miRNA yields; however, varying preanalytical conditions had a significant effect and should be taken into consideration during project design. Of note, 500 μL serum yielded sufficient miRNA for qPCR and small RNA sequencing and on average 650 unique miRNAs were detected in samples from presumably healthy donors. Of note, 500 μL serum yielded sufficient DNA for whole-genome sequencing and subsequent SNP calling, giving a uniform representation of the genomes. DNA and miRNA are stable during long-term storage, making large prospectively collected serum repositories an invaluable source for miRNA and DNA biomarker discovery. Large-scale biomarker studies with long follow-up time are possible utilizing biorepositories with archived serum and state-of-the-art technology. ©2015 American Association for Cancer Research.

  11. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Directory of Open Access Journals (Sweden)

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  12. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus. (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H


    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  13. ISVASE: identification of sequence variant associated with splicing event using RNA-seq data. (United States)

    Aljohi, Hasan Awad; Liu, Wanfei; Lin, Qiang; Yu, Jun; Hu, Songnian


    Exon recognition and splicing precisely and efficiently by spliceosome is the key to generate mature mRNAs. About one third or a half of disease-related mutations affect RNA splicing. Software PVAAS has been developed to identify variants associated with aberrant splicing by directly using RNA-seq data. However, it bases on the assumption that annotated splicing site is normal splicing, which is not true in fact. We develop the ISVASE, a tool for specifically identifying sequence variants associated with splicing events (SVASE) by using RNA-seq data. Comparing with PVAAS, our tool has several advantages, such as multi-pass stringent rule-dependent filters and statistical filters, only using split-reads, independent sequence variant identification in each part of splicing (junction), sequence variant detection for both of known and novel splicing event, additional exon-exon junction shift event detection if known splicing events provided, splicing signal evaluation, known DNA mutation and/or RNA editing data supported, higher precision and consistency, and short running time. Using a realistic RNA-seq dataset, we performed a case study to illustrate the functionality and effectiveness of our method. Moreover, the output of SVASEs can be used for downstream analysis such as splicing regulatory element study and sequence variant functional analysis. ISVASE is useful for researchers interested in sequence variants (DNA mutation and/or RNA editing) associated with splicing events. The package is freely available at .

  14. Application of small RNA technology for improved control of parasitic helminths. (United States)

    Britton, Collette; Winter, Alan D; Marks, Neil D; Gu, Henry; McNeilly, Tom N; Gillan, Victoria; Devaney, Eileen


    Over the last decade microRNAs (miRNAs) and small interfering RNAs (siRNAs) have emerged as important regulators of post-transcriptional gene expression. miRNAs are short, non-coding RNAs that regulate a variety of processes including cancer, organ development and immune function. This class of small RNAs bind with partial complementarity to their target mRNA sequences, most often in the 3'UTR, to negatively regulate gene expression. In parasitic helminths, miRNAs are being increasingly studied for their potential roles in development and host-parasite interactions. The availability of genome data, combined with small RNA sequencing, has paved the way to profile miRNAs expressed at particular developmental stages for many parasitic helminths. While some miRNAs are conserved across species, others appear to be unique to specific parasites, suggesting important roles in adaptation and survival in the host environment. Some miRNAs are released from parasites, in exosomes or in protein complexes, and the potential effects of these on host immune function are being increasingly studied. In addition, release of miRNAs from schistosome and filarial parasites into host plasma can be exploited for the development of specific and sensitive diagnostic biomarkers of infection. Interfering with miRNA function, as well as silencing key components of the pathways they regulate, will progress our understanding of parasite development and provide a novel approach to therapeutic control. RNA interference (RNAi) by siRNAs has proven to be inconsistent in parasitic nematodes. However, the recent successes reported for schistosome and liver fluke RNAi, encourage further efforts to enhance delivery of RNA and improve in vitro culture systems and assays to monitor phenotypic effects in nematodes. These improvements are important for the establishment of reliable functional genomic platforms for novel drug and vaccine development. In this review we focus on the important roles of mi

  15. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.


    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  16. Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq). (United States)

    Watters, Kyle E; Lucks, Julius B


    Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

  17. miRDis: a Web tool for endogenous and exogenous microRNA discovery based on deep-sequencing data analysis. (United States)

    Zhang, Hanyuan; Vieira Resende E Silva, Bruno; Cui, Juan


    Small RNA sequencing is the most widely used tool for microRNA (miRNA) discovery, and shows great potential for the efficient study of miRNA cross-species transport, i.e., by detecting the presence of exogenous miRNA sequences in the host species. Because of the increased appreciation of dietary miRNAs and their far-reaching implication in human health, research interests are currently growing with regard to exogenous miRNAs bioavailability, mechanisms of cross-species transport and miRNA function in cellular biological processes. In this article, we present microRNA Discovery (miRDis), a new small RNA sequencing data analysis pipeline for both endogenous and exogenous miRNA detection. Specifically, we developed and deployed a Web service that supports the annotation and expression profiling data of known host miRNAs and the detection of novel miRNAs, other noncoding RNAs, and the exogenous miRNAs from dietary species. As a proof-of-concept, we analyzed a set of human plasma sequencing data from a milk-feeding study where 225 human miRNAs were detected in the plasma samples and 44 show elevated expression after milk intake. By examining the bovine-specific sequences, data indicate that three bovine miRNAs (bta-miR-378, -181* and -150) are present in human plasma possibly because of the dietary uptake. Further evaluation based on different sets of public data demonstrates that miRDis outperforms other state-of-the-art tools in both detection and quantification of miRNA from either animal or plant sources. The miRDis Web server is available at:

  18. Viroids: from genotype to phenotype just relying on RNA sequence and structural motifs

    Directory of Open Access Journals (Sweden)

    Ricardo eFlores


    Full Text Available As a consequence of two unique physical properties, small size and circularity, viroid RNAs do not code for proteins and thus depend on RNA sequence/structural motifs for interacting with host proteins that mediate their invasion, replication, spread, and circumvention of defensive barriers. Viroid genomes fold up on themselves adopting collapsed secondary structures wherein stretches of nucleotides stabilized by Watson-Crick pairs are flanked by apparently unstructured loops. However, compelling data show that they are instead stabilized by alternative non-canonical pairs and that specific loops in the rod-like secondary structure, characteristic of Potato spindle tuber viroid and most other members of the family Pospiviroidae, are critical for replication and systemic trafficking. In contrast, rather than folding into a rod-like secondary structure, most members of the family Avsunvioidae adopt multibranched conformations occasionally stabilized by kissing loop interactions critical for viroid viability in vivo. Besides these most stable secondary structures, viroid RNAs alternatively adopt during replication transient metastable conformations containing elements of local higher-order structure, prominent among which are the hammerhead ribozymes catalyzing a key replicative step in the family Avsunvioidae, and certain conserved hairpins that also mediate replication steps in the family Pospiviroidae. Therefore, different RNA structures ⎯either global or local ⎯ determine different functions, thus highlighting the need for in-depth structural studies on viroid RNAs.

  19. The PETfold and PETcofold web servers for intra- and intermolecular structures of multiple RNA sequences

    DEFF Research Database (Denmark)

    Seemann, Ernst Stefan; Menzel, Karl Peter; Backofen, Rolf


    gene. We present web servers to analyze multiple RNA sequences for common RNA structure and for RNA interaction sites. The web servers are based on the recent PET (Probabilistic Evolutionary and Thermodynamic) models PETfold and PETcofold, but add user friendly features ranging from a graphical layer...... to interactive usage of the predictors. Additionally, the web servers provide direct access to annotated RNA alignments, such as the Rfam 10.0 database and multiple alignments of 16 vertebrate genomes with human. The web servers are freely available at:

  20. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.


    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  1. Micropathogen Community Analysis in Hyalomma rufipes via High-Throughput Sequencing of Small RNAs (United States)

    Luo, Jin; Liu, Min-Xuan; Ren, Qiao-Yun; Chen, Ze; Tian, Zhan-Cheng; Hao, Jia-Wei; Wu, Feng; Liu, Xiao-Cui; Luo, Jian-Xun; Yin, Hong; Wang, Hui; Liu, Guang-Yuan


    Ticks are important vectors in the transmission of a broad range of micropathogens to vertebrates, including humans. Because of the role of ticks in disease transmission, identifying and characterizing the micropathogen profiles of tick populations have become increasingly important. The objective of this study was to survey the micropathogens of Hyalomma rufipes ticks. Illumina HiSeq2000 technology was utilized to perform deep sequencing of small RNAs (sRNAs) extracted from field-collected H. rufipes ticks in Gansu Province, China. The resultant sRNA library data revealed that the surveyed tick populations produced reads that were homologous to St. Croix River Virus (SCRV) sequences. We also observed many reads that were homologous to microbial and/or pathogenic isolates, including bacteria, protozoa, and fungi. As part of this analysis, a phylogenetic tree was constructed to display the relationships among the homologous sequences that were identified. The study offered a unique opportunity to gain insight into the micropathogens of H. rufipes ticks. The effective control of arthropod vectors in the future will require knowledge of the micropathogen composition of vectors harboring infectious agents. Understanding the ecological factors that regulate vector propagation in association with the prevalence and persistence of micropathogen lineages is also imperative. These interactions may affect the evolution of micropathogen lineages, especially if the micropathogens rely on the vector or host for dispersal. The sRNA deep-sequencing approach used in this analysis provides an intuitive method to survey micropathogen prevalence in ticks and other vector species. PMID:28861401

  2. From early lessons to new frontiers: the worm as a treasure trove of small RNA biology. (United States)

    Youngman, Elaine M; Claycomb, Julie M


    In the past 20 years, the tiny soil nematode Caenorhabditis elegans has provided critical insights into our understanding of the breadth of small RNA-mediated gene regulatory activities. The first microRNA was identified in C. elegans in 1993, and the understanding that dsRNA was the driving force behind RNA-mediated gene silencing came from experiments performed in C. elegans in 1998. Likewise, early genetic screens in C. elegans for factors involved in RNA interference pointed to conserved mechanisms for small RNA-mediated gene silencing pathways, placing the worm squarely among the founding fathers of a now extensive field of molecular biology. Today, the worm continues to be at the forefront of ground-breaking insight into small RNA-mediated biology. Recent studies have revealed with increasing mechanistic clarity that C. elegans possesses an extensive nuclear small RNA regulatory network that encompasses not only gene silencing but also gene activating roles. Further, a portrait is emerging whereby small RNA pathways play key roles in integrating responses to environmental stimuli and transmitting epigenetic information about such responses from one generation to the next. Here we discuss endogenous small RNA pathways in C. elegans and the insight worm biology has provided into the mechanisms employed by these pathways. We touch on the increasingly spectacular diversity of small RNA biogenesis and function, and discuss the relevance of lessons learned in the worm for human biology.

  3. Responses of mRNA expression of PepT1 in small intestine to ...

    African Journals Online (AJOL)

    To study the effect of circulation small peptides concentration on mRNA expression in small intestine, graded amount of soybean small peptides (SSP) were infused into lactating goats through duodenal fistulas. Peptide-bound amino acid (PBAA) concentration in arterial plasma and the mRNA expression of PepT1 was ...

  4. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.


    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...... the six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have....... tarandivulpes, formed a sister group to other Sarcocystis species with a canine definitive host. The position of S. hardangeri on the tree suggested that it uses another type of definitive host than the other Sarcocystis species in this clade. Considering the geographical distribution and infection intensity...

  5. Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes. (United States)

    Iwasaki, Shintaro; Kobayashi, Maki; Yoda, Mayuko; Sakaguchi, Yuriko; Katsuma, Susumu; Suzuki, Tsutomu; Tomari, Yukihide


    Small silencing RNAs--small interfering RNAs (siRNAs) or microRNAs (miRNAs)--direct posttranscriptional gene silencing of their mRNA targets as guides for the RNA-induced silencing complex (RISC). Both siRNAs and miRNAs are born double stranded. Surprisingly, loading these small RNA duplexes into Argonaute proteins, the core components of RISC, requires ATP, whereas separating the two small RNA strands within Argonaute does not. Here we show that the Hsc70/Hsp90 chaperone machinery is required to load small RNA duplexes into Argonaute proteins, but not for subsequent strand separation or target cleavage. We envision that the chaperone machinery uses ATP and mediates a conformational opening of Ago proteins so that they can receive bulky small RNA duplexes. Our data suggest that the chaperone machinery may serve as the driving force for the RISC assembly pathway. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA (United States)

    Tedder, Philip; Zubko, Elena; Westhead, David R.; Meyer, Peter


    Two pools of small RNAs were cloned from inflorescences of Petunia hybrida using a 5′-ligation dependent and a 5′-ligation independent approach. The two libraries were integrated into a public website that allows the screening of individual sequences against 359,769 unique clones. The library contains 15 clones with 100% identity and 53 clones with one mismatch to miRNAs described for other plant species. For two conserved miRNAs, miR159 and miR390, we find clear differences in tissue-specific distribution, compared with other species. This shows that evolutionary conservation of miRNA sequences does not necessarily include a conservation of the miRNA expression profile. Almost 60% of all clones in the database are 24-nucleotide clones. In accordance with the role of 24mers in marking repetitive regions, we find them distributed across retroviral and transposable element sequences but other 24mers map to promoter regions and to different transcript regions. For one target region we observe tissue-specific variation of matching 24mers, which demonstrates that, as for 21mers, 24mer concentrations are not necessarily identical in different tissues. Asymmetric distribution of a putative novel miRNA in the two libraries suggests that the cloning method can be selective for the representation of certain small RNAs in a collection. PMID:19369427

  7. Systems genetics of complex diseases using RNA-sequencing methods

    DEFF Research Database (Denmark)

    Mazzoni, Gianluca; Kogelman, Lisette; Suravajhala, Prashanth


    Next generation sequencing technologies have enabled the generation of huge quantities of biological data, and nowadays extensive datasets at different ‘omics levels have been generated. Systems genetics is a powerful approach that allows to integrate different ‘omics level and understand the bio...

  8. Sequence analysis of mitochondrial 16S ribosomal RNA gene

    Indian Academy of Sciences (India)

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence ...

  9. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma. (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O


    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  10. Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland. (United States)

    Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H


    Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

  11. Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes. (United States)

    Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I


    Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

  12. High-Level Accumulation of Exogenous Small RNAs Not Affecting Endogenous Small RNA Biogenesis and Function in Plants

    Institute of Scientific and Technical Information of China (English)

    SHEN Wan-xia; Neil A Smith; ZHOU Chang-yong; WANG Ming-bo


    RNA silencing is a fundamental plant defence and gene control mechanism in plants that are directed by 20-24 nucleotide (nt) small interfering RNA (siRNA) and microRNA (miRNA). Infection of plants with viral pathogens or transformation of plants with RNA interference (RNAi) constructs is usually associated with high levels of exogenous siRNAs, but it is unclear if these siRNAs interfere with endogenous small RNA pathways and hence affect plant development. Here we provide evidence that viral satellite RNA (satRNA) infection does not affect siRNA and miRNA biogenesis or plant growth despite the extremely high level of satRNA-derived siRNAs. We generated transgenic Nicotiana benthamiana plants that no longer develop the speciifc yellowing symptoms generally associated with infection by Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat). We then used these plants to show that CMV Y-Sat infection did not cause any visible phenotypic changes in comparison to uninfected plants, despite the presence of high-level Y-Sat siRNAs. Furthermore, we showed that the accumulation of hairpin RNA (hpRNA)-derived siRNAs or miRNAs, and the level of siRNA-directed transgene silencing, are not signiifcantly affected by CMV Y-Sat infection. Taken together, our results suggest that the high levels of exogenous siRNAs associated with viral infection or RNAi-inducing transgenes do not saturate the endogenous RNA silencing machineries and have no signiifcant impact on normal plant development.

  13. sRNAtoolboxVM: Small RNA Analysis in a Virtual Machine. (United States)

    Gómez-Martín, Cristina; Lebrón, Ricardo; Rueda, Antonio; Oliver, José L; Hackenberg, Michael


    High-throughput sequencing (HTS) data for small RNAs (noncoding RNA molecules that are 20-250 nucleotides in length) can now be routinely generated by minimally equipped wet laboratories; however, the bottleneck in HTS-based research has shifted now to the analysis of such huge amount of data. One of the reasons is that many analysis types require a Linux environment but computers, system administrators, and bioinformaticians suppose additional costs that often cannot be afforded by small to mid-sized groups or laboratories. Web servers are an alternative that can be used if the data is not subjected to privacy issues (what very often is an important issue with medical data). However, in any case they are less flexible than stand-alone programs limiting the number of workflows and analysis types that can be carried out.We show in this protocol how virtual machines can be used to overcome those problems and limitations. sRNAtoolboxVM is a virtual machine that can be executed on all common operating systems through virtualization programs like VirtualBox or VMware, providing the user with a high number of preinstalled programs like sRNAbench for small RNA analysis without the need to maintain additional servers and/or operating systems.

  14. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto; Vacherie, Benoî t; Benzoni, Francesca; Stefani, Fabrizio; Karsenti, Eric; Jaillon, Olivier; Not, Fabrice; Nunes, Flavia; Payri, Claude; Wincker, Patrick; Barbe, Valé rie


    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  15. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto


    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  16. Physiological and Pathological Transcriptional Activation of Endogenous Retroelements Assessed by RNA-Sequencing of B Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jan Attig


    Full Text Available In addition to evolutionarily-accrued sequence mutation or deletion, endogenous retroelements (EREs in eukaryotic genomes are subject to epigenetic silencing, preventing or reducing their transcription, particularly in the germplasm. Nevertheless, transcriptional activation of EREs, including endogenous retroviruses (ERVs and long interspersed nuclear elements (LINEs, is observed in somatic cells, variably upon cellular differentiation and frequently upon cellular transformation. ERE transcription is modulated during physiological and pathological immune cell activation, as well as in immune cell cancers. However, our understanding of the potential consequences of such modulation remains incomplete, partly due to the relative scarcity of information regarding genome-wide ERE transcriptional patterns in immune cells. Here, we describe a methodology that allows probing RNA-sequencing (RNA-seq data for genome-wide expression of EREs in murine and human cells. Our analysis of B cells reveals that their transcriptional response during immune activation is dominated by induction of gene transcription, and that EREs respond to a much lesser extent. The transcriptional activity of the majority of EREs is either unaffected or reduced by B cell activation both in mice and humans, albeit LINEs appear considerably more responsive in the latter host. Nevertheless, a small number of highly distinct ERVs are strongly and consistently induced during B cell activation. Importantly, this pattern contrasts starkly with B cell transformation, which exhibits widespread induction of EREs, including ERVs that minimally overlap with those responsive to immune stimulation. The distinctive patterns of ERE induction suggest different underlying mechanisms and will help separate physiological from pathological expression.

  17. MicroRNA from Moringa oleifera: Identification by High Throughput Sequencing and Their Potential Contribution to Plant Medicinal Value. (United States)

    Pirrò, Stefano; Zanella, Letizia; Kenzo, Maurice; Montesano, Carla; Minutolo, Antonella; Potestà, Marina; Sobze, Martin Sanou; Canini, Antonella; Cirilli, Marco; Muleo, Rosario; Colizzi, Vittorio; Galgani, Andrea


    Moringa oleifera is a widespread plant with substantial nutritional and medicinal value. We postulated that microRNAs (miRNAs), which are endogenous, noncoding small RNAs regulating gene expression at the post-transcriptional level, might contribute to the medicinal properties of plants of this species after ingestion into human body, regulating human gene expression. However, the knowledge is scarce about miRNA in Moringa. Furthermore, in order to test the hypothesis on the pharmacological potential properties of miRNA, we conducted a high-throughput sequencing analysis using the Illumina platform. A total of 31,290,964 raw reads were produced from a library of small RNA isolated from M. oleifera seeds. We identified 94 conserved and two novel miRNAs that were validated by qRT-PCR assays. Results from qRT-PCR trials conducted on the expression of 20 Moringa miRNA showed that are conserved across multiple plant species as determined by their detection in tissue of other common crop plants. In silico analyses predicted target genes for the conserved miRNA that in turn allowed to relate the miRNAs to the regulation of physiological processes. Some of the predicted plant miRNAs have functional homology to their mammalian counterparts and regulated human genes when they were transfected into cell lines. To our knowledge, this is the first report of discovering M. oleifera miRNAs based on high-throughput sequencing and bioinformatics analysis and we provided new insight into a potential cross-species control of human gene expression. The widespread cultivation and consumption of M. oleifera, for nutritional and medicinal purposes, brings humans into close contact with products and extracts of this plant species. The potential for miRNA transfer should be evaluated as one possible mechanism of action to account for beneficial properties of this valuable species.

  18. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes. (United States)

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver


    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  19. Genetic diagnosis of Mendelian disorders via RNA sequencing. (United States)

    Kremer, Laura S; Bader, Daniel M; Mertes, Christian; Kopajtich, Robert; Pichler, Garwin; Iuso, Arcangela; Haack, Tobias B; Graf, Elisabeth; Schwarzmayr, Thomas; Terrile, Caterina; Koňaříková, Eliška; Repp, Birgit; Kastenmüller, Gabi; Adamski, Jerzy; Lichtner, Peter; Leonhardt, Christoph; Funalot, Benoit; Donati, Alice; Tiranti, Valeria; Lombes, Anne; Jardel, Claude; Gläser, Dieter; Taylor, Robert W; Ghezzi, Daniele; Mayr, Johannes A; Rötig, Agnes; Freisinger, Peter; Distelmaier, Felix; Strom, Tim M; Meitinger, Thomas; Gagneur, Julien; Prokisch, Holger


    Across a variety of Mendelian disorders, ∼50-75% of patients do not receive a genetic diagnosis by exome sequencing indicating disease-causing variants in non-coding regions. Although genome sequencing in principle reveals all genetic variants, their sizeable number and poorer annotation make prioritization challenging. Here, we demonstrate the power of transcriptome sequencing to molecularly diagnose 10% (5 of 48) of mitochondriopathy patients and identify candidate genes for the remainder. We find a median of one aberrantly expressed gene, five aberrant splicing events and six mono-allelically expressed rare variants in patient-derived fibroblasts and establish disease-causing roles for each kind. Private exons often arise from cryptic splice sites providing an important clue for variant prioritization. One such event is found in the complex I assembly factor TIMMDC1 establishing a novel disease-associated gene. In conclusion, our study expands the diagnostic tools for detecting non-exonic variants and provides examples of intronic loss-of-function variants with pathological relevance.

  20. Customized workflow development and data modularization concepts for RNA-Sequencing and metatranscriptome experiments. (United States)

    Lott, Steffen C; Wolfien, Markus; Riege, Konstantin; Bagnacani, Andrea; Wolkenhauer, Olaf; Hoffmann, Steve; Hess, Wolfgang R


    RNA-Sequencing (RNA-Seq) has become a widely used approach to study quantitative and qualitative aspects of transcriptome data. The variety of RNA-Seq protocols, experimental study designs and the characteristic properties of the organisms under investigation greatly affect downstream and comparative analyses. In this review, we aim to explain the impact of structured pre-selection, classification and integration of best-performing tools within modularized data analysis workflows and ready-to-use computing infrastructures towards experimental data analyses. We highlight examples for workflows and use cases that are presented for pro-, eukaryotic and mixed dual RNA-Seq (meta-transcriptomics) experiments. In addition, we are summarizing the expertise of the laboratories participating in the project consortium "Structured Analysis and Integration of RNA-Seq experiments" (de.STAIR) and its integration with the Galaxy-workbench of the RNA Bioinformatics Center (RBC). Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  1. The small RNA content of human sperm reveals pseudogene-derived piRNAs complementary to protein-coding genes (United States)

    Pantano, Lorena; Jodar, Meritxell; Bak, Mads; Ballescà, Josep Lluís; Tommerup, Niels; Oliva, Rafael; Vavouri, Tanya


    At the end of mammalian sperm development, sperm cells expel most of their cytoplasm and dispose of the majority of their RNA. Yet, hundreds of RNA molecules remain in mature sperm. The biological significance of the vast majority of these molecules is unclear. To better understand the processes that generate sperm small RNAs and what roles they may have, we sequenced and characterized the small RNA content of sperm samples from two human fertile individuals. We detected 182 microRNAs, some of which are highly abundant. The most abundant microRNA in sperm is miR-1246 with predicted targets among sperm-specific genes. The most abundant class of small noncoding RNAs in sperm are PIWI-interacting RNAs (piRNAs). Surprisingly, we found that human sperm cells contain piRNAs processed from pseudogenes. Clusters of piRNAs from human testes contain pseudogenes transcribed in the antisense strand and processed into small RNAs. Several human protein-coding genes contain antisense predicted targets of pseudogene-derived piRNAs in the male germline and these piRNAs are still found in mature sperm. Our study provides the most extensive data set and annotation of human sperm small RNAs to date and is a resource for further functional studies on the roles of sperm small RNAs. In addition, we propose that some of the pseudogene-derived human piRNAs may regulate expression of their parent gene in the male germline. PMID:25904136

  2. From early lessons to new frontiers: The worm as a treasure trove of small RNA biology

    Directory of Open Access Journals (Sweden)

    Elaine M. Youngman


    Full Text Available In the past twenty years, the tiny soil nematode C. elegans has provided critical insights into our understanding of the breadth of small RNA-mediated gene regulatory activities. The first microRNA was identified in C. elegans in 1993, and the understanding that dsRNA was the driving force behind RNA-mediated gene silencing came from experiments performed in C. elegans in 1998. Likewise, early genetic screens in C. elegans for factors involved in RNAi pointed to conserved mechanisms for small RNA-mediated gene silencing pathways, placing the worm squarely among the founding fathers of a now extensive field of molecular biology. Today, the worm continues to be at the forefront of ground-breaking insight into small RNA-mediated biology. Recent studies have revealed with increasing mechanistic clarity that C. elegans possesses an extensive nuclear small RNA regulatory network that encompasses not only gene silencing but also gene activating roles. Further, a portrait is emerging whereby small RNA pathways play key roles in integrating responses to environmental stimuli and transmitting epigenetic information about such responses from one generation to the next. Here we discuss endogenous small RNA pathways in C. elegans and the insight worm biology has provided into the mechanisms employed by these pathways. We touch on the increasingly spectacular diversity of small RNA biogenesis and function, and discuss the relevance of lessons learned in the worm for human biology.

  3. Transcriptome landscape of Lactococcus lactis reveals many novel RNAs including a small regulatory RNA involved in carbon uptake and metabolism. (United States)

    van der Meulen, Sjoerd B; de Jong, Anne; Kok, Jan


    RNA sequencing has revolutionized genome-wide transcriptome analyses, and the identification of non-coding regulatory RNAs in bacteria has thus increased concurrently. Here we reveal the transcriptome map of the lactic acid bacterial paradigm Lactococcus lactis MG1363 by employing differential RNA sequencing (dRNA-seq) and a combination of manual and automated transcriptome mining. This resulted in a high-resolution genome annotation of L. lactis and the identification of 60 cis-encoded antisense RNAs (asRNAs), 186 trans-encoded putative regulatory RNAs (sRNAs) and 134 novel small ORFs. Based on the putative targets of asRNAs, a novel classification is proposed. Several transcription factor DNA binding motifs were identified in the promoter sequences of (a)sRNAs, providing insight in the interplay between lactococcal regulatory RNAs and transcription factors. The presence and lengths of 14 putative sRNAs were experimentally confirmed by differential Northern hybridization, including the abundant RNA 6S that is differentially expressed depending on the available carbon source. For another sRNA, LLMGnc_147, functional analysis revealed that it is involved in carbon uptake and metabolism. L. lactis contains 13% leaderless mRNAs (lmRNAs) that, from an analysis of overrepresentation in GO classes, seem predominantly involved in nucleotide metabolism and DNA/RNA binding. Moreover, an A-rich sequence motif immediately following the start codon was uncovered, which could provide novel insight in the translation of lmRNAs. Altogether, this first experimental genome-wide assessment of the transcriptome landscape of L. lactis and subsequent sRNA studies provide an extensive basis for the investigation of regulatory RNAs in L. lactis and related lactococcal species.

  4. RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location. (United States)

    Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L


    The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

  5. Advances in targeted delivery of small interfering RNA using simple bioconjugates

    DEFF Research Database (Denmark)

    Nielsen, Christoffer; Kjems, Jørgen; Sorensen, Kristine Rothaus


    with a targeting moiety, in a simple bioconjugate construct. We discuss the use of different types of targeting moieties, as well as the different conjugation strategies employed for preparing these bioconjugate constructs that deliver the siRNA to target cells. We focus especially on the in-built or passive......Introduction: Development of drugs based on RNA interference by small interfering RNA (siRNA) has been progressing slowly due to a number of challenges associated with the in vivo behavior of siRNA. A central problem is controlling siRNA delivery to specific cell types. Here, we review existing...... literature on one type of strategy for solving the issue of cell-specific delivery of siRNA, namely delivering the siRNA as part of simple bioconjugate constructs. Areas covered: This review presents current experience from strategies aimed at targeting siRNA to specific cell types, by associating the siRNA...

  6. Rice MEL2, the RNA recognition motif (RRM) protein, binds in vitro to meiosis-expressed genes containing U-rich RNA consensus sequences in the 3'-UTR. (United States)

    Miyazaki, Saori; Sato, Yutaka; Asano, Tomoya; Nagamura, Yoshiaki; Nonomura, Ken-Ichi


    Post-transcriptional gene regulation by RNA recognition motif (RRM) proteins through binding to cis-elements in the 3'-untranslated region (3'-UTR) is widely used in eukaryotes to complete various biological processes. Rice MEIOSIS ARRESTED AT LEPTOTENE2 (MEL2) is the RRM protein that functions in the transition to meiosis in proper timing. The MEL2 RRM preferentially associated with the U-rich RNA consensus, UUAGUU[U/A][U/G][A/U/G]U, dependently on sequences and proportionally to MEL2 protein amounts in vitro. The consensus sequences were located in the putative looped structures of the RNA ligand. A genome-wide survey revealed a tendency of MEL2-binding consensus appearing in 3'-UTR of rice genes. Of 249 genes that conserved the consensus in their 3'-UTR, 13 genes spatiotemporally co-expressed with MEL2 in meiotic flowers, and included several genes whose function was supposed in meiosis; such as Replication protein A and OsMADS3. The proteome analysis revealed that the amounts of small ubiquitin-related modifier-like protein and eukaryotic translation initiation factor3-like protein were dramatically altered in mel2 mutant anthers. Taken together with transcriptome and gene ontology results, we propose that the rice MEL2 is involved in the translational regulation of key meiotic genes on 3'-UTRs to achieve the faithful transition of germ cells to meiosis.

  7. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J


    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  8. Characterization of the Small RNA Transcriptome of the Marine Coccolithophorid, Emiliania huxleyi. (United States)

    Zhang, Xiaoyu; Gamarra, Jaime; Castro, Steven; Carrasco, Estela; Hernandez, Aaron; Mock, Thomas; Hadaegh, Ahmad R; Read, Betsy A


    Small RNAs (smRNAs) control a variety of cellular processes by silencing target genes at the transcriptional or post-transcription level. While extensively studied in plants, relatively little is known about smRNAs and their targets in marine phytoplankton, such as Emiliania huxleyi (E. huxleyi). Deep sequencing was performed of smRNAs extracted at different time points as E. huxleyi cells transition from logarithmic to stationary phase growth in batch culture. Computational analyses predicted 18 E. huxleyi specific miRNAs. The 18 miRNA candidates and their precursors vary in length (18-24 nt and 71-252 nt, respectively), genome copy number (3-1,459), and the number of genes targeted (2-107). Stem-loop real time reverse transcriptase (RT) PCR was used to validate miRNA expression which varied by nearly three orders of magnitude when growth slows and cells enter stationary phase. Stem-loop RT PCR was also used to examine the expression profiles of miRNA in calcifying and non-calcifying cultures, and a small subset was found to be differentially expressed when nutrients become limiting and calcification is enhanced. In addition to miRNAs, endogenous small RNAs such as ra-siRNAs, ta-siRNAs, nat-siRNAs, and piwiRNAs were predicted along with the machinery for the biogenesis and processing of si-RNAs. This study is the first genome-wide investigation smRNAs pathways in E. huxleyi. Results provide new insights into the importance of smRNAs in regulating aspects of physiological growth and adaptation in marine phytoplankton and further challenge the notion that smRNAs evolved with multicellularity, expanding our perspective of these ancient regulatory pathways.

  9. Characterization of the Small RNA Transcriptome of the Marine Coccolithophorid, Emiliania huxleyi.

    Directory of Open Access Journals (Sweden)

    Xiaoyu Zhang

    Full Text Available Small RNAs (smRNAs control a variety of cellular processes by silencing target genes at the transcriptional or post-transcription level. While extensively studied in plants, relatively little is known about smRNAs and their targets in marine phytoplankton, such as Emiliania huxleyi (E. huxleyi. Deep sequencing was performed of smRNAs extracted at different time points as E. huxleyi cells transition from logarithmic to stationary phase growth in batch culture. Computational analyses predicted 18 E. huxleyi specific miRNAs. The 18 miRNA candidates and their precursors vary in length (18-24 nt and 71-252 nt, respectively, genome copy number (3-1,459, and the number of genes targeted (2-107. Stem-loop real time reverse transcriptase (RT PCR was used to validate miRNA expression which varied by nearly three orders of magnitude when growth slows and cells enter stationary phase. Stem-loop RT PCR was also used to examine the expression profiles of miRNA in calcifying and non-calcifying cultures, and a small subset was found to be differentially expressed when nutrients become limiting and calcification is enhanced. In addition to miRNAs, endogenous small RNAs such as ra-siRNAs, ta-siRNAs, nat-siRNAs, and piwiRNAs were predicted along with the machinery for the biogenesis and processing of si-RNAs. This study is the first genome-wide investigation smRNAs pathways in E. huxleyi. Results provide new insights into the importance of smRNAs in regulating aspects of physiological growth and adaptation in marine phytoplankton and further challenge the notion that smRNAs evolved with multicellularity, expanding our perspective of these ancient regulatory pathways.

  10. Study design requirements for RNA sequencing-based breast cancer diagnostics. (United States)

    Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias


    Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic.

  11. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer. (United States)

    Álvarez-Martos, Isabel; Ferapontova, Elena E


    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. RNA Sequencing and Bioinformatics Analysis Implicate the Regulatory Role of a Long Noncoding RNA-mRNA Network in Hepatic Stellate Cell Activation. (United States)

    Guo, Can-Jie; Xiao, Xiao; Sheng, Li; Chen, Lili; Zhong, Wei; Li, Hai; Hua, Jing; Ma, Xiong


    To analyze the long noncoding (lncRNA)-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs) during activation. LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2) and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2) in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox) were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM)-related signaling pathway in HSCs and fibrotic livers. Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation. © 2017 The Author(s). Published by S. Karger AG, Basel.

  13. Systemic delivery of siRNA in pumpkin by a plant PHLOEM SMALL RNA-BINDING PROTEIN 1-ribonucleoprotein complex. (United States)

    Ham, Byung-Kook; Li, Gang; Jia, Weitao; Leary, Julie A; Lucas, William J


    In plants, the vascular system, specifically the phloem, functions in delivery of small RNA (sRNA) to exert epigenetic control over developmental and defense-related processes. Although the importance of systemic sRNA delivery has been established, information is currently lacking concerning the nature of the protein machinery involved in this process. Here, we show that a PHLOEM SMALL-RNA BINDING PROTEIN 1 (PSRP1) serves as the basis for formation of an sRNA ribonucleoprotein complex (sRNPC) that delivers sRNA (primarily 24 nt) to sink organs. Assembly of this complex is facilitated through PSRP1 phosphorylation by a phloem-localized protein kinase, PSRPK1. During long-distance transport, PSRP1-sRNPC is stable against phloem phosphatase activity. Within target tissues, phosphatase activity results in disassembly of PSRP1-sRNPC, a process that is probably required for unloading cargo sRNA into surrounding cells. These findings provide an insight into the mechanism involved in delivery of sRNA associated with systemic gene silencing in plants. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  14. Viral Small-RNA Analysis of Bombyx mori Larval Midgut during Persistent and Pathogenic Cytoplasmic Polyhedrosis Virus Infection. (United States)

    Zografidis, Aris; Van Nieuwerburgh, Filip; Kolliopoulou, Anna; Apostolou-Karampelis, Konstantinos; Head, Steven R; Deforce, Dieter; Smagghe, Guy; Swevers, Luc


    The lepidopteran innate immune response against RNA viruses remains poorly understood, while in other insects several studies have highlighted an essential role for the exo-RNAi pathway in combating viral infection. Here, by using deep-sequencing technology for viral small-RNA (vsRNA) assessment, we provide evidence that exo-RNAi is operative in the silkworm Bombyx mori against both persistent and pathogenic infection of B. mori cytoplasmic polyhedrosis virus (BmCPV) which is characterized by a segmented double-stranded RNA (dsRNA) genome. Further, we show that Dicer-2 predominantly targets viral dsRNA and produces 20-nucleotide (nt) vsRNAs, whereas an additional pathway is responsive to viral mRNA derived from segment 10. Importantly, vsRNA distributions, which define specific hot and cold spot profiles for each viral segment, to a considerable degree overlap between Dicer-2-related (19 to 21 nt) and Dicer-2-unrelated vsRNAs, suggesting a common origin for these profiles. We found a degenerate motif significantly enriched at the cut sites of vsRNAs of various lengths which link an unknown RNase to the origins of vsRNAs biogenesis and distribution. Accordingly, the indicated RNase activity may be an important early factor for the host's antiviral defense in Lepidoptera. This work contributes to the elucidation of the lepidopteran antiviral response against infection of segmented double-stranded RNA (dsRNA) virus (CPV; Reoviridae) and highlights the importance of viral small-RNA (vsRNA) analysis for getting insights into host-pathogen interactions. Three vsRNA pathways are implicated in antiviral defense. For dsRNA, two pathways are proposed, either based on Dicer-2 cleavage to generate 20-nucleotide vsRNAs or based on the activity of an uncharacterized endo-RNase that cleaves the viral RNA substrate at a degenerate motif. The analysis also indicates the existence of a degradation pathway that targets the positive strand of segment 10. Copyright © 2015, American

  15. Discovery and small RNA profile of Pecan mosaic-associated virus, a novel potyvirus of pecan trees. (United States)

    Su, Xiu; Fu, Shuai; Qian, Yajuan; Zhang, Liqin; Xu, Yi; Zhou, Xueping


    A novel potyvirus was discovered in pecan (Carya illinoensis) showing leaf mosaic symptom through the use of deep sequencing of small RNAs. The complete genome of this virus was determined to comprise of 9,310 nucleotides (nt), and shared 24.0% to 58.9% nucleotide similarities with that of other Potyviridae viruses. The genome was deduced to encode a single open reading frame (polyprotein) on the plus strand. Phylogenetic analysis based on the whole genome sequence and coat protein amino acid sequence showed that this virus is most closely related to Lettuce mosaic virus. Using electron microscopy, the typical Potyvirus filamentous particles were identified in infected pecan leaves with mosaic symptoms. Our results clearly show that this virus is a new member of the genus Potyvirus in the family Potyviridae. The virus is tentatively named Pecan mosaic-associated virus (PMaV). Additionally, profiling of the PMaV-derived small RNA (PMaV-sRNA) showed that the most abundant PMaV-sRNAs were 21-nt in length. There are several hotspots for small RNA production along the PMaV genome; two 21-nt PMaV-sRNAs starting at 811 nt and 610 nt of the minus-strand genome were highly repeated.

  16. Quantitative miRNA expression analysis: comparing microarrays with next-generation sequencing

    DEFF Research Database (Denmark)

    Willenbrock, Hanni; Salomon, Jesper; Søkilde, Rolf


    Recently, next-generation sequencing has been introduced as a promising, new platform for assessing the copy number of transcripts, while the existing microarray technology is considered less reliable for absolute, quantitative expression measurements. Nonetheless, so far, results from the two...... technologies have only been compared based on biological data, leading to the conclusion that, although they are somewhat correlated, expression values differ significantly. Here, we use synthetic RNA samples, resembling human microRNA samples, to find that microarray expression measures actually correlate...... better with sample RNA content than expression measures obtained from sequencing data. In addition, microarrays appear highly sensitive and perform equivalently to next-generation sequencing in terms of reproducibility and relative ratio quantification....

  17. Efficient RNA extraction protocol for the wood mangrove species Laguncularia racemosa suited for next-generation RNA sequencing

    International Nuclear Information System (INIS)

    Wilwerth, M. W.; Rossetto, P.


    Mangrove flora and habitat have immeasurable importance in marine and coastal ecology as well as in the economy. Despite their importance, they are constantly threatened by oil spill accidents and environmental contamination; therefore, it is crucial to understand the changes in gene expression to better predict toxicity in these plants. Among the species of Atlantic coast mangrove (Americas and Africa), Laguncularia racemosa, or white mangrove, is a conspicuous species. The wide distribution of L. racemosa in areas where marine oil exploration is rapidly increasing make it a candidate mangrove species model to uncover the impact of oil spills at the molecular level with the use of massive transcriptome sequencing. However, for this purpose, the RNA extraction protocol should ensure low levels of contaminants and structure integrity. In this study, eight RNA extraction methods were tested and analysed using downstream applications. The InviTrap Spin Plant RNA Mini Kit performed best with regard to purity and integrity. Moreover, the obtained RNA was submitted to cDNA synthesis and RT-PCR, successfully generating amplification products of the expected size. These Results show the applicability of the RNA obtained here for downstream methodologies, such as the construction of cDNA libraries for the Illumina Hi-seq platform. (author)

  18. Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H


    RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

  19. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    Directory of Open Access Journals (Sweden)

    Masfique Mehedi

    Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  20. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure. (United States)

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz


    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  1. mESAdb: microRNA expression and sequence analysis database. (United States)

    Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen


    microRNA expression and sequence analysis database ( (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.

  2. incaRNAfbinv: a web server for the fragment-based design of RNA sequences (United States)

    Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny


    Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at PMID:27185893

  3. MicroRNA-944 Affects Cell Growth by Targeting EPHA7 in Non-Small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Minxia Liu


    Full Text Available MicroRNAs (miRNAs have critical roles in lung tumorigenesis and development. To determine aberrantly expressed miRNAs involved in non-small cell lung cancer (NSCLC and investigate pathophysiological functions and mechanisms, we firstly carried out small RNA deep sequencing in NSCLC cell lines (EPLC-32M1, A549 and 801D and a human immortalized cell line 16HBE, we then studied miRNA function by cell proliferation and apoptosis. cDNA microarray, luciferase reporter assay and miRNA transfection were used to investigate interaction between the miRNA and target gene. miR-944 was significantly down-regulated in NSCLC and had many putative targets. Moreover, the forced expression of miR-944 significantly inhibited the proliferation of NSCLC cells in vitro. By integrating mRNA expression data and miR-944-target prediction, we disclosed that EPHA7 was a potential target of miR-944, which was further verified by luciferase reporter assay and microRNA transfection. Our data indicated that miR-944 targets EPHA7 in NSCLC and regulates NSCLC cell proliferation, which may offer a new mechanism underlying the development and progression of NSCLC.

  4. MicroRNA-944 Affects Cell Growth by Targeting EPHA7 in Non-Small Cell Lung Cancer. (United States)

    Liu, Minxia; Zhou, Kecheng; Cao, Yi


    MicroRNAs (miRNAs) have critical roles in lung tumorigenesis and development. To determine aberrantly expressed miRNAs involved in non-small cell lung cancer (NSCLC) and investigate pathophysiological functions and mechanisms, we firstly carried out small RNA deep sequencing in NSCLC cell lines (EPLC-32M1, A549 and 801D) and a human immortalized cell line 16HBE, we then studied miRNA function by cell proliferation and apoptosis. cDNA microarray, luciferase reporter assay and miRNA transfection were used to investigate interaction between the miRNA and target gene. miR-944 was significantly down-regulated in NSCLC and had many putative targets. Moreover, the forced expression of miR-944 significantly inhibited the proliferation of NSCLC cells in vitro. By integrating mRNA expression data and miR-944-target prediction, we disclosed that EPHA7 was a potential target of miR-944, which was further verified by luciferase reporter assay and microRNA transfection. Our data indicated that miR-944 targets EPHA7 in NSCLC and regulates NSCLC cell proliferation, which may offer a new mechanism underlying the development and progression of NSCLC.

  5. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences. (United States)

    Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří


    The purpose of the proposed web server, publicly available at, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. 3' end labelling of RNA with /sup 32/P suitable for rapid gel sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Winter, G; Brownlee, G G [Medical Research Council, Cambridge (UK)


    A new general method of labelling the 2', 3'-diol end of RNA with /sup 32/P has been devised suitable for gel sequencing. Poly(A) polymerase (E.coli) is incubated with the RNA and limiting amounts of ..cap alpha..-/sup 32/P-ATP. The mono-addition product is then cleaved with periodate and ..beta..-eliminated with aniline, leaving the RNA terminally labelled with 3'/sup 32/P-phosphate. When applied to a model compound, tRNAsup(Phe) from E. coli, over 28 residues could be read from the 3' end.

  7. RNA-Sequencing of Primary Retinoblastoma Tumors Provides New Insights and Challenges Into Tumor Development

    Directory of Open Access Journals (Sweden)

    Sailaja V. Elchuri


    Full Text Available Retinoblastoma is rare tumor of the retina caused by the homozygous loss of the Retinoblastoma 1 tumor suppressor gene (RB1. Loss of the RB1 protein, pRB, results in de-regulated activity of the E2F transcription factors, chromatin changes and developmental defects leading to tumor development. Extensive microarray profiles of these tumors have enabled the identification of genes sensitive to pRB disruption, however, this technology has a number of limitations in the RNA profiles that they generate. The advent of RNA-sequencing has enabled the global profiling of all of the RNA within the cell including both coding and non-coding features and the detection of aberrant RNA processing events. In this perspective, we focus on discussing how RNA-sequencing of rare Retinoblastoma tumors will build on existing data and open up new area’s to improve our understanding of the biology of these tumors. In particular, we discuss how the RB-research field may be to use this data to determine how RB1 loss results in the expression of; non-coding RNAs, causes aberrant RNA processing events and how a deeper analysis of metabolic RNA changes can be utilized to model tumor specific shifts in metabolism. Each section discusses new opportunities and challenges associated with these types of analyses and aims to provide an honest assessment of how understanding these different processes may contribute to the treatment of Retinoblastoma.

  8. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils. (United States)

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V


    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  9. Combined sequencing of mRNA and DNA from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Florian Mertes


    Full Text Available Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO database under accession number GSE69471.

  10. The role of upstream sequences in selecting the reading frame on tmRNA

    Directory of Open Access Journals (Sweden)

    Dewey Jonathan D


    Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.

  11. associated virus (AAV)-mediated expression of small interfering RNA

    African Journals Online (AJOL)



    Apr 11, 2011 ... disadvantages. In this study, a siRNA expression recombinant adeno-associated virus (AAV) was .... cleotides were designed, which contained a sense strand of p53 or ..... During MJ, Kaplitt MG, Stem MB, Eidelberg D (2001).

  12. Small RNA-seq during acute maximal exercise reveal RNAs involved in vascular inflammation and cardiometabolic health: brief report. (United States)

    Shah, Ravi; Yeri, Ashish; Das, Avash; Courtright-Lim, Amanda; Ziegler, Olivia; Gervino, Ernest; Ocel, Jeffrey; Quintero-Pinzon, Pablo; Wooster, Luke; Bailey, Cole Shields; Tanriverdi, Kahraman; Beaulieu, Lea M; Freedman, Jane E; Ghiran, Ionita; Lewis, Gregory D; Van Keuren-Jensen, Kendall; Das, Saumya


    Exercise improves cardiometabolic and vascular function, although the mechanisms remain unclear. Our objective was to demonstrate the diversity of circulating extracellular RNA (ex-RNA) release during acute exercise in humans and its relevance to exercise-mediated benefits on vascular inflammation. We performed plasma small RNA sequencing in 26 individuals undergoing symptom-limited maximal treadmill exercise, with replication of our top candidate miRNA in a separate cohort of 59 individuals undergoing bicycle ergometry. We found changes in miRNAs and other ex-RNAs with exercise (e.g., Y RNAs and tRNAs) implicated in cardiovascular disease. In two independent cohorts of acute maximal exercise, we identified miR-181b-5p as a key ex-RNA increased in plasma after exercise, with validation in a separate cohort. In a mouse model of acute exercise, we found significant increases in miR-181b-5p expression in skeletal muscle after acute exercise in young (but not older) mice. Previous work revealed a strong role for miR-181b-5p in vascular inflammation in obesity, insulin resistance, sepsis, and cardiovascular disease. We conclude that circulating ex-RNAs were altered in plasma after acute exercise target pathways involved in inflammation, including miR-181b-5p. Further investigation into the role of known (e.g., miRNA) and novel (e.g., Y RNAs) RNAs is warranted to uncover new mechanisms of vascular inflammation on exercise-mediated benefits on health. NEW & NOTEWORTHY How exercise provides benefits to cardiometabolic health remains unclear. We performed RNA sequencing in plasma during exercise to identify the landscape of small noncoding circulating transcriptional changes. Our results suggest a link between inflammation and exercise, providing rich data on circulating noncoding RNAs for future studies by the scientific community. Copyright © 2017 the American Physiological Society.

  13. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

    Directory of Open Access Journals (Sweden)

    Jonathan A Kopechek

    Full Text Available RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14. Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9 or control RNA (n = 8 during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3 confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively. Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.

  14. The cellular RNA-binding protein EAP recognizes a conserved stem-loop in the Epstein-Barr virus small RNA EBER 1. (United States)

    Toczyski, D P; Steitz, J A


    EAP (EBER-associated protein) is an abundant, 15-kDa cellular RNA-binding protein which associates with certain herpesvirus small RNAs. We have raised polyclonal anti-EAP antibodies against a glutathione S-transferase-EAP fusion protein. Analysis of the RNA precipitated by these antibodies from Epstein-Barr virus (EBV)- or herpesvirus papio (HVP)-infected cells shows that > 95% of EBER 1 (EBV-encoded RNA 1) and the majority of HVP 1 (an HVP small RNA homologous to EBER 1) are associated with EAP. RNase protection experiments performed on native EBER 1 particles with affinity-purified anti-EAP antibodies demonstrate that EAP binds a stem-loop structure (stem-loop 3) of EBER 1. Since bacterially expressed glutathione S-transferase-EAP fusion protein binds EBER 1, we conclude that EAP binding is independent of any other cellular or viral protein. Detailed mutational analyses of stem-loop 3 suggest that EAP recognizes the majority of the nucleotides in this hairpin, interacting with both single-stranded and double-stranded regions in a sequence-specific manner. Binding studies utilizing EBER 1 deletion mutants suggest that there may also be a second, weaker EAP-binding site on stem-loop 4 of EBER 1. These data and the fact that stem-loop 3 represents the most highly conserved region between EBER 1 and HVP 1 suggest that EAP binding is a critical aspect of EBER 1 and HVP 1 function. Images PMID:8380232

  15. De novo transcriptome and small RNA analysis of two Chinese willow cultivars reveals stress response genes in Salix matsudana.

    Directory of Open Access Journals (Sweden)

    Guodong Rao

    Full Text Available Salix matsudana Koidz. is a deciduous, rapidly growing, and drought resistant tree and is one of the most widely distributed and commonly cultivated willow species in China. Currently little transcriptomic and small RNAomic data are available to reveal the genes involve in the stress resistant in S. matsudana. Here, we report the RNA-seq analysis results of both transcriptome and small RNAome data using Illumina deep sequencing of shoot tips from two willow variants(Salix. matsudana and Salix matsudana Koidz. cultivar 'Tortuosa'. De novo gene assembly was used to generate the consensus transcriptome and small RNAome, which contained 106,403 unique transcripts with an average length of 944 bp and a total length of 100.45 MB, and 166 known miRNAs representing 35 miRNA families. Comparison of transcriptomes and small RNAomes combined with quantitative real-time PCR from the two Salix libraries revealed a total of 292 different expressed genes(DEGs and 36 different expressed miRNAs (DEMs. Among the DEGs and DEMs, 196 genes and 24 miRNAs were up regulated, 96 genes and 12 miRNA were down regulated in S. matsudana. Functional analysis of DEGs and miRNA targets showed that many genes were involved in stress resistance in S. matsudana. Our global gene expression profiling presents a comprehensive view of the transcriptome and small RNAome which provide valuable information and sequence resources for uncovering the stress response genes in S. matsudana. Moreover the transcriptome and small RNAome data provide a basis for future study of genetic resistance in Salix.

  16. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    Directory of Open Access Journals (Sweden)

    Robert C. Edgar


    Full Text Available Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%, all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal.

  17. RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences. (United States)

    Brule, C E; Dean, K M; Grayhack, E J


    The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

  18. Characterization of novel precursor miRNAs using next generation sequencing and prediction of miRNA targets in Atlantic halibut.

    Directory of Open Access Journals (Sweden)

    Teshome Tilahun Bizuayehu

    Full Text Available BACKGROUND: microRNAs (miRNAs are implicated in regulation of many cellular processes. miRNAs are processed to their mature functional form in a step-wise manner by multiple proteins and cofactors in the nucleus and cytoplasm. Many miRNAs are conserved across vertebrates. Mature miRNAs have recently been characterized in Atlantic halibut (Hippoglossus hippoglossus L.. The aim of this study was to identify and characterize precursor miRNA (pre-miRNAs and miRNA targets in this non-model flatfish. Discovery of miRNA precursor forms and targets in non-model organisms is difficult because of limited source information available. Therefore, we have developed a methodology to overcome this limitation. METHODS: Genomic DNA and small transcriptome of Atlantic halibut were sequenced using Roche 454 pyrosequencing and SOLiD next generation sequencing (NGS, respectively. Identified pre- miRNAs were further validated with reverse-transcription PCR. miRNA targets were identified using miRanda and RNAhybrid target prediction tools using sequences from public databases. Some of miRNA targets were also identified using RACE-PCR. miRNA binding sites were validated with luciferase assay using the RTS34st cell line. RESULTS: We obtained more than 1.3 M and 92 M sequence reads from 454 genomic DNA sequencing and SOLiD small RNA sequencing, respectively. We identified 34 known and 9 novel pre-miRNAs. We predicted a number of miRNA target genes involved in various biological pathways. miR-24 binding to kisspeptin 1 receptor-2 (kiss1-r2 was confirmed using luciferase assay. CONCLUSION: This study demonstrates that identification of conserved and novel pre-miRNAs in a non-model vertebrate lacking substantial genomic resources can be performed by combining different next generation sequencing technologies. Our results indicate a wide conservation of miRNA precursors and involvement of miRNA in multiple regulatory pathways, and provide resources for further research on miRNA

  19. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence (United States)

    Ortega, Maya


    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  20. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Directory of Open Access Journals (Sweden)

    Adrian Valli

    Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  1. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes. (United States)

    Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio


    RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  2. Sequence-specific bias correction for RNA-seq data using recurrent neural networks. (United States)

    Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru


    The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

  3. A small and efficient dimerization/packaging signal of rat VL30 RNA and its use in murine leukemia virus-VL30-derived vectors for gene transfer. (United States)

    Torrent, C; Gabus, C; Darlix, J L


    Retroviral genomes consist of two identical RNA molecules associated at their 5' ends by the dimer linkage structure located in the packaging element (Psi or E) necessary for RNA dimerization in vitro and packaging in vivo. In murine leukemia virus (MLV)-derived vectors designed for gene transfer, the Psi + sequence of 600 nucleotides directs the packaging of recombinant RNAs into MLV virions produced by helper cells. By using in vitro RNA dimerization as a screening system, a sequence of rat VL30 RNA located next to the 5' end of the Harvey mouse sarcoma virus genome and as small as 67 nucleotides was found to form stable dimeric RNA. In addition, a purine-rich sequence located at the 5' end of this VL30 RNA seems to be critical for RNA dimerization. When this VL30 element was extended by 107 nucleotides at its 3' end and inserted into an MLV-derived vector lacking MLV Psi +, it directed the efficient encapsidation of recombinant RNAs into MLV virions. Because this VL30 packaging signal is smaller and more efficient in packaging recombinant RNAs than the MLV Psi + and does not contain gag or glyco-gag coding sequences, its use in MLV-derived vectors should render even more unlikely recombinations which could generate replication-competent viruses. Therefore, utilization of the rat VL30 packaging sequence should improve the biological safety of MLV vectors for human gene transfer.

  4. Exact association test for small size sequencing data. (United States)

    Lee, Joowon; Lee, Seungyeoun; Jang, Jin-Young; Park, Taesung


    Recent statistical methods for next generation sequencing (NGS) data have been successfully applied to identifying rare genetic variants associated with certain diseases. However, most commonly used methods (e.g., burden tests and variance-component tests) rely on large sample sizes. Notwithstanding, due to its-still high cost, NGS data is generally restricted to small sample sizes, that cannot be analyzed by most existing methods. In this work, we propose a new exact association test for sequencing data that does not require a large sample approximation, which is applicable to both common and rare variants. Our method, based on the Generalized Cochran-Mantel-Haenszel (GCMH) statistic, was applied to NGS datasets from intraductal papillary mucinous neoplasm (IPMN) patients. IPMN is a unique pancreatic cancer subtype that can turn into an invasive and hard-to-treat metastatic disease. Application of our method to IPMN data successfully identified susceptible genes associated with progression of IPMN to pancreatic cancer. Our method is expected to identify disease-associated genetic variants more successfully, and corresponding signal pathways, improving our understanding of specific disease's etiology and prognosis.

  5. 16S rRNA gene sequence and phylogenetic tree of lactobacillus ...

    African Journals Online (AJOL)

    ... processed by denaturing gradient gel electrophoresis (DGGE). Phylogenetic tree was constructed with the sequences of the V2-V3 region of 16S rRNA gene. Results show two distinct divisions among the Lactobacillus species. The study presents a new understanding of the nature of the Lactobacillus vaginal microbiota ...

  6. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing


    B Dhawan; S Sebastian; R Malhotra; A Kapil; D Gautam


    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  7. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    B Dhawan


    Full Text Available We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  8. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures. (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun


    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at

  9. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul


    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at PMID:28582416

  10. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at

  11. Comparison of dengue virus type 2-specific small RNAs from RNA interference-competent and -incompetent mosquito cells.

    Directory of Open Access Journals (Sweden)

    Jaclyn C Scott


    Full Text Available The exogenous RNA interference (RNAi pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (siRNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2 cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts.

  12. eRNA: a graphic user interface-based tool optimized for large data analysis from high-throughput RNA sequencing. (United States)

    Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang


    RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at

  13. Discovery and validation of Barrett's esophagus microRNA transcriptome by next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Ajay Bansal

    Full Text Available Barrett's esophagus (BE is transition from squamous to columnar mucosa as a result of gastroesophageal reflux disease (GERD. The role of microRNA during this transition has not been systematically studied.For initial screening, total RNA from 5 GERD and 6 BE patients was size fractionated. RNA <70 nucleotides was subjected to SOLiD 3 library preparation and next generation sequencing (NGS. Bioinformatics analysis was performed using R package "DEseq". A p value<0.05 adjusted for a false discovery rate of 5% was considered significant. NGS-identified miRNA were validated using qRT-PCR in an independent group of 40 GERD and 27 BE patients. MicroRNA expression of human BE tissues was also compared with three BE cell lines.NGS detected 19.6 million raw reads per sample. 53.1% of filtered reads mapped to miRBase version 18. NGS analysis followed by qRT-PCR validation found 10 differentially expressed miRNA; several are novel (-708-5p, -944, -224-5p and -3065-5p. Up- or down- regulation predicted by NGS was matched by qRT-PCR in every case. Human BE tissues and BE cell lines showed a high degree of concordance (70-80% in miRNA expression. Prediction analysis identified targets that mapped to developmental signaling pathways such as TGFβ and Notch and inflammatory pathways such as toll-like receptor signaling and TGFβ. Cluster analysis found similarly regulated (up or down miRNA to share common targets suggesting coordination between miRNA.Using highly sensitive next-generation sequencing, we have performed a comprehensive genome wide analysis of microRNA in BE and GERD patients. Differentially expressed miRNA between BE and GERD have been further validated. Expression of miRNA between BE human tissues and BE cell lines are highly correlated. These miRNA should be studied in biological models to further understand BE development.

  14. Systematic Prediction of the Impacts of Mutations in MicroRNA Seed Sequences

    Directory of Open Access Journals (Sweden)

    Bhattacharya Anindya


    Full Text Available MicroRNAs are a class of small non-coding RNAs that are involved in many important biological processes and the dysfunction of microRNA has been associated with many diseases. The seed region of a microRNA is of crucial importance to its target recognition. Mutations in microRNA seed regions may disrupt the binding of microRNAs to their original target genes and make them bind to new target genes. Here we use a knowledge-based computational method to systematically predict the functional effects of all the possible single nucleotide mutations in human microRNA seed regions. The result provides a comprehensive reference for the functional assessment of the impacts of possible natural and artificial single nucleotide mutations in microRNA seed regions.

  15. Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

    International Nuclear Information System (INIS)

    Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo; Gago, Selma


    Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one of the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery

  16. The LncRNA Connectivity Map: Using LncRNA Signatures to Connect Small Molecules, LncRNAs, and Diseases. (United States)

    Yang, Haixiu; Shang, Desi; Xu, Yanjun; Zhang, Chunlong; Feng, Li; Sun, Zeguo; Shi, Xinrui; Zhang, Yunpeng; Han, Junwei; Su, Fei; Li, Chunquan; Li, Xia


    Well characterized the connections among diseases, long non-coding RNAs (lncRNAs) and drugs are important for elucidating the key roles of lncRNAs in biological mechanisms in various biological states. In this study, we constructed a database called LNCmap (LncRNA Connectivity Map), available at , to establish the correlations among diseases, physiological processes, and the action of small molecule therapeutics by attempting to describe all biological states in terms of lncRNA signatures. By reannotating the microarray data from the Connectivity Map database, the LNCmap obtained 237 lncRNA signatures of 5916 instances corresponding to 1262 small molecular drugs. We provided a user-friendly interface for the convenient browsing, retrieval and download of the database, including detailed information and the associations of drugs and corresponding affected lncRNAs. Additionally, we developed two enrichment analysis methods for users to identify candidate drugs for a particular disease by inputting the corresponding lncRNA expression profiles or an associated lncRNA list and then comparing them to the lncRNA signatures in our database. Overall, LNCmap could significantly improve our understanding of the biological roles of lncRNAs and provide a unique resource to reveal the connections among drugs, lncRNAs and diseases.

  17. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs. (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S


    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  18. Full Genome Sequence and sfRNA Interferon Antagonist Activity of Zika Virus from Recife, Brazil.

    Directory of Open Access Journals (Sweden)

    Claire L Donald


    Full Text Available The outbreak of Zika virus (ZIKV in the Americas has transformed a previously obscure mosquito-transmitted arbovirus of the Flaviviridae family into a major public health concern. Little is currently known about the evolution and biology of ZIKV and the factors that contribute to the associated pathogenesis. Determining genomic sequences of clinical viral isolates and characterization of elements within these are an important prerequisite to advance our understanding of viral replicative processes and virus-host interactions.We obtained a ZIKV isolate from a patient who presented with classical ZIKV-associated symptoms, and used high throughput sequencing and other molecular biology approaches to determine its full genome sequence, including non-coding regions. Genome regions were characterized and compared to the sequences of other isolates where available. Furthermore, we identified a subgenomic flavivirus RNA (sfRNA in ZIKV-infected cells that has antagonist activity against RIG-I induced type I interferon induction, with a lesser effect on MDA-5 mediated action.The full-length genome sequence including non-coding regions of a South American ZIKV isolate from a patient with classical symptoms will support efforts to develop genetic tools for this virus. Detection of sfRNA that counteracts interferon responses is likely to be important for further understanding of pathogenesis and virus-host interactions.

  19. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms. (United States)

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli


    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  20. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Directory of Open Access Journals (Sweden)

    Sara Kangaspeska

    Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  1. Characterization and comparative profiling of the small RNA transcriptomes in the Hemipteran insect Nilaparvata lugens. (United States)

    Zha, Wenjun; Zhou, Lei; Li, Sanhe; Liu, Kai; Yang, Guocai; Chen, Zhijun; Liu, Kai; Xu, Huashan; Li, Peide; Hussain, Saddam; You, Aiqing


    MicroRNAs (miRNAs) are a group of small RNAs involved in various biological processes through negative regulation of mRNAs at the post-transcriptional level. The brown planthopper (BPH), Nilaparvata lugens (Stål), is one of the most serious and destructive insect pests of rice. In the present study, two small RNA libraries of virulent N. lugens populations (Biotype I survives on susceptive rice variety TN1 and Biotype Y survives on moderately resistant rice variety YHY15) were constructed and sequenced using the high-throughput sequencing technology in order to identify the relationship between miRNAs of N.lugens and adaptation of BPH pests to rice resistance. In total 15,758,632 and 11,442,592 reads, corresponding to 3,144,026 and 2,550,049 unique sequences, were obtained in the two libraries (BPH-TN1 and BPH-YHY15 libraries), respectively. A total of 41 potential novel miRNAs were predicted in the two libraries, and 26 miRNAs showed significantly differential expression between two libraries. All miRNAs were significantly up-regulated in the BPH-TN1 library. Target genes likely regulated by these differentially expressed miRNAs were predicted using computational prediction. The functional annotation of target genes performed by Gene Ontology enrichment (GO) and Kyoto Encyclopedia of Genes and Genomes pathway analysis (KEGG) indicated that a majority of differential miRNAs were involved in "Metabolism" pathway. These results provided an understanding of the role of miRNAs in BPH to adaptability of BPH on rice resistance, and will be useful in developing new control strategies for host defense against BPH. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Genome-wide Annotation, Identification, and Global Transcriptomic Analysis of Regulatory or Small RNA Gene Expression in Staphylococcus aureus. (United States)

    Carroll, Ronan K; Weiss, Andy; Broach, William H; Wiemels, Richard E; Mogen, Austin B; Rice, Kelly C; Shaw, Lindsey N


    In Staphylococcus aureus, hundreds of small regulatory or small RNAs (sRNAs) have been identified, yet this class of molecule remains poorly understood and severely understudied. sRNA genes are typically absent from genome annotation files, and as a consequence, their existence is often overlooked, particularly in global transcriptomic studies. To facilitate improved detection and analysis of sRNAs in S. aureus, we generated updated GenBank files for three commonly used S. aureus strains (MRSA252, NCTC 8325, and USA300), in which we added annotations for >260 previously identified sRNAs. These files, the first to include genome-wide annotation of sRNAs in S. aureus, were then used as a foundation to identify novel sRNAs in the community-associated methicillin-resistant strain USA300. This analysis led to the discovery of 39 previously unidentified sRNAs. Investigating the genomic loci of the newly identified sRNAs revealed a surprising degree of inconsistency in genome annotation in S. aureus, which may be hindering the analysis and functional exploration of these elements. Finally, using our newly created annotation files as a reference, we perform a global analysis of sRNA gene expression in S. aureus and demonstrate that the newly identified tsr25 is the most highly upregulated sRNA in human serum. This study provides an invaluable resource to the S. aureus research community in the form of our newly generated annotation files, while at the same time presenting the first examination of differential sRNA expression in pathophysiologically relevant conditions. Despite a large number of studies identifying regulatory or small RNA (sRNA) genes in Staphylococcus aureus, their annotation is notably lacking in available genome files. In addition to this, there has been a considerable lack of cross-referencing in the wealth of studies identifying these elements, often leading to the same sRNA being identified multiple times and bearing multiple names. In this work

  3. Integrated mRNA and microRNA analysis identifies genes and small miRNA molecules associated with transcriptional and post-transcriptional-level responses to both drought stress and re-watering treatment in tobacco. (United States)

    Chen, Qiansi; Li, Meng; Zhang, Zhongchun; Tie, Weiwei; Chen, Xia; Jin, Lifeng; Zhai, Niu; Zheng, Qingxia; Zhang, Jianfeng; Wang, Ran; Xu, Guoyun; Zhang, Hui; Liu, Pingping; Zhou, Huina


    Drought stress is one of the most severe problem limited agricultural productivity worldwide. It has been reported that plants response to drought-stress by sophisticated mechanisms at both transcriptional and post-transcriptional levels. However, the precise molecular mechanisms governing the responses of tobacco leaves to drought stress and water status are not well understood. To identify genes and miRNAs involved in drought-stress responses in tobacco, we performed both mRNA and small RNA sequencing on tobacco leaf samples from the following three treatments: untreated-control (CL), drought stress (DL), and re-watering (WL). In total, we identified 798 differentially expressed genes (DEGs) between the DL and CL (DL vs. CL) treatments and identified 571 DEGs between the WL and DL (WL vs. DL) treatments. Further analysis revealed 443 overlapping DEGs between the DL vs. CL and WL vs. DL comparisons, and, strikingly, all of these genes exhibited opposing expression trends between these two comparisons, strongly suggesting that these overlapping DEGs are somehow involved in the responses of tobacco leaves to drought stress. Functional annotation analysis showed significant up-regulation of genes annotated to be involved in responses to stimulus and stress, (e.g., late embryogenesis abundant proteins and heat-shock proteins) antioxidant defense (e.g., peroxidases and glutathione S-transferases), down regulation of genes related to the cell cycle pathway, and photosynthesis processes. We also found 69 and 56 transcription factors (TFs) among the DEGs in, respectively, the DL vs. CL and the WL vs. DL comparisons. In addition, small RNA sequencing revealed 63 known microRNAs (miRNA) from 32 families and 368 novel miRNA candidates in tobacco. We also found that five known miRNA families (miR398, miR390, miR162, miR166, and miR168) showed differential regulation under drought conditions. Analysis to identify negative correlations between the differentially expressed mi

  4. RNA shotgun metagenomic sequencing of northern California (USA mosquitoes uncovers viruses, bacteria, and fungi

    Directory of Open Access Journals (Sweden)

    James Angus eChandler


    Full Text Available Mosquitoes, most often recognized for the microbial agents of disease they may carry, harbor diverse microbial communities that include viruses, bacteria, and fungi, collectively called the microbiota. The composition of the microbiota can directly and indirectly affect disease transmission through microbial interactions that could be revealed by its characterization in natural populations of mosquitoes. Furthermore, the use of shotgun metagenomic sequencing (SMS approaches could allow the discovery of unknown members of the microbiota. In this study, we use RNA SMS to characterize the microbiota of seven individual mosquitoes (species include Culex pipiens, Culiseta incidens, and Ochlerotatus sierrensis collected from a variety of habitats in California, USA. Sequencing was performed on the Illumina HiSeq platform and the resulting sequences were quality-checked and assembled into contigs using the A5 pipeline. Sequences related to single stranded RNA viruses of the Bunyaviridae and Rhabdoviridae were uncovered, along with an unclassified genus of double-stranded RNA viruses. Phylogenetic analysis finds that in all three cases, the closest relatives of the identified viral sequences are other mosquito-associated viruses, suggesting widespread host-group specificity among disparate viral taxa. Interestingly, we identified a Narnavirus of fungi, also reported elsewhere in mosquitoes, that potentially demonstrates a nested host-parasite association between virus, fungi, and mosquito. Sequences related to 8 bacterial families and 13 fungal families were found across the seven samples. Bacillus and Escherichia/Shigella were identified in all samples and Wolbachia was identified in all Cx. pipiens samples, while no single fungal genus was found in more than two samples. This study exemplifies the utility of RNA SMS in the characterization of the natural microbiota of mosquitoes and, in particular, the value of identifying all microbes associated with

  5. NSun2-Mediated Cytosine-5 Methylation of Vault Noncoding RNA Determines Its Processing into Regulatory Small RNAs

    Directory of Open Access Journals (Sweden)

    Shobbir Hussain


    Full Text Available Autosomal-recessive loss of the NSUN2 gene has been identified as a causative link to intellectual disability disorders in humans. NSun2 is an RNA methyltransferase modifying cytosine-5 in transfer RNAs (tRNAs, yet the identification of cytosine methylation in other RNA species has been hampered by the lack of sensitive and reliable molecular techniques. Here, we describe miCLIP as an additional approach for identifying RNA methylation sites in transcriptomes. miCLIP is a customized version of the individual-nucleotide-resolution crosslinking and immunoprecipitation (iCLIP method. We confirm site-specific methylation in tRNAs and additional messenger and noncoding RNAs (ncRNAs. Among these, vault ncRNAs contained six NSun2-methylated cytosines, three of which were confirmed by RNA bisulfite sequencing. Using patient cells lacking the NSun2 protein, we further show that loss of cytosine-5 methylation in vault RNAs causes aberrant processing into Argonaute-associated small RNA fragments that can function as microRNAs. Thus, impaired processing of vault ncRNA may contribute to the etiology of NSun2-deficiency human disorders.

  6. Accounting for technical noise in differential expression analysis of single-cell RNA sequencing data. (United States)

    Jia, Cheng; Hu, Yu; Kelly, Derek; Kim, Junhyong; Li, Mingyao; Zhang, Nancy R


    Recent technological breakthroughs have made it possible to measure RNA expression at the single-cell level, thus paving the way for exploring expression heterogeneity among individual cells. Current single-cell RNA sequencing (scRNA-seq) protocols are complex and introduce technical biases that vary across cells, which can bias downstream analysis without proper adjustment. To account for cell-to-cell technical differences, we propose a statistical framework, TASC (Toolkit for Analysis of Single Cell RNA-seq), an empirical Bayes approach to reliably model the cell-specific dropout rates and amplification bias by use of external RNA spike-ins. TASC incorporates the technical parameters, which reflect cell-to-cell batch effects, into a hierarchical mixture model to estimate the biological variance of a gene and detect differentially expressed genes. More importantly, TASC is able to adjust for covariates to further eliminate confounding that may originate from cell size and cell cycle differences. In simulation and real scRNA-seq data, TASC achieves accurate Type I error control and displays competitive sensitivity and improved robustness to batch effects in differential expression analysis, compared to existing methods. TASC is programmed to be computationally efficient, taking advantage of multi-threaded parallelization. We believe that TASC will provide a robust platform for researchers to leverage the power of scRNA-seq. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming. (United States)

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben


    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

  8. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences (United States)

    Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří


    The purpose of the proposed web server, publicly available at, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580

  9. Optimal packaging of FIV genomic RNA depends upon a conserved long-range interaction and a palindromic sequence within gag. (United States)

    Rizvi, Tahir A; Kenyon, Julia C; Ali, Jahabar; Aktar, Suriya J; Phillip, Pretty S; Ghazawi, Akela; Mustafa, Farah; Lever, Andrew M L


    The feline immunodeficiency virus (FIV) is a lentivirus that is related to human immunodeficiency virus (HIV), causing a similar pathology in cats. It is a potential small animal model for AIDS and the FIV-based vectors are also being pursued for human gene therapy. Previous studies have mapped the FIV packaging signal (ψ) to two or more discontinuous regions within the 5' 511 nt of the genomic RNA and structural analyses have determined its secondary structure. The 5' and 3' sequences within ψ region interact through extensive long-range interactions (LRIs), including a conserved heptanucleotide interaction between R/U5 and gag. Other secondary structural elements identified include a conserved 150 nt stem-loop (SL2) and a small palindromic stem-loop within gag open reading frame that might act as a viral dimerization initiation site. We have performed extensive mutational analysis of these sequences and structures and ascertained their importance in FIV packaging using a trans-complementation assay. Disrupting the conserved heptanucleotide LRI to prevent base pairing between R/U5 and gag reduced packaging by 2.8-5.5 fold. Restoration of pairing using an alternative, non-wild type (wt) LRI sequence restored RNA packaging and propagation to wt levels, suggesting that it is the structure of the LRI, rather than its sequence, that is important for FIV packaging. Disrupting the palindrome within gag reduced packaging by 1.5-3-fold, but substitution with a different palindromic sequence did not restore packaging completely, suggesting that the sequence of this region as well as its palindromic nature is important. Mutation of individual regions of SL2 did not have a pronounced effect on FIV packaging, suggesting that either it is the structure of SL2 as a whole that is necessary for optimal packaging, or that there is redundancy within this structure. The mutational analysis presented here has further validated the previously predicted RNA secondary structure of FIV

  10. Identification and characterization of novel serum microRNA candidates from deep sequencing in cervical cancer patients. (United States)

    Juan, Li; Tong, Hong-li; Zhang, Pengjun; Guo, Guanghong; Wang, Zi; Wen, Xinyu; Dong, Zhennan; Tian, Ya-ping


    Small non-coding microRNAs (miRNAs) are involved in cancer development and progression, and serum profiles of cervical cancer patients may be useful for identifying novel miRNAs. We performed deep sequencing on serum pools of cervical cancer patients and healthy controls with 3 replicates and constructed a small RNA library. We used MIREAP to predict novel miRNAs and identified 2 putative novel miRNAs between serum pools of cervical cancer patients and healthy controls after filtering out pseudo-pre-miRNAs using Triplet-SVM analysis. The 2 putative novel miRNAs were validated by real time PCR and were significantly decreased in cervical cancer patients compared with healthy controls. One novel miRNA had an area under curve (AUC) of 0.921 (95% CI: 0.883, 0.959) with a sensitivity of 85.7% and a specificity of 88.2% when discriminating between cervical cancer patients and healthy controls. Our results suggest that characterizing serum profiles of cervical cancers by Solexa sequencing may be a good method for identifying novel miRNAs and that the validated novel miRNAs described here may be cervical cancer-associated biomarkers.

  11. Calling genotypes from public RNA-sequencing data enables identification of genetic variants that affect gene-expression levels

    NARCIS (Netherlands)

    Deelen, Patrick; Zhernakova, Daria V.; de Haan, Mark; van der Sijde, Marijke; Bonder, Marc Jan; Karjalainen, Juha; van der Velde, K. Joeri; Abbott, Kristin M.; Fu, Jingyuan; Wijmenga, Cisca; Sinke, Richard J.; Swertz, Morris A.; Franke, Lude


    Background: RNA-sequencing (RNA-seq) is a powerful technique for the identification of genetic variants that affect gene-expression levels, either through expression quantitative trait locus (eQTL) mapping or through allele-specific expression (ASE) analysis. Given increasing numbers of RNA-seq

  12. Genome-Wide Analysis of Gene and microRNA Expression in Diploid and Autotetraploid Paulownia fortunei (Seem Hemsl. under Drought Stress by Transcriptome, microRNA, and Degradome Sequencing

    Directory of Open Access Journals (Sweden)

    Zhenli Zhao


    Full Text Available Drought is a common and recurring climatic condition in many parts of the world, and it can have disastrous impacts on plant growth and development. Many genes involved in the drought response of plants have been identified. Transcriptome, microRNA (miRNA, and degradome analyses are rapid ways of identifying drought-responsive genes. The reference genome sequence of Paulownia fortunei (Seem Hemsl. is now available, which makes it easier to explore gene expression, transcriptional regulation, and post-transcriptional in this species. In this study, four transcriptome, small RNA, and degradome libraries were sequenced by Illumina sequencing, respectively. A total of 258 genes and 11 miRNAs were identified for drought-responsive genes and miRNAs in P. fortunei. Degradome sequencing detected 28 miRNA target genes that were cleaved by members of nine conserved miRNA families and 12 novel miRNAs. The results here will contribute toward enriching our understanding of the response of Paulownia fortunei trees to drought stress and may provide new direction for further experimental studies related the development of molecular markers, the genetic map construction, and other genomic research projects in Paulownia.

  13. Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping (United States)

    Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.


    Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.

  14. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer. (United States)

    Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A


    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

  15. On the optimal trimming of high-throughput mRNA sequence data

    Directory of Open Access Journals (Sweden)

    Matthew D MacManes


    Full Text Available The widespread and rapid adoption of high-throughput sequencing technologies has afforded researchers the opportunity to gain a deep understanding of genome level processes that underlie evolutionary change, and perhaps more importantly, the links between genotype and phenotype. In particular, researchers interested in functional biology and adaptation have used these technologies to sequence mRNA transcriptomes of specific tissues, which in turn are often compared to other tissues, or other individuals with different phenotypes. While these techniques are extremely powerful, careful attention to data quality is required. In particular, because high-throughput sequencing is more error-prone than traditional Sanger sequencing, quality trimming of sequence reads should be an important step in all data processing pipelines. While several software packages for quality trimming exist, no general guidelines for the specifics of trimming have been developed. Here, using empirically derived sequence data, I provide general recommendations regarding the optimal strength of trimming, specifically in mRNA-Seq studies. Although very aggressive quality trimming is common, this study suggests that a more gentle trimming, specifically of those nucleotides whose Phred score < 2 or < 5, is optimal for most studies across a wide variety of metrics.

  16. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification. (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant


    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  17. Genome-wide identification of soybean microRNA responsive to soybean cyst nematodes infection by deep sequencing. (United States)

    Tian, Bin; Wang, Shichen; Todd, Timothy C; Johnson, Charles D; Tang, Guiliang; Trick, Harold N


    The soybean cyst nematode (SCN), Heterodera glycines, is one of the most devastating diseases limiting soybean production worldwide. It is known that small RNAs, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), play important roles in regulating plant growth and development, defense against pathogens, and responses to environmental changes. In order to understand the role of soybean miRNAs during SCN infection, we analyzed 24 small RNA libraries including three biological replicates from two soybean cultivars (SCN susceptible KS4607, and SCN HG Type 7 resistant KS4313N) that were grown under SCN-infested and -noninfested soil at two different time points (SCN feeding establishment and egg production). In total, 537 known and 70 putative novel miRNAs in soybean were identified from a total of 0.3 billion reads (average about 13.5 million reads for each sample) with the programs of Bowtie and miRDeep2 mapper. Differential expression analyses were carried out using edgeR to identify miRNAs involved in the soybean-SCN interaction. Comparative analysis of miRNA profiling indicated a total of 60 miRNAs belonging to 25 families that might be specifically related to cultivar responses to SCN. Quantitative RT-PCR validated similar miRNA interaction patterns as sequencing results. These findings suggest that miRNAs are likely to play key roles in soybean response to SCN. The present work could provide a framework for miRNA functional identification and the development of novel approaches for improving soybean SCN resistance in future studies.

  18. Enhancing potency of siRNA targeting fusion genes by optimization outside of target sequence. (United States)

    Gavrilov, Kseniya; Seo, Young-Eun; Tietjen, Gregory T; Cui, Jiajia; Cheng, Christopher J; Saltzman, W Mark


    Canonical siRNA design algorithms have become remarkably effective at predicting favorable binding regions within a target mRNA, but in some cases (e.g., a fusion junction site) region choice is restricted. In these instances, alternative approaches are necessary to obtain a highly potent silencing molecule. Here we focus on strategies for rational optimization of two siRNAs that target the junction sites of fusion oncogenes BCR-ABL and TMPRSS2-ERG. We demonstrate that modifying the termini of these siRNAs with a terminal G-U wobble pair or a carefully selected pair of terminal asymmetry-enhancing mismatches can result in an increase in potency at low doses. Importantly, we observed that improvements in silencing at the mRNA level do not necessarily translate to reductions in protein level and/or cell death. Decline in protein level is also heavily influenced by targeted protein half-life, and delivery vehicle toxicity can confound measures of cell death due to silencing. Therefore, for BCR-ABL, which has a long protein half-life that is difficult to overcome using siRNA, we also developed a nontoxic transfection vector: poly(lactic-coglycolic acid) nanoparticles that release siRNA over many days. We show that this system can achieve effective killing of leukemic cells. These findings provide insights into the implications of siRNA sequence for potency and suggest strategies for the design of more effective therapeutic siRNA molecules. Furthermore, this work points to the importance of integrating studies of siRNA design and delivery, while heeding and addressing potential limitations such as restricted targetable mRNA regions, long protein half-lives, and nonspecific toxicities.

  19. Slicer-independent mechanism drives small-RNA strand separation during human RISC assembly. (United States)

    Park, June Hyun; Shin, Chanseok


    Small RNA silencing is mediated by the effector RNA-induced silencing complex (RISC) that consists of an Argonaute protein (AGOs 1-4 in humans). A fundamental step during RISC assembly involves the separation of two strands of a small RNA duplex, whereby only the guide strand is retained to form the mature RISC, a process not well understood. Despite the widely accepted view that 'slicer-dependent unwinding' via passenger-strand cleavage is a prerequisite for the assembly of a highly complementary siRNA into the AGO2-RISC, here we show by careful re-examination that 'slicer-independent unwinding' plays a more significant role in human RISC maturation than previously appreciated, not only for a miRNA duplex, but, unexpectedly, for a highly complementary siRNA as well. We discovered that 'slicer-dependency' for the unwinding was affected primarily by certain parameters such as temperature and Mg(2+). We further validate these observations in non-slicer AGOs (1, 3 and 4) that can be programmed with siRNAs at the physiological temperature of humans, suggesting that slicer-independent mechanism is likely a common feature of human AGOs. Our results now clearly explain why both miRNA and siRNA are found in all four human AGOs, which is in striking contrast to the strict small-RNA sorting system in Drosophila. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. A novel RNA sequencing data analysis method for cell line authentication.

    Directory of Open Access Journals (Sweden)

    Erik Fasterius

    Full Text Available We have developed a novel analysis method that can interrogate the authenticity of biological samples used for generation of transcriptome profiles in public data repositories. The method uses RNA sequencing information to reveal mutations in expressed transcripts and subsequently confirms the identity of analysed cells by comparison with publicly available cell-specific mutational profiles. Cell lines constitute key model systems widely used within cancer research, but their identity needs to be confirmed in order to minimise the influence of cell contaminations and genetic drift on the analysis. Using both public and novel data, we demonstrate the use of RNA-sequencing data analysis for cell line authentication by examining the validity of COLO205, DLD1, HCT15, HCT116, HKE3, HT29 and RKO colorectal cancer cell lines. We successfully authenticate the studied cell lines and validate previous reports indicating that DLD1 and HCT15 are synonymous. We also show that the analysed HKE3 cells harbour an unexpected KRAS-G13D mutation and confirm that this cell line is a genuine KRAS dosage mutant, rather than a true isogenic derivative of HCT116 expressing only the wild type KRAS. This authentication method could be used to revisit the numerous cell line based RNA sequencing experiments available in public data repositories, analyse new experiments where whole genome sequencing is not available, as well as facilitate comparisons of data from different experiments, platforms and laboratories.

  1. Effect of chronic uremia on the transcriptional profile of the calcified aorta analyzed by RNA sequencing

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Gravesen, Eva; Mace, Maria L.


    The development of vascular calcification (VC) in chronic uremia (CU) is a tightly regulated process controlled by factors promoting and inhibiting mineralization. Next-generation high-throughput RNA sequencing (RNA-seq) is a powerful and sensitive tool for quantitative gene expression profiling...... with an expression level of >1 reads/kilobase transcript/million mapped reads, 2,663 genes were differentially expressed with 47% upregulated genes and 53% downregulated genes in uremic rats. Significantly deregulated genes were enriched for ontologies related to the extracellular matrix, response to wounding...

  2. A Capture-SELEX Strategy for Multiplexed Selection of RNA Aptamers Against Small Molecules

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Doessing, Holger B.; Long, Katherine S.


    -SELEX, a selection strategy that uses an RNA library to yield ligand-responsive RNA aptamers targeting small organic molecules in solution. To demonstrate the power of this method we selected several aptamers with specificity towards either the natural sweetener rebaudioside A or the food-coloring agent carminic...

  3. Small RNA and A-to-I Editing in Autism Spectrum Disorders (United States)

    Eran, Alal

    One in every 88 children is diagnosed with Autism Spectrum Disorders (ASDs), a set of neurodevelopmental conditions characterized by social impairments, communication deficits, and repetitive behavior. ASDs have a substantial genetic component, but the specific cause of most cases remains unknown. Understanding gene-environment interactions underlying ASD is essential for improving early diagnosis and identifying critical targets for intervention and prevention. Towards this goal, we surveyed adenosine-to-inosine (A-to-I) RNA editing in autistic brains. A-to-I editing is an epigenetic mechanism that fine-tunes synaptic function in response to environmental stimuli, shown to modulate complex behavior in animals. We used ultradeep sequencing to quantify A-to-I receding of candidate synaptic genes in postmortem cerebella from individuals with ASD and neurotypical controls. We found unexpectedly wide distributions of human A-to-I editing levels, whose extremes were consistently populated by individuals with ASD. We correlated A-to-I editing with isoform usage, identified clusters of correlated sites, and examined differential editing patterns. Importantly, we found that individuals with ASD commonly use a dysfunctional form of the editing enzyme ADARB1. We next profiled small RNAs thought to regulate A-to-I editing, which originate from one of the most commonly altered loci in ASD, 15q11. Deep targeted sequencing of SNORD115 and SNORD116 transcripts enabled their high-resolution detection in human brains, and revealed a strong gender bias underlying their expression. The consistent 2-fold upregulation of 15q11 small RNAs in male vs. female cerebella could be important in delineating the role of this locus in ASD, a male dominant disorder. Overall, these studies provide an accurate population-level view of small RNA and A-to-I editing in human cerebella, and suggest that A-to-I editing of synaptic genes may be informative for assessing the epigenetic risk for autism

  4. Structural insights into mechanisms of the small RNA methyltransferase HEN1

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Ying; Ji, Lijuan; Huang, Qichen; Vassylyev, Dmitry G.; Chen, Xuemei; Ma, Jin-Biao; (UAB); (UCR)


    RNA silencing is a conserved regulatory mechanism in fungi, plants and animals that regulates gene expression and defence against viruses and transgenes. Small silencing RNAs of {approx}20-30 nucleotides and their associated effector proteins, the Argonaute family proteins, are the central components in RNA silencing. A subset of small RNAs, such as microRNAs and small interfering RNAs (siRNAs) in plants, Piwi-interacting RNAs in animals and siRNAs in Drosophila, requires an additional crucial step for their maturation; that is, 2'-O-methylation on the 3' terminal nucleotide. A conserved S-adenosyl-L-methionine-dependent RNA methyltransferase, HUA ENHANCER 1 (HEN1), and its homologues are responsible for this specific modification. Here we report the 3.1 {angstrom} crystal structure of full-length HEN1 from Arabidopsis in complex with a 22-nucleotide small RNA duplex and cofactor product S-adenosyl-L-homocysteine. Highly cooperative recognition of the small RNA substrate by multiple RNA binding domains and the methyltransferase domain in HEN1 measures the length of the RNA duplex and determines the substrate specificity. Metal ion coordination by both 2' and 3' hydroxyls on the 3'-terminal nucleotide and four invariant residues in the active site of the methyltransferase domain suggests a novel Mg{sup 2+}-dependent 2'-O-methylation mechanism.

  5. Sequence-based heuristics for faster annotation of non-coding RNA families. (United States)

    Weinberg, Zasha; Ruzzo, Walter L


    Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

  6. visnormsc: A Graphical User Interface to Normalize Single-cell RNA Sequencing Data. (United States)

    Tang, Lijun; Zhou, Nan


    Single-cell RNA sequencing (RNA-seq) allows the analysis of gene expression with high resolution. The intrinsic defects of this promising technology imports technical noise into the single-cell RNA-seq data, increasing the difficulty of accurate downstream inference. Normalization is a crucial step in single-cell RNA-seq data pre-processing. SCnorm is an accurate and efficient method that can be used for this purpose. An R implementation of this method is currently available. On one hand, the R package possesses many excellent features from R. On the other hand, R programming ability is required, which prevents the biologists who lack the skills from learning to use it quickly. To make this method more user-friendly, we developed a graphical user interface, visnormsc, for normalization of single-cell RNA-seq data. It is implemented in Python and is freely available at . Although visnormsc is based on the existing method, it contributes to this field by offering a user-friendly alternative. The out-of-the-box and cross-platform features make visnormsc easy to learn and to use. It is expected to serve biologists by simplifying single-cell RNA-seq normalization.

  7. Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia. (United States)

    Kojima, Kenji K; Jurka, Jerzy


    Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an "archaeal" RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes.

  8. Determining RNA quality for NextGen sequencing: some exceptions to the gold standard rule of 23S to 16S rRNA ratio (United States)

    Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...

  9. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus. (United States)

    Hammond, R W; Crosslin, J M


    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  10. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    International Nuclear Information System (INIS)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S.; Arbuthnot, Patrick


    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  11. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    Energy Technology Data Exchange (ETDEWEB)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S. [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa); Arbuthnot, Patrick, E-mail: [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa)


    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  12. Single-cell RNA sequencing reveals metallothionein heterogeneity during hESC differentiation to definitive endoderm

    Directory of Open Access Journals (Sweden)

    Junjie Lu


    Full Text Available Differentiation of human pluripotent stem cells towards definitive endoderm (DE is the critical first step for generating cells comprising organs such as the gut, liver, pancreas and lung. This in-vitro differentiation process generates a heterogeneous population with a proportion of cells failing to differentiate properly and maintaining expression of pluripotency factors such as Oct4. RNA sequencing of single cells collected at four time points during a 4-day DE differentiation identified high expression of metallothionein genes in the residual Oct4-positive cells that failed to differentiate to DE. Using X-ray fluorescence microscopy and multi-isotope mass spectrometry, we discovered that high intracellular zinc level corresponds with persistent Oct4 expression and failure to differentiate. This study improves our understanding of the cellular heterogeneity during in-vitro directed differentiation and provides a valuable resource to improve DE differentiation efficiency. Keywords: hPSC, Differentiation, Definitive endoderm, Heterogeneity, Single cell, RNA sequencing

  13. Quantifying alternative splicing from paired-end RNA-sequencing data


    Rossell, David; Stephan-Otto Attolini, Camille; Kroiss, Manuel; Stöcker, Almond


    RNA-sequencing has revolutionized biomedical research and, in particular, our ability to study gene alternative splicing. The problem has important implications for human health, as alternative splicing may be involved in malfunctions at the cellular level and multiple diseases. However, the high-dimensional nature of the data and the existence of experimental biases pose serious data analysis challenges. We find that the standard data summaries used to study alternative splicing are severely...

  14. Screening for sequence-specific RNA-BPs by comprehensive UV crosslinking

    Directory of Open Access Journals (Sweden)

    Le Meuth-Metzinger Valerie


    Full Text Available Abstract Background Specific cis-elements and the associated trans-acting factors have been implicated in the post-transcriptional regulation of gene expression. In the era of genome wide analyses identifying novel trans-acting factors and cis-regulatory elements is a step towards understanding coordinated gene expression. UV-crosslink analysis is a standard method used to identify RNA-binding proteins. Uridine is traditionally used to radiolabel substrate RNAs, however, proteins binding to cis-elments particularly uridine poor will be weakly or not detected. We evaluate here the possibility of using UV-crosslinking with RNA substrates radiolabeled with each of the four ribonucleotides as an approach for screening for novel sequence specific RNA-binding proteins. Results The radiolabeled RNA substrates were derived from the 3'UTRs of the cloned Eg and c-mos Xenopus laevis maternal mRNAs. Specific, but not identical, uv-crosslinking signals were obtained, some of which corresponded to already identified proteins. A signal for a novel 90 kDa protein was observed with the c-mos 3'UTR radiolabeled with both CTP and GTP but not with UTP. The binding site of the 90 kDa RNA-binding protein was localised to a 59-nucleotide portion of the c-mos 3'UTR. Conclusion That the 90 kDa signal was detected with RNAs radiolabeled with CTP or GTP but not UTP illustrates the advantage of radiolabeling all four nucleotides in a UV-crosslink based screen. This method can be used for both long and short RNAs and does not require knowledge of the cis-acting sequence. It should be amenable to high throughput screening for RNA binding proteins.

  15. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity (United States)


    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  16. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses. (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P


    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  17. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing. (United States)

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li


    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

  18. CoverageAnalyzer (CAn: A Tool for Inspection of Modification Signatures in RNA Sequencing Profiles

    Directory of Open Access Journals (Sweden)

    Ralf Hauenschild


    Full Text Available Combination of reverse transcription (RT and deep sequencing has emerged as a powerful instrument for the detection of RNA modifications, a field that has seen a recent surge in activity because of its importance in gene regulation. Recent studies yielded high-resolution RT signatures of modified ribonucleotides relying on both sequence-dependent mismatch patterns and reverse transcription arrests. Common alignment viewers lack specialized functionality, such as filtering, tailored visualization, image export and differential analysis. Consequently, the community will profit from a platform seamlessly connecting detailed visual inspection of RT signatures and automated screening for modification candidates. CoverageAnalyzer (CAn was developed in response to the demand for a powerful inspection tool. It is freely available for all three main operating systems. With SAM file format as standard input, CAn is an intuitive and user-friendly tool that is generally applicable to the large community of biomedical users, starting from simple visualization of RNA sequencing (RNA-Seq data, up to sophisticated modification analysis with significance-based modification candidate calling.

  19. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.


    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...

  20. Identification and analysis of pig chimeric mRNAs using RNA sequencing data (United States)


    Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

  1. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Ma Lei


    Full Text Available Abstract Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs.

  2. RNA isolation for transcriptomics of human and mouse small skin biopsies

    Directory of Open Access Journals (Sweden)

    Breit Timo M


    Full Text Available Abstract Background Isolation of RNA from skin biopsies presents a challenge, due to the tough nature of skin tissue and a high presence of RNases. As we lacked the dedicated equipment, i.e. homogenizer or bead-beater, needed for the available RNA from skin isolation methods, we adapted and tested our zebrafish single-embryo RNA-isolation protocol for RNA isolation from skin punch biopsies. Findings We tested our new RNA-isolation protocol in two experiments: a large-scale study with 97 human skin samples, and a small study with 16 mouse skin samples. Human skin was sampled with 4.0 mm biopsy punches and for the mouse skin different punch diameter sizes were tested; 1.0, 1.5, 2.0, and 2.5 mm. The average RNA yield in human samples was 1.5 μg with an average RNA quality RIN value of 8.1. For the mouse biopsies, the average RNA yield was 2.4 μg with an average RIN value of 7.5. For 96% of the human biopsies and 100% of the mouse biopsies we obtained enough high-quality RNA. The RNA samples were successfully tested in a transcriptomics analysis using the Affymetrix and Roche NimbleGen platforms. Conclusions Using our new RNA-isolation protocol, we were able to consistently isolate high-quality RNA, which is apt for further transcriptomics analysis. Furthermore, this method is already useable on biopsy material obtained with a punch diameter as small as 1.5 mm.

  3. Examining the intersection between splicing, nuclear export and small RNA pathways. (United States)

    Nabih, Amena; Sobotka, Julia A; Wu, Monica Z; Wedeles, Christopher J; Claycomb, Julie M


    Nuclear Argonaute/small RNA pathways in a variety of eukaryotic species are generally known to regulate gene expression via chromatin modulation and transcription attenuation in a process known as transcriptional gene silencing (TGS). However, recent data, including genetic screens, phylogenetic profiling, and molecular mechanistic studies, also point to a novel and emerging intersection between the splicing and nuclear export machinery with nuclear Argonaute/small RNA pathways in many organisms. In this review, we summarize the field's current understanding regarding the relationship between splicing, export and small RNA pathways, and consider the biological implications for coordinated regulation of transcripts by these pathways. We also address the importance and available approaches for understanding the RNA regulatory logic generated by the intersection of these particular pathways in the context of synthetic biology. The interactions between various eukaryotic RNA regulatory pathways, particularly splicing, nuclear export and small RNA pathways provide a type of combinatorial code that informs the identity ("self" versus "non-self") and dictates the fate of each transcript in a cell. Although the molecular mechanisms for how splicing and nuclear export impact small RNA pathways are not entirely clear at this early stage, the links between these pathways are widespread across eukaryotic phyla. The link between splicing, nuclear export, and small RNA pathways is emerging and establishes a new frontier for understanding the combinatorial logic of gene regulation across species that could someday be harnessed for therapeutic, biotechnology and agricultural applications. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. RNA Sequencing Reveals that Kaposi Sarcoma-Associated Herpesvirus Infection Mimics Hypoxia Gene Expression Signature (United States)

    Viollet, Coralie; Davis, David A.; Tekeste, Shewit S.; Reczko, Martin; Pezzella, Francesco; Ragoussis, Jiannis


    Kaposi sarcoma-associated herpesvirus (KSHV) causes several tumors and hyperproliferative disorders. Hypoxia and hypoxia-inducible factors (HIFs) activate latent and lytic KSHV genes, and several KSHV proteins increase the cellular levels of HIF. Here, we used RNA sequencing, qRT-PCR, Taqman assays, and pathway analysis to explore the miRNA and mRNA response of uninfected and KSHV-infected cells to hypoxia, to compare this with the genetic changes seen in chronic latent KSHV infection, and to explore the degree to which hypoxia and KSHV infection interact in modulating mRNA and miRNA expression. We found that the gene expression signatures for KSHV infection and hypoxia have a 34% overlap. Moreover, there were considerable similarities between the genes up-regulated by hypoxia in uninfected (SLK) and in KSHV-infected (SLKK) cells. hsa-miR-210, a HIF-target known to have pro-angiogenic and anti-apoptotic properties, was significantly up-regulated by both KSHV infection and hypoxia using Taqman assays. Interestingly, expression of KSHV-encoded miRNAs was not affected by hypoxia. These results demonstrate that KSHV harnesses a part of the hypoxic cellular response and that a substantial portion of hypoxia-induced changes in cellular gene expression are induced by KSHV infection. Therefore, targeting hypoxic pathways may be a useful way to develop therapeutic strategies for KSHV-related diseases. PMID:28046107

  5. Misinterpreting the therapeutic effects of small interfering RNA caused by immune stimulation. (United States)

    Robbins, Marjorie; Judge, Adam; Ambegia, Ellen; Choi, Catherine; Yaworski, Ed; Palmer, Lorne; McClintock, Kevin; MacLachlan, Ian


    Activation of innate immunity has direct effects in modulating viral replication, tumor growth, angiogenesis, and inflammatory and other immunological processes. It is now established that unmodified siRNA can activate this innate immune response and therefore there is real potential for siRNA to elicit nonspecific therapeutic effects in a wide range of disease models. Here we demonstrate that in a murine model of influenza infection, the antiviral activity of siRNA is due primarily to immune stimulation elicited by the active siRNA duplexes and is not the result of therapeutic RNA interference (RNAi) as previously reported. We show that the misinterpretation stems from the use of a particular control green fluorescent protein (GFP) siRNA that we identify as having unusually low immunostimulatory activity compared with the active anti-influenza siRNA. Curiously, this GFP siRNA has served as a negative control for a surprising number of groups reporting therapeutic effects of siRNA. The inert immunologic profile of the GFP sequence was unique among a broad panel of published siRNAs, all of which could elicit significant interferon induction from primary immune cells. This panel included eight active siRNAs against viral, angiogenic, and oncologic targets, the reported therapeutic efficacy of which was based on comparison with the nonimmunostimulatory GFP siRNA. These results emphasize the need for researchers to anticipate, monitor, and adequately control for siRNA-mediated immune stimulation and calls into question the interpretation of numerous published reports of therapeutic RNAi in vivo. The use of chemically modified siRNA with minimal immunostimulatory capacity will help to delineate more accurately the mechanism of action underlying such studies.

  6. Deep Sequence Analysis of AgoshRNA Processing Reveals 3’ A Addition and Trimming

    Directory of Open Access Journals (Sweden)

    Alex Harwig


    Full Text Available The RNA interference (RNAi pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA, was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2 slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp. This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3’ strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3’ tail of 1–3 A-nucleotides (nt and we present evidence that this product is subsequently trimmed by the poly(A-specific ribonuclease (PARN.

  7. RNA-binding domain of the A protein component of the U1 small nuclear ribonucleoprotein analyzed by NMR spectroscopy is structurally similar to ribosomal proteins

    International Nuclear Information System (INIS)

    Hoffman, D.W.; Query, C.C.; Golden, B.L.; White, S.W.; Keene, J.D.


    An RNA recognition motif (RRM) of ∼80 amino acids constitutes the core of RNA-binding domains found in a large family of proteins involved in RNA processing. The U1 RNA-binding domain of the A protein component of the human U1 small nuclear ribonucleoprotein (RNP), which encompasses the RRM sequence, was analyzed by using NMR spectroscopy. The domain of the A protein is a highly stable monomer in solution consisting of four antiparallel β-strands and two α-helices. The highly conserved RNP1 and RNP2 consensus sequences, containing residues previously suggested to be involved in nucleic acid binding, are juxtaposed in adjacent β-strands. Conserved aromatic side chains that are critical for RNA binding are clustered on the surface to the molecule adjacent to a variable loop that influences recognition of specific RNA sequences. The secondary structure and topology of the RRM are similar to those of ribosomal proteins L12 and L30, suggesting a distant evolutionary relationship between these two types of RNA-associated proteins

  8. Comparison of two approaches for the classification of 16S rRNA gene sequences. (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan


    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

  9. Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries in a small scale sequencing project

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A


    Full Text Available Abstract Background Subtractive hybridization methods are valuable tools for identifying differentially regulated genes in a given tissue avoiding redundant sequencing of clones representing the same expressed genes, maximizing detection of low abundant transcripts and thus, affecting the efficiency and cost effectiveness of small scale cDNA sequencing projects aimed to the specific identification of useful genes for breeding purposes. The objective of this work is to evaluate alternative strategies to high-throughput sequencing projects for the identification of novel genes differentially expressed in sunflower as a source of organ-specific genetic markers that can be functionally associated to important traits. Results Differential organ-specific ESTs were generated from leaf, stem, root and flower bud at two developmental stages (R1 and R4. The use of different sources of RNA as tester and driver cDNA for the construction of differential libraries was evaluated as a tool for detection of rare or low abundant transcripts. Organ-specificity ranged from 75 to 100% of non-redundant sequences in the different cDNA libraries. Sequence redundancy varied according to the target and driver cDNA used in each case. The R4 flower cDNA library was the less redundant library with 62% of unique sequences. Out of a total of 919 sequences that were edited and annotated, 318 were non-redundant sequences. Comparison against sequences in public databases showed that 60% of non-redundant sequences showed significant similarity to known sequences. The number of predicted novel genes varied among the different cDNA libraries, ranging from 56% in the R4 flower to 16 % in the R1 flower bud library. Comparison with sunflower ESTs on public databases showed that 197 of non-redundant sequences (60% did not exhibit significant similarity to previously reported sunflower ESTs. This approach helped to successfully isolate a significant number of new reported sequences

  10. AllelicImbalance: An R/ bioconductor package for detecting, managing, and visualizing allele expression imbalance data from RNA sequencing

    DEFF Research Database (Denmark)

    Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per


    the possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility...... of RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...

  11. SCRAM: a pipeline for fast index-free small RNA read alignment and visualization. (United States)

    Fletcher, Stephen J; Boden, Mikael; Mitter, Neena; Carroll, Bernard J


    Small RNAs play key roles in gene regulation, defense against viral pathogens and maintenance of genome stability, though many aspects of their biogenesis and function remain to be elucidated. SCRAM (Small Complementary RNA Mapper) is a novel, simple-to-use short read aligner and visualization suite that enhances exploration of small RNA datasets. The SCRAM pipeline is implemented in Go and Python, and is freely available under MIT license. Source code, multiplatform binaries and a Docker image can be accessed via Supplementary data are available at Bioinformatics online.

  12. Mapping a nucleolar targeting sequence of an RNA binding nucleolar protein, Nop25

    International Nuclear Information System (INIS)

    Fujiwara, Takashi; Suzuki, Shunji; Kanno, Motoko; Sugiyama, Hironobu; Takahashi, Hisaaki; Tanaka, Junya


    Nop25 is a putative RNA binding nucleolar protein associated with rRNA transcription. The present study was undertaken to determine the mechanism of Nop25 localization in the nucleolus. Deletion experiments of Nop25 amino acid sequence showed Nop25 to contain a nuclear targeting sequence in the N-terminal and a nucleolar targeting sequence in the C-terminal. By expressing derivative peptides from the C-terminal as GFP-fusion proteins in the cells, a lysine and arginine residue-enriched peptide (KRKHPRRAQDSTKKPPSATRTSKTQRRRR) allowed a GFP-fusion protein to be transported and fully retained in the nucleolus. When the peptide was fused with cMyc epitope and expressed in the cells, a cMyc epitope was then detected in the nucleolus. Nop25 did not localize in the nucleolus by deletion of the peptide from Nop25. Furthermore, deletion of a subdomain (KRKHPRRAQ) in the peptide or amino acid substitution of lysine and arginine residues in the subdomain resulted in the loss of Nop25 nucleolar localization. These results suggest that the lysine and arginine residue-enriched peptide is the most prominent nucleolar targeting sequence of Nop25 and that the long stretch of basic residues might play an important role in the nucleolar localization of Nop25. Although Nop25 contained putative SUMOylation, phosphorylation and glycosylation sites, the amino acid substitution in these sites had no effect on the nucleolar localization, thus suggesting that these post-translational modifications did not contribute to the localization of Nop25 in the nucleolus. The treatment of the cells, which expressed a GFP-fusion protein with a nucleolar targeting sequence of Nop25, with RNase A resulted in a complete dislocation of the protein from the nucleolus. These data suggested that the nucleolar targeting sequence might therefore play an important role in the binding of Nop25 to RNA molecules and that the RNA binding of Nop25 might be essential for the nucleolar localization of Nop25

  13. Potent host-directed small-molecule inhibitors of myxovirus RNA-dependent RNA-polymerases.

    Directory of Open Access Journals (Sweden)

    Stefanie A Krumm

    Full Text Available Therapeutic targeting of host cell factors required for virus replication rather than of pathogen components opens new perspectives to counteract virus infections. Anticipated advantages of this approach include a heightened barrier against the development of viral resistance and a broadened pathogen target spectrum. Myxoviruses are predominantly associated with acute disease and thus are particularly attractive for this approach since treatment time can be kept limited. To identify inhibitor candidates, we have analyzed hit compounds that emerged from a large-scale high-throughput screen for their ability to block replication of members of both the orthomyxovirus and paramyxovirus families. This has returned a compound class with broad anti-viral activity including potent inhibition of different influenza virus and paramyxovirus strains. After hit-to-lead chemistry, inhibitory concentrations are in the nanomolar range in the context of immortalized cell lines and human PBMCs. The compound shows high metabolic stability when exposed to human S-9 hepatocyte subcellular fractions. Antiviral activity is host-cell species specific and most pronounced in cells of higher mammalian origin, supporting a host-cell target. While the compound induces a temporary cell cycle arrest, host mRNA and protein biosynthesis are largely unaffected and treated cells maintain full metabolic activity. Viral replication is blocked at a post-entry step and resembles the inhibition profile of a known inhibitor of viral RNA-dependent RNA-polymerase (RdRp activity. Direct assessment of RdRp activity in the presence of the reagent reveals strong inhibition both in the context of viral infection and in reporter-based minireplicon assays. In toto, we have identified a compound class with broad viral target range that blocks host factors required for viral RdRp activity. Viral adaptation attempts did not induce resistance after prolonged exposure, in contrast to rapid

  14. Characterization of the Zika virus induced small RNA response in Aedes aegypti cells.

    Directory of Open Access Journals (Sweden)

    Margus Varjak


    Full Text Available RNA interference (RNAi controls arbovirus infections in mosquitoes. Two different RNAi pathways are involved in antiviral responses: the PIWI-interacting RNA (piRNA and exogenous short interfering RNA (exo-siRNA pathways, which are characterized by the production of virus-derived small RNAs of 25-29 and 21 nucleotides, respectively. The exo-siRNA pathway is considered to be the key mosquito antiviral response mechanism. In Aedes aegypti-derived cells, Zika virus (ZIKV-specific siRNAs were produced and loaded into the exo-siRNA pathway effector protein Argonaute 2 (Ago2; although the knockdown of Ago2 did not enhance virus replication. Enhanced ZIKV replication was observed in a Dcr2-knockout cell line suggesting that the exo-siRNA pathway is implicated in the antiviral response. Although ZIKV-specific piRNA-sized small RNAs were detected, these lacked the characteristic piRNA ping-pong signature motif and were bound to Ago3 but not Piwi5 or Piwi6. Silencing of PIWI proteins indicated that the knockdown of Ago3, Piwi5 or Piwi6 did not enhance ZIKV replication and only Piwi4 displayed antiviral activity. We also report that the expression of ZIKV capsid (C protein amplified the replication of a reporter alphavirus; although, unlike yellow fever virus C protein, it does not inhibit the exo-siRNA pathway. Our findings elucidate ZIKV-mosquito RNAi interactions that are important for understanding its spread.

  15. An optimized protocol for generation and analysis of Ion Proton sequencing reads for RNA-Seq. (United States)

    Yuan, Yongxian; Xu, Huaiqian; Leung, Ross Ka-Kit


    Previous studies compared running cost, time and other performance measures of popular sequencing platforms. However, comprehensive assessment of library construction and analysis protocols for Proton sequencing platform remains unexplored. Unlike Illumina sequencing platforms, Proton reads are heterogeneous in length and quality. When sequencing data from different platforms are combined, this can result in reads with various read length. Whether the performance of the commonly used software for handling such kind of data is satisfactory is unknown. By using universal human reference RNA as the initial material, RNaseIII and chemical fragmentation methods in library construction showed similar result in gene and junction discovery number and expression level estimated accuracy. In contrast, sequencing quality, read length and the choice of software affected mapping rate to a much larger extent. Unspliced aligner TMAP attained the highest mapping rate (97.27 % to genome, 86.46 % to transcriptome), though 47.83 % of mapped reads were clipped. Long reads could paradoxically reduce mapping in junctions. With reference annotation guide, the mapping rate of TopHat2 significantly increased from 75.79 to 92.09 %, especially for long (>150 bp) reads. Sailfish, a k-mer based gene expression quantifier attained highly consistent results with that of TaqMan array and highest sensitivity. We provided for the first time, the reference statistics of library preparation methods, gene detection and quantification and junction discovery for RNA-Seq by the Ion Proton platform. Chemical fragmentation performed equally well with the enzyme-based one. The optimal Ion Proton sequencing options and analysis software have been evaluated.

  16. Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that reflect systemic microRNA changes in psoriasis

    DEFF Research Database (Denmark)

    Løvendorf, Marianne B; Mitsui, Hiroshi; Zibert, John R


    Psoriasis is a systemic disease with cutaneous manifestations. MicroRNAs (miRNAs) are small non-coding RNA molecules that are differentially expressed in psoriatic skin; however, only few cell- and region-specific miRNAs have been identified in psoriatic lesions. We used laser capture...... microdissection (LCM) and next-generation sequencing (NGS) to study the specific miRNA expression profiles in the epidermis (Epi) and dermal inflammatory infiltrates (RD) of psoriatic skin (N = 6). We identified 24 deregulated miRNAs in the Epi and 37 deregulated miRNAs in the RD of psoriatic plaque compared...... with normal psoriatic skin (FCH > 2, FDR

  17. Small RNA profiling of influenza A virus-infected cells identifies miR-449b as a regulator of histone deacetylase 1 and interferon beta.

    Directory of Open Access Journals (Sweden)

    William A Buggele

    Full Text Available The mammalian antiviral response relies on the alteration of cellular gene expression, to induce the production of antiviral effectors and regulate their activities. Recent research has indicated that virus infections can induce the accumulation of cellular microRNA (miRNA species that influence the stability of host mRNAs and their protein products. To determine the potential for miRNA regulation of cellular responses to influenza A virus infection, small RNA profiling was carried out using next generation sequencing. Comparison of miRNA expression profiles in uninfected human A549 cells to cells infected with influenza A virus strains A/Udorn/72 and A/WSN/33, revealed virus-induced changes in miRNA abundance. Gene expression analysis identified mRNA targets for a cohort of highly inducible miRNAs linked to diverse cellular functions. Experiments demonstrate that the histone deacetylase, HDAC1, can be regulated by influenza-inducible miR-449b, resulting in altered mRNA and protein levels. Expression of miR-449b enhances virus and poly(I:C activation of the IFNβ promoter, a process known to be negatively regulated by HDAC1. These findings demonstrate miRNA induction by influenza A virus infection and elucidate an example of miRNA control of antiviral gene expression in human cells, defining a role for miR-449b in regulation of HDAC1 and antiviral cytokine signaling.

  18. A systems biology approach for miRNA-mRNA expression patterns analysis in non-small cell lung cancer. (United States)

    Najafi, Ali; Tavallaei, Mahmood; Hosseini, Sayed Mostafa


    Non-small cell lung cancers (NSCLCs) is a prevalent and heterogeneous subtype of lung cancer accounting for 85 percent of patients. MicroRNAs (miRNAs), a class of small endogenous non-coding RNAs, incorporate into regulation of gene expression post-transcriptionally. Therefore, deregulation of miRNAs' expression has provided further layers of complexity to the molecular etiology and pathogenesis of different diseases and malignancies. Although, until now considerable number of studies has been carried out to illuminate this complexity in NSCLC, they have remained less effective in their goal due to lack of a holistic and integrative systems biology approach which considers all natural elaborations of miRNAs' function. It is able to reliably nominate most affected signaling pathways and therapeutic target genes by deregulated miRNAs during a particular pathological condition. Herein, we utilized a holistic systems biology approach, based on appropriate re-analyses of microarray datasets followed by reliable data filtering, to analyze integrative and combinatorial deregulated miRNA-mRNA interaction network in NSCLC, aiming to ascertain miRNA-dysregulated signaling pathway and potential therapeutic miRNAs and mRNAs which represent a lion' share during various aspects of NSCLC's pathogenesis. Our systems biology approach introduced and nominated 1) important deregulated miRNAs in NSCLCs compared with normal tissue 2) significant and confident deregulated mRNAs which were anti-correlatively targeted by deregulated miRNA in NSCLCs and 3) dysregulated signaling pathways in association with deregulated miRNA-mRNAs interactions in NSCLCs. These results introduce possible mechanism of function of deregulated miRNAs and mRNAs in NSCLC that could be used as potential therapeutic targets.

  19. Deep RNA sequencing of the skeletal muscle transcriptome in swimming fish.

    Directory of Open Access Journals (Sweden)

    Arjan P Palstra

    Full Text Available Deep RNA sequencing (RNA-seq was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss with the specific objective to identify expressed genes and quantify the transcriptomic effects of swimming-induced exercise. Pubertal autumn-spawning seawater-raised female rainbow trout were rested (n = 10 or swum (n = 10 for 1176 km at 0.75 body-lengths per second in a 6,000-L swim-flume under reproductive conditions for 40 days. Red and white muscle RNA of exercised and non-exercised fish (4 lanes was sequenced and resulted in 15-17 million reads per lane that, after de novo assembly, yielded 149,159 red and 118,572 white muscle contigs. Most contigs were annotated using an iterative homology search strategy against salmonid ESTs, the zebrafish Danio rerio genome and general Metazoan genes. When selecting for large contigs (>500 nucleotides, a number of novel rainbow trout gene sequences were identified in this study: 1,085 and 1,228 novel gene sequences for red and white muscle, respectively, which included a number of important molecules for skeletal muscle function. Transcriptomic analysis revealed that sustained swimming increased transcriptional activity in skeletal muscle and specifically an up-regulation of genes involved in muscle growth and developmental processes in white muscle. The unique collection of transcripts will contribute to our understanding of red and white muscle physiology, specifically during the long-term reproductive migration of salmonids.

  20. In vivo efficacy and off-target effects of locked nucleic acid (LNA) and unlocked nucleic acid (UNA) modified siRNA and small internally segmented interfering RNA (sisiRNA) in mice bearing human tumor xenografts

    NARCIS (Netherlands)

    Mook, O. R. F.; Vreijling, Jeroen; Wengel, Suzy L.; Wengel, Jesper; Zhou, Chuanzheng; Chattopadhyaya, Jyoti; Baas, Frank; Fluiter, Kees


    The clinical use of small interfering RNA (siRNA) is hampered by poor uptake by tissues and instability in circulation. In addition, off-target effects pose a significant additional problem for therapeutic use of siRNA. Chemical modifications of siRNA have been reported to increase stability and

  1. Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals


    Thess, Andreas; Grund, Stefanie; Mui, Barbara L; Hope, Michael J; Baumhof, Patrick; Fotin-Mleczek, Mariola; Schlake, Thomas


    Being a transient carrier of genetic information, mRNA could be a versatile, flexible, and safe means for protein therapies. While recent findings highlight the enormous therapeutic potential of mRNA, evidence that mRNA-based protein therapies are feasible beyond small animals such as mice is still lacking. Previous studies imply that mRNA therapeutics require chemical nucleoside modifications to obtain sufficient protein expression and avoid activation of the innate immune system. Here we sh...

  2. Radiolabeling small RNA with technetium-99m for visualizing cellular delivery and mouse biodistribution

    International Nuclear Information System (INIS)

    Liu Ning; Ding Hongliu; Vanderheyden, Jean-Luc; Zhu Zhihong; Zhang Yumin


    To develop a noninvasive direct method for the in vivo tracking of small interfering RNA (siRNA) used in RNA interference, two 18-nucleotide oligoribonucleotides were radiolabeled with technetium-99m ( 99m Tc-RNA). The ability of 99m Tc-RNA to track delivery was tested in cultured cells and living mice. The cellular delivery of 99m Tc-RNAs could be quantified by gamma counting and could be visualized by microautoradiography. Radiolabeled RNAs can be efficiently delivered into cells by reaching up to 3x10 5 molecules of small RNAs per cell. Moreover, RNAs were internalized with homogeneous distribution throughout the cytoplasm and nucleus. In tumor-bearing mice, whole-body images and biodistribution studies showed that 99m Tc-RNAs were delivered to almost all tissues after intravenous injection. The imaging of living animals allowed noninvasive and longitudinal monitoring of the in vivo delivery of these small RNAs. In conclusion, using 99m Tc radiolabeling, the delivery of small RNAs could be measured quantitatively in cultured cells and could be noninvasively visualized in living animals using a gamma camera. The results of this study could open up a new approach for measuring the in vivo delivery of small RNAs that might further facilitate the development of siRNAs as targeted therapies

  3. Establishment of a continuous culture system for Entamoeba muris and analysis of the small subunit rRNA gene

    Directory of Open Access Journals (Sweden)

    Kobayashi S.


    Full Text Available We established a culture system for Entamoeba muris (MG-EM-01 strain isolated from a Mongolian gerbil using a modified Balamuth’s egg yolk infusion medium supplemented with 4% adult bovine serum and Bacteroides fragilis cocultured with Escherichia coli. Further, encystation was observed in the culture medium. The morphological characteristics of E. muris are similar to those of Entamoeba coli (E. coli; moreover, the malic isoenzyme electrophoretic band, which shows species-specific electrophoretic mobility, of E. muris had almost the same mobility as that observed with the malic isoenzyme electrophorectic band of E. coli (UZG-EC-01 strain isolated from a gorilla. We determined the small subunit rRNA (SSU-rRNA gene sequence of the MG-EM-01 strain, and this sequence was observed to show 82.7% homology with that of the UZG-EC-01 strain. Further, the resultant phylogenetic tree for molecular taxonomy based on the SSU-rRNA genes of the 21 strains of the intestinal parasitic amoeba species indicated that the MG-EM-01 strain was most closely related to E. coli.

  4. E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

    Directory of Open Access Journals (Sweden)

    Minami Mazda

    Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

  5. Transcriptomic characterization of soybean (Glycine max) roots in response to rhizobium infection by RNA sequencing

    International Nuclear Information System (INIS)

    He, Q.; Li, Z.; Wang, S.; Huang, S.; Yang, H.


    Legumes interacting with rhizobium to convert N2 into ammonia for plant use has attracted worldwide interest. However, the plant basal nitrogen fixation mechanisms induced in response to Rhizobium, giving differential gene expression of plants, have not yet been fully realized. The differential expressed genes of soybean between inoculated and mock-inoculated were analyzed by a RNA-Seq. The results of the sequencing were aligned against the Williams 82 genome sequence, which contain 55787 transcripts; 280 and 316 transcripts were found to be up- and down-regulated, respectively, for inoculated and mock-inoculated soybean roots at stage V1. Gene ontology (GO) analyses detected 104, 182 and 178 genes associated with the cell component category, molecular function category and biological process category, respectively. Pathway analysis revealed that 98 differentially expressed genes (115 transcripts) were involved in 169 biological pathways. We selected 19 differentially expressed genes and analyzed their expressions in mock-inoculated, inoculated USDA110 and CCBAU45436 using qRT-PCR. The results were in accordance with those obtained from rhizobia infected RNA-Seq data. These showed that the results of RNA-Seq had reliability and universality. Additionally, this study showed some novel genes associated with the nitrogen fixation process in comparison to previously identified QTLs. (author)

  6. microRNA expression profiling in fetal single ventricle malformation identified by deep sequencing. (United States)

    Yu, Zhang-Bin; Han, Shu-Ping; Bai, Yun-Fei; Zhu, Chun; Pan, Ya; Guo, Xi-Rong


    microRNAs (miRNAs) have emerged as key regulators in many biological processes, particularly cardiac growth and development, although the specific miRNA expression profile associated with this process remains to be elucidated. This study aimed to characterize the cellular microRNA profile involved in the development of congenital heart malformation, through the investigation of single ventricle (SV) defects. Comprehensive miRNA profiling in human fetal SV cardiac tissue was performed by deep sequencing. Differential expression of 48 miRNAs was revealed by sequencing by oligonucleotide ligation and detection (SOLiD) analysis. Of these, 38 were down-regulated and 10 were up-regulated in differentiated SV cardiac tissue, compared to control cardiac tissue. This was confirmed by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. Predicted target genes of the 48 differentially expressed miRNAs were analyzed by gene ontology and categorized according to cellular process, regulation of biological process and metabolic process. Pathway-Express analysis identified the WNT and mTOR signaling pathways as the most significant processes putatively affected by the differential expression of these miRNAs. The candidate genes involved in cardiac development were identified as potential targets for these differentially expressed microRNAs and the collaborative network of microRNAs and cardiac development related-mRNAs was constructed. These data provide the basis for future investigation of the mechanism of the occurrence and development of fetal SV malformations.

  7. The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain. (United States)

    Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene


    T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.

  8. Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression (United States)

    Xiong, Li-Ping; Ma, Yu-Qiang; Tang, Lei-Han


    Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if work