WorldWideScience

Sample records for small consanguineous families

  1. Genetics of intellectual disability in consanguineous families.

    Science.gov (United States)

    Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Herwig, Ralf; Hosseini, Masoumeh; Oppitz, Cornelia; Abedini, Seyedeh Sedigheh; Suckow, Vanessa; Larti, Farzaneh; Beheshtian, Maryam; Lipkowitz, Bettina; Akhtarkhavari, Tara; Mehvari, Sepideh; Otto, Sabine; Mohseni, Marzieh; Arzhangi, Sanaz; Jamali, Payman; Mojahedi, Faezeh; Taghdiri, Maryam; Papari, Elaheh; Soltani Banavandi, Mohammad Javad; Akbari, Saeide; Tonekaboni, Seyed Hassan; Dehghani, Hossein; Ebrahimpour, Mohammad Reza; Bader, Ingrid; Davarnia, Behzad; Cohen, Monika; Khodaei, Hossein; Albrecht, Beate; Azimi, Sarah; Zirn, Birgit; Bastami, Milad; Wieczorek, Dagmar; Bahrami, Gholamreza; Keleman, Krystyna; Vahid, Leila Nouri; Tzschach, Andreas; Gärtner, Jutta; Gillessen-Kaesbach, Gabriele; Varaghchi, Jamileh Rezazadeh; Timmermann, Bernd; Pourfatemi, Fatemeh; Jankhah, Aria; Chen, Wei; Nikuei, Pooneh; Kalscheuer, Vera M; Oladnabi, Morteza; Wienker, Thomas F; Ropers, Hans-Hilger; Najmabadi, Hossein

    2018-01-04

    Autosomal recessive (AR) gene defects are the leading genetic cause of intellectual disability (ID) in countries with frequent parental consanguinity, which account for about 1/7th of the world population. Yet, compared to autosomal dominant de novo mutations, which are the predominant cause of ID in Western countries, the identification of AR-ID genes has lagged behind. Here, we report on whole exome and whole genome sequencing in 404 consanguineous predominantly Iranian families with two or more affected offspring. In 219 of these, we found likely causative variants, involving 77 known and 77 novel AR-ID (candidate) genes, 21 X-linked genes, as well as 9 genes previously implicated in diseases other than ID. This study, the largest of its kind published to date, illustrates that high-throughput DNA sequencing in consanguineous families is a superior strategy for elucidating the thousands of hitherto unknown gene defects underlying AR-ID, and it sheds light on their prevalence.

  2. Genetic analysis of a consanguineous Pakistani family with Leber ...

    Indian Academy of Sciences (India)

    2014-08-01

    Aug 1, 2014 ... RESEARCH NOTE. Genetic analysis of a consanguineous Pakistani family with Leber .... representation of the deleterious mutation at genomic and protein level. ... In the last couple of years, numerous mutations in. GUCY2D ...

  3. Consanguinity and family clustering of male factor infertility in Lebanon.

    Science.gov (United States)

    Inhorn, Marcia C; Kobeissi, Loulou; Nassar, Zaher; Lakkis, Da'ad; Fakih, Michael H

    2009-04-01

    To investigate the influence of consanguineous marriage on male factor infertility in Lebanon, where rates of consanguineous marriage remain high (29.6% among Muslims, 16.5% among Christians). Clinic-based, case-control study, using reproductive history, risk factor interview, and laboratory-based semen analysis. Two IVF clinics in Beirut, Lebanon, during an 8-month period (January-August 2003). One hundred twenty infertile male patients and 100 fertile male controls, distinguished by semen analysis and reproductive history. None. Standard clinical semen analysis. The rates of consanguineous marriage were relatively high among the study sample. Patients (46%) were more likely than controls (37%) to report first-degree (parental) and second-degree (grandparental) consanguinity. The study demonstrated a clear pattern of family clustering of male factor infertility, with patients significantly more likely than controls to report infertility among close male relatives (odds ratio = 2.58). Men with azoospermia and severe oligospermia showed high rates of both consanguinity (50%) and family clustering (41%). Consanguineous marriage is a socially supported institution throughout the Muslim world, yet its relationship to infertility is poorly understood. This study demonstrated a significant association between consanguinity and family clustering of male factor infertility cases, suggesting a strong genetic component.

  4. A Family Study of Consanguinity in Children with Intellectual Disabilities in Barwani, India

    OpenAIRE

    Lakhan, Ram; Bipeta, Rajshekhar; Yerramilli, Srinivasa S. R. R.; Nahar, Vinayak K.

    2017-01-01

    Background: Intellectual disability (ID) can be inherited in families through consanguineous marriage. The ID in an individual can be associated with the ID, epilepsy, and mental illness in their parents. Such connections can be seen more closely among consanguineous marriages in tribal and nontribal population in India. Objective: This study shows a few common patterns of the consanguineous relationship in the parents of children with ID in India. Materials and Methods: This is a case series...

  5. Loss of function mutations in RP1 are responsible for retinitis pigmentosa in consanguineous familial cases

    Science.gov (United States)

    Kabir, Firoz; Ullah, Inayat; Ali, Shahbaz; Gottsch, Alexander D.H.; Naeem, Muhammad Asif; Assir, Muhammad Zaman; Khan, Shaheen N.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

    2016-01-01

    Purpose This study was undertaken to identify causal mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in consanguineous families. Methods Large consanguineous families were ascertained from the Punjab province of Pakistan. An ophthalmic examination consisting of a fundus evaluation and electroretinography (ERG) was completed, and small aliquots of blood were collected from all participating individuals. Genomic DNA was extracted from white blood cells, and a genome-wide linkage or a locus-specific exclusion analysis was completed with polymorphic short tandem repeats (STRs). Two-point logarithm of odds (LOD) scores were calculated, and all coding exons and exon–intron boundaries of RP1 were sequenced to identify the causal mutation. Results The ophthalmic examination showed that affected individuals in all families manifest cardinal symptoms of RP. Genome-wide scans localized the disease phenotype to chromosome 8q, a region harboring RP1, a gene previously implicated in the pathogenesis of RP. Sanger sequencing identified a homozygous single base deletion in exon 4: c.3697delT (p.S1233Pfs22*), a single base substitution in intron 3: c.787+1G>A (p.I263Nfs8*), a 2 bp duplication in exon 2: c.551_552dupTA (p.Q185Yfs4*) and an 11,117 bp deletion that removes all three coding exons of RP1. These variations segregated with the disease phenotype within the respective families and were not present in ethnically matched control samples. Conclusions These results strongly suggest that these mutations in RP1 are responsible for the retinal phenotype in affected individuals of all four consanguineous families. PMID:27307693

  6. Paternal asthma is a predictor for childhood asthma in the consanguineous families from the United Arab Emirates.

    Science.gov (United States)

    Joseph, Maries; Zoubeidi, Taoufik; Al-Dhaheri, Sherina M; Al-Dhaheri, Aysha Ahmed; Al-Dhaheri, Afra A; Al-Kaabi, Fatima M; Al-Muhairi, Shamma J; Joseph, Jose

    2009-03-01

    Consanguinity is known to increase the burden of genetic disorders among offspring. However, the effect of consanguinity on a complex disorder like childhood asthma has not been studied previously. Therefore, we explored this relationship by studying the asthma prevalence in children between 6 and 14 years of age among the local Arab families of the United Arab Emirates (UAE) where consanguinity is known to be highly prevalent. A total of 1136 children from 295 families met our inclusion criteria. The prevalence of childhood asthma was higher among children in consanguineous families (43.3%) compared to non-consanguineous (22.6%, p consanguinity and the number of asthmatic children per family (p = 0.0002). Girls from consanguineous families had proportionately more asthma (42.9%, p consanguineous families increased asthma risk for both boys and girls (p = 0.021 for boys, p consanguineous families. The significant asthma predictors for girls from the consanguineous families were the degree of consanguinity and paternal asthma. The only predictor for boys was paternal asthma. These interesting observations merit further studies on both larger samples and in other consanguineous communities for confirmation.

  7. A consanguineous family with Hirschsprung disease, microcephaly, and mental retardation (Goldberg-Shprintzen syndrome)

    NARCIS (Netherlands)

    Brooks, AS; Breuning, MH; Osinga, J; Van der Smagt, JJ; Catsman, CE; Buys, CHCM; Meijers, C; Hofstra, RMW

    Hirschsprung disease, mental retardation, microcephaly, and specific craniofacial dysmorphism were observed in three children from a large, consanguineous, Moroccan family. A fourth child showed similar clinical features, with the exception of Hirschsprung disease. The association of these

  8. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  9. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  10. A Family Study of Consanguinity in Children with Intellectual Disabilities in Barwani, India.

    Science.gov (United States)

    Lakhan, Ram; Bipeta, Rajshekhar; Yerramilli, Srinivasa S R R; Nahar, Vinayak K

    2017-01-01

    Intellectual disability (ID) can be inherited in families through consanguineous marriage. The ID in an individual can be associated with the ID, epilepsy, and mental illness in their parents. Such connections can be seen more closely among consanguineous marriages in tribal and nontribal population in India. This study shows a few common patterns of the consanguineous relationship in the parents of children with ID in India. This is a case series research design. Extreme or deviant case sampling was applied. Data were collected in homes, camps, and clinical settings in the Barwani district of Madhya Pradesh, India. The patterns of consanguineous marriages and the relationship between children with ID and their relatives with ID, epilepsy, and mental illness were analyzed and reported with pedigree charts. Multiple patterns of consanguineous marriages in tribal and nontribal populations were observed. ID was found to be associated in children with their relatives of the first, second, and third generations. ID may inherit in individuals from their relatives of the first, second, and third generations who have ID, epilepsy, or mental illness and married in the relationship. Appropriate knowledge, guidance, and counseling may be provided to potential couples before planning a consanguineous marriage.

  11. A family study of consanguinity in children with intellectual disabilities in Barwani, India

    Directory of Open Access Journals (Sweden)

    Ram Lakhan

    2017-01-01

    Full Text Available Background: Intellectual disability (ID can be inherited in families through consanguineous marriage. The ID in an individual can be associated with the ID, epilepsy, and mental illness in their parents. Such connections can be seen more closely among consanguineous marriages in tribal and nontribal population in India. Objective: This study shows a few common patterns of the consanguineous relationship in the parents of children with ID in India. Materials and Methods: This is a case series research design. Extreme or deviant case sampling was applied. Data were collected in homes, camps, and clinical settings in the Barwani district of Madhya Pradesh, India. The patterns of consanguineous marriages and the relationship between children with ID and their relatives with ID, epilepsy, and mental illness were analyzed and reported with pedigree charts. Results: Multiple patterns of consanguineous marriages in tribal and nontribal populations were observed. ID was found to be associated in children with their relatives of the first, second, and third generations. Conclusion: ID may inherit in individuals from their relatives of the first, second, and third generations who have ID, epilepsy, or mental illness and married in the relationship. Appropriate knowledge, guidance, and counseling may be provided to potential couples before planning a consanguineous marriage.

  12. Familial Recurrence of 3MC Syndrome in Consanguineous Families: A Clinical and Molecular Diagnostic Approach With Review of the Literature.

    Science.gov (United States)

    Gardner, Olivia K; Haynes, Karla; Schweitzer, Daniela; Johns, Alexis; Magee, William P; Urata, Mark M; Sanchez-Lara, Pedro A

    2017-11-01

    We report four individuals from two unrelated consanguineous families with 3MC syndrome. In the first family, chromosome microarray data revealed that the two affected sisters, born to first-cousin parents, shared a unique homozygous C-terminal deletion in the COLEC11 gene. Two affected brothers from a second family, also born to first-cousin parents, shared a region of homozygosity that included the second gene known to cause the 3MC syndrome, MASP1. We discuss the diagnostic approach of craniofacial disorders born to consanguineous parents and highlight a literature search and reference a helpful dysmorphology solution powered by FDNA (Facial Dysmorphology Novel Analysis) technology.

  13. New MCM8 mutation associated with premature ovarian insufficiency and chromosomal instability in a highly consanguineous Tunisian family.

    Science.gov (United States)

    Bouali, Nouha; Francou, Bruno; Bouligand, Jérôme; Imanci, Dilek; Dimassi, Sarra; Tosca, Lucie; Zaouali, Monia; Mougou, Soumaya; Young, Jacques; Saad, Ali; Guiochon-Mantel, Anne

    2017-10-01

    To identify the gene(s) involved in the etiology of premature ovarian insufficiency in a highly consanguineous Tunisian family. Genetic analysis of a large consanguineous family with several affected siblings. University hospital-based cytogenetics and molecular genetics laboratories. A highly consanguineous Tunisian family with several affected siblings born to healthy second-degree cousins. None. Targeted exome sequencing was performed by next-generation sequencing for affected family members. Mutations were validated by Sanger sequencing. Functional experiments were performed to explore the deleterious effects of the identified mutation. DNA damage was induced by increasing mitomycin C (MMC) concentrations on cultured peripheral lymphocytes. Analysis of the next-generation sequencing data revealed a new homozygous missense mutation in the minichromosome maintenance 8 gene (MCM8).This homozygous mutation (c. 482A>C; p.His161Pro) was predicted to be deleterious and segregated with the disease in the family. MCM8 participates in homologous recombination during meiosis and DNA double-stranded break repair by dimerizing with MCM9. Mcm8 knock out results in an early block in follicle development and small gonads. Given this, we tested the chromosomal breakage repair capacity of homozygous and heterozygous MCM8 p.His161Pro mutation on cultured peripheral lymphocytes exposed to increasing MMC concentrations. We found that chromosomal breakage after MMC exposure was significantly higher in cells from homozygously affected individuals than in those from a healthy control. Our findings provide additional support to the view that MCM8 mutations are involved in the primary ovarian insufficiency phenotype. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  14. Molecular genetic analysis of consanguineous families with primary ...

    Indian Academy of Sciences (India)

    MUZAMMIL AHMAD KHAN1

    4Department of Cell and Developmental Biology, School of Life Sciences, University of Science .... Sex. Male. Male. Male. Male. Head circumference (cm). 41. 46. 46. 39. Intellectual disability .... One family revealed a novel single-base dele-.

  15. Molecular genetic analysis of consanguineous families with primary ...

    Indian Academy of Sciences (India)

    MUZAMMIL AHMAD KHAN

    3Institute of Human Genetics, Medical University of Graz, Graz 8010, Austria. 4Department of Cell and ... Materials and methods. Family recruitment and sample collection ..... 2014 A Drosophila genetic resource of mutats to study mechanism ...

  16. Mutations in ALDH1A3 represent a frequent cause of microphthalmia/anophthalmia in consanguineous families.

    Science.gov (United States)

    Abouzeid, Hana; Favez, Tatiana; Schmid, Angélique; Agosti, Céline; Youssef, Mohammed; Marzouk, Iman; El Shakankiry, Nihal; Bayoumi, Nader; Munier, Francis L; Schorderet, Daniel F

    2014-08-01

    Anophthalmia or microphthalmia (A/M), characterized by absent or small eye, can be unilateral or bilateral and represent developmental anomalies due to the mutations in several genes. Recently, mutations in aldehyde dehydrogenase family 1, member A3 (ALDH1A3) also known as retinaldehyde dehydrogenase 3, have been reported to cause A/M. Here, we screened a cohort of 75 patients with A/M and showed that mutations in ALDH1A3 occurred in six families. Based on this series, we estimate that mutations in ALDH1A3 represent a major cause of A/M in consanguineous families, and may be responsible for approximately 10% of the cases. Screening of this gene should be performed in a first line of investigation, together with SOX2. © 2014 WILEY PERIODICALS, INC.

  17. MED23-associated Intellectual Disability in a Non-consanguineous Family

    OpenAIRE

    Trehan, Aditi; Brady, Jacqueline M.; Maduro, Valerie; Bone, William; Huang, Yan; Golas, Gretchen A.; Kane, Megan; Lee, Paul R.; Thurm, Audrey; Gropman, Andrea L.; Paul, Scott M.; Vezina, Gilbert; Markello, Thomas C.; Gahl, William A.; Boerkoel, Cornelius F.

    2015-01-01

    Intellectual disability (ID) is a heterogeneous condition arising from a variety of environmental and genetic factors. Among these causes are defects in transcriptional regulators. Herein, we report two brothers in a non-consanguineous family with novel compound heterozygous, disease-segregating mutations (NM_015979.3: [3656A>G];[4006C>T], NP_057063.2: [H1219R];[R1336X]) in MED23. This gene encodes a subunit of the Mediator complex that modulates the expression of RNA polymerase II-dependent ...

  18. Search for consanguinity within and among families of patients with trichothiodystrophy associated with xeroderma pigmentosum.

    Science.gov (United States)

    Nuzzo, F; Zei, G; Stefanini, M; Colognola, R; Santachiara, A S; Lagomarsini, P; Marinoni, S; Salvaneschi, L

    1990-01-01

    The association of two rare hereditary disorders, trichothiodystrophy (TTD) and xeroderma pigmentosum (XP), was found in four patients from three families, apparently unrelated but living in the same geographical area. In order to test the hypothesis of a common ancestor, consanguinity within and among the families was checked using three different approaches: reconstruction of genealogical trees, typing of blood markers, and surname analysis. The results of the three types of analyses strengthen the hypothesis that, in at least two out of the three families, the genetic defect determining the TTD/XP phenotype is identical by descent, as a consequence of remote inbreeding. This implies that if two mutations are responsible for the two diseases they are at linked loci or affect the same gene. PMID:2308151

  19. The Genetics of Asymmetry: Whole Exome Sequencing in a Consanguineous Turkish Family with an Overrepresentation of Left-Handedness

    Directory of Open Access Journals (Sweden)

    Sebastian Ocklenburg

    2017-05-01

    Full Text Available Handedness is the most pronounced behavioral asymmetry in humans. Genome-wide association studies have largely failed to identify genetic loci associated with phenotypic variance in handedness, supporting the idea that the trait is determined by a multitude of small, possibly interacting genetic and non-genetic influences. However, these studies typically are not capable of detecting influences of rare mutations on handedness. Here, we used whole exome sequencing in a Turkish family with history of consanguinity and overrepresentation of left-handedness and performed quantitative trait analysis with handedness lateralization quotient as a phenotype. While rare variants on different loci showed significant association with the phenotype, none was functionally relevant for handedness. This finding was further confirmed by gene ontology group analysis. Taken together, our results add further evidence to the suggestion that there is no major gene or mutation that causes left-handedness.

  20. MED23-associated intellectual disability in a non-consanguineous family.

    Science.gov (United States)

    Trehan, Aditi; Brady, Jacqueline M; Maduro, Valerie; Bone, William P; Huang, Yan; Golas, Gretchen A; Kane, Megan S; Lee, Paul R; Thurm, Audrey; Gropman, Andrea L; Paul, Scott M; Vezina, Gilbert; Markello, Thomas C; Gahl, William A; Boerkoel, Cornelius F; Tifft, Cynthia J

    2015-06-01

    Intellectual disability (ID) is a heterogeneous condition arising from a variety of environmental and genetic factors. Among these causes are defects in transcriptional regulators. Herein, we report on two brothers in a nonconsanguineous family with novel compound heterozygous, disease-segregating mutations (NM_015979.3: [3656A > G];[4006C > T], NP_057063.2: [H1219R];[R1336X]) in MED23. This gene encodes a subunit of the Mediator complex that modulates the expression of RNA polymerase II-dependent genes. These brothers, who had profound ID, spasticity, congenital heart disease, brain abnormalities, and atypical electroencephalography, represent the first case of MED23-associated ID in a non-consanguineous family. They also expand upon the clinical features previously reported for mutations in this gene. © 2015 Wiley Periodicals, Inc.

  1. Small Families

    Science.gov (United States)

    ... children of larger families. The financial costs of maintaining a household are lower. It is easier for ... separated from you, hindering the development of new relationships with peers. In fact, you may have that ...

  2. Usher syndrome in four siblings from a consanguineous family of Pakistani origin.

    Science.gov (United States)

    Trop, I; Schloss, M D; Polomeno, R; Der Kaloustian, V

    1995-04-01

    Usher syndrome is a heterogeneous group of disorders of autosomal recessive inheritance characterized by retinitis pigmentosa and congenital sensorineural hearing loss. Two types are accepted clinically: type I is associated with profound congenital deafness with progressive pigmentary retinopathy and total loss of vestibular function. Type II is a milder form, with moderate-to-profound hearing loss and a milder form of retinitis pigmentosa. Vestibular function is preserved. A total of five loci have been identified as accounting for the two distinct phenotypic presentations. We describe a consanguineous family of Pakistani origin whose four children all are affected with Usher syndrome type I. DNA analysis showed non-linkage to any of the loci already identified as tightly linked to the Usher syndrome type I.

  3. Molecular genetic analysis of consanguineous Pakistani families with autosomal recessive hypohidrotic ectodermal dysplasia.

    Science.gov (United States)

    Bibi, Nosheen; Ahmad, Saeed; Ahmad, Wasim; Naeem, Muhammad

    2011-02-01

    Hypohidrotic ectodermal dysplasia is an inherited disorder characterized by defective development of teeth, hairs and sweat glands. X-linked hypohidrotic ectodermal dysplasia is caused by mutations in the EDA gene, and autosomal forms of hypohidrotic ectodermal dysplasia are caused by mutations in either the EDAR or the EDARADD genes. To study the molecular genetic cause of autosomal recessive hypohidrotic ectodermal dysplasia in three consanguineous Pakistani families (A, B and C), genotyping of 13 individuals was carried out by using polymorphic microsatellite markers that are closely linked to the EDAR gene on chromosome 2q11-q13 and the EDARADD gene on chromosome 1q42.2-q43. The results revealed linkage in the three families to the EDAR locus. Sequence analysis of the coding exons and splice junctions of the EDAR gene revealed two mutations: a novel non-sense mutation (p.E124X) in the probands of families A and B and a missense mutation (p.G382S) in the proband of family C. In addition, two synonymous single-nucleotide polymorphisms were also identified. The finding of mutations in Pakistani families extends the body of evidence that supports the importance of EDAR for the development of hypohidrotic ectodermal dysplasia. © 2010 The Authors. Australasian Journal of Dermatology © 2010 The Australasian College of Dermatologists.

  4. Pathogenic mutations in TULP1 responsible for retinitis pigmentosa identified in consanguineous familial cases

    Science.gov (United States)

    Ullah, Inayat; Kabir, Firoz; Iqbal, Muhammad; Gottsch, Clare Brooks S.; Naeem, Muhammad Asif; Assir, Muhammad Zaman; Khan, Shaheen N.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

    2016-01-01

    Purpose To identify pathogenic mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in consanguineous familial cases. Methods Seven large familial cases with multiple individuals diagnosed with retinitis pigmentosa were included in the study. Affected individuals in these families underwent ophthalmic examinations to document the symptoms and confirm the initial diagnosis. Blood samples were collected from all participating members, and genomic DNA was extracted. An exclusion analysis with microsatellite markers spanning the TULP1 locus on chromosome 6p was performed, and two-point logarithm of odds (LOD) scores were calculated. All coding exons along with the exon–intron boundaries of TULP1 were sequenced bidirectionally. We constructed a single nucleotide polymorphism (SNP) haplotype for the four familial cases harboring the K489R allele and estimated the likelihood of a founder effect. Results The ophthalmic examinations of the affected individuals in these familial cases were suggestive of RP. Exclusion analyses confirmed linkage to chromosome 6p harboring TULP1 with positive two-point LOD scores. Subsequent Sanger sequencing identified the single base pair substitution in exon14, c.1466A>G (p.K489R), in four families. Additionally, we identified a two-base deletion in exon 4, c.286_287delGA (p.E96Gfs77*); a homozygous splice site variant in intron 14, c.1495+4A>C; and a novel missense variation in exon 15, c.1561C>T (p.P521S). All mutations segregated with the disease phenotype in the respective families and were absent in ethnically matched control chromosomes. Haplotype analysis suggested (p<10−6) that affected individuals inherited the causal mutation from a common ancestor. Conclusions Pathogenic mutations in TULP1 are responsible for the RP phenotype in seven familial cases with a common ancestral mutation responsible for the disease phenotype in four of the seven families. PMID:27440997

  5. A novel mutation in CDK5RAP2 gene causes primary microcephaly with speech impairment and sparse eyebrows in a consanguineous Pakistani family

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Mang, Yuan

    2017-01-01

    2 mutations is still under explored as only eleven families have been reported worldwide. Here, we analyzed a consanguineous Pakistani MCPH family, characterized by moderate to severe intellectual disability, speech impairment, moderately short stature and sparse eyebrows. Whole exome sequencing...

  6. Genetic analysis of fructose-1,6-bisphosphatase (FBPase) deficiency in nine consanguineous Pakistani families.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Ramzan, Khushnooda; Bhinder, Munir Ahmad; Shakeel, Hussain; Iqbal, Muhammad; Aslam, Asim; Shehzad, Wasim; Cheema, Huma Arshad; Rehman, Habib

    2017-10-26

    Fructose-1,6-bisphosphatase (FBPase) deficiency is a rare inherited metabolic disorder characterized by recurrent episodes of hypoglycemia, ketosis and lactic acidosis. FBPase is encoded by FBP1 gene and catalyzes the hydrolysis of fructose-1,6-bisphosphate to fructose-6-phosphate in the last step of gluconeogenesis. We report here FBP1 mutations in nine consanguineous Pakistani families affected with FBPase deficiency. Nine families having one or two individuals affected with FBPase deficiency were enrolled over a period of 3 years. All FBP1 exonic regions including splicing sites were PCR-amplified and sequenced bidirectionally. Familial cosegregation of mutations with disease was confirmed by direct sequencing and PCR-RFLP analysis. Three different FBP1 mutations were identified. Each of two previously reported mutations (c.472C>T (p.Arg158Trp) and c.841G>A (p.Glu281Lys)) was carried by four different families. The ninth family carried a novel 4-bp deletion (c.609_612delAAAA), which is predicted to result in frameshift (p.Lys204Argfs*72) and loss of FBPase function. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. FBPase deficiency is often fatal in the infancy and early childhood. Early diagnosis and prompt treatment is therefore crucial to preventing early mortality. We recommend the use of c.472C>T and c.841G>A mutations as first choice genetic markers for molecular diagnosis of FBPase deficiency in Pakistan.

  7. WDR73 missense mutation causes infantile onset intellectual disability and cerebellar hypoplasia in a consanguineous family.

    Science.gov (United States)

    Jiang, Chen; Gai, Nan; Zou, Yongyi; Zheng, Yu; Ma, Ruiyu; Wei, Xianda; Liang, Desheng; Wu, Lingqian

    2017-01-01

    Galloway-Mowat syndrome (GMS) is a very rare autosomal-recessive disorder characterized by nephrotic syndrome associated with microcephaly, and various central nervous system abnormalities, mostly cerebral hypoplasia or cerebellar atrophy, intellectual disability and neural-migration defects. WDR73 is the only gene known to cause GMS, and has never been implicated in other disease. Here we present a Chinese consanguineous family with infantile onset intellectual disability and cerebellar hypoplasia but no microcephaly. Whole exome sequencing identified a WDR73 p.W371G missense mutation. The mutation is confirmed to be segregated in this family by Sanger sequencing according to a recessive inheritance pattern. It is predicted to be deleterious by multiple algorithms and affect highly conserved site. Structural modeling revealed conformational differences between the wild type protein and the p.W371G protein. Real-time PCR and Western blotting revealed altered mRNA and protein levels in mutated samples. Our study indicates the novel WDR73 p.W371G missense mutation causes infantile onset intellectual disability and cerebellar hypoplasia in recessive mode of inheritance. Our findings imply that microcephaly is a variable phenotype in WDR73-related disease, suggest WDR73 to be a candidate gene of severe intellectual disability and cerebellar hypoplasia, and expand the molecular spectrum of WDR73-related disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Variable pathogenicity of exon 43del (FAA) in four Fanconi anaemia patients within a consanguineous family.

    Science.gov (United States)

    Koc, A; Pronk, J C; Alikasifoglu, M; Joenje, H; Altay, C

    1999-01-01

    Four Fanconi anaemia group A (FAA) patients within two related consanguineous families are presented: the propositus (male, 13 years, transplanted at age 10), and his three cousins (one male, 8 years, and two female newborns). Assignment of the patients to FAA was based on the functional complementation analysis by somatic cell hybridization and confirmed by mutation screening showing a homozygous deletion of exon 43 (4267-4404del) in the FAA gene to be present in all four patients. The newborn patients had been diagnosed prenatally by DNA analysis. In spite of identical molecular pathology and close familial relationship the clinical phenotypes of the four patients were not concordant. Discordant symptoms included birthweight, pigmentation abnormalities, skeletal, renal and genital abnormalities, whereas microcephaly and possibly the haematological course were concordant. Differences in environmental conditions and/or genetic make-up along with chance effects during development may explain discordant phenotypes despite identical molecular pathology in these patients. However, our results do not rule out the possibility that the exon 43del mutation may have prognostic value for the haematological course of the disease.

  9. A Common Ancestral Mutation in CRYBB3 Identified in Multiple Consanguineous Families with Congenital Cataracts.

    Directory of Open Access Journals (Sweden)

    Xiaodong Jiao

    Full Text Available This study was performed to investigate the genetic determinants of autosomal recessive congenital cataracts in large consanguineous families.Affected individuals underwent a detailed ophthalmological examination and slit-lamp photographs of the cataractous lenses were obtained. An aliquot of blood was collected from all participating family members and genomic DNA was extracted from white blood cells. Initially, a genome-wide scan was performed with genomic DNAs of family PKCC025 followed by exclusion analysis of our familial cohort of congenital cataracts. Protein-coding exons of CRYBB1, CRYBB2, CRYBB3, and CRYBA4 were sequenced bidirectionally. A haplotype was constructed with SNPs flanking the causal mutation for affected individuals in all four families, while the probability that the four familial cases have a common founder was estimated using EM and CHM-based algorithms. The expression of Crybb3 in the developing murine lens was investigated using TaqMan assays.The clinical and ophthalmological examinations suggested that all affected individuals had nuclear cataracts. Genome-wide linkage analysis localized the causal phenotype in family PKCC025 to chromosome 22q with statistically significant two-point logarithm of odds (LOD scores. Subsequently, we localized three additional families, PKCC063, PKCC131, and PKCC168 to chromosome 22q. Bidirectional Sanger sequencing identified a missense variation: c.493G>C (p.Gly165Arg in CRYBB3 that segregated with the disease phenotype in all four familial cases. This variation was not found in ethnically matched control chromosomes, the NHLBI exome variant server, or the 1000 Genomes or dbSNP databases. Interestingly, all four families harbor a unique disease haplotype that strongly suggests a common founder of the causal mutation (p<1.64E-10. We observed expression of Crybb3 in the mouse lens as early as embryonic day 15 (E15, and expression remained relatively steady throughout development.Here, we

  10. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    OpenAIRE

    Shamim Saleha; Muhammad Ajmal; Muhammad Jamil

    2016-01-01

    AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype...

  11. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  12. Phenotypic Progression of Stargardt Disease in a Large Consanguineous Tunisian Family Harboring New ABCA4 Mutations

    Directory of Open Access Journals (Sweden)

    Yousra Falfoul

    2018-01-01

    Full Text Available To assess the progression of Stargardt (STGD disease over nine years in two branches of a large consanguineous Tunisian family. Initially, different phenotypes were observed with clinical intra- and interfamilial variations. At presentation, four different retinal phenotypes were observed. In phenotype 1, bull’s eye maculopathy and slight alteration of photopic responses in full-field electroretinography were observed in the youngest child. In phenotype 2, macular atrophy and yellow white were observed in two brothers. In phenotype 3, diffuse macular, peripapillary, and peripheral RPE atrophy and hyperfluorescent dots were observed in two sisters. In phenotype 4, Stargardt disease-fundus flavimaculatus phenotype was observed in two cousins with later age of onset. After a progression of 9 years, all seven patients displayed the same phenotype 3 with advanced stage STGD and diffuse atrophy. WES and MLPA identified two ABCA4 mutations M1: c.[(?_4635_(5714+?dup; (?_6148_(6479_+? del] and M2: c.[2041C>T], p.[R681∗]. In one branch, the three affected patients had M1/M1 causal mutations and in the other branch the two affected patients had M1/M2 causal mutations. After 9-year follow-up, all patients showed the same phenotypic evolution, confirming the progressive nature of the disease. Genetic variations in the two branches made no difference to similar end-stage disease.

  13. Junctional epidermolysis bullosa in the Middle East: clinical and genetic studies in a series of consanguineous families.

    Science.gov (United States)

    Nakano, Aoi; Lestringant, Gilles G; Paperna, Tamar; Bergman, Reuven; Gershoni, Ruth; Frossard, Philippe; Kanaan, Moien; Meneguzzi, Guerrino; Richard, Gabriele; Pfendner, Ellen; Uitto, Jouni; Pulkkinen, Leena; Sprecher, Eli

    2002-04-01

    Junctional epidermolysis bullosa (JEB) is a group of inherited blistering diseases characterized by epidermal-dermal separation resulting from mutations that affect the function of critical components of the basement membrane zone. This group of autosomal recessive diseases is especially prevalent in regions where consanguinity is common, such as the Middle East. However, the clinical and genetic epidemiology of JEB in this region remains largely unexplored. The aim of the present study was to assess a series of consanguineous JEB families originating from the Middle East. We identified 7 families referred to us between 1998 and 1999 and originating from the United Arab Emirates, Saudi Arabia, Sudan, Yemen, and Israel. Histologic, immunofluorescence, and electron microscopy studies were performed to direct the subsequent molecular analysis. DNA obtained from all family members was amplified by means of polymerase chain reaction and analyzed by conformation-sensitive gel electrophoresis with subsequent direct sequencing. In 6 families presenting with the clinical and histologic features distinctive for JEB, mutations in genes encoding 1 of the 3 subunit polypeptides of laminin-5 were identified. Two families each had mutations in LAMB3, 2 in LAMA3, and 2 in LAMC2. Out of 7 distinct mutations, 5 were novel and 2 were recurrent. No relationship was found between the presence of nonsense/frameshift mutations in laminin-5 genes and perinatal mortality, contradicting a major genotype-phenotype correlation previously reported in the European and US literature. Similarly, none of the recurrent LAMB3 hot spot mutations previously described in other populations was found in our series. Finally, in a family with the clinical diagnosis of generalized atrophic benign epidermolysis bullosa, a homozygous non-sense mutation in Col17A1 gene (encoding the BPAG2 antigen) was identified. The present report suggests (1) the existence of a unique spectrum of mutations in the Middle East

  14. A homozygous mutation in a consanguineous family consolidates the role of ALDH1A3 in autosomal recessive microphthalmia

    DEFF Research Database (Denmark)

    Roos, L; Fang, M; Dali, C

    2013-01-01

    to the identification of new genes. Very recently, homozygous variations within ALDH1A3 have been associated with autosomal recessive microphthalmia with or without cysts or coloboma, and with variable subphenotypes of developmental delay/autism spectrum disorder in eight families. In a consanguineous family where...... three of the five siblings were affected with microphthalmia/coloboma, we identified a novel homozygous missense mutation in ALDH1A3 using exome sequencing. Of the three affected siblings, one had intellectual disability and one had intellectual disability and autism, while the last one presented...... with normal development. This study contributes further to the description of the clinical spectrum associated with ALDH1A3 mutations, and illustrates the interfamilial clinical variation observed in individuals with ALDH1A3 mutations....

  15. APOA5 Q97X Mutation Identified through homozygosity mapping causes severe hypertriglyceridemia in a Chilean consanguineous family

    Directory of Open Access Journals (Sweden)

    Dussaillant Catalina

    2012-11-01

    Full Text Available Abstract Background Severe hypertriglyceridemia (HTG has been linked to defects in LPL, APOC2, APOA5, LMF1 and GBIHBP1 genes. However, a number of severe HTG cases are probably caused by as yet unidentified mutations. Very high triglyceride plasma levels (>112 mmol/L at diagnosis were found in two sisters of a Chilean consanguineous family, which is strongly suggestive of a recessive highly penetrant mutation. The aim of this study was to determine the genetic locus responsible for the severe HTG in this family. Methods We carried out a genome-wide linkage study with nearly 300,000 biallelic markers (Illumina Human CytoSNP-12 panel. Using the homozygosity mapping strategy, we searched for chromosome regions with excess of homozygous genotypes in the affected cases compared to non-affected relatives. Results A large homozygous segment was found in the long arm of chromosome 11, with more than 2,500 consecutive homozygous SNP shared by the proband with her affected sister, and containing the APOA5/A4/C3/A1 cluster. Direct sequencing of the APOA5 gene revealed a known homozygous nonsense Q97X mutation (p.Gln97Ter found in both affected sisters but not in non-affected relatives nor in a sample of unrelated controls. Conclusion The Q97X mutation of the APOA5 gene in homozygous status is responsible for the severe hypertriglyceridemia in this family. We have shown that homozygosity mapping correctly pinpointed the genomic region containing the gene responsible for severe hypertriglyceridemia in this consanguineous Chilean family.

  16. APOA5 Q97X mutation identified through homozygosity mapping causes severe hypertriglyceridemia in a Chilean consanguineous family.

    Science.gov (United States)

    Dussaillant, Catalina; Serrano, Valentina; Maiz, Alberto; Eyheramendy, Susana; Cataldo, Luis Rodrigo; Chavez, Matías; Smalley, Susan V; Fuentes, Marcela; Rigotti, Attilio; Rubio, Lorena; Lagos, Carlos F; Martinez, José Alfredo; Santos, José Luis

    2012-11-15

    Severe hypertriglyceridemia (HTG) has been linked to defects in LPL, APOC2, APOA5, LMF1 and GBIHBP1 genes. However, a number of severe HTG cases are probably caused by as yet unidentified mutations. Very high triglyceride plasma levels (>112 mmol/L at diagnosis) were found in two sisters of a Chilean consanguineous family, which is strongly suggestive of a recessive highly penetrant mutation. The aim of this study was to determine the genetic locus responsible for the severe HTG in this family. We carried out a genome-wide linkage study with nearly 300,000 biallelic markers (Illumina Human CytoSNP-12 panel). Using the homozygosity mapping strategy, we searched for chromosome regions with excess of homozygous genotypes in the affected cases compared to non-affected relatives. A large homozygous segment was found in the long arm of chromosome 11, with more than 2,500 consecutive homozygous SNP shared by the proband with her affected sister, and containing the APOA5/A4/C3/A1 cluster. Direct sequencing of the APOA5 gene revealed a known homozygous nonsense Q97X mutation (p.Gln97Ter) found in both affected sisters but not in non-affected relatives nor in a sample of unrelated controls. The Q97X mutation of the APOA5 gene in homozygous status is responsible for the severe hypertriglyceridemia in this family. We have shown that homozygosity mapping correctly pinpointed the genomic region containing the gene responsible for severe hypertriglyceridemia in this consanguineous Chilean family.

  17. RESEARCH NOTE Molecular genetic analysis of consanguineous ...

    Indian Academy of Sciences (India)

    Navya

    Molecular genetic analysis of consanguineous families with primary microcephaly ... Translational Research Institute, Academic Health System, Hamad Medical ..... bridging the gap between homozygosity mapping and deep sequencing.

  18. Novel compound heterozygous mutations of ALDH1A3 contribute to anophthalmia in a non-consanguineous Chinese family

    Directory of Open Access Journals (Sweden)

    Yunqiang Liu

    2017-06-01

    Full Text Available Abstract Anophthalmia is a rare eye development anomaly resulting in absent ocular globes or tissue in the orbit since birth. Here, we investigated a newborn with bilateral anophthalmia in a Chinese family. Exome sequencing revealed that compound heterozygous mutations c.287G > A (p.(Arg96His and c.709G > A (p.(Gly237Arg of the ALDH1A3 gene were present in the affected newborn. Both mutations were absent in all of the searched databases, including 10,000 in-house Chinese exome sequences, and these mutations were confirmed as having been transmitted from the parents. Comparative amino acid sequence analysis across distantly related species revealed that the residues at positions 96 and 234 were evolutionarily highly conserved. In silico analysis predicted these changes to be damaging, and in vitro expression analysis revealed that the mutated alleles were associated with decreased protein production and impaired tetrameric protein formation. This study firstly reported that compound heterozygous mutations of the ALDH1A3 gene can result in anophthalmia in humans, thus highlighting those heterozygous mutations in ALDH1A3 should be considered for molecular screening in anophthalmia, particularly in cases from families without consanguineous relationships.

  19. A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

    Science.gov (United States)

    Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H

    2016-12-15

    PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Clinical Polymorphism of Stargardt Disease in a Large Consanguineous Tunisian Family; Implications for Nosology

    Directory of Open Access Journals (Sweden)

    Leila El Matri

    2013-01-01

    Full Text Available Purpose: To describe the polymorphic expression of Stargardt disease in a large Tunisian family with clinical intra- and interfamilial variation of the condition. Methods: Twelve subjects from two related families with autosomal recessive Stargardt disease were enrolled. A detailed clinical examination including visual acuity and visual field measurement, fundus photography, fluorescein angiography, electroretinography (ERG and color vision testing was performed for all subjects. Results: The youngest child from family A manifested typical Stargardt disease while her two brothers presented with Stargardt disease-fundus flavimaculatus (STGD-FFM and her two sisters demonstrated a peculiar phenotype overlapping Stargardt disease and cone-rod dystrophy; their phenotypic manifestation corresponded well with ERG groups I, II and III, respectively. This uncommon occurrence of an age-related decline in ERG amplitude and worsening of fundus changes is suggestive of a grading pattern in Stargardt disease. Their two cousins in family B, displayed the STGD-FFM phenotype. Despite clinically similar STGD-FFM patterns in both families, age of onset and progression of the phenotype in family B differed from family A. Conclusion: This is the first report on phenotypic variation of Stargardt disease in a large Tunisian family. Regarding phenotype and severity of visual symptoms, family A demonstrated Stargardt disease at various stages of progression. In addition, STGDFFM appeared to be an independent clinical entity in family B. These findings imply that further parameters are required to classify Stargardt′s disease.

  1. Homozygous missense mutation in the LMAN2L gene segregates with intellectual disability in a large consanguineous Pakistani family.

    Science.gov (United States)

    Rafiullah, Rafiullah; Aslamkhan, Muhammad; Paramasivam, Nagarajan; Thiel, Christian; Mustafa, Ghulam; Wiemann, Stefan; Schlesner, Matthias; Wade, Rebecca C; Rappold, Gudrun A; Berkel, Simone

    2016-02-01

    Intellectual disability (ID) is a neurodevelopmental disorder affecting 1%-3% of the population worldwide. It is characterised by high phenotypic and genetic heterogeneity and in most cases the underlying cause of the disorder is unknown. In our study we investigated a large consanguineous family from Baluchistan, Pakistan, comprising seven affected individuals with a severe form of autosomal recessive ID (ARID) and epilepsy, to elucidate a putative genetic cause. Whole exome sequencing (WES) of a trio, including a child with ID and epilepsy and its healthy parents that were part of this large family, revealed a homozygous missense variant p.R53Q in the lectin mannose-binding 2-like (LMAN2L) gene. This homozygous variant was co-segregating in the family with the phenotype of severe ID and infantile epilepsy; unaffected family members were heterozygous variant carriers. The variant was predicted to be pathogenic by five different in silico programmes and further three-dimensional structure modelling of the protein suggests that variant p.R53Q may impair protein-protein interaction. LMAN2L (OMIM: 609552) encodes for the lectin, mannose-binding 2-like protein which is a cargo receptor in the endoplasmic reticulum important for glycoprotein transport. Genome-wide association studies have identified an association of LMAN2L to different neuropsychiatric disorders. This is the first report linking LMAN2L to a phenotype of severe ARID and seizures, indicating that the deleterious homozygous p.R53Q variant very likely causes the disorder. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  2. Whole exome sequencing of a consanguineous family identifies the possible modifying effect of a globally rare AK5 allelic variant in celiac disease development among Saudi patients.

    Directory of Open Access Journals (Sweden)

    Jumana Yousuf Al-Aama

    Full Text Available Celiac disease (CD, a multi-factorial auto-inflammatory disease of the small intestine, is known to occur in both sporadic and familial forms. Together HLA and Non-HLA genes can explain up to 50% of CD's heritability. In order to discover the missing heritability due to rare variants, we have exome sequenced a consanguineous Saudi family presenting CD in an autosomal recessive (AR pattern. We have identified a rare homozygous insertion c.1683_1684insATT, in the conserved coding region of AK5 gene that showed classical AR model segregation in this family. Sequence validation of 200 chromosomes each of sporadic CD cases and controls, revealed that this extremely rare (EXac MAF 0.000008 mutation is highly penetrant among general Saudi populations (MAF is 0.62. Genotype and allelic distribution analysis have indicated that this AK5 (c.1683_1684insATT mutation is negatively selected among patient groups and positively selected in the control group, in whom it may modify the risk against CD development [p<0.002]. Our observation gains additional support from computational analysis which predicted that Iso561 insertion shifts the existing H-bonds between 400th and 556th amino acid residues lying near the functional domain of adenylate kinase. This shuffling of amino acids and their H-bond interactions is likely to disturb the secondary structure orientation of the polypeptide and induces the gain-of-function in nucleoside phosphate kinase activity of AK5, which may eventually down-regulates the reactivity potential of CD4+ T-cells against gluten antigens. Our study underlines the need to have population-specific genome databases to avoid false leads and to identify true candidate causal genes for the familial form of celiac disease.

  3. Dental findings and treatment in consanguinity associated congenital chronic familial neutropenia.

    Science.gov (United States)

    Buduneli, Nurcan; Cogulu, Dilsah; Kardesler, Levent; Kütükçüler, Necil

    2006-01-01

    The purpose of this report is to describe dental findings and treatment of an 11-year old male patient and a 5-year old female patient, children of first cousins, suffering from severe benign congenital chronic familial neutropenia. This case report emphazises the importance of differential diagnosis of immunodeficiencies including congenital chronic familial neutropenia in the background of severe periodontal diseases and/or diffuse carious lesions in children.

  4. Autozygosity mapping of a large consanguineous Pakistani family reveals a novel non-syndromic autosomal recessive mental retardation locus on 11p15-tel

    DEFF Research Database (Denmark)

    Rehman, Shoaib ur; Baig, Shahid Mahmood; Eiberg, Hans

    2011-01-01

    done in all sampled individuals in the family. The nuclear central loop in the five generation family showed homozygosity for a 6-Mb telomeric region on 11p15, whereas all other linkage regions were excluded by calculation of logarithm of odds (LOD) for the SNP microarray data. A maximum LOD score of Z......Autosomal recessive inherited mental retardation is an extremely heterogeneous disease and accounts for approximately 25% of all non-syndromic mental retardation cases. Autozygosity mapping of a large consanguineous Pakistani family revealed a novel locus for non-syndromic autosomal recessive...

  5. Consanguinity and primary immunodeficiencies.

    Science.gov (United States)

    Al-Herz, Waleed; Aldhekri, Hasan; Barbouche, Mohamed-Ridha; Rezaei, Nima

    2014-01-01

    Primary immunodeficiencies (PIDs) are a heterogeneous group of genetic disorders caused by defects in the immune system that predispose patients to infections, autoimmune diseases, lymphoproliferation and malignancies. Most PIDs are inherited in an autosomal recessive pattern; therefore, they are more common in areas with high rates of consanguineous marriage. Reports about PIDs from these areas have demonstrated a peculiar prevalence of more severe forms of diseases compared to other regions, and patients born to consanguineous parents have increased rates of morbidity and mortality compared to other patients. Individuals at high risk of having a child with a PID who wish to have a healthy child have limited options, these include prenatal diagnosis and pre-implantation genetic diagnosis. However, these options require a collaborative team of specialists and may not always be implemented due to geographic, religious, financial or social factors. The recent introduction of newborn-screening programs for a number of T and B lymphocyte deficiencies will facilitate early diagnosis and therapeutic interventions, which may include hematopoietic stem cell transplantation and intravenous immunoglobulin treatment. There is a need for the implementation of strategies to increase public awareness of the health risks associated with consanguineous marriage. It should be stressed that genetic counseling should be an important component of the care of patients with PIDs as well as their families. © 2014 S. Karger AG, Basel.

  6. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    Directory of Open Access Journals (Sweden)

    Shamim Saleha

    2016-05-01

    Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  7. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

    Science.gov (United States)

    Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

    2016-01-01

    To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  8. Restrictive Dermopathy: Molecular diagnosis of restrictive dermopathy in a stillborn fetus from a consanguineous Iranian family

    International Nuclear Information System (INIS)

    Karaminejad, A.; Goodarzi, P.; Huong, Le Thi Thanh; Wehnert, Manfred S.

    2009-01-01

    Restrictive dermopathy (RD) is an autosomal recessive lethal human genetic disorder. It is characterized by intrauterine growth retardation, tight and rigid skin with erosions, multiple joint contractures, lung hypoplasia, prominent superficial vasculature and epidermal hyperkeratosis. In the present report, we describe the first case of restrictive dermopathy in a stillborn fetus of Iranian origin, confirmed by molecular genetic diagnosis. In the index case (G-30159), a homozygous one base insertion in ZMPSTE24exon 9 (c.1085-1086insT) was identified. We believe that by increasing awareness of this disease in clinicians, gynecologists and pathologists, we may be able to help families who have had suspected cases of restrictive dermopathy be diagnosed and offer molecular testing in carriers and prenatal diagnosis to prevent the occurrence of further affected cases. (author)

  9. Consanguineous Marriage and Marital Adjustment in Turkey.

    Science.gov (United States)

    Fisiloglu, Hurol

    2001-01-01

    Investigates the relationship between consanguineous marriage and marital adjustment in Turkey. The results of the study show that the consanguineous marriage group had significantly lower marital adjustment and had more conflict with extended family than the nonconsanguineous marriage group. The finding is discussed in the context of research and…

  10. CONSANGUINEOUS MARRIAGE IN JORDAN: AN UPDATE.

    Science.gov (United States)

    Islam, M Mazharul; Ababneh, Faisal M; Khan, Md Hasinur Rahaman

    2017-08-10

    This study examined the recent level, trends and determinants of consanguineous marriage in Jordan using time-series data from the Jordan Population and Family Health Surveys (JPFHSs). According to the 2012 JPFHS, 35% of all marriages were consanguineous in Jordan in 2012. There has been a declining trend in consanguinity in the country, with the rate decreasing from a level of 57% in 1990. Most consanguineous marriage in 2012 were first cousin marriages, constituting 23% of all marriages and 66% of all consanguineous marriages. The data show that women with a lower age at marriage, older marriage cohort, larger family size, less than secondary level of education, rural place of residence, no employment, no exposure to mass media, a monogamous marriage, a husband with less than higher level of education and lower economic status, and those from the Badia region, were more likely to have a consanguineous marriage. Increasing age at marriage, level of education, urbanization and knowledge about the health consequences of consanguinity, and the ongoing socioeconomic and demographic transition in the country, will be the driving forces for further decline in consanguinity in Jordan.

  11. The Use of High-Density SNP Array to Map Homozygosity in Consanguineous Families to Efficiently Identify Candidate Genes: Application to Woodhouse-Sakati Syndrome

    Directory of Open Access Journals (Sweden)

    Molly B. Sheridan

    2015-01-01

    Full Text Available Two consanguineous Qatari siblings presented for evaluation: a 17-4/12-year-old male with hypogonadotropic hypogonadism, alopecia, intellectual disability, and microcephaly and his 19-year-old sister with primary amenorrhea, alopecia, and normal cognition. Both required hormone treatment to produce secondary sex characteristics and pubertal development beyond Tanner 1. SNP array analysis of both probands was performed to detect shared regions of homozygosity which may harbor homozygous mutations in a gene causing their common features of abnormal pubertal development, alopecia, and variable cognitive delay. Our patients shared multiple homozygous genomic regions; ten shared regions were >1 Mb in length and constituted 0.99% of the genome. DCAF17, encoding a transmembrane nuclear protein of uncertain function, was the only gene identified in a homozygous region known to cause hypogonadotropic hypogonadism. DCAF17 mutations are associated with Woodhouse-Sakati syndrome, a rare disorder characterized by alopecia, hypogonadotropic hypogonadism, sensorineural hearing loss, diabetes mellitus, and extrapyramidal movements. Sequencing of the coding exons and flanking intronic regions of DCAF17 in the proband revealed homozygosity for a previously described founder mutation (c.436delC. Targeted DCAF17 sequencing of his affected sibling revealed the same homozygous mutation. This family illustrates the utility of SNP array testing in consanguineous families to efficiently and inexpensively identify regions of genomic homozygosity in which genetic candidates for recessive conditions can be identified.

  12. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  13. A novel HSF4 gene mutation (p.R405X causing autosomal recessive congenital cataracts in a large consanguineous family from Pakistan

    Directory of Open Access Journals (Sweden)

    Cheema Abdul

    2008-11-01

    Full Text Available Abstract Background Hereditary cataracts are most frequently inherited as autosomal dominant traits, but can also be inherited in an autosomal recessive or X-linked fashion. To date, 12 loci for autosomal recessive cataracts have been mapped including a locus on chromosome 16q22 containing the disease-causing gene HSF4 (Genbank accession number NM_001040667. Here, we describe a family from Pakistan with the first nonsense mutation in HSF4 thus expanding the mutational spectrum of this heat shock transcription factor gene. Methods A large consanguineous Pakistani family with autosomal recessive cataracts was collected from Quetta. Genetic linkage analysis was performed for the common known autosomal recessive cataracts loci and linkage to a locus containing HSF4 (OMIM 602438 was found. All exons and adjacent splice sites of the heat shock transcription factor 4 gene (HSF4 were sequenced. A mutation-specific restriction enzyme digest (HphI was performed for all family members and unrelated controls. Results The disease phenotype perfectly co-segregated with markers flanking the known cataract gene HSF4, whereas other autosomal recessive loci were excluded. A maximum two-point LOD score with a Zmax = 5.6 at θ = 0 was obtained for D16S421. Direct sequencing of HSF4 revealed the nucleotide exchange c.1213C > T in this family predicting an arginine to stop codon exchange (p.R405X. Conclusion We identified the first nonsense mutation (p.R405X in exon 11 of HSF4 in a large consanguineous Pakistani family with autosomal recessive cataract.

  14. A novel DFNB31 mutation associated with Usher type 2 syndrome showing variable degrees of auditory loss in a consanguineous Portuguese family.

    Science.gov (United States)

    Audo, Isabelle; Bujakowska, Kinga; Mohand-Saïd, Saddek; Tronche, Sophie; Lancelot, Marie-Elise; Antonio, Aline; Germain, Aurore; Lonjou, Christine; Carpentier, Wassila; Sahel, José-Alain; Bhattacharya, Shomi; Zeitz, Christina

    2011-01-01

    To identify the genetic defect of a consanguineous Portuguese family with rod-cone dystrophy and varying degrees of decreased audition. A detailed ophthalmic and auditory examination was performed on a Portuguese patient with severe autosomal recessive rod-cone dystrophy. Known genetic defects were excluded by performing autosomal recessive retinitis pigmentosa (arRP) genotyping microarray analysis and by Sanger sequencing of the coding exons and flanking intronic regions of eyes shut homolog-drosophila (EYS) and chromosome 2 open reading frame 71 (C2orf71). Subsequently, genome-wide homozygosity mapping was performed in DNA samples from available family members using a 700K single nucleotide polymorphism (SNP) microarray. Candidate genes present in the significantly large homozygous regions were screened for mutations using Sanger sequencing. The largest homozygous region (~11 Mb) in the affected family members was mapped to chromosome 9, which harbors deafness, autosomal recessive 31 (DFNB31; a gene previously associated with Usher syndrome). Mutation analysis of DFNB31 in the index patient identified a novel one-base-pair deletion (c.737delC), which is predicted to lead to a truncated protein (p.Pro246HisfsX13) and co-segregated with the disease in the family. Ophthalmic examination of the index patient and the affected siblings showed severe rod-cone dystrophy. Pure tone audiometry revealed a moderate hearing loss in the index patient, whereas the affected siblings were reported with more profound and early onset hearing impairment. We report a novel truncating mutation in DFNB31 associated with severe rod-cone dystrophy and varying degrees of hearing impairment in a consanguineous family of Portuguese origin. This is the second report of DFNB31 implication in Usher type 2.

  15. A missense mutation in the CRBN gene that segregates with intellectual disability and self-mutilating behaviour in a consanguineous Saudi family.

    Science.gov (United States)

    Sheereen, Atia; Alaamery, Manal; Bawazeer, Shahad; Al Yafee, Yusra; Massadeh, Salam; Eyaid, Wafaa

    2017-04-01

    Autosomal-recessive non-syndromic intellectual disability (ARNS-ID) is an aetiologically heterogeneous disorder. Although little is known about the function of human cereblon (CRBN), its relationship to mild cognitive deficits suggests that it is involved in the basic processes of human memory and learning. We aim to identify the genetic cause of intellectual disability and self-mutilation in a consanguineous Saudi family with five affected members. Clinical whole-exome sequencing was performed on the proband patient, and Sanger sequencing was done to validate and confirm segregation in other family members. A missense variant (c. 1171T>C) in the CRBN gene was identified in five individuals with severe intellectual disability (ID) in a consanguineous Saudi family. The homozygous variant was co-segregating in the family with the phenotype of severe ID, seizures and self-mutilating behaviour. The missense mutation (p.C391R) reported here results in the replacement of a conserved cysteine residue by an arginine in the CULT (cereblon domain of unknown activity, binding cellular ligands and thalidomide) domain of CRBN, which contains a zinc-binding site. These findings thus contribute to a growing list of ID disorders caused by CRBN mutations, broaden the spectrum of phenotypes attributable to ARNS-ID and provide new insight into genotype-phenotype correlations between CRBN mutations and the aetiology of ARNS-ID. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  16. Genome-wide linkage in a highly consanguineous pedigree reveals two novel loci on chromosome 7 for non-syndromic familial Premature Ovarian Failure.

    Directory of Open Access Journals (Sweden)

    Sandrine Caburet

    Full Text Available BACKGROUND: The human condition known as Premature Ovarian Failure (POF is characterized by loss of ovarian function before the age of 40. A majority of POF cases are sporadic, but 10-15% are familial, suggesting a genetic origin of the disease. Although several causal mutations have been identified, the etiology of POF is still unknown for about 90% of the patients. METHODOLOGY/PRINCIPAL FINDINGS: We report a genome-wide linkage and homozygosity analysis in one large consanguineous Middle-Eastern POF-affected family presenting an autosomal recessive pattern of inheritance. We identified two regions with a LOD(max of 3.26 on chromosome 7p21.1-15.3 and 7q21.3-22.2, which are supported as candidate regions by homozygosity mapping. Sequencing of the coding exons and known regulatory sequences of three candidate genes (DLX5, DLX6 and DSS1 included within the largest region did not reveal any causal mutations. CONCLUSIONS/SIGNIFICANCE: We detect two novel POF-associated loci on human chromosome 7, opening the way to the identification of new genes involved in the control of ovarian development and function.

  17. Consanguinity and genetic disorders: Profile from Jordan

    International Nuclear Information System (INIS)

    Hamamy, Hanan A.; Ajlouni, Kamel M.; Masri, Amira T.; Al-Hadidy, Azmy M.

    2007-01-01

    With 20-30% of all marriages occurring between first cousins, increasing attention in Jordan is now given to role of consanguinity in the occurrence of genetic diseases. The objective of this study is to define the specific categories of genetic disorders associated with consanguineous marriages. Etiological categories and consanguinity rates were studied among 623 families with genetic syndromes, congenital anomalies or mental retardation, or both, seen at the National Center for Diabetes, Endocrinology and Genetics for the period August 2002 to August 2006. Comparisons were made for first cousin marriage rates in the study group and that for the general population. First cousin marriages constituted 69%, 22% and 41.7% of marriages among families with autosomal recessive conditions (group 1), dominant, X-linked and chromosomal conditions (group 2) and sporadic undiagnosed conditions (group 3) respectively. The differences in the rates of the first cousin matings were highly significant when comparing known figures in the general population with group 1 and 3, but not significant with group 2. Two messages to the public and health care personnel regarding consanguinity can be derived from this study. The first message is that among genetic disorders, only autosomal recessive disorders are strongly associated with consanguinity. The second message is that approximately 30% of sporadic undiagnosed cases of mental retardation, congenital anomalies and dimorphism may have an autosomal recessive etiology with risks of recurrence in future pregnancies. (author)

  18. A novel loss-of-function mutation in GPR54/KISS1R leads to hypogonadotropic hypogonadism in a highly consanguineous family.

    Science.gov (United States)

    Nimri, Revital; Lebenthal, Yael; Lazar, Liora; Chevrier, Lucie; Phillip, Moshe; Bar, Meytal; Hernandez-Mora, Eva; de Roux, Nicolas; Gat-Yablonski, Galia

    2011-03-01

    The G protein-coupled receptor 54 (GPR54), the kisspeptin receptor, is essential for stimulation of GnRH secretion and induction of puberty. Recently loss-of-function mutations of the GPR54 have been implicated as a cause of isolated idiopathic hypogonadotropic hypogonadism (IHH). The objective of the study was to identify the genetic cause of IHH in a consanguineous pedigree and to characterize the phenotypic features from infancy through early adulthood. In six patients with normosmic IHH belonging to two families of Israeli Muslim-Arab origin highly related to one another, DNA was analyzed for mutations in the GnRHR and GPR54 genes, with functional analysis of the mutation found. The five males underwent comprehensive endocrine evaluation and were under longitudinal follow-up; the one female presented in early adulthood. A new homozygous mutation (c.T815C) in GPR54 leading to a phenylalanine substitution by serine (p.F272S) was detected in all patients. Functional analysis showed an almost complete inhibition of kisspeptin-induced GPR54 signaling and a dramatic decrease of the mutated receptor expression at the cell surface. The males exhibited the same clinical features from infancy to adulthood, characterized by cryptorchidism, a relatively short penis, and no spontaneous pubertal development. The female patient presented at 18 yr with impuberism and primary amenorrhea. Repeated stimulation tests demonstrated complete gonadotropin deficiency throughout follow-up. A novel loss-of-function mutation (p.F272S) in the GPR54 gene is associated with familial normosmic IHH. Underdeveloped external genitalia and impuberism point to the major role of GPR54 in the activation of the gonadotropic axis from intrauterine life to adulthood.

  19. Integration of sequence data from a Consanguineous family with genetic data from an outbred population identifies PLB1 as a candidate rheumatoid arthritis risk gene.

    Directory of Open Access Journals (Sweden)

    Yukinori Okada

    Full Text Available Integrating genetic data from families with highly penetrant forms of disease together with genetic data from outbred populations represents a promising strategy to uncover the complete frequency spectrum of risk alleles for complex traits such as rheumatoid arthritis (RA. Here, we demonstrate that rare, low-frequency and common alleles at one gene locus, phospholipase B1 (PLB1, might contribute to risk of RA in a 4-generation consanguineous pedigree (Middle Eastern ancestry and also in unrelated individuals from the general population (European ancestry. Through identity-by-descent (IBD mapping and whole-exome sequencing, we identified a non-synonymous c.2263G>C (p.G755R mutation at the PLB1 gene on 2q23, which significantly co-segregated with RA in family members with a dominant mode of inheritance (P = 0.009. We further evaluated PLB1 variants and risk of RA using a GWAS meta-analysis of 8,875 RA cases and 29,367 controls of European ancestry. We identified significant contributions of two independent non-coding variants near PLB1 with risk of RA (rs116018341 [MAF = 0.042] and rs116541814 [MAF = 0.021], combined P = 3.2 × 10(-6. Finally, we performed deep exon sequencing of PLB1 in 1,088 RA cases and 1,088 controls (European ancestry, and identified suggestive dispersion of rare protein-coding variant frequencies between cases and controls (P = 0.049 for C-alpha test and P = 0.055 for SKAT. Together, these data suggest that PLB1 is a candidate risk gene for RA. Future studies to characterize the full spectrum of genetic risk in the PLB1 genetic locus are warranted.

  20. [Spectrum of congenital malformations observed in neonates of consanguineous parents].

    Science.gov (United States)

    Pinto Escalante, D; Castillo Zapata, I; Ruiz Allec, D; Ceballos Quintal, J M

    2006-01-01

    Consanguineous unions occur in all populations around the world. Couples related as second cousins or closer have been observed with deleterious effect. Among the clinical effects of parental consanguinity, the incidence of offspring with congenital malformations (CM) increases approximately two-fold. A hospital database of neonates with CM was searched to select neonates with parental consanguinity and two control groups. One control group consisted of healthy neonates and the other control group consisted of neonates with CM but without parental consanguinity. Both control groups consisted of the first neonate of the same sex to be born after a consanguineous neonate with CM. Family, sociodemographic and anthropometric variables, as well as the severity of the malformations, were compared between the two groups with CM. Neonates with CM were grouped into five categories: Major multiple CM, minor multiple CM, isolated major CM, isolated minor CM, and specific diseases. The indigenous Mayan subpopulation was also analyzed. Among 1117 neonates with CM, parental consanguinity was found in 21. Parental consanguinity was also found in 8 neonates in the group of healthy controls (OR 2.4 [1.05-5.95]). The most common form of consanguinity was between second cousins and was more frequent in the Mayan subpopulation. Major multiple CM were more frequent among consanguineous than among nonconsanguineous couples. No association was found between the severity of CM and the degree of relationship. The prevalence of consanguinity found in neonates with CM and healthy controls (1.9 % and 0.8 %) was similar to that found in other Latin populations. A higher prevalence was found in the Mayan population. Mayor multiple CM were more frequent among the neonates of consanguineous than among nonconsanguineous couples.

  1. Congenital abnormalities in newborns of consanguineous and nonconsanguineous parents.

    Science.gov (United States)

    Naderi, S

    1979-02-01

    The aim of this study was to determine the types, patterns, and frequencies of congenital anomalies among newborns of both consanguineous and nonconsanguineous parents in southern Iran. From 9526 consecutive pregnancies observed, 9623 newborns resulted (9431 singleton and 95 sets of multiple gestation). There were 7261 newborns from nonconsanguineous parents and 2362 (24.5%) babies from consanguineous marriages. Of the total pregnancies, 1.54% resulted in malformed children (1.53% of singleton and 2.1% of multiple gestations). The incidence of congenital abnormalities in newborns of nonconsanguineous parents was 1.66% as compared to 4.02% for newborns of the consanguineous group. Major and multiple malformations were found to be slightly more common in the consanguinous group. Prematurity, prenatal mortality rate, and congenital abnormalities were more common in the consanguineous group. Probably the closer the familial relationship of the parents, the greater the chances of congenital abnormalities.

  2. Consanguineous marriages in Afghanistan.

    Science.gov (United States)

    Saify, Khyber; Saadat, Mostafa

    2012-01-01

    The present cross-sectional study was done in order to illustrate the prevalence and types of consanguineous marriages among Afghanistan populations. Data on types of marriages were collected using a simple questionnaire. The total number of couples in the study was 7140 from the following provinces: Badakhshan, Baghlan, Balkh, Bamyan, Kabul, Kunduz, Samangan and Takhar. Consanguineous marriages were classified by the degree of relationship between couples: double first cousins, first cousins, first cousins once removed, second cousins and beyond second cousins. The coefficient of inbreeding (F) was calculated for each couple and the mean coefficient of inbreeding (α) estimated for each population. The proportion of consanguineous marriages in the country was 46.2%, ranging from 38.2% in Kabul province to 51.2% in Bamyan province. The equivalent mean inbreeding coefficient (α) was 0.0277, and ranged from 0.0221 to 0.0293 in these two regions. There were significant differences between provinces for frequencies of different types of marriages (pconsanguineous marriages, followed by double first cousin (6.9%), second cousin (5.8%), beyond second cousin (3.9%) and first cousin once removed (1.8%). There were significant differences between ethnic groups for the types of marriages (χ2=177.6, df=25, pconsanguinity.

  3. Survey of familial glaucoma shows a high incidence of cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in non-consanguineous congenital forms in a Spanish population

    Science.gov (United States)

    Millá, Elena; Mañé, Begoña; Duch, Susana; Hernan, Imma; Borràs, Emma; Planas, Ester; Dias, Miguel de Sousa; Carballo, Miguel

    2013-01-01

    Purpose To identify myocilin (MYOC) and cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in a Spanish population with different clinical forms of familial glaucoma or ocular hypertension (OHT). Methods Index patients from 226 families participated in this study. Patients were diagnosed with familial glaucoma or OHT by complete ophthalmologic examination. Screening for MYOC mutations was performed in 207 index patients: 96 with adult-onset primary open-angle glaucoma (POAG), 21 with primary congenital glaucoma (PCG), 18 with juvenile-onset open-angle glaucoma (JOAG), five with Axenfeld-Rieger syndrome (ARS), and 67 with other types of glaucoma. One hundred two of the families (including all those in whom a MYOC mutation was detected) were also screened for CYP1B1 mutations: 45 POAG, 25 PCG, 21 JOAG, four ARS, and seven others. Results We examined 292 individuals (patients and relatives) with a positive family history of glaucoma or OHT. We identified two novel MYOC variants, p.Lys39Arg and p.Glu218Lys, in two families with POAG, and six previously reported MYOC mutations in seven families with POAG (four), JOAG (one), PCG (one), and normotensive glaucoma (one). CYP1B1 mutations were found in 16 index patients with PCG (nine), POAG (three), JOAG (two), and ARS (two). Conclusions The high percentage (9/25=36%) of mutations in CYP1B1 found in non-consanguineous patients with congenital glaucoma mandates genetic testing. However, the percentage of mutations (9/207=4.4%) in MYOC associated with glaucoma is relatively low in our population. The variable phenotype expression of glaucoma, even in families, cannot be explained with a digenic mechanism between MYOC and CYP1B1. PMID:23922489

  4. Identification and in silico characterization of p.G380R substitution in FGFR3, associated with achondroplasia in a non-consanguineous Pakistani family.

    Science.gov (United States)

    Ajmal, Muhammad; Mir, Asif; Shoaib, Muhammad; Malik, Salman Akbar; Nasir, Muhammad

    2017-07-05

    The dimerization efficiency of FGFR3 transmembrane domain plays a critical role in the formation of a normal skeleton through the negative regulation of bone development. Recently, gain-of-function mutations in the transmembrane domain of FGFR3 has been described associated with an aberrant negative regulation, leading to the development of achondroplasia-group disorders, including achondroplasia (ACH), hypochondroplasia (HCH) and thanatophoric dysplasia (TD). Here, we describe a non-consanguineous Pakistani family with achondroplasia to explain hereditary basis of the disease. PCR-based linkage analysis using microsatellite markers was employed to localize the disease gene. Gene specific intronic primers were used to amplify the genomic DNA from all affected as well as phenotypically healthy individuals. Amplified PCR products were then subjected to Sanger sequencing and RFLP analysis to identify a potentially pathogenic mutation. The impact of identified mutation on FGFR3 protein's structure and stability was highlighted through different bioinformatics tools. Genetic screening of the family revealed a previously reported heterozygous c.1138 G > A (p.G380R) mutation in the coding exon 8 of FGFR3 gene. Identified genetic variation was confirmed in all affected individuals while healthy individuals and controls were found genotypically normal. The results were further validated by RFLP analysis as c.1138 G > A substitution generates a unique recognition site for SfcI endonuclease. Following SfcI digestion, the electrophoretic pattern of three bands/DNA fragments for each patient is indicative of heterozygous status of the disease allele. In silico studies of the mutant FGFR3 protein predicted to adversely affect the stability of FGFR3 protein. Mutation in the transmembrane domain may adversely affect the dimerization efficiency and overall stability of the FGFR3, leading to a constitutively active protein. As a result, an uncontrolled intracellular signaling

  5. Impact of 226C>T MSH2 gene mutation on cancer phenotypes in two HNPCC-associated highly-consanguineous families from Kuwait: emphasis on premarital genetic testing.

    Science.gov (United States)

    Marafie, Makia J; Al-Awadi, Sadiqa; Al-Mosawi, Fatemah; Elshafey, Alaa; Al-Ali, Waleed; Al-Mulla, Fahd

    2009-01-01

    Lynch syndrome or hereditary nonpolyposis colorectal cancer (HNPCC) is one of the commonest cancer susceptibility syndromes. It is characterized by early onset colon cancer and a variety of extracolonic tumours. Germline mutations in the DNA mismatch repair genes (MLH1, MSH2, MSH6, PMS1, and PMS2) are responsible for this disorder. Identifying an affected individual depends on the tumour histopathology, family history that fulfils the Amsterdam and/or Bethesda criteria, tumour immunohistochemistry, microsatellite instability, and finally molecular analysis of an affected member. It is a laborious, time consuming and expensive procedure, which needs the effort of a multi-disciplinary team. However, once the diagnosis is established and germline defect is identified, other high risk pre-symptomatic carriers could be offered intensive surveillance and management as a preventive measure against cancer development. Here, we present two large highly consanguineous HNPCC-families from Kuwait in whom a founder MSH2 mutation was identified. The relationship between this mutation and cancer expressivity in two large consanguineous families harbouring other genetic defects is discussed. Moreover, we shed light on the challenges pertaining to diagnosis, screening, premarital counselling of couples and prenatal diagnosis of offspring with biallelic MSH2 gene mutation.

  6. Epilepsy and consanguinity in Shiraz, Iran.

    Science.gov (United States)

    Asadi-Pooya, Ali Akbar

    2005-01-01

    The importance of consanguinity and its association with epilepsy has been suggested in some studies, but in one study the risk contributed to consanguinity for childhood epilepsy was not significanta. In the present study, there was an attempt to determine if consanguinity has any important association with epilepsy. All the epileptic children and adolescents up to the age of 18 years, who had been referred to Motahary Clinic in Shiraz, Iran, during a six-month period, were included in this cross-sectional study. The percentage of consanguinity in parents of the epileptic patients was compared to a sample of the general population in the same geographical area. In total, 181 unrelated epileptic children were included in this study. The mean age of these children was 7+/-4.6 years. The male/female ratio in these patients was 1.29. Overall, 61(33.7%) of the parents were first cousins (OR=2.264, 95%-CI: 1.618-3.169 in comparison to the general population), 37 (20.4%) were second cousins (OR=3.557, 95%-CI: 2.389-5.296), and 83 (45.9%) were not related. The percentage of consanguinity in parents of the epileptic patients was significantly higher in comparison to a sample of the general population (OR=2.612, 95%-CI: 1.929-3.536, Pmarriages (at least by 2.2 folds), as well as pre-marriage counseling for couples who have a family history of epilepsy are necessary as an effective preventive program.

  7. Familial versus mass selection in small populations

    Directory of Open Access Journals (Sweden)

    Couvet Denis

    2003-07-01

    Full Text Available Abstract We used diffusion approximations and a Markov-chain approach to investigate the consequences of familial selection on the viability of small populations both in the short and in the long term. The outcome of familial selection was compared to the case of a random mating population under mass selection. In small populations, the higher effective size, associated with familial selection, resulted in higher fitness for slightly deleterious and/or highly recessive alleles. Conversely, because familial selection leads to a lower rate of directional selection, a lower fitness was observed for more detrimental genes that are not highly recessive, and with high population sizes. However, in the long term, genetic load was almost identical for both mass and familial selection for populations of up to 200 individuals. In terms of mean time to extinction, familial selection did not have any negative effect at least for small populations (N ≤ 50. Overall, familial selection could be proposed for use in management programs of small populations since it increases genetic variability and short-term viability without impairing the overall persistence times.

  8. Changing profile of couples seeking genetic counseling for consanguinity in Australia.

    Science.gov (United States)

    Port, Katrina E; Mountain, Helen; Nelson, John; Bittles, Alan H

    2005-01-15

    Consanguineous marriage is rare in most Western countries and, for example, in the USA it may be subject to regulation by both civil legislation and religious prescription. This is not the case in many regions of Asia and Africa where marriage within the family is strongly favored. Since the 1970s there has been widespread migration to North America, Western Europe, and Australasia from communities which encourage consanguineous marriage. To assess the effect of this trend on a genetic counseling program, the records of 302 couples referred to Genetic Services of Western Australia for consanguinity counseling were abstracted for the period 1975-2001. Overall, a family history of genetic disease or a previously affected child was reported in 28.8% of cases. Premarital or prepregnancy counseling on grounds of consanguinity was sought by 41.0% of couples, and a further 18.2% of consanguineous couples had been referred because of a consanguineous pregnancy. In 7.6% of cases a relationship closer than first cousin was involved. Through time there was a significant increase in the numbers of consanguineous consultants, and their patterns of religious affiliation and ethnic origin widened markedly. Although effectively excluded from entry to Australia prior to 1975, couples of Asian origin accounted for 25.5% of all consanguineous consultants. With ongoing migration, changes in the ethnic profiles and the specific counseling requirements of consanguineous couples can be expected to continue and probably accelerate.

  9. Constitutional Mismatch Repair Deficiency in Israel: High Proportion of Founder Mutations in MMR Genes and Consanguinity.

    Science.gov (United States)

    Baris, Hagit N; Barnes-Kedar, Inbal; Toledano, Helen; Halpern, Marisa; Hershkovitz, Dov; Lossos, Alexander; Lerer, Israela; Peretz, Tamar; Kariv, Revital; Cohen, Shlomi; Half, Elizabeth E; Magal, Nurit; Drasinover, Valerie; Wimmer, Katharina; Goldberg, Yael; Bercovich, Dani; Levi, Zohar

    2016-03-01

    Heterozygous germline mutations in any of the mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2, cause Lynch syndrome (LS), an autosomal dominant cancer predisposition syndrome conferring a high risk of colorectal, endometrial, and other cancers in adulthood. Offspring of couples where both spouses have LS have a 1:4 risk of inheriting biallelic MMR gene mutations. These cause constitutional MMR deficiency (CMMRD) syndrome, a severe recessively inherited cancer syndrome with a broad tumor spectrum including mainly hematological malignancies, brain tumors, and colon cancer in childhood and adolescence. Many CMMRD children also present with café au lait spots and axillary freckling mimicking neurofibromatosis type 1. We describe our experience in seven CMMRD families demonstrating the role and importance of founder mutations and consanguinity on its prevalence. Clinical presentations included brain tumors, colon cancer, lymphoma, and small bowel cancer. In children from two nonconsanguineous Ashkenazi Jewish (AJ) families, the common Ashkenazi founder mutations were detected; these were homozygous in one family and compound heterozygous in the other. In four consanguineous families of various ancestries, different homozygous mutations were identified. In a nonconsanguineous Caucasus/AJ family, lack of PMS2 was demonstrated in tumor and normal tissues; however, mutations were not identified. CMMRD is rare, but, especially in areas where founder mutations for LS and consanguinity are common, pediatricians should be aware of it since they are the first to encounter these children. Early diagnosis will enable tailored cancer surveillance in the entire family and a discussion regarding prenatal genetic diagnosis. © 2015 Wiley Periodicals, Inc.

  10. Prevalence of consanguineous marriage among parents of deaf and normal children in Ardabil, North Western Iran

    Directory of Open Access Journals (Sweden)

    Shahrooz Nemati

    2012-06-01

    Full Text Available Background and Aim: Having healthy non-handicapped children plays a major role in mental health of the family and decreases family and society's costs. While consanguineous marriage could lead to expression of recessive genes and a variety of handicaps including deafness, the aim of present study was to scrutinize the prevalence of consanguineous marriage among parents of deaf and normal children as well as its relationship with deafness.Methods: In this study, 467 couples parenting normal children were selected by cluster sampling from elementary, guidance and high schools of Ardabil city and 423 couples parenting disabled children were selected non-randomly among which 130 had deaf children. Descriptive statistics was used to determine the prevalence of consanguineous marriage and chi-square test to compare prevalence of consanguineous marriage among parents of normal and deaf children.Results: Descriptive analyses showed that 80 out of 130 (61.54% parents who had deaf children have had consanguineous marriage. Furthermore data analysis demonstrated that prevalence of consanguineous marriage was significantly higher among parents of deaf children (p<0.001.Conclusion: Consanguineous marriage plays a major role in expression of recessive genes and could lead to development of various handicaps including deafness. Increasing couples' awareness about consequences of consanguineous marriage and conducting genetic counseling are indispensable.

  11. Endogamy, consanguinity and community genetics

    Indian Academy of Sciences (India)

    Unknown

    Centre for Human Genetics, Edith Cowan University, 100 Joondalup Drive, Perth, WA 6027, Australia ... vidual mutation profiles, but to date the clinical con- .... rity of clinical studies only the effects of consanguinity ..... invest in the training of specialist medical, scientific, ... tions in a prospective study at a teaching hospital.

  12. The prevalence of isolated growth hormone deficiency among children of short stature in Jordan and its relationship with consanguinity.

    Science.gov (United States)

    Zayed, Ayman A; Mustafa Ali, Moaath K; Al-Ani, Mohammad A; Momani, Munther S; Yousef, Al-Motassem F

    2014-12-01

    The prevalence of isolated growth hormone deficiency (IGHD) among short-statured children in Jordan, where consanguineous marriage (CM) is common, is unknown. No studies have investigated the relationship between degrees of consanguinity and IGHD. This study aimed to determine the prevalence of IGHD among short-statured children referred to a university hospital in Jordan and its relationship with different degrees of consanguinity. We conducted a 24-month cross-sectional observational trial at an outpatient tertiary care center in Amman, Jordan. We obtained detailed family histories, medical evaluations and laboratory tests for 94 short-statured children (50 boys and 44 girls aged 6-16 years). Complete and partial GHD were defined as peak GH responses of 5 and 7 μg/l (15 and 21 mIU/l) [IRMA/DiaSorin®], respectively, in both exercise and insulin tolerance tests. GHD was diagnosed in 69·1% of the short children, including 86% (43/50) of the children of consanguineous parents (83·3%, 93·8% and 81·8% of children of first cousins, first cousins once removed and second cousins, respectively) and 50% (20/44) of the children of nonconsanguineous parents (P = 0·039, 0·002 and 0·013, respectively). However, there was no statistically significant difference in the prevalence of small pituitary MRI between GH-deficient children of consanguineous parents and those of nonconsanguineous parents (28·6% vs 13·6%, P = 0·3). The prevalence of IGHD among referred short children in Jordan was exceptionally high and significantly higher in the children of CM. In countries where CM is common, preconception counselling and rigorous surveillance for GHD in short children may be indicated. © 2014 John Wiley & Sons Ltd.

  13. Prevalence and Pattern of Consanguineous Marriages Among Different Communities in Mangalore

    Directory of Open Access Journals (Sweden)

    Bhagya Bhaskar

    2013-01-01

    Full Text Available Introduction: Consanguineous marriages are a common practice in the Middle East, Asian and African populations. Many studies have stated an association between first cousin marriages and the incidence of autosomal recessive diseases and congenital malformations. High frequency of consanguinity is reported by researchers among South India. The objectives of this study were to determine the prevalence and type of consanguineous marriages among the different communities of Mangalore. Methods: This study was conducted on 1164 married women in Mangalore to investigate the prevalence and type of consanguineous marriages. All the women were interviewed personally using a structured questionnaire. Family pedigree was constructed to study the type of consanguineous marriages. Data analysis was done by SPSS Win 13.0. Results: A low percentage of consanguinity (6.53% was observed with a mean inbreeding coefficient of 0.0339. Frequency of consanguinity between religions was highly significant. Of these the most frequent were first cousin marriages (43.42%. Within Hindu religion the highest rate of consanguinity was among the Billavas (47.62% of which the most frequent were distant relative marriages (75% followed by second cousin marriages (57.14%. There was no significant difference in the frequency distribution of the types of consanguinity between the religions and also between the different groups among Hindus. Conclusion: The frequency of consanguinity was found to be low in Mangalore. The findings contradict with the earlier reports of high prevalence of consanguineous marriages in South India. Increased female education, increased socio-economic status and decrease in parental decisions in marriages may be the reasons.

  14. Consanguinity and isolated atrial septal defect in North East of Iran.

    Science.gov (United States)

    Moghaddam, Hasan Mottaghi; Esfehani, Reza Jafarzadeh; Panah, Nader Yazdan; Esfehani, Ali Jafarzadeh

    2014-01-01

    The rate of consanguineous marriage is high in Middle Eastern countries such as Iran. The relationship between consanguineous marriage and congenital heart disease is discussed in some studies, but there is not much data for relationship between atrial septal defect (ASD) and consanguineous marriage. The aim of this study was to evaluate the relationship between consanguineous marriage and ASD echocardiographic characteristics. This was a cross-sectional study approved by Mashhad University of Medical Sciences ethics committee and took place in Mashhad, Iran, for a period of 3 years from August 2008 till September 2011. In this cross-sectional study, 113 ASD patients participated and they were categorized into 3 groups on the basis of family relationship between their parents: first group-"no relationship," second group- "third degree relationship," and third group- "far relationship." Among the 54 male and 59 female ASD patients, the most prevalent type of ASD was ASD secundum (85.0%) followed by sinus venosus (8.8%). A total of 56% patients were present in the first group and 15% and 29% in the second group and the third group, respectively." The relationship between consanguinity and type of ASD (P relationship between the age of onset of disease and consanguinity (P=.003) was also observed. Considering the fact that there is a high prevalence of ASD and consanguineous marriage in Iran and bearing in mind the results of the present study, we recommend educating couples about the outcomes of consanguineous marriage in pre-marriage counseling.

  15. Prevalence of consanguineous marriage among parents of deaf and normal children in Ardabil, North Western Iran

    OpenAIRE

    Shahrooz Nemati; Gholam Ali Afrooz; Ali Asgari; Bagher Ghobari Bonab

    2012-01-01

    Background and Aim: Having healthy non-handicapped children plays a major role in mental health of the family and decreases family and society's costs. While consanguineous marriage could lead to expression of recessive genes and a variety of handicaps including deafness, the aim of present study was to scrutinize the prevalence of consanguineous marriage among parents of deaf and normal children as well as its relationship with deafness.Methods: In this study, 467 couples parenting normal ch...

  16. Consanguinity in Lebanon: prevalence, distribution and determinants.

    Science.gov (United States)

    Barbour, Bernadette; Salameh, Pascale

    2009-07-01

    The union of individuals with a common ancestor may lead to serious health consequences in their offspring. Consanguinity is high in Middle Eastern communities; it was around 26% in 1988. The objective of this study was to determine the prevalence of consanguinity in Beirut and other Lebanese regions, and its associated factors in different subgroups. The cross-sectional study was performed on a convenience sample of married women in Lebanon. The women were administered a standardized questionnaire in a face-to-face interview by independent enquirers. Among 1556 women, the overall prevalence of consanguineous marriages was 35.5%, and the consanguinity coefficient was 0.020; 968 marriages (62.2%) were not consanguineous, 492 (31.6%) were first cousin, 61 (3.9%) were second cousin and 36 (2.3%) had lower degrees of consanguinity. Beirut suburb dwelling, low education subgroups, women working in the home and non-Christian religion presented the highest rates of consanguinity (pwomen thinking that consanguinity would not lead to serious diseases. Consanguinity is therefore still a prevailing problem in Lebanon. Specific health education, and genetic counselling in particular, are suggested to explain the consequences of consanguinity to the general population and to help couples make informed choices.

  17. The changing pattern and determinants of declining consanguinity in Jordan during 1990-2012.

    Science.gov (United States)

    Islam, M Mazharul

    2018-03-01

    Consanguinity is a deep rooted cultural trait in Jordan. To examine the patterns and determinants of declining rates of consanguineous marriage in Jordan during 1990-2012 in the context of the changing pattern of socio-economic and demographic conditions. The data come from the 1990 and 2012 Jordan Population and Family Health Surveys (JPFHSs). A total of 6461 women in 1990 and 11,352 women in 2012 were successfully interviewed. Descriptive and multivariate statistical techniques were used for data analysis. Consanguinity was found to be widely practiced (35% in 2012) until recent times in Jordan. However, there has been a secular declining trend over the last few decades as the practice of consanguinity has declined from 56% in 1990 to 35% in 2012. Increasing age at marriage and female education, higher level of education of husbands, declining family size, increasing rate of urbanisation and female employment, exposure to mass media and higher economic status appeared as significant predictors of declining consanguinity in Jordan. The findings of this study support Goode's hypothesis of a decrease of consanguinity with modernisation. Although consanguinity is a deeply rooted cultural trend in Jordan, it is gradually losing ground due to modernisation and socio-demographic transition of the country.

  18. THE CAUSAL RELATIONSHIP BETWEEN CONSANGUINEOUS MARRIAGES AND INFANT MORTALITY IN TURKEY.

    Science.gov (United States)

    Koç, İsmet; Eryurt, Mehmet Alİ

    2017-07-01

    Turkey has high levels of infant mortality and consanguineous marriages. It has had a high level of infant mortality for its economic level for many years. Over recent decades, although adult mortality rates have not been very different from those of other countries with similar socioeconomic structures, its life expectancy at birth has remained low due to its high infant mortality rate. This has been called the Turkish Puzzle. According to the Turkey Family Structure and Population Issues Survey, 27% of women had a consanguineous marriage in 1968. Subsequent Turkish Demographic and Health Surveys (TDHSs) found the rate of consanguineous marriages to be stagnated at 22-24%, with a resistance to reduction. According to the TDHS-2008, 24% of women had a consanguineous marriage. Numerous studies in various countries of the world have indicated that consanguineous marriages, particularly of first-degree, have the effect of increasing infant mortality. The main aim of this study was to assess the causal impact of consanguineous, particularly first-degree consanguineous, marriages on infant mortality, controlling for individual, cultural, bio-demographic and environmental factors. Data were merged from four Turkish DHS data sets (1993, 1998, 2003 and 2008). Multivariate analysis revealed that first-degree consanguineous marriages have increased infant mortality by 45% in Turkey: 57% in urban areas and 39% in rural areas. The results indicate that there is a causal relationship between consanguineous marriages and infant mortality. This finding should be taken into account when planning policies to reduce infant mortality in Turkey, and in other countries with high rates of consanguineous marriage and infant mortality.

  19. Prevalence of consanguineous marriages among Iranian Georgians.

    Science.gov (United States)

    Rafiee, Laleh; Saadat, Mostafa

    2011-01-01

    Consanguineous marriage--marriage between relatives--has received a great deal of attention as a potential risk factor for many adverse health outcomes. The present cross-sectional study was done in order to illustrate the prevalence and types of consanguineous marriages among Iranian Georgians living in Frydoonshahr (Isfahan province, central Iran). Data on consanguineous marriages were collected using a simple questionnaire. The total number of couples in this study was 646. Consanguineous marriage was classified by the degree of relationship between couples. First cousin marriages (14.2%) were the most common type of consanguineous marriages, followed by second cousin (7.0%), beyond second cousin (1.5%) and first cousin once removed (0.6%). The mean inbreeding coefficient (α) was calculated as 0.0104 for the population. The present study shows that the study population, as other Iranian populations, has a high level of consanguinity.

  20. Consanguinity and reproductive health among Arabs

    Directory of Open Access Journals (Sweden)

    Al Ali Mahmoud T

    2009-10-01

    Full Text Available Abstract Consanguineous marriages have been practiced since the early existence of modern humans. Until now consanguinity is widely practiced in several global communities with variable rates depending on religion, culture, and geography. Arab populations have a long tradition of consanguinity due to socio-cultural factors. Many Arab countries display some of the highest rates of consanguineous marriages in the world, and specifically first cousin marriages which may reach 25-30% of all marriages. In some countries like Qatar, Yemen, and UAE, consanguinity rates are increasing in the current generation. Research among Arabs and worldwide has indicated that consanguinity could have an effect on some reproductive health parameters such as postnatal mortality and rates of congenital malformations. The association of consanguinity with other reproductive health parameters, such as fertility and fetal wastage, is controversial. The main impact of consanguinity, however, is an increase in the rate of homozygotes for autosomal recessive genetic disorders. Worldwide, known dominant disorders are more numerous than known recessive disorders. However, data on genetic disorders in Arab populations as extracted from the Catalogue of Transmission Genetics in Arabs (CTGA database indicate a relative abundance of recessive disorders in the region that is clearly associated with the practice of consanguinity.

  1. Thalassemia major and consanguinity in Shiraz city, Iran.

    Science.gov (United States)

    Asadi-Pooya, Ali Akbar; Doroudchi, Mehrnoosh

    2004-09-05

    Beta-thalassemia is among the most common genetic disorders in the world and in Iran, with widespread occurrence. A cross-sectional study on 648 beta-thalassemia patients in Shiraz, Iran was carried out to determine the demography of beta-thalassemia major in Shiraz city, Fars province, Iran and also the rate of consanguinity and the significance of pre-marriage counseling in decreasing familial marriages and consequently preventing this autosomal recessive genetic disease. All interviewed patients had thalassemia major and their age, sex, and the consanguinity between parents were recorded. 40.6% of beta-thalassemia patients were outcomes of first-cousin marriages. Comparison of the percentages of familial marriages (consanguinity) between parents of beta-thalassemia patients and a sample of normal population, revealed a statistically significant difference (pmarriages among thalassemic families, however, more education and awareness of young women and men about the increased risk of beta-thalassemia after familial marriage through pre-marriage counseling is still necessary.

  2. Modernization and Consanguineous Marriage in Iran.

    Science.gov (United States)

    Givens, Benjamin P.; Hirschman, Charles

    1994-01-01

    Used data on 4,667 women from the Iran Fertility Survey to examine trends and social correlates of consanguineous marriage. Found modest increase in proportion of marriages between cousins in Iran from 1940s to 1970s. Results suggest that modernization may be eroding social bases on consanguinity, whereas increased availability of cousins may lead…

  3. The frequency of consanguineous marriage in eastern Turkey.

    Science.gov (United States)

    Akbayram, S; Sari, N; Akgün, C; Doğan, M; Tuncer, O; Caksen, H; Oner, A F

    2009-01-01

    The frequency of consanguineous marriage in Eastern Turkey: The rate of consanguineous marriage (CM) varies depended on different factors such as race, characteristics of population, and religion and moral features in different countries. Gene frequency and genetic structure are changed by CMs. The aim of the present study is to assess the prevalence of CM and its effects on miscarriage, stillbirth, congenital malformation and ratio of newborn death. This study was performed in Van region, Eastern Turkey, between September 2005 and April 2006. A total of 650 families from 24 districts chosen in accordance with the number of inhabitants were included in this study. First cousin marriages were accepted as a first degree CMs, sesquialter and second cousin marriages as second degree and marriages between distant relatives were accepted as a third degree CM. Monthly income of the families was classified in accordance with minimum wage determined by government. Of all families, 224 (34.4%) had CM, and 168 (75%) had first-degree consanguinity. A lower CM rate was found in mothers who graduated from secondary school or upgrading (p relationship was found between CM and fathers' education level. While a low CM rate was found in families who had two or less children (p < 0.01), high rate was observed in families who had five or more children. In addition, a high rate of miscarriage, stillbirth and mental-motor retardation was found in families with CM (p < 0.05). The rate of child mortality between the aged 0-2 years was found to be higher in families with CM (p < 0.01). The higher CM rate was observed in families who married due to pressure or insistence of their families than married voluntarily (p < 0.05). Our study showed that CM rate was very high, 34.4%, in our region Eastern Turkey.

  4. Consanguineous marriage and reproduction in Beirut, Lebanon.

    Science.gov (United States)

    Khlat, M

    1988-08-01

    Effects of consanguineous marriages on couples' fertility and on offspring mortality were investigated in Beirut through a population-based health survey of 2,752 households. A multistage random sampling procedure was used, and information was obtained from all ever-married women in the household about their reproductive performance and genealogical relationship with spouse; demographic and socioeconomic information was also recorded. Twenty-five percent of all marriages were between relatives, and the spouses were first cousins in approximately 57% of all consanguineous marriages. Total pregnancies, live births, and living children were significantly higher among consanguineous couples than among nonconsanguineous ones, as was the proportion dead among children ever born. However, no difference remained in either fertility or mortality, when allowance was made for socioeconomic status, religious affiliation, and marriage duration. The issue of confounding is discussed, and the lack of significant pattern in the final analysis is interpreted as resulting from a long-term practice of consanguineous marriages.

  5. Non–family Managers in Family Small and medium firms

    Directory of Open Access Journals (Sweden)

    Lucila Mariel Garavaglia

    2017-11-01

    According to the main results, there is a wide variety of causes for hiring non-family managers, and they are asked to do several tasks of different kinds. In addition, it has been found that the recruitment and selection processes are quite informal, with an active participation of the familymember entrepreneur. Finally, the results show a strict employment relationship between the parties.

  6. Consanguineous marriage in PR China: a study in rural Man (Manchu) communities.

    Science.gov (United States)

    Wang, W; Qian, Cong; Bittles, A H

    2002-01-01

    Although there is a long history of consanguineous marriage in China, information on its prevalence is very limited. The Man (Qing) dynasty ruled China for over 250 years, but no consanguinity studies have been reported on this important population. The objective of the present investigation was to determine the present-day level of consanguineous marriage in the Man community, and to compare the data with existing consanguinity information on other Chinese populations. The study was conducted in a group of 11 rural Man communities in the north-eastern Chinese province of Liaoning. Household-based interviews were conducted by local staff on 513 couples, 418 of whom were Man with another 95 Man-Han inter-ethnic marriages. Basic pedigrees were constructed to determine the biological relationship between each set of spouses. Thirty of the 418 couples were in a consanguineous union, with a mean coefficient of inbreeding alpha = 0.0012. The small population sizes of the study may have contributed to the spatial variation in the patterns of inbreeding. Across generations there was a reduction in consanguineous marriages and an increase in inter-ethnic unions, which paralleled changes in civil marriage regulations.

  7. Consanguinity Among Parents of Iranian Deaf Children.

    Science.gov (United States)

    Ajallouyan, Mohammad; Radfar, Shokofeh; Nouhi, Sima; Tavallaie, Seid Abbas; Amirsalari, Susan; Yousefi, Jaleh; Hasanali Fard, Mahdieh

    2016-11-01

    It seems that there is a relationship between consanguinity and profound hearing loss but there is little data about the association of consanguinity and hearing loss in Iran. The aim of this study is to demonstrate the causes of profound bilateral sensorineural hearing loss among Iranian samples who are candidates for cochlear implantation. This study was retrospective, analytical, and designed to collect information about profound hearing impaired cases referred to the Baqiyatallah Cochlear implantation center using enumeration. A total of 310 children with profound hearing impairments participated in this study. They were aged from 6 months to 4 years old. The study was done between January 2007 and April 2009. Chi-square tests were used to show whether there was any statistical difference between the incidence of marital consanguinity of their parents and the normal population. Sixty-five percent of those 310 children had parents who had married with their relatives. Of the 203 (65%) parents that had consanguineous marriages, 132 were first cousins, which includes the children of two brothers (37 [11.8%] patrilateral parallel cousins), the children of two sisters (38 [12.2%] multi-lateral parallel cousins), or the children of a brother and a sister (57 [18.3%] cross cousins). Fifty-four (17.4%) of the parents were second cousins and 17 (5.2%) were beyond second cousins. Also, hearing loss etiology was obvious in 237 (76.3%) of the patients with profound hearing loss but was unknown in 73 (23.7%). Hereditary was identified as the most common cause in 33% of the cases. Our data demonstrated a 65% occurrence of consanguineous marriage among the parents of deaf children, which is statistically different from the percentage of consanguineous marriage among Iranian population (38%). This indicates an obvious relationship between severe hearing loss and consanguineous marriage.

  8. Prevalence of consanguineous marriages in Syria.

    Science.gov (United States)

    Othman, Hasan; Saadat, Mostafa

    2009-09-01

    Consanguineous marriage is the union of individuals having at least one common ancestor. The present cross-sectional study was done in order to illustrate the prevalence and types of consanguineous marriages in the Syrian Arab Republic. Data on consanguineous marriages were collected using a simple questionnaire. The total number of couples in this study was 67,958 (urban areas: 36,574 couples; rural areas: 31,384 couples) from the following provinces: Damascus, Hamah, Tartous, Latakia, Al Raqa, Homs, Edlep and Aleppo. In each province urban and rural areas were surveyed. Consanguineous marriage was classified by the degree of relationship between couples: double first cousins (F=1/8), first cousins (F=1/16), second cousins (F=1/64) and beyond second cousins (Fconsanguinity was 30.3% in urban and 39.8% in rural areas. Total rate of consanguinity was found to be 35.4%. The equivalent mean inbreeding coefficient (alpha) was 0.0203 and 0.0265 in urban and rural areas, respectively. The mean proportion of consanguineous marriages ranged from 67.5% in Al Raqa province to 22.1% in Latakia province. The alpha-value ranged from 0.0358 to 0.0127 in these two provinces, respectively. The western and north-western provinces (including Tartous, Lattakia and Edlep) recorded lower levels of inbreeding than the central, northern and southern provinces. The overall alpha-value was estimated to be about 0.0236 for the studied populations. First cousin marriages (with 20.9%) were the most common type of consanguineous marriages, followed by double first cousin (with 7.8%) and second cousin marriages (with 3.3%), and beyond second cousin was the least common type.

  9. Space weathering of small Koronis family members

    Science.gov (United States)

    Thomas, Cristina A.; Rivkin, Andrew S.; Trilling, David E.; Enga, Marie-therese; Grier, Jennifer A.

    2011-03-01

    The space weathering process and its implications for the relationships between S- and Q-type asteroids and ordinary chondrite meteorites is an often debated topic in asteroid science. Q-type asteroids have been shown to display the best spectral match to ordinary chondrites (McFadden, L.A., Gaffey, M.J., McCord, T.B. [1985]. Science 229, 160-163). While the Q-types and ordinary chondrites share some spectral features with S-type asteroids, the S-types have significantly redder spectral slopes than the Q-types in visible and near-infrared wavelengths. This reddening of spectral slope is attributed to the effects of space weathering on the observed surface composition. The analysis by Binzel et al. (Binzel, R.P., Rivkin, A.S., Stuart, J.S., Harris, A.W., Bus, S.J., Burbine, T.H. [2004]. Icarus 170, 259-294) provided a missing link between the Q- and S-type bodies in near-Earth space by showing a reddening of spectral slope in objects from 0.1 to 5 km that corresponded to a transition from Q-type to S-type asteroid spectra, implying that size, and therefore surface age, is related to the relationship between S- and Q-types. The existence of Q-type asteroids in the main-belt was not confirmed until Mothé-Diniz and Nesvorny (Mothé-Diniz, T., Nesvorny, D. [2008]. Astron. Astrophys. 486, L9-L12) found them in young S-type clusters. The young age of these families suggest that the unweathered surface could date to the formation of the family. This leads to the question of whether older S-type main-belt families can contain Q-type objects and display evidence of a transition from Q- to S-type. To answer this question we have carried out a photometric survey of the Koronis family using the Kitt Peak 2.1 m telescope. This provides a unique opportunity to compare the effects of the space weathering process on potentially ordinary chondrite-like bodies within a population of identical initial conditions. We find a trend in spectral slope for objects 1-5 km that shows the

  10. [Maxillodental anomalies and consanguineous marriages].

    Science.gov (United States)

    Garaev, Z I

    1999-01-01

    Families of 549 probands and families of 123 probands with cleft lip and/or palate were examined in order to evaluate the relationship between marriages between close relatives and the incidence and structure of maxillodental diseases. Clinical and genealogical analysis of families of probands with maxillodental abnormalities and cleft lip and/or palate showed a significantly higher incidence of marriages between close relatives and an inbreeding coefficient in these families. Analysis of the population and familial incidence of maxillodental abnormalities and the inbreeding coefficient will help the physicians consulting such families more accurately evaluate the risk and improve the efficacy of prevention of such conditions.

  11. Consanguineous Marriage Among the Parents of Hearing Impaired Students in Baghcheban Primary Schools

    Directory of Open Access Journals (Sweden)

    Mansoureh Nikbakht

    2005-06-01

    Full Text Available Objective: Genetic studies show that consanguineous marriage can increase the probability of incidence of genetic impairments such as hearing impairments. The target of this study is to identify the prevalence of consanguinity among the parents of hearing impaired students in primary schools. Materials and Methods: We selected all of deaf students of Tehran (614 students. Their mothers answered to questionnaires. The questions were about Risk Factors of deafness in mother pregnancy or in neonatal period. Results: from 614 students, 389 parents of them (64% had consanguineous marriage and 223 person (36% didn’t have this factor. 2 person did not answer to this question. In this study we observed that there is 32.3% family history of hearing loss, 29.2%deaf sister and brother, 17% ear infection history. Other risk factors were studied too. Also there is significant correlation between consanguinity and more than one deaf children in the family (p<0.005. Conclusion: According to high incidence of consanguinity (64%that was observed in this study it may be one of most important causes of sensory neural hearing loss in children, so we should give enough information about this problem to the people.

  12. Consanguinity, endogamy and inborn errors of metabolism in Oman: a cross-sectional study.

    Science.gov (United States)

    Al-Thihli, Khalid; Al-Murshedi, Fathiya; Al-Hashmi, Nadia; Al-Mamari, Watfa; Islam, M Mazharul; Al-Yahyaee, Said A

    2014-01-01

    The Sultanate of Oman, like many other Arab countries, has relatively high rates of consanguinity. Reports suggest that the incidence of inborn errors of metabolism (IEM) is also high in Oman. This retrospective cross-sectional study was designed to evaluate the number of patients with IEM being followed at the only two tertiary centers in Oman treating such patients, and to calculate the consanguinity rates among these families. The electronic medical records of all patients were reviewed for demographic and clinical characteristics. A total of 285 patients with IEM were being followed at the 2 centers involved; 162 (56.8%) were male and 123 (43.2%) were female. The history of consanguinity was documented or available for 241 patients: 229 patients (95%) were born to consanguineous parents related as second cousins or closer. First-cousin marriages were reported in 191 families (79.3%), while 31 patients (12.9%) were born to second cousins. The parents of 5 patients (2%) were related as double first cousins, and 2 patients (1%) were born to first cousins once removed. The average coefficient of inbreeding (F) in our study was 0.081. Seventeen patients (6%) had associated comorbid conditions other than IEM. Our study highlights the clinical burden of IEM in Oman and emphasizes the high consanguinity rates among the parents of affected patients. © 2014 S. Karger AG, Basel

  13. Spectra of small Koronis family members

    Science.gov (United States)

    Thomas, C.; Rivkin, A.; Trilling, D.; Moskovitz, N.

    2014-07-01

    The space-weathering process and its implications for the relationships between S- and Q-type asteroids and ordinary chondrite meteorites are long-standing problems in asteroid science. Although the visible and near-infrared spectra of S- and Q-type objects qualitatively show the same absorption features and quantitatively show evidence of the same minerals, the S types display increased spectral slopes and muted absorption features compared to the Q types. This spectral mismatch is consistent with the effects of the space weathering process. Binzel et al. provided the missing link between Q- and S-type bodies in near-Earth space by showing a reddening of spectral slope in objects from 0.1 to 5 km that corresponded to the transition from Q- to S-type spectra. This result implied that size, and therefore age, is related to the relationship between Q- and S-type. The existence of Q-type objects in the main belt was not confirmed until Mothe-Diniz and Nesvorny (2008) found them in young S-type clusters. To investigate the trend from Q to S in the main belt, we examined space weathering within the old main-belt Koronis family using a spectrophotometric survey (Rivkin et al. 2011, Thomas et al. 2011). Rivkin et al. (2011) identified several potential Q-type objects within the Koronis family. Our Q-type candidates were identified using broad-band spectrophotometry and could not be taxonomically classified on that basis alone. We obtained follow-up visible and near-infrared spectral observations of our potential Q-type objects, (26970) Elias, (45610) 2000 DJ_{48}, and (37411) 2001 XF_{152}, using Gemini and Magellan. We will present the results of these spectral follow-up observations. Observations of (26970) Elias demonstrate that the object is more consistent with the average Q-type spectrum than the average S-type spectrum.

  14. Consanguineous marriage in Oman: understanding the community awareness about congenital effects of and attitude towards consanguineous marriage.

    Science.gov (United States)

    Mazharul Islam, M

    2017-05-01

    Although consanguinity is widely practiced in Oman, the attitude of community towards consanguinity and the awareness of its health consequences to offspring remain largely unexplored. To analyse the levels and trends of consanguineous marriage and examine community awareness about congenital anomaly associated with consanguinity and attitude towards consanguinity in Oman. The data come from a nationally representative survey on Omani adults of age 18 years and above, irrespective of their marital status. Data were analysed using both descriptive and multivariate statistical techniques. The survey results indicate a very high rate (49%) of consanguineous marriage in Oman. There is a declining trend in consanguinity which may be attributed to decline in first cousin marriage. Omani adults have moderately high knowledge (69%) about health consequences of consanguineous marriage. There is a high positive attitude towards consanguineous marriage (75%) which appeared as a significant predictor of current practice of consanguineous marriage in Oman. The positive attitude of the Omani community towards consanguinity outweighs the negative health consequences of consanguinity, and the practice is likely to remain high in the near future. Strong educational and motivational programmes are needed to bring further changes in attitude towards consanguinity and, thus, reduce the burden of congenital anomalies associated with consanguinity in Oman.

  15. Consanguinity and spousal concordance in Kuwait.

    Science.gov (United States)

    al-Kandari, Y; Crews, D E; Poirier, F E

    2002-12-01

    Consanguineous marriage is favored in Kuwait. This research focuses on the relationship of physical and cultural traits to marriage types in Kuwait and examines concordance as a function of consanguinity and marriage duration. In a nonrandom opportunistic sample of 242 couples anthropometric and blood pressure data have been collected as well as data on acculturation, religiosity, Farsi proficiency, level of education, occupation, and attitudes regarding fertility. Significant concordances occur in cultural characteristics among couples in all three types of marriages with respect to the degree of religiosity, acculturation, language similarity, education, and occupation. Non-consanguineous spouses have the highest concordance in educational level, occupation, and degree of acculturation, but the lowest for religiosity and Farsi proficiency. Nonkin marriages seem to be based on personal preferences. In the wider potential nonkin marriage pool spouses show more concordance in stature and education indicating the positive assortative mating for those traits. Non-consanguineous spouses show a significant association for triceps and subscapular skinfold thicknesses hip and waist circumferences, and body fat distribution. Unrelated spouses exhibit more concordance for physical traits than do related spouses. There is a significant correlation between spouses in first and double cousin marriages as well as in spouses in second and less than second cousin unions for systolic and diastolic blood pressure, while non-consanguineous spouses show a significant association in diastolic blood pressure only.

  16. Small bowel endoscopy in familial adenomatous polyposis and Lynch syndrome

    NARCIS (Netherlands)

    Koornstra, Jan Jacob

    Patients with familial adenomatous polyposis (FAP) and patients with Lynch syndrome have an increased risk of developing small intestinal neoplasia. In both conditions, the lifetime risk to develop small bowel cancer is estimated to be around 5%. In FAP, this risk is associated with the degree of

  17. Social structure and consanguinity in a French mountain Population (1550-1849).

    Science.gov (United States)

    Rabino-Massa, Emma; Prost, Michel; Boëtsch, Gilles

    2005-04-01

    Sociocultural factors play a crucial role in the variation of consanguinity in a population. The choice of specific matrimonial strategies can favor the closure or opening of the group to the outside, whereas differential fertility affects the gene flow from one generation to another. In the present study we analyzed the role of socioprofessional groups in the maintenance of endogamy and consanguinity in a French Alpine valley: Vallouise in the Briançon area. In mountain environments, where the reproductive space is limited and quickly saturated, the autochthonous families adopt diversified matrimonial strategies. These marriage practices tend to prevent fragmentation of agricultural property. We analyzed the matrimonial behavior in the two main social groups of this population (décideurs and farmers) from 1550 to 1849. To better understand the behavior of the two social groups, we considered the two components of consanguinity, close and distant. Our study showed that the two groups had similar behavior regarding consanguinity. The way to prevent fragmentation of the patrimony was to choose a consanguineous spouse. This type of strategy inevitably leads to a high percentage of endogamy, which in this region of the Alps exceeded 90% through many centuries.

  18. Consanguinity pattern and heritability of Vitiligo in Arar, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Dhaifallah A Alenizi

    2014-01-01

    Full Text Available Context: Epidemiological studies have shown that vitiligo is a complex trait, involving combinations of pathogenic effects of multiple susceptibility genes as well as environmental risk factors. Aim: To observe whether consanguinity increased the incidence of vitiligo in Saudi patients from Arar. Patients and Methods: This study included 69 Saudi patients with vitiligo and their families. These patients, selected from the experience specialist dermatology center in Arar, from April 2011 to 2012, were interviewed by a dermatologist to confirm the diagnosis and complete a questionnaire. Results: A total of 69 patients, 40 males and 29 females were selected. Their mean age was 34.5 ± 11.8 years with the median age of 23 years. The mean age at onset of disease was 27.9 ± 12.9 years. The mean duration of the disease was 9.7 ± 5.3 years. The frequency of focal, vulgaris, universal, and acrofacial subtypes was 22 (31.9%, 21 (30.4%, 8 (11.6%, and 18 (26.1%, respectively. A positive family history of vitiligo was obtained in 45 (65.2% cases. A comparison of the frequency of vitiligo among siblings in relation to the general population was more in accord with the multifactorial model. Conclusion: Consanguinity in marriage increases the incidence of the disease. Therefore, genetic counseling and premarital examination would be important contributions to lower the prevalence of vitiligo.

  19. Relationship between birth order of spouses with different degrees of consanguineous relationship.

    Science.gov (United States)

    Reddy, B M; Malhotra, K C

    1991-08-01

    The relationship between birth order of spouses with different degrees of consanguinity is examined in a sample of 1826 couples belonging to the endogamous Vadde Fisherfolk of Kolleru Lake, Andhra Pradesh, India. We attempt to explain the wide variation in the frequency of different kinds of consanguineous marriages through the age-sex structure of the population in general and especially of the related families. This structure may also be manifested in the association between the birth orders of spouses. A highly significant and large correlation between the birth orders of spouses in uncle-niece marriages and a gradual decrease in the correlation with increase in remoteness of the relationship between the spouses were observed. Given the distribution of age differences between the spouses and assuming a standard age-sex structure, it seems possible to estimate the optimum frequency with which at least close consanguineous marriages occur in any particular population.

  20. Consanguinity and Disorders of Sexual Developments in the Sudan ...

    African Journals Online (AJOL)

    Background: Consanguinity is very common in the Sudanese society. There is a lack of studies on consanguinity and its impact on genetic diseases in Sudan. In this study we correlated Disorders of Sexual developments (DSDs), as an example of genetic conditions, in relation with consanguinity. Material and Methods: A ...

  1. [Analysis of clinical phenotype and mode of inheritance in retinitis pigmentosa patients with consanguineous marriage].

    Science.gov (United States)

    Rong, Wei-ning; Sheng, Xun-lun; Liu, Ya-ni

    2012-10-01

    To analyse the mode of inheritance and clinical characteristics of retinitis pigmentosa (RP) patients with consanguineous marriage. RP patients were recruited for this study in Ningxia Eye Hospital from September 2009 to July 2011. All patients received complete ophthalmic examination. The mode of inheritance were determined based on family history and marriage history. Clinical features were characterized by complete ophthalmic examinations including visual acuity, macular OCT, visual field and electroretinogram (ERG). A total of 143 individuals with RP (33 families) were recruited. Based on analysis of family history and marriage history, 20 RP families (23 patients) had consanguineous marriage history accounted for 60.6% RP families (16.1% RP patients). There were 4 patients (from 4 families) diagnosed as Usher syndrome. In 20 RP families with consanguineous marriage history, 7 families (35.0%) were Hui ethnicity and 13 families (65%) were Han ethnicity. The marriages of 15 families were between first cousins and 3 families were between second cousins, only 2 families were between half cousins matrimony. Of 23 RP patients, 12 were males and 11 were females. The average age of onset was 11.4 ± 6.8 years and the average age of recruitment was (32.0 ± 13.5) years. The best-corrected visual acuity was less than 0.6 in 78.2% patients. According to the features of the fundus, 13 patients were classical retinitis pigmentosa and 10 patients were retinitis pigmentosa sine pigmento. Visual field examination showed that all patients had varying degrees of peripheral visual field defect. Retinal neuroepithelial layer of macular and peripheral retina became thinner and retinal photoreceptors were disappeared. The average thickness of macular fovea was (186.1 ± 78.7) µm on right eyes and (187.4 ± 76.3) µm on left eyes. The incidence of RP with consanguineous marriages was high in Ningxia Region. The mode of inheritance of RP patients with consanguinity is autosomal

  2. Association between consanguinity and survival of marriages ...

    African Journals Online (AJOL)

    Background and purpose: The present study was performed to investigate the association between consanguineous marriages and divorce risk. Materials and methods: A total of 496 couples at divorce time and 800 couples from general population who have no plan for divorce (as control group) were included in the study.

  3. Consanguinity and its relevance to clinical genetics

    African Journals Online (AJOL)

    Rabah M. Shawky

    2013-01-29

    Jan 29, 2013 ... Autosomal dominant e.g. Marfan's syndrome and achondroplasia. ... In X-linked diseases consanguineous marriage was de- tected in all cases of ..... government should put strict laws for premarital tests. Conflict of interest .... V. Genetic contribution to high neonatally lethal malformation rate in the United ...

  4. Cerebro-costo-mandibular syndrome with consanguinity

    International Nuclear Information System (INIS)

    Clarke, E.A.; Nguyen, V.D.

    1985-01-01

    The cerebro-costo-mandibular syndrome is a rare disorder characterized by unique posterior rib defectes, micrognathia, and mental deficiency. The mode of transmission is undetermined. This report describes the first case with documented parental consanguinity as well as hitherto undescribed CT and skeletal findings. (orig.)

  5. Training and HRD Strategies in Family and Non-Family Owned Small Businesses: A Comparative Approach.

    Science.gov (United States)

    Matlay, Harry

    2002-01-01

    A survey of 6,000 British small businesses, 600 interviews, and 120 case studies found that 70-80% were family owned; most favored informal management styles. In family-owned businesses, training of nonfamily employees was considered less crucial; investments in the latter were related to long-term business strategies and potential succession.…

  6. Small family, smart family? : family size and the IQ scores of young men

    OpenAIRE

    Black, Sandra E.; Devereux, Paul J.; Salvanes, Kjell Gunnar

    2007-01-01

    How do families influence the ability of children? Cognitive skills have been shown to be a strong predictor of educational attainment and future labor market success; as a result, understanding the determinants of cognitive skills can lead to a better understanding of children's long run outcomes. This paper uses a large dataset on the male population of Norway and focuses on one family characteristic: the effect of family size on IQ. Because of the endogeneity of family size, we instrument ...

  7. Consanguinity, prematurity, birth weight and pregnancy loss: a prospective cohort study at four primary health center areas of Karnataka, India.

    Science.gov (United States)

    Bellad, M B; Goudar, S S; Edlavitch, S A; Mahantshetti, N S; Naik, V; Hemingway-Foday, J J; Gupta, M; Nalina, H R; Derman, R; Moss, N; Kodkany, B S

    2012-06-01

    To determine whether consanguinity adversely influences pregnancy outcome in South India, where consanguinity is a common means of family property retention. Data were collected from a prospective cohort of 647 consenting women, consecutively registered for antenatal care between 14 and 18 weeks gestation, in Belgaum district, Karnataka in 2005. Three-generation pedigree charts were drawn for consanguineous participants. χ (2)-Test and Student's t-test were used to assess categorical and continuous data, respectively, using SPSS version 14. Multivariate logistic regression adjusted for confounding variables. Overall, 24.1% of 601 women with singleton births and outcome data were consanguineous. Demographic characteristics between study groups were similar. Non-consanguineous couples had fewer stillbirths (2.6 vs 6.9% P=0.017; adjusted P=0.050), miscarriages (1.8 vs 4.1%, P=0.097; adjusted P=0.052) and lower incidence of birth weight birth (P=0.013), whereas smoking (P=0.015) and poverty (P=0.003) were associated with higher rates of low birth weight. Consanguinity significantly increases pregnancy loss and birth weight <2500 g.

  8. Small Family, Smart Family? Family Size and the IQ Scores of Young Men

    Science.gov (United States)

    Black, Sandra E.; Devereux, Paul J.; Salvanes, Kjell G.

    2010-01-01

    This paper uses Norwegian data to estimate the effect of family size on IQ scores of men. Instrumental variables (IV) estimates using sex composition as an instrument show no significant negative effect of family size; however, IV estimates using twins imply that family size has a negative effect on IQ scores. Our results suggest that the effect…

  9. Consanguineous marriage and reproduction in Beirut, Lebanon.

    OpenAIRE

    Khlat, M

    1988-01-01

    Effects of consanguineous marriages on couples' fertility and on offspring mortality were investigated in Beirut through a population-based health survey of 2,752 households. A multistage random sampling procedure was used, and information was obtained from all ever-married women in the household about their reproductive performance and genealogical relationship with spouse; demographic and socioeconomic information was also recorded. Twenty-five percent of all marriages were between relative...

  10. Addressing key issues in the consanguinity-related risk of autosomal recessive disorders in consanguineous communities: lessons from a qualitative study of British Pakistanis.

    Science.gov (United States)

    Darr, A; Small, N; Ahmad, W I U; Atkin, K; Corry, P; Modell, B

    2016-01-01

    Currently, there is no consensus regarding services required to help families with consanguineous marriages manage their increased genetic reproductive risk. Genetic services for communities with a preference for consanguineous marriage in the UK remain patchy, often poor. Receiving two disparate explanations of the cause of recessive disorders (cousin marriage and recessive inheritance) leads to confusion among families. Further, the realisation that couples in non-consanguineous relationships have affected children leads to mistrust of professional advice. British Pakistani families at-risk for recessive disorders lack an understanding of recessive disorders and their inheritance. Such an understanding is empowering and can be shared within the extended family to enable informed choice. In a three-site qualitative study of British Pakistanis, we explored family and health professional perspectives on recessively inherited conditions. Our findings suggest, firstly, that family networks hold strong potential for cascading genetic information, making the adoption of a family-centred approach an efficient strategy for this community. However, this is dependent on provision of high-quality and timely information from health care providers. Secondly, families' experience was of ill-coordinated and time-starved services, with few having access to specialist provision from Regional Genetics Services; these perspectives were consistent with health professionals' views of services. Thirdly, we confirm previous findings that genetic information is difficult to communicate and comprehend, further complicated by the need to communicate the relationship between cousin marriage and recessive disorders. A communication tool we developed and piloted is described and offered as a useful resource for communicating complex genetic information.

  11. Consanguineous marriages in the genetic counseling centers of Isfahan and the ethical issues of clinical consultations.

    Science.gov (United States)

    Nouri, Narges; Nouri, Nayereh; Tirgar, Samane; Soleimani, Elham; Yazdani, Vida; Zahedi, Farzaneh; Larijani, Bagher

    2017-01-01

    Consanguineous marriage, which is common in many regions in the world, has absorbed much attention as a causative factor in raising the incidence of genetic diseases. The adverse effects may be attributed to the expression of the genes received from common ancestors and mortality and morbidity of the offspring. Iran has a high rate of consanguineous marriages. In recent years genetic counseling has come to be considered in health care services. This cross-sectional study was conducted in order to determine the prevalence and types of consanguineous marriages in the genetic clinics in Isfahan. We aimed to define the different types of marriages, specific categories of genetic disorders associated with consanguineous marriages, and mode of inheritance in the family tree. We also narratively reviewed the ethical aspects of the issue. The data were collected using a simple questionnaire. A total number of 1535 couples from urban and rural areas formed the study population. The marriages were classified according to the degree of the relationship between couples, including: double cousin, first cousin, first cousin once removed, second cousin and beyond second cousin. The SPSS software version 16 was used for data analysis. Data obtained through genetic counseling offered during a 5-year period revealed that 74.3% had consanguineous relationships, 62.3% were first cousins, 1% were double cousins and 7.8% were second cousins. In addition, 76% of the couples had at least one genetic disease in their family tree. Related ethical issues were also considered in this study, including autonomy and informed decision making, benefit and harm assessment, confidentiality, ethics in research, justice in access to counseling services, financial problems ethics, and the intellectual property of scientific success.

  12. Socioeconomic, demographic, and geographic variables affecting the diverse degrees of consanguineous marriages in Spain.

    Science.gov (United States)

    Fuster, V; Colantonio, S E

    2004-02-01

    In a population the inbreeding coefficient alpha is determined by the relative incidence of the various degrees of consanguineous marriages--uncle-niece or aunt-nephew (C12), first cousin (C22), first cousin once removed (C23), second cousin (C33)--which may be related to temporal, geographic, demographic, and economic factors. Using published information from Spain corresponding to urban and rural areas, in this article we seek to establish how each specific relationship behaves with respect to geographic, demographic, and socioeconomic factors, to determine differential urban-rural patterns, and to study whether the diverse types of consanguineous matings relate homogeneously to these factors. For this purpose we performed multiple regressions in which the dependent variables were the different degrees of consanguinity previously selected and the independent variables were geographic, demographic, and economic factors. Our results indicate that the various types of consanguineous marriages in Spain are more conditioned by geographic, demographic, and economic variables than by the inbreeding level alpha (the coefficient of determination was between 0.22 and 0.72; the maximum for alpha was 0.35). A regional pattern exists in Spain and corresponds to close and to remote kinship, which may be mainly related to economic and family factors. Close relationships appear to be more associated with economic variables, whereas second-cousin marriages correspond largely to rural areas of the Spanish Central Plateau.

  13. Prevalence of consanguineous marriages and associated factors among Israeli Bedouins

    OpenAIRE

    Na’amnih, Wasef; Romano-Zelekha, Orly; Kabaha, Ahmed; Rubin, Liza Pollack; Bilenko, Natalya; Jaber, Lutfi; Honovich, Mira; Shohat, Tamy

    2014-01-01

    The Bedouin population in Israel is a semi-nomadic traditional patriarchal society. Consanguineous marriages are very common, contributing to high rates of congenital malformations and genetic diseases, resulting in high infant mortality. Data on consanguineous marriages among Bedouins in Israel are limited. This study examined the current prevalence of consanguineous marriages and their determinants among Israeli Bedouins. One thousand two hundred ninety Bedouin women who delivered in the ma...

  14. Consanguinity studies and genome research in Mediterranean developing countries

    OpenAIRE

    Romeo, G.; Gialluisi, A.; Pippucci, T.

    2012-01-01

    Purpose: Classical studies of consanguinity have taken advantage of the relationship between the gene frequency for a rare autosomal recessive disorder (q) and the proportion of offspring of consanguineous couples who are affected with the same disorder. The Swedish geneticist Gunnar Dahlberg provided the first theoretical formulation of the inverse correlation between q and the increase in frequency of consanguineous marriages among parents of affected children with respect to marriages of t...

  15. Cervical vertebral fusion (Klippel-Feil) syndrome with consanguineous parents.

    Science.gov (United States)

    Juberg, R C; Gershanik, J J

    1976-06-01

    We describe a female infant with the cervical vertebral fusion (Klippel-Feil) syndrome whom we recognized at birth because of her short neck, restriction of cervical movement, and low posterior hairline. X-ray examination showed anomalies of C1, and between C2-3 and C3-4; thus, we classified her as type II, with variable cervical fusion. At 24 months she was small and manifested hearing deficiency. The mother and father were consanguineous with five common ancestors four generations ago, which resulted in a coefficient of inbreeding equivalent to a second cousin relationship. The parents and grandparents were phenotypically normal, and the parents were radiologically normal. This form of the syndrome has previously been said to be autosomal dominant. Our conclusion of determination by a single autosomal recessive gene is evidence of genetic heterogeneity.

  16. Prevalence of consanguineous marriages and associated factors among Israeli Bedouins.

    Science.gov (United States)

    Na'amnih, Wasef; Romano-Zelekha, Orly; Kabaha, Ahmed; Rubin, Liza Pollack; Bilenko, Natalya; Jaber, Lutfi; Honovich, Mira; Shohat, Tamy

    2014-10-01

    The Bedouin population in Israel is a semi-nomadic traditional patriarchal society. Consanguineous marriages are very common, contributing to high rates of congenital malformations and genetic diseases, resulting in high infant mortality. Data on consanguineous marriages among Bedouins in Israel are limited. This study examined the current prevalence of consanguineous marriages and their determinants among Israeli Bedouins. One thousand two hundred ninety Bedouin women who delivered in the maternity wards of the only hospital serving the Bedouin population were interviewed between November 2009 and January 2010. The prevalence of consanguineous marriages was 44.8 %. The most common type of spousal relationship was first cousins (65.7 % of all consanguineous marriages). The mean inbreeding coefficient was 0.0238. Factors significantly associated with consanguinity were less years of schooling (OR 0.94, 95 % CI (0.88-0.99), p = 0.02) and younger age at marriage of the wife (OR 0.90, 95 % CI (0.80-0.96), p = 0.0002). In conclusion, the rate of consanguineous marriages among Bedouins is very high, making this population at risk for congenital malformations and genetic diseases. Efforts should be directed at better education and provision of premarital and prenatal counseling on the health consequences of consanguineous marriages and the possibilities to lower those risks.

  17. The Implications of Parental Consanguinity on the Care of Neonates.

    Science.gov (United States)

    Ng, Diana

    2016-08-01

    Approximately 6% of births worldwide, 7.9 million children, are born with a serious genetic congenital abnormality each year. A factor thought to increase the prevalence of birth defects is parental consanguinity, which is a social custom practiced in at least 20% of the world's population. The purpose of this article is to explore the relationship between consanguinity and congenital defects. This article also aims to enhance neonatal healthcare practitioners' comprehension of its implications for practice and research. A review of literature was compiled from a search of the online databases Cumulative Index of Nursing and Allied Health (CINAHL), PubMed, EBSCO MegaFILE, and Google Scholar. Literature pertinent to this topic primarily consists of research studies that examine the inbreeding depression phenomenon through comparison of the prevalence of birth defects among the offspring of consanguineous and nonconsanguineous couples. Current studies indicate that the progeny of consanguineous couples are at an increased risk of congenital defects compared with those of nonconsanguineous couples. Consanguinity is one risk factor among many that can lead to a major birth defect. Relationships between consanguineous populations and neonatal healthcare practitioners such as registered nurses, advanced practice nurses, and physicians could significantly alter neonatal health outcomes. Specific recommendations such as genetic counseling and therapeutic communication are discussed. Further studies need to investigate the connection between consanguinity and birth defects while controlling for nongenetic variables. Moreover, a focus on consanguineous communities in the United States would prove beneficial.

  18. Crosstalk between Bcl-2 family and Ras family small GTPases: potential cell fate regulation?

    International Nuclear Information System (INIS)

    Kang, Jia; Pervaiz, Shazib

    2013-01-01

    Cell fate regulation is a function of diverse cell signaling pathways that promote cell survival and or inhibit cell death execution. In this regard, the role of the Bcl-2 family in maintaining a tight balance between cell death and cell proliferation has been extensively studied. The conventional dogma links cell fate regulation by the Bcl-2 family to its effect on mitochondrial permeabilization and apoptosis amplification. However, recent evidence provide a novel mechanism for death regulation by the Bcl-2 family via modulating cellular redox metabolism. For example overexpression of Bcl-2 has been shown to contribute to a pro-oxidant intracellular milieu and down-regulation of cellular superoxide levels enhanced death sensitivity of Bcl-2 overexpressing cells. Interestingly, gene knockdown of the small GTPase Rac1 or pharmacological inhibition of its activity also reverted death phenotype in Bcl-2 expressing cells. This appears to be a function of an interaction between Bcl-2 and Rac1. Similar functional associations have been described between the Bcl-2 family and other members of the Ras superfamily. These interactions at the mitochondria provide novel opportunities for strategic therapeutic targeting of drug-resistant cancers.

  19. Family Portrait of the Small Inner Satellites of Jupiter

    Science.gov (United States)

    1997-01-01

    These images, taken by Galileo's solid state imaging system between November 1996 and June 1997, provide the first ever 'family portrait' of the four small, irregularly shaped moons that orbit Jupiter in the zone between the planet's ring and the larger Galilean satellites. The moons are shown in their correct relative sizes, with north approximately up in all cases. From left to right, arranged in order of increasing distance from Jupiter, are Metis (longest dimension is approximately 60 kilometers or 37 miles across), Adrastea (20 kilometers or 12 miles across), Amalthea (247 kilometers or 154 miles across), and Thebe (116 kilometers or 72 miles across). While Amalthea, the largest of these four tiny moons, was imaged by NASA's two Voyager spacecraft in 1979 with a resolution comparable to what is shown here, the new Galileo observations represent the first time that Metis, Adrastea, and Thebe have been seen as more than points of light.The Jet Propulsion Laboratory, Pasadena, CA manages the Galileo mission for NASA's Office of Space Science, Washington, DC. JPL is an operating division of California Institute of Technology (Caltech).This image and other images and data received from Galileo are posted on the World Wide Web, on the Galileo mission home page at URL http://www.jpl.nasa.gov/ galileo.

  20. Síndrome de Usher de tipo II: caracterización oftalmológica, auditiva y genética de una familia consanguínea Type II Usher syndrome: ophthalmological, auditory, and genetic characterization of a consanguineous family

    Directory of Open Access Journals (Sweden)

    Rásife Freyre Luque

    2011-09-01

    Full Text Available Se caracterizó a una familia consanguínea de 25 miembros, 3 de los cuales padecían el síndrome de Usher de tipo II, a través del estudio auditivo, oftalmológico y genético en el Centro de Retinosis Pigmentaria de Santiago de Cuba. Los pacientes (2 varones y 1 fémina tenían en común: aparición de la enfermedad en la etapa juvenil, mala visión nocturna, campos visuales reducidos, hipoacusia neurosensorial y resultados normales en las pruebas vestibulares; asimismo, en genética molecular, la electroforesis en gel de poliacrilamida reveló la presencia del marcador D1S237, estrechamente ligado al gen USH2 en el cromosoma 1. Esa caracterización permitirá aplicar la terapia génica y los implantes, tanto de células madre como cocleares, según corresponda.A consanguineous family of 25 members, 3 of whom suffered from type II Usher syndrome was characterized through the auditory, ophthalmologic, and genetic study in the Retinitis Pigmentosa Center from Santiago de Cuba. The patients (2 males and a female had in common: occurrence of the illness during youth, bad night vision, reduced visual fields, neurosensorial hypoakusia, and normal results in the vestibular tests; also, in molecular genetics, electrophoresis in polyacrilamide gel revealed the presence of the D1S237 marker, closely linked to the gene USH2 in chromosome 1. That characterization will allow to apply the genic therapy and both implants, mother cells and cochlear, as it corresponds.

  1. Impact of consanguineous marriages and degrees of inbreeding on fertility, child mortality, secondary sex ratio, selection intensity, and genetic load: a cross-sectional study from Northern India.

    Science.gov (United States)

    Fareed, Mohd; Kaisar Ahmad, Mir; Azeem Anwar, Malik; Afzal, Mohammad

    2017-01-01

    The aim of our study was to understand the relationship between consanguineous marriages and reproductive outcomes. A total of 999 families were recruited from five Muslim populations of Jammu region. Family pedigrees were drawn to access the family history and inbreeding status in terms of coefficient of inbreeding (F). Fertility, mortality, secondary sex ratio, selection intensity, and lethal equivalents were measured using standard methods. The significant differences for gross fertility was found to be higher among inbred groups as compared to the unrelated families (P consanguineous families of all populations in comparison with the non-consanguineous family groups. Moreover, the prenatal and postnatal child mortality rates (i.e., U5MR and U18MR) have presented a persuasive increase with an upsurge in the homozygosity level. The mortality rate was found to be maximum among families with the highest value of coefficient of inbreeding (F). The selection intensity (SI) also showed inflations among families with respect to their increasing inbreeding coefficients. The greater values of lethal equivalents per gamete (LEs/gamete) were observed for autosomal inheritance in comparison with sex-linked inheritance. Our conclusive assessment brings out the deleterious consequence of consanguineous marriages on reproductive outcomes.

  2. Family Planning Behavior and Small Family Concept Acceptance in Two Different Geographical Characteristics Municipality of South Klaten, Klaten, Central Java

    Directory of Open Access Journals (Sweden)

    P Priyono

    2014-12-01

    Full Text Available The research aim to know the family planning behaviour, the acceptance small family norm and the influential factors in two villages that have different geographical aspect. The behaviour involve the knowledge, the attitude and the practice where as the influential factors involve education, accupation, values of children, income, children still born and family size desired. The research areas are chosen purposive in two villages that have different geographical aspect, social aspect and cultural aspect. The aspect are: 1 location and topography, 2 socialy  structure, and 3 the achievement of effective acceptor. Based on the three aspects, Ngalas village (developing and Sumberejo (developed are chosen as research areas. The recorded as ative acceptor (recordedin RI/PUS/1991 form. The respondents are chosen by cencus at two neighborhoord association at every village. There are six variables in this research are assumed influence the periode of the contraceptives use, such as education, occupation status, values of children, family income, children still born, and family size desired. There are three variables are assumed influence the small family norm, such as education, occupation status, and values of children. The data was analyzed by frequency table, crosee table, and statistical analysis (Q square and Regresion. The data was always compared between the two villages. The analysis use computer by Microsoft Program.  The research result showed that Sumberejo was better than Ngalas in the knowledge, the attitude, and the practice of family planning. Most of the people who live in Sumberejo understood the contraception device well (52,4%, where as in Ngalas (26,8%. Both of them agreed on using contraception device (more than 70%. The respondent who live in Sumberejo used IUD (40% and MOW/MOP (23,23%. They had used of the contraception device for 4.8 years on an average. Mean  while the respondents in Ngalas use IUD (23,68% and MOW/MOP (2

  3. Parental consanguinity and associated factors in congenital talipes equinovarus.

    Science.gov (United States)

    Sreenivas, T; Nataraj, A R

    2012-03-01

    The cause of congenital talipes equinovarus (CTEV) is multifactorial and, consanguinity could be one of the causative factors in its development. The purpose of this study was, to determine the prevalence of parental consanguinity in CTEV and other factors like associated, congenital anomalies, maternal and fetal factors and also the severity of CTEV in these patients. The above factors were studied in 54 patients of less than 1 month of age with parental, consanguinity and 91 feet were evaluated for its severity using Dimeglio classification at the time of presentation. Out of 174 children presented to our department with CTEV, 54 (31%) children were born out, of consanguineous marriage. Thirty seven (68.5%) patients had bilateral CTEV. Twenty five (46.3%), patients had associated congenital anomalies and myelomeningocele being the commonest anomaly, associated. Out of 91 feet 61 (67%) were of grade 4 severity. High grade of severity observed in both idiopathic and non idiopathic CTEV suggests the, probable role of consanguinity as an etiological factor in the development of CTEV especially in our, part of the world. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Assessing the Local Need for Family and Child Care Services: A Small Area Utilization Analysis.

    Science.gov (United States)

    Percy, Andrew; Carr-Hill, Roy; Dixon, Paul; Jamison, James Q.

    2000-01-01

    Describes study of administrative data from Northern Ireland on the costs of family and child care services, using small area utilization modeling, to derive a new set of needs indicators that could be used within the family and child care capitation funding formula. Argues that small area utilization modeling produces a fairer and more equitable…

  5. Molecular genetic analysis of consanguineous families with primary ...

    Indian Academy of Sciences (India)

    RESEARCH NOTE Volume 96 Issue 2 June 2017 pp 383-387 ... Autosomal recessive primary microcephaly is a rare genetic disorder that is ... Department of Cell and Developmental Biology, School of Life Sciences, University of Science and ...

  6. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  7. The influence of family-related factors on the succession process in small and medium-sized family businesses

    Directory of Open Access Journals (Sweden)

    E Venter

    2014-07-01

    Full Text Available In this study family-related factors that can influence the succession process in small and medium-sized family businesses are empirically investigated.  The dependent variable in this study is measured by two underlying dimensions, namely satisfaction with the process and continued profitability of the business.  The empirical results indicate that the family-related factors that influence both the aforementioned dimensions are the mutual acceptance of roles, the relationship between the owner-manager and successor, and family harmony.  The continued profitability of the business is also influenced by the agreement to continue the business. The existence of family harmony in itself influences the relationship between the owner-manager and successor, the agreement to continue the business, as well as the mutual acceptance of roles.  The managerial implications of these empirical findings are discussed and recommendations offered.

  8. Prevalence of consanguineous marriages in west and south of Afghanistan.

    Science.gov (United States)

    Saadat, Mostafa; Tajbakhsh, Khadijeh

    2013-11-01

    The prevalence of consanguinity in eight provinces of Afghanistan has recently been reported by Saify & Saadat (2012). The present cross-sectional study was done in order to illustrate the prevalence and types of consanguineous marriages among other populations of Afghanistan. Data on types of marriages were collected using a simple questionnaire. The total number of couples in this study was 5200 from the following provinces: Farah, Ghazni, Herat, Hilmand, Kabul, Kandahar, Logar, Parwan and Wardak. Consanguineous marriages were classified by the degree of relationship between couples: double first cousins, first cousins, first cousins once removed, second cousins and beyond second cousins. The coefficient of inbreeding (F) was calculated for each couple and the mean coefficient of inbreeding (α) estimated for each population. The α in the country was 0.0226, ranging from 0.0203 in Farah province to 0.0246 in Herat province. There were significant differences between provinces for frequencies of different types of marriages (pconsanguineous marriages, followed by second cousins (16.0%), first cousins once removed (14.0%), beyond second cousins (6.9%) and double first cousins (1.6%). There was significant difference between ethnic groups for the types of marriages (pconsanguinity among ethnic groups in Afghanistan, respectively. The present study shows that the Afghani populations, the same as other Islamic populations, have high levels of consanguinity.

  9. Is consanguinity prevalence decreasing in Saudis?: a study in two ...

    African Journals Online (AJOL)

    2014-06-02

    Jun 2, 2014 ... Consanguineous mating and inbreeding have been a subject of human biological inquiry since George. Darwin, himself the son of a marriage between Charles. Darwin and his cousin Emma Wedgewood [2], who. Corresponding author: Arjumand S. Warsy. Department of Biochemistry. College of Science.

  10. A novel family of small proteins that affect plant development

    Energy Technology Data Exchange (ETDEWEB)

    John Charles Walker

    2011-04-29

    The DVL genes represent a new group of plant proteins that influence plant growth and development. Overexpression of DVL1, and other members of the DVL family, causes striking phenotypic changes. The DVL proteins share sequence homology in their C-terminal half. Point mutations in the C-terminal domain show it is necessary and deletion studies demonstrate the C-terminal domain is sufficient to confer the overexpression phenotypes. The phenotypes observed, and the conservation of the protein sequence in the plant kingdom, does suggest the DVL proteins have a role in modulating plant growth and development. Our working hypothesis is the DVL proteins function as regulators of cellular signaling pathways that control growth and development.

  11. Mutation Analysis of Consanguineous Moroccan Patients with Parkinson’s Disease Combining Microarray and Gene Panel

    Directory of Open Access Journals (Sweden)

    Ahmed Bouhouche

    2017-10-01

    Full Text Available During the last two decades, 15 different genes have been reported to be responsible for the monogenic form of Parkinson’s disease (PD, representing a worldwide frequency of 5–10%. Among them, 10 genes have been associated with autosomal recessive PD, with PRKN and PINK1 being the most frequent. In a cohort of 145 unrelated Moroccan PD patients enrolled since 2013, 19 patients were born from a consanguineous marriage, of which 15 were isolated cases and 4 familial. One patient was homozygous for the common LRRK2 G2019S mutation and the 18 others who did not carry this mutation were screened for exon rearrangements in the PRKN gene using Affymetrix Cytoscan HD microarray. Two patients were determined homozygous for PRKN exon-deletions, while another patient presented with compound heterozygous inheritance (3/18, 17%. Two other patients showed a region of homozygosity covering the 1p36.12 locus and were sequenced for the candidate PINK1 gene, which revealed two homozygous point mutations: the known Q456X mutation in exon 7 and a novel L539F variation in exon 8. The 13 remaining patients were subjected to next-generation sequencing (NGS that targeted a panel of 22 PD-causing genes and overlapping phenotypes. NGS data showed that two unrelated consanguineous patients with juvenile-onset PD (12 and 13 years carried the same homozygous stop mutation W258X in the ATP13A2 gene, possibly resulting from a founder effect; and one patient with late onset (76 years carried a novel heterozygous frameshift mutation in SYNJ1. Clinical analysis showed that patients with the ATP13A2 mutation developed juvenile-onset PD with a severe phenotype, whereas patients having either PRKN or PINK1 mutations displayed early-onset PD with a relatively mild phenotype. By identifying pathogenic mutations in 45% (8/18 of our consanguineous Moroccan PD series, we demonstrate that the combination of chromosomal microarray analysis and NGS is a powerful approach to

  12. Water striders (family Gerridae): mercury sentinels in small freshwater ecosystems

    International Nuclear Information System (INIS)

    Jardine, Timothy D.; Al, Tom A.; MacQuarrie, Kerry T.B.; Ritchie, Charles D.; Arp, Paul A.; Maprani, Antu; Cunjak, Richard A.

    2005-01-01

    To circumvent some of the previous limitations associated with contaminant-monitoring programs, we tested the suitability of the water strider (Hemiptera: Gerridae) as a mercury sentinel by comparing total mercury concentrations in water striders and brook trout (Salvelinus fontinalis) from a variety of stream sites in New Brunswick, Canada. There was a strong association between the two variables across sites (r 2 = 0.81, P < 0.001) in systems where both atmospheric deposition and a point source (an abandoned gold mine) were likely contributing to ambient mercury levels. In a small stream draining the gold mine tailings pile, water striders had mercury concentrations an order of magnitude higher than those from reference locations. Temporal variation at three southern New Brunswick stream sites was non-significant. These results suggest that water strider mercury levels accurately quantify food chain entry of the element. The use of sentinel species holds great potential for expanding contaminant-monitoring programs. - Water striders accurately reflect the entry of mercury in food chains of small freshwater systems

  13. Adoption Of Small Family Norms In A Rural Community Of West Bengal

    Directory of Open Access Journals (Sweden)

    Biswas A.K

    1994-01-01

    Full Text Available Research Questions: 1. To what extent do rural eligible couples accept the small family norm? 2. What are the factors which influence the adoption of small family norm by these couples? Objectives: 1. To determine the extent of adoption of small norm among family planning service acceptors (2 To identify factors influencing adoption of small family norm. Study Design: Cross sectional Study Setting: 2 villages- a PHC village and one 5 kms away of Block Sonarpur. Participants: 312 eligible couples of these villages. Study Variables: Socio â€" economics status, literacy of the wives, type of family, religion, number of children, type of family planning method. Outcome Variables: Prevalence of contraceptive method use, reasons for not using family planning methods. Statistical Analysis: Proportions Results : The prevalence of contraceptive use was 44.9% but the Effective Couple Protection Rate was only 20.5% and the Crude Birth Rate was still high (35/1000. This was because 40% of the couples had more then 2 children and of them 38% were still exposed to the risk of conception. Muslim couples had a lower contraceptive acceptance rate than Hindu couples. The more literate the wife, the greater the acceptance of the small family norm. Male preference pressure from elders and fear about contraception were the main reasons for non acceptance of family planning methods: The health teams were the main source of information to these couples. Recommendations: There is an urgent need to increase the emphasis on the 2 child family norm. The IEC activities of the health team should be strengthened.

  14. Patterns of Relating Between Physicians and Medical Assistants in Small Family Medicine Offices

    Science.gov (United States)

    Elder, Nancy C.; Jacobson, C. Jeffrey; Bolon, Shannon K.; Fixler, Joseph; Pallerla, Harini; Busick, Christina; Gerrety, Erica; Kinney, Dee; Regan, Saundra; Pugnale, Michael

    2014-01-01

    PURPOSE The clinician-colleague relationship is a cornerstone of relationship-centered care (RCC); in small family medicine offices, the clinician–medical assistant (MA) relationship is especially important. We sought to better understand the relationship between MA roles and the clinician-MA relationship within the RCC framework. METHODS We conducted an ethnographic study of 5 small family medicine offices (having informed by clinicians’ roles in hiring and managing MAs and the social familiarity of MAs and clinicians. Within the RCC framework, these findings can be seen as previously undefined constraints and freedoms in what is known as the Complex Responsive Process of Relating between clinicians and MAs. CONCLUSIONS Improved understanding of clinician-MA relationships will allow a better appreciation of how clinicians and MAs function in family medicine teams. Our findings may assist small offices undergoing practice transformation and guide future research to improve the education, training, and use of MAs in the family medicine setting. PMID:24615311

  15. Early detection of leprosy by examination of household contacts, determination of serum anti-PGL-1 antibodies and consanguinity

    Directory of Open Access Journals (Sweden)

    Renata Bazan-Furini

    2011-08-01

    Full Text Available A cross-sectional clinical trial in which the serum anti-phenolic glycolipid (anti-PGL-1 antibodies were analysed in household contacts (HHC of patients with leprosy as an adjunct early leprosy diagnostic marker was conducted. The families of 83 patients underwent clinical examination and serum anti-PGL1 measurement using enzyme-linked immunosorbent assay. Of 320 HHC, 98 were contacts of lepromatous leprosy (LL, 80 were contacts of borderline lepromatous (BL, 28 were contacts of borderline (BB leprosy, 54 were contacts of borderline tuberculoid (BT, 40 were contacts of tuberculoid (TT and 20 were contacts of indeterminate (I leprosy. Consanguinity with the patients was determined for 232 (72.5% HHC. Of those 232 contacts, 183 had linear consanguinity. Forty-nine HHC had collateral consanguinity. Fifty-eight contacts (18.1% tested positive for anti-PGL1 antibodies. The number of seropositive contacts based on the clinical forms of the index case was 17 (29.3% for LL, 15 (25.9% for BL, one (1.7% for BB, 14 (24.1% for BT, three (5.2% for TT and eight (13.7% for I. At the one year follow-up, two (3.4% of these seropositive contacts had developed BT leprosy. The results of the present study indicate that the serum anti-PGL-1 IgM antibody may be useful for evaluating antigen exposure and as a tool for an early leprosy diagnosis in HHC.

  16. Assessing the influence of consanguinity on congenital heart disease

    Directory of Open Access Journals (Sweden)

    Alan H Bittles

    2011-01-01

    Full Text Available Numerous articles have been published linking consanguineous marriage to an elevated prevalence of congenital heart disease, with ventricular septal defects and atrial septal defects the most commonly cited disorders. While initially persuasive, on closer examination many of these studies have fundamental shortcomings in their design and in the recruitment of study subjects and controls. Improved matching of cases and controls, to include recognition of the long-established community boundaries within which most marriages are contracted, and the assessment of consanguinity within specific levels and types of marital union would improve and help to focus the study outcomes. At the same time, major discrepancies between studies in their reported prevalence and types of congenital heart disease suggest an urgent need for greater standardization in the classification and reporting of these disorders.

  17. Assessing the influence of consanguinity on congenital heart disease

    International Nuclear Information System (INIS)

    Bittles, Alan H.

    2011-01-01

    Numerous articles have been published linking consanguineous marriage to an elevated prevalence of congenital heart disease, with ventricular septal defects and atrial septal defects the most commonly cited disorders. While initially persuasive, on closer examination many of these studies have fundamental shortcomings in their design and in the recruitment of study subjects and controls. Improved matching of cases and controls, to include recognition of the long-established community boundaries within which most marriages are contracted, and the assessment of consanguinity within specific levels and types of marital union would improve and help to focus the study outcomes. At the same time, major discrepancies between studies in their reported prevalence and types of congenital heart disease suggest an urgent need for greater standardization in the classification and reporting of these disorders

  18. The Hidden Work of Women in Small Family Firms in Southern Spain

    Directory of Open Access Journals (Sweden)

    Paula Rodríguez-Modroño

    2017-01-01

    Full Text Available Women have historically played an important hidden role in family firms, and a great deal of research is now shedding light on this role. In spite of the more formal nature of female work at the present day, still a considerable volume of women’s contributions in family firms is unregistered and unpaid, even in developed regions. A questionnaire was administered to 396 women working in small and medium-sized family firms located in Andalucia, a southern European region, characterized by familialism and an important informal economy. Our results confirm the persistence of subordinate forms of unpaid family collaboration due to the neutrality assigned to female contributions under the traditional gendered division of work. But also this study shows how some of the women voluntarily embrace subordinate roles as a temporary way to gain professional experience, useful for their future work inside or outside the family firm.

  19. Small Family, Smart Family? Family Size and the IQ Scores of Young Men. NBER Working Paper No. 13336

    Science.gov (United States)

    Black, Sandra E.; Devereux, Paul J.; Salvanes, Kjell G.

    2007-01-01

    How do families influence the ability of children? Cognitive skills have been shown to be a strong predictor of educational attainment and future labor market success; as a result, understanding the determinants of cognitive skills can lead to a better understanding of children's long run outcomes. This paper uses a large dataset on the male…

  20. Hurler disease (mucopolysaccharidosis type IH: clinical features and consanguinity in Tunisian population

    Directory of Open Access Journals (Sweden)

    Chkioua Latifa

    2011-11-01

    Full Text Available Abstract Mucopolysaccharidosis type I (MPS I was a group of rare autosomal recessive disorder caused by the deficiency of the lysosomal enzyme, alpha -L -iduronidase, and the resulting accumulation of undergraded dematan sulfate and heparan sulfate. MPS I patients have a wide range of clinical presentations, that makes it difficult to predict patient phenotype which is needed for genetic counseling and also impedes the selection and evaluation of patients undergoing therapy bone marrow transplantation. Aim of the study consanguinity rates have been determined among 14 families with mucopolysaccharidosis type I, seen in the pediatric departments of different geographic areas of Tunisia (Central and Southern areas for the period August 2004 - August 2011 in order to investigate the relation between consanguinity and this disorder. Patients and methods Clinical and molecular analyses confirmed the diagnosis for MPS type I in the studied families. Results Most of the Tunisian MPS I patients have been identified at the homozygous status: p.P533R mutation (7 homozygous and one double heterozygous p.L578Q/p.P533R patients; 41.66% of all the investigated MPSI patients, p.F177S (1 homozygous patient; 5.55%, p.L530fs (1 patient; 5.55%, p.Y581X (2 patients; 11.11%, p.F602X (3 patients; 16.66%, p.R628X (1 patient; 5.55%. Another mutation: p.L578Q has been identified at the heterozygous status in the only double heterozygous p.L578Q/p.P533R case. Part of the mutations was the result of a founder effect. These described points are the consequences of the high rate of consanguinity. Conclusion The high frequency of p.P533R mutation could be explained by the high degree of inbreeding. This is due to the richness of the genetic background of the studied population. A multidisciplinary approach is essential to develop adequate preventive program adapted to the social, cultural, and economic context.

  1. Gender, Work-Family Linkages, and Economic Success among Small Business Owners.

    Science.gov (United States)

    Loscocco, Karyn A.; Leicht, Kevin T.

    1993-01-01

    Investigated work-family connections and economic success among women and men small business owners. Analyses of data from 3-year panel survey of 99 women and 312 men showed considerable gender similarity in processes through which business and individual characteristics affect personal earnings, although women were disadvantaged in some…

  2. Reduced small world brain connectivity in probands with a family history of epilepsy.

    Science.gov (United States)

    Bharath, R D; Chaitanya, G; Panda, R; Raghavendra, K; Sinha, S; Sahoo, A; Gohel, S; Biswal, B B; Satishchandra, P

    2016-12-01

    The role of inheritance in ascertaining susceptibility to epilepsy is well established, although the pathogenetic mechanisms are still not very clear. Interviewing for a positive family history is a popular epidemiological tool in the understanding of this susceptibility. Our aim was to visualize and localize network abnormalities that could be associated with a positive family history in a group of patients with hot water epilepsy (HWE) using resting-state functional magnetic resonance imaging (rsfMRI). Graph theory analysis of rsfMRI (clustering coefficient γ; path length λ; small worldness σ) in probands with a positive family history of epilepsy (FHE+, 25) were compared with probands without FHE (FHE-, 33). Whether a closer biological relationship was associated with a higher likelihood of network abnormalities was also ascertained. A positive family history of epilepsy had decreased γ, increased λ and decreased σ in bilateral temporofrontal regions compared to FHE- (false discovery rate corrected P ≤ 0.0062). These changes were more pronounced in probands having first degree relatives and siblings with epilepsy. Probands with multiple types of epilepsy in the family showed decreased σ in comparison to only HWE in the family. Graph theory analysis of the rsfMRI can be used to understand the neurobiology of diseases like genetic susceptibility in HWE. Reduced small worldness, proportional to the degree of relationship, is consistent with the current understanding that disease severity is higher in closer biological relations. © 2016 EAN.

  3. Do consanguineous parents of a child affected by an autosomal recessive disease have more DNA identical-by-descent than similarly-related parents with healthy offspring? Design of a case-control study

    Directory of Open Access Journals (Sweden)

    Cornel Martina C

    2010-07-01

    Full Text Available Abstract Background The offspring of consanguineous relations have an increased risk of congenital/genetic disorders and early mortality. Consanguineous couples and their offspring account for approximately 10% of the global population. The increased risk for congenital/genetic disorders is most marked for autosomal recessive disorders and depends on the degree of relatedness of the parents. For children of first cousins the increased risk is 2-4%. For individual couples, however, the extra risk can vary from zero to 25% or higher, with only a minority of these couples having an increased risk of at least 25%. It is currently not possible to differentiate between high-and low-risk couples. The quantity of DNA identical-by-descent between couples with the same degree of relatedness shows a remarkable variation. Here we hypothesize that consanguineous partners with children affected by an autosomal recessive disease have more DNA identical-by-descent than similarly-related partners who have only healthy children. The aim of the study is thus to establish whether the amount of DNA identical-by-descent in consanguineous parents of children with an autosomal recessive disease is indeed different from its proportion in consanguineous parents who have healthy children only. Methods/Design This project is designed as a case-control study. Cases are defined as consanguineous couples with one or more children with an autosomal recessive disorder and controls as consanguineous couples with at least three healthy children and no affected child. We aim to include 100 case couples and 100 control couples. Control couples are matched by restricting the search to the same family, clan or ethnic origin as the case couple. Genome-wide SNP arrays will be used to test our hypothesis. Discussion This study contains a new approach to risk assessment in consanguineous couples. There is no previous study on the amount of DNA identical-by-descent in consanguineous

  4. Localization of A Novel Autosomal Recessive Non-Syndromic Hearing Impairment Locus (DFNB38) to 6q26–q27 in a Consanguineous Kindred from Pakistan

    OpenAIRE

    Ansar, Muhammad; Ramzan, Mohammad; Pham, Thanh L.; Yan, Kai; Jamal, Syed Muhammad; Haque, Sayedul; Ahmad, Wasim; Leal, Suzanne M.

    2003-01-01

    For autosomal recessive nonsyndromic hearing impairment over 30 loci have been mapped and 19 genes have been identified. DFNB38, a novel locus for autosomal recessive nonsyndromic hearing impairment, was localized in a consanguineous Pakistani kindred to 6q26–q27. The affected family members present with profound prelingual sensorineural hearing impairment and use sign language for communications. Linkage was established to microsatellite markers located on chromosome 6q26–q27 (Multipoint lod...

  5. Investigation of current university research concerning energy conversion and conservation in small single-family dwellings

    Science.gov (United States)

    Grossman, G. R.; Roberts, A. S., Jr.

    1975-01-01

    An investigation was made of university research concerning energy conversion and conservation techniques which may be applied in small single-family residences. Information was accumulated through published papers, progress reports, telephone conversations, and personal interviews. A synopsis of each pertinent investigation is given. Finally, a discussion of the synopses is presented and recommendations are made concerning the applicability of concepts for the design and construction of NASA-Langley Research Center's proposed Technology Utilization House in Hampton, Virginia.

  6. Effect of consanguinity on birth defects in Saudi women; results from a nested case-control study

    DEFF Research Database (Denmark)

    Majeed-Saidan, Muhammad Ali; Ammari, Amer N; AlHashem, Amal M

    2015-01-01

    BACKGROUND: The role of consanguinity in the etiology of structural birth defects outside of chromosomal and inherited disorders has always been debated. We studied the independent role of consanguinity on birth defects in Saudi women with a high prevalence of consanguineous marriages. METHODS: T...

  7. Key factors of project success in family small and medium-sized companies: the theoretical review

    Directory of Open Access Journals (Sweden)

    Sinisa Arsic

    2017-10-01

    Full Text Available The paper proposes a systematization of the key success factors of projects, through the theoretical review of family-owned companies operating in the EU market. It is the small and medium companies that in their own way contribute to the overall success of the national economy in terms of economic activity, increased employment, development activities and defining better business environment. The theoretical review observed numerous studies of family businesses, and the contribution of this work is in the systematization of the results of previous research – over three horizons, i.e., over the role of managers in the creation of successful projects (or owner if it is a family enterprise, institutional support for companies in Serbia and the EU, specific industries and the parent (regional markets where a family company operates. Project management, as a general representation of the concept of implementation of strategic and operational endeavors, contains many specifics in terms of critical success factors of projects depending on the environment in which they are implemented. The goal of the paper is reflected in the identification and presentation of critical success factors of projects implemented in family companies. The paper concludes with a discussion of the research results in relation to the existing, similar research studies, as well as with the announcement of future research, which will examine the conclusions drawn on a real sample.

  8. Domestic violence and consanguineous marriages - perspective from Rawalpindi, Pakistan.

    Science.gov (United States)

    Shaikh, M Ali; Kayani, A; Shaikh, I Ali

    2014-01-09

    Domestic violence is globally endemic and adversely impacts the health and economic well-being of women and society. This study used the standardized and validated assessment instrument "Woman Abuse Screening Tool" to study the prevalence of various forms of domestic violence among married women. The relationship between domestic violence and consanguineous marriage was studied using the chi-squared test. Cumulatively, 1010 married women were interviewed. Emotional abuse was the most commonly reported abuse, reported by 721 (71.4%) women as either often or sometimes, followed by sexual abuse and physical abuse, reported by 527 (52.2%) and 511 (50.6%) respectively. Being married to one's cousin did not protect married women from being abused either emotionally or physically by their husbands; thsi was statistically significant. There is a need for better understanding of the magnitude and scale of domestic violence in Pakistan by using standardized assessment tools for meaningful comparisons across different parts of the country over time.

  9. Papillon-Lefevre syndrome: Reporting consanguinity as a risk factor.

    Science.gov (United States)

    Shah, Aasim Farooq; Tangade, Pradeep; Agarwal, Swatantra

    2014-07-01

    Papillon-Lefevre syndrome (PLS) is an autosomal recessive genetic disorder characterized by palmoplantar hyperkeratosis associated with severe early-onset periodontitis and premature loss of primary and permanent teeth. This report describes two cases of PLS in 28-year-old female and 16-year-old male siblings with consanguineously married parents. The patients presented to the Department of Public Health Dentistry of a dental education and research institute in India with thickening, flaking, and scaling of the skin on the palms and soles of the feet. On oral examination, the female patient presented completely resorbed maxillary and mandibular alveolar ridges with retention of only the third molars. The male patient retained only teeth 18, 13, 28, 38, and 45. Based on complete histories and clinical examination findings, a final diagnosis of PLS was made and treatment was initiated using an interdisciplinary dental approach in both cases.

  10. Papillon–Lefevre syndrome: Reporting consanguinity as a risk factor

    Directory of Open Access Journals (Sweden)

    Aasim Farooq Shah

    2014-07-01

    Full Text Available Papillon–Lefevre syndrome (PLS is an autosomal recessive genetic disorder characterized by palmoplantar hyperkeratosis associated with severe early-onset periodontitis and premature loss of primary and permanent teeth. This report describes two cases of PLS in 28-year-old female and 16-year-old male siblings with consanguineously married parents. The patients presented to the Department of Public Health Dentistry of a dental education and research institute in India with thickening, flaking, and scaling of the skin on the palms and soles of the feet. On oral examination, the female patient presented completely resorbed maxillary and mandibular alveolar ridges with retention of only the third molars. The male patient retained only teeth 18, 13, 28, 38, and 45. Based on complete histories and clinical examination findings, a final diagnosis of PLS was made and treatment was initiated using an interdisciplinary dental approach in both cases.

  11. Parental consanguinity and susceptibility to drug abuse among offspring, a case-control study.

    Science.gov (United States)

    Saadat, Mostafa; Vakili-Ghartavol, Roghayyeh

    2010-11-30

    Consanguineous marriage is the union of individuals having at least one common ancestor. It is well established that consanguinity is a potential risk factor for many adverse health outcome of offspring. In the present case-control study we tested the hypothesis of an association between parental consanguinity marriages and risk of offspring substance abuse. The study was performed in Shiraz (Fars province, Iran). Here 156 male drug abusers (case group) and 264 randomly selected healthy blood donors, matched for age and gender as control group, were included in the study. The prevalence of parental consanguineous marriages in the studied sample was 39.1 and 28.0% among cases and controls, respectively. The difference was statistically significant. The substance abusers were more smokers and drinkers compared with the control group. There was significant negative linear trend between drug abuse and level of education. The participants stratified using drinking habits and then the analysis was carried out separately for drinker and non-drinker subjects. Among drinkers, neither before nor after adjusting for smoking status and educational level, parental consanguinity did not show association with risk of substance abuse. Among non-drinkers, after adjusting for smoking status and educational level, parental consanguineous marriage was significantly associated with increased risk of substance abuse. Our study supports a significant relationship between parental consanguinity and drug abuse among non-drinker subjects. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Effect of Consanguinity on Low Birth Weight: A Meta-Analysis.

    Science.gov (United States)

    Poorolajal, Jalal; Ameri, Pegah; Soltanian, Alireza; Bahrami, Masoud

    2017-03-01

    Consanguinity (when couples share at least one common ancestor) is a public health issue with a variety of distributions and incidence rates worldwide. Several epidemiological studies have explored the association between consanguinity and low birth weight (LBW). However, the results are inconsistent. This meta-analysis aimed to explore the overall association between consanguineous marriage and LBW. We searched PubMed, Web of Science, Scopus, ScienceDirect, and reference lists of articles up to May 2015. We included cohort, case-control, and cross-sectional studies addressing the association between consanguinity and LBW. We assessed heterogeneity using Q-test and I2 statistic. We explored publication bias using the Egger's and Begg's tests and the funnel plot. We meta-analyzed the data and reported the overall odds ratio (OR) and mean difference with 95% confidence intervals (CI) using the random-effects model. We included 24 out of 3941 retrieved studies, with 44,131 participants. We indicated that LBW was associated significantly with first-cousin marriages (OR = 1.36; 95% CI: 1.03, 1.69) and non-significantly with second-cousin marriages (OR = 1.20; 95% CI: 0.49, 1.91). Furthermore, first-cousin marriages can reduce the birth weight of siblings of consanguineous couples 144 g more compared to non-consanguineous marriages. This meta-analysis measured the association between consanguinity and LBW. Based on the current evidence, consanguineous marriage can increase the risk for LBW. However, further evidence based on large cohort studies conducted in different settings is required to make a robust conclusion regarding the effect of consanguinity on LBW.

  13. DETERMINATION OF THE PREVALENCE AND THE AFFECTING FACTORS OF CONSANGUINOUS MARRIAGES AMONG YOUNG ADULT MEN

    Directory of Open Access Journals (Sweden)

    Omer Faruk TEKBAS

    2005-06-01

    Full Text Available In order to examine the prevalence and the affecting factors of consanguinous marriage which is common especially in around of our country and leads to very important health problems, a questionnaire was applied to all 402 married soldiers among 4300 soldiers of Etimesgut Armor School and Training Division Command. At the end of the study, it has been found that the overall prevalence of consanguinous marriage was 18.7%. Contrary to general expectations, ?love and marriage by loving? other than ?economical concerns? was determined as the basic reason of the consanguinous marriage. [TAF Prev Med Bull 2005; 4(3.000: 120-128

  14. [The point-digital interpretation and the choice of the dermatoglyphic patterns on human fingers for diagnostics of consanguineous relationship].

    Science.gov (United States)

    Zvyagin, V N; Rakitin, V A; Fomina, E E

    The objective of the present study was the development of the point-digital model for the scaless interpretation of the dermatoglyphic papillary patterns on human fingers that would allow to comprehensively describe, in digital terms, the main characteristics of the traits and perform the quantitative assessment of the frequency of their inheritance. A specially developed computer program, D.glyphic. 7-14 was used to mark the dermatoglyphic patterns on the fingerprints obtained from 30 familial triplets (father + mother + child).The values of all the studied traits for kinship diagnostics were found by calculating the ratios of the sums of differences between the traits in the parent-parent pairs to those in the respective parent-child pairs. The algorithms for the point marking of the traits and reading out the digital information about them have been developed. The traditional dermatoglyphic patterns were selected and the novel ones applied for the use in the framework of the point-digital model for the interpretation of the for diagnostics of consanguineous relationship. The present experimental study has demonstrated the high level of inheritance of the selected traits and the possibility to develop the algorithms and computation techniques for the calculation of consanguineous relationship coefficients based on these traits.

  15. Potential social, economic and general health benefits of consanguineous marriage: results from the Born in Bradford cohort study.

    Science.gov (United States)

    Bhopal, Raj S; Petherick, Emily S; Wright, John; Small, Neil

    2014-10-01

    More than 1 billion people live in societies where consanguineous marriages are common. When children are born to consanguineous unions, there is an increased probability of the expression of single-gene disorders with a recessive mode of inheritance. There are presumptive social benefits of consanguineous marriages reported in the literature. The UK's Born in Bradford birth cohort study recruited 12 453 women at 26-28 weeks' gestation between 2007 and 2010. In all, 11 396 completed a questionnaire, including questions about their relationship to their baby's father. We compared Pakistani and Other ethnic groups in consanguineous relationships and Pakistani, Other and White British groups not in consanguineous relationships, calculating percentages and age-adjusted prevalence ratios (95% confidence intervals). In the Pakistani group, 59.3% of women (n = 3038) were blood relatives of their baby's father. Consanguinity was uncommon in the Other ethnic group (7.3%, n = 127) and rare (n = 5) in the White British group. Compared with non-consanguineous counterparts, mothers in consanguineous relationships were socially and economically disadvantaged (e.g. never employed, less likely to have higher education). The Pakistani consanguineous group's social, economic and health lifestyle circumstances were equivalent to, in some cases better than, women in non-consanguineous relationships (e.g. up-to-date in paying bills, or in disagreeing that they wished for more warmth in their marital relationship). The consanguineous relationship group had less separation/divorce. Rates of cigarette smoking during pregnancy were lower in mothers in consanguineous relationships. Debate about consanguinity should balance the potential protective effect of consanguineous relationships with established genetic risk of congenital anomaly in children. © The Author 2013. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.

  16. A complex microcephaly syndrome in a Pakistani family associated with a novel missense mutation in RBBP8 and a heterozygous deletion in NRXN1

    NARCIS (Netherlands)

    Agha, Z.; Iqbal, Z.; Azam, M.; Siddique, M.; Willemsen, M.H.; Kleefstra, T.; Zweier, C.; Leeuw, N. de; Qamar, R.; Bokhoven, H. van

    2014-01-01

    We report on a consanguineous Pakistani family with a severe congenital microcephaly syndrome resembling the Seckel syndrome and Jawad syndrome. The affected individuals in this family were born to consanguineous parents of whom the mother presented with mild intellectual disability (ID), epilepsy

  17. Modernization or cultural maintenance: the practice of consanguineous marriage in Iran.

    Science.gov (United States)

    Jalal Abbasi-Shavazi, Mohammad; McDonald, Peter; Hosseini-Chavoshi, Meimanat

    2008-11-01

    Consanguineous marriage has been the culturally preferred form of marriage in Iran. This paper examines the extent to which education, urbanization and changes in modes of economic production have affected the incidence of consanguineous marriage and attitudes towards consanguineous marriages. The 2002 Iran Fertility Transition Survey conducted in the four provinces of Gilan, Sistan and Baluchistan, Yazd and West Azarbaijan provides information on the degree of relationship of marriage partners from around 6550 ever-married women aged 15-49. Attitudinal data were also obtained. Overall, the level of marriage to biological relatives ranged from 23% in Gilan to 78% in Sistan and Baluchistan. The paper finds that the practice of marriage to biological relatives has remained surprisingly resilient in the face of modernizing influences and that ethnicity, province and area of residence remain important determinants. On the other hand, attitudes have shifted towards marriage with a non-relative. Anthropological research would illuminate the processes of consanguineous marriage in Iran.

  18. Small leucine rich proteoglycan family regulates multiple signalling pathways in neural development and maintenance.

    Science.gov (United States)

    Dellett, Margaret; Hu, Wanzhou; Papadaki, Vasiliki; Ohnuma, Shin-ichi

    2012-04-01

    The small leucine-rich repeat proteoglycan (SLRPs) family of proteins currently consists of five classes, based on their structural composition and chromosomal location. As biologically active components of the extracellular matrix (ECM), SLRPs were known to bind to various collagens, having a role in regulating fibril assembly, organization and degradation. More recently, as a function of their diverse proteins cores and glycosaminoglycan side chains, SLRPs have been shown to be able to bind various cell surface receptors, growth factors, cytokines and other ECM components resulting in the ability to influence various cellular functions. Their involvement in several signaling pathways such as Wnt, transforming growth factor-β and epidermal growth factor receptor also highlights their role as matricellular proteins. SLRP family members are expressed during neural development and in adult neural tissues, including ocular tissues. This review focuses on describing SLRP family members involvement in neural development with a brief summary of their role in non-neural ocular tissues and in response to neural injury. © 2012 The Authors Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  19. How a Small Family Run Business Adopted Critical Reflection Action Learning Using Hand Drawn Images to Initiate Organisational Change

    Science.gov (United States)

    Shepherd, Gary

    2016-01-01

    In this account of practice I would like to share my experiences of facilitating a Critical Reflection Action Learning (CRAL) set with a small family run business, struggling to make change and expand their services due to the problems they encountered in separating their business lives from their family lives. The account I present here is based…

  20. Consanguineous marriages in the genetic counseling centers of Isfahan and the ethical issues of clinical consultations

    OpenAIRE

    Nouri, Narges; Nouri, Nayereh; Tirgar, Samane; Soleimani, Elham; Yazdani, Vida; Zahedi, Farzaneh; Larijani, Bagher

    2017-01-01

    Consanguineous marriage, which is common in many regions in the world, has absorbed much attention as a causative factor in raising the incidence of genetic diseases. The adverse effects may be attributed to the expression of the genes received from common ancestors and mortality and morbidity of the offspring. Iran has a high rate of consanguineous marriages. In recent years genetic counseling has come to be considered in health care services. This cross-sectional study was conducted in orde...

  1. Familial hemophagocytic lymphohistiocytosis in two Saudi siblings

    OpenAIRE

    Abbaker, Abdelakarim Ibrahim; Dammas, Ali Saeed

    2015-01-01

    Primary familial hemophagocytic lymphohistiocytosis (HLH; or familial erythrophagocytic lymphohistiocytosis [FEL]) is a heterogeneous autosomal recessive disorder more prevalent with parental consanguinity. There is aggressive proliferation of activated macrophages and histiocytes, which phagocytose red blood cells (RBCs), white blood cells (WBCs), and platelets, leading to anemia, neutropenia and thrombocytopenia. The exaggerated response of immune system in familial HLH can occur in the abs...

  2. Consanguineous marriages and matrimonial distance: a study among three South Indian caste groups.

    Science.gov (United States)

    Reddy, P G

    1988-12-01

    Reddy studies consanguineous marriages and matrimonial distance in 3 castes of Nellore district, Andhra Pradesh, South India. The castes include the well-to-do agricultural caste, the Desuri Kapu; the 2nd, artisan caste in the middle of the hierarchy, the Devanga; and the third caste at the bottom of the social ladder, the Mala. During field work conducted in 1978-1979, prominent elders of the villages were approached; information on the consanguinity of marriage and matrimonial distance was gathered through intensive interviews of both men and women from all the households of the 3 castes. Among the total of 979 marriages, 28.9% occurred within the village, the proportion of intra-village marriages being significantly higher in Nellore taluk than in Sullurpet. The 3 castes overall show little difference in the incidence of intra-village marriages, but there is some within caste regional variation in the incidence of intra-village marriages, the Devanga showing a significantly higher incidence in Nellore than in Sullurpet. Intra-village marriages are more common among consanguineous couples (41.5%) than among non-consanguineous (18.3%), a highly significant excess in each of the caste groups. In short, Reddy concludes that intra-village marriages are more common among consanguineous couples than non-consanguineous, and mean matrimonial distance is also lower.

  3. The relationship between consanguineous marriage and death in fetus and infants

    Directory of Open Access Journals (Sweden)

    Majid Mehr Mohammadi

    2012-01-01

    Full Text Available Background: Given the high prevalence of consanguineous marriages in rural and urban areas of Iran, the aim of this study was to identify its role in increasing fetal and infant deaths. Materials ans Methods : This was a cross-sectional study in which 494 mothers with more than one exceptional child (mentally retarded and physically-dynamically disabled or with normal children were selected based on multi-stage random sampling method. Data was gathered using the features of parents with more than one exceptional child questionnaire. The validity and reliability of this questionnaire was acceptable. Hierarchical log-linear method was used for statistical analysis. Results: Consanguineous marriage significantly increased the number of births of exceptional children. Moreover, there was a significant relation between the history of fetal/infant death and belonging to the group. There was a significant relation between consanguineous marriage and the history of fetal/infant death which means consanguineous marriage increased the prevalence of fetal/infant death in parents with exceptional children rather than in parents with normal children. Conclusions: The rate of fetal/infant death in exceptional births of consanguineous marriages was higher than that of non-consanguineous marriages.

  4. The relationship between consanguineous marriage and death in fetus and infants.

    Science.gov (United States)

    Mohammadi, Majid Mehr; Hooman, Heidar Ali; Afrooz, Gholam Ali; Daramadi, Parviz Sharifi

    2012-05-01

    Given the high prevalence of consanguineous marriages in rural and urban areas of Iran, the aim of this study was to identify its role in increasing fetal and infant deaths. This was a cross-sectional study in which 494 mothers with more than one exceptional child (mentally retarded and physically-dynamically disabled) or with normal children were selected based on multi-stage random sampling method. Data was gathered using the features of parents with more than one exceptional child questionnaire. The validity and reliability of this questionnaire was acceptable. Hierarchical log-linear method was used for statistical analysis. Consanguineous marriage significantly increased the number of births of exceptional children. Moreover, there was a significant relation between the history of fetal/infant death and belonging to the group. There was a significant relation between consanguineous marriage and the history of fetal/infant death which means consanguineous marriage increased the prevalence of fetal/infant death in parents with exceptional children rather than in parents with normal children. The rate of fetal/infant death in exceptional births of consanguineous marriages was higher than that of non-consanguineous marriages.

  5. National impacts of the Weatherization Assistance Program in single-family and small multifamily dwellings

    Energy Technology Data Exchange (ETDEWEB)

    Brown, M.A.; Berry, L.G.; Balzer, R.A.; Faby, E.

    1993-05-01

    Since 1976, the US Department of Energy (DOE) has operated one of the largest energy conservation programs in the nation -- the low-income Weatherization Assistance Program. The program strives to increase the energy efficiency of dwellings occupied by low-income persons in order to reduce their energy consumption, lower their fuel bills, increase the comfort of their homes, and safeguard their health. It targets vulnerable groups including the elderly, people with disabilities, and families with children. The most recent national evaluation of the impacts of the Program was completed in 1984 based on energy consumption data for households weatherized in 1981. DOE Program regulations and operations have changed substantially since then: new funding sources, management principles, diagnostic procedures, and weatherization technologies have been incorporated. Many of these new features have been studied in isolation or at a local level; however, no recent evaluation has assessed their combined, nationwide impacts to date or their potential for the future. In 1990, DOE initiated such an evaluation. This evaluation is comprised of three ``impact`` studies (the Single-Family Study, High-Density Multifamily Study, and Fuel-Oil Study) and two ``policy`` studies. Altogether, these five studies will provide a comprehensive national assessment of the Weatherization Assistance Program as it existed in the 1989 Program Year (PY 1989). This report presents the results of the first phase of the Single-Family Study. It evaluates the energy savings and cost effectiveness of the Program as it has been applied to the largest portion of its client base -- low-income households that occupy single-family dwellings, mobile homes, and small (2- to 4-unit) multifamily dwellings. It is based upon a representative national sample that covers the full range of conditions under which the program was implemented in PY 1989.

  6. Does family control of small business lead to under exploitation of their financial growth potential? Evidence of the existence of conservative growth behavior in family controlled French SMEs.

    OpenAIRE

    Anaïs Hamelin

    2010-01-01

    This paper uses a very large sample of French SMEs to study growth of small businesses. Firms are distinguished according to the intensity of family control. The estimated relationship accounts for firm characteristics of size, age, sector, and ease to access credit. The results show that firms with greater family control are prone to exhibit lower rates of sales growth than feasible, given firm internal financing resources (ie they adopt a conservative growth behavior). Because firm growth i...

  7. Consanguinity in Qatar: knowledge, attitude and practice in a population born between 1946 and 1991.

    Science.gov (United States)

    Sandridge, A L; Takeddin, J; Al-Kaabi, E; Frances, Y

    2010-01-01

    From March 2007 to March 2008 a cross-sectional study was conducted in Qatar to estimate the prevalence of consanguinity among Qataris and to assess their knowledge of the risks and their attitudes towards the practice. A secondary objective was to test the acceptability of sixteen Likert-style questions within the Qatari population. Face-to-face interviews using a 70-item structured questionnaire were conducted by three native Arabic-speaking medical students with 362 Qatari employees. Where consanguinity existed between the employee's parents, a diagram of the consanguinal relationship (phylogram) was completed. The response rate was 93%. By phylogram, 22% of participants reported a cousin relationship between their parents (consanguinal relationship) and another 15% reported that their parents were from the same tribe (affinal relationship). With respect to their own marital decision, 68% of the respondents had been married at least once. By phylogram, 35% of these reported a consanguineous relationship (first marriage), 9% reported only an affinal relationship and 56% reported that they were not married to a blood relative. Results on the sixteen Likert-style attitude questions were stratified by consanguinity status of parents and of self. In the stratification by consanguinity status of parents the top five attitudes differed by group but there appeared to be more similarity between the consanguinal and only tribal groups. Attitudinal results were stratified by sex. Results showed that the males had a stronger belief in several of the attitudes than females with the exception of causation of genetic abnormalities and health problems. The phylogram was shown to collect more detailed and explicit data than hard-coding. With respect to knowledge, the results showed that knowledge was imperfect with high proportions of participants not knowing that consanguinity has been implicated in autosomal recessive diseases such as thalassaemia, inborn errors of metabolism

  8. [Juvenile myasthenia gravis in sub-Saharan Africa: a case study of two consanguine sisters born from consanguinity in Togo].

    Science.gov (United States)

    Maneh, Nidain; Apetse, Kossivi; Diatewa, Bénédicte Marèbe; Domingo, Sidik Abou-Bakr; Agba, Aidé Isabelle; Ayena, Koffi Didier; Balogou, Koffi Agnon; Balo, Komi Patrice

    2017-01-01

    Myasthenia gravis is a rare acquired autoimmune pathology causing neuromuscular transmission impairment. Juvenile onset of myasthenia gravis is often characterized by ocular involvement. We report two cases of ocular juvenile myasthenia gravis (JMG) in two siblings. They were two young girls, XA and XB, aged 11 and 9 years, of Malian origin, residing in Togo, born from first-degree of consanguinity presenting to Ophthalmology due to progressive decrease in visual acuity. XA showed visual acuity 8/10 on both eyes while XB showed improvement in visual acuity from 3/10 to 7/10 using a pinhole occluder, suggesting ametropia. XA had a 2-year history of bilateral ptosis lifting the upper eyelid of 7 mm, while XB had a 3-year history of bilateral ptosis with no lifting of the upper eyelid. Ice pack test was strongly positive in both patients. They had Cogan's lid twitch with paresis of the oculomotor nerve without diplopia. The dosage of acetylcholine receptor autoantibodies was normal. The diagnosis of JMG associated with ametropia was suspected. Ametropia was corrected by glasses and a specific treatment with pyridostigmine was initiated, but both patients were lost to follow-up. Autoimmune myasthenia gravis with inaugural ophthalmologic manifestation is rare but it can occur among children living in sub-Saharan Africa. Studies should be conducted to establish the features of this disease.

  9. Physicochemical characterization of a new family of small alkyl phosphonium imide ionic liquids

    International Nuclear Information System (INIS)

    Hilder, M.; Girard, G.M.A.; Whitbread, K.; Zavorine, S.; Moser, M.; Nucciarone, D.; Forsyth, M.; MacFarlane, D.R.; Howlett, P.C.

    2016-01-01

    Despite their promising properties, phosphonium based ionic liquids have attracted little attention as compared to their nitrogen-based cation counterparts. This study focuses on the properties of a family of small phosphonium imide ionic liquids, as well as the effect of lithium salt addition to these. The 6 ionic liquids were either alkyl, cyclic or nitrile functionalised phoshonium cations with bis(trifluoromethanesulfonyl)imide, NTf_2, or bis(fluorosulfonyl)imide (FSI) as anion. Amongst the properties investigated were ionic conductivity, viscosity, thermal behaviour, electrochemical stability and the reversibility of electrochemical lithium cycling. All ionic liquids showed very promising properties e.g. having low transition temperatures, high electrochemical stabilities, low viscosities and high conductivities. Particularly the trimethyl phosphonium ionic liquids showed some of the highest conductivities reported amongst phosphonium ionic liquids generally. The combination of electrochemical stability, high conductivity and reversible lithium cycling makes them promising systems for energy storage devices such as lithium batteries.

  10. Expression of myc family oncoproteins in small-cell lung-cancer cell lines and xenografts

    DEFF Research Database (Denmark)

    Rygaard, K; Vindeløv, L L; Spang-Thomsen, M

    1993-01-01

    A number of genes have altered activity in small-cell lung cancer (SCLC), but especially genes of the myc family (c-myc, L-myc and N-myc) are expressed at high levels in SCLC. Most studies have explored expression at the mRNA level, whereas studies of myc family oncoprotein expression are sparse....... WE examined the expression of myc proto-oncogenes at the mRNA and protein level in 23 cell lines or xenografts. In the cell lines, the doubling time and the cell-cycle distribution, as determined by flow-cytometric DNA analysis, were examined to establish whether the level of myc......-myc. In general, the level of expression of c-myc and N-myc was similar at the mRNA and the protein level. Expression of c-myc was positively correlated with the proliferative index (sum of S and G2+M phases) of cell lines, but not with the population doubling time. In general, L-myc-expressing cell lines had...

  11. Oral clefts, consanguinity, parental tobacco and alcohol use: a case-control study in Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Isabel Cristina Gonçalves Leite

    2009-03-01

    Full Text Available This hospital-based, case-control study investigated the possible associations between family history of malformations, parental consanguinity, smoking and alcohol drinking and nonsyndromic orofacial cleft (OC, subdivided in 2 main groups: CL/P - cleft lip with or without cleft palate and CP - cleft palate alone. 274 cases were matched (age, sex and place of residence to 548 controls. Odds ratios (OR and 95% confidence intervals (95% CI - adjusted for maternal age, schooling and smoking / alcohol use - were calculated by conditional logistic regression. The results demonstrated that the history of oral clefts either in the father's (CL/P: OR = 16.00, 5.64-69.23; CP: OR = 6.64, 1.48-33.75 or in the mother's family (CL/P: OR = 5.00, 2.31-10.99, CP: OR = 12.44, 1.33-294.87 was strongly associated with both types of clefts, but parental consanguinity was associated only with CL/P (OR = 3.8, 1.27-12.18. Prevalence of maternal smoking during the first trimester of pregnancy was higher among cases but the OR (1.13, 0.81-1.57 was not statistically significant. Maternal passive smoking (nonsmoking mothers during pregnancy was associated with CL/P (1.39, 1.01-1.98 but not with CP. Maternal alcohol use during the 1st trimester increased odds for CL/P (OR = 2.08, 1.27-3.41 and CP (OR = 2.89, 1.25-8.30, and odds for OC tended to increase with dose. Neither smoking nor alcohol use by fathers increased risks for OC. This study provides further evidence of a possible role of maternal exposure to tobacco smoke and alcohol in the etiology of nonsyndromic oral clefts.

  12. Consanguinity and major genetic disorders in Saudi children: Acommunity-based cross-sectional study

    International Nuclear Information System (INIS)

    El-Mouzan, Mohammad I.; Al-Salloum, Abdullah A.; Al-Herbish, Abdullah S.; Qurachi, Mansour M.; Al-Omar, Ahmad A.

    2008-01-01

    There is a high rate of consanguinity in Saudi Arabia; however,information on its relationship with genetic disorders is limited. Theobjective of this cross-sectional study was to explore the role ofconsanguinity in genetic disorders. The study sample was determined by amultistage probability random sampling procedure. Primary care physiciansperformed a history and physical examination of all children and adolescentsyounger than 19 years and all cases of genetic diseases were recorded. Thechi-square test was used to compare proportions. During the two-year studyperiod (2004-2005), 11554 of 11874 (97%) mothers answered the question onconsanguinity and 6470 of 11554 (56%) were consanguineous. There was nosignificant association between first-cousin consanguinity and Down syndrome(P=0.55). Similarly, there was no significant association with either sicklecell disease (P=0.97) or glucose-6-phosphate dehydrogenase deficiency(P=0.67) for-cousin in consanguinity. A borderline statistical significancewas found for major congenital malformations (P=0.05). However, the mostsignificant association with first-cousin consanguinity was congenital heartdisease (CHD) (P=0.01). Finally, no significant association was found fortype 1 diabetes mellitus (P=0.92). For all types of consanguinity, similartrends of association were found, with a definite statistically significantassociation only with CHD (P=0.003). The data suggest a significant role ofparental consanguinity in CHD. However, a relationship between consanguinityand other genetic diseases could not be established. The effect ofconsanguinity on genetic diseases is not uniform and this should be takeninto consideration in genetic counseling. (author)

  13. Inbreeding in Gredos mountain range (Spain): contribution of multiple consanguinity and intervalley variation.

    Science.gov (United States)

    Fuster, V; Jiménez, A M; Colantonio, S E

    2001-04-01

    The present paper examines consanguineous marriages occurring between 1874 and 1975 in three valleys (Tormes, Alberche, and Tiétar) in the Sierra de Gredos mountain range, Avila province, Spain. Information was obtained from parish registers of 42 localities, corresponding to a total of 41,696 weddings. Consanguineous marriages were defined as those up to the third degree of consanguinity (second cousins). From 1874 to 1975 the percentage of related mates was 4.45% and the inbreeding coefficient was 0.0011868 (for 1874 to 1917 corresponding figures up to the fourth degree were 16.44% and 0.00 19085, respectively). In order to ascertain the characteristics and evolution of mating patterns in Gredos, the contribution of each degree of kinship was analyzed as a whole and then for each valley separately. Regarding total consanguineous marriages in Gredos, there is a low frequency of uncle-niece matings (0.21%) and a first-second cousin mating ratio (C22/C33) of 0.23 (up to the third degree of consanguinity). Before 1918 multiple matings (i.e., those involving more than a single relationship) accounted for 19.16% of consanguineous marriages (up to the fourth degree). The observed frequencies of multiple consanguineous marriages was, on average, about twice that expected at random, and the proportion of such marriages to total inbreeding was 34.65%. The temporal change of the Gredos inbreeding pattern was characterized by a recent decrease; the highest inbreeding levels correspond to the period from 1915 to 1944. Finally, intervalley differences (maximum inbreeding coefficient in the Tormes, minimum in the Tiétar) are interpreted considering the geography, population size, and population mobility for each valley

  14. Identification of potential small molecule binding pockets on Rho family GTPases.

    Directory of Open Access Journals (Sweden)

    Juan Manuel Ortiz-Sanchez

    Full Text Available Rho GTPases are conformational switches that control a wide variety of signaling pathways critical for eukaryotic cell development and proliferation. They represent attractive targets for drug design as their aberrant function and deregulated activity is associated with many human diseases including cancer. Extensive high-resolution structures (>100 and recent mutagenesis studies have laid the foundation for the design of new structure-based chemotherapeutic strategies. Although the inhibition of Rho signaling with drug-like compounds is an active area of current research, very little attention has been devoted to directly inhibiting Rho by targeting potential allosteric non-nucleotide binding sites. By avoiding the nucleotide binding site, compounds may minimize the potential for undesirable off-target interactions with other ubiquitous GTP and ATP binding proteins. Here we describe the application of molecular dynamics simulations, principal component analysis, sequence conservation analysis, and ensemble small-molecule fragment mapping to provide an extensive mapping of potential small-molecule binding pockets on Rho family members. Characterized sites include novel pockets in the vicinity of the conformationaly responsive switch regions as well as distal sites that appear to be related to the conformations of the nucleotide binding region. Furthermore the use of accelerated molecular dynamics simulation, an advanced sampling method that extends the accessible time-scale of conventional simulations, is found to enhance the characterization of novel binding sites when conformational changes are important for the protein mechanism.

  15. Consanguinity and its relationship to differential fertility and mortality in the Kotia: a tribal population of Andhra Pradesh, India.

    Science.gov (United States)

    Yasim; Naidu, J M; Mascie-Taylor, C G

    1997-04-01

    Data on patterns of marriage, differential fertility and mortality were collected from 211 Kotia women residing in Visakhapatnam district of Andhra Pradesh, India. Consanguineous marriages made up just over a quarter of the total, and of these, father's sister's daughter (FSD) were more common than mother's brother's daughter (MBD). The mean inbreeding coefficient for the sample (F) was 0.0172. Women in consanguineous marriages had a lower mean number of total conceptions, live births and living offspring (net fertility) than women in non-consanguineous marriages. Significant heterogeneity was found in the means of living offspring for FSD, MBD and non-consanguineous couples, but not for conceptions and live births.

  16. A family of small-world network models built by complete graph and iteration-function

    Science.gov (United States)

    Ma, Fei; Yao, Bing

    2018-02-01

    Small-world networks are popular in real-life complex systems. In the past few decades, researchers presented amounts of small-world models, in which some are stochastic and the rest are deterministic. In comparison with random models, it is not only convenient but also interesting to study the topological properties of deterministic models in some fields, such as graph theory, theorem computer sciences and so on. As another concerned darling in current researches, community structure (modular topology) is referred to as an useful statistical parameter to uncover the operating functions of network. So, building and studying such models with community structure and small-world character will be a demanded task. Hence, in this article, we build a family of sparse network space N(t) which is different from those previous deterministic models. Even though, our models are established in the same way as them, iterative generation. By randomly connecting manner in each time step, every resulting member in N(t) has no absolutely self-similar feature widely shared in a large number of previous models. This makes our insight not into discussing a class certain model, but into investigating a group various ones spanning a network space. Somewhat surprisingly, our results prove all members of N(t) to possess some similar characters: (a) sparsity, (b) exponential-scale feature P(k) ∼α-k, and (c) small-world property. Here, we must stress a very screming, but intriguing, phenomenon that the difference of average path length (APL) between any two members in N(t) is quite small, which indicates this random connecting way among members has no great effect on APL. At the end of this article, as a new topological parameter correlated to reliability, synchronization capability and diffusion properties of networks, the number of spanning trees on a representative member NB(t) of N(t) is studied in detail, then an exact analytical solution for its spanning trees entropy is also

  17. Can mt2 much-gt mb2 arise from small corrections in four-family models

    International Nuclear Information System (INIS)

    Mendel, R.R.; Margolis, B.; Therrien, E.; Valin, P.

    1989-01-01

    This paper proposes a general dynamical scheme capable of explaining naturally the main properties of the observed spectrum, namely the strong inter-family mass hierarchies and the mixing pattern. The authors illustrate these properties in the three-family case with a simple toy model. There is an indication that large values of m t may be required in order to obtain |V by |much-lt|V bc ; the fact the m 2 much-gt m 2 could be due to small corrections in a four-family model where m' ∼ m'. The authors point out possible natural explanations for the small mass of the e, μ and τ neutrinos in the three and four family cases

  18. The assessment of the family vision generation process in small and ...

    African Journals Online (AJOL)

    61.93% of the variance, describing the theoretical dimensions of the generation of ... the core values, family business philosophies and a family vision. ... formulation, is the development of the family business continuity plan. This plan ... In the study of family businesses, one of the first tasks is to determine what is meant by ...

  19. Challenges in the care for consanguineous couples: an exploratory interview study among general practitioners and midwives

    Directory of Open Access Journals (Sweden)

    Teeuw Marieke E

    2012-10-01

    Full Text Available Abstract Background It is often suggested that an effort must be made to increase awareness among consanguineous couples of their reproductive risk, and to refer them for genetic counseling if needed. Primary care professionals are considered most appropriate for addressing the subject and identifying couples at risk during consultations in their practice. This Dutch study aims to explore the experiences, attitudes and beliefs of such professionals regarding their care for consanguineous couples. Methods Sixteen semi-structured interviews were conducted with midwives and general practitioners. Results Although most primary care professionals considered it their task to inform couples about the risks of consanguinity, during consultations the topic was generally only briefly touched upon and quickly abandoned. Important reasons for this were professionals’ beliefs about religious and social values of couples, their low perception of the couples’ reproductive risk and expected limited feasibility of referral. Feelings of embarrassment regarding addressing consanguinity did not seem to play a significant role. Conclusions Primary care professional beliefs about their clients’ religious and social values, their attitudes toward the risk, and perceived limited options for referral seem to conflict with the professional norm to address the topic of consanguinity.

  20. The decline in consanguineous marriage among Muslims in Israel: The role of education

    Directory of Open Access Journals (Sweden)

    Jona Schellekens

    2017-12-01

    Full Text Available Background: There are two explanations for the inverse relationship between consanguinity and women's education. The female empowerment hypothesis posits that better-educated women will demand more freedom in choosing a marriage partner, whereas the role incompatibility hypothesis posits that school enrollment may prevent women from fulfilling spousal obligations. Objective: This article presents estimates of the relative contributions of school enrolment and educational attainment to the decline in consanguineous marriage. Methods: Our data comes from three rounds of the Palestinians in Israel Socio-Economic Survey. Using multinomial logistic regression analysis, we estimated discrete-time event history models to assess the effects of education on the probability of a consanguineous marriage. To test the two hypotheses we constructed two distinct education vectors for each woman from information on the number of years of schooling. The first charts yearly enrolment in education, whereas the second vector reflects actual attainment in each year. Results: Between 1975‒1979 and 2005‒2010, consanguineous marriage declined by almost 60Š. The rise in the age of leaving school explains about a third of the decline. Educational attainment did not contribute to the decline. Contribution: To the best of our knowledge, this is the first study to present estimates of the relative contributions of school enrolment and educational attainment to the decline in consanguineous marriage.

  1. CONSANGUINEOUS MARRIAGES AMONG IRANIAN MANDAEANS LIVING IN SOUTH-WEST IRAN.

    Science.gov (United States)

    Saadat, Mostafa; Zarghami, Mahdis

    2018-07-01

    SummarySeveral studies have indicated that consanguineous marriages (unions between biologically related persons) are associated with increased risk of autosomal recessive diseases and several multifactorial traits. Mandaeans are a closed ethno-religious community living in areas of southern Iraq and Iran (Khuzestan Province). There are currently no data on the prevalence of consanguineous marriages among Mandaeans. The present study was carried out in 2016 to determine the prevalence of consanguinity among Iranian Mandaeans living in Khuzestan Province, south-west Iran. A total of 137 couples (urban areas: 79 couples; rural areas: 58 couples) were included in the study. Information on the consanguineous marriages of the subjects was collected through direct interviews. Marriages were classified by the degree of relationship between couples as double first cousins, first cousins, first cousin once removed, second cousins and unrelated marriages. The coefficient of inbreeding (F) was calculated for each couple and the mean coefficient of inbreeding (α) estimated for the population, stratified by rural and urban areas. The overall frequency of consanguinity was found to be 50.7% in urban and 86.2% in rural areas. There was a significant difference between rural and urban areas in types of marriages (χ 2=24.8, df=4, p<0.001) and first cousin marriages (51.8%) were the most common type. The overall α-value was estimated to be 0.0363 for the Iranian Mandaean population.

  2. Loss-of-function mutations in the thyrotropin receptor gene as a major determinant of hyperthyrotropinemia in a consanguineous community.

    Science.gov (United States)

    Tenenbaum-Rakover, Yardena; Grasberger, Helmut; Mamanasiri, Sunee; Ringkananont, Usanee; Montanelli, Lucia; Barkoff, Marla S; Dahood, Ahmad Mahameed-Hag; Refetoff, Samuel

    2009-05-01

    Resistance to TSH (RTSH) is a condition of impaired responsiveness of the thyroid gland to TSH, characterized by elevated serum TSH, low or normal thyroid hormone levels, and hypoplastic or normal-sized thyroid gland. The aim of the study was to evaluate the clinical course and the genotype-phenotype relationship of RTSH caused by two different TSH receptor (TSHR) gene mutations in a consanguineous population. We conducted a clinical and genetic investigation of 46 members of an extended family and 163 individuals living in the same town. In vitro functional studies of the mutant TSHRs were also performed. Two TSHR gene mutations (P68S and L653V) were identified in 33 subjects occurring as homozygous L653V (five subjects), heterozygous L653V (20 subjects), heterozygous P68S (four subjects), and compound heterozygous L653V/P68S (four subjects). With the exception of one individual with concomitant autoimmune thyroid disease, all homozygotes and compound heterozygotes presented with compensated RTSH (high TSH with free T(4) and T(3) in the normal range). Only nine of 24 heterozygotes had mild hyperthyrotropinemia. The L653V mutation resulted in a higher serum TSH concentration and showed a more severe in vitro abnormality than P68S. Haplotype analysis predicted a founder of the L653V six to seven generations earlier, whereas the P68S is older. Cross-sectional and prospective longitudinal studies indicate that TSH and T(4) concentrations remain stable over time. High frequency hyperthyrotropinemia in an Israeli Arab-Muslim consanguineous community is attributed to two inactivating TSHR gene mutations. Concordant genotype-phenotype was demonstrated clinically and by in vitro functional analysis. Retrospective and prospective studies indicate that in the absence of concomitant autoimmune thyroid disease, elevated TSH levels reflect stable compensated RTSH.

  3. An empirical analysis of the effects of consanguineous marriages on economic development.

    Science.gov (United States)

    Bildirici, Melike; Kökdener, Meltem; Ersin, Oezgür ömer

    2010-01-01

    In this study, development experiences toward economic development are investigated to provide an alternative analysis of economic development, human capital, and genetic inheritance in the light of consanguineous marriages. The countries analyzed in the study are discussed in accordance with consanguineous marriage practices and classified by their per capita gross domestic product (GDP) growth. A broad range of countries are analyzed in the study. Arab countries that experienced high rates of growth in their gross national income during the twentieth century but failed to fulfill adequate development measures as reflected in the growth in national income, countries undergoing transition from tight government regulation to free market democracy, and African nations that have experienced complications in the process of development show important differences in the process of economic development. It is shown that the countries that have reached high average development within the context of per capita GDP have overcome problems integral to consanguineous marriage.

  4. Senior-Loken syndrome: A novel NPHP5 gene mutation in a family from Kuwait

    Directory of Open Access Journals (Sweden)

    Makia J Marafie

    2014-04-01

    Conclusion: Identification of this pathogenic mutation helped in confirmation of the clinical diagnosis and in providing a proper pre-marital genetic counselling and testing for a couple embarking on marriage from this highly consanguineous high-risk family.

  5. Inbreeding coefficients and degree of consanguineous marriages in Spain: a review.

    Science.gov (United States)

    Fuster, Vicente; Colantonio, Sonia Edith

    2003-01-01

    The contribution of consanguineous marriages corresponding to uncle-niece or aunt-nephew (C12), first cousin (C22), first cousin once removed (C23), and second cousin (C33) to the inbreeding coefficient (alpha) was analyzed from a sample of Spanish areas and periods. Multiple regressions were performed taking as independent variables the different degrees of consanguinity previously selected (C12, C22, C23, and C33) and as dependent variable the inbreeding coefficient (alpha). According to the results obtained for any degree and period, rural frequencies always surpass urban. However, the pattern is similar in both areas. In the period where consanguinity was more elevated (1890-1929) the C22/C33 ratio increased. Its variation is not due to C22 and C33 changes in the same way. In rural areas, this ratio surpasses the expected value by a factor of 2-3, but in urban areas it was 7-10 times larger, in some cases due to migration. While in rural Spain the C33 frequency was approximately 1.5 times C22, in cities C22 was 1.5 times C33. The best fit among the various types of consanguineous matings and alpha involves a lineal relationship. Regardless of the number of variables contributing significantly to alpha, C22 matings are always present. Moreover, their standardized (beta) coefficients are the highest. The above indicates that this consanguineous relationship conditions the inbreeding coefficient the most. In the period of greater consanguinity, close relationships, uncle-niece C12, and first cousin once removed (C23) make a significant contribution to alpha. In rural Spain second cousins (C33) always significantly determined alpha; however, in cities the inbreeding variation was mainly due to C12 and C23. Copyright 2003 Wiley-Liss, Inc.

  6. Consanguinity Ratio in Beta-Thalassemia Major Patients in District Bannu

    International Nuclear Information System (INIS)

    Khan, M. S.; Ahmed, M.; Khan, R. A.; Mushtaq, N.; Shah, M. W. U.

    2015-01-01

    Objective: To assess the frequency of consanguinity in b-thalassemia major patients and its association with age, gender and hepatitis C virus antibody positivity. Methods: The cross-sectional study was conducted from June 2013 to July 2014 at various hospitals of district Bannu in the North Western Khyber Pakhtunkhwa province of Pakistan. Data was recorded on a predesigned questionnaire. Results: Out of 180 subjects, 133(74 percent) parents were cousins, while 47(26 percent) were unrelated. The frequency of anti-hepatitis C virus antibody positivity was 14(7.77 percent). Conclusion: High prevalence of the disease in the study region was due to consanguineous marriages. (author)

  7. Application of a high-throughput genotyping method for loci exclusion in non-consanguineous Australian pedigrees with autosomal recessive retinitis pigmentosa.

    Science.gov (United States)

    Paterson, Rachel L; De Roach, John N; McLaren, Terri L; Hewitt, Alex W; Hoffmann, Ling; Lamey, Tina M

    2012-01-01

    Retinitis pigmentosa (RP) is the most common form of inherited blindness, caused by progressive degeneration of photoreceptor cells in the retina, and affects approximately 1 in 3,000 people. Over the past decade, significant progress has been made in gene therapy for RP and related diseases, making genetic characterization increasingly important. Recently, high-throughput technologies have provided an option for reasonably fast, cost-effective genetic characterization of autosomal recessive RP (arRP). The current study used a single nucleotide polymorphism (SNP) genotyping method to exclude up to 28 possible disease-causing genes in 31 non-consanguineous Australian families affected by arRP. DNA samples were collected from 59 individuals affected with arRP and 74 unaffected family members from 31 Australian families. Five to six SNPs were genotyped for 28 genes known to cause arRP or the related disease Leber congenital amaurosis (LCA). Cosegregation analyses were used to exclude possible causative genes from each of the 31 families. Bidirectional sequencing was used to identify disease-causing mutations in prioritized genes that were not excluded with cosegregation analyses. Two families were excluded from analysis due to identification of false paternity. An average of 28.9% of genes were excluded per family when only one affected individual was available, in contrast to an average of 71.4% or 89.8% of genes when either two, or three or more affected individuals were analyzed, respectively. A statistically significant relationship between the proportion of genes excluded and the number of affected individuals analyzed was identified using a multivariate regression model (pA) and USH2A in two families (c.2276 G>T). This study has shown that SNP genotyping cosegregation analysis can be successfully used to refine and expedite the genetic characterization of arRP in a non-consanguineous population; however, this method is effective only when DNA samples are

  8. Service Family Support -- A Small-Scale Project of Educational Psychologists Working with Parents

    Science.gov (United States)

    Hogg, Jane; Hart, Anne; Collins, Zoe V.

    2014-01-01

    Being in a Service family can be a difficult position for children and parents alike due to high levels of mobility, parental separation, and the remaining parent's stress and emotional well-being. A Service family is defined as a family with one or both parents employed by the Ministry of Defence (MOD). The current project looked at the…

  9. Contribution of family labour to the profitability and competitiveness of small-scale dairy production systems in central Mexico.

    Science.gov (United States)

    Posadas-Domínguez, Rodolfo Rogelio; Arriaga-Jordán, Carlos Manuel; Martínez-Castañeda, Francisco Ernesto

    2014-01-01

    The objective of this work was to determine the effect of family labour on the profitability and competitiveness of small-scale dairy farms in the highlands of Central Mexico. Economic data from 37 farms were analysed from a stratified statistical sampling with a Neyman assignment. Three strata were defined taking herd size as criterion. Stratum 1: herds from 3 to 9 cows plus replacements, Stratum 2: herds from 10 to 19 cows and Stratum 3: herds from 20 to 30 cows. The policy analysis matrix was used as the method to determine profitability and competitiveness. The coefficient of private profitability (CPP) when the economic cost of family labour is included in the cost structure was 8.0 %, 31.0 % and 46.0 %. When the economic cost of family labour is not included, CPP increase to 47.0 %, 57.0 % and 66.0 % for each strata, respectively. The private cost ratio (PCR) when family labour is included was 0.79, 0.51 and 0.42 for strata 1, 2 and 3, respectively. When family labour is not included, the PCR was 0.07, 0.25 and 0.26. Net profit per litre of milk including family labour was US$0.03 l(-1) for Stratum 1, US$0.09 for Stratum 2 and US$0.12 l(-1) for Stratum 3; but increased to $0.12, 0.14 and 0.15, respectively, when the economic cost of family labour is not included. It is concluded that family labour is a crucial factor in the profitability and competitiveness of small-scale dairy production.

  10. Prevalence of consanguineous marriages among shi'a populations of Lebanon.

    Science.gov (United States)

    El-Kheshen, Ghadir; Saadat, Mostafa

    2013-09-01

    In genetics, a consanguineous marriage means union between couples who are related as second cousins or closer. The present cross-sectional study was carried out in order to illustrate the prevalence and types of consanguineous marriages in the Shi'a population living in widespread territories in Lebanon including the Bekaa Valley, the south of Lebanon and the southern suburb of Beirut. Data on types of marriages were collected using a simple questionnaire. The total number of couples in the study was 1203. Consanguineous marriage was classified by the degree of relationship between couples. The overall frequency of consanguinity was found to be 28.4%, with first cousin marriages (21.3%) being the most common type followed by first cousins once removed (5.5%), then double first cousins (0.8%). The frequencies of second cousin and beyond second cousin marriages were the same at 0.4% of all the marriages. The mean inbreeding coefficient (α) was estimated at about 0.0161 for the population. There were no significant differences between the three studied territories for frequencies of different types of marriages (p>0.1), nor were there significant differences between the rural and urban areas (p>0.1).

  11. Prevalence and characteristics of non-syndromic orofacial clefts and the influence of consanguinity.

    Science.gov (United States)

    Alamoudi, N M; Sabbagh, H J; Innes, N P T; El Derwi, D; Hanno, A Z; Al-Aama, J Y; Habiballah, A H; Mossey, P A

    2014-01-01

    The Objective of this study was to identify the prevalence and describe the characteristics of non-syndromic orofacial cleft (NSOFC) in Jeddah, Saudi Arabia and examine the influence of consanguinity. Six hospitals were selected to represent Jeddah's five municipal districts. New born infants with NSOFC born between 1st of January 2010 to 31st of December 2011 were clinically examined and their number compared to the total number of infants born in these hospitals to calculate the prevalence of NSOFC types and sub-phenotypes. Referred Infants were included for the purpose of studying NSOFC characteristics and their relationship to consanguinity. Information on NSOFC infants was gathered through parents' interviews, infants 'files and patient examinations. Prospective surveillance of births resulted in identifying 37 NSOFC infants born between 1st of January 2010 to 31st of December 2011 giving a birth prevalence of 0.80/1000 living births. The total infants seen, including referred cases, were 79 children. Consanguinity among parents of cleft palate (CP) cases was statistically higher than that among cleft lip with or without cleft palate (CL/P) patients (P = 0.039). Although there appears to be a trend in the relationship between consanguinity and severity of CL/P sub-phenotype, it was not statistically significant (P = 0.248). Birth prevalence of NSOFC in Jeddah City was 0.8/1000 live births with CL/P: 0.68/1000 and CP: 0.13/1000. Both figures were low compared to the global birth prevalence (NSOFC: 1.25/1000, CL/P: 0.94/1000 and CP: 0.31/1000 live births). Consanguineous parents were statistically higher among CP cases than among other NSOFC phenotypes.

  12. Pre-marital genetic counselling to consanguineous couples: attitudes, beliefs and decisions among counselled, noncounselled and unrelated couples in Israel.

    Science.gov (United States)

    Shiloh, S; Reznik, H; Bat-Miriam-Katznelson, M; Goldman, B

    1995-11-01

    Semi-structured interviews were conducted with 65 Israeli subjects who received genetic counselling while considering marriage to a close relative, 40 subjects married to a close relative who did not receive pre-marital genetic counselling, and 125 controls married to a nonrelative and never having considered marrying a relative. It was found that 72% of the consanguineous couples who received pre-marital genetic counselling proceeded with their plans and married their relative; 86% of them reported that the counselling influenced their final decision to some degree. Counsellees' appraisals of genetic counselling revealed unfulfilled expectations to obtain more definitive answers, and mixed reactions to the nondirective approach applied by the counsellors. Comparisons between consanguineous and control couples revealed different views about consanguinity in general, and genetic risks in particular. Consanguineous couples, unlike controls, perceived consanguinity as an ordinary form of marriage, and had more favorable attitudes towards it. Compared to the noncounselled consanguineous group, consanguineous couples who received pre-marital genetic counselling had fewer children, estimated their genetic risk as lower but its subjective significance as higher, and perceived genetic disorders as more severe. The implications of these results are discussed from both theoretical and practical standpoints.

  13. Consanguineous marriage in an urban area of Saudi Arabia: rates and adverse health effects on the offspring.

    Science.gov (United States)

    al-Abdulkareem, A A; Ballal, S G

    1998-02-01

    The objective of this cross-sectional study was to determine the pattern and time trend of consanguineous marriage and its adverse health effects on the offspring in Dammam city, Eastern Province, in the Kingdom of Saudi Arabia. This city is known to attract Saudis from different parts of the country because it is in the heart of this industrial region. Five primary health care centers were randomly selected from different sectors of the city in addition to the city's only Maternity and Children's Hospital. For inclusion in the study a wife must have at least one pregnancy that terminated in either full term liveborn baby, still birth, or abortion. A total of 1307 ever-married Saudis completed a pre-structured questionnaire during an interview. The rate of consanguineous marriage was 52.0% with an average inbreeding coefficient of 0.0312. First-cousin marriages were the commonest (39.3%) of all matings. The consanguineous groups had a significantly higher number of pregnancies. The mean birth weight of the offspring of consanguineous couples was not statistically significant being less than that of the non-consanguineous. However, within the consanguineous groups the more closely related couples had smaller babies on average. No significant differences were noted for the rates of inherited diseases and reproductive wastage. The rate of consanguineous marriage in this city was high and so was the inbreeding coefficient. These figures place this nation among the countries with a high rate of consanguineous marriages. A nationwide study to determine accurately the relationship between consanguinity and inherited diseases has much to commend it.

  14. Detection of the YORP effect for small asteroids in the Karin family

    Science.gov (United States)

    Nesvorny, David; Carruba, Valerio; Vokrouhlicky, David

    2016-10-01

    The Karin family formed by a collisional breakup of a ~40-km parent asteroid only 5.75 Myr ago. The young age can be demonstrated by numerically integrating the orbits of Karin family members backward in time and showing the convergence of orbital elements. Previous work has pointed out that the convergence is not ideal if the backward integration only accounts for the gravitational perturbations from the Solar System planets. It improves when the thermal radiation force known as the Yarkovsky effect is accounted for. This method can be used to estimate the spin obliquities of Karin family members. Here we show that the obliquity distribution of diameter D=1-2 km asteroids in the Karin family is bimodal, as expected if the YORP effect acted to move obliquities toward extreme values (0 or 180 deg). The measured magnitude of the effect is consistent with the standard YORP model. Specifically, the strength of the YORP effect is inferred to be roughly 70% of the nominal YORP strength obtained for a collection of random Gaussian spheroids. The surface thermal conductivity is found to be 0.07-0.2 W/m/K (thermal inertia 300-500 in the SI units). These results are consistent with surfaces composed of rough and rocky regolith. The obliquity values predicted here for 480 members of the Karin cluster can be validated by the lightcurve inversion method. In broader context, the bimodal distribution of obliquities in the Karin cluster can be thought as an initial stage of dynamical evolution that later leads to a characteristically bi-lobed distribution of family members in the semimajor axis (e.g., Eos, Merxia or Erigone families).

  15. Evasion of CO2 and dissolved carbon in river waters of three small catchments in an area occupied by small family farms in the eastern Amazon

    Directory of Open Access Journals (Sweden)

    Maria Beatriz Silva da Rosa

    2017-08-01

    Full Text Available CO2 effluxes from streams and rivers have been hypothesized to be a critical pathway of carbon flow from the biosphere back to the atmosphere. This study was conducted in three small Amazonian catchments to evaluate carbon evasion and dynamics, where land-use change has occurred on small family-farms. Monthly field campaigns were conducted from June 2006 to May 2007 in the Cumaru (CM, Pachibá (PB and São João (SJ streams. Electrical conductivity, pH, temperature, and dissolved oxygen measurements were done in situ, while water samples were collected to determine dissolved organic carbon (DOC and dissolved inorganic carbon (DIC concentrations, as well as carbon dioxide partial pressures (pCO2 and CO2 evasion fluxes. Instantaneous discharge measured by a current meter was used to calculate DOC fluxes. Considering all the sites, DOC, DIC, pCO2, and CO2 flux measurements ranged as follows, respectively: 0.27 - 12.13 mg L-1; 3.5 - 38.9 mg L-1; 2,265 - 26,974 ppm; and 3.39 - 75.35 μmol m-2 s-1. DOC annual flux estimates for CM, SJ and PB were, respectively, 281, 245, and 169 kg C ha-1. CO2 evasion fluxes had an average of 22.70 ± 1.67 μmol m-2 s-1. These CO2 evasion fluxes per unit area were similar to those measured for major Amazonian rivers, thus confirming our hypothesis that small streams can evade substantial quantities of CO2. As secondary vegetation is abundant as a result of family farming management in the region, we conclude that this vegetation can be a major driver of an abundant carbon cycle.

  16. Family Involvement in Creative Teaching Practices for All in Small Rural Schools

    Science.gov (United States)

    Vigo Arrazola, Begoña; Soriano Bozalongo, Juana

    2015-01-01

    Parental involvement is interpreted as a key form of support that can contribute to the establishment of inclusive practices in schools, but this can be difficult in sparsely populated areas. Using ethnographic methods of participant observation, informal conversations and document analysis, this article therefore focuses on family involvement…

  17. CONSANGUINITY, GENETICS AND DEFINITIONS OF KINSHIP IN THE UK PAKISTANI POPULATION.

    Science.gov (United States)

    Bittles, A H; Small, N A

    2016-11-01

    Consanguineous marriage is a controversial topic in many Western societies, with attention mainly focused on the health of immigrant communities from Asia and Africa. In the UK consanguinity is especially prevalent in the Pakistani community, which now numbers over 1.1 million. Less attention has been paid to the influence of hereditary population stratification within Pakistani communities, in particular biraderi (literally brotherhood) membership, which denotes male lineages that largely govern marriage partner choice and hence the transmission of disease genes. The various roles played by biraderi and their relationship to other socio-occupational and kinship terms, such as caste, quom and zat, are often overlooked in health-based studies. The interchangeable use of these different kinship terms without rigorous definition can create identity uncertainty and hinders inter-study comparisons. Where feasible, standardization of terminology would be both desirable and beneficial, with biraderi the preferred default term to identify specific social and genetic relationships within the Pakistani diaspora.

  18. The Effect of Consanguineous Marriage on Mental Health among the Students of the Shahrekord University of Medical Sciences.

    Science.gov (United States)

    Hosseinpour, Maryam; Deris, Fatemeh; Solati-Dehkordi, Kamal; Heidari-Soreshjani, Sheida; Karimi, Negar; Teimori, Hossein

    2016-11-01

    In Iran, after unintentional accidents, mental health problems are the second leading burden of disease. Consanguineous marriage is very common in Iran and the association between parental consanguinity and mental health is an important issue that has not yet been studied sufficiently in Iran. To investigate the effect of consanguinity and the degree of relationship on different levels of mental health. In this cross-sectional study, conducted in the Shahrekord University of Medical Sciences, two groups of students were enrolled. The first group consisted of 156 students that had consanguineous parent (case group) and the second group was 156 students whose parents had non-blood relationship (control group). The students were evaluated using General Health Questionnaire (GHQ-28). Statistical analysis was conducted by Pearson's correlation coefficient, independent t-test and the one-way analysis of variance. Odd ratio was used to estimate the relative risk. Over 30% of the individuals were suffering from mental health problems. The most and least common mental health problems in both groups were social dysfunction (54.5% in the case group and the control group 50%) and depression (15.4% in the case group and 17.3% in the control group), respectively. No statistically significant difference was observed in the frequency of overall mental health and its subscales between student with non-consanguineous parent (control group) and the students that had consanguineous parent (case group) (p>0.05) and the status of mental health was not significantly different among student with different degree of kinship (p>0.05). The study revealed that social dysfunction was very common among the study students and also there were no relationship between parental consanguineous marriage and mental health. Parental consanguinity and genetic factors may not be the major causes of high prevalence of mental health problems in Iran and the effects of the environmental factors on these

  19. The impact of consanguinity on the frequency of inborn errors of metabolism

    DEFF Research Database (Denmark)

    Afzal, Raja Majid; Lund, Allan Meldgaard; Skovby, Flemming

    2018-01-01

    for selected IEM with autosomal recessive mode of inheritance, a national screening program of newborns covering the period from 2002 until April 2017. Among the 838,675 newborns from Denmark, the Faroe Islands and Greenland, a total of 196 newborns had an IEM of whom 155 from Denmark were included...... children. The data indicate a strong association between consanguinity and IEM. These figures could be useful to health professionals providing antenatal, pediatric, and clinical genetic services....

  20. The relationship between consanguineous marriage and death in fetus and infants

    OpenAIRE

    Mohammadi, Majid Mehr; Hooman, Heidar Ali; Afrooz, Gholam Ali; Daramadi, Parviz Sharifi

    2012-01-01

    Background: Given the high prevalence of consanguineous marriages in rural and urban areas of Iran, the aim of this study was to identify its role in increasing fetal and infant deaths. Materials ans Methods : This was a cross-sectional study in which 494 mothers with more than one exceptional child (mentally retarded and physically-dynamically disabled) or with normal children were selected based on multi-stage random sampling method. Data was gathered using the features of parents with more...

  1. A novel NDUFV1 gene mutation in complex I deficiency in consanguineous siblings with brainstem lesions and Leigh syndrome.

    Science.gov (United States)

    Vilain, C; Rens, C; Aeby, A; Balériaux, D; Van Bogaert, P; Remiche, G; Smet, J; Van Coster, R; Abramowicz, M; Pirson, I

    2012-09-01

    Although deficiency of complex I of the mitochondrial respiratory chain is a frequent cause of encephalopathy in children, only a few mutations have been reported in each of its subunits. In the absence of families large enough for conclusive segregation analysis and of robust functional testing, it is difficult to unequivocally show the causality of the observed mutations and to delineate genotype-phenotype correlations, making additional observations necessary. We observed two consanguineous siblings with an early-onset encephalopathy, medulla, brainstem and mesencephalon lesions on brain magnetic resonance imaging and death before 8 months of age, caused by a complex I deficiency. We used a homozygosity mapping approach and identified a missense mutation in the NDUFV1 gene. The mutation, p.Arg386His, affects a highly conserved residue, contiguous to a cysteine residue known to coordinate an Fe ion. This observation adds to our understanding of complex I deficiency disease. It validates the important role of Arg386 and therefore supports the current molecular model of iron-sulfur clusters in NDUFV1. © 2011 John Wiley & Sons A/S.

  2. Screening for homozygosity by descent in families with autosomal

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 81; Issue 2 ... Perspectives Volume 81 Issue 2 August 2002 pp 59-63 ... disease locus in families with the recessive form of the disease, we used the approach of screening for homozygosity by descent in offspring of consanguineous and nonconsanguineous families with RP.

  3. ASSESSMENT OF KNOWLEDGE, ATTITUDE AND PRACTICE TOWARDS CONSANGUINEOUS MARRIAGES AMONG A COHORT OF MULTIETHNIC HEALTH CARE PROVIDERS IN SAUDI ARABIA.

    Science.gov (United States)

    Alnaqeb, Dhekra; Hamamy, Hanan; Youssef, Amira M; Al-Rubeaan, Khalid

    2018-01-01

    This study aimed to assess knowledge, attitude and practice related to consanguinity among multiethnic health care providers in the Kingdom of Saudi Arabia. Using a cross-sectional study design, a validated, self-administered close-ended questionnaire was randomly distributed to health care providers in different health institutions in the country between 1st August 2012 and 31st July 2013. A total of 1235 health care providers completed the study questionnaire. Of the 892 married participants (72.23% of total), 11.43% were married to a first cousin, and were predominantly Arabs, younger than 40 years and male. Only 17.80% of the patients seen by the health care providers requested consanguinity related counselling. A knowledge barrier was expressed by 27.49% of the participants, and 85.67% indicated their willingness to have more training in basic genetic counselling. A language barrier was expressed as a limiting factor to counselling for consanguinity among non-Arabs. The health care providers had a major dearth of knowledge that was reflected in their attitude and practice towards consanguinity counselling. This finding indicates the need for more undergraduate and postgraduate medical and nursing education and training in the counselling of consanguineous couples. It is recommended that consanguinity counselling is included in the current premarital screening and counselling programmes in the Kingdom.

  4. The risk ratio for development of hereditary sensorineural hearing loss in consanguineous marriage offspring.

    Science.gov (United States)

    Sanyelbhaa, Hossam; Kabel, Abdelmagied; Abo El-Naga, Heba Abd El-Rehem; Sanyelbhaa, Ahmed; Salem, Hatem

    2017-10-01

    This study aims to define the relative risk of development of hearing loss in offspring of consanguineous marriages. This is a retrospective case-control study conducted in a tertiary referral center in Jeddah, KSA. The study group included 1600 probands (848 males, 752 females), with age range 0.5-12 years (6.6 ± 3.6). The study group comprised of two equal, age and sex matched subgroups; Hearing Loss (HL) group and Normal Hearing (NH) group. The children included in the HL group should have idiopathic or non syndromic genetic sensorineural hearing loss. The HL Group comprised 800 children with variable degrees of sensorineural hearing loss. Profound and severe degrees of hearing loss were the most prevalent degrees (P marriage offspring in the NH group was 42.5%, while in the HL group it was 68.9% (P  0.05). The relative risk and 95% confidence interval (RR, 95% CI) for development of hearing loss in offspring of consanguineous marriage was 1.76 (95% CI 1.57-1.97, P marriage progeny to develop SNHL when compared to non consanguineous progeny. Copyright © 2017. Published by Elsevier B.V.

  5. Interconversion of two GDP-bound conformations and their selection in an Arf-family small G protein.

    Science.gov (United States)

    Okamura, Hideyasu; Nishikiori, Masaki; Xiang, Hongyu; Ishikawa, Masayuki; Katoh, Etsuko

    2011-07-13

    ADP-ribosylation factor (Arf) and other Arf-family small G proteins participate in many cellular functions via their characteristic GTP/GDP conformational cycles, during which a nucleotide(∗)Mg(2+)-binding site communicates with a remote N-terminal helix. However, the conformational interplay between the nucleotides, the helix, the protein core, and Mg(2+) has not been fully delineated. Herein, we report a study of the dynamics of an Arf-family protein, Arl8, under various conditions by means of NMR relaxation spectroscopy. The data indicated that, when GDP is bound, the protein core, which does not include the N-terminal helix, reversibly transition between an Arf-family GDP form and another conformation that resembles the Arf-family GTP form. Additionally, we found that the N-terminal helix and Mg(2+), respectively, stabilize the aforementioned former and latter conformations in a population-shift manner. Given the dynamics of the conformational changes, we can describe the Arl8 GTP/GDP cycle in terms of an energy diagram. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Comparative phylogenetic and expression analysis of small GTPases families in legume and non-legume plants.

    Science.gov (United States)

    Flores, Ana Claudia; Via, Virginia Dalla; Savy, Virginia; Villagra, Ulises Mancini; Zanetti, María Eugenia; Blanco, Flavio

    2018-02-01

    Small monomeric GTPases act as molecular switches in several processes that involve polar cell growth, participating mainly in vesicle trafficking and cytoskeleton rearrangements. This gene superfamily has largely expanded in plants through evolution as compared with other Kingdoms, leading to the suggestion that members of each subfamily might have acquired new functions associated to plant-specific processes. Legume plants engage in a nitrogen-fixing symbiotic interaction with rhizobia in a process that involves polar growth processes associated with the infection throughout the root hair. To get insight into the evolution of small GTPases associated with this process, we use a comparative genomic approach to establish differences in the Ras GTPase superfamily between legume and non-legume plants. Phylogenetic analyses did not show clear differences in the organization of the different subfamilies of small GTPases between plants that engage or not in nodule symbiosis. Protein alignments revealed a strong conservation at the sequence level of small GTPases previously linked to nodulation by functional genetics. Interestingly, one Rab and three Rop proteins showed conserved amino acid substitutions in legumes, but these changes do not alter the predicted conformational structure of these proteins. Although the steady-state levels of most small GTPases do not change in response to rhizobia, we identified a subset of Rab, Rop and Arf genes whose transcript levels are modulated during the symbiotic interaction, including their spatial distribution along the indeterminate nodule. This study provides a comprehensive study of the small GTPase superfamily in several plant species. The genetic program associated to root nodule symbiosis includes small GTPases to fulfill specific functions during infection and formation of the symbiosomes. These GTPases seems to have been recruited from members that were already present in common ancestors with plants as distant as monocots

  7. How a Small Family of Yeast IDPs Control Complicated Processes Related to DNA Replication

    DEFF Research Database (Denmark)

    Marabini, Riccardo

    Ribonucleotide reductase (RNR) and proliferating cell nuclear antigen (PCNA) are two essential proteins involved in DNA replication. RNR catalyzes the last and rate limiting step of the deoxyribonucleotide biosynthetic pathway. The dysregulation of RNR has been related to higher mutation rate...... characterized in budding and fission yeast. Within this protein family Dif1 (from S. cerevisiae) and Spd1 (from S. pombe) were analyzed in this study. These proteins were previously found to interact with and regulate the activity of RNR and Spd1 was also linked to PCNA dependent signaling for degradation...

  8. New Opportunitie s for Small Satellite Programs Provided by the Falcon Family of Launch Vehicles

    Science.gov (United States)

    Dinardi, A.; Bjelde, B.; Insprucker, J.

    2008-08-01

    The Falcon family of launch vehicles, developed by Space Exploration Technologies Corporation (SpaceX), are designed to provide the world's lowest cost access to orbit. Highly reliable, low cost launch services offer considerable opportunities for risk reduction throughout the life cycle of satellite programs. The significantly lower costs of Falcon 1 and Falcon 9 as compared with other similar-class launch vehicles results in a number of new business case opportunities; which in turn presents the possibility for a paradigm shift in how the satellite industry thinks about launch services.

  9. Localization of A Novel Autosomal Recessive Non-Syndromic Hearing Impairment Locus (DFNB38) to 6q26–q27 in a Consanguineous Kindred from Pakistan

    Science.gov (United States)

    Ansar, Muhammad; Ramzan, Mohammad; Pham, Thanh L.; Yan, Kai; Jamal, Syed Muhammad; Haque, Sayedul; Ahmad, Wasim; Leal, Suzanne M.

    2010-01-01

    For autosomal recessive nonsyndromic hearing impairment over 30 loci have been mapped and 19 genes have been identified. DFNB38, a novel locus for autosomal recessive nonsyndromic hearing impairment, was localized in a consanguineous Pakistani kindred to 6q26–q27. The affected family members present with profound prelingual sensorineural hearing impairment and use sign language for communications. Linkage was established to microsatellite markers located on chromosome 6q26–q27 (Multipoint lod score 3.6). The genetic region for DFNB38 spans 10.1 cM according to the Marshfield genetic map and is bounded by markers D6S980 and D6S1719. This genetic region corresponds to 3.4 MB on the sequence-based physical map. PMID:12890929

  10. Genetic heterogeneity and consanguinity lead to a "double hit": homozygous mutations of MYO7A and PDE6B in a patient with retinitis pigmentosa.

    Science.gov (United States)

    Goldenberg-Cohen, Nitza; Banin, Eyal; Zalzstein, Yael; Cohen, Ben; Rotenstreich, Ygal; Rizel, Leah; Basel-Vanagaite, Lina; Ben-Yosef, Tamar

    2013-01-01

    Retinitis pigmentosa (RP), the most genetically heterogeneous disorder in humans, actually represents a group of pigmentary retinopathies characterized by night blindness followed by visual-field loss. RP can appear as either syndromic or nonsyndromic. One of the most common forms of syndromic RP is Usher syndrome, characterized by the combination of RP, hearing loss, and vestibular dysfunction. The underlying cause of the appearance of syndromic and nonsyndromic RP in three siblings from a consanguineous Israeli Muslim Arab family was studied with whole-genome homozygosity mapping followed by whole exome sequencing. THE FAMILY WAS FOUND TO SEGREGATE NOVEL MUTATIONS OF TWO DIFFERENT GENES: myosin VIIA (MYO7A), which causes type 1 Usher syndrome, and phosphodiesterase 6B, cyclic guanosine monophosphate-specific, rod, beta (PDE6B), which causes nonsyndromic RP. One affected child was homozygous for both mutations. Since the retinal phenotype seen in this patient results from overlapping pathologies, one might expect to find severe retinal degeneration. Indeed, he was diagnosed with RP based on an abnormal electroretinogram (ERG) at a young age (9 months). However, this early diagnosis may be biased, as two of his older siblings had already been diagnosed, leading to increased awareness. At the age of 32 months, he had relatively good vision with normal visual fields. Further testing of visual function and structure at different ages in the three siblings is needed to determine whether the two RP-causing genes mutated in this youngest sibling confer increased disease severity. This report further supports the genetic heterogeneity of RP, and demonstrates how consanguinity could increase intrafamilial clustering of multiple hereditary diseases. Moreover, this report provides a unique opportunity to study the clinical implications of the coexistence of pathogenic mutations in two RP-causative genes in a human patient.

  11. Genetic heterogeneity and consanguinity lead to a “double hit”: Homozygous mutations of MYO7A and PDE6B in a patient with retinitis pigmentosa

    Science.gov (United States)

    Goldenberg-Cohen, Nitza; Banin, Eyal; Zalzstein, Yael; Cohen, Ben; Rotenstreich, Ygal; Rizel, Leah; Basel-Vanagaite, Lina

    2013-01-01

    Purpose Retinitis pigmentosa (RP), the most genetically heterogeneous disorder in humans, actually represents a group of pigmentary retinopathies characterized by night blindness followed by visual-field loss. RP can appear as either syndromic or nonsyndromic. One of the most common forms of syndromic RP is Usher syndrome, characterized by the combination of RP, hearing loss, and vestibular dysfunction. Methods The underlying cause of the appearance of syndromic and nonsyndromic RP in three siblings from a consanguineous Israeli Muslim Arab family was studied with whole-genome homozygosity mapping followed by whole exome sequencing. Results The family was found to segregate novel mutations of two different genes: myosin VIIA (MYO7A), which causes type 1 Usher syndrome, and phosphodiesterase 6B, cyclic guanosine monophosphate-specific, rod, beta (PDE6B), which causes nonsyndromic RP. One affected child was homozygous for both mutations. Since the retinal phenotype seen in this patient results from overlapping pathologies, one might expect to find severe retinal degeneration. Indeed, he was diagnosed with RP based on an abnormal electroretinogram (ERG) at a young age (9 months). However, this early diagnosis may be biased, as two of his older siblings had already been diagnosed, leading to increased awareness. At the age of 32 months, he had relatively good vision with normal visual fields. Further testing of visual function and structure at different ages in the three siblings is needed to determine whether the two RP-causing genes mutated in this youngest sibling confer increased disease severity. Conclusions This report further supports the genetic heterogeneity of RP, and demonstrates how consanguinity could increase intrafamilial clustering of multiple hereditary diseases. Moreover, this report provides a unique opportunity to study the clinical implications of the coexistence of pathogenic mutations in two RP-causative genes in a human patient. PMID:23882135

  12. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  13. Social and cultural resources for the setting up and functioning of family enterprises in a small Bulgarian town

    Directory of Open Access Journals (Sweden)

    Petrova Ivanka

    2015-01-01

    Full Text Available As a field of culture, the family enterprise shows that in the current European societies the economic operation does not proceed only from a purely rational point of view and that notwithstanding the common speaking of globalization, the local may be a prerequisite for successful economic development. My objective has been to show, proceeding from an example from a small Bulgarian town, that the family enterprise is a field of culture in which the observed phenomena are strongly influenced by the social inclusion of the enterprise and by its tie-up with the context of the urban environment. I shall investigate in what way local social and cultural resources are intensively used in the process of setting up and functioning of a family enterprise from the sphere of hoteldom and tourism in the town of Belogradchik. I intend to study whether these resources are conducive to the economic prosperity of the firm. Another research objective is to establish the manner of identification of the enterprise with the town, with the region and the local culture by way of the services provided (tourist and restaurant. I shall look for an answer to the question of how the enterprise’ working realm fits in the concrete cultural, historical and social context of the town.

  14. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    Energy Technology Data Exchange (ETDEWEB)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Monti, Paola; Fronza, Gilberto [Mutagenesis Unit, Istituto di Ricerca e Cura a Carattere Scientifico Azienda Ospedaliera Universitaria San Martino-IST-Istituto Nazionale per la Ricerca sul Cancro, 16132 Genoa (Italy); Pereira, Clara [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Saraiva, Lucília, E-mail: lucilia.saraiva@ff.up.pt [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal)

    2015-01-01

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.

  15. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    International Nuclear Information System (INIS)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana; Monti, Paola; Fronza, Gilberto; Pereira, Clara; Saraiva, Lucília

    2015-01-01

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73

  16. A novel approach for small sample size family-based association studies: sequential tests.

    Science.gov (United States)

    Ilk, Ozlem; Rajabli, Farid; Dungul, Dilay Ciglidag; Ozdag, Hilal; Ilk, Hakki Gokhan

    2011-08-01

    In this paper, we propose a sequential probability ratio test (SPRT) to overcome the problem of limited samples in studies related to complex genetic diseases. The results of this novel approach are compared with the ones obtained from the traditional transmission disequilibrium test (TDT) on simulated data. Although TDT classifies single-nucleotide polymorphisms (SNPs) to only two groups (SNPs associated with the disease and the others), SPRT has the flexibility of assigning SNPs to a third group, that is, those for which we do not have enough evidence and should keep sampling. It is shown that SPRT results in smaller ratios of false positives and negatives, as well as better accuracy and sensitivity values for classifying SNPs when compared with TDT. By using SPRT, data with small sample size become usable for an accurate association analysis.

  17. An insight into recent consanguinity within the Basque area in Spain. Effects of autochthony, industrialization and demographic changes.

    Science.gov (United States)

    Alfonso-Sanchez, M A; Peña, J A; Aresti, U; Calderón, R

    2001-01-01

    The importance of studying the genetic kinship of those human groups characterized by a deeply rooted ethnicity has traditionally been and still is an interesting goal of anthropological and population genetic studies. However, only a few surveys have aimed to learn about the impact of industrial development on the consanguinity of these populations and even those have concentrated on industrialized regions. This approach is worth analysing in Spain, where industrialization was late in relation to other western European countries. In this work we analyse the characteristics of inbreeding in Guipúzcoa from 1951 to 1995. This Basque province underwent industrial and tourist development earlier than other Spanish regions. It has the highest density of Basque speakers and has always occupied a central position within the map of distribution of the Basque language. Guipúzcoa is geographically placed in the core of the Basque area. SUDJECTS AND METHODS: Data on consanguineous marriages recorded in the province of Guipúzcoa between 1951 and 1995 were taken from Roman Catholic dispensations stored in the Diocesan Archives of San Sebastián, the province's capital city. Over the whole time period, a total of 1152 consanguineous marriages were registered. The high frequencies of first cousin (M22) (F = 1/16) and uncle-niece, aunt-nephew (M12) (F = 1/8) consanguineous marriages distinguish Guipúzcoa from the rest of Iberian populations. The M22/M33 ratio (with M33 being second cousins) has never dropped below 0.67, which represents a significant deviation from the expectation value of 0.25. When consanguineous marriages are classified according to marriage partner birthplaces interesting results emerge. Provincial endogamy shows the highest consanguinity rates (57%) and the proportion of M22/M33 is also rather high (0.63). However, a major contribution to the consanguinity levels and mean inbreeding coefficient recorded in Guipúzcoa over recent decades has been made by

  18. Evaluation of a Teaching Kit for Family and Consumer Science Classrooms: Motivating Students to Use a Food Thermometer with Small Cuts of Meat

    Science.gov (United States)

    Edwards, Zena; Edlefsen, Miriam; Hillers, Virginia; McCurdy, Sandra M.

    2005-01-01

    The U.S. Dept. of Agriculture recommends use of food thermometers to safely cook small cuts of meat, yet most consumers do not use them. Consumers lack knowledge about how and why to use food thermometers with small cuts of meat. Opportunities exist for family and consumer science classes to provide education about thermometers to adolescents, who…

  19. Implications of the Small Spin Changes Measured for Large Jupiter-Family Comet Nuclei

    Science.gov (United States)

    Kokotanekova, R.; Snodgrass, C.; Lacerda, P.; Green, S. F.; Nikolov, P.; Bonev, T.

    2018-06-01

    Rotational spin-up due to outgassing of comet nuclei has been identified as a possible mechanism for considerable mass-loss and splitting. We report a search for spin changes for three large Jupiter-family comets (JFCs): 14P/Wolf, 143P/Kowal-Mrkos, and 162P/Siding Spring. None of the three comets has detectable period changes, and we set conservative upper limits of 4.2 (14P), 6.6 (143P) and 25 (162P) minutes per orbit. Comparing these results with all eight other JFCs with measured rotational changes, we deduce that none of the observed large JFCs experiences significant spin changes. This suggests that large comet nuclei are less likely to undergo rotationally-driven splitting, and therefore more likely to survive more perihelion passages than smaller nuclei. We find supporting evidence for this hypothesis in the cumulative size distributions of JFCs and dormant comets, as well as in recent numerical studies of cometary orbital dynamics. We added 143P to the sample of 13 other JFCs with known albedos and phase-function slopes. This sample shows a possible correlation of increasing phase-function slopes for larger geometric albedos. Partly based on findings from recent space missions to JFCs, we hypothesise that this correlation corresponds to an evolutionary trend for JFCs. We propose that newly activated JFCs have larger albedos and steeper phase functions, which gradually decrease due to sublimation-driven erosion. If confirmed, this could be used to analyse surface erosion from ground and to distinguish between dormant comets and asteroids.

  20. State-of-the-art of small molecule inhibitors of the TAM family: the point of view of the chemist.

    Science.gov (United States)

    Baladi, Tom; Abet, Valentina; Piguel, Sandrine

    2015-11-13

    The TAM family of tyrosine kinases receptors (Tyro3, Axl and Mer) is implicated in cancer development, autoimmune reactions and viral infection and is therefore emerging as an effective and attractive therapeutic target. To date, only a few small molecules have been intentionally designed to block the TAM kinases, while most of the inhibitors were developed for blocking different protein kinases and then identified through selectivity profile studies. This minireview will examine in terms of chemical structure the different compounds able to act on either one, two or three TAM kinases with details about structure-activity relationships, drug-metabolism and pharmacokinetics properties where they exist. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  1. Structural and functional studies of a family of Dictyostelium discoideum developmentally regulated, prestalk genes coding for small proteins

    Directory of Open Access Journals (Sweden)

    Escalante Ricardo

    2008-01-01

    Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.

  2. Consanguinity among the risk factors for underweight in children under five: a study from rural Sindh

    International Nuclear Information System (INIS)

    Hasnain, S.F.; Hashmi, S.K.

    2009-01-01

    Malnutrition is a common problem, especially in developing countries. Of the 11 million children under 5 who die each year in the developing countries mainly from preventable causes, the death of about 54% are either directly or indirectly attributable to malnutrition. The objectives of this study were to assess the prevalence and associated factors for underweight in rural Sindh. Methods: A cross-sectional survey was conducted in Jhangara Town, located in District Dadu, Sindh. Eight hundred children under 5 years of age were enrolled. A questionnaire was used to elicit required information and anthropometric measurements were made. Results: The overall prevalence for underweight was 54.3% in the study population, which was higher than the prevalence reported by PDHS 1990 - 91. In multivariate analysis, various factors for underweight were consanguinity (OR=1.5, 95% CI=1.0 - 2.07), low birth weight (parents perspective) (OR=1.6, 95% CI=1.08 - 2.16) and lack of breast-feeding (OR=2.7, 95% CI=1.19 - 6.17). Conclusion: Effective strategies to discourage consanguineous marriages between first cousins are required. Promoting breast feeding is another factor that should be incorporated while designing control strategies to reduce morbidity and mortality due to malnutrition in children (<5 years). (author)

  3. Mutation analysis in a family with oculocutaneous albinism manifesting in the same generation of three branches

    NARCIS (Netherlands)

    Preising, Markus N.; Forster, Hedwig; Tan, H.; Lorenz, Birgit; de Jong, Paulus T. V. M.; Plomp, Astrid S.

    2007-01-01

    To elucidate the molecular basis of oculocutaneous albinism with variable expressivity in a family from The Netherlands in which no consanguinity was reported. Three affected family members were screened for mutations in tyrosinase (TYR) and the pink-eye-dilution gene (P) by using SSCP. The

  4. Mal de Meleda: A Report of Two Cases In One Family

    Directory of Open Access Journals (Sweden)

    M.Kantor

    2006-08-01

    Full Text Available Mal de Meleda is a rare autosomal recessive skin disorder, characterized by transgressive palmoplantar keratoderma, lichenoid skin lesions, perioral erythema, brachydactyly and nail abnormalities. We are reporting two cases of a clinically typical disease in a family. No consanguineous relationship between the parents was known and cases could not be detected in three generations of the patient's family.

  5. Relationship between the depression status of patients with resectable non-small cell lung cancer and their family members in China.

    Science.gov (United States)

    Wu, Xian-Ning; Su, Dan; Li, Hui-Ping; Wang, Wei-Li; Wu, Wei-Qin; Yang, Ya-Juan; Yu, Feng-Lei; Zhang, Jing-Ping

    2013-10-01

    Less work on depression status has been done with family members of patients with non-small cell lung cancer (NSCLC). This study investigated depression status of patients and their family members; and the relationship of the depression status between these two groups. This cross-sectional study enrolled 194 patients diagnosed with non-small cell lung cancer as well as their family members. In this study, a self-administered General Information Questionnaire was used to collect general information and the Self-rating Depression Scale (SDS) to assess depression status. Linear correlation analysis was used to probe the relationship of the depression status between patients and their family members. Of the 194 patients, 148 (76.3%) showed symptoms of depression. 148 (76.3%) family members had depression symptoms. The severity of depression in patients was positively correlated with that of family members (r = 0.577, p family members suffered depression, and the two were correlated. A prospective study might prove helpful in determining the real relationship existing between the two groups' mental status and whether early detection and intervention might ameliorate this current situation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. The prevalence of attention deficit hyperactivity symptoms in schoolchildren in a highly consanguineous community.

    Science.gov (United States)

    Bener, Abdulbari; Al Qahtani, Razna; Teebi, Ahmad S; Bessisso, Mohammed

    2008-01-01

    The objective of the present study was to find the prevalence of attention deficit hyperactivity (ADH) symptoms in a sample of primary schoolchildren in Qatar and investigate the behaviour of the children with and without ADH symptoms in a highly consanguineous community. A total of 2,500 primary school students, aged 6-12 years, were randomly selected from the government primary schools, and 1,869 students (947 boys and 922 girls) gave consent to participate in this study. An Arabic questionnaire was used to collect the sociodemographic variables and a standardized Arabic version of the Conners' Teacher Rating Scale for ADH symptoms. Of the 947 boys, 158 (16.7%; 95% confidence interval, CI, 14.4-19.2) and of the 922 girls, 50 (5.4%; 95% CI 4.1-7.1) scored above the cut-off (>or=15) for ADH symptoms, thus giving an overall prevalence of 11.1% (95% CI 9.7-12.6). The children who had higher scores for ADH symptoms were in the age group of 6-9 years. Children who had higher scores for ADH symptoms had a poorer school performance than those with lower scores (p = 0.002). Two hundred (96.2%) children with ADH were disobedient, 126 (60.6%) noisy and hyperactive, 76 (36.5%) very cranky, 78 (37.5%) troublesome and 79 (37.9%) nervous. The logistic regression identified socio-economic condition, number of children, school performance and poor relationship between parents as the main contributors to ADH. Although the univariate analysis showed a significant relationship (p = 0.010) between ADH symptoms and consanguineous parents, logistic regression did not support this association (p = 0.075). This suggests that consanguinity has no impact on ADH children. The study revealed that ADH is a common problem among schoolchildren. The children with higher scores for ADH symptoms had a poorer school performance than those with lower scores. A significant difference exists between the behaviour of children with and without ADH. (c) 2008 S. Karger AG, Basel.

  7. Birth prevalence of non-syndromic orofacial clefts in Saudi Arabia and the effects of parental consanguinity

    Science.gov (United States)

    Sabbagh, Heba J.; Innes, Nicola P.; Sallout, Bahauddin I.; Alamoudi, Najlaa M.; Hamdan, Mustafa A.; Alhamlan, Nasir; Al-Khozami, Amaal I.; Abdulhameed, Fatma D.; Al-Aama, Jumana Y.; Mossey, Peter A.

    2015-01-01

    Objectives: To describe the characteristics and prevalence of non-syndromic orofacial clefting (NSOFC) and assess the effects of parental consanguinity on NSOFC phenotypes in the 3 main cities of Saudi Arabia. Methods: All infants (114,035) born at 3 referral centers in Riyadh, and 6 hospitals in Jeddah and Madinah between January 2010 and December 2011 were screened. The NSOFC cases (n=133) were identified and data was collected through clinical examination and records, and information on consanguinity through parent interviews. The diagnosis was confirmed by reviewing medical records and contacting the infants’ pediatricians. Control infants (n=233) matched for gender and born in the same hospitals during the same period, were selected. Results: The prevalence of NSOFC was 1.07/1000 births in Riyadh, and 1.17/1000 births overall; cleft lip (CL) was 0.47/1000 births, cleft lip and palate (CLP) was 0.42/1000 births, and cleft palate (CP) was 0.28/1000 births. Cleft palate was significantly associated with consanguinity (p=0.047, odds ratio: 2.5, 95% confidence interval: 1 to 6.46), particularly for first cousin marriages. Conclusion: The birth prevalence of NSOFC in Riyadh alone, and in the 3 main cities of Saudi Arabia were marginally lower than the mean global prevalence. While birth prevalence for CLP was comparable to global figures, the CL:CLP ratio was high, and only CP was significantly associated with consanguinity. PMID:26318465

  8. Birth prevalence of non-syndromic orofacial clefts in Saudi Arabia and the effects of parental consanguinity

    Directory of Open Access Journals (Sweden)

    Heba J. Sabbagh

    2015-09-01

    Full Text Available Objectives: To describe the characteristics and prevalence of non-syndromic orofacial clefting (NSOFC and assess the effects of parental consanguinity on NSOFC phenotypes in the 3 main cities of Saudi Arabia. Methods: All infants (114,035 born at 3 referral centers in Riyadh, and 6 hospitals in Jeddah and Madinah between January 2010 and December 2011 were screened. The NSOFC cases (n=133 were identified and data was collected through clinical examination and records, and information on consanguinity through parent interviews. The diagnosis was confirmed by reviewing medical records and contacting the infants’ pediatricians. Control infants (n=233 matched for gender and born in the same hospitals during the same period, were selected. Results: The prevalence of NSOFC was 1.07/1000 births in Riyadh, and 1.17/1000 births overall; cleft lip (CL was 0.47/1000 births, cleft lip and palate (CLP was 0.42/1000 births, and cleft palate (CP was 0.28/1000 births. Cleft palate was significantly associated with consanguinity (p=0.047, odds ratio: 2.5, 95% confidence interval: 1 to 6.46, particularly for first cousin marriages. Conclusion: The birth prevalence of NSOFC in Riyadh alone, and in the 3 main cities of Saudi Arabia were marginally lower than the mean global prevalence. While birth prevalence for CLP was comparable to global figures, the CL:CLP ratio was high, and only CP was significantly associated with consanguinity.

  9. Associations of recurrent miscarriages with chromosomal abnormalities, thrombophilia allelic polymorphisms and/or consanguinity in Saudi Arabia.

    Science.gov (United States)

    Turki, Rola F; Assidi, Mourad; Banni, Huda A; Zahed, Hanan A; Karim, Sajjad; Schulten, Hans-Juergen; Abu-Elmagd, Muhammad; Rouzi, Abdulrahim A; Bajouh, Osama; Jamal, Hassan S; Al-Qahtani, Mohammed H; Abuzenadah, Adel M

    2016-10-10

    Recurrent pregnancy loss (RPL) or recurrent spontaneous abortion is an obstetric complication that affects couples at reproductive age. Previous reports documented a clear relationship between parents with chromosomal abnormalities and both recurrent miscarriages and infertility. However, limited data is available from the Arabian Peninsula which is known by higher rates of consanguineous marriages. The main goal of this study was to determine the prevalence of chromosomal abnormalities and thrombophilic polymorphisms, and to correlate them with RPL and consanguinity in Saudi Arabia. Cytogenetic analysis of 171 consent patients with RPL was performed by the standard method of 72-h lymphocyte culture and GTG banding. Allelic polymorphisms of three thrombophilic genes (Factor V Leiden, Prothrombin A20210G, MTHFR C677T) were performed using PCR-RFLP (restriction fragment length polymorphism) and gel electrophoresis. Data analysis revealed that 7.6 % of patients were carrier of numerical or structural chromosomal abnormalities. A high rate of translocations (46 %) was associated to increased incidence of RPL. A significant correlation between consanguineous RPL patients and chromosomal abnormalities (P consanguineous marriages in the Saudi population, these results underline the importance of systematic cytogenetic investigation and genetic counseling preferably at the premarital stage or at least during early pregnancy phase through preimplantation genetic diagnosis (PGD).

  10. Domestic violence in consanguineous marriages - findings from Pakistan Demographic and Health Survey 2012-13.

    Science.gov (United States)

    Shaikh, Masood Ali

    2016-10-01

    Domestic violence is a pandemic and estimated to affect one in three women globally, in their lifetime. Marriages within blood relations in Pakistan are common. In this study a secondary analysis of Pakistan Demographic and Health Survey 2012-13 was done to study the prevalence and profile of domestic violence in the context of consanguineous marriages in Pakistan. Almost 65% of women had some kind of blood relationship with their husbands. Women having a blood relationship with husbands were more likely to report having ever been subjected to marital control behaviours, emotional and physical violence by their husbands, compared to ones without such relationship. However, these associations fail to reach statistical significance; underscoring the ubiquitous nature of marital control and violence. More effective public health education campaigns for just and equal treatment of wives by their husbands to speedily curb the scourge of domestic violence in the country are needed.

  11. Parental consanguineous marriages and clinical response to chemotherapy in locally advanced breast cancer patients.

    Science.gov (United States)

    Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam

    2011-03-28

    The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  12. Consanguineous marriage and increased risk of idiopathic congenital talipes equinovarus: a case-control study in a rural area.

    Science.gov (United States)

    Sahin, Orcun; Yildirim, Cengiz; Akgun, Rahmi C; Haberal, Bahtiyar; Yazici, Ayse C; Tuncay, Ismail C

    2013-01-01

    The purpose of this study is to evaluate if there is any relationship between consanguineous marriages and idiopathic congenital talipes equinovarus (CTEV). A case-control study on CTEV screening was conducted in a rural eastern city of Turkey between 2009 and 2011 and a total of 28 cases (infants with idiopathic CTEV) and 575 controls (healthy infants) were recruited. Sociodemographic status of the infants, including gestational age and birth weights, maternal characteristics and, if any, the degree of consanguinity, were recorded. As an inclusion criterion, only singleton, full-term, live births were accepted. A backward stepwise logistic regression model was used to evaluate the relationship between idiopathic CTEV and parental consanguinity. Unadjusted and adjusted odds ratios (OR) with 95% confidence interval (CI) were calculated. Among maternal and infant characteristics, significant risk factors for idiopathic CTEV in the regression analysis were work status (employed), consanguineous marriage, sex (male), and gestational age (>42 wk). Babies born to first-cousin parents had >4 times the risk of idiopathic CTEV [OR, 4.138, (95% CI, 1.484, 11.538)] and the risk for those born to distant relatives was 2.9 times higher [OR, 2.941, (95% CI, 1.070, 8.087)] than for children of unrelated parents. Consanguineous marriage was significantly associated with an increased risk of idiopathic CTEV. This association remained significant even after adjusting for potential confounding variables. To obtain more accurate results, a population-based screening study with an increased number of cases and controls should be performed in future studies. Case-control study investigating the effect of a patient characteristic on the outcome of disease (level-III).

  13. Study of a large Anglo-Saxon family with beta-thalassaemia trait.

    Science.gov (United States)

    Raik, E; Powell, E; Gordon, S

    1976-01-01

    Study of a large Anglo-Saxon family with beta-thalassaemia trait revealed evidence of consanguinity, moreover both branches of the family shared a Spanish ancestor. The manifestations of the disorder were varied in severity and yet the degree of severity appeared to breed true within any individual part of the family. Our explanation for the inheritance pattern observed in the family was to postulate the existence of two non-allelic genes influencing the rate of beta-chain synthesis.

  14. The effects of small-scale, homelike facilities for older people with dementia on residents, family caregivers and staff: design of a longitudinal, quasi-experimental study.

    Science.gov (United States)

    Verbeek, Hilde; van Rossum, Erik; Zwakhalen, Sandra M G; Ambergen, Ton; Kempen, Gertrudis I J M; Hamers, Jan P H

    2009-01-20

    Small-scale and homelike facilities for older people with dementia are rising in current dementia care. In these facilities, a small number of residents live together and form a household with staff. Normal, daily life and social participation are emphasized. It is expected that these facilities improve residents' quality of life. Moreover, it may have a positive influence on staff's job satisfaction and families involvement and satisfaction with care. However, effects of these small-scale and homelike facilities have hardly been investigated. Since the number of people with dementia increases, and institutional long-term care is more and more organized in small-scale and homelike facilities, more research into effects is necessary. This paper presents the design of a study investigating effects of small-scale living facilities in the Netherlands on residents, family caregivers and nursing staff. A longitudinal, quasi-experimental study is carried out, in which 2 dementia care settings are compared: small-scale living facilities and regular psychogeriatric wards in traditional nursing homes. Data is collected from residents, their family caregivers and nursing staff at baseline and after 6 and 12 months of follow-up. Approximately 2 weeks prior to baseline measurement, residents are screened on cognition and activities of daily living (ADL). Based on this screening profile, residents in psychogeriatric wards are matched to residents living in small-scale living facilities. The primary outcome measure for residents is quality of life. In addition, neuropsychiatric symptoms, depressive symptoms and social engagement are assessed. Involvement with care, perceived burden and satisfaction with care provision are primary outcome variables for family caregivers. The primary outcomes for nursing staff are job satisfaction and motivation. Furthermore, job characteristics social support, autonomy and workload are measured. A process evaluation is performed to investigate to

  15. Activation of Relaxin Family Receptor 1 from different mammalian species by relaxin peptide and small molecule agonist ML290

    Directory of Open Access Journals (Sweden)

    Zaohua eHuang

    2015-08-01

    Full Text Available Relaxin peptide (RLN, which signals through the relaxin family peptide 1 (RXFP1 GPCR receptor, has shown therapeutic effects in an acute heart failure clinical trial. We have identified a small molecule agonist of human RXFP1, ML290; however, it does not activate the mouse receptor. To find a suitable animal model for ML290 testing and to gain mechanistic insights into the interaction of various ligands with RXFP1, we have cloned rhesus macaque, pig, rabbit, and guinea pig RXFP1s and analyzed their activation by RLN and ML290. HEK293T cells expressing macaque or pig RXFP1 responded to relaxin and ML290 treatment as measured by an increase of cAMP production. Guinea pig RXFP1 responded to relaxin but had very low response to ML290 treatment only at highest concentrations used. The rabbit RXFP1 amino acid sequence was the most divergent, with a number of unique substitutions within the ectodomain and the 7-transmembrane domain (7TM. Two splice variants of rabbit RXFP1 derived through alternative splicing of the forth exon were identified. In contrast to the other species, rabbit RXFP1s were activated by ML290, but not with human, pig, mouse, or rabbit relaxins. Using FLAG-tagged constructs, we have shown that both rabbit RXFP1 variants are expressed on the cell surface. No binding of human Eu-labeled relaxin to rabbit RXFP1 was detected, suggesting that in this species RXFP1 might be non-functional. We used chimeric rabbit-human and guinea pig-human constructs to identify regions important for RLN or ML290 receptor activation. Chimeras with the human ectodomain and rabbit 7TM domain were activated by RLN, whereas substitution of part of the guinea pig 7TM domain with the human sequence only partially restored ML290 activation, confirming the allosteric mode of action for the two ligands. Our data demonstrate that macaque and pig models can be used for ML290 testing.

  16. [Consanguineous marriage and morbi-mortality, short literature review based on an exceptional association: Usher syndrome and Von Recklinghausen neurofibromatosis].

    Science.gov (United States)

    Atipo-Tsiba, Pépin-Williams

    2016-01-01

    Usher syndrome is defined by the association of a progressive or non-progressive congenital sensorineural hearing loss with variable severity and a gradually blinding pigmentary retinopathy. Von Recklinghausen neurofibromatosis or Neurofibromatosis type 1 is the major clinically form of neurofibromatosis which occurs in approximately 90% of cases. Both types of disease are genetic in origin with very low prevalence. The probability of co-occurrence of these diseases in a single individual is exceptional. Inbreeding, as well as all genetic diseases, increases quite significantly the probability of their occurrence. Consanguineous marriages are still widespread in Maghreb and in some regions of the western African. This observation reports an exceptional case of this association in a 40-year-old man of Mauritanian origin born from a consanguineous union.

  17. Causes and prevalence of consanguineous marriage, child health, happiness in relationships and life satisfaction among the women in Hatay

    OpenAIRE

    İnandı, Tacettin; Savaş, Nazan; Arslan, Evrim; Yeniçeri, Arif; Erdem, Mehmet; Durmaz, Elif; Peker, Ersin; Alışkın, Ömer

    2016-01-01

    Objective: This study assessed the causes and prevalence of consanguineous marriages, their effects on the children's health, on life satisfaction and on relationship’s relation to the happiness of the women. Methods: In this cross-sectional study, the population consisted of married, divorced or widowed women in Hatay, Turkey. The study sample was 584 women selected by a multistage sampling method. The data were collected during April and May 2014 at the women’s homes with a face to fac...

  18. A new family programme in Zhejiang province.

    Science.gov (United States)

    Xu, B

    1994-04-01

    Zhejiang Province in China has promoted a new family planning program since April 1993. The program stresses delayed marriage and childbearing, fewer and healthier births, modernization of family life, and prosperity through hard work. The people are receptive to the new program out of a desire for an improved standard of living. The objective is to build small, modern families who 1) practice deferred marriage and childbearing; 2) voluntarily practice family planning and have no unplanned births; 3) practice avoidance of consanguineous marriage, become sterilized if a carrier of a hereditary disease of chromosomal abnormality, and use premarital education and counseling and proper prenatal care; 4) uphold the laws and maintain discipline in action to avoid criminal behavior; 5) establish families that respect the old, care for children, and help their neighbors; 6) complete 9 years of compulsory education; and 7) create well being through hard work. The program is compatible with the strategy of the "three stresses" and an integrated approach. IEC and service provision are important components in program implementation. The target population are the masses and grassroots cadres, particularly those in the childbearing ages. IEC will be directed in different ways to different groups. Those aged 18-35 years will receive education. Face to face interaction with family planning workers and lectures will be directed to grassroots cadres. The mass media will be employed to reach the masses. The messages will include information and persuasion to adopt new families, accept family planning regulations, and learn about contraceptive use, healthy births and childrearing, education, health care, sex education, and income generation skills. Classes will be conducted for groups, such as teenagers, unmarried youth, pregnant women, and lactating women. Priority will be given to couples that accept the certificates for one child; favoritism will be granted for allocation of

  19. An Assessment of the Influence of Selected on the Performance of Small to Medium Sized Family Owned Businesses in the Zimbabwe Retail Sector

    Directory of Open Access Journals (Sweden)

    Maxwell Sandada

    2015-10-01

    Full Text Available The study attempted to assess the factors that are affecting business performance of small to medium sized family owned businesses in the Zimbabwean retail sector. The objective was to establish the effect of innovation, management skills, succession planning and corporate governance on family owned SMEs in Zimbabwe. The study sought to complement other previous studies that were carried out in other different contexts by producing evidence on the same phenomenon from a developing country context. The study adopted a quantitative approach. A self-administered survey was conducted to collect data that was analysed using descriptive, correlation and regression analyses. The results showed that the most significant factors affecting business performance in order of predictive power were innovation, proper management skills, succession planning and corporate governance. The findings have implications to family business managers and owners in Zimbabwe who are encouraged to be innovative, properly manage, practise succession planning and be guided by business morals in managing their enterprises. Whilst the factors ensuring the success of Small and Medium sized enterprises have extensively been examined, there is dearth of research on family business success factors especially in a developing country like Zimbabwe.

  20. The determinants of the readiness to let go among senior generation owner-managers of small and medium-sized family businesses

    Directory of Open Access Journals (Sweden)

    Stephan P van der Merwe

    2010-09-01

    Full Text Available The objective of this study was to assess the determinants of the readiness of the senior generation owner-managers to finally transfer the management and control of the family business to the younger generation. Data from 504 questionnaires linked to 81 family businesses were collected and analysed. An Oblimin oblique rotation was carried out on the principal components of the exploratory factor analysis. Five factors with eigen-values greater than one, explaining 62.64 per cent of the variance, were extracted. These five factors describing the theoretical dimensions of the dependent variable were: the senior generation owner-manager’s readiness to let go, and the independent variables of retirement planning, perceived suitability of the successor, estate planning, and the perceived liquidity of the business after the transfer. No significant practical differences relating to these five factors could be found between the perceptions of male and female respondents, the senior and younger generation family members or family members involved in medium-sized or small businesses. Practical recommendations are suggested to ensure a smooth final transfer of the management and control of the business to the younger generation family members.

  1. Correlation between familial cancer history and epidermal growth factor receptor mutations in Taiwanese never smokers with non-small cell lung cancer: a case-control study.

    Science.gov (United States)

    Cheng, Po-Chung; Cheng, Yun-Chung

    2015-03-01

    Lung cancer is a leading cause of cancer deaths in the world. Cigarette smoking remains a prominent risk factor, but lung cancer incidence has been increasing in never smokers. Genetic abnormalities including epidermal growth factor receptor (EGFR) mutations predominate in never smoking lung cancer patients. Furthermore, familial aggregations of patients with these mutations reflect heritable susceptibility to lung cancer. The correlation between familial cancer history and EGFR mutations in never smokers with lung cancer requires investigation. This was a retrospective case-control study that evaluated the prevalence of EGFR mutations in lung cancer patients with familial cancer history. Never smokers with lung cancer treated at a hospital in Taiwan between April 2012 and May 2014 were evaluated. Inclusion criteria were never smokers with non-small cell lung cancer (NSCLC). Exclusion criteria involved patients without records of familial cancer history or tumor genotype. This study included 246 never smokers with lung cancer. The study population mainly involved never smoking women with a mean age of 60 years, and the predominant tumor histology was adenocarcinoma. Lung cancer patients with familial cancer history had an increased prevalence of EGFR mutations compared to patients without family history [odds ratio (OR): 5.9; 95% confidence interval (CI): 3.3-10.6; Pnon-pulmonary cancers (OR: 5.0; 95% CI: 2.5-10.0; Pnever smoking lung cancer patients with familial cancer history. Moreover, a sizable proportion of never smoking cancer patients harbored these mutations. These observations have implications for the treatment of lung cancer in never smokers.

  2. The effect of consanguineous marriage on reading disability in the Arab community.

    Science.gov (United States)

    Abu-Rabia, Salim; Maroun, Lateefeh

    2005-02-01

    The present study examined the effect of consanguineous marriage in the Arab community on reading disabilities of offspring. It examined whether the rate of reading disabilities was higher among offspring of first-cousin parents than offspring of unrelated parents; and whether reading-disabled children of first-cousin parents were more disabled in phonological awareness and phonological decoding than reading-disabled children of unrelated parents and normally reading younger children. These questions were investigated among 814 pupils of the 4th, 5th, and 6th grades, using word recognition and reading comprehension tests. Two experimental groups were chosen from this population. These were a reading-disabled group of 22 pupils who were children of first-cousin marriages and 21 pupils who were children of unrelated parents. A control group was also selected, consisting of 21 younger normally reading pupils at the same reading level. All the groups were tested on non-words, real words, phonological, orthographic and working memory measures. The results indicated that the rate of reading disabilities among children of first-cousin parents was higher than that of with children of second-cousin parents, distantly related parents, or unrelated parents. Further, no differences were found in phonological awareness and decoding between the two reading-disabled groups. Moreover, the results indicate a significant advantage of the younger normal readers over the reading-disabled children in the measures of phonological awareness, decoding, and orthographical knowledge that requires spelling. However, in reading common words and choosing words in context, the performance of the reading-disabled groups and the normally reading group were similar. It has been suggested that further research is needed to evaluate the role of intelligence, nevertheless our results provide new evidence for a genetic basis to reading disabilities.

  3. Genetic heterogeneity in Pakistani microcephaly families

    DEFF Research Database (Denmark)

    Sajid Hussain, M; Bakhtiar, Syeda Marriam; Farooq, Muhammad

    2013-01-01

    Autosomal recessive primary microcephaly (MCPH) is caused by mutations in at least eight different genes involved either in cell division or DNA repair. Most mutations are identified in consanguine families from Pakistan, Iran and India. To further assess their genetic heterogeneity and mutational...... mutation. One third of the families were linked to ASPM followed by WDR62 confirming previous data. We identified three novel ASPM mutations, four novel WDR62 mutations, one novel MCPH1 mutation and two novel CEP152 mutations. CEP152 mutations have not been described before in the Pakistani population....

  4. Familial myasthenia gravis: report of four cases

    Directory of Open Access Journals (Sweden)

    José Lamartine de Assis

    1976-09-01

    Full Text Available Two pairs of siblings with myasthenia gravis, belonging to two different families, are reported. This is the only record of familial myasthenia during the past twenty years, in a total of 145 patients seen at the Neurological Clinic of the São Paulo Medical School. In spite of the fact that myasthenia gravis does not show hereditary characteristics, the peculiar features of the four cases justify the present report. The two pairs of siblings were born from non myasthenic nor consanguineous parents. The disease started at birth showing bilateral partial eyelid ptosis in all patients. The course of the illness has been favorable. There was no thymoma.

  5. Familial hypercholesterolemia with multiple cutaneous xanthomas

    Directory of Open Access Journals (Sweden)

    Reddy BSN

    2006-01-01

    Full Text Available An interesting episode of homozygous familial hypercholesterolemia affecting four children born to a consanguinous parents belonging to two different families is reported for its rarity. The patients had multiple cutaneous xanthomas including the characteristic xanthoma tendinosum, xanthoma interosseum, xanthoma tuberosum, and xanthelasma palpebrarum. Prominent corneal arcus juvenalis has been noted in three children. Gross elevation of serum levels of low density lipoprotein cholesterol (LDLc with normal values of triglycerides have been found in all patients. They have been prescribed medication with oral tablets of simvastatin and advised fat restricted diet and regular follow up in the clinic at periodic intervals.

  6. Families of Smooth Rational Curves of Small Degree on the Fano Variety of Degree 5 of Main Series

    Directory of Open Access Journals (Sweden)

    M. S. Omelkova

    2013-01-01

    Full Text Available In this paper we consider some families of smooth rational curves of degree 2, 3 and 4 on a smooth Fano threefold X which is a linear section of the Grassmanian G(1, 4 under the Pl¨ucker embedding. We prove that these families are irreducible. The proof of the irreducibility of the families of curves of degree d is based on the study of degeneration of a rational curve of degree d into a curve which decomposes into an irreducible rational curve of degree d−1 and a projective line intersecting transversally at a point. We prove that the Hilbert scheme of curves of degree d on X is smooth at the point corresponding to such a reducible curve. Then calculations in the framework of deformation theory show that such a curve varies into a smooth rational curve of degree d. Thus, the set of reducible curves of degree d of the above type lies in the closure of a unique component of the Hilbert scheme of smooth rational curves of degree d on X. From this fact and the irreducibility of the Hilbert scheme of smooth rational curves of degree d on the Grassmannian G(1, 4 one deduces the irreducibility of the Hilbert scheme of smooth rational curves of degree d on a general Fano threefold X.

  7. Identification of very small open reading frames in the genomes of Holmes Jungle virus, Ord River virus, and Wongabel virus of the genus Hapavirus, family Rhabdoviridae.

    Science.gov (United States)

    Gubala, Aneta; Walsh, Susan; McAllister, Jane; Weir, Richard; Davis, Steven; Melville, Lorna; Mitchell, Ian; Bulach, Dieter; Gauci, Penny; Skvortsov, Alex; Boyle, David

    2017-01-01

    Viruses of the family Rhabdoviridae infect a broad range of hosts from a variety of ecological and geographical niches, including vertebrates, arthropods, and plants. The arthropod-transmitted members of this family display considerable genetic diversity and remarkable genomic flexibility that enable coding for various accessory proteins in different locations of the genome. Here, we describe the genome of Holmes Jungle virus, isolated from Culex annulirostris mosquitoes collected in northern Australia, and make detailed comparisons with the closely related Ord River and Wongabel viruses, with a focus on identifying very small open reading frames (smORFs) in their genomes. This is the first systematic prediction of smORFs in rhabdoviruses, emphasising the intricacy of the rhabdovirus genome and the knowledge gaps. We speculate that these smORFs may be of importance to the life cycle of the virus in the arthropod vector.

  8. Identification of very small open reading frames in the genomes of Holmes Jungle virus, Ord River virus, and Wongabel virus of the genus Hapavirus, family Rhabdoviridae

    Science.gov (United States)

    Gubala, Aneta; Walsh, Susan; McAllister, Jane; Weir, Richard; Davis, Steven; Melville, Lorna; Mitchell, Ian; Bulach, Dieter; Gauci, Penny; Skvortsov, Alex; Boyle, David

    2017-01-01

    Viruses of the family Rhabdoviridae infect a broad range of hosts from a variety of ecological and geographical niches, including vertebrates, arthropods, and plants. The arthropod-transmitted members of this family display considerable genetic diversity and remarkable genomic flexibility that enable coding for various accessory proteins in different locations of the genome. Here, we describe the genome of Holmes Jungle virus, isolated from Culex annulirostris mosquitoes collected in northern Australia, and make detailed comparisons with the closely related Ord River and Wongabel viruses, with a focus on identifying very small open reading frames (smORFs) in their genomes. This is the first systematic prediction of smORFs in rhabdoviruses, emphasising the intricacy of the rhabdovirus genome and the knowledge gaps. We speculate that these smORFs may be of importance to the life cycle of the virus in the arthropod vector. PMID:28747815

  9. Identification of very small open reading frames in the genomes of Holmes Jungle virus, Ord River virus, and Wongabel virus of the genus , family

    Directory of Open Access Journals (Sweden)

    Aneta Gubala

    2017-07-01

    Full Text Available Viruses of the family Rhabdoviridae infect a broad range of hosts from a variety of ecological and geographical niches, including vertebrates, arthropods, and plants. The arthropod-transmitted members of this family display considerable genetic diversity and remarkable genomic flexibility that enable coding for various accessory proteins in different locations of the genome. Here, we describe the genome of Holmes Jungle virus, isolated from Culex annulirostris mosquitoes collected in northern Australia, and make detailed comparisons with the closely related Ord River and Wongabel viruses, with a focus on identifying very small open reading frames (smORFs in their genomes. This is the first systematic prediction of smORFs in rhabdoviruses, emphasising the intricacy of the rhabdovirus genome and the knowledge gaps. We speculate that these smORFs may be of importance to the life cycle of the virus in the arthropod vector.

  10. A mutation in the FOXE3 gene causes congenital primary aphakia in an autosomal recessive consanguineous Pakistani family

    DEFF Research Database (Denmark)

    Anjum, Iram; Eiberg, Hans; Baig, Shahid Mahmood

    2010-01-01

    of the population in this region of Pakistan which has prevailed for many months. CONCLUSIONS: FOXE3 is responsible for the early developmental arrest of the lens placode, and the complete loss of a functional FOXE3 protein results in primary aphakia. It can also be deduced that this mutation is quite primitive...

  11. Adoptees and adoptive families :an exploration of the formation of the legal family, the stigma of adoption, and the decision to search

    OpenAIRE

    Kressierer, Dana Katherine

    1994-01-01

    In this thesis I utilize sociological theories on deviance, published research on adoption, and surveys of 41 adoptees and 15 adoptive parents in order to address four primary questions: 1.What factors have influenced adoption historically, and continue to influence current practices? 2.In what ways does the legal system treat the adoptive family differently than the consanguine family? 3.Is there a stigma associated with adoption? 4.What factors are associat...

  12. Conserved Lipid and Small-Molecule Modulation of COQ8 Reveals Regulation of the Ancient Kinase-like UbiB Family.

    Science.gov (United States)

    Reidenbach, Andrew G; Kemmerer, Zachary A; Aydin, Deniz; Jochem, Adam; McDevitt, Molly T; Hutchins, Paul D; Stark, Jaime L; Stefely, Jonathan A; Reddy, Thiru; Hebert, Alex S; Wilkerson, Emily M; Johnson, Isabel E; Bingman, Craig A; Markley, John L; Coon, Joshua J; Dal Peraro, Matteo; Pagliarini, David J

    2018-02-15

    Human COQ8A (ADCK3) and Saccharomyces cerevisiae Coq8p (collectively COQ8) are UbiB family proteins essential for mitochondrial coenzyme Q (CoQ) biosynthesis. However, the biochemical activity of COQ8 and its direct role in CoQ production remain unclear, in part due to lack of known endogenous regulators of COQ8 function and of effective small molecules for probing its activity in vivo. Here, we demonstrate that COQ8 possesses evolutionarily conserved ATPase activity that is activated by binding to membranes containing cardiolipin and by phenolic compounds that resemble CoQ pathway intermediates. We further create an analog-sensitive version of Coq8p and reveal that acute chemical inhibition of its endogenous activity in yeast is sufficient to cause respiratory deficiency concomitant with CoQ depletion. Collectively, this work defines lipid and small-molecule modulators of an ancient family of atypical kinase-like proteins and establishes a chemical genetic system for further exploring the mechanistic role of COQ8 in CoQ biosynthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Respiratory Protection Behavior and Respiratory Indices among Poultry House Workers on Small, Family-Owned Farms in North Carolina: A Pilot Project.

    Science.gov (United States)

    Kearney, Gregory D; Gallagher, Barbara; Shaw, Robert

    2016-01-01

    The aim of this pilot study was to evaluate respiratory behavior and respiratory indices of poultry workers on family-owned, poultry farms with 10 or less employees in North Carolina. A field study was conducted to collect data on participants (N = 24) using spirometry, fractional exhaled nitric oxide (Feno), and an interviewer-administered questionnaire. The majority of workers (76%) ranked respiratory protection as being important, yet 48% reported never or rarely wearing respiratory protection when working in dusty conditions. A large percent of workers reported eye (55%) and nasal (50%) irritation and dry cough (50%). On average, pulmonary lung function and Feno tests were normal among nonsmokers. In bivariate analysis, significant associations were identified between working 7 days on the farm (P = .01), with eye irritation, and working 5 or fewer years in poultry farming (P = .01). Poultry workers on family-owned farms spend a considerable amount of work time in poultry houses and report acute respiratory-related health symptoms. Administrative controls among small, family-owned poultry farms are necessary to improve and promote safety and health to its employees.

  14. Lethal/severe osteogenesis imperfecta in a large family: a novel homozygous LEPRE1 mutation and bone histological findings

    NARCIS (Netherlands)

    van Dijk, Fleur S.; Nikkels, Peter G. J.; den Hollander, Nicolette S.; Nesbitt, Isabel M.; van Rijn, Rick R.; Cobben, Jan M.; Pals, Gerard

    2011-01-01

    We report a large consanguineous Turkish family in which multiple individuals are affected with autosomal recessive lethal or severe osteogenesis imperfecta (OI) due to a novel homozygous LEPRE1 mutation. In one affected individual histological studies of bone tissue were performed, which may

  15. Sex linked versus autosomal inbreeding coefficient in close consanguineous marriages in the Basque country and Castile (Spain): genetic implications.

    Science.gov (United States)

    Calderón, R; Morales, B; Peña, J A; Delgado, J

    1995-10-01

    Pedigree structures of 161 uncle/niece-aunt/nephew and 4420 first cousin consanguineous marriages registered during the 19th and 20th centuries in two large and very different Spanish regions have been analysed and their genetic consequences evaluated. The frequencies of the different pedigree subtypes within each degree of relationship were quite similar in both populations despite significant heterogeneity in inbreeding patterns. The mean X-linked inbreeding coefficient (Fx) for each type of cousin mating was calculated and compared to that expected for autosomal genes (F). The effect of genealogical structure on the Fx/F ratio was compared to different cultural populations worldwide. Preferentiality and avoidance of close consanguinity along with specific types of pedigrees are discussed on the basis of premarital migration and sociocultural rules still deeply rooted in certain human groups. By admitting that the observed Fx coefficient is usually higher than F in most human populations some remarks have been made in terms of population genetic risk.

  16. The significance of PIWI family expression in human lung embryogenesis and non-small cell lung cancer.

    Science.gov (United States)

    Navarro, Alfons; Tejero, Rut; Viñolas, Nuria; Cordeiro, Anna; Marrades, Ramon M; Fuster, Dolors; Caritg, Oriol; Moises, Jorge; Muñoz, Carmen; Molins, Laureano; Ramirez, Josep; Monzo, Mariano

    2015-10-13

    The expression of Piwi-interacting RNAs, small RNAs that bind to PIWI proteins, was until recently believed to be limited to germinal stem cells. We have studied the expression of PIWI genes during human lung embryogenesis and in paired tumor and normal tissue prospectively collected from 71 resected non-small-cell lung cancer patients. The mRNA expression analysis showed that PIWIL1 was highly expressed in 7-week embryos and downregulated during the subsequent weeks of development. PIWIL1 was expressed in 11 of the tumor samples but in none of the normal tissue samples. These results were validated by immunohistochemistry, showing faint cytoplasmic reactivity in the PIWIL1-positive samples. Interestingly, the patients expressing PIWIL1 had a shorter time to relapse (TTR) (p = 0.006) and overall survival (OS) (p = 0.0076) than those without PIWIL1 expression. PIWIL2 and 4 were downregulated in tumor tissue in comparison to the normal tissue (p < 0.001) and the patients with lower levels of PIWIL4 had shorter TTR (p = 0.048) and OS (p = 0.033). In the multivariate analysis, PIWIL1 expression emerged as an independent prognostic marker. Using 5-Aza-dC treatment and bisulfite sequencing, we observed that PIWIL1 expression could be regulated in part by methylation. Finally, an in silico study identified a stem-cell expression signature associated with PIWIL1 expression.

  17. Senior-Loken syndrome: A novel NPHP5 gene mutation in a family from Kuwait

    OpenAIRE

    Marafie, Makia J; Al-Mulla, Fahd

    2014-01-01

    Background: Rare autosomal recessive disorders of variable severity are segregating in many highly consanguineous families from the Arab population. One of these deleterious diseases is Senior-Loken syndrome, a hereditary heterogeneous multiorgan disorder, which combines nephronophthisis with retinal dystrophy, leading to blindness and eventually end stage renal failure. This disorder has been reported in many cases worldwide, including two unrelated families from Arabian Gulf countries, whic...

  18. Alternative oxidase (AOX) constitutes a small family of proteins in Citrus clementina and Citrus sinensis L. Osb.

    Science.gov (United States)

    Araújo Castro, Jacqueline; Gomes Ferreira, Monique Drielle; Santana Silva, Raner José; Andrade, Bruno Silva; Micheli, Fabienne

    2017-01-01

    The alternative oxidase (AOX) protein is present in plants, fungi, protozoa and some invertebrates. It is involved in the mitochondrial respiratory chain, providing an alternative route for the transport of electrons, leading to the reduction of oxygen to form water. The present study aimed to characterize the family of AOX genes in mandarin (Citrus clementina) and sweet orange (Citrus sinensis) at nucleotide and protein levels, including promoter analysis, phylogenetic analysis and C. sinensis gene expression. This study also aimed to do the homology modeling of one AOX isoform (CcAOXd). Moreover, the molecular docking of the CcAOXd protein with the ubiquinone (UQ) was performed. Four AOX genes were identified in each citrus species. These genes have an open reading frame (ORF) ranging from 852 bp to 1150 bp and a number of exons ranging from 4 to 9. The 1500 bp-upstream region of each AOX gene contained regulatory cis-elements related to internal and external response factors. CsAOX genes showed a differential expression in citrus tissues. All AOX proteins were predicted to be located in mitochondria. They contained the conserved motifs LET, NERMHL, LEEEA and RADE-H as well as several putative post-translational modification sites. The CcAOXd protein was modeled by homology to the AOX of Trypanosona brucei (45% of identity). The 3-D structure of CcAOXd showed the presence of two hydrophobic helices that could be involved in the anchoring of the protein in the inner mitochondrial membrane. The active site of the protein is located in a hydrophobic environment deep inside the AOX structure and contains a diiron center. The molecular docking of CcAOXd with UQ showed that the binding site is a recessed pocket formed by the helices and submerged in the membrane. These data are important for future functional studies of citrus AOX genes and/or proteins, as well as for biotechnological approaches leading to AOX inhibition using UQ homologs.

  19. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Directory of Open Access Journals (Sweden)

    Adrian Valli

    Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  20. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Science.gov (United States)

    Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

    2012-01-01

    RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  1. Bag3 promotes resistance to apoptosis through Bcl-2 family members in non-small cell lung cancer.

    Science.gov (United States)

    Zhang, Yong; Wang, Jian-Hua; Lu, Qiang; Wang, Yun-Jie

    2012-01-01

    In non-small cell lung cancer (NSCLC) certain molecular characteristics, which are related to molecular alterations have been investigated. These are responsible for both the initiation and maintenance of the malignancy in lung cancer. The aim of this study was to evaluate the influence of Bag3 (Bcl-2 associated athanogene 3) in the regulation of apoptosis on NSCLC. Bag3 and Hsp70 expression were examined by immunohistochemistry to confirm their potential roles in the prevalence of NSCLC. We also established human normal bronchial epithelial cells and HOP-62 cell line as the model to analyze cell apoptosis and the expression of Hsp70, Bcl-XL and Bcl-2, which were affected by Bag3. In this study, we found that Bag3 and Hsp70 are highly expressed in few tissues and cell lines of NSCLC. Bag3 inhibits apoptosis in human normal bronchial epithelial cell lines and sustain the survival of NSCLC cells. Bag3, Hsp70, Bcl-XL and Bcl-2 are up-regulated in NSCLC cell lines. At the same time, the silencing of Bag3 results in diminishing protein levels of Bcl-XL and Bcl-2. The results of immunoprecipitation identified that Bag3 could interact with Hsp70, Bcl-XL and Bcl-2 NSCLC cells directly or indirectly. We conclude that NSCLC cells were protected from apoptosis through increasing Bag3 expression and consequently promoted the expression of Bcl-XL and Bcl-2.

  2. Influence of wellness education on first-line icotinib hydrochloride patients with stage IV non-small cell lung cancer and their family caregivers.

    Science.gov (United States)

    Yanwei, Li; Minghui, Fang; Manman, Quan; Zhuchun, Yan; Dongying, Liu; Zhanyu, Pan

    2018-04-11

    This study aims to examine the effects of wellness education (WE) intervention on the behavioral change, psychological status, performance status on patients with stage IV non-small cell lung cancer (NSCLC) undergoing icotinib hydrochloride treatment and their relationships with family caregivers. We conducted an intervention study involving 126 individuals with confirmed activating epidermal growth factor receptor mutation-positive stage IV NSCLC who received icotinib hydrochloride as first-line therapy between January 2014 and January 2016; their caregivers were also included in the study. For a period of 12 weeks, participants were randomly assigned into WE and control groups. The patients and family members in the WE group were provided with WE information about treatment, diet, social needs, rehabilitation, physical/mental health education, communication strategies, and patient care advice at least 3 times per week during treatment. Qualitative feedback of the participants was recorded during the intervention. Food Composition Database, the Family Environment Scale, patients/caregivers quality-of-life (Functional Assessment of Cancer Therapy-Lung/Caregiver Quality of Life Index-Cancer Scale), and Hospital Anxiety and Depression Scale (HADS) were measured at baseline and for 12 weeks. Data were analyzed to compare the different outcomes. Of the 126 caregivers (64 WE and 62 control), 120 completed the study. We observed significant differences between the WE group and control group with respect to low daily calorie intake (31.0% vs 77.4%, p 0.05). After 12 weeks, WE intervention had improved scores on Functional Assessment of Cancer Therapy-Lung-EWB and Caregiver Quality of Life Index-Cancer Scale adaptation. In addition, the patients also showed improvements in HADS. WE interventions in patients with stage IV NSCLC undergoing icotinib hydrochloride treatment and their family resulted in strong intentions to engage in health-promoting behaviors related to

  3. Small G proteins in insulin action: Rab and Rho families at the crossroads of signal transduction and GLUT4 vesicle traffic.

    Science.gov (United States)

    Ishikura, S; Koshkina, A; Klip, A

    2008-01-01

    Insulin stimulates glucose uptake into muscle and adipose tissues through glucose transporter 4 (GLUT4). GLUT4 cycles between the intracellular compartments and the plasma membrane. GLUT4 traffic-regulating insulin signals are largely within the insulin receptor-insulin receptor substrate-phosphatidylinositol 3-kinase (IR-IRS-PI3K) axis. In muscle cells, insulin signal bifurcates downstream of the PI3K into one arm leading to the activation of the Ser/Thr kinases Akt and atypical protein kinase C, and another leading to the activation of Rho family protein Rac1 leading to actin remodelling. Activated Akt inactivates AS160, a GTPase-activating protein for Rab family small G proteins. Here we review the roles of Rab and Rho proteins, particularly Rab substrates of AS160 and Rac1, in insulin-stimulated GLUT4 traffic. We discuss: (1) how distinct steps in GLUT4 traffic may be regulated by discrete Rab proteins, and (2) the importance of Rac1 activation in insulin-induced actin remodelling in muscle cells, a key element for the net gain in surface GLUT4.

  4. Affinal and Consanguineal Kin as a Social Support for the Rural Elderly. Paper of the Journal Series of the North Carolina Agricultural Research Service, Raleigh, NC.

    Science.gov (United States)

    Kivett, Vira R.

    Although the support network of elderly individuals has received increased attention recently, most research has focused on the parent child relationship without examining other levels of kin interrelations. To examine the help received by rural-transitional older adults from their consanguineous kin (adult children, grandchildren, siblings,…

  5. SNP Analysis and Whole Exome Sequencing: Their Application in the Analysis of a Consanguineous Pedigree Segregating Ataxia

    Directory of Open Access Journals (Sweden)

    Sarah L. Nickerson

    2015-10-01

    Full Text Available Autosomal recessive cerebellar ataxia encompasses a large and heterogeneous group of neurodegenerative disorders. We employed single nucleotide polymorphism (SNP analysis and whole exome sequencing to investigate a consanguineous Maori pedigree segregating ataxia. We identified a novel mutation in exon 10 of the SACS gene: c.7962T>G p.(Tyr2654*, establishing the diagnosis of autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS. Our findings expand both the genetic and phenotypic spectrum of this rare disorder, and highlight the value of high-density SNP analysis and whole exome sequencing as powerful and cost-effective tools in the diagnosis of genetically heterogeneous disorders such as the hereditary ataxias.

  6. The relationship between periodontal status and peripheral levels of neutrophils in two consanguineous siblings with severe congenital neutropenia: case reports.

    Science.gov (United States)

    Tözüm, Tolga Fikret; Berker, Ezel; Ersoy, Fügen; Tezcan, Iihan; Sanal, Ozden

    2003-03-01

    Congenital neutropenia is characterized by a severe reduction in absolute neutrophil counts, resulting in an almost total absence of neutrophils. It is well known that severe neutropenia affects periodontal status. Oral manifestations include ulcerations, gingival desquamation, gingival inflammation, attachment loss, and alveolar bone loss which may result in tooth loss. Treatment with granulocyte-colony stimulating factor (G-CSF) may improve this periodontal condition. This article reports the relationship between periodontal disease status and peripheral neutrophil levels in two consanguineous siblings with severe congenital neutropenia who did not receive routine G-CSF for 2 years prior to examination. Both siblings were given scaling, root planing, and periodontal prophylaxis in regular follow-up visits. This report demonstrates that periodontal therapy supported by adequate oral hygiene may result in restoration of neutrophil counts in siblings with congenital neutropenia.

  7. Regional and ethnic distribution of beta thalassemia mutations and effect of consanguinity in patients referred for prenatal diagnosis

    International Nuclear Information System (INIS)

    Hafeez, M.

    2007-01-01

    To determine the regional and ethnic distribution of beta thalassemia mutation and the effect of consanguinity in patients referred for prenatal diagnosis of beta b-thalassemia and to target the high risk population for screening. A total of 499 couples were referred to Gentec Lab., Lahore, from all over Pakistan for prenatal diagnosis of b-thalassemia. After counseling, chorionic villus sampling was done between 10-16 weeks of gestation. DNA analysis was done by Amplification Refractory Mutation System (ARMS) for type of mutation in the Armed Forces Institute of Pathology, Rawalpindi. Ethnicity, race and consanguineous relationship of parents was determined.b-thalassemia was prevalent in Punjabis (60.7%) followed by Saraikees (25.5%). Castewise it was most frequent in Rajputs followed by Jatts, Arain, Sheikhs and Pathans. 56.7% of the couples were first cousins and 19.8% were relatives. The commonest mutations were Frameshift 8-9 (Fr8-9) 33.5%, Intervening Sequence 1-5 (IVS 1-5) 17.2%, Fr4142 - 8%, IVS 1-1 - 5.2%, Deletion 619 (Del 619) 4.2% and Codon 5 (Cd 5) - 4.2%. In samples sent for analysis, 53.1% turned out to be carriers (trait), 25.3% were diseased (thalassemia major) and 21.6% were normal. P-value of all results was less than 0.001. In this series, the highest frequency was found in Punjabi Rajputs. The commonest mutation was Fr 8-9. Most parents were first cousins. Premarital thalassemia carrier testing can effectively reduce the disease. (author)

  8. Genealogical and molecular analysis of a family-based cohort of congenital heart disease patients from the São Miguel Island (Azores, Portugal).

    Science.gov (United States)

    Cabral, Rita; Pires, Renato; Anjos, Rui; Branco, Claudia C; Maciel, Paula; Mota-Vieira, Luisa

    2016-11-01

    Congenital heart disease (CHD) is one common birth malformation, accounting for ∼30% of total congenital abnormalities. Considering the unknown role of consanguinity in causing CHD, this study hypothesised that consanguineous unions and/or familial aggregation may be frequent in the Azorean Island of São Miguel (Portugal). To that end, a retrospective observational study was performed based on genealogical and molecular analyses. The study enrolled 112 CHD patients from São Miguel Island, which allowed the assessment of type of family (simplex or multiplex), parental consanguinity and grandparental endogamy. Based on 15 STR markers, inbreeding coefficients (F IS ) in the CHD cohort and healthy control group (n = 114) were estimated. Multiplex families were 37.6% (n = 41/109), a rate considerably higher than previously described in the literature (genealogical and genetic features related with CHD, revealing the presence of parental consanguinity and extensive familial aggregation in the CHD patients from São Miguel Island.

  9. Mental disorders and consanguinity comparison of first-cousin marriages and matched unrelated marriages

    Energy Technology Data Exchange (ETDEWEB)

    Helgason, T

    1979-01-01

    Mental disorders have long been known to run in families. How and why has still not been agreed upon. However, most psychiatrists probably agree that there is no unitary cause, either environmental or hereditary, for the common mental disorders. In each case a number of etiological factors are at work to a variable extent, social, psychological, biochemical and pathophysiological. These include hereditary mechanism, such as predisposition which under certain stress (Rosenthal 1970) can result in a disease. The present paper is intended to give some additional data for the further discussion of the issues involved. It is a part of a larger study of first-cousin marriages and their children. The purpose of this larger study is to investigate various genetic markers among these families as well as their fertility, morbidity and mortality. Here the occurrence of mental disorders in these families will be analyzed and compared with that in the general population. If recessive hereditary traits are involved in the etiology of mental disorders an increased frequence should be expected among children of such families.

  10. Palliative Care Intervention in Improving Symptom Control and Quality of Life in Patients With Stage II-IV Non-small Cell Lung Cancer and Their Family Caregivers

    Science.gov (United States)

    2017-10-16

    Caregiver; Psychological Impact of Cancer and Its Treatment; Recurrent Non-small Cell Lung Cancer; Stage IIA Non-small Cell Lung Cancer; Stage IIB Non-small Cell Lung Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Non-small Cell Lung Cancer

  11. Suppression of Wnt signaling by the miR-29 family is mediated by demethylation of WIF-1 in non-small-cell lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Min [Department of Respiratory Medicine, Shanghai Tenth People’s Hospital, Tongji University, Shanghai 200072 (China); Wu, Junjie, E-mail: wujunjiesh@126.com [Department of Pneumology, Changhai Hospital of Shanghai, Second Military Medical University, Shanghai 200433 (China); State Key Laboratory of Genetic Engineering and Ministry of Education Key Laboratory of Contemporary Anthropology, School of Life Sciences, Fudan University, Shanghai 200433 (China); Cai, Yong, E-mail: dryongcai@126.com [Department of Radiation Oncology, Shanghai Pulmonary Hospital, Tongji University School of Medicine, Shanghai 200433 (China)

    2013-09-06

    Highlights: •Dnmt3A and Dnmt3B are involved in the down-regulation of WIF-1 expression in non-small-cell lung cancer. •MiR-29 family members could restore WIF-1 expression through demethylation. •MiR-29s suppress Wnt/β-catenin signaling pathway and inhibit tumor growth. •The expression of miR-29a and miR-29b could be regulated partially in a positive feedback loop. -- Abstract: Wnt inhibitory factor-1 (WIF-1) silencing induced by promoter hypermethylation is a common mechanism of aberrant activation of the Wnt signaling pathway in non-small-cell lung cancer (NSCLC). However, the activity of regulators associated with the methylation of the WIF-1 gene remains unclear. Here, we investigated the role of three DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) in the expression of WIF-1. The three DNMTs were up-regulated in NSCLC tumor tissues and suppression of DNMT3A and DNMT3B restored the expression of WIF-1 in NSCLC cells. The miR-29 family (miR-29a, -29b, and -29c), which negatively regulates DNMT3A and DNMT3B, was examined in association with the Wnt/β-catenin signaling pathway. A positive correlation between the expression of WIF-1 and that of MiR-29s was observed in NSCLC tissues. Methylation-specific PCR and Western blotting indicated that miR-29s positively regulate WIF-1 expression by inhibiting the methylation of its promoter. Furthermore, miR-29 overexpression downregulated β-catenin expression, inhibited cell proliferation and induced apoptosis. The expression of miR-29a and miR-29b was partially regulated by DNMT3A and DNMT3B in a positive feedback loop. Taken together, our findings show that miR-29s suppress the Wnt signaling pathway through demethylation of WIF-1 in NSCLC.

  12. Meanings of family under the perspective of parents of adolescent students

    Directory of Open Access Journals (Sweden)

    Francisca Georgina Macedo de Sousa

    2014-09-01

    Full Text Available This study aimed to understand the meanings of family according to parents of adolescent students. A qualitative research conducted with nine parents of adolescents from a public school, Maranhão, Brazil. Data collection occurred through unstructured interview from February to April 2011, and were submitted to thematic content analysis. Eight themes emerged: Structure, values and meanings of family; Roles and functions of family members; Family and school; Family dynamics and the health-disease process in the family; Affective bonds and family relationships; Strategies for family functioning; Feelings and support network; Adolescence and the adolescent in the family. The meanings of family overtook consanguinity, extending to friendship, solidarity and affection in a dynamic relationship that involves dialogue, affection, love and responsibility.

  13. Genome-wide identification and analysis of biotic and abiotic stress regulation of small heat shock protein (HSP20) family genes in bread wheat.

    Science.gov (United States)

    Muthusamy, Senthilkumar K; Dalal, Monika; Chinnusamy, Viswanathan; Bansal, Kailash C

    2017-04-01

    Small Heat Shock Proteins (sHSPs)/HSP20 are molecular chaperones that protect plants by preventing protein aggregation during abiotic stress conditions, especially heat stress. Due to global climate change, high temperature is emerging as a major threat to wheat productivity. Thus, the identification of HSP20 and analysis of HSP transcriptional regulation under different abiotic stresses in wheat would help in understanding the role of these proteins in abiotic stress tolerance. We used sequences of known rice and Arabidopsis HSP20 HMM profiles as queries against publicly available wheat genome and wheat full length cDNA databases (TriFLDB) to identify the respective orthologues from wheat. 163 TaHSP20 (including 109 sHSP and 54 ACD) genes were identified and classified according to the sub-cellular localization and phylogenetic relationship with sequenced grass genomes (Oryza sativa, Sorghum bicolor, Zea mays, Brachypodium distachyon and Setaria italica). Spatio-temporal, biotic and abiotic stress-specific expression patterns in normalized RNA seq and wheat array datasets revealed constitutive as well as inductive responses of HSP20 in different tissues and developmental stages of wheat. Promoter analysis of TaHSP20 genes showed the presence of tissue-specific, biotic, abiotic, light-responsive, circadian and cell cycle-responsive cis-regulatory elements. 14 TaHSP20 family genes were under the regulation of 8 TamiRNA genes. The expression levels of twelve HSP20 genes were studied under abiotic stress conditions in the drought- and heat-tolerant wheat genotype C306. Of the 13 TaHSP20 genes, TaHSP16.9H-CI showed high constitutive expression with upregulation only under salt stress. Both heat and salt stresses upregulated the expression of TaHSP17.4-CI, TaHSP17.7A-CI, TaHSP19.1-CIII, TaACD20.0B-CII and TaACD20.6C-CIV, while TaHSP23.7-MTI was specifically induced only under heat stress. Our results showed that the identified TaHSP20 genes play an important role under

  14. Beta-thalassemia- institution based analysis of ethnic and geographic distribution, effect of consanguinity and safety of chorionic villus sampling as a diagnostic, tool for pre-natal diagnosis in selected patients

    International Nuclear Information System (INIS)

    Abdullah, K.N.; Liaqat, J.; Azim, W.

    2011-01-01

    To study the ethnic and geographic distribution of Beta-thalassemia amongst the patients included and to study the effect of consanguinity in promoting this disease. Also, to establish the safety of CVS when used as a pre-natal diagnostic tool in aiding the early diagnosis of Beta-thalassemia in selected patients. Study Design: Descriptive Study. Place and Duration of Study: PNS Shifa Karachi, from Jan 2008 to Dec 2008. Patients and Methods: A total of 223 women out of 240 that were referred from all over Sindh to PNS Shifa Hospital Karachi for susceptible gene mutations participated in the study. The standard procedure that was used in this study was trans-abdominal aspiration of chorionic villi through suction needle. The samples were then sent for further analysis to the Pathology Department at PNS Shifa Hospital Karachi. Results: In our study population Beta-thalassemia was most prevalent in Sindhi 107 (48%) followed by Punjabi 46 (21%), 27 (12%) Pathan, and 43 (19%) Balochi. Out of 223 women, 95 were of thalassemia trait, while 85 were of thalassemia major. Fifty five percent of thalassemia trait and 56% of thalassemia major fetus parents were first cousins. The rate of pregnancy loss after performing CVS was 2.0% with no complications reported. Conclusion: It is concluded that highest percentage of thalassemia is in first cousins and sindhi origin families are mostly affected. However CVS is a safe and effective tool for prenatal diagnosis and subsequent counselling in selected couples. (author)

  15. Body Mass Index, family lifestyle, physical activity and eating behavior on a sample of primary school students in a small town of Western Sicily

    Directory of Open Access Journals (Sweden)

    Enza Sidoti

    2009-09-01

    Full Text Available

    Background: Obesity is actually a discernible issue in prosperous western society and is dramatically increasing in children and adolescents. Many studies indicate that obesity in childhood may become chronic disease in adulthood and, particularly, those who are severely overweight have an increased risk of death by cardiovascular disease. Understanding the determinants of life style and behavior in a person’s youth and making attempts to change children’s habits is considered a key strategy in the primary prevention of obesity. This study aims to find a correlation between Body Mass Index, (BMI, physical activity and eating behavior and to identify, eventually, risks, protective factors and possible directions for interventions on incorrect nutritional/physical activity and intra-familiar life styles in a sample of young adolescents in a small town of Western Sicily.

    Methods: The research surveyed the entire population of the last three curricular years of two Primary Schools in a town of western Sicily, (n=294. The instrument used for the survey was a questionnaire containing 20 different items with multiple choices answers. Personal information, physical activity and eating behaviors were collected both for parents and students to cross students’ and parents’ characteristics. Data were codified and statistical analysis was computed through Statistica and Openstat software.

    Results: Data obtained demonstrated a relevant percentage (18% of obese children. Prevalence of overweight was high as well, (23%, and many in this area (12% were at risk since they were on the limits of the lower class. A significant association was found between the percentage of students classified as having an elevated BMI and a sedentary habit and/or an incorrect eating behavior. Among the overweight and obese children a direct statistical association was also shown between the weight of their

  16. An investigation of the impact of succession planning on the success of small and medium-sized family businesses / Hilton Edwin Nell

    OpenAIRE

    Nell, Hilton Edwin

    2014-01-01

    The objective of this study is to assess the role that succession planning plays in family businesses in the Sedibeng region of the Gauteng province in South Africa. According to Netsiande (2008:1) family businesses should anticipate, recognise, understand and work pro-actively on issues, learn from other businesses and find their own unique solution.to ensure sustainability. Management succession and succession planning is very important and it has a significant impact on family member...

  17. THE MYC FAMILY OF ONCOGENES AND THEIR PRESENCE AND IMPORTANCE IN SMALL-CELL LUNG-CARCINOMA AND OTHER TUMOR TYPES

    NARCIS (Netherlands)

    DEVRIES, EGE; MULDER, NH

    1993-01-01

    The myc family of cellular oncogenes, c - myr, N - myc, encodes three highly related, cell cycle specific, nuclear phosphoproteins. All are able to transform primary rat embryo fibroblasts when cotransfected with the c - ras oncogene. Myc family genes am differentially expressed with respect to

  18. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  19. Familial short fifth metacarpals and insulin resistance

    International Nuclear Information System (INIS)

    Hyari, Muwafag; Hamamy, Hanan; Barham, Muries; Ajlouni, Kamel; Al-Hadidy, Azmy

    2006-01-01

    Very few reports on the phenotype of short fifth metacarpals have been published in the medical literature. We report a Jordanian family in which three sisters aged 15, 13 and 8 years revealed bilateral shortening of the fifth fingers and radiological shortening of the fifth metacarpals. The father had unilateral short fifth metacarpal. The elder two sisters, their father as well as their brother and another sister manifested insulin resistance. Spherocytosis was diagnosed in one of the girls and her father. The parents are non-consanguineous. This constellation of findings has not been previously reported and could point to the presence of two disorders segregating in the family or to a novel syndrome with autosomal dominant inheritance and variable expressivity. (orig.)

  20. Intermittent chronic neutropenia in a patient with familial Mediterranean fever.

    Science.gov (United States)

    Ganiou Tidjani, K; Ailal, F; Najib, J; Bellanné-Chantelot, C; Donadieu, J; Bousfiha, A A

    2008-11-01

    A 12-year-old daughter of consanguineous Moroccan parents was diagnosed with cyclic neutropenia, based on a combination of recurrent gingivostomatitis, a fluctuating neutrophil count, and several episodes of severe neutropenia. No ELA2 gene mutations were found. At age 19 years she presented with edema of the limbs, proteinuria and renal failure. Renal amyloidosis AA was diagnosed by biopsy. Gene mutations associated with family Mediterranean fever (FMF) were sought, and a homozygous mutation (M694V) was found in the MFEV gene. This is the novel finding of FMF that masqueraded as cyclic neutropenia. (c) 2008 Wiley-Liss, Inc.

  1. Analyses of MMP20 Missense Mutations in Two Families with Hypomaturation Amelogenesis Imperfecta.

    Science.gov (United States)

    Kim, Youn Jung; Kang, Jenny; Seymen, Figen; Koruyucu, Mine; Gencay, Koray; Shin, Teo Jeon; Hyun, Hong-Keun; Lee, Zang Hee; Hu, Jan C-C; Simmer, James P; Kim, Jung-Wook

    2017-01-01

    Amelogenesis imperfecta is a group of rare inherited disorders that affect tooth enamel formation, quantitatively and/or qualitatively. The aim of this study was to identify the genetic etiologies of two families presenting with hypomaturation amelogenesis imperfecta. DNA was isolated from peripheral blood samples obtained from participating family members. Whole exome sequencing was performed using DNA samples from the two probands. Sequencing data was aligned to the NCBI human reference genome (NCBI build 37.2, hg19) and sequence variations were annotated with the dbSNP build 138. Mutations in MMP20 were identified in both probands. A homozygous missense mutation (c.678T>A; p.His226Gln) was identified in the consanguineous Family 1. Compound heterozygous MMP20 mutations (c.540T>A, p.Tyr180 * and c.389C>T, p.Thr130Ile) were identified in the non-consanguineous Family 2. Affected persons in Family 1 showed hypomaturation AI with dark brown discoloration, which is similar to the clinical phenotype in a previous report with the same mutation. However, the dentition of the Family 2 proband exhibited slight yellowish discoloration with reduced transparency. Functional analysis showed that the p.Thr130Ile mutant protein had reduced activity of MMP20, while there was no functional MMP20 in the Family 1 proband. These results expand the mutational spectrum of the MMP20 and broaden our understanding of genotype-phenotype correlations in amelogenesis imperfecta.

  2. Analyses of MMP20 Missense Mutations in Two Families with Hypomaturation Amelogenesis Imperfecta

    Directory of Open Access Journals (Sweden)

    Jung-Wook Kim

    2017-04-01

    Full Text Available Amelogenesis imperfecta is a group of rare inherited disorders that affect tooth enamel formation, quantitatively and/or qualitatively. The aim of this study was to identify the genetic etiologies of two families presenting with hypomaturation amelogenesis imperfecta. DNA was isolated from peripheral blood samples obtained from participating family members. Whole exome sequencing was performed using DNA samples from the two probands. Sequencing data was aligned to the NCBI human reference genome (NCBI build 37.2, hg19 and sequence variations were annotated with the dbSNP build 138. Mutations in MMP20 were identified in both probands. A homozygous missense mutation (c.678T>A; p.His226Gln was identified in the consanguineous Family 1. Compound heterozygous MMP20 mutations (c.540T>A, p.Tyr180* and c.389C>T, p.Thr130Ile were identified in the non-consanguineous Family 2. Affected persons in Family 1 showed hypomaturation AI with dark brown discoloration, which is similar to the clinical phenotype in a previous report with the same mutation. However, the dentition of the Family 2 proband exhibited slight yellowish discoloration with reduced transparency. Functional analysis showed that the p.Thr130Ile mutant protein had reduced activity of MMP20, while there was no functional MMP20 in the Family 1 proband. These results expand the mutational spectrum of the MMP20 and broaden our understanding of genotype-phenotype correlations in amelogenesis imperfecta.

  3. Family welfare.

    Science.gov (United States)

    Sinha, N K

    1992-01-01

    Between 1901-1921, India gained 12.9 million people because mortality remained high. The death rate fell between 1921-1951, but birth rates remained the same. Therefore 110 million people were added--2 times the population increase between 1891-1921. Between 1951-1981, the population increased to 324 million. Socioeconomic development was responsible for most of the downward trend in the birth rate during the 20th century. Even though large families were the norm in early India, religious leaders encouraged small family size. The 1st government family planning clinics in the world opened in Mysore and Bangalore in 1930. Right before Independence, the Bhore Committee made recommendations to reduce population growth such as increasing the age of marriage for girls. Since 1951 there has been a change in measures and policies geared towards population growth with each of the 7 5-Year Plans because policy makers applied what they learned from each previous plan. The 1st 5-Year Plan emphasized the need to understand what factors contribute to population growth. It also integrated family planning services into health services of hospitals and health centers. The government was over zealous in its implementation of the sterilization program (2nd 5-Year Plan, 1956-1961), however, which hurt family planning programs for many years. As of early 1992, sterilization, especially tubectomy, remained the most popular family planning method, however. The 7th 5-Year Plan changed its target of reaching a Net Reproductive Rate of 1 by 2001 to 2006-2011. It set a goal of 100% immunization coverage by 1990 but it did not occur. In 1986, the Ministry of Health and Family Welfare planned to make free contraceptives available in urban and rural areas and to involve voluntary organizations. The government needs to instill measures to increase women's status, women's literacy, and age of marriage as well as to eliminate poverty, ensure old age security, and ensure child survival and

  4. Women with family cancer history are at risk for poorer physical quality of life and lower self-efficacy: a longitudinal study among men and women with non-small cell lung cancer.

    Science.gov (United States)

    Banik, Anna; Schwarzer, Ralf; Pawlowska, Izabela; Boberska, Monika; Cieslak, Roman; Luszczynska, Aleksandra

    2017-04-04

    We investigated the determinants of trajectories of physical symptoms related to lung cancer (a quality of life [QOL] aspect) and self-efficacy among patients with non-small cell lung cancer (NSCLC). It was hypothesized that gender and family cancer history in first-degree relatives would have synergistic effects on QOL-lung cancer specific symptoms and self-efficacy. Women with family cancer history were expected to be at risk of poorer adjustment. Quantitative, longitudinal design was applied. Participants provided their responses at 3-4 days after surgery, 1-month follow-up, and 4-month follow-up. We recruited 102 in-patients (men: 51%) with NSCLC who underwent surgery aimed at removing a lung tumor. Self-report data were collected with QLQ-LC13 and a scale for self-efficacy for managing illness. Mixed-models analysis indicated that trajectories of physical quality of life (symptoms of lung cancer) as well as self-efficacy were unfavorable among women with family cancer history. Among NSCLC patients, gender and family cancer history may be considered basic screening criteria for identifying groups of patients at risk for poorer physical QOL (higher level of physical symptoms related to lung cancer) and lower incline of self-efficacy after cancer surgery.

  5. The quest for small family size among Pakistani women--is voluntary termination of pregnancy a matter of choice or necessity?

    Science.gov (United States)

    Saleem, Sarah; Fikree, Fariyal F

    2005-07-01

    To present the socio-biologic predictors of induced abortion among married women residing in low income squatter settlements of Karachi, Pakistan. A cross-sectional survey was conducted in three squatter settlements of Karachi from June to August 1997. Interviews were conducted on 1,214 married women assessing past pregnancy history, literacy and employment status of self and spouse and specifically probing for past history of seeking an induced abortion. Fifty women reported an induced abortion during last three years prior to survey. Of these, forty percent (20/50) of abortion seekers were using some method of family planning before conceiving the index pregnancy. Post abortion family planning method use was adopted by 50% (25/50) of the abortion seekers. The most parsimonious multivariate logistic regression model included grand-multigravidity (OR 2.6 CI, 1.3 - 5.2), literate status of the woman (OR 1.9 CI, 1.0 - 3.4) and the 26-35 age group (OR 3.0 CI, 1.4 - 6.6). Unplanned/mistimed pregnancies generally result from high unmet need and ineffective use of contraceptives and culminate through induced abortions. We propose that improvement in the quality of family planning counseling should be targeted to effective use of a method, back-up support in case of method failure and the health consequences of unsafe abortions.

  6. Familial epilepsy in Algeria: Clinical features and inheritance profiles.

    Science.gov (United States)

    Chentouf, Amina; Dahdouh, Aïcha; Guipponi, Michel; Oubaiche, Mohand Laïd; Chaouch, Malika; Hamamy, Hanan; Antonarakis, Stylianos E

    2015-09-01

    To document the clinical characteristics and inheritance pattern of epilepsy in multigeneration Algerian families. Affected members from extended families with familial epilepsy were assessed at the University Hospital of Oran in Algeria. Available medical records, neurological examination, electroencephalography and imaging data were reviewed. The epilepsy type was classified according to the criteria of the International League Against Epilepsy and modes of inheritance were deduced from pedigree analysis. The study population included 40 probands; 23 male (57.5%) and 17 female subjects (42.5%). The mean age of seizure onset was 9.5 ± 6.1 years. According to seizure onset, 16 patients (40%) had focal seizures and 20 (50%) had generalized seizures. Seizure control was achieved for two patients (5%) for 10 years, while 28 (70%) were seizure-free for 3 months. Eleven patients (27.5%) had prior febrile seizures, 12 were diagnosed with psychiatric disorders and four families had syndromic epilepsy. The consanguinity rate among parents of affected was 50% with phenotypic concordance observed in 25 families (62.5%). Pedigree analysis suggested autosomal dominant (AD) inheritance with or without reduced penetrance in 18 families (45%), probable autosomal recessive (AR) inheritance in 14 families (35%), and an X-linked recessive inheritance in one family. This study reveals large Algerian families with multigenerational inheritance of epilepsy. Molecular testing such as exome sequencing would clarify the genetic basis of epilepsy in some of our families. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  7. FAMILY BOMBYLIIDAE.

    Science.gov (United States)

    Lamas, Carlos José Einicker; Evenhuis, Neal L

    2016-06-14

    Bombyliidae is one of the largest Diptera families with more than 4,500 recognized species worldwide. Their species vary from robust to thin, and may be small to large (2-20mm) and looks like bees or wasps. They also present great variation in color. Adults can often be seen either resting and sunning themselves on trails, rocks or twigs or feeding on flowering plants as they are nectar feeders. All reared bee flies are predators or parasitoids of arthropods. The Colombian fauna of bombyliids comprises at the moment 22 species, and 12 genera, of which, six are endemic species. Nonetheless, this number may be much higher, as Colombia is a megadiverse country and there are not many specimens of this family deposited in collections all over the world.

  8. A two fold risk of metabolic syndrome in a sample of patients with schizophrenia: do consanguinity and family history increase risk?

    Science.gov (United States)

    Bener, Abdulbari; Al-Hamaq, Abdulla O A A; Dafeeah, Elnour E

    2014-01-01

    Patients with schizophrenia are at greater risk for metabolic syndrome (MetS) and other cardiovascular risk factors. The objective of the study was to examine the prevalence of metabolic syndrome (MetS) and its criteria among patients with schizophrenia (Sz) according to the revised criteria of NCEP ATP III and assess which component contributed to the increased risk of the MetS in schizophrenia patients. This was a matched case-control study. Outpatient clinics of the Psychiatry department and Primary Health Care (PHC) Centers of the Supreme Council of Health, State of Qatar. The study was carried out among patients with schizophrenia (SZ) and healthy subjects above 20 years old. The study based on matched by age and gender of 233 cases and 466 controls. The survey was conducted from June 2010 to May 2011. Face to face interviews were conducted using a structured questionnaire followed by laboratory tests. Metabolic syndrome was defined using the National Cholesterol Education Program - Third Adult Treatment Panel (ATP III). The prevalence of metabolic syndrome among schizophrenic patients (36.5%) were significantly higher than healthy subjects (18.7%) (pmetabolic abnormalities compared to men. The study indicated that metabolic syndrome was highly prevalent in patients with schizophrenia. The female gender was significantly associated with a higher prevalence of metabolic syndrome. The identification and clinical management of this high risk group is of great importance. Copyright © 2013 Diabetes India. Published by Elsevier Ltd. All rights reserved.

  9. Homozygous disruption of PDZD7 by reciprocal translocation in a consanguineous family: a new member of the Usher syndrome protein interactome causing congenital hearing impairment.

    Science.gov (United States)

    Schneider, Eberhard; Märker, Tina; Daser, Angelika; Frey-Mahn, Gabriele; Beyer, Vera; Farcas, Ruxandra; Schneider-Rätzke, Brigitte; Kohlschmidt, Nicolai; Grossmann, Bärbel; Bauss, Katharina; Napiontek, Ulrike; Keilmann, Annerose; Bartsch, Oliver; Zechner, Ulrich; Wolfrum, Uwe; Haaf, Thomas

    2009-02-15

    A homozygous reciprocal translocation, 46,XY,t(10;11),t(10;11), was detected in a boy with non-syndromic congenital sensorineural hearing impairment. Both parents and their four other children were heterozygous translocation carriers, 46,XX,t(10;11) and 46,XY,t(10;11), respectively. Fluorescence in situ hybridization of region-specific clones to patient chromosomes was used to localize the breakpoints within bacterial artificial chromosome (BAC) RP11-108L7 on chromosome 10q24.3 and within BAC CTD-2527F12 on chromosome 11q23.3. Junction fragments were cloned by vector ligation and sequenced. The chromosome 10 breakpoint was identified within the PDZ domain containing 7 (PDZD7) gene, disrupting the open reading frame of transcript PDZD7-C (without PDZ domain) and the 5'-untranslated region of transcript PDZD7-D (with one PDZ and two prolin-rich domains). The chromosome 11 breakpoint was localized in an intergenic segment. Reverse transcriptase-polymerase chain reaction analysis revealed PDZD7 expression in the human inner ear. A murine Pdzd7 transcript that is most similar in structure to human PDZD7-D is known to be expressed in the adult inner ear and retina. PDZD7 shares sequence homology with the PDZ domain-containing genes, USH1C (harmonin) and DFNB31 (whirlin). Allelic mutations in harmonin and whirlin can cause both Usher syndrome (USH1C and USH2D, respectively) and congenital hearing impairment (DFNB18 and DFNB31, respectively). Protein-protein interaction assays revealed the integration of PDZD7 in the protein network related to the human Usher syndrome. Collectively, our data provide strong evidence that PDZD7 is a new autosomal-recessive deafness-causing gene and also a prime candidate gene for Usher syndrome.

  10. Crystallization and preliminary X-ray diffraction analysis of XAC1151, a small heat-shock protein from Xanthomonas axonopodis pv. citri belonging to the α-crystallin family

    Energy Technology Data Exchange (ETDEWEB)

    Hilario, Eduardo; Teixeira, Elaine Cristina; Pedroso, Gisele Audrei; Bertolini, Maria Célia [Departamento de Bioquímica e Tecnologia Química, Instituto de Química, Universidade Estadual Paulista, Araraquara-SP (Brazil); Medrano, Francisco Javier, E-mail: fjmedrano@yahoo.com [Departamento de Cristalografia de Proteínas, Centro de Biologia Molecular Estrutural, Laboratório Nacional de Luz Síncrotron, Caixa Postal 6192, CEP 13084-971, Campinas-SP (Brazil); Departamento de Bioquímica e Tecnologia Química, Instituto de Química, Universidade Estadual Paulista, Araraquara-SP (Brazil)

    2006-05-01

    XAC1151, a small heat-shock protein from X. axonopodis pv. citri belonging to the α-crystallin family, was crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium phosphate. X-ray diffraction data were collected to 1.65 Å resolution using a synchrotron-radiation source. The hspA gene (XAC1151) from Xanthomonas axonopodis pv. citri encodes a protein of 158 amino acids that belongs to the small heat-shock protein (sHSP) family of proteins. These proteins function as molecular chaperones by preventing protein aggregation. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium phosphate. X-ray diffraction data were collected to 1.65 Å resolution using a synchrotron-radiation source. The crystal belongs to the rhombohedral space group R3, with unit-cell parameters a = b = 128.7, c = 55.3 Å. The crystal structure was solved by molecular-replacement methods. Structure refinement is in progress.

  11. Insight into durum wheat Lpx-B1: a small gene family coding for the lipoxygenase responsible for carotenoid bleaching in mature grains.

    Science.gov (United States)

    Verlotta, Angelo; De Simone, Vanessa; Mastrangelo, Anna M; Cattivelli, Luigi; Papa, Roberto; Trono, Daniela

    2010-11-26

    The yellow colour of pasta products is one of the main criteria used by consumers to assess pasta quality. This character is due to the presence of carotenoid pigments in semolina. During pasta processing, oxidative degradation of carotenoid pigments occurs mainly due to lipoxygenase (LOX). In durum wheat (Triticum durum Desf.), two Lpx-1 genes have been identified on chromosome 4B, Lpx-B1.1 and Lpx-B1.2, and evidences have been reported that the deletion of Lpx-B1.1 is associated with a strong reduction in LOX activity in semolina. In the present study, we characterised the Lpx-B1 gene family identified in a durum wheat germplasm collection and related the distribution and expression of the Lpx-B1 genes and alleles to variations in LOX activity in the mature grains. In addition to the already known Lpx-B1.1 and Lpx-B1.2 genes, a new gene was identified, Lpx-B1.3, along with three different Lpx-B1.1 alleles, Lpx-B1.1a, Lpx-B1.1b and the partially deleted Lpx-B1.1c. Screening of the germplasm collection showed that all of the genotypes have one of the three Lpx-B1.1 alleles, associated with either Lpx-B1.2 or Lpx-B1.3, thus showing that in this collection the two genes are alternatives. Therefore, based on Lpx-B1 distribution, three different haplotypes were distinguished: haplotype I, carrying Lpx-B1.3 and the Lpx-B1.1b allele; haplotype II carrying Lpx-B1.2 and the Lpx-B1.1a allele; and haplotype III carrying Lpx-B1.2 and the Lpx-B1.1c allele. Determination of Lpx-B1 transcript abundance and total LOX activity in mature grains revealed differences among these three haplotypes: haplotypes I, II and III showed high, intermediate and low levels, respectively, of functional Lpx-B1 transcripts and enzymatic activity. In this germplasm collection, the Lpx-B1 gene family accounts for most of the total LOX activity in the mature grains. Information on these Lpx-B1 haplotypes provides significant improvement for prediction of LOX-1 activity levels in mature grains, and

  12. SugE belongs to the small multidrug resistance (SMR) protein family involved in tributyltin (TBT) biodegradation and bioremediation by alkaliphilic Stenotrophomonas chelatiphaga HS2.

    Science.gov (United States)

    Hassan, Hamdy A

    2018-03-01

    Tributyltin (TBT) used in a variety of industrial processes, subsequent discharge into the environment, its fate, toxicity and human exposure are topics of current concern. TBT degradation by alkaliphilic bacteria may be a key factor in the remediation of TBT in high pH contaminated sites. In this study, Stenotrophomonas chelatiphaga HS2 were isolated and identified from TBT contaminated site in Mediterranean Sea. S. chelatiphaga HS2 has vigor capability to transform TBT into dibutyltin and monobutyltin (DBT and MBT) at pH 9 and 7% NaCl (w/v). A gene was amplified and characterized from strain HS2 as SugE protein belongs to SMR protein family, a reverse transcription polymerase chain reaction analysis confirmed that SugE protein involved in the TBT degradation by HS2 strain. TBT bioremediation was investigated in stimulated TBT contaminated sediment samples (pH 9) using S chelatiphaga HS2 in association with E. coli BL21 (DE3)-pET28a(+)-sugE instead of S chelatiphaga HS2 alone reduced significantly the TBT half-life from 12d to 5d, although no TBT degradation appeared using E. coli BL21 (DE3)-pET28a(+)-sugE alone. This finding indicated that SugE gene increased the rate and degraded amount of TBT and is necessary in enhancing TBT bioremediation. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. [Dwarfism due to familial panhypopituitarism].

    Science.gov (United States)

    Cos Welsh, J; Espinosa de los Monteros, A; de la Luz Ajuria, M; Morillo Almao, E

    1977-01-01

    Three sisters of 27 7/12, 13 8/12 and 9 1/12 years of age, respectively, with proportionate dwarfism, high pitched voice and lack of sexual development are described. All the patients had very low serum levels of immunoreactive growth hormone (GH), as well as of LH and FSH. Hypoglycemia induced by insulin and arginine infusion failed to increase GH levels, and the administration of the hypothalamic LH-FSH releasing hormone (LH-RH) did not elicit any response in the secretion of gonadotropins. The oldest sister developed hypothyroidism in recent years, since the I131 thyroid uptake was normal ten years before; her serum TSH was low and did not change with TRH stimulation. In addition, a low pituitary ACTH reserve was demonstrated by the hypoglycemia and metirapone tests. Case 2 showed partial pituitary TSH and ACTH reserve, whereas the youngest child only had low TSH pituitary reserve. These patients had all the clinical and laboratory characteristics of familial panhypopituitarism, with normal sella turcica. Genetic transmission in this cases is consistent with the autosomal recessive form, which is the most frequent type of inheritance of this entity. Consanguinity can not be ruled out. The results of the hypothalamic-pituitary functional tests apparently suggest that the primary defect could be located at the pituitary level. It is also possible that the pathological process may have a progressive evolution.

  14. Family Therapy

    Science.gov (United States)

    Family therapy Overview Family therapy is a type of psychological counseling (psychotherapy) that can help family members improve communication and resolve conflicts. Family therapy is usually provided by a psychologist, ...

  15. Dissolved families

    DEFF Research Database (Denmark)

    Christoffersen, Mogens

    The situation in the family preceding a family separation is studied here, to identify risk factors for family dissolution. Information registers covering prospective statistics about health aspects, demographic variables, family violence, self-destructive behaviour, unemployment, and the spousal...

  16. Negative regulation of AMP-activated protein kinase (AMPK) activity by macrophage migration inhibitory factor (MIF) family members in non-small cell lung carcinomas.

    Science.gov (United States)

    Brock, Stephanie E; Rendon, Beatriz E; Yaddanapudi, Kavitha; Mitchell, Robert A

    2012-11-02

    AMP-activated protein kinase (AMPK) is a nutrient- and metabolic stress-sensing enzyme activated by the tumor suppressor kinase, LKB1. Because macrophage migration inhibitory factor (MIF) and its functional homolog, d-dopachrome tautomerase (d-DT), have protumorigenic functions in non-small cell lung carcinomas (NSCLCs) but have AMPK-activating properties in nonmalignant cell types, we set out to investigate this apparent paradox. Our data now suggest that, in contrast to MIF and d-DTs AMPK-activating properties in nontransformed cells, MIF and d-DT act cooperatively to inhibit steady-state phosphorylation and activation of AMPK in LKB1 wild type and LKB1 mutant human NSCLC cell lines. Our data further indicate that MIF and d-DT, acting through their shared cell surface receptor, CD74, antagonize NSCLC AMPK activation by maintaining glucose uptake, ATP production, and redox balance, resulting in reduced Ca(2+)/calmodulin-dependent kinase kinase β-dependent AMPK activation. Combined, these studies indicate that MIF and d-DT cooperate to inhibit AMPK activation in an LKB1-independent manner.

  17. Family relationship, water contact and occurrence of Buruli ulcer in Benin.

    Directory of Open Access Journals (Sweden)

    Ghislain Emmanuel Sopoh

    Full Text Available BACKGROUND: Mycobacterium ulcerans disease (Buruli ulcer is the most widespread mycobacterial disease in the world after leprosy and tuberculosis. How M. ulcerans is introduced into the skin of humans remains unclear, but it appears that individuals living in the same environment may have different susceptibilities. OBJECTIVES: This study aims to determine whether frequent contacts with natural water sources, family relationship or the practice of consanguineous marriages are associated with the occurrence of Buruli ulcer (BU. DESIGN: Case control study. SETTING: Department of Atlantique, Benin. SUBJECTS: BU-confirmed cases that were diagnosed and followed up at the BU detection and treatment center (CDTUB of Allada (Department of the Atlantique, Benin during the period from January 1st, 2006, to June 30th, 2008, with three matched controls (persons who had no signs or symptoms of active or inactive BU for age, gender and village of residence per case. MAIN OUTCOMES MEASURED: Contact with natural water sources, BU history in the family and the practice of consanguineous marriages. RESULTS: A total of 416 participants were included in this study, including 104 cases and 312 controls. BU history in the family (p<0.001, adjusted by daily contact with a natural water source (p = 0.007, was significantly associated with higher odds of having BU (OR; 95% CI = 5.5; 3.0-10.0. The practice of consanguineous marriage was not associated with the occurrence of BU (p = 0.40. Mendelian disorders could explain this finding, which may influence individual susceptibility by impairing immunity. CONCLUSION: This study suggests that a combination of genetic factors and behavioral risk factors may increase the susceptibility for developing BU.

  18. Preclinical evaluation of the imipridone family, analogs of clinical stage anti-cancer small molecule ONC201, reveals potent anti-cancer effects of ONC212.

    Science.gov (United States)

    Wagner, Jessica; Kline, Christina Leah; Ralff, Marie D; Lev, Avital; Lulla, Amriti; Zhou, Lanlan; Olson, Gary L; Nallaganchu, Bhaskara Rao; Benes, Cyril H; Allen, Joshua E; Prabhu, Varun V; Stogniew, Martin; Oster, Wolfgang; El-Deiry, Wafik S

    2017-10-02

    Anti-cancer small molecule ONC201 upregulates the integrated stress response (ISR) and acts as a dual inactivator of Akt/ERK, leading to TRAIL gene activation. ONC201 is under investigation in multiple clinical trials to treat patients with cancer. Given the unique imipridone core chemical structure of ONC201, we synthesized a series of analogs to identify additional compounds with distinct therapeutic properties. Several imipridones with a broad range of in vitro potencies were identified in an exploration of chemical derivatives. Based on in vitro potency in human cancer cell lines and lack of toxicity to normal human fibroblasts, imipridones ONC206 and ONC212 were prioritized for further study. Both analogs inhibited colony formation, and induced apoptosis and downstream signaling that involves the integrated stress response and Akt/ERK, similar to ONC201. Compared to ONC201, ONC206 demonstrated improved inhibition of cell migration while ONC212 exhibited rapid kinetics of activity. ONC212 was further tested in >1000 human cancer cell lines in vitro and evaluated for safety and anti-tumor efficacy in vivo. ONC212 exhibited broad-spectrum efficacy at nanomolar concentrations across solid tumors and hematological malignancies. Skin cancer emerged as a tumor type with improved efficacy relative to ONC201. Orally administered ONC212 displayed potent anti-tumor effects in vivo, a broad therapeutic window and a favorable PK profile. ONC212 was efficacious in vivo in BRAF V600E melanoma models that are less sensitive to ONC201. Based on these findings, ONC212 warrants further development as a drug candidate. It is clear that therapeutic utility extends beyond ONC201 to include additional imipridones.

  19. Family emotional expressiveness and family structure

    Directory of Open Access Journals (Sweden)

    Čotar-Konrad Sonja

    2016-01-01

    Full Text Available The present paper scrutinizes the relationship between family emotional expressiveness (i.e., the tendency to express dominant and/or submissive positive and negative emotions and components of family structure as proposed in Olson’s Circumplex model (i.e., cohesion and flexibility, family communication, and satisfaction in families with adolescents. The study was conducted on a sample of 514 Slovenian adolescents, who filled out two questionnaires: the Slovenian version of Family Emotional Expressiveness - FEQ and FACES IV. The results revealed that all four basic dimensions of family functioning were significantly associated with higher/more frequent expressions of positive submissive emotions, as well as with lower/less frequent expressions of negative dominant emotions. Moreover, expressions of negative submissive emotions explained a small, but significant amount of variance in three out of four family functioning variables (satisfaction, flexibility, and communication. The importance of particular aspects of emotional expressiveness for family cohesion, flexibility, communication, and satisfaction is discussed, and the relevance of present findings for family counselling is outlined.

  20. Intergenerational patterns of family violence related to alcohol abuse: a genogram-based study

    Directory of Open Access Journals (Sweden)

    Cláudia Silveira Tondowski

    2014-12-01

    Full Text Available The objective of this study was to analyze intergenerational patterns of alcohol related violence (ARV. An intentional sample comprising 42 family members was selected according to a set of criteria, including history of ARV. A genogram based on anonymous semi-structured taped interviews was created. The Content Analysis pointed to different patterns of repetition of intergenerational ARV. The most recurrent ones were those of lineal consanguinity (father/son and through marriage. We observed similarities over the generations of each family as regards the pattern of alcohol consumption; the type of violence; the family reaction and the family life cycle in which ARV was intensified. Our results confirm the intergenerational reproduction of ARV. In conclusion, it is important to create intervention strategies to prevent intergenerational repetition of this association of behaviors.

  1. Family relationship, water contact and occurrence of Buruli ulcer in Benin.

    Science.gov (United States)

    Sopoh, Ghislain Emmanuel; Barogui, Yves Thierry; Johnson, Roch Christian; Dossou, Ange Dodji; Makoutodé, Michel; Anagonou, Sévérin Y; Kestens, Luc; Portaels, Françoise

    2010-07-13

    Mycobacterium ulcerans disease (Buruli ulcer) is the most widespread mycobacterial disease in the world after leprosy and tuberculosis. How M. ulcerans is introduced into the skin of humans remains unclear, but it appears that individuals living in the same environment may have different susceptibilities. This study aims to determine whether frequent contacts with natural water sources, family relationship or the practice of consanguineous marriages are associated with the occurrence of Buruli ulcer (BU). Case control study. Department of Atlantique, Benin. BU-confirmed cases that were diagnosed and followed up at the BU detection and treatment center (CDTUB) of Allada (Department of the Atlantique, Benin) during the period from January 1st, 2006, to June 30th, 2008, with three matched controls (persons who had no signs or symptoms of active or inactive BU) for age, gender and village of residence per case. Contact with natural water sources, BU history in the family and the practice of consanguineous marriages. A total of 416 participants were included in this study, including 104 cases and 312 controls. BU history in the family (pconsanguineous marriage was not associated with the occurrence of BU (p = 0.40). Mendelian disorders could explain this finding, which may influence individual susceptibility by impairing immunity. This study suggests that a combination of genetic factors and behavioral risk factors may increase the susceptibility for developing BU.

  2. Intra-Family Gamete Donation: A Solution to Concerns Regarding Gamete Donation in China?

    Science.gov (United States)

    Liao, Juhong; Devolder, Katrien

    2016-09-01

    Gamete donation from third parties is controversial in China as it severs blood ties, which are considered of utmost importance in Confucian tradition. In recent years, infertile couples are increasingly demonstrating a preference for the use of gametes donated by family members to conceive children-known as "intra-family gamete donation." The main advantage of intra-family gamete donation is that it maintains blood ties between children and both parents. To date there is no practice of intra-family gamete donation in China. In this paper, we investigate intra-family adoption in China in order to illustrate that intra-family gamete donation is consistent with Confucian tradition regarding the importance of maintaining blood ties within the family. There are several specific ethical issues raised by intra-family gamete donation. It may, for example, result in consanguinity and the semblance of incest, lead to confused family relationships, and raise concerns about possible coercion of familial donors. Confucian tradition provides a new approach to understand and deal with these ethical issues in a way that Western tradition does not. As a result, we suggest intra-family gamete donation could be an acceptable solution to the problem of infertility in China. However, further discussion and open debates on the ethical issues raised by intra-family gamete donation are needed in China.

  3. Disease severity in familial cases of IBD.

    Science.gov (United States)

    Andreu, M; Márquez, L; Domènech, E; Gisbert, J P; García, V; Marín-Jiménez, I; Peñalva, M; Gomollón, F; Calvet, X; Merino, O; Garcia-Planella, E; Vázquez-Romero, N; Esteve, M; Nos, P; Gutiérrez, A; Vera, I; Cabriada, J L; Martín, M D; Cañas-Ventura, A; Panés, J

    2014-03-01

    Phenotypic traits of familial IBD relative to sporadic cases are controversial, probably related to limited statistical power of published evidence. To know if there are phenotype differences between familial and sporadic IBD, evaluating the prospective Spanish registry (ENEIDA) with 11,983 cases. 5783 patients (48.3%) had ulcerative colitis (UC) and 6200 (51.7%) Crohn's disease (CD). Cases with one or more 1st, 2nd or 3rd degree relatives affected by UC/CD were defined as familial case. In UC and CD, familial cases compared with sporadic cases had an earlier disease onset (UC: 33 years [IQR 25-44] vs 37 years [IQR 27-49]; p<0.0001); (CD: 27 years [IQR 21-35] vs 29 years [IQR 22-40]; p<0.0001), higher prevalence of extraintestinal immune-related manifestations (EIMs) (UC: 17.2% vs 14%; p=0.04); (CD: 30.1% vs 23.6%; p<0.0001). Familial CD had higher percentage of ileocolic location (42.7% vs 51.8%; p=0.0001), penetrating behavior (21% vs 17.6%; p=0.01) and perianal disease (32% vs 27.1%; p=0.003). Differences are not influenced by degree of consanguinity. When a sufficiently powered cohort is evaluated, familial aggregation in IBD is associated to an earlier disease onset, more EIMs and more severe phenotype in CD. This feature should be taken into account at establishing predictors of disease course. © 2013.

  4. Family Meals

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Family Meals KidsHealth / For Parents / Family Meals What's in ... even more important as kids get older. Making Family Meals Happen It can be a big challenge ...

  5. Family Arguments

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Life Listen Español Text Size Email Print Share Family Arguments Page Content Article Body We seem to ...

  6. Family History

    Science.gov (United States)

    Your family history includes health information about you and your close relatives. Families have many factors in common, including their genes, ... as heart disease, stroke, and cancer. Having a family member with a disease raises your risk, but ...

  7. Family Issues

    Science.gov (United States)

    ... Some have two parents, while others have a single parent. Sometimes there is no parent and grandparents raise grandchildren. Some children live in foster families, adoptive families, or in stepfamilies. Families are much ...

  8. Family Disruptions

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Life Listen Español Text Size Email Print Share Family Disruptions Page Content Article Body No matter how ...

  9. Family genome browser: visualizing genomes with pedigree information.

    Science.gov (United States)

    Juan, Liran; Liu, Yongzhuang; Wang, Yongtian; Teng, Mingxiang; Zang, Tianyi; Wang, Yadong

    2015-07-15

    Families with inherited diseases are widely used in Mendelian/complex disease studies. Owing to the advances in high-throughput sequencing technologies, family genome sequencing becomes more and more prevalent. Visualizing family genomes can greatly facilitate human genetics studies and personalized medicine. However, due to the complex genetic relationships and high similarities among genomes of consanguineous family members, family genomes are difficult to be visualized in traditional genome visualization framework. How to visualize the family genome variants and their functions with integrated pedigree information remains a critical challenge. We developed the Family Genome Browser (FGB) to provide comprehensive analysis and visualization for family genomes. The FGB can visualize family genomes in both individual level and variant level effectively, through integrating genome data with pedigree information. Family genome analysis, including determination of parental origin of the variants, detection of de novo mutations, identification of potential recombination events and identical-by-decent segments, etc., can be performed flexibly. Diverse annotations for the family genome variants, such as dbSNP memberships, linkage disequilibriums, genes, variant effects, potential phenotypes, etc., are illustrated as well. Moreover, the FGB can automatically search de novo mutations and compound heterozygous variants for a selected individual, and guide investigators to find high-risk genes with flexible navigation options. These features enable users to investigate and understand family genomes intuitively and systematically. The FGB is available at http://mlg.hit.edu.cn/FGB/. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Co-existence of phenylketonuria either with maple syrup urine disease or Sandhoff disease in two patients from Iran: emphasizing the role of consanguinity.

    Science.gov (United States)

    Abiri, Maryam; Talebi, Saeed; Uitto, Jouni; Youssefian, Leila; Vahidnezhad, Hassan; Shirzad, Tina; Salehpour, Shadab; Zeinali, Sirous

    2016-10-01

    Most inborn errors of metabolism (IEMs) are inherited in an autosomal recessive manner. IEMs are one of the major concerns in Iran due to its extensive consanguineous marriages. Herein, we report two patients with two co-existent IEMs: a girl affected by classic phenylketonuria (PKU) and maple syrup urine disease (MSUD) and a male patient affected with Sandhoff disease and PKU, where Sandhoff disease was suspected due to the presence of a cherry-red spot in the eyes at 6 months which is unrelated to PKU. Sequencing of candidate genes in the first patient revealed one novel and three recurrent compound heterozygous mutations of p.Ser231Pro and p.Ala300Ser in the PAH gene and p.Glu330Lys and p.Arg170Cys mutations in the BCKDHB gene. Genetic testing results in the second patient showed previously reported homozygous mutations of p.Arg261Gln in the PAH and p.Arg533Cys mutation in the HEXB gene. Genetic testing confirmed the clinical diagnosis of both diseases in both patients. To the best of our knowledge; this is the first report of the co-existence of two distinct genetic disorders in two individuals from Iran. Co-existent different IEMs in patients complicated the clinical diagnosis and management of the diseases.

  11. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Directory of Open Access Journals (Sweden)

    Catherine Cukras

    Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  12. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Science.gov (United States)

    Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

    2012-01-01

    Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  13. Familial myasthenia gravis: report of four cases Miastenia grave familial: registro de quatro casos

    Directory of Open Access Journals (Sweden)

    José Lamartine de Assis

    1976-09-01

    Full Text Available Two pairs of siblings with myasthenia gravis, belonging to two different families, are reported. This is the only record of familial myasthenia during the past twenty years, in a total of 145 patients seen at the Neurological Clinic of the São Paulo Medical School. In spite of the fact that myasthenia gravis does not show hereditary characteristics, the peculiar features of the four cases justify the present report. The two pairs of siblings were born from non myasthenic nor consanguineous parents. The disease started at birth showing bilateral partial eyelid ptosis in all patients. The course of the illness has been favorable. There was no thymoma.Os autores registram dois pares de gêmeos com miastenia grave, pertencentes a duas famílias diferentes. Este é o único registro de miastenia familial durante os últimos 20 anos, num total de 145 pacientes examinados na Clínica Neurológica da FMUSP. Apesar do fato de a miastenia grave não ter características hereditárias, os aspectos peculiares dos quatro pacientes justificam o presente registro. Os dois pares de gêmeos nasceram de pais não miastênicos e sem consanguinidade. A doença iniciou-se no nascimento, evoluindo com ptose bilateral parcial da pálpebra superior precocemente em todos os pacientes. O curso da moléstia tem sido favorável. Não havia timoma.

  14. Family Privilege

    Science.gov (United States)

    Seita, John R.

    2014-01-01

    Family privilege is defined as "strengths and supports gained through primary caring relationships." A generation ago, the typical family included two parents and a bevy of kids living under one roof. Now, every variation of blended caregiving qualifies as family. But over the long arc of human history, a real family was a…

  15. WOMEN IN FAMILY BUSINESS

    OpenAIRE

    Mr Anshu

    2012-01-01

    The role of women in family businesses is explored in the paper. Although recognized as generally very important players, the role of women is often defined as invisible in business decision-making, supportive in men’s traditional business domains and only rarelyadequately recognized and rewarded. The paper explores possible differences in the views of men and women who manage small family firms. Their attitudes opposing the traditional business roles ofwomen, different views on managerial, o...

  16. Molecular diagnostic in two families affected with Autosomic Recessive Pigmentary Retinitis

    International Nuclear Information System (INIS)

    Leal Esquivel, A.

    1996-01-01

    This study included two Costa Rican families with members affected by Recessive Pigmentary Autosomic Retinitis (RPAR). The first family (C1) from the province of San Jose, has 10 alive affected members, and 14 obligatory carriers. They present an Early Appearance Degeneration, RPAR tipe1 (cane-cone). The author used polymorphic markers (STRPs) to discard some related regions, with the RP in the literature. He also used the Linkage program, for the analysis of ligaments. The second family (P1), proceeding from Acosta (situated in the province of Alajuela), has 13 alive affected members and 23 obligatory carriers and they present numerous consanguineous unions. This case is a RPAR with Early Appearance (Night Blindness, fat ERG), but with a shower degeneration. The author concludes that, with studies such as this one, there will be a capacity to offer RP molecular diagnostic, and also advance in its knowledge and treatment. (S. Grainger)

  17. XPC gene mutations in families with xeroderma pigmentosum from Pakistan; prevalent founder effect.

    Science.gov (United States)

    Ijaz, Ambreen; Basit, Sulman; Gul, Ajab; Batool, Lilas; Hussain, Abrar; Afzal, Sibtain; Ramzan, Khushnooda; Ahmad, Jamil; Wali, Abdul

    2018-03-23

    Xeroderma pigmentosum (XP) is a rare autosomal recessive skin disorder characterized by hyperpigmentation, premature skin aging, ocular and cutaneous photosensitivity, and increased risk of skin carcinoma. We investigated seven consanguineous XP families with nine patients from Pakistan. All the Patients exhibited typical clinical symptoms of XP since first year of life. Whole genome SNP genotyping identified a 14 Mb autozygous region segregating with the disease phenotype on chromosome 3p25.1. DNA sequencing of XPC gene revealed a founder homozygous splice site mutation (c.2251-1G>C) in patients from six families (A-F) and a homozygous nonsense mutation (c.1399C>T; p.Gln467*) in patients of family G. This is the first report of XPC mutations, underlying XP phenotype, in Pakistani population. © 2018 Japanese Teratology Society.

  18. Maintenance of family networks

    DEFF Research Database (Denmark)

    marsico, giuseppina; Chaudhary, N; Valsiner, Jaan

    2015-01-01

    Families are social units that expand in time (across generations) and space (as a geographically distributed sub-structures of wider kinship networks). Understanding of intergenerational family relations thus requires conceptualization of communication processes that take place within a small...... collective of persons linked with one another by a flexible social network. Within such networks, Peripheral Communication Patterns set the stage for direct everyday life activities within the family context. Peripheral Communication Patterns are conditions where one family network member (A) communicates...... manifestly with another member (B) with the aim of bringing the communicative message to the third member (C) who is present but is not explicitly designated as the manifest addressee of the intended message. Inclusion of physically non-present members of the family network (elders living elsewhere, deceased...

  19. Family Violence and Family Physicians

    Science.gov (United States)

    Herbert, Carol P.

    1991-01-01

    The acronym IDEALS summarizes family physicians' obligations when violence is suspected: to identify family violence; document injuries; educate families and ensure safety for victims; access resources and coordinate care; co-operate in the legal process; and provide support for families. Failure to respond reflects personal and professional experience and attitudes, fear of legal involvement, and lack of knowledge. Risks of intervention include physician burnout, physician overfunctioning, escalation of violence, and family disruption. PMID:21228987

  20. Cancerous leptomeningitis and familial congenital hypopituitarism.

    Science.gov (United States)

    Vujovic, S; Vujosevic, S; Kavaric, S; Sopta, J; Ivovic, M; Saveanu, A; Brue, T; Korbonits, M; Popovic, V

    2016-05-01

    People are at higher risk of cancer as they get older or have a strong family history of cancer. The potential influence of environmental and behavioral factors remains poorly understood. Earlier population and case control studies reported that upper quartile of circulating IGF-I is associated with a higher risk of developing cancer suggesting possible involvement of the growth hormone (GH)/IGF system in initiation or progression of cancer. Since GH therapy increases IGF-1 levels, there have been concerns that GH therapy in hypopituitarism might increase the risk of cancer. We report a 42-year-old female patient who presented with subacute onset of symptoms of meningitis and with the absence of fever which resulted in death 70 days after the onset of symptoms. The patient together with her younger brother was diagnosed at the age of 5 years with familial congenital hypopituitarism, due to homozygous mutation c.150delA in PROP1 gene. Due to evolving hypopituitarism, she was replaced with thyroxine (from age 5), hydrocortisone (from age 13), GH (from age 13 until 17), and sex steroids in adolescence and adulthood. Her consanguineous family has a prominent history of malignant diseases. Six close relatives had malignant disease including her late maternal aunt with breast cancer. BRCA 1 and BRCA 2 mutational analysis in the patient's mother was negative. Histology after autopsy disclosed advanced ovarian cancer with multiple metastases to the brain, leptomeninges, lungs, heart, and adrenals. Low circulating IGF-1 did not seem to protect this patient from cancer initiation and progression in the context of strong family history of malignancies.

  1. Familial gigantism

    NARCIS (Netherlands)

    W.W. de Herder (Wouter)

    2012-01-01

    textabstractFamilial GH-secreting tumors are seen in association with three separate hereditary clinical syndromes: multiple endocrine neoplasia type 1, Carney complex, and familial isolated pituitary adenomas.

  2. Familial gigantism

    Directory of Open Access Journals (Sweden)

    Wouter W. de Herder

    2012-01-01

    Full Text Available Familial GH-secreting tumors are seen in association with three separate hereditary clinical syndromes: multiple endocrine neoplasia type 1, Carney complex, and familial isolated pituitary adenomas.

  3. Novel mutations of MYO7A and USH1G in Israeli Arab families with Usher syndrome type 1.

    Science.gov (United States)

    Rizel, Leah; Safieh, Christine; Shalev, Stavit A; Mezer, Eedy; Jabaly-Habib, Haneen; Ben-Neriah, Ziva; Chervinsky, Elena; Briscoe, Daniel; Ben-Yosef, Tamar

    2011-01-01

    This study investigated the genetic basis for Usher syndrome type 1 (USH1) in four consanguineous Israeli Arab families. Haplotype analysis for all known USH1 loci was performed in each family. In families for which haplotype analysis was inconclusive, we performed genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array. For mutation analysis, specific primers were used to PCR amplify the coding exons of the MYO7A, USH1C, and USH1G genes including intron-exon boundaries. Mutation screening was performed with direct sequencing. A combination of haplotype analysis and genome-wide homozygosity mapping indicated linkage to the USH1B locus in two families, USH1C in one family and USH1G in another family. Sequence analysis of the relevant genes (MYO7A, USH1C, and USH1G) led to the identification of pathogenic mutations in all families. Two of the identified mutations are novel (c.1135-1147dup in MYO7A and c.206-207insC in USH1G). USH1 is a genetically heterogenous condition. Of the five USH1 genes identified to date, USH1C and USH1G are the rarest contributors to USH1 etiology worldwide. It is therefore interesting that two of the four Israeli Arab families reported here have mutations in these two genes. This finding further demonstrates the unique genetic structure of the Israeli population in general, and the Israeli Arab population in particular, which due to high rates of consanguinity segregates many rare autosomal recessive genetic conditions.

  4. Family Issues

    Science.gov (United States)

    ... es Autismo? Family Issues Home / Living with Autism / Family Issues Stress Siblings A child’s autism diagnosis affects every member of the family in different ways. Parents/caregivers must now place their ... may put stress on their marriage, other children, work, finances, and ...

  5. Phenotypic concordance in familial inflammatory bowel disease (IBD). Results of a nationwide IBD Spanish database.

    Science.gov (United States)

    Cabré, Eduard; Mañosa, Míriam; García-Sánchez, Valle; Gutiérrez, Ana; Ricart, Elena; Esteve, Maria; Guardiola, Jordi; Aguas, Mariam; Merino, Olga; Ponferrada, Angel; Gisbert, Javier P; Garcia-Planella, Esther; Ceña, Gloria; Cabriada, José L; Montoro, Miguel; Domènech, Eugeni

    2014-07-01

    Disease outcome has been found to be poorer in familial inflammatory bowel disease (IBD) than in sporadic forms, but assessment of phenotypic concordance in familial IBD provided controversial results. We assessed the concordance for disease type and phenotypic features in IBD families. Patients with familial IBD were identified from the IBD Spanish database ENEIDA. Families in whom at least two members were in the database were selected for concordance analysis (κ index). Concordance for type of IBD [Crohn's disease (CD) vs. ulcerative colitis (UC)], as well as for disease extent, localization and behaviour, perianal disease, extraintestinal manifestations, and indicators of severe disease (i.e., need for immunosuppressors, biological agents, and surgery) for those pairs concordant for IBD type, were analyzed. 798 out of 11,905 IBD patients (7%) in ENEIDA had familial history of IBD. Complete data of 107 families (231 patients and 144 consanguineous pairs) were available for concordance analyses. The youngest members of the pairs were diagnosed with IBD at a significantly younger age (p<0.001) than the oldest ones. Seventy-six percent of pairs matched up for the IBD type (κ=0.58; 95%CI: 0.42-0.73, moderate concordance). There was no relevant concordance for any of the phenotypic items assessed in both diseases. Familial IBD is associated with diagnostic anticipation in younger individuals. Familial history does not allow predicting any phenotypic feature other than IBD type. Copyright © 2013 European Crohn's and Colitis Organisation. Published by Elsevier B.V. All rights reserved.

  6. Small Data

    NARCIS (Netherlands)

    S. Pemberton (Steven)

    2014-01-01

    htmlabstractThe term “Open Data” often goes hand in hand with the term “Big Data”, where large data sets get released allowing for analysis, but the Cinderella of the Open Data ball is Small Data, small amounts of data, nonetheless possibly essential, that are too small to be put in some database or

  7. Cleft lip and cleft palate relationship with familial marriage: a study in 136 cases

    Directory of Open Access Journals (Sweden)

    Azimi C

    2010-02-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Clefts of the lip and palate are one of the most common congenital birth anomalies. Genetic factors play a great role in the etiology of them and the high percentage of the consanguineous marriage of the parents of the affected persons is one of the reasons. These defects not only make abnormal changes on appearance of the neonate, but also make a lot of stress and psychological problems for the patients and their families. Study on the prevalence of clefts, their risk factors and also genetic counseling for affected persons and their families can be a guideline for general population and probably reduce these anomalies over the generations."n"nMethods: Patients referred to the Department of Genetics, Imam Khomeini Hospital, Tehran, Iran were studied. A total of 7374 pedigrees of all the patients admitted to the Department, were studied during 2002-2005 and 99 pedigrees with the patients with cleft lip± palate or isolated cleft palate were separated. The total number of cases among these 99 pedigrees was 136. The effects of consanguineous marriage, positive family history and sex were investigated among cases."n"nResults: 70.8% of patients with syndromic clefts and 58.7% of patients with nonsyndromic CL

  8. Familial megacalyces with autosomal recessive inheritance

    International Nuclear Information System (INIS)

    Lam, A.H.

    1988-01-01

    Three children with bilateral congenital megacalyces from a consanguinous marriage are reported. No renal abnormality was detected in the parents. Our observation supports the genetic nature of the disease. The ultrasonographic features of congenital megacalyces are described. (orig.)

  9. Jamaican families.

    Science.gov (United States)

    Miner, Dianne Cooney

    2003-01-01

    The study of the family in the Caribbean originated with European scholars who assumed the universality of the patriarchal nuclear family and the primacy of this structure to the healthy functioning of society. Matrifocal Caribbean families thus were seen as chaotic and disorganized and inadequate to perform the essential tasks of the social system. This article provides a more current discussion of the Jamaican family. It argues that its structure is the result of the agency and adaptation of its members and not the root cause of the increasing marginalization of peoples in the developing world. The article focuses on families living in poverty and how the family structure supports essential family functions, adaptations, and survival.

  10. Family dynamics and infant temperament in Danish families

    DEFF Research Database (Denmark)

    Wilson, M.E.; Hall, Elisabeth O.C.; White, M.A.

    1994-01-01

    , although always in a negative direction, in family dynamics over this transition. The largest change was an increase in perceived role conflict reported by both mothers and fathers. Mothers reported more role conflict than fathers. Positive family dynamics were related to infant rhythmicity.......Transition to parenthood involves the fine balance of family dynamics which both affect, and are affected by, the infant's temperament. The purpose of this study was to investigate changes in family dynamics over the transition to parenthood and the relationship of family dynamics to infant...... temperament. A sample of 99 families in Odense, Denmark, completed the Family Dynamics Measure in the third trimester of pregnancy and again when the infant was 8-9 months old. At this second time, the mothers also completed the Revised Infant Temperament Questionnaire. Overall we found small changes...

  11. Family dynamics and infant temperament in Danish families

    DEFF Research Database (Denmark)

    Wilson, M.E.; Hall, Elisabeth O.C.; White, M.A.

    1994-01-01

    temperament. A sample of 99 families in Odense, Denmark, completed the Family Dynamics Measure in the third trimester of pregnancy and again when the infant was 8-9 months old. At this second time, the mothers also completed the Revised Infant Temperament Questionnaire. Overall we found small changes......Transition to parenthood involves the fine balance of family dynamics which both affect, and are affected by, the infant's temperament. The purpose of this study was to investigate changes in family dynamics over the transition to parenthood and the relationship of family dynamics to infant......, although always in a negative direction, in family dynamics over this transition. The largest change was an increase in perceived role conflict reported by both mothers and fathers. Mothers reported more role conflict than fathers. Positive family dynamics were related to infant rhythmicity....

  12. Study of brachydactyly in gipsy population: Description of a familial case

    Directory of Open Access Journals (Sweden)

    Pérez-Lázaro, Antonia

    2016-04-01

    Full Text Available Brachydactyly is an inheritable autosomal genetic malformation, either dominant or recessive. This article describes a gypsy family presenting with congenital brachydactyly. The study was conducted at the Sanitary District of Guadix, in Granada, Spain. The study subjects were four siblings (two women and two men, members of the same family and belonging to the Roma community. Demographic and genetic data were collected. With some variability, they had the phenotypic manifestation of brachydactyly. Radiographic data revealed that it was type A4 brachydactyly, but one of them featured a blend of A4 with E, or perhaps it is a new unclassified variety. All cases showed similar abnormalities in the feet. Besides, they are obese, and have dyslipidemia and different degrees of consanguinity.

  13. SPG20 mutation in three siblings with familial hereditary spastic paraplegia.

    Science.gov (United States)

    Dardour, Leila; Roelens, Filip; Race, Valerie; Souche, Erika; Holvoet, Maureen; Devriendt, Koen

    2017-07-01

    Troyer syndrome (MIM#275900) is an autosomal recessive form of complicated hereditary spastic paraplegia. It is characterized by progressive lower extremity spasticity and weakness, dysarthria, distal amyotrophy, developmental delay, short stature, and subtle skeletal abnormalities. It is caused by deleterious mutations in the SPG20 gene, encoding spartin, on Chromosome 13q13. Until now, six unrelated families with a genetically confirmed diagnosis have been reported. Here we report the clinical findings in three brothers of a consanguineous Moroccan family, aged 24, 17, and 7 yr old, with spastic paraplegia, short stature, motor and cognitive delay, and severe intellectual disability. Targeted exon capture and sequencing showed a homozygous nonsense mutation in the SPG20 gene, c.1369C>T (p.Arg457*), in the three affected boys. © 2017 Dardour et al.; Published by Cold Spring Harbor Laboratory Press.

  14. Small Data

    OpenAIRE

    Pemberton, Steven

    2014-01-01

    htmlabstractThe term “Open Data” often goes hand in hand with the term “Big Data”, where large data sets get released allowing for analysis, but the Cinderella of the Open Data ball is Small Data, small amounts of data, nonetheless possibly essential, that are too small to be put in some database or online dataset to be put to use. RDFa is a technology that allows Cinderella to go to the ball.

  15. Family intervention for schizophrenia.

    Science.gov (United States)

    Pharoah, F M; Mari, J J; Streiner, D

    2000-01-01

    It has been showed that people with schizophrenia from families that express high levels of criticism, hostility, or over involvement, have more frequent relapses than people with similar problems from families that tend to be less expressive of their emotions. Psychosocial interventions designed to reduce these levels of expressed emotions within families now exist for mental health workers. These interventions are proposed as adjuncts rather than alternatives to drug treatments, and their main purpose is to decrease the stress within the family and also the rate of relapse. To estimate the effects of family psychosocial interventions in community settings for the care of those with schizophrenia or schizophrenia-like conditions compared to standard care. Electronic searches of the Cochrane Library (Issue 2, 1998), the Cochrane Schizophrenia Group's Register (June 1998), EMBASE (1981-1995) and MEDLINE (1966-1995) were undertaken and supplemented with reference searching of the identified literature. Randomised or quasi-randomised studies were selected if they focused on families of people with schizophrenia or schizoaffective disorder and compared community-orientated family-based psychosocial intervention of more than five sessions to standard care. Data were reliably extracted, and, where appropriate and possible, summated. Peto odds ratios (OR), their 95% confidence intervals (CI) and number needed to treat (NNT) were estimated. The reviewers assume that people who died or dropped out had no improvement and tested the sensitivity of the final results to this assumption. Family intervention may decrease the frequency of relapse (one year OR 0.57 CI 0.4-0.8, NNT 6.5 CI 4-14). The trend over time of this main finding is towards the null and some small but negative studies may not have been identified by the search. Family intervention may decrease hospitalisation and encourage compliance with medication but data are few and equivocal. Family intervention does not

  16. Family Polymorphism

    DEFF Research Database (Denmark)

    Ernst, Erik

    2001-01-01

    safety and flexibility at the level of multi-object systems. We are granted the flexibility of using different families of kinds of objects, and we are guaranteed the safety of the combination. This paper highlights the inability of traditional polymorphism to handle multiple objects, and presents family...... polymorphism as a way to overcome this problem. Family polymorphism has been implemented in the programming language gbeta, a generalized version of Beta, and the source code of this implementation is available under GPL....

  17. A Novel Role for CSRP1 in a Lebanese Family with Congenital Cardiac Defects

    Directory of Open Access Journals (Sweden)

    Amina Kamar

    2017-12-01

    Full Text Available Despite an obvious role for consanguinity in congenital heart disease (CHD, most studies fail to document a monogenic model of inheritance except for few cases. We hereby describe a first-degree cousins consanguineous Lebanese family with 7 conceived children: 2 died in utero of unknown causes, 3 have CHD, and 4 have polydactyly. The aim of the study is to unveil the genetic variant(s causing these phenotypes using next generation sequencing (NGS technology. Targeted exome sequencing identified a heterozygous duplication in CSRP1 which leads to a potential frameshift mutation at position 154 of the protein. This mutation is inherited from the father, and segregates only with the CHD phenotype. The in vitro characterization demonstrates that the mutation dramatically abrogates its transcriptional activity over cardiac promoters like NPPA. In addition, it differentially inhibits the physical association of CSRP1 with SRF, GATA4, and with the newly described partner herein TBX5. Whole exome sequencing failed to show any potential variant linked to polydactyly, but revealed a novel missense mutation in TRPS1. This mutation is inherited from the healthy mother, and segregating only with the cardiac phenotype. Both TRPS1 and CSRP1 physically interact, and the mutations in each abrogate their partnership. Our findings add fundamental knowledge into the molecular basis of CHD, and propose the di-genic model of inheritance as responsible for such malformations.

  18. Family literacy

    DEFF Research Database (Denmark)

    Sehested, Caroline

    2012-01-01

    I Projekt familielæsning, der er et samarbejde mellem Nationalt Videncenter for Læsning og Hillerød Bibliotek, arbejder vi med at få kontakt til de familier, som biblioteket ellers aldrig ser som brugere og dermed også de børn, der vokser op i familier, for hvem bøger og oplæsningssituationer ikk...... er en selvfølgelig del af barndommen. Det, vi vil undersøge og ønsker at være med til at udvikle hos disse familier, er det, man kan kalde family literacy....

  19. Community families

    DEFF Research Database (Denmark)

    Jensen, Lotte Groth; Lou, Stina; Aagaard, Jørgen

    2017-01-01

    : Qualitative interviews with members of volunteer families. Discussion: The families were motivated by helping a vulnerable person and to engaging in a rewarding relationship. However, the families often doubted their personal judgment and relied on mental health workers to act as safety net. Conclusion......Background: Social interventions targeted at people with severe mental illness (SMI) often include volunteers. Volunteers' perspectives are important for these interventions to work. The present paper investigates the experiences of volunteer families who befriend a person with SMI. Material...

  20. This is My Family

    OpenAIRE

    Yeğen, Hale Nur; Çetin, Merve

    2017-01-01

    Me and my family, Families poem, Mother-Father, Brother-Sister, Grandparents, Uncle-Aunt, Cousin, Family, Family handgame, My family tree, Activities (Three In a Family), Digital Games, A family poem, Quiz

  1. Family problems

    International Nuclear Information System (INIS)

    Goldman, T.

    1984-01-01

    Even Grand Unified Theories may not explain the repetitive pattern of fermions in the Standard Model. The abysmal absence of dynamical information about these ''families'' is emphasized. The evidence that family quantum numbers exist, and are not conserved, is reviewed. It is argued that rare kaon decays may be the best means to obtain more information on this important question

  2. Family problems

    International Nuclear Information System (INIS)

    Goldman, T.

    1984-01-01

    Even Grand Unified Theories may not explain the repetitive pattern of fermions in the Standard Model. The abysmal absence of dynamical information about these families is emphasized. The evidence that family quantum numbers exist, and are not conserved, is reviewed. It is argued that rare kaon decays may be the best means to obtain more information on this important question

  3. Familial hypercholesterolemia

    Science.gov (United States)

    ... and Tests A physical exam may show fatty skin growths called xanthomas and cholesterol deposits in the eye (corneal arcus). The health care provider will ask questions about your personal and family medical history. There may be: A strong family history of ...

  4. FAMILY PYRGOTIDAE.

    Science.gov (United States)

    Mello, Ramon Luciano; Lamas, Carlos José Einicker

    2016-06-14

    Pyrgotidae is a family of endoparasitics flies of beetles with worldwide distribution. The Neotropical fauna is composed by 59 valid species names disposed in 13 genera. The occurrence of Pyrgota longipes Hendel is the first record of the family in Colombia.

  5. [Phenotypic and molecular characterization of a Colombian family with phenylketonuria].

    Science.gov (United States)

    Gélvez, Nancy; Acosta, Johana; López, Greizy; Castro, Derly; Prieto, Juan Carlos; Bermúdez, Martha; Tamayo, Marta L

    2016-09-01

    Phenylketonuria is a metabolic disorder characterized by severe neurological involvement and behavioral disorder, whose early diagnosis enables an effective treatment to avoid disease sequelae, thus changing the prognosis. Objective: To characterize a family with phenylketonuria in Colombia at clinical, biochemical and molecular levels. Materials and methods: The population consisted of seven individuals of a consanguineous family with four children with suggestive symptoms of phenylketonuria. After signing an informed consent, blood and urine samples were taken for colorimetric tests and high performance liquid and thin layer chromatographies. DNA extraction and sequencing of the 13 exons of the PAH gene were performed in all subjects. We designed primers for each exon with the Primer 3 software using automatic sequencing equipment Abiprism 3100 Avant. Sequences were analyzed using the SeqScape, v2.0, software. Results: We described the clinical and molecular characteristics of a Colombian family with phenylketonuria and confirmed the presence of the mutation c.398_401delATCA. We established a genotype-phenotype correlation, highlighting the interesting clinical variability found among the affected patients despite having the same mutation in all of them. Conclusions: Early recognition of this disease is very important to prevent its neurological and psychological sequelae, given that patients reach old age without diagnosis or proper management.

  6. Small hydro

    International Nuclear Information System (INIS)

    Bennett, K.; Tung, T.

    1995-01-01

    A small hydro plant in Canada is defined as any project between 1 MW and 15 MW but the international standard is 10 MW. The global market for small hydro development was considered good. There are some 1000 to 2000 MW of generating capacity being added each year. In Canada, growth potential is considered small, primarily in remote areas, but significant growth is anticipated in Eastern Europe, Africa and Asia. Canada with its expertise in engineering, manufacturing and development is considered to have a good chance to take advantage of these growing markets

  7. Multiple familial trichoepithelioma: a rare cutaneous tumour

    International Nuclear Information System (INIS)

    Arfan-ul-Bari; Simeen-ber-Rehman

    2004-01-01

    Multiple familial trichoepithelioma (MFT) is a rare autosomal dominant skin disease that presents as many small tumours predominantly on the face. We report a case of multiple familial trichoepithelioma occurring in three members of a family. They were diagnosed simultaneously. Only one was treated with medium depth chemical peeling with partial response. (author)

  8. Young family as the basis of forming family potential in perspective

    Directory of Open Access Journals (Sweden)

    H. H. Mamadalieva

    2017-01-01

    Full Text Available The purpose of the article is to disclose the place and the role of a young family in formation in perspective of the family potential of the Republic of Uzbekistan. The family represents an association of people based on marriage or consanguinity, who have a common life and mutual responsibility, and is an essential component of the social structure of the society. It is the most important life value in many countries. These days, there is often a transition to new models of family formation. The family in Uzbekistan is quite stable, despite new and not always positive trends occurring in the world. It continues to be the most important value in life, the guardian of national traditions and customs, the basis of personality formation and healthy way of living. The scientific novelty of the article is that for the fi rst time the role and the place of a young family in formation in the perspective of family potential is disclosed using the example of Uzbekistan. According to the Law of the Republic of Uzbekistan «About the State Youth Policy» a young family is a family where the age of both spouses does not exceed thirty inclusive, or a family in where children (child are raised by one parent aged no more than thirty inclusive, including the divorced, and the widower (widow. Procreation of population is largely due to a young family (3/4 of the total number of children are born with the parents under 30 years of age. Uzbekistan is characterized by a high marriage rate. The population, entering into marriage, increases annually in the Republic. At the same time, the marriage rate grows. All this promotes formation of young families and increase of their share in the total number of families in the Republic. The measures provided by the state policy concerning families in general, refer, mostly and largely, to young families in the fi rst place. Methods of statistical analysis, methods of groups, and methods of

  9. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Science.gov (United States)

    Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  10. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Directory of Open Access Journals (Sweden)

    Behzad Davarniya

    Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  11. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

    Science.gov (United States)

    Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

  12. Family matters

    DEFF Research Database (Denmark)

    Kieffer-Kristensen, Rikke; Siersma, Volkert Dirk; Teasdale, Thomas William

    2013-01-01

    brain injury participated. Family and brain injury characteristics were reported by the ill and healthy parents. Children self-reported post-traumatic stress symptoms (PSS) using the Child Impact of Events revised (CRIES). Emotional and behavioural problems among the children were also identified...... by the parents using the Achenbach’s Child Behaviour Checklist (CBCL). RESULTS: The family stress variables relating to the healthy spouse in all six comparisons were significant (p... scores for the children. For the adjusted associations, we again found the family stress variables in the healthy spouse to be related to the risk of emotional and behavioral problems in the children. CONCLUSIONS: The present results suggest that in ABI families, the children’s emotional functioning...

  13. Familial hypercholesterolaemia

    African Journals Online (AJOL)

    Familial hypercholesterolaemia (FH) is a monogenic disorder of low-density lipoprotein (LDL) metabolism. It is characterised .... Figure 2: Cumulative prevalence of physical signs in adult FH patients at the. GSH Lipid .... microvascular trauma.

  14. Family Life

    Science.gov (United States)

    ... family members to do your laundry, walk the dog, or update others on your progress. You may ... parenting while living with cancer . The importance of communication As demonstrated above, good communication is important in ...

  15. Familial dysautonomia

    Science.gov (United States)

    ... condition. FD occurs most often in people of Eastern European Jewish ancestry (Ashkenazi Jews). It is caused ... also be used for prenatal diagnosis. People of Eastern European Jewish background and families with a history ...

  16. Waardenburg syndrome type I: Dental phenotypes and genetic analysis of an extended family.

    Science.gov (United States)

    Sólia-Nasser, L; de Aquino, S-N; Paranaíba, L-M R; Gomes, A; Dos-Santos-Neto, P; Coletta, R-D; Cardoso, A-F; Frota, A-C; Martelli-Júnior, H

    2016-05-01

    The aim of this study was to describe the pattern of inheritance and the clinical features in a large family with Waardenburg syndrome type I (WS1), detailing the dental abnormalities and screening for PAX3 mutations. To characterize the pattern of inheritance and clinical features, 29 family members were evaluated by dermatologic, ophthalmologic, otorhinolaryngologic and orofacial examination. Molecular analysis of the PAX3 gene was performed. The pedigree of the family,including the last four generations, was constructed and revealed non-consanguineous marriages. Out of 29 descendants, 16 family members showed features of WS1, with 9 members showing two major criteria indicative of WS1. Five patients showed white forelock and iris hypopigmentation, and four showed dystopia canthorum and iris hypopigmentation. Two patients had hearing loss. Dental abnormalities were identified in three family members, including dental agenesis, conical teeth and taurodontism. Sequencing analysis failed to identify mutations in the PAX3 gene. These results confirm that WS1 was transmitted in this family in an autosomal dominant pattern with variable expressivity and high penetrance. The presence of dental manifestations, especially tooth agenesis and conical teeth which resulted in considerable aesthetic impact on affected individuals was a major clinical feature. This article reveals the presence of well-defined dental changes associated with WS1 and tries to establish a possible association between these two entities showing a new spectrum of WS1.

  17. Homozygosity mapping in autosomal recessive retinitis pigmentosa families detects novel mutations

    Science.gov (United States)

    Marzouka, Nour al Dain; Hebrard, Maxime; Manes, Gaël; Sénéchal, Audrey; Meunier, Isabelle; Hamel, Christian P.

    2013-01-01

    Purpose Autosomal recessive retinitis pigmentosa (arRP) is a genetically heterogeneous disease resulting in progressive loss of photoreceptors that leads to blindness. To date, 36 genes are known to cause arRP, rendering the molecular diagnosis a challenge. The aim of this study was to use homozygosity mapping to identify the causative mutation in a series of inbred families with arRP. Methods arRP patients underwent standard ophthalmic examination, Goldman perimetry, fundus examination, retinal OCT, autofluorescence measurement, and full-field electroretinogram. Fifteen consanguineous families with arRP excluded for USH2A and EYS were genotyped on 250 K SNP arrays. Homozygous regions were listed, and known genes within these regions were PCR sequenced. Familial segregation and mutation analyzes were performed. Results We found ten mutations, seven of which were novel mutations in eight known genes, including RP1, IMPG2, NR2E3, PDE6A, PDE6B, RLBP1, CNGB1, and C2ORF71, in ten out of 15 families. The patients carrying RP1, C2ORF71, and IMPG2 mutations presented with severe RP, while those with PDE6A, PDE6B, and CNGB1 mutations were less severely affected. The five families without mutations in known genes could be a source of identification of novel genes. Conclusions Homozygosity mapping combined with systematic screening of known genes results in a positive molecular diagnosis in 66.7% of families. PMID:24339724

  18. Unusual association of turner syndrome and hypopituitarism in a Tunisian family.

    Science.gov (United States)

    Bougacha-Elleuch, N; Elleuch, M; Charfi, N; Mnif, F; Belghith, N; Abdelhedi, F; Kammoun, H; Hachicha, M; Mnif, M; Abid, M

    2016-01-01

    Familial occurrence of either Turner syndrome or hypopituitarism is very rare. Particularly, their association is an uncommon finding. In this context, we describe for the first time 4 sisters with Turner syndrome, hypopituitarism was reported in three among them. Our cohort consists of four Tunisian adult sisters belonging to a consanguineous family. Biochemical analysis, resonance magnetic imaging and cytogenetic analyses were performed. Turner syndrome was diagnosed at the ages of 14, 17, 31 and 43 years in cases 1, 2, 3 and 4 respectively. They suffered from short stature, dysmorphic syndrome and/or delayed puberty. Interestingly, 3 among them showed also hypopituitarism, hypogonadotrophic hypogonadism and central hypothyroidism. Somatotropic insufficiency was proven in one case. Pituitary MRI has shown an empty sella turcica with hypoplastic pituitary gland in three cases. Their karyotypes were compatible with 45X in one case, 45X/46XX in the second and 45X/46XX/47XXY with x label in two cases. Hence, the presence of these familial cases of TS must evoke new etiopathogenetic arguments. Coincidence of hypopituitarism in this family, might suggest common genetic background for the two diseases. This particular family would be a precious tool for an extensive molecular analysis. More attention should be given to other family's members mainly in the presence of delayed puberty and sterility in other members. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  19. LGMD2D syndrome: the importance of clinical and molecular genetics in patient and family management. Case Report.

    Science.gov (United States)

    Al-Harbi, Khalid M; Abdallah, Atiyeh M

    2016-09-01

    We report the case of a seven-year-old female from a consanguineous Saudi family with autosomal recessive limb girdle muscular dystrophy type 2D (LGMD2D) most likely caused by a rare SGCA mutation. Histopathological and molecular investigations resulted in the discovery of a homozygous mutation (c.226 C>T (p.L76 F)) in exon 3 of SGCA in the patient. The parents and one sibling were heterozygous carriers, but the mutation was not otherwise detected in 80 ethnic controls from the same geographic area. In silico analysis revealed that the mutation resulted in a functional leucine to phenylalanine alteration that was deleterious to the protein structure. This is only the second reported case of the p.L76F mutation in LGMD, and highlights that molecular genetics analysis is essential to deliver the most appropriate management to the patient and offer the family genetic counseling.

  20. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  1. Homozygosity mapping and targeted sanger sequencing reveal genetic defects underlying inherited retinal disease in families from pakistan.

    Directory of Open Access Journals (Sweden)

    Maleeha Maria

    Full Text Available Homozygosity mapping has facilitated the identification of the genetic causes underlying inherited diseases, particularly in consanguineous families with multiple affected individuals. This knowledge has also resulted in a mutation dataset that can be used in a cost and time effective manner to screen frequent population-specific genetic variations associated with diseases such as inherited retinal disease (IRD.We genetically screened 13 families from a cohort of 81 Pakistani IRD families diagnosed with Leber congenital amaurosis (LCA, retinitis pigmentosa (RP, congenital stationary night blindness (CSNB, or cone dystrophy (CD. We employed genome-wide single nucleotide polymorphism (SNP array analysis to identify homozygous regions shared by affected individuals and performed Sanger sequencing of IRD-associated genes located in the sizeable homozygous regions. In addition, based on population specific mutation data we performed targeted Sanger sequencing (TSS of frequent variants in AIPL1, CEP290, CRB1, GUCY2D, LCA5, RPGRIP1 and TULP1, in probands from 28 LCA families.Homozygosity mapping and Sanger sequencing of IRD-associated genes revealed the underlying mutations in 10 families. TSS revealed causative variants in three families. In these 13 families four novel mutations were identified in CNGA1, CNGB1, GUCY2D, and RPGRIP1.Homozygosity mapping and TSS revealed the underlying genetic cause in 13 IRD families, which is useful for genetic counseling as well as therapeutic interventions that are likely to become available in the near future.

  2. Familial macrocephaly

    International Nuclear Information System (INIS)

    Tatsuno, Masaru; Hayashi, Michiko; Iwamoto, Hiroko

    1984-01-01

    We reported 63 macrocephalic children with special emphasis on 16 cases with familial macrocephaly. Of the 16 children with familial macrocephaly, 13 were boys. Foureen parents (13 fathers and 1 mother) had head sizes above 98th percentile. Three of 5 brothers and 5 of 8 sisters also had large heads. The head circumference at birth was known for 14 of the children and it was above the 98th percentile in 7 patients. Subsequent evaluations have shown the head size of these children to be following a normal growth curve. Some of the children were hypotonic as infants, but their development was generally normal. CT scans usually clearly distinguished these children from those with hydorocephalus. The familial macrocephalic children had ventricular measurements which were within the normal range, but absolute measurements of the ventricular size may be misleading, because the CT appearance was of mildly dilated ventricles in half of them. (author)

  3. Family Structure and Family Processes in Mexican American Families

    OpenAIRE

    Zeiders, Katharine H.; Roosa, Mark W.; Tein, Jenn-Yun

    2011-01-01

    Despite increases in single-parent families among Mexican Americans (MA), few studies have examined the association of family structure and family adjustment. Utilizing a diverse sample of 738 Mexican American families (21.7% single parent), the current study examined differences across family structure on early adolescent outcomes, family functioning, and parent-child relationship variables. Results revealed that early adolescents in single parent families reported greater school misconduct,...

  4. Super families

    International Nuclear Information System (INIS)

    Amato, N.; Maldonado, R.H.C.

    1989-01-01

    The study on phenomena in the super high energy region, Σ E j > 1000 TeV revealed events that present a big dark spot in central region with high concentration of energy and particles, called halo. Six super families with halo were analysed by Brazil-Japan Cooperation of Cosmic Rays. For each family the lateral distribution of energy density was constructed and R c Σ E (R c ) was estimated. For studying primary composition, the energy correlation with particles released separately in hadrons and gamma rays was analysed. (M.C.K.)

  5. [Serological Characteristics and Family Survey of 3 Cases of H-deficient Blood Group].

    Science.gov (United States)

    Geng, Wei; Gao, Huan-Huan; Zhang, Lin-Wei

    2016-06-01

    To investigate the serological characteristics and the genetic status of the family of H-deficient blood group in Jining area of Shandong province in China. ABO, H, and Lewis blood groups in 3 probands were screened out by the serological method, and saliva testing was performed on all the individuals. The presence of weak A or B on the RBC was confirmed by using the adsorption-elution procedure. Three cases of H-deficient blood group were identified to be para-Bombay blood group (secretor), out of 3 cases, 2 cases were Bh, 1 case was Ah, and anti-H or anti-HI antibody was detected in their serum. Three cases of H-deficerent blood group are para-Bombay phenotype, among them one proband's parents have been confirmed to be consanguineous relationship.

  6. Cortical atrophy and hypofibrinogenemia due to FGG and TBCD mutations in a single family: a case report.

    Science.gov (United States)

    Stephen, Joshi; Nampoothiri, Sheela; Vinayan, K P; Yesodharan, Dhanya; Remesh, Preetha; Gahl, William A; Malicdan, May Christine V

    2018-05-16

    Blended phenotypes or co-occurrence of independent phenotypically distinct conditions are extremely rare and are due to coincidence of multiple pathogenic mutations, especially due to consanguinity. Hereditary fibrinogen deficiencies result from mutations in the genes FGA, FGB, and FGG, encoding the three different polypeptide chains that comprise fibrinogen. Neurodevelopmental abnormalities have not been associated with fibrinogen deficiencies. In this study, we report an unusual patient with a combination of two independently inherited genetic conditions; fibrinogen deficiency and early onset cortical atrophy. The study describes a male child from consanguineous family presented with hypofibrinogenemia, diffuse cortical atrophy, microcephaly, hypertonia and axonal motor neuropathy. Through a combination of homozygosity mapping and exome sequencing, we identified bi-allelic pathogenic mutations in two genes: a homozygous novel truncating mutation in FGG (c.554del; p.Lys185Argfs*14) and a homozygous missense mutation in TBCD (c.1423G > A;p.Ala475Thr). Loss of function mutations in FGG have been associated with fibrinogen deficiency, while the c.1423G > A mutation in TBCD causes a novel syndrome of neurodegeneration and early onset encephalopathy. Our study highlights the importance of homozygosity mapping and exome sequencing in molecular prenatal diagnosis, especially when multiple gene mutations are responsible for the phenotype.

  7. Identification of two new mutations in the GPR98 and the PDE6B genes segregating in a Tunisian family.

    Science.gov (United States)

    Hmani-Aifa, Mounira; Benzina, Zeineb; Zulfiqar, Fareeha; Dhouib, Houria; Shahzadi, Amber; Ghorbel, Abdelmonem; Rebaï, Ahmed; Söderkvist, Peter; Riazuddin, Sheikh; Kimberling, William J; Ayadi, Hammadi

    2009-04-01

    Autosomal recessive retinitis pigmentosa (ARRP) is a genetically heterogeneous disorder. ARRP could be associated with extraocular manifestations that define specific syndromes such as Usher syndrome (USH) characterized by retinal degeneration and congenital hearing loss (HL). The USH type II (USH2) associates RP and mild-to-moderate HL with preserved vestibular function. At least three genes USH2A, the very large G-protein-coupled receptor, GPR98, and DFNB31 are responsible for USH2 syndrome. Here, we report on the segregation of non-syndromic ARRP and USH2 syndrome in a consanguineous Tunisian family, which was previously used to define USH2B locus. With regard to the co-occurrence of these two different pathologies, clinical and genetic reanalysis of the extended family showed (i) phenotypic heterogeneity within USH2 patients and (ii) excluded linkage to USH2B locus. Indeed, linkage analysis disclosed the cosegregation of the USH2 phenotype with the USH2C locus markers, D5S428 and D5S618, whereas the ARRP perfectly segregates with PDE6B flanking markers D4S3360 and D4S2930. Molecular analysis revealed two new missense mutations, p.Y6044C and p.W807R, occurring in GPR98 and PDE6B genes, respectively. In conclusion, our results show that the USH2B locus at chromosome 3p23-24.2 does not exist, and we therefore withdraw this locus designation. The combination of molecular findings for GPR98 and PDE6B genes enable us to explain the phenotypic heterogeneity and particularly the severe ocular affection first observed in one USH2 patient. This report presents an illustration of how consanguinity could increase familial clustering of multiple hereditary diseases within the same family.

  8. Family unification in five and six dimensions

    International Nuclear Information System (INIS)

    Babu, K.S.; Barr, S.M.; Kyae, Bumseok

    2002-01-01

    In family unification models, all three families of quarks and leptons are grouped together into an irreducible representation of a simple gauge group, thus unifying the standard model gauge symmetries and a gauged family symmetry. Large orthogonal groups, and the exceptional groups E 7 and E 8 , have been much studied for family unification. The main theoretical difficulty of family unification is the existence of mirror families at the weak scale. It is shown here that family unification without mirror families can be realized in simple five-dimensional and six-dimensional orbifold models similar to those recently proposed for SU(5) and SO(10) grand unification. It is noted that a family unification group that survived to near the weak scale and whose coupling extrapolated to high scales unified with those of the standard model would be evidence, accessible in principle at low energy, of the existence of small (Planckian or GUT-scale) extra dimensions

  9. Peculiaridades de la pequeña empresa familiar ante la responsabilidad social empresarial: un análisis exploratorio en la Comunidad de Madrid=Peculiarities of the small family firm on business social responsibility: an exploratory analysis in the Madrid

    Directory of Open Access Journals (Sweden)

    Cristina López-Cózar Navarro

    2014-06-01

    Full Text Available Las empresas familiares presentan ciertas peculiaridades que pueden considerarse puntos fuertes en la implantación de políticas de Responsabilidad Social Empresarial (RSE, como tener una sólida cultura empresarial, basada en unos valores compartidos, una orientación a largo plazo y una especial relación con la comunidad local. No obstante, hay otros aspectos que pueden resultar debilidades, como la escasa descentralización en la toma de decisiones o el nepotismo. Pese a que existen numerosos trabajos en la literatura académica sobre RSE, son muy escasos los estudios que analizan el caso concreto de la pequeña empresa familiar. Dada la importancia de este tipo de empresas en la mayoría de las economías, se pretende contribuir a cubrir esta laguna; por tanto, el objetivo del presente trabajo es identificar aquellos aspectos propios de las pequeñas empresas familiares de primera generación que pueden dificultar o favorecer la adopción de un comportamiento socialmente responsable.Family businesses have certain peculiarities that can be considered strengths in their attitude towards Business Social Responsibility (BSR, like having a solid business culture with shared values, a long-term orientation and a special feeling towards the local community. Nonetheless, there are other aspects that can be considered as weaknesses, including nepotism or centralized decision making. Despite the large body of academic literature on BSR, there are not many studies that are only focused on the particular case of small family businesses. Given the importance of family businesses in most economies, this paper will contribute to fill this gap in the literature. The aim of this study is to determine the specific aspects of the small first-generation family business that may hinder or facilitate the adoption of responsible behavior.

  10. THE CHALLENGES OF FAMILY BUSINESS

    Directory of Open Access Journals (Sweden)

    Stoilkovska Aleksandra

    2011-12-01

    Full Text Available Small businesses give a lot of possibilities for realization of your own creativity and inventivity. Employment of new family members creates work atmosphere that cannot be felt in other companies. Organizational culture results from the employee cohesion and from their devotion to the organization and to the work, and therefore cannot be achieved in other organizations and with any other motivational techniques. These excellent working conditions are a great base for fulfilling the organizational aims, as well as for united and satisfied family. The work in the family organizations is specific from two aspects: from the advantages that it offers and from the problems that arise from this kind of business. Knowing the conditions in the family business, i.e. knowing the factors that influence the effectiveness and efficiency of family business enables more efficient work. Family business development with change of generation or with the increase in the number of family members brings new moments. In addition, one good story can be transformed in an unpleasant conflict and can get to disunion in the family as well in the business. Knowing the possibilities and threats in connection to the factors that influence the family business enables preventive actions in order to avoid undesirable situations.

  11. Understanding the transgenerational orientation of family businesses: the role of family governance and business family identity

    OpenAIRE

    Süss-Reyes, Julia

    2017-01-01

    The development of a transgenerational orientation is one of the most significant challenges that family businesses face and only a small number actually survive across generations. While prior research has focused on the business unit to provide us with a solid understanding of how corporate governance affects business performance and continuity, the role of the business family in the development of a transgenerational orientation has received less attention. To address this g...

  12. Family Violence.

    Science.gov (United States)

    Emery, Robert E.

    1989-01-01

    Researchers and policymakers have begun to recognize the extent and severity of family violence, particularly its effects on children. But there is much disagreement about the definition of violence, its development, the consequences for victims, and the most effective avenues for intervention. Advances recommendations for further research.…

  13. Family arizing

    NARCIS (Netherlands)

    Croes, M.J.G.; Feijs, L.M.G.; Chen, L.; Djajadingrat, T.; Feijs, L.M.G.; Hu, J.; Kufin, S.H.M.; Rampino, L.; Rodriguez, E.; Steffen, D.

    2015-01-01

    In this demo we show the two main components of the Family Arizing system which allows parents to stay in contact with their child and, in cases of distress, provide the child with a remote comforting hug. The two components to be shown are the active necklace and the active snuggle.

  14. Family Genericity

    DEFF Research Database (Denmark)

    Ernst, Erik

    2006-01-01

    Type abstraction in object-oriented languages embody two techniques, each with its own strenghts and weaknesses. The first technique is extension, yielding abstraction mechanisms with good support for gradual specification. The prime example is inheritance. The second technique is functional abst...... the result as family genericity. The presented language design has been implemented....

  15. FAMILY ASILIDAE.

    Science.gov (United States)

    Wolff, Marta; Lamas, Carlos José Einicker

    2016-06-14

    Asilidae is one of the largest Diptera families with more than 7,000 recognized species worldwide. All their species are predators on arthropods, mainly insects. This catalogue presents 71 species distributed in 26 genera, ten tribes or generic groups and four subfamilies. For each species we present the available geographical information and relevant references.

  16. Family Hypnotherapy.

    Science.gov (United States)

    Araoz, Daniel L.; Negley-Parker, Esther

    1985-01-01

    A therapeutic model to help families activate experiential and right hemispheric functioning through hypnosis is presented in detail, together with a clinical illustration. Different situations in which this model is effective are mentioned and one such set of circumstances is described. (Author)

  17. Familial hypercholesterolaemia

    DEFF Research Database (Denmark)

    Versmissen, Jorie; Vongpromek, Ranitha; Yahya, Reyhana

    2016-01-01

    cholesterol efflux capacity between male familial hypercholesterolaemia (FH) patients with and without CHD relative to their non-FH brothers, and examined HDL constituents including sphingosine-1-phosphate (S1P) and its carrier apolipoprotein M (apoM). RESULTS: Seven FH patients were asymptomatic and six had...... in asymptomatic FH patients may play a role in their apparent protection from premature CHD....

  18. Absence of consensus in diagnostic criteria for familial neurodegenerative diseases.

    LENUS (Irish Health Repository)

    Byrne, Susan

    2012-04-01

    A small proportion of cases seen in neurodegenerative conditions such as amyotrophic lateral sclerosis (ALS), Parkinson\\'s disease and Alzheimer disease are familial. These familial cases are usually clinically indistinguishable from sporadic cases. Identifying familial cases is important both in terms of clinical guidance for family members and for gene discovery.

  19. [Family violence].

    Science.gov (United States)

    Manoudi, F; Chagh, R; Es-soussi, M; Asri, F; Tazi, I

    2013-09-01

    Family violence is a serious public health problem, the scale of which is seriously increasing in Morocco. Although it has existed for a long time, we ignore the real characteristics of this plague in our country; our work consisted in an epidemiological approach of family violence in Marrakech during 2006. After elaborating a questionnaire, which allows the study of the demographic and social profile of the families, the study of violence exercised in the family and the evaluation of the depression in the women, we led an inquiry amongst 265 women. Analysis of the results obtained has allowed us to underline the following characteristics: 16.6% of the women in our sample had been physically beaten; the young age is a risk factor; the age range most affected by violence is in women between the ages of 30 and 40 and which represent 39% of the battered women; domestic violence touches all the social, economic and cultural classes: in our study, 63% of the women having undergone violence were housewives, 25% were managers and 3% senior executives; family problems were the most important cause of violence in our study, representing 32.32%. Requests for money was the cause in 11.3% of the cases, and imposed sexual relations were found in 6.8% of the cases; alcoholism is an aggravating factor of family violence; 27.3% of the spouses who assaulted their wives were drunk; 52% of the assaulted women were victims of violence in childhood and 36% had been witness to their father's violence; in 63.6% of the cases of violence, the children were witnesses, and in 25% of the cases the children were victims of violence at the same time as their mothers; 50% of the women victims of violence did not react, while 38.6% left home, and 9.1 filed for divorce. Thirty-two percent of the assaulted woman had been traumatised by the aggression; the association of depression and violence was very high, 343% of the battered women in our study suffered from severe depression. This work

  20. Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

    Directory of Open Access Journals (Sweden)

    Fang Hu

    2014-10-01

    Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

  1. Calling-in the Family: Dialogic Performances of Family Conflict

    Science.gov (United States)

    Congdon, Mark, Jr.; Herakova, Liliana; Bishop, Jessica

    2018-01-01

    Courses: Introduction to Communication, Introduction to Interpersonal Communication, Family Communication, Small Group Communication, Communication and Listening. Objectives: By this end of this activity, students will be able to identify and practice supportive and defensive communication; understand a dialogic approach to conflict; and…

  2. Small talk

    Directory of Open Access Journals (Sweden)

    Ryszard Przybylski

    2016-12-01

    Full Text Available The poem Small talk conjures up a communicative situation in which the main character, a newcomer from Poland, answers conventional questions related to their country. Bearing in mind the fact that this poem is set during a military dictatorship, superficial interest in his homeland may trigger a feeling of impatience. This is at least the impression formed if we adopt the perspective defined within the romantic tradition, and when taking into account the conventional poetry of martial law in Poland. Nevertheless, Barańczak retains an ironic distance towards such communicative situations and, as a consequence, does not create poetry that meets most readersʼ expectations. His poetic imperative for verbal art to be the expression of mistrust remains valid.

  3. Small Composers

    DEFF Research Database (Denmark)

    Holgersen, Sven-Erik; Bruun, Peter; Tjagvad, Mette

    2018-01-01

    the study: What expectations do the class teacher and the professional musicians have to the creative practice, i.e. to the collaboration and to the musical outcome? To which extent do the collaborating partners share a common understanding of the aim, content and method of the workshop? How do the roles......The present chapter discusses roles and responsibilities of the collaborating partners in a creative music workshop called Small Composers. The aim is to be attentive to a number of potential alterations implicated by the collaborating partners’ different backgrounds. The following questions guided...... and responsibilities of the collaborating partners become visible through the practice? How do the professional identities of the teacher and the musicians become visible and what are the implications for the workshop as a musical community of practice?...

  4. Management of Change in Tourism - The Problem of Family Internal Succession in Family Tourism SMEs

    OpenAIRE

    Zehrer, Anita; Haslwanter, Julia

    2010-01-01

    “World-wide, the family business constitutes the most prevalent form of business or-ganization” (Poutziouris et al. 2004, p. 7). Alpine tourism is also dominated by small- and medium-sized enterprises (SME), among which family firms represent the majority (Astrachan and Shanker 2003). Family firms are urged to perform business, strategic, and succession planning for their survival (Knight 1993). Planning for the integration of the younger generation into the family firm is an issue of strateg...

  5. Unions in small and medium-sized enterprises

    DEFF Research Database (Denmark)

    Holten, Ann-Louise; Crouch, Colin

    2014-01-01

    Trade unions are commonly weak in small- and medium-sized enterprises, which constitute a majority of European firms and are often family-owned. We investigate the influence of family ownership on employee membership, perceptions and experience with unions in Danish and Italian firms in the textile...... and clothing sector. Family ownership reduces union membership; and within family firms, the number of family members employed is negatively associated with unionization rates and employee perceptions of unions....

  6. Asteroid families - Physical properties and evolution

    International Nuclear Information System (INIS)

    Chapman, C.R.; Paolicchi, P.; Zappala, V.; Binzel, R.P.; Bell, J.F.

    1989-01-01

    Asteroid families are considered to be fragments from collisional destruction of precursor bodies. However, results available on the inferred mineralogy, size distributions, and spins of family members do not confirm the expectations of the traditional model. Only a handful of nearly 100 proposed families, most of them populous, have distributions of inferred mineralogies consistent with simple cosmochemical models for parent bodies. It is suggested that most catastrophic collisions may not result in observable families, but rather in a spray of smaller particles, thus accounting for the small number of confirmed and consistent families, despite evidence for extensive collisional evolution of asteroids. 52 refs

  7. A novel COL4A3 mutation causes autosomal-recessive Alport syndrome in a large Turkish family.

    Science.gov (United States)

    Uzak, Asli Subasioglu; Tokgoz, Bulent; Dundar, Munis; Tekin, Mustafa

    2013-03-01

    Alport syndrome (AS) is a genetically heterogeneous disorder that is characterized by hematuria, progressive renal failure typically resulting in end-stage renal disease, sensorineural hearing loss, and variable ocular abnormalities. Only 15% of cases with AS are autosomal recessive and are caused by mutations in the COL4A3 or COL4A4 genes, encoding type IV collagen. Clinical data in a large consanguineous family with four affected members were reviewed, and genomic DNA was extracted. For mapping, 15 microsatellite markers flanking COL4A3, COL4A4, and COL4A5 in 16 family members were typed. For mutation screening, all coding exons of COL4A3 were polymerase chain reaction- amplified and Sanger-sequenced from genomic DNA. The disease locus was mapped to chromosome 2q36.3, where COL4A3 and COL4A4 reside. Sanger sequencing revealed a novel mis-sense mutation (c.2T>C; p.M1T) in exon 1 of COL4A3. The identified nucleotide change was not found in 100 healthy ethnicity-matched controls via Sanger sequencing. We present a large consanguineous Turkish family with AS that was found to have a COL4A3 mutation as the cause of the disease. Although the relationship between the various genotypes and phenotypes in AS has not been fully elucidated, detailed clinical and molecular analyses are helpful for providing data to be used in genetic counseling. It is important to identify new mutations to clarify their clinical importance, to assess the prognosis of the disease, and to avoid renal biopsy for final diagnosis.

  8. Familial Idiopathic Cranial Neuropathy in a Chinese Family.

    Science.gov (United States)

    Zhang, Li; Liang, Jianfeng; Yu, Yanbing

    Cranial neuropathy is usually idiopathic and familial cases are uncommon. We describe a family with 5 members with cranial neuropathy over 3 generations. All affected patients were women, indicating an X-linked dominant or an autosomal dominant mode of inheritance. Our cases and a review of the literature suggest that familial idiopathic cranial neuropathy is a rare condition which may be related to autosomal dominant vascular disorders (e.g. vascular tortuosity, sclerosis, elongation or extension), small posterior cranial fossas, anatomical variations of the posterior circulation, hypersensitivity of cranial nerves and other abnormalities. Moreover, microvascular decompression is the treatment of choice because vascular compression is the main factor in the pathogenesis. To the best of our knowledge, this is the first report of familial cranial neuropathy in China.

  9. The potential impact of family history of metabolic syndrome and risk of type 2 diabetes mellitus: In a highly endogamous population.

    Science.gov (United States)

    Bener, Abdulbari; Darwish, Sarah; Al-Hamaq, Abdulla O A; Yousafzai, Mohammad T; Nasralla, Eman A

    2014-03-01

    This study aims to determine the potential impact of positive family history of Metabolic Syndrome (MetS) among two generations, on developing Type 2 Diabetes Mellitus (T2DM) and the potential relation of consanguineous marriage among patients with MetS to the risk of developing T2DM among a sample of Qataris. A cross-sectional study. Primary healthcare (PHC) centers. The survey and measurement were conducted from April 2011 to December 2012 among Qatari nationals above 20 years of age. Of the 2,182 subjects, who were approached to participate in the study, 1,552 (71%) gave their consent. Face-to-face interviews were conducted using a structured questionnaire followed by anthropometric measurements and laboratory tests. Metabolic syndrome was defined using the National Cholesterol Education Program-Third Adult Treatment Panel (ATP III) as well as International Diabetes Federation (IDF). Overall, the prevalence of MetS was 26.2% according to ATP III and 36.9% according to IDF (P family history for MetS was significantly higher in MetS patients with T2DM as compared to those without T2DM (46.7% vs. 33.8%; P = 0.009). The proportion of positive family history of MetS among fathers (35% vs. 21.9%; P = 0.005), mothers (30.5% vs. 18.8%; P = 0.008), maternal aunt (18.3% vs. 11.2%; P = 0.055), and maternal grand father (19.5% vs. 10%; P = 0.010) were significantly higher in MetS patients with T2DM as compared to the counterpart. The proportion of consanguineous marriages was almost two times higher among MetS patients with T2DM as compared to those without T2DM (80.9% vs. 41.9%; P Family history of MetS among parents, maternal aunt, maternal grandfather, and consanguineous marriages among patients of MetS are significantly associated with the development of T2DM in Qatar. These results support the necessity of earlier screening for T2DM among MetS patients with positive family history of MetS.

  10. Family roles as family functioning regulators

    OpenAIRE

    STEPANYAN ARMINE

    2015-01-01

    The author examines the problems of formation and functioning of family roles. Having social roots, family roles appear on individual level by performing the social function of the formation of family as a social institute.

  11. The Role of Family in Family Firms

    OpenAIRE

    Marianne Bertrand; Antoinette Schoar

    2006-01-01

    History is replete with examples of spectacular ascents of family businesses. Yet there are also numerous accounts of family businesses brought down by bitter feuds among family members, disappointed expectations between generations, and tragic sagas of later generations unable to manage their wealth. A large fraction of businesses throughout the world are organized around families. Why are family firms so prevalent? What are the implications of family control for the governance, financing an...

  12. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  13. Shodagor Family Strategies : Balancing Work and Family on the Water.

    Science.gov (United States)

    Starkweather, Kathrine E

    2017-06-01

    The Shodagor of Matlab, Bangladesh, are a seminomadic community of people who live and work on small wooden boats, within the extensive system of rivers and canals that traverse the country. This unique ecology places particular constraints on family and economic life and leads to Shodagor parents employing one of four distinct strategies to balance childcare and provisioning needs. The purpose of this paper is to understand the conditions that lead a family to choose one strategy over another by testing predictions about socioecological factors that impact the sexual division of labor, including a family's stage in the domestic cycle, aspects of the local ecology, and the availability of alloparents. Results show that although each factor has an impact on the division of labor individually, a confluence of these factors best explains within-group, between-family differences in how mothers and fathers divide subsistence and childcare labor. These factors also interact in particular ways for Shodagor families, and it appears that families choose their economic strategies based on the constellation of constraints that they face. The results of these analyses have implications for theory regarding the sexual division of labor across cultures and inform how Shodagor family economic and parenting strategies should be contextualized in future studies.

  14. Family Child Care Licensing Study, 1997.

    Science.gov (United States)

    Children's Foundation, Washington, DC.

    This report details the findings of an annual survey of state child care regulatory agencies. The survey gathered data on both small family child care homes and group or large family child care homes in each of the 50 states, the District of Columbia, Puerto Rico and the Virgin Islands. The report's introduction lists the survey categories and…

  15. Genetic investigation of 93 families with microphthalmia or posterior microphthalmos.

    Science.gov (United States)

    Patel, N; Khan, A O; Alsahli, S; Abdel-Salam, G; Nowilaty, S R; Mansour, A M; Nabil, A; Al-Owain, M; Sogati, S; Salih, M A; Kamal, A M; Alsharif, H; Alsaif, H S; Alzahrani, S S; Abdulwahab, F; Ibrahim, N; Hashem, M; Faquih, T; Shah, Z A; Abouelhoda, M; Monies, D; Dasouki, M; Shaheen, R; Wakil, S M; Aldahmesh, M A; Alkuraya, F S

    2018-06-01

    Microphthalmia is a developmental eye defect that is highly variable in severity and in its potential for systemic association. Despite the discovery of many disease genes in microphthalmia, at least 50% of patients remain undiagnosed genetically. Here, we describe a cohort of 147 patients (93 families) from our highly consanguineous population with various forms of microphthalmia (including the distinct entity of posterior microphthalmos) that were investigated using a next-generation sequencing multi-gene panel (i-panel) as well as whole exome sequencing and molecular karyotyping. A potentially causal mutation was identified in the majority of the cohort with microphthalmia (61%) and posterior microphthalmos (82%). The identified mutations (55 point mutations, 15 of which are novel) spanned 24 known disease genes, some of which have not or only very rarely been linked to microphthalmia (PAX6, SLC18A2, DSC3 and CNKSR1). Our study has also identified interesting candidate variants in 2 genes that have not been linked to human diseases (MYO10 and ZNF219), which we present here as novel candidates for microphthalmia. In addition to revealing novel phenotypic aspects of microphthalmia, this study expands its allelic and locus heterogeneity and highlights the need for expanded testing of patients with this condition. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Roles within the Family

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Text Size Email Print Share Roles Within the Family Page Content Article Body Families are not democracies. ...

  17. A paralogue of the phosphomutase-like gene family in Candida glabrata, CgPmu2, gained broad-range phosphatase activity due to a small number of clustered substitutions.

    Science.gov (United States)

    Orlando, Kelly A; Iosue, Christine L; Leone, Sarah G; Davies, Danielle L; Wykoff, Dennis D

    2015-10-15

    Inorganic phosphate is required for a range of cellular processes, such as DNA/RNA synthesis and intracellular signalling. The phosphate starvation-inducible phosphatase activity of Candida glabrata is encoded by the gene CgPMU2 (C. glabrata phosphomutase-like protein). CgPMU2 is part of a three-gene family (∼75% identical) created through gene duplication in the C. glabrata clade; only CgPmu2 is a PHO-regulated broad range acid phosphatase. We identified amino acids that confer broad range phosphatase activity on CgPmu2 by creating fusions of sections of CgPMU2 with CgPMU1, a paralogue with little broad range phosphatase activity. We used site-directed mutagenesis on various fusions to sequentially convert CgPmu1 to CgPmu2. Based on molecular modelling of the Pmu proteins on to a histidine phosphatase crystal structure, clusters of amino acids were found in two distinct regions that were able to confer phosphatase activity. Substitutions in these two regions together conferred broad phosphatase activity on CgPmu1. Interestingly, one change is a histidine adjacent to the active site histidine of CgPmu2 and it exhibits a novel ability to partially replace the conserved active site histidine in CgPmu2. Additionally, a second amino acid change was able to confer nt phosphatase activity to CgPmu1, suggesting single amino acid changes neofunctionalize CgPmu2. © 2015 Authors; published by Portland Press Limited.

  18. FINANCIAL MANAGEMENT IN THE FAMILY AND NON-FAMILY SME´S IN THE TEXTILE INDUSTRY IN MEXICO

    OpenAIRE

    Martha Isabel Bojorquez Zapata; Antonio Emmanuel Perez Brito; Jorge Humberto Basulto Triay

    2014-01-01

    In this paper, we analyze differences in financial management practices between family and non-family Small and Medium Enterprises (SMEs) in the textile industry. We hypothesize that family SMEs use different sources of funding for new investments, tend to have less debt, are more profitable and use less financial and accounting information for decision making than non-family SMEs. We survey 24 textile SMEs located in Yucatan, Mexico. The results show that family SMEs rely more heavily on int...

  19. Family Psychology and Family Therapy in Japan.

    Science.gov (United States)

    Kameguchi, Kenji; Murphy-Shigematsu, Stephen

    2001-01-01

    Reviews the development of family psychology and family therapy in Japan, tracing the origins of these movements, explaining how these fields were activated by the problem of school refusal, and describing an approach to family therapy that has been developed to work with families confronting this problem, as well as preventive programs of family…

  20. Strengthening Family Practices for Latino Families.

    Science.gov (United States)

    Chartier, Karen G; Negroni, Lirio K; Hesselbrock, Michie N

    2010-01-01

    The study examined the effectiveness of a culturally-adapted Strengthening Families Program (SFP) for Latinos to reduce risks for alcohol and drug use in children. Latino families, predominantly Puerto Rican, with a 9-12 year old child and a parent(s) with a substance abuse problem participated in the study. Pre- and post-tests were conducted with each family. Parental stress, parent-child dysfunctional relations, and child behavior problems were reduced in the families receiving the intervention; family hardiness and family attachment were improved. Findings contribute to the validation of the SFP with Latinos, and can be used to inform social work practice with Puerto Rican families.

  1. Participação paterna no cuidado de crianças pequenas: um estudo etnográfico com famílias de camadas populares Paternal involvement in the care of small children: an ethnographic study of low-income families

    Directory of Open Access Journals (Sweden)

    Vânia Bustamante

    2005-12-01

    Full Text Available O presente estudo focaliza a participação paterna no cuidado da saúde de crianças menores de seis anos em famílias de camadas populares. Trata-se de um estudo de cunho etnográfico desenvolvido mediante observação participante e entrevistas. Visitamos famílias de um bairro de periferia de uma capital nordestina, durante um período de nove meses, e encontramos que ter filhos constitui uma dimensão fundamental na vida de homens e mulheres, constituindo causa comum da formação de novos núcleos familiares. A participação paterna é sintetizada em três dimensões: a educação, em que o pai é fundamental; os cuidados corporais, entendidos como atribuição feminina; e a preservação da integridade, considerada dever de todos os membros da família. Embora persista a identificação com papéis de gênero tradicionais, ao contrastarmos discursos com práticas, percebemos que em todas as famílias, e mais intensamente nas nucleares, existem dimensões nas que os homens participam ativamente, evidenciando proximidade física e emocional com os filhos.The present study focused on father's involvement in the health care of small children (under six years in low-income families. An ethnographic study was performed with interviews and participatory observation. We visited families in an outlying low-income urban neighborhood in Northeast Brazil, for nine months. Children appeared as a fundamental dimension in the lives of men and women, constituting a common reason for forming a family nucleus. The paternal role involved three key dimensions: education, in which the father was essential; body care, usually considered a female attribution; and preservation of integrity, considered an obligation for all family members. Despite the fact that traditional identification of gender roles still persists, based on contrasting discourses and practices, in all families (and especially in nuclear ones there were dimensions in which men participated

  2. To integrate family planning into the building up of mental civilization by offering comprehensive services.

    Science.gov (United States)

    1988-03-01

    The government of Nangong City, a newly instituted city with a relatively large proportion of agricultural workers has integrated family planning into the building up of mental civilization. As a result, in 1986, the family planning practice rate was 98.4%. One way the government accomplished this was by developing production to eliminate poverty, to show that population development has a significant impact on socioeconomic development. To help change people's attitudes about family planning, the government 1) used publicity, such as speechmaking, mass media, and courses in population theory; 2) awarded those who made contributions; 3) carried out publicity and education in accordance with characteristics of different groups of people; and 4) encouraged bridegrooms to live with their wives' families if the wives' parents had had no son. Another technique the government used as the popularization of scientific knowledge about population theory, physiology and hygiene, birth control, and eugenics and health in births. A 4th method was to popularize knowledge of laws and regulations, such as of early marriage and consanguineous marriage. 5th, the government developed social security undertakings: 1) giving priority to single-child families and 2) taking care of the elderly. Finally, the government improved maternal and child care by 1) providing premarital health care; 2) creating a project for healthier births and better upbringing; 3) family planning workers showing warm concern for reproductive women; and 4) controlling women's diseases and providing health care knowledge, as well as family planning services. These 6 activities have resulted in 1) the decreasing momentum of per capita arable land being controlled, 2) 1-child couples having more time to learn, 3) the development of educational undertakings, 4) a change in people's traditional practices, and 5) improvement in the understanding of patriotism.

  3. Impact of chronic obstructive pulmonary disease on family functioning.

    Science.gov (United States)

    Kanervisto, Merja; Paavilainen, Eija; Astedt-Kurki, Päivi

    2003-01-01

    The purpose of this study was to ascertain family dynamics of Finnish patients with severe chronic obstructive pulmonary disease (COPD) on the basis of Barnhill's framework for healthy family functioning. This study used description and comparison and an interview-administered questionnaire and survey. Participants were patients with COPD and their family members (n = 65) living in the Tampere University Hospital catchment area. The sample consisted of families of home oxygen therapy patients (n = 36) and families of inpatients (n = 29). Families consisted of patients and their family members. Data were collected from patients by interview-administered questionnaires and from family members by survey. The instrument used was the Family Dynamics Measure 2, operationalized and tested by the American Family Research Group. Families of home oxygen therapy patients experienced significantly more mutuality (P =.03) and made decisions about their illness and life significantly more independently (P =.05) than families of inpatients. Families of home oxygen therapy patients handled change significantly more flexibly (P =.03) than families of inpatients. For the most part, families of both patient groups functioned well, but overall family functioning was clearly better in families of home oxygen therapy patients. The sample included some dysfunctional and even severely dysfunctional families. The results of this study cannot be generalized beyond the study sample because of the small sample size, but they provide suggestions for developing the care of patients with COPD and their families.

  4. Identification of a missense mutation in the tyrosinase gene in a Chinese family with oculocutaneous albinism type 1.

    Science.gov (United States)

    Lu, Qian; Yuan, Lamei; Xu, Hongbo; Huang, Xiangjun; Yang, Zhijian; Yi, Junhui; Ni, Bin; Chen, Yong; Deng, Hao

    2017-03-01

    Oculocutaneous albinism (OCA) is a group of heterogeneous and autosomal recessive disorders characterized by a reduction or complete loss of melanin biosynthesis in melanocytes. OCA type 1 (OCA1) is the most severe and common form of OCA, and is caused by mutations in the tyrosinase gene (TYR). The present study aimed to identify the genetic cause of OCA1 in a four‑generation consanguineous Chinese Han family. Complete physical examinations were performed and blood samples were collected from five members of the family and 100 unrelated healthy controls. Exome sequencing was conducted in the proband, followed by verification in other family members, using Sanger sequencing. Patients in the family presented with typical OCA1 features, including hypopigmentation of the skin and hair, and distinctive ocular changes. A homozygous missense variant, c.896G>A (p.R299H), in the TYR gene was identified in two patients, which co‑segregated with disease in the family. This variant was not present in the 100 healthy controls. These results expand the number of mutations identified to be responsible for OCA1 in the Chinese Han population, and may have implications for genetic counseling and clinical management of the disease.

  5. Hematopoietic stem cell transplantation from non-sibling matched family donors for patients with thalassemia major in Jordan.

    Science.gov (United States)

    Hussein, Ayad Ahmed; Al-Zaben, Abdulhadi; Khattab, Eman; Haroun, Anas; Frangoul, Haydar

    2016-02-01

    There are limited data on the outcome of patients with thalassemia receiving HSCT from non-sibling matched family donors. Of the 341 patients with thalassemia major that underwent donor search at our center from January 2003 to December 2011, 236 (69.2%) had fully matched family donor of which 28 patients (8.2%) had non-sibling matched family donors identified. We report on seven patients with a median age of eight yr (4-21) who underwent myeloablative (n = 4) or RIC (n = 3) HSCT. The median age of the donors was 33 yr (4-47), three were parents, two first cousins, one paternal uncle, and one paternal aunt. All patients achieved primary neutrophil and platelet engraftment at a median of 18 (13-20) and 16 days (11-20), respectively. One patient developed grade II acute GVHD, and two patients developed limited chronic GVHD. One patient experienced secondary GF requiring a second transplant. At a median follow-up of 69 months (7-110), all patients are alive and thalassemia free. Our data emphasize the need for extended family HLA typing for patients with thalassemia major in regions where there is high rate of consanguinity. Transplant from non-sibling matched family donor can result in excellent outcome. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Family Matters

    Directory of Open Access Journals (Sweden)

    Isabel de Riquer

    2011-04-01

    Full Text Available The scene is at the court of James I of Aragon in the mid-13th c., the place is the royal palace of Barcelona or any of the crown's other possessions, and the dramatis personae include the heir to the throne, prince Peire (future king Peire the Great, and the court's most famous troubadour, Cerverí de Girona (fl. 1259-85. Author of the largest corpus of any Occitan troubadour (114 poems, Cerverì distinguishes himself by the surprises and challenges he presents to his audience: an alba (the most openly erotic genre to the Virgin Mary, the Cobla in sis lengatges (Cobla in Six Languages, the apparently nonsensical Vers estrayn. Cerverì borrows equally from the folk-inspired Galician-Portuguese poetry and from the French tradition, including the chanson de malmariée, where a young woman bemoans being sold off by her family to an old man (gilos, "Jealous" and separated from her youthful doulz amis, some even praying for the death of their husband. Both within that tradition and among Cerverì's three chansons de malmariée, the Gelosesca stands out as "especially determined" to lose her husband, using every "solution" (prayer, black magic, potion or experimenta.

  7. Small Business Development Center

    Data.gov (United States)

    Small Business Administration — Small Business Development Centers (SBDCs) provide assistance to small businesses and aspiring entrepreneurs throughout the United States and its territories. SBDCs...

  8. Homozygous TREM2 mutation in a family with atypical frontotemporal dementia.

    Science.gov (United States)

    Le Ber, Isabelle; De Septenville, Anne; Guerreiro, Rita; Bras, José; Camuzat, Agnès; Caroppo, Paola; Lattante, Serena; Couarch, Philippe; Kabashi, Edor; Bouya-Ahmed, Kawtar; Dubois, Bruno; Brice, Alexis

    2014-10-01

    TREM2 mutations were first identified in Nasu-Hakola disease, a rare autosomal recessive disease characterized by recurrent fractures because of bone cysts and presenile dementia. Recently, homozygous and compound heterozygous TREM2 mutations were identified in rare families with frontotemporal lobar degeneration (FTLD) but without bone involvement. We identified a p.Thr66Met heterozygous mutation in a new consanguineous Italian family. Two sibs had early onset autosomal recessive FTLD without severe bone disorders. Atypical signs were present in this family: early parietal and hippocampus involvement, parkinsonism, epilepsy, and corpus callosum thickness on brain magnetic resonance imaging. This study further demonstrates the implication of TREM2 mutations in FTLD phenotypes. It illustrates the variability of bone phenotype and underlines the frequency of atypical signs in TREM2 carriers. This and previous studies evidence that TREM2 mutation screening should be limited to autosomal recessive FTLD with atypical phenotypes characterized by: (1) a very young age at onset (20-50 years); (2) early parietal and hippocampal deficits; (3) the presence of seizures and parkinsonism; (4) suggestive extensive white matter lesions and corpus callosum thickness on brain magnetic resonance imaging. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Kinship, family and social network

    Directory of Open Access Journals (Sweden)

    2000-12-01

    Full Text Available There is considerable overlap between Le Play's mid-eighteenth-century household model map and the regional TFR map of central-southern Europe in the 1980s. The author examines the overall structure of relationships involved in Le Play's typology and observes that both the stem-family and the unstable family area in the Southern Europe are marked by a small, close-knit network of strong ties, with kinship predominance. Vice versa, the social support hinges upon a network of kin in the stem-family area, upon an alliance among different kindred units in the unstable Mediterranean area. All this leads to formulating a hypothesis of a tri-partite model for Western European relationship models. How can we explain the relationship between family predominance as anthropological embedding and family collapse as demographic reaction? The author reconsiders this question in the light of Festinger's cognitive dissonance theory and Elder's 'principle of accentuation': different, regionally rooted, family and kinship patterns "react" in contact with an appropriate reagent, such as the macro-process of modernisation, generating different patterns of today's demographic behaviour.

  10. Naxos disease in an Arab family is not caused by the Pk2157del2 mutation; evidance for exclusion of the plakoglobin gene

    International Nuclear Information System (INIS)

    Stuhmann, M.; El-Harith, A.; Bukhari, Iqbal A.

    2004-01-01

    Nax os disease is a rare hereditary disorder characterized by palmoplantar keratoderma, woolly hair and cardiomyopathy. This study aims to determine whether Naxos disease in a Saudi Arab family is caused by the Pk2157del2 mutation that was identified in Greek families from Naxos Island where the disease had originally been described. This study was undertaken at King Fahad Hospital of the University, Al-Khobar, and the Medical University of Hannover, in the spring of 2003. Naxos disease has been encountered in a 2-year-old girl and her 30-year-old aunt of a Saudi Arab family. Deoxyribonucleic acid samples of this family were analyzed by polymerase chain-reaction (PCR) amplification of the respective region of the plakoglobin gene, and direct nucleotide sequencing of the PCR-products. Segregation analysis was performed employing the newly detected IVS11+22G/A polymorphism. Molecular genetic analysis of the DNA sample of the child diagnosed with Naxos disease showed absence of the Pk2157del2 mutation. In addition, the segregation analysis revealed heterozygosity for IVS11+22G/A in the affected girl. Absence of the Pk2157del2 frameshift in the affected child proved that Naxos disease in this Saudi Arab family is not caused by the same mutation that was identified in the Greek families. Furthermore, heterozygosity for the IVS11+22G/A polymorphism provided evidence for exclusion of the plakoglobin gene in this consanguineous family. (author)

  11. SMALL ENTERPRENEURSHIP IN HOSPITALITY: CROATIAN EXPERIENCES

    Directory of Open Access Journals (Sweden)

    Slobodan Ivanovic

    2013-03-01

    Full Text Available After introductory explanations regarding the selection problems of small enterprises in the Croatian hotel industry, the author provides a number of key indicators of their role in improving the competitiveness of the Croatian hotel industry in the global tourism market. In developed tourism countries, small enterprises have a dominant share in the structure of the hotel industry, and their importance is growing even in the former socialist countries of Europe. Small hotels in Italy accounted for more than 50%, and in Austria with more than 70% of lodging facilities and represent a generator of hotel business in a large number of European tourism countries, and great attention is given to the small enterpreneurs stimulating their growth with different measures of tourist and general economy politics. The author reflects on the Croatian experience of the small businesses in the hospitality through research of development of small family hotels and their importance for the improvement of the supply of the Croatian hotel industry which future is built on personal approach to guests and present trends in the tourism market. States that the role of the National Association of family and small hotels, which represents the specific interests of small hoteliers and enables the continuous improvement of the quality of their offerings, as well as measures to encourage small business development at the macro level. Based on the made analysis the measures of increasing the efficiency of small businesses in the Croatian hospitality are given.

  12. Homozygous 16p13.11 duplication associated with mild intellectual disability and urinary tract malformations in two siblings born from consanguineous parents.

    Science.gov (United States)

    Houcinat, N; Llanas, B; Moutton, S; Toutain, J; Cailley, D; Arveiler, B; Combe, C; Lacombe, D; Rooryck, C

    2015-11-01

    The use of array-comparative genomic hybridization (array-CGH) in routine clinical work has allowed the identification of many new copy number variations (CNV). The 16p13.11 duplication has been implicated in various congenital anomalies and neurodevelopmental disorders, but it has also been identified in healthy individuals. We report a clinical observation of two brothers from related parents each carrying a homozygous 16p13.11 duplication. The propositus had mild intellectual disability and posterior urethral valves with chronic renal disease. His brother was considered a healthy child with only learning disabilities and poor academic performances. However, a routine medical examination at 25-years-old revealed a mild chronic renal disease and ureteropelvic junction obstruction. Furthermore, the father presented with a unilateral renal agenesis, thus it seemed that a "congenital anomalies of kidney and urinary tract" (CAKUT) phenotype segregated in this family. This may be related to the duplication, but we cannot exclude the involvement of additional genetic or non-genetic factors in the urological phenotype. Several cohort studies showed association between this chromosomal imbalance and different clinical manifestations, but rarely with CAKUT. The duplication reported here was similar to the larger one of 3.4 Mb previously described versus the more common of 1.6 Mb. It encompassed at least 11 known genes, including the five ohnologs previously identified. Our observation, in addition to expanding the clinical spectrum of the duplication provides further support to understanding the underlying pathogenic mechanism. © 2015 Wiley Periodicals, Inc.

  13. Lack of association between the Pro12Ala polymorphism of the PPAR-gamma 2 gene and type 2 diabetes mellitus in the Qatari consanguineous population.

    Science.gov (United States)

    Badii, Ramin; Bener, Abdulbari; Zirie, Mahmoud; Al-Rikabi, Ammar; Simsek, Mehmet; Al-Hamaq, Abdulla O A A; Ghoussaini, Maya; Froguel, Philippe; Wareham, Nick J

    2008-03-01

    Peroxisome proliferators-activated receptor gamma (PPAR gamma) is a nuclear hormone receptor that serves as a master regulator for adipocytes-specific genes contributing to adipocytes differentiation, insulin sensitivity and lipid metabolism. The substitution of proline to alanine at codon 12 of the PPAR gamma 2 gene (Pro12Ala polymorphism) is most widely studied, and the associations with diabetes, obesity, and other clinical parameters have been reported and discussed in several ethnic groups. Among native Qatar ethnicity, however, there is no report about this polymorphism. The aim of this study was to estimate the allele frequency of the Pro12Ala polymorphism of PPAR gamma 2 gene among Qatari population and investigate the association between this polymorphism and obesity or type 2 diabetes. This is a matched case-control study. It was carried out among diabetic patients and healthy subjects at the Primary Healthcare Clinics, and the survey was conducted from February 2003 to March 2006 in Qatari male and female nationals aged 35 to 60 years. The study was based on matched age, sex, and ethnicity of 400 cases (with diabetes) and 450 controls (without diabetes). Face-to-face interviews were based on a questionnaire that included variables such as age, sex, sociodemographic status, body mass index (BMI), and obesity. Their health status was assessed by medical conditions, family history, and blood pressure measurements. The allele frequency of Pro12Ala polymorphism in PPAR gamma 2 gene among Qataris is lower than that in many Caucasian ethnic groups. No association is seen between the Pro12Ala and type 2 Diabetes (0.055 vs 0.059, OR = 1.1311, P = 0.669). Nearly half of the diabetic type 2 patients (48.5%) were obese (BMI > 30) compared to nondiabetic subjects (29.8%) (P Qatar.

  14. Bequeathing Family Continuity.

    Science.gov (United States)

    Spanier, Graham B.

    1989-01-01

    Notes that many children who experience abuse, family disruption, or poverty reach adulthood with a strong commitment to family life. Questions whether changes in American families are indicators of pathology, deterioration, and instability; and asks how dysfunctional families transmit commitment to the concept of family to succeeding generations.…

  15. The Reconstituted Family

    OpenAIRE

    Talbot, Yves

    1981-01-01

    The reconstituted or step-family is becoming more prevalent. The physician who cares for families should be acquainted with the different aspects of such family structure and family functioning. This will enable professionals to better understand and assist their patients, by anticipating the different stresses related to the new family formation, and supporting their adaptation.

  16. Family Capital: Implications for Interventions with Families

    Science.gov (United States)

    Belcher, John R.; Peckuonis, Edward V.; Deforge, Bruce R.

    2011-01-01

    Social capital has been extensively discussed in the literature as building blocks that individuals and communities utilize to leverage system resources. Similarly, some families also create capital, which can enable members of the family, such as children, to successfully negotiate the outside world. Families in poverty confront serious…

  17. Familial Pulmonary Fibrosis

    Science.gov (United States)

    ... Education & Training Home Conditions Familial Pulmonary Fibrosis Familial Pulmonary Fibrosis Make an Appointment Find a Doctor Ask a ... more members within the same family have Idiopathic Pulmonary Fibrosis (IPF) or any other form of Idiopathic Interstitial ...

  18. Family Activities for Fitness

    Science.gov (United States)

    Grosse, Susan J.

    2009-01-01

    This article discusses how families can increase family togetherness and improve physical fitness. The author provides easy ways to implement family friendly activities for improving and maintaining physical health. These activities include: walking, backyard games, and fitness challenges.

  19. Normal Functioning Family

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Español Text Size Email Print Share Normal Functioning Family Page Content Article Body Is there any way ...

  20. Improving Family Communications

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Listen Español Text Size Email Print Share Improving Family Communications Page Content Article Body How can I ...

  1. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  2. Family self-tailoring: Applying a systems approach to improving family healthy living behaviors.

    Science.gov (United States)

    Moore, Shirley M; Jones, Lenette; Alemi, Farrokh

    2016-01-01

    The adoption and maintenance of healthy living behaviors by individuals and families is a major challenge. We describe a new model of health behavior change, SystemCHANGE (SC), which focuses on the redesign of family daily routines using system improvement methods. In the SC intervention, families are taught a set of skills to engage in a series of small, family self-designed experiments to test ideas to change their daily routines. The family system-oriented changes brought about by these experiments build healthy living behaviors into family daily routines so that these new behaviors happen as a matter of course, despite wavering motivation, willpower, or personal effort on the part of individuals. Case stories of the use of SC to improve family healthy living behaviors are provided. Results of several pilot tests of SC indicate its potential effectiveness to change health living behaviors across numerous populations. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Families and family therapy in Hong Kong.

    Science.gov (United States)

    Tse, Samson; Ng, Roger M K; Tonsing, Kareen N; Ran, Maosheng

    2012-04-01

    Family therapy views humans not as separate entities, but as embedded in a network of relationships, highlighting the reciprocal influences of one's behaviours on one another. This article gives an overview of family demographics and the implementation of family therapy in Hong Kong. We start with a review of the family demographics in Hong Kong and brief notes on families in mainland China. Demographics show that the landscape has changed markedly in the past decade, with more cross-border marriages, an increased divorce rate, and an ageing overall population - all of which could mean that there is increasing demand for professional family therapy interventions. However, only a limited number of professionals are practising the systems-based approach in Hong Kong. Some possible reasons as to why family therapy is not well disseminated and practised are discussed. These reasons include a lack of mental health policy to support family therapy, a lack of systematic family therapy training, and a shortage of skilled professionals. Furthermore, challenges in applying the western model in Chinese culture are also outlined. We conclude that more future research is warranted to investigate how family therapy can be adapted for Chinese families.

  4. Familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome are different manifestations of the same disease: novel missense mutations in GALNT3

    International Nuclear Information System (INIS)

    Joseph, Leo; Joseph, Selvanayagam; Hing, Sandra N.; Idowu, Bernadine D.; Delaney, David; Presneau, Nadege; O'Donnell, Paul; Diss, Tim; Flanagan, Adrienne Margaret

    2010-01-01

    To report on the biochemistry and clinical and genetic findings of two siblings, the younger sister presenting with recurrent bone pain of the radius and ulna, and medullary sclerosis, and the older brother with soft tissue calcific deposits (tumoral calcinosis) but who later developed bone pain. Both were found to be hyperphosphaturic. The index family comprised four individuals (father, mother, brother, sister). The affected siblings were the offspring of a non-consanguineous Indian family of Tamil origin. Bidirectional sequencing was performed on the DNA from the index family and on 160 alleles from a population of 80 unrelated unaffected control individuals of Tamil extraction and 72 alleles from individuals of non-Tamil origin. Two symptomatic siblings were found to harbour previously unreported compound heterozygous missense UDP-N-acetyl-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-transferase; GALNT3) mutations in exon 4 c.842A>G and exon 5 c.1097T>G. This sequence variation was not detected in the control DNA. This is the first report of siblings exhibiting stigmata of familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome with documented evidence of autosomal recessive missense GALNT3 mutations. The findings from this family add further evidence to the literature that familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome are manifestations of the same disease and highlight the importance of appropriate metabolic and genetic investigations. (orig.)

  5. Familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome are different manifestations of the same disease: novel missense mutations in GALNT3

    Energy Technology Data Exchange (ETDEWEB)

    Joseph, Leo; Joseph, Selvanayagam [Vinodhagan Memorial Hospital and Dr. Joseph' s Ortho Clinic, Department of Orthopaedic Surgery, Thanjavur (India); Hing, Sandra N.; Idowu, Bernadine D.; Delaney, David [Royal National Orthopaedic Hospital NHS Trust, Department of Histopathology, Stanmore, Middlesex (United Kingdom); Presneau, Nadege [University College London (UCL), Cancer Institute, London (United Kingdom); O' Donnell, Paul [Royal National Orthopaedic Hospital NHS Trust, Department of Radiology, Stanmore, Middlesex (United Kingdom); University College London (UCL), Institute of Orthopaedics and Musculoskeletal Science, Stanmore (United Kingdom); University College London (UCL), The Institute of Orthopaedics and Musculoskeletal Science, London (United Kingdom); Diss, Tim [University College London Hospital (UCLH) NHS Trust, Rockefeller Building, Department of Histopathology, London (United Kingdom); Flanagan, Adrienne Margaret [Royal National Orthopaedic Hospital NHS Trust, Department of Histopathology, Stanmore, Middlesex (United Kingdom); University College London (UCL), Cancer Institute, London (United Kingdom); University College London Hospital (UCLH) NHS Trust, Rockefeller Building, Department of Histopathology, London (United Kingdom); University College London (UCL), Institute of Orthopaedics and Musculoskeletal Science, Stanmore (United Kingdom); Institute of Orthopaedics and Musculoskeletal Science, Stanmore, Middlesex (United Kingdom)

    2010-01-15

    To report on the biochemistry and clinical and genetic findings of two siblings, the younger sister presenting with recurrent bone pain of the radius and ulna, and medullary sclerosis, and the older brother with soft tissue calcific deposits (tumoral calcinosis) but who later developed bone pain. Both were found to be hyperphosphaturic. The index family comprised four individuals (father, mother, brother, sister). The affected siblings were the offspring of a non-consanguineous Indian family of Tamil origin. Bidirectional sequencing was performed on the DNA from the index family and on 160 alleles from a population of 80 unrelated unaffected control individuals of Tamil extraction and 72 alleles from individuals of non-Tamil origin. Two symptomatic siblings were found to harbour previously unreported compound heterozygous missense UDP-N-acetyl-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-transferase; GALNT3) mutations in exon 4 c.842A>G and exon 5 c.1097T>G. This sequence variation was not detected in the control DNA. This is the first report of siblings exhibiting stigmata of familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome with documented evidence of autosomal recessive missense GALNT3 mutations. The findings from this family add further evidence to the literature that familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome are manifestations of the same disease and highlight the importance of appropriate metabolic and genetic investigations. (orig.)

  6. [Premalignant conditions of the small bowel].

    Science.gov (United States)

    Drastich, P

    2013-01-01

    Small intestinal dysplastic lesions are rare and difficult to detect before they progress to cancer. New investigative modalities, such as capsule endoscopy and doubleballoon enteroscopy, are very promising in search for premalignant lesions. Screening patients at high-risk for small bowel neoplasia is the only sensible approach. Duodenal adenoma represents the most easily accessible tumors with the possibility of curative endoscopic resection. Due to the strong association of the small bowel and colonic adenomas, it is always necessary to perform colonoscopy. In young patients, the exclusion of familial polyposis by genetic testing is always mandatory. Patients with celiac disease are especially at risk of developing nonHodgkins lymphomas and adenocarcinomas. There is a high-risk of ampuloma and other adenomas in patients with familial adenomatous polyposis. Patients with prolonged and complicated course of Crohns disease, Peutz Jeghers syndrome and patients with ileoanal pouch have higher risk of adenocarcinoma of the small intestine.

  7. IDENTIFYING COLLISIONAL FAMILIES IN THE KUIPER BELT

    International Nuclear Information System (INIS)

    Marcus, Robert A.; Ragozzine, Darin; Murray-Clay, Ruth A.; Holman, Matthew J.

    2011-01-01

    The identification and characterization of numerous collisional families-clusters of bodies with a common collisional origin-in the asteroid belt has added greatly to the understanding of asteroid belt formation and evolution. More recent study has also led to an appreciation of physical processes that had previously been neglected (e.g., the Yarkovsky effect). Collisions have certainly played an important role in the evolution of the Kuiper Belt as well, though only one collisional family has been identified in that region to date, around the dwarf planet Haumea. In this paper, we combine insights into collisional families from numerical simulations with the current observational constraints on the dynamical structure of the Kuiper Belt to investigate the ideal sizes and locations for identifying collisional families. We find that larger progenitors (r ∼ 500 km) result in more easily identifiable families, given the difficulty in identifying fragments of smaller progenitors in magnitude-limited surveys, despite their larger spread and less frequent occurrence. However, even these families do not stand out well from the background. Identifying families as statistical overdensities is much easier than characterizing families by distinguishing individual members from interlopers. Such identification seems promising, provided the background population is well known. In either case, families will also be much easier to study where the background population is small, i.e., at high inclinations. Overall, our results indicate that entirely different techniques for identifying families will be needed for the Kuiper Belt, and we provide some suggestions.

  8. Family doctors' involvement with families in Estonia

    Directory of Open Access Journals (Sweden)

    Lember Margus

    2004-10-01

    Full Text Available Abstract Background Family doctors should care for individuals in the context of their family. Family has a powerful influence on health and illness and family interventions have been shown to improve health outcomes for a variety of health problems. The aim of the study was to investigate the Estonian family doctors' (FD attitudes to the patients' family-related issues in their work: to explore the degree of FDs involvement in family matters, their preparedness for management of family-related issues and their self-assessment of the ability to manage different family-related problems. Methods A random sample (n = 236 of all FDs in Estonia was investigated using a postal questionnaire. Altogether 151 FDs responded to the questionnaire (response rate 64%, while five of them were excluded as they did not actually work as FDs. Results Of the respondents, 90% thought that in managing the health problems of patients FDs should communicate and cooperate with family members. Although most of the family doctors agreed that modifying of the health damaging risk factors (smoking, alcohol and drug abuse of their patients and families is their task, one third of them felt that dealing with these problems is ineffective, or perceived themselves as poorly prepared or having too little time for such activities. Of the respondents, 58% (n = 83 were of the opinion that they could modify also relationship problems. Conclusions Estonian family doctors are favourably disposed to involvement in family-related problems, however, they need some additional training, especially in the field of relationship management.

  9. Understanding Transportation Choice of Families with Small Children in Oslo

    OpenAIRE

    Miller, Scott Thomas

    2011-01-01

    This qualitative study took place in the Oslo area and focused on the transportation mode choices of parents with children in day care. Understanding why parents choose a certain mode of transport was the main objective of this research. Answers to the question of why were looked at in the context of theories stemming from urban planning, sociology, psychology amongst others. The findings show that while geographical distances did have the largest impact on how people travelled around work h...

  10. How small is small? A short history of quanta

    International Nuclear Information System (INIS)

    Ford, Kenneth W.

    2008-01-01

    All speak about quantum jumps, but scarcely anyone knows, what it is. The strange rules in the world of quanta evade from our imagination power: space and time are stirred together, mass becomes to energy and vice versa. Kenneth W. Ford has developed a unique approach, in order to explain these phenomena understandably and entertainingly: Otherwise than all other books on this theme illustrates ''How small is small?'' the laws of quantum physics by the picture of the particle family. We learn to know the quarks, the leptons, and bosons, and the residue of the kinship, and we get an outlook in the future of quantum theory. Kenneth W. Ford explains, why this theory revolutionized the physics of the 20th century. He presents the most important researchers and gives fascinating insights in the world ''below the surface''

  11. The Ins and Outs of Small GTPase Rac1 in the Vasculature

    NARCIS (Netherlands)

    Marinković, Goran; Heemskerk, Niels; van Buul, Jaap D.; de Waard, Vivian

    2015-01-01

    The Rho family of small GTPases forms a 20-member family within the Ras superfamily of GTP-dependent enzymes that are activated by a variety of extracellular signals. The most well known Rho family members are RhoA (Ras homolog gene family, member A), Cdc42 (cell division control protein 42), and

  12. Mutation analysis for DJ-1 in sporadic and familial parkinsonism: screening strategy in parkinsonism.

    Science.gov (United States)

    Tomiyama, Hiroyuki; Li, Yuanzhe; Yoshino, Hiroyo; Mizuno, Yoshikuni; Kubo, Shin-Ichiro; Toda, Tatsushi; Hattori, Nobutaka

    2009-05-22

    DJ-1 mutations cause autosomal recessive parkinsonism (ARP). Although some reports of DJ-1 mutations have been published, there is lack of information on the prevalence of these mutations in large-scale studies of both familial and sporadic parkinsonism. In this genetic screening study, we analyzed the distribution and frequency of DJ-1 mutations by direct nucleotide sequencing of coding exons and exon-intron boundaries of DJ-1, in 386 parkin-negative parkinsonism patients (371 index cases: 67 probands of autosomal recessive parkinsonism families, 90 probands of autosomal dominant parkinsonism families, 201 patients with sporadic parkinsonism, and 13 with unknown family histories) from 12 countries (Japan 283, China 27, Taiwan 22, Korea 22, Israel 16, Turkey 5, Philippines 2, Bulgaria 2, Greece 2, Tunisia 1, USA 2, Ukraine 1, unknown 1). None had causative mutation in DJ-1, suggesting DJ-1 mutation is very rare among patients with familial and sporadic parkinsonism from Asian countries and those with other ethnic background. This is in contrast to the higher frequencies and worldwide distribution of parkin- and PINK1-related parkinsonism in ARP and sporadic parkinsonism. Thus, after obtaining clinical information, screening for mutations in (1) parkin, (2) PINK1, (3) DJ-1, (4) ATP13A2 should be conducted in that order, in ARP and sporadic parkinsonism, based on their reported frequencies. In addition, haplotype analysis should be employed to check for homozygosity of 1p36, which harbors a cluster of causative genes for ARP such as DJ-1, PINK1 and ATP13A2 in ARP and sporadic parkinsonism, especially in parkinsonism with consanguinity.

  13. Isolated familial somatotropinomas: clinical features and analysis of the MEN1 gene.

    Science.gov (United States)

    De Menis, Ernesto; Prezant, Toni R

    2002-01-01

    Isolated familial somatotropinomas (IFS) rarely occurs in the absence of multiple endocrine neoplasia type I (MEN1) or the Carney complex. In the present study we report two Italian siblings affected by GH-secreting adenomas. There was no history of parental consanguinity. The sister presented at 18 years of age with secondary amenorrhea and acromegalic features and one of her two brothers presented with gigantism at the same age. Endocrinological investigations confirmed GH hypersecretion in both cases. Although a pituitary microadenoma was detected in both patients, transsphenoidal surgery was not successful. The sister received conventional radiotherapy and acromegaly is now considered controlled; the brother is being treated with octreotide LAR 30 mg monthly and the disease is considered clinically active. Patients, their parents and the unaffected brother underwent extensive evaluation, and no features of MEN1 or Carney complex were found. Analysis of polymorphic microsatellite markers from chromosome 11q13 (D11S599, D11S4945, D11S4939, D11S4938 and D11S987) showed that the acromegalic siblings had inherited different maternal chromosomes and shared the paternal chromosome. No pathogenic MEN1 sequence changes were detected by sequencing or dideoxy fingerprinting of the coding sequence (exons 2-10) and exon/intron junctions. Although mutations in the promoter, introns or untranslated regions of the MEN1 gene cannot be excluded, germline mutations within the coding region of this gene do not appear responsible for IFS in this family.

  14. Famiglia e geno-poiesi nel Nazionalsocialismo - Family and genos-poiesis in National Socialism

    Directory of Open Access Journals (Sweden)

    Alberto Castaldini

    2014-12-01

    Full Text Available The Nazi regime (1933-45 wanted to protect and promote through the creation of a new family structure the conservation of the biological heredity of the German nation, in order to preserve and refine obsessively the identity and the purity of the so-called Blutsgemeinschaft, the “community of blood” in which to identify the political and the cultural entity of the Volk, one of the pillars of Hitler’s biocracy. In the first half of the 20th century the value of memory, the nature of the family and the meaning of the relationship between the generations were manipulated and debased. This view, with its tragic ethical and juridical consequences, was scientifically warranted by German academic world, whose leading exponents took controversial positions. For instance the human biologist and eugenicist Otmar von Verschuer (1896-1969 theorized a biological unity between present and past, stating that the “German people is a large community of ancestors, namely a consanguineous solidarity”. In this way the Nazis deeply redefined the bonds of kinship and the genos assumed the nature of a “fictitious symbol” (C. Tullio-Altan in the service of a regime that in the name of an imaginary ancestral vitalism pursued a systematic policy of death.

  15. Competitiveness of Family Businesses

    NARCIS (Netherlands)

    M.A.A.M. Leenders (Mark); E. Waarts (Eric)

    2001-01-01

    textabstractThe purpose of this study is to systematically examine the advantages and disadvantages of different types of family businesses. We distinguish four different types of family businesses based on their family and business orientation: (1) House of Business, (2) Family Money Machine, (3)

  16. Families in Transition .

    Science.gov (United States)

    Bundy, Michael L., Ed.; Gumaer, James, Ed.

    1984-01-01

    Focuses on disrupted families and the role of the school counselor in helping children adjust. Describes characteristics of healthy families, and discusses the transition to the blended family, effects of divorce groups on children's classroom behavior, counseling children in stepfamilies, single-parent families, and parenting strengths of single…

  17. Pure γ-families

    International Nuclear Information System (INIS)

    Dunaevskii, A.M.

    1977-01-01

    The subject of this work are pure gamma families consisting of the gamma quanta produced in the early stages of cosmic cascades. The criteria of selecting these families from the all measured families are presented. The characteristics of these families are given and some conclusions about the mechanism of the nuclear-electromagnetic cascades are extracted. (S.B.)

  18. The role of women in family businesses

    OpenAIRE

    Jaka Vadnjal; Blaž Zupan

    2010-01-01

    The role of women in family businesses is explored in the paper. Although recognised as generally very important players, the role of women is oft en defined as invisible in business decision-making, supportive in men’s traditional business domains and only rarely adequately recognised and rewarded. The paper explores possible differences in the views of men and women who manage small family firms. Their attitudes opposing the traditional business roles of women, ...

  19. Lung cancer - small cell

    Science.gov (United States)

    Cancer - lung - small cell; Small cell lung cancer; SCLC ... About 15% of all lung cancer cases are SCLC. Small cell lung cancer is slightly more common in men than women. Almost all cases of SCLC are ...

  20. Small millets, big potential

    International Development Research Centre (IDRC) Digital Library (Canada)

    consumption of small millets, mainly due to limited productivity, high ... for effective integration of small millets in the ... replicated in other cities. ... to micro-, small- and medium-entrepreneurs producing millet-based ... and Activities Network,.

  1. BRANDING IN SMALL BUSINESS

    OpenAIRE

    Catalin Mihail BARBU; Radu Florin OGARCA; Mihai Razvan Constantin BARBU

    2010-01-01

    In this paper we analyzed the branding in small business. Using a desk research on Internet and the press we have identified the practices small businesses use to enhance their brand and the brand dynamics in small business. Our main contribution is that we tried to figure out the strategy of branding in small business. This need further to be investigated in order to understand how branding works in small business and to better capture the role of branding in small business.

  2. Founding a Family in Czech Society in the First Half of the 19th Century [Zakładanie rodziny w krajach czeskich w pierwszej połowie XIX wieku

    Directory of Open Access Journals (Sweden)

    František ČAPKA

    2016-06-01

    Full Text Available In the period in question, the family in the Czech Lands was usually comprised of between five and seven members – father, mother and children. Founding a family was subject to the agreement of the lord of the manor (in the countryside or the municipal authority (in the town. „Confirmation of probity” was requested from the seigniorial authorities in Catholic parishes even after the abolition of serfdom in the Habsburg monarchy (1781, while the approval of the couple’s legal representatives (parents was also required in the case of the marriage of people younger than twenty-four (the age of maturity. Partners were chosen by parents according to their property and social standing. People to be married were generally not only from the same social class, but also from the same place or nearby in the surrounding area. No lower age limit for marriage was stipulated by the law, though grooms younger than twenty were the exception, while around a fifth of brides were younger than twenty. The family represented a small social group comprised of individuals joined by marriage, consanguinity or adoption. It was seen as an institution to which the greatest regard was given. Its integrity was protected by a number of laws and traditions. In the first half of the nineteenth century, women usually got married between the ages of twenty and twenty-five, and men between the ages of twenty-five and thirty. The upper age limit, however, approached a figure of as much as fifty, or even exceeded it, for men living in towns. The age of brides was also higher in town families, among which couples being engaged for many years was also not unusual. This was particularly common among clerical workers, who had to attain a certain standing in order to be able to found a family. What’s more, according to the imperial decree of 1800, every state or municipal official needed the agreement of his superior if his pay had not reached a certain financial

  3. Small Business Size Standards

    Data.gov (United States)

    Small Business Administration — Certain government programs, such as SBA loan programs and contracting opportunities, are reserved for small business concerns. In order to qualify, businesses must...

  4. Work-family harmony

    OpenAIRE

    Adhikari,Pralhad

    2018-01-01

    The phenomenon of positively thinking about work and organization during the family hours by a worker is called work-family harmony. On the fag opposite of work-family conflict is work-family harmony. The work extends/intrudes into the family life of the worker, but in a positive way. This kind of positive thinking about the organization helps person's subjective well-being grow and his mental health is also nourished.

  5. Rakhaine community embraces family planning.

    Science.gov (United States)

    Chowdhury, S M

    1994-01-01

    The Rakhaines are a small, tightly knit community of 15,000 people who occupy parts of the coastal and hilly districts of southern Bangladesh. It is a closed community with different ethnic origins and religion from other Bangladeshis. As such, they have been largely unreached by government health and family planning services. In response to the need to bring services to these people, contact was established between the Family Planning Association of Bangladesh (FPAB) and the Rakhaine in 1987 in the interest of improving family health and well-being among the Rakhaine people through the introduction of maternal and child health care and family planning. The Family Planning Services for the Rakhaine Community project of the FPAB began in Cox's Bazar and Harbang in late 1987, and spread gradually over the hilly terrain inhabited by the Rakhaine to now serve 2000 couples. Although family planning was the focal point, the project also incorporated schemes for income generation, maternal and child health care, and sanitation. At baseline, less than 25% of reproductive age couples were using contraception, but this proportion grew to 69% by 1993, higher than the national contraceptive prevalence rate of approximately 40%. Used by 41% of married women of reproductive age, the pill is the most preferred contraceptive method, followed by sterilization among 10% of women. The efforts of fieldworkers were crucial to program success. The author notes that current users have been using contraception on average for just over two years. Moreover, the level of tetanus toxoid immunization rose to 60% of pregnant women, while 75% of children are now immunized against major life-threatening diseases. Some costs are recovered, but not enough to finance the project.

  6. Nontraditional family romance.

    Science.gov (United States)

    Corbett, K

    2001-07-01

    Family stories lie at the heart of psychoanalytic developmental theory and psychoanalytic clinical technique, but whose family? Increasingly, lesbian and gay families, multiparent families, and single-parent families are relying on modern reproductive technologies to form families. The contemplation of these nontraditional families and the vicissitudes of contemporary reproduction lead to an unknowing of what families are, including the ways in which psychoanalysts configure the family within developmental theory. This article focuses on the stories that families tell in order to account for their formation--stories that include narratives about parental union, parental sexuality, and conception. The author addresses three constructs that inform family stories and that require rethinking in light of the category crises posed by and for the nontraditional family: (1) normative logic, (2) family reverie and the construction of a family romance, and (3) the primal scene. These constructs are examined in tandem with detailed clinical material taken from the psychotherapy of a seven-year-old boy and his two mothers.

  7. Trends in family tourism

    Directory of Open Access Journals (Sweden)

    Heike A. Schänzel

    2015-03-01

    Full Text Available Purpose – Families represent a large and growing market for the tourism industry. Family tourism is driven by the increasing importance placed on promoting family togetherness, keeping family bonds alive and creating family memories. Predictions for the future of family travel are shaped by changes in demography and social structures. With global mobility families are increasingly geographically dispersed and new family markets are emerging. The purpose of this paper is to discuss the trends that shape the understanding of families and family tourism. Design/methodology/approach – This paper examines ten trends that the authors as experts in the field identify of importance and significance for the future of family tourism. Findings – What emerges is that the future of family tourism lies in capturing the increasing heterogeneity, fluidity and mobility of the family market. Originality/value – The paper contributes to the understanding about the changes taking place in family tourism and what it means to the tourism industry in the future.

  8. Small Business Administration: Workforce Transformation Plan Is Evolving

    National Research Council Canada - National Science Library

    D'Agostino, Davi

    2002-01-01

    .... SBA's mission is to maintain and strengthen the nation's economy by aiding, counseling, assisting, and protecting the interests of the nation's small businesses and by helping businesses and families...

  9. Small-scale Aquaculture to Strengthen Food Security in Cambodia ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    , vitamin A, protein, and essential fatty acids. Six hundred (600) households largely headed by women farmers are raising small nutrient-rich fish for their families' consumption in the same ponds as large fish, which can be sold for income.

  10. Strengthening Family Practices for Latino Families

    Science.gov (United States)

    Chartier, Karen G.; Negroni, Lirio K.; Hesselbrock, Michie N.

    2010-01-01

    This study examined the effectiveness of a culturally adapted Strengthening Families Program (SFP) for Latinos to reduce risks for alcohol and drug use in children. Latino families, predominantly Puerto Rican, with a 9- to 12-year-old child and a parent(s) with a substance abuse problem participated in the study. Pre- and post-tests were conducted…

  11. Intra-family messaging with family circles

    NARCIS (Netherlands)

    Schatorjé, R.J.W.; Markopoulos, P.; Neustaedter, C.; Harrison, S.; Sellen, A.

    2013-01-01

    This chapter makes the argument that intra-family communication is not an issue of connectivity anytime anywhere, but of providing communication media that are flexible and expressive allowing families to appropriate them and fit their own idiosyncratic ways of communicating with each other. We

  12. Family Therapy for the "Truncated" Nuclear Family.

    Science.gov (United States)

    Zuk, Gerald H.

    1980-01-01

    The truncated nuclear family consists of a two-generation group in which conflict has produced a polarization of values. The single-parent family is at special risk. Go-between process enables the therapist to depolarize sharply conflicted values and reduce pathogenic relating. (Author)

  13. Novel mutation in TSPAN12 leads to autosomal recessive inheritance of congenital vitreoretinal disease with intra-familial phenotypic variability.

    Science.gov (United States)

    Gal, Moran; Levanon, Erez Y; Hujeirat, Yasir; Khayat, Morad; Pe'er, Jacob; Shalev, Stavit

    2014-12-01

    Developmental malformations of the vitreoretinal vasculature are a heterogeneous group of conditions with various modes of inheritance, and include familial exudative vitreoretinopathy (FEVR), persistent fetal vasculature (PFV), and Norrie disease. We investigated a large consanguineous kindred with multiple affected individuals exhibiting variable phenotypes of abnormal vitreoretinal vasculature, consistent with the three above-mentioned conditions and compatible with autosomal recessive inheritance. Exome sequencing identified a novel c.542G > T (p.C181F) apparently mutation in the TSPAN12 gene that segregated with the ocular disease in the family. The TSPAN12 gene was previously reported to cause dominant and recessive FEVR, but has not yet been associated with other vitreoretinal manifestations. The intra-familial clinical variability caused by a single mutation in the TSPAN12 gene underscores the complicated phenotype-genotype correlation of mutations in this gene, and suggests that there are additional genetic and environmental factors involved in the complex process of ocular vascularization during embryonic development. Our study supports considering PFV, FEVR, and Norrie disease a spectrum of disorders, with clinical and genetic overlap, caused by mutations in distinct genes acting in the Norrin/β-catenin signaling pathway. © 2014 Wiley Periodicals, Inc.

  14. Loosely coupled class families

    DEFF Research Database (Denmark)

    Ernst, Erik

    2001-01-01

    are expressed using virtual classes seem to be very tightly coupled internally. While clients have achieved the freedom to dynamically use one or the other family, it seems that any given family contains a xed set of classes and we will need to create an entire family of its own just in order to replace one...... of the members with another class. This paper shows how to express class families in such a manner that the classes in these families can be used in many dierent combinations, still enabling family polymorphism and ensuring type safety....

  15. Neutrino masses and family replication

    International Nuclear Information System (INIS)

    Hung, P.Q.

    1999-01-01

    The issue of whether or not there is any link between the smallness of the neutrino mass (if present) and the odd or even nature of the number of families is investigated. It is found that, by assuming the existence of right-handed neutrinos (which would imply that neutrinos will have a mass) and a new chiral SU(2) gauge theory, a constraint on the nature of the number of families can be obtained. In addition, a model, based on that extra SU(2), is constructed where it is plausible to have one 'very heavy' fourth neutrino and three almost degenerate light neutrinos whose masses are all of the Dirac type. copyright 1999 The American Physical Society

  16. Association between consanguinity and survival of marriages

    African Journals Online (AJOL)

    Mostafa Saadat

    2014-09-08

    Sep 8, 2014 ... Received 5 July 2014; accepted 17 August 2014. Available online 8 .... study on a large sample size from the Born in Bradford cohort study. ... self evident that replication of present findings in other popu- lations is recommended. Disclosure statement ... Marriage · and personality: a genetic analysis. J Pers ...

  17. A homozygous CARD9 mutation in a family with susceptibility to fungal infections.

    Science.gov (United States)

    Glocker, Erik-Oliver; Hennigs, Andre; Nabavi, Mohammad; Schäffer, Alejandro A; Woellner, Cristina; Salzer, Ulrich; Pfeifer, Dietmar; Veelken, Hendrik; Warnatz, Klaus; Tahami, Fariba; Jamal, Sarah; Manguiat, Annabelle; Rezaei, Nima; Amirzargar, Ali Akbar; Plebani, Alessandro; Hannesschläger, Nicole; Gross, Olaf; Ruland, Jürgen; Grimbacher, Bodo

    2009-10-29

    Chronic mucocutaneous candidiasis may be manifested as a primary immunodeficiency characterized by persistent or recurrent infections of the mucosa or the skin with candida species. Most cases are sporadic, but both autosomal dominant inheritance and autosomal recessive inheritance have been described. We performed genetic studies in 36 members of a large, consanguineous five-generation family, in which 4 members had recurrent fungal infections and an additional 3 members died during adolescence, 2 after invasive infection of the brain with candida species. All 36 family members were enrolled in the study, and 22 had blood samples taken for DNA analysis. Homozygosity mapping was used to locate the mutated gene. In the 4 affected family members (patients) and the 18 unaffected members we sequenced CARD9, the gene encoding the caspase recruitment domain-containing protein 9, carried out T-cell phenotyping, and performed functional studies, with the use of either leukocytes from the patients or a reconstituted murine model of the genetic defect. We found linkage (lod score, 3.6) to a genomic interval on chromosome 9q, including CARD9. All four patients had a homozygous point mutation in CARD9, resulting in a premature termination codon (Q295X). Healthy family members had wild-type expression of the CARD9 protein; the four patients lacked wild-type expression, which was associated with low numbers of Th17 cells (helper T cells producing interleukin-17). Functional studies based on genetic reconstitution of myeloid cells from Card9(-/-) mice showed that the Q295X mutation impairs innate signaling from the antifungal pattern-recognition receptor dectin-1. An autosomal recessive form of susceptibility to chronic mucocutaneous candidiasis is associated with homozygous mutations in CARD9. 2009 Massachusetts Medical Society

  18. 76 FR 39115 - Notice of Proposed Information Collection: Transformation Initiative Family Self-Sufficiency...

    Science.gov (United States)

    2011-07-05

    ... Information Collection: Transformation Initiative Family Self-Sufficiency Demonstration Small Grants AGENCY... information: Title of Proposal: Notice of Funding Availability for the Transformation Initiative Family Self..., think tanks, consortia, Institutions of higher education accredited by a national or regional...

  19. Which family--what therapy: Maori culture, families and family therapy in New Zealand.

    Science.gov (United States)

    Kumar, Shailesh; Dean, Peter; Smith, Barry; Mellsop, Graham W

    2012-04-01

    New Zealand is a relatively young and small country which has seen steady migration for nearly seven centuries. Despite a long history of rivalry and hostility between Maori and European values, the country has also seen some significant synergism between the two cultures. For the last three decades Asians have also migrated at a significant pace. The country faces the challenge of delivering quality mental health services to such cultures which are bifurcated in being socio-centric (Maori, Pacific Islanders and Asian total 32% combined) or ego-centric (European total 68%). Significant progress has been made in including families of the mentally ill in their treatment and care planning. Legislative requirements have been introduced for the family to be consulted in the treatment of those who are being compelled to receive psychiatric care under the Mental Health Act. Models of family therapy developed through innovation meeting the unique local needs or adaptation of existing models from overseas are being used. An overview of such family therapy modalities is presented.

  20. Invalidating stagnation theory for family owned businesses : comparing family-to-family and third party ownership transfers

    NARCIS (Netherlands)

    Alija Ibrahimovic; Lex van Teeffelen; Roger Heaver

    2015-01-01

    Miller, Le Breton-Miller and Scholnick (2008) summarize and discuss two major perspectives constructed from the literature on family owned businesses (FOBs): stewardship and stagnation theory. In this paper the stagnation theory is being put to the test on Dutch small/medium enterprises (SMEs).

  1. MSUD Family Support Group

    Science.gov (United States)

    ... The Treatment Of MSUD The MSUD Family Support Group has provided funds to Buck Institute for its ... of the membership of the MSUD Family Support Group, research for improved treatments and potential cure was ...

  2. National Military Family Association

    Science.gov (United States)

    ... MilitaryFamily.org © 2017 - National Military Family Association Twitter Facebook Pinterest Instagram Charity Navigator Four Star Charity GuideStar Exchange Better Business Bureau Charity Watch Independent Charity of America nonprofit ...

  3. IGSF9 Family Proteins

    DEFF Research Database (Denmark)

    Hansen, Maria; Walmod, Peter Schledermann

    2013-01-01

    The Drosophila protein Turtle and the vertebrate proteins immunoglobulin superfamily (IgSF), member 9 (IGSF9/Dasm1) and IGSF9B are members of an evolutionarily ancient protein family. A bioinformatics analysis of the protein family revealed that invertebrates contain only a single IGSF9 family gene......, the longest isoforms of the proteins have the same general organization as the neural cell adhesion molecule family of cell adhesion molecule proteins, and like this family of proteins, IGSF9 family members are expressed in the nervous system. A review of the literature revealed that Drosophila Turtle...... facilitates homophilic cell adhesion. Moreover, IGSF9 family proteins have been implicated in the outgrowth and branching of neurites, axon guidance, synapse maturation, self-avoidance, and tiling. However, despite the few published studies on IGSF9 family proteins, reports on the functions of both Turtle...

  4. Family Caregiver Alliance

    Science.gov (United States)

    ... on your schedule. Look for our launch soon! FAMILY CARE NAVIGATOR ─ Click on Your State AL AK ... AiA18 Smart Patients Caregivers Community In partnership with Family Caregiver Alliance Learn more Caregiver Research Studies show ...

  5. Resilience of refugee families

    Directory of Open Access Journals (Sweden)

    Batić Dragana

    2012-01-01

    Full Text Available This study attempted to find a correlation between the trauma of family members of war and exile, and the characteristics of family functioning and lasted from 1992-1995. The term “family resilience” refers to the processes of adaptation and coping in the family as a functional unit. This paper presents a study of refugee families from Bosnia, who lived in refugee camps in Macedonia during the war of 1992- 1995. Data were obtained by interviews, observations, and a number of psychological instruments especially for children and parents, which measured the effects of psychological stress and family relationships. Based on the results obtained by quantitative and qualitative analysis, and application of theoretical models of systemic theory and family therapy, existence for four types of refugee families has been found and described, depending on the structure and the level of functionality.

  6. Unique Family Living Situations

    Science.gov (United States)

    ... Yet, what if the family home changes for reasons of divorce, death, or economics? Factors, such as shifting between ... for a child of any age. If the reason is due to divorce, work together as a family (both parents and ...

  7. Xeroderma Pigmentosum - A Family

    Directory of Open Access Journals (Sweden)

    Garg Anush

    2000-01-01

    Full Text Available A family of xeroderma pigmentosum is reported. Four children of different ages were afflicted with varying clinical presentation. Sequential development and progression of the disease from freckling to malignancy within the family are discussed.

  8. Essays on Family Firms

    OpenAIRE

    Zhou, Haoyong

    2012-01-01

    The dissertation examines corporate performance and capital structure of family firms, contributing to the limited empirical research on family firms. Family firms are prevalent in national economies all over the world. It is the prevalence that makes family firms receive increasing attentions from academia. The dissertation consists of an introduction and three chapters. Each chapter is an independent paper. The first chapter is a joint work with Professor Morten Bennedsen and...

  9. Family Obligations in Denmark

    DEFF Research Database (Denmark)

    Koch-Nielsen, Inger

    How is the balance in obligations between the Family and the Danish Welfare State? Can we observe a trend to shift the responsibility back to the family? This booklet intends to sketch the legal framework around the division of responsibilities between the Family and the state and to analyse...... to what extent and where the unit of rights and obliagations is the individual and where it is the family or household....

  10. Genetics of familial melanoma

    DEFF Research Database (Denmark)

    Aoude, Lauren G; Wadt, Karin A W; Pritchard, Antonia L

    2015-01-01

    Twenty years ago, the first familial melanoma susceptibility gene, CDKN2A, was identified. Two years later, another high-penetrance gene, CDK4, was found to be responsible for melanoma development in some families. Progress in identifying new familial melanoma genes was subsequently slow; however...

  11. Family Counseling Psychology.

    Science.gov (United States)

    Levant, Ronald F., ed.

    1983-01-01

    Describes programs for family counseling which use psychological-educational and skills training methods to remediate individual and family problems or enhance family life. The six articles discuss client-centered skills training, behavioral approaches, cognitive behavioral marital therapy, Adlerian parent education, and couple communication. (JAC)

  12. Year of the Family.

    Science.gov (United States)

    California Agriculture, 1994

    1994-01-01

    This special issue focuses on problems and challenges confronting the California family and on research and extension efforts to provide at least partial answers. Research briefs by staff include "Challenges Confront the California Family" (state trends in poverty, divorce, single-parent families, child abuse, delinquency, teen births,…

  13. Rethinking Family Power.

    Science.gov (United States)

    Kranichfeld, Marion L.

    1987-01-01

    Men's power is emphasized in the family power literature on marital decision making. Little attention has been paid to women's power, accrued through their deeper embeddedness in intrafamilial roles. Micro-level analysis of family power demonstrates that women's positions in the family power structure rest not on the horizontal marital tie but…

  14. Analysis of metabolomics data from twin families

    NARCIS (Netherlands)

    Draisma, Hermanus Henricus Maria

    2011-01-01

    Metabolomics is the comprehensive analysis of small molecules involved in metabolism, on the basis of samples that have been obtained from organisms in a given physiological state. Data obtained from measurements of trait levels in twin families can be used to elucidate the importance of genetic and

  15. Family size and intra-family inequalities in education in Ouagadougou

    Directory of Open Access Journals (Sweden)

    James Lachaud

    2014-12-01

    Full Text Available Background: While the potential benefits for educational investment of decline in family size are well known, some questions have emerged on the distribution of these benefits. Do all the children in a family benefit equitably from the improved conditions brought about by limiting their number? And what are the consequences of reduction in family size for social inequalities in educational opportunity within the family? Objective: This study aims to analyze the inequalities in education between children within the same family in the context of falling fertility in Ouagadougou, the capital city of Burkina Faso. Methods: Inequalities in school attainment are analyzed, first in regard to family sizes and second in terms of gender, birth order, and the interactions between these two variables. Probit models are estimated and adjusted Wald F statistics with Bonferroni corrections for multiple comparisons are computed. Results: The results show that family households with fewer children exhibit different patterns of investment in children's schooling, with lower inequalities between children by gender and birth order. At the post-primary level, however, the firstborn girls in small families appear to be less likely to be enrolled in school compared with those in large families, and also to be disadvantaged in their schooling compared to other children of small families. Conclusions: Reduced fertility appears to have negative effects on the schooling of the oldest girls and beneficial effects for all other children in the household. To mitigate this disadvantage, measures should be considered to reconcile domestic work with the new opportunities emerging from expanding school systems and smaller family sizes.

  16. Lynch syndrome-related small intestinal adenocarcinomas.

    Science.gov (United States)

    Jun, Sun-Young; Lee, Eui-Jin; Kim, Mi-Ju; Chun, Sung Min; Bae, Young Kyung; Hong, Soon Uk; Choi, Jene; Kim, Joon Mee; Jang, Kee-Taek; Kim, Jung Yeon; Kim, Gwang Il; Jung, Soo Jin; Yoon, Ghilsuk; Hong, Seung-Mo

    2017-03-28

    Lynch syndrome is an autosomal-dominant disorder caused by defective DNA mismatch repair (MMR) genes and is associated with increased risk of malignancies in multiple organs. Small-intestinal adenocarcinomas are common initial manifestations of Lynch syndrome. To define the incidence and characteristics of Lynch syndrome-related small-intestinal adenocarcinomas, meticulous familial and clinical histories were obtained from 195 patients with small-intestinal adenocarcinoma, and MMR protein immunohistochemistry, microsatellite instability, MLH1 methylation, and germline mutational analyses were performed. Lynch syndrome was confirmed in eight patients (4%), all of whom had synchronous/metachronous malignancies without noticeable familial histories. Small-intestinal adenocarcinomas were the first clinical manifestation in 37% (3/8) of Lynch syndrome patients, and second malignancies developed within 5 years in 63% (5/8). The patients with accompanying Lynch syndrome were younger (≤50 years; P=0.04) and more likely to have mucinous adenocarcinomas (P=0.003), and tended to survive longer (P=0.11) than those with sporadic cases. A meticulous patient history taking, MMR protein immunolabeling, and germline MMR gene mutational analysis are important for the diagnosis of Lynch syndrome-related small-intestinal adenocarcinomas. Identifying Lynch syndrome in patients with small-intestinal adenocarcinoma can be beneficial for the early detection and treatment of additional Lynch syndrome-related cancers, especially in patients who are young or have mucinous adenocarcinomas.

  17. Small angle spectrometers: Summary

    International Nuclear Information System (INIS)

    Courant, E.; Foley, K.J.; Schlein, P.E.

    1986-01-01

    Aspects of experiments at small angles at the Superconducting Super Collider are considered. Topics summarized include a small angle spectrometer, a high contingency spectrometer, dipole and toroid spectrometers, and magnet choices

  18. Small Community Training & Education

    Science.gov (United States)

    Operators Small Systems Small Community Training & Education education, training and professional implement the 1996 Amendments to the Safe Drinking Water Act (SDWA). • EPA Environmental Education Center

  19. Gender Segregation Small Firms

    OpenAIRE

    Kenneth R Troske; William J Carrington

    1992-01-01

    This paper studies interfirm gender segregation in a unique sample of small employers. We focus on small firms because previous research on interfirm segregation has studied only large firms and because it is easier to link the demographic characteristics of employers and employees in small firms. This latter feature permits an assessment of the role of employer discrimination in creating gender segregation. Our first finding is that interfirm segregation is prevalent among small employers. I...

  20. A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

    Science.gov (United States)

    Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

    2017-04-12

    Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

  1. New evidence for the role of calpain 10 in autosomal recessive intellectual disability: identification of two novel nonsense variants by exome sequencing in Iranian families.

    Science.gov (United States)

    Oladnabi, Morteza; Musante, Luciana; Larti, Farzaneh; Hu, Hao; Abedini, Seyedeh Sedigheh; Wienker, Thomas; Ropers, Hans Hilger; Kahrizi, Kimia; Najmabadi, Hossein

    2015-03-01

    Knowledge of the genes responsible for intellectual disability, particularly autosomal recessive forms, is rapidly expanding. Increasing numbers of the gene show great heterogeneity and supports the hypothesis that human genome may contain over 2000 causative genes with a critical role in brain development. Since 2004, we have applied genome-wide SNP genotyping and next-generation sequencing in large consanguineous Iranian families with intellectual disability, to identify the genes harboring disease-causing mutations. The current study paved the way for identification of responsible genes in two unrelated Iranian families. We found two novel nonsense mutations, p.C77* and p.Q115*, in the calpain catalytic domain of CAPN10, which is a cysteine protease known to be involved in pathogenesis of noninsulin-dependent diabetes mellitus. Another different mutation in this gene (p.S138_R139ins5) has previously been reported in an Iranian family. All of these patients have common clinical features in spite of specific brain structural abnormalities on MRI. Different mutations in CAPN10 have already been found in three independent Iranian families. These results have strongly supported the possible role of CAPN10 in human brain development. Altogether, we proposed CAPN10 as a promising candidate gene for intellectual disability, which should be considered in diagnostic gene panels.

  2. Novel VPS13B Mutations in Three Large Pakistani Cohen Syndrome Families Suggests a Baloch Variant with Autistic-Like Features.

    Science.gov (United States)

    Rafiq, Muhammad Arshad; Leblond, Claire S; Saqib, Muhammad Arif Nadeem; Vincent, Akshita K; Ambalavanan, Amirthagowri; Khan, Falak Sher; Ayaz, Muhammad; Shaheen, Naseema; Spiegelman, Dan; Ali, Ghazanfar; Amin-ud-Din, Muhammad; Laurent, Sandra; Mahmood, Huda; Christian, Mehtab; Ali, Nadir; Fennell, Alanna; Nanjiani, Zohair; Egger, Gerald; Caron, Chantal; Waqas, Ahmed; Ayub, Muhammad; Rasheed, Saima; Forgeot d'Arc, Baudouin; Johnson, Amelie; So, Joyce; Brohi, Muhammad Qasim; Mottron, Laurent; Ansar, Muhammad; Vincent, John B; Xiong, Lan

    2015-06-25

    Cohen Syndrome (COH1) is a rare autosomal recessive disorder, principally identified by ocular, neural and muscular deficits. We identified three large consanguineous Pakistani families with intellectual disability and in some cases with autistic traits. Clinical assessments were performed in order to allow comparison of clinical features with other VPS13B mutations. Homozygosity mapping followed by whole exome sequencing and Sanger sequencing strategies were used to identify disease-related mutations. We identified two novel homozygous deletion mutations in VPS13B, firstly a 1 bp deletion, NM_017890.4:c.6879delT; p.Phe2293Leufs*24, and secondly a deletion of exons 37-40, which co-segregate with affected status. In addition to COH1-related traits, autistic features were reported in a number of family members, contrasting with the "friendly" demeanour often associated with COH1. The c.6879delT mutation is present in two families from different regions of the country, but both from the Baloch sub-ethnic group, and with a shared haplotype, indicating a founder effect among the Baloch population. We suspect that the c.6879delT mutation may be a common cause of COH1 and similar phenotypes among the Baloch population. Additionally, most of the individuals with the c.6879delT mutation in these two families also present with autistic like traits, and suggests that this variant may lead to a distinct autistic-like COH1 subgroup.

  3. Disrupted Refugee Family Life

    DEFF Research Database (Denmark)

    Shapiro, Ditte Krogh

    2017-01-01

    Fleeing civil war involves managing life threatening events and multiple disruptions of everyday life. The theoretical potentials of analysing the recreation of everyday family life among Syrian refugees in Denmark is explored based on conceptualizations that emphasize the collective agency...... of family members in social historical contexts. Studying the multiple perspectives of family members shows how social support conceptualized as care practises is conflictual in the changing everyday family practices that are transformed by policy. The purpose of studying how families manage to flee civil...... war and struggle to recreate an everyday life in exile is to contribute with contextualization and expansion of mainstream understandings of family life, suffering, and resilience in refugee family trajectories in multiple contexts....

  4. Inside the Family Firm

    DEFF Research Database (Denmark)

    Bennedsen, Morten; Nielsen, Kasper; Pérez-González, Francisco

    2005-01-01

    This paper uses a unique dataset from Denmark to investigate (1) the role of family characteristics in corporate decision making, and (2) the consequences of these decisions on firm performance. We focus on the decision to appoint either a family or an external chief executive officer (CEO). We...... show that a departing CEO's family characteristics have a strong predictive power in explaining CEO succession decisions: family CEOs are more frequently selected the larger the size of the family, the higher the ratio of male children and when the departing CEOs had only had one spouse. We...... then analyze the impact of family successions on performance. We overcome endogeneity and omitted variables problems of previous papers in the literature by using the gender of a departing CEO's first-born child as an instrumental variable (IV) for family successions. This is a plausible IV as male first...

  5. Small Business Commitment | NREL

    Science.gov (United States)

    Small Business Commitment Small Business Commitment Central to NREL's mission is our commitment to small business through a comprehensive and mature outreach program that combines proven techniques with the latest technology and best business practices. For More Information Contact Us Please email Rexann

  6. Multiplex families with epilepsy

    Science.gov (United States)

    Afawi, Zaid; Oliver, Karen L.; Kivity, Sara; Mazarib, Aziz; Blatt, Ilan; Neufeld, Miriam Y.; Helbig, Katherine L.; Goldberg-Stern, Hadassa; Misk, Adel J.; Straussberg, Rachel; Walid, Simri; Mahajnah, Muhammad; Lerman-Sagie, Tally; Ben-Zeev, Bruria; Kahana, Esther; Masalha, Rafik; Kramer, Uri; Ekstein, Dana; Shorer, Zamir; Wallace, Robyn H.; Mangelsdorf, Marie; MacPherson, James N.; Carvill, Gemma L.; Mefford, Heather C.; Jackson, Graeme D.; Scheffer, Ingrid E.; Bahlo, Melanie; Gecz, Jozef; Heron, Sarah E.; Corbett, Mark; Mulley, John C.; Dibbens, Leanne M.; Korczyn, Amos D.

    2016-01-01

    Objective: To analyze the clinical syndromes and inheritance patterns of multiplex families with epilepsy toward the ultimate aim of uncovering the underlying molecular genetic basis. Methods: Following the referral of families with 2 or more relatives with epilepsy, individuals were classified into epilepsy syndromes. Families were classified into syndromes where at least 2 family members had a specific diagnosis. Pedigrees were analyzed and molecular genetic studies were performed as appropriate. Results: A total of 211 families were ascertained over an 11-year period in Israel. A total of 169 were classified into broad familial epilepsy syndrome groups: 61 generalized, 22 focal, 24 febrile seizure syndromes, 33 special syndromes, and 29 mixed. A total of 42 families remained unclassified. Pathogenic variants were identified in 49/211 families (23%). The majority were found in established epilepsy genes (e.g., SCN1A, KCNQ2, CSTB), but in 11 families, this cohort contributed to the initial discovery (e.g., KCNT1, PCDH19, TBC1D24). We expand the phenotypic spectrum of established epilepsy genes by reporting a familial LAMC3 homozygous variant, where the predominant phenotype was epilepsy with myoclonic-atonic seizures, and a pathogenic SCN1A variant in a family where in 5 siblings the phenotype was broadly consistent with Dravet syndrome, a disorder that usually occurs sporadically. Conclusion: A total of 80% of families were successfully classified, with pathogenic variants identified in 23%. The successful characterization of familial electroclinical and inheritance patterns has highlighted the value of studying multiplex families and their contribution towards uncovering the genetic basis of the epilepsies. PMID:26802095

  7. Small hepatocellular carcinoma versus small cavernous hemangioma

    International Nuclear Information System (INIS)

    Choi, B.I.; Park, H.W.; Kim, S.H.; Han, M.C.; Kim, C.W.

    1989-01-01

    To determine the optimal pulse sequence for detection and differential diagnosis of small hepatocellular carcinomas and cavernous hemangiomas less than 5 cm in diameter, the authors have analyzed spin-echo (SE) images of 15 small hepatocellular carcinomas and 31 small cavernous hemangiomas obtained at 2.0 T. Pulse sequences used included repetition times (TRs) of 500 and 2,000 msec and echo times (TEs) of 30,60,90,120,150, and 180 msec. Mean tumor-liver contrast-to-noise ratios on the SE 2,000/60 (TR msec/TE msec) sequence were 23.90 ± 16.33 and 62.10 ± 25.94 for small hepatocellular carcinomas and hemangiomas, respectively, and were significantly greater than for all other pulse sequences. Mean tumor-liver signal intensity ratios on the SE 2,000/150 sequence were 2.34 ± 1.72 and 6.04 ± 2.72 for small hepatocellular carcinomas and hemangiomas, respectively, and were significantly greater than for all other pulse sequences in hemangiomas

  8. Family planning and social position of women.

    Science.gov (United States)

    Begum, Hasna

    1993-04-01

    This presentation began with at least three biases: (i) Acceptance of a secular approach to the problem of artificially controlling human reproduction; (ii) acceptance of an absolute egalitarian position in matter of choices and applications of family planning methods; and (iii) acceptance of the view that a small family gives women more opportunities to flourish as humans. The conclusion of the presentation is: though in implementing family planning programmes much deviation from the egalitarian principle could be found, in reality the implementation itself does bring about some opportunities for women to enhance their position in society. Undoubtedly the malpractices in family planning programmes cause death and miseries to women. But, until better methods are invented for both male and female sexes to replace the harmful ones and the male members of the society feel equal responsibility in matters of controlling reproduction, women have now no other choice but to accept the lesser evil.

  9. Succession Issues among Family Entrepreneursin Countries of the Gulf

    OpenAIRE

    Ralph Palliam; Hanas A. Cader; Charles Chiemeke

    2011-01-01

    Small family business succession is gaining increased prominence in Western societies. In Arab societies, literature on family business succession is virtually nonexistent. As Arab societies are embracing Western values, the issues of family business succession that are considered in the West will become major issues in Arab societies. This empirical study explores the transferability of theoretical constructs developed in the West to the countries of the Gulf Cooperation Council. The finding...

  10. Small Business Management Volume III: Curriculum. An Adult Education Program.

    Science.gov (United States)

    Persons, Edgar A.; Swanson, Gordon I.

    The small business management adult education program outlined in this curriculum guide is designed to help small business entrepreneurs solve their business management problems and attain the goals they have established for their businesses and their families. (An instructor's manual and practice problems are in separate volumes.) The 3-year…

  11. Small Business in America: The Year 2000 and Beyond.

    Science.gov (United States)

    Institute for Enterprise Advancement, Washington, DC.

    Small businesses are meeting the challenges of a changing economy and leading the way in production and job creation. Small businesses especially will continue to benefit from demographic and societal shifts, in particular the emergence of the two-career family that fuels the service industry. Women and minority persons are the newest…

  12. Enhancing National Unity Through Family-Life Education ...

    African Journals Online (AJOL)

    The Family is the most basic social unit in today's society. Despite it's small size, it plays important roles in stabilizing and enhancing the growth of the adult members of the society and provide a context for the growth and development of the children. The changing nature of the role of the family, in recent time, demands for a ...

  13. Effectiveness of resource-enhancing family-oriented intervention.

    Science.gov (United States)

    Häggman-Laitila, Arja; Tanninen, Hanna-Mari; Pietilä, Anna-Maija

    2010-09-01

    The purpose of the study was to assess the effectiveness of a resource-enhancing family-oriented intervention. There is very little empirical knowledge of how nurses working in a home context develop relationships with families, what methods they use to enhance families' resources and how such relationships affect the families' health outcomes. The study was designed as a descriptive service evaluation. A total of 129 family members from 30 families with small children participated in the study. Data were collected with family care plans and client reports in 2004-2005. Data were analysed by qualitative content analysis and by descriptive statistical methods. Resource-enhancing discussions were carried out in all family meetings. Other methods were video guidance, creation of a family tree and parents' role map, network collaboration, observation and parent-child group activity. The families needed support mostly in parents' health and well-being, coping with parenthood, upbringing and child care, parents' relationships, social relations and children's health and growth. The families had an average of five support needs at the beginning of the intervention and 1·8 needs at the completion. The families set on average 3·6 and achieved 4·5 goals during the family nursing process. The resource-enhancing family nursing can be used for supporting parenthood, the raising of and caring for the children, strengthening of social support networks, decreasing the need for support from the authorities and enhancing the parents' resources to manage the duties related to their work and studies. The study resulted in empirically based concepts that can be used in the future to construct instruments to evaluate the effectiveness of resource-enhancing family nursing from the perspective of families and family health. The findings add to our professional understanding of resource-enhancing family nursing. © 2010 Blackwell Publishing Ltd.

  14. Family governance practices and teambuilding : Paradox of the enterprising family

    NARCIS (Netherlands)

    Berent-Braun, M.M.; Uhlaner, L.M.

    2012-01-01

    This paper explores the relationship between family governance practices and financial performance of the business and family assets of business-owning families. A business-owning family that shares a focus on preserving and growing wealth as a family is defined as the enterprising family. Results

  15. Hereditary motor and sensory neuropathy Lom type in a Serbian family.

    Science.gov (United States)

    Dacković, J; Keckarević-Marković, M; Komazec, Z; Rakocević-Stojanović, V; Lavrnić, D; Stević, Z; Ribarić, K; Romac, S; Apostolski, S

    2008-10-01

    Hereditary motor and sensory neuropathy Lom type (HMSNL), also called CMT 4D, a hereditary autosomal recessive neuropathy, caused by mutation in N-Myc downstream regulated gene 1 (NDRG1 gene), was first described in a Bulgarian Gypsy population near Lom and later has been found in Gypsy communities in Italy, Spain, Slovenia and Hungary. We present two siblings with HMSNL, female and male, aged 30 and 26, respectively in a Serbian non-consanguineous family of Gypsy ethnic origin. They had normal developmental milestones. Both had symptoms of lower limb muscle weakness and walking difficulties with frequent falls, which began at the age of seven. At the age of 12, they developed hearing problems and at the age of 15 hand muscle weakness. Neurological examination revealed sensorineural hearing loss, dysarthria, severe distal and mild proximal muscle wasting and weakness, areflexia and impairment of all sensory modalities of distal distribution. Electrophysiological study revealed denervation with severe and early axonal loss. Sensorineural hearing loss was confirmed on electrocochleography and brainstem evoked potentials. Molecular genetic testing confirmed homozygote C564t (R148X) mutation in NDRG1 gene.

  16. A new compound heterozygous CFTR mutation in a Chinese family with cystic fibrosis.

    Science.gov (United States)

    Xie, Yingjun; Huang, Xueqiong; Liang, Yujian; Xu, Lingling; Pei, Yuxin; Cheng, Yucai; Zhang, Lidan; Tang, Wen

    2017-11-01

    Cystic fibrosis (CF) is the most common autosomal recessive disease among Caucasians but is rarer in the Chinese population, because mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. To elucidate the causative role of a novel compound heterozygous mutation of CF. In this study, clinical samples were obtained from two siblings with recurrent airway infections, clubbed fingers, salt-sweat and failure to gain weight in a non-consanguineous Chinese family. Next-generation sequencing was performed on the 27 coding exons of CFTR in both children, with confirmation by Sanger sequencing. Next-generation sequencing showed the same compound heterozygous CFTR mutation (c.865A>T p.Arg289X and c.3651_3652insAAAT p.Tyr1219X) in both children. As this mutation is consistent with the clinical manifestations of CF and no other mutations were detected after scanning the gene sequence, we suggest that the CF phenotype is caused by compound heterozygosity for c.865A>T and c.3651_3652insAAAT. As c865A>T is not currently listed in the "Cystic Fibrosis Mutation Database", this information about CF in a Chinese population is of interest. © 2015 John Wiley & Sons Ltd.

  17. [Family therapy of encopresis].

    Science.gov (United States)

    Spitczok von Brisinski, Ingo; Lüttger, Fred

    2007-01-01

    Encopresis is a taboo symptom, which is connected with great suffering from mental pressure not only for the children concerned, but also their relatives. Family related approaches are indispensable to understand encopresis, because as a result of high symptom persistence and psychological comorbidity in many cases a purely behavior-therapeutic, symptom focused approach is not sufficient, and further psychotherapeutic interventions are necessary. There is a strong temporal correlation between family interaction and frequency of soiling and changes of interaction influence changes in soiling more than the other way round. In a literature review different family relationship patterns and approaches of family therapy are represented regarding encopresis. Meaningful differences for family therapy are represented regarding primary/secondary encopresis, encopresis with/without comorbid psychiatric disorder as well as encopresis with/without dysfunctional family interaction. Distinctions are made between symptom focused, not-symptom focused and combined family therapeutic approaches, which are illustrated with case examples of outpatient and inpatient treatment. Symptom focused family therapy like e.g. externalizing of the soiling is helpful also if no dysfunctional family interaction patterns are present, because all family members can contribute to treatment success according to their own resources.

  18. Extended family medicine training

    Science.gov (United States)

    Slade, Steve; Ross, Shelley; Lawrence, Kathrine; Archibald, Douglas; Mackay, Maria Palacios; Oandasan, Ivy F.

    2016-01-01

    Abstract Objective To examine trends in family medicine training at a time when substantial pedagogic change is under way, focusing on factors that relate to extended family medicine training. Design Aggregate-level secondary data analysis based on the Canadian Post-MD Education Registry. Setting Canada. Participants All Canadian citizens and permanent residents who were registered in postgraduate family medicine training programs within Canadian faculties of medicine from 1995 to 2013. Main outcome measures Number and proportion of family medicine residents exiting 2-year and extended (third-year and above) family medicine training programs, as well as the types and numbers of extended training programs offered in 2015. Results The proportion of family medicine trainees pursuing extended training almost doubled during the study period, going from 10.9% in 1995 to 21.1% in 2013. Men and Canadian medical graduates were more likely to take extended family medicine training. Among the 5 most recent family medicine exit cohorts (from 2009 to 2013), 25.9% of men completed extended training programs compared with 18.3% of women, and 23.1% of Canadian medical graduates completed extended training compared with 13.6% of international medical graduates. Family medicine programs vary substantially with respect to the proportion of their trainees who undertake extended training, ranging from a low of 12.3% to a high of 35.1% among trainees exiting from 2011 to 2013. Conclusion New initiatives, such as the Triple C Competency-based Curriculum, CanMEDS–Family Medicine, and Certificates of Added Competence, have emerged as part of family medicine education and credentialing. In acknowledgment of the potential effect of these initiatives, it is important that future research examine how pedagogic change and, in particular, extended training shapes the care family physicians offer their patients. As part of that research it will be important to measure the breadth and uptake of

  19. Lepton family number violation

    International Nuclear Information System (INIS)

    Herczeg, P.

    1999-01-01

    At present there is evidence from neutrino oscillation searches that the neutrinos are in fact massive particles and that they mix. If confirmed, this would imply that the conservation of LFN is not exact. Lepton family number violation (LFNV) has been searched for with impressive sensitivities in many processes involving charged leptons. The present experimental limits on some of them (those which the author shall consider here) are shown in Table 1. These stringent limits are not inconsistent with the neutrino oscillation results since, given the experimental bounds on the masses of the known neutrinos and the neutrino mass squared differences required by the oscillation results, the effects of LFNV from neutrino mixing would be too small to be seen elsewhere (see Section 2). The purpose of experiments searching for LFNV involving the charged leptons is to probe the existence of other sources of LFNV. Such sources are present in many extensions of the SM. In this lecture the author shall discuss some of the possibilities, focusing on processes that require muon beams. Other LFNV processes, such as the decays of the kaons and of the τ, provide complementary information. In the next Section he shall consider some sources of LFNV that do not require an extension of the gauge group of the SM (the added leptons or Higgs bosons may of course originate from models with extended gauge groups). In Section 3 he discusses LFNV in left-right symmetric models. In Section 4 he considers LFNV in supersymmetric models, first in R-parity conserving supersymmetric grand unified models, and then in the minimal supersymmetric standard model with R-parity violation. The last section is a brief summary of the author's conclusions

  20. Attitude of the youth to the institute of family and family values

    Directory of Open Access Journals (Sweden)

    Artur A. Rean

    2016-03-01

    Full Text Available The paper draws attention to the large number of divorces in contemporary Russia. It is emphasized that much of them fall on the first years of marriage. However, most of the surveys conducted in recent years have shown that the family is one of the leading positions in the structure of adolescent value. On the basis of this juxtaposition, it is concluded that young people need to be specially trained for family life. Contemporary family and the school cannot cope with this task. We have carried out a large-scale empirical study in eight regions of different federal districts of Russia, the results of which are shown in the paper. Total sample amounted of more than 7,000 people. The sample included respondents from large and small cities in Russia, as well as from the villages of nuclear and one-parent families, families with 1-2 children and also large families. The research has shown that in the structure of life values the family still occupies the first position. It was also found that the vast majority of respondents emphasize the need to be specially trained for building a family. However, only one third of respondents believe that this can be done by conducting special courses on the family and family life in schools. For the majority of the respondents, their parent family is not a guide or a pattern. The greatest impact on the youth in the process of growing up is produced by mother. Fathers, occupying the second position, prove to be outsiders with a large gap. It was revealed that a generalized portrait of the mother and the father are completely positive, i.e. they do not contain any negative characteristics. The top ten most popular qualities to describe father and mother are the following: kind, reliable, caring, responsible, family-making, smart. Other qualities of the top ten highest priorities differ.