WorldWideScience

Sample records for sld

  1. B physics at SLD

    International Nuclear Information System (INIS)

    Willocq, S.

    1997-06-01

    The authors review recent B physics results obtained in polarized e + e - interactions at the SLC by the SLD experiment. The excellent 3-D vertexing capabilities of SLD are exploited to extract precise B + and B d 0 lifetimes, as well as measurements of the time evolution of B d 0 - (anti B d 0 ) mixing

  2. Overview of the SLD

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1985-10-01

    The SLD is a second generation detector for the SLAC Linear Collider (SLC). It is optimized for Z 0 physics and exploration of new physics in the Z 0 energy region. The SLD will have a CCD vertex detector, high resolution drift chambers for momentum measurement, a Cerenkov Ring Imaging Detector for particle identification, and calorimetry based on lead/liquid argon followed by an iron/gas system. The detector covers the full solid angle. 13 refs., 7 figs

  3. SLD liquid argon calorimeter

    International Nuclear Information System (INIS)

    Vella, E.

    1992-10-01

    The liquid argon calorimeter (LAC) of the SLD detector is a parallel plate -- liquid argon sampling calorimeter, used to measure particle energies in Z 0 decays at the Stanford Linear Collider. The LAC module design is based on a unique projective tower structure, in which lead plates and segmented lead tiles serve both as absorbers and electrodes. The LAC front end electronics incorporates several novel features, including extensive multiplexing and optical fiber readout, which take advantage of the low SLC beam crossing frequency. The operational performance of the LAC during the recently completed SLD physics run (which recorded over 10,000 Z 0 events) is discussed

  4. QCD at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Plano, R. [Rutgers Univ., New Brunswick, NJ (United States)

    1997-01-01

    This talk reviews seven SLD papers, which provide useful, unique, and precise contributions to our understanding of hadron production in the decay of Z{sup 0} produced in e{sup +}e{sup -} collisions. The data were gathered by the SLAC Large Detector (SLD) at the SLAC Linear Collider (SLC). This accelerator/detector is able to systematic advantages including a tiny and stable interaction region combined with a precise high-resolution vertex detector, excellent particle identification, and a high-resolution vertex detector, excellent particle identification, and a highly polarized electron beam. The papers include studies of: (1) factorial and cumulant moments, (2) charged multiplicities produced by b, c, and uds quarks, (3) rapidity gaps, orientations and energy partitions of three-jet events, (4) jet handedness, (5) triple-product correlation in polarized Z{sup 0} decays to three jets, and {pi}{sup {+-}}, K{sup {+-}}, p, K{sup 0}, and {Lambda} production in Z{sup 0} decays. Comparisons are made to LEP results where appropriate.

  5. SLD physics studies: Proceedings of the SLD physics week

    International Nuclear Information System (INIS)

    1989-10-01

    This report contains papers on the following topics relating to SLD physics: electroweak parameter and QCD tests; heavy quark spectroscopy; B bar B mixing and CP violations; search for supersymmetry; search for technicolor; and search for new quarks, leptons and Z's

  6. Dicty_cDB: SLD492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLD492 (Link to dictyBase) - - - Contig-U11049-1 SLD492P (Link to Original site) SLD492...F 347 SLD492Z 454 SLD492P 801 - - Show SLD492 Library SL (Link to library) Clone ID SLD492... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLD4-D/SLD492Q.Seq.d/ Representative seq. ID SLD492...P (Link to Original site) Representative DNA sequence >SLD492 (SLD492Q) /CSM/SL/SLD4-D/SLD492...nces producing significant alignments: (bits) Value SLD492 (SLD492Q) /CSM/SL/SLD4-D/SLD492

  7. Data acquisition system for SLD

    International Nuclear Information System (INIS)

    Sherden, D.J.

    1985-05-01

    This paper describes the data acquisition system planned for the SLD detector which is being constructed for use with the SLAC Linear Collider (SLC). An exclusively FASTBUS front-end system is used together with a VAX-based host system. While the volume of data transferred does not challenge the band-width capabilities of FASTBUS, extensive use is made of the parallel processing capabilities allowed by FASTBUS to reduce the data to a size which can be handled by the host system. The low repetition rate of the SLC allows a relatively simple software-based trigger. The principal components and overall architecture of the hardware and software are described

  8. Heavy quark physics from SLD

    Energy Technology Data Exchange (ETDEWEB)

    Messner, R. [Stanford Univ., CA (United States)

    1997-01-01

    This report covers preliminary measurements from SLD on heavy quark production at the Z{sup 0}, using 150,000 hadronic Z{sup 0} decays accumulated during the 1993-1995 runs. A measurement of R{sub b} with a lifetime double tag is presented. The high electron beam polarization of the SLC is employed in the direct measurement of the parity-violating parameters A{sub b} and A{sub c} by use of the left-right forward-backward asymmetry. The lifetimes of B{sup +} and B{sup 0} mesons have been measured by two analyses. The first identifies semileptonic decays of B mesons with high (p,p{sub t}) leptons; the second analysis isolates a sample of B meson decays with a two-dimensional impact parameter tag and reconstructs the decay length and charge using a topological vertex reconstruction method.

  9. Heavy quark physics from SLD

    International Nuclear Information System (INIS)

    Messner, R.

    1997-01-01

    This report covers preliminary measurements from SLD on heavy quark production at the Z 0 , using 150,000 hadronic Z 0 decays accumulated during the 1993-1995 runs. A measurement of R b with a lifetime double tag is presented. The high electron beam polarization of the SLC is employed in the direct measurement of the parity-violating parameters A b and A c by use of the left-right forward-backward asymmetry. The lifetimes of B + and B 0 mesons have been measured by two analyses. The first identifies semileptonic decays of B mesons with high (p,p t ) leptons; the second analysis isolates a sample of B meson decays with a two-dimensional impact parameter tag and reconstructs the decay length and charge using a topological vertex reconstruction method

  10. Recent QCD Results from SLD

    International Nuclear Information System (INIS)

    Muller, David

    1999-01-01

    We present selected results on strong interaction physics from the SLD experiment at the SLAC Linear Collider. We report on several new studies of 3- and 4-jet hadronic Z 0 decays, in which jets are identified as quark, antiquark or gluon. The 3-jet Z 0 --> b anti-bg rate is sensitive to the b-quark mass; prospects for measuring m b are discussed. The gluon energy spectrum is measured over the full kinematic range, providing an improved test of QCD and limits on anomalous b anti-bg couplings. The parity violation in Z 0 --> b anti-bg decays is consistent with electroweak theory plus QCD. New tests of T- and CP-conservation at the bbg vertex are performed. A new measurement of the rate of gluon splitting into b anti-b pairs yields g b anti-b = 0.0031 ± 0.0007 (stat.)± 0.0006 (syst.) (Preliminary). We also present a number of new results on jet fragmentation into identified hadrons. The B hadron energy spectrum is measured over the full kinematic range using a new, inclusive technique, allowing stringent tests of predictions for its shape and a precise measurement of (xB) = 0.714 ± 0.005(stat.) ± 0.007(syst.) (Preliminary). A detailed study of correlations in rapidity y between pairs of identified pi ± , K ± and p/anti-p confirms that strangeness and baryon number are conserved locally, and shows local charge conservation between meson-baryon and strange-nonstrange pairs. Flavor-dependent long-range correlations are observed for all combinations of these hadron species, yielding new information on leading particle production. The first study of correlations using rapidities signed such that y > 0 corresponds to the quark direction provides additional new insights into fragmentation, including the first direct observation of baryon number ordering along the q anti-q axis

  11. Physics at the Z pole with SLD

    International Nuclear Information System (INIS)

    Willocq, S.

    1997-06-01

    The authors review recent results from a wide physics program in polarized e + e - interactions at the SLC performed by the SLD experiment. Unique and precise measurements of the electroweak parameters A e , A b , A c , and R b provide valuable constraints on the Standard Model. The excellent 3-D vertexing capabilities of SLD are further exploited to extract precise B + and B d 0 lifetimes, as well as measurements of the time evolution of B d 0 - (anti B d 0 ) mixing. Finally, the unique capabilities of the SLC/SLD are used to test QCD in new ways. The authors present results on general properties of particle production in light, c, and b quark events, as well as the first observation of leading particle production in light-quark hemispheres

  12. First results from the SLD silicon calorimeters

    International Nuclear Information System (INIS)

    Berridge, S.C.; Bugg, W.M.; Kroeger, R.S.; Weidemann, A.W.; White, S.L.

    1992-07-01

    The small-angle calorimeters of the SLD were successfully operated during the recent SLC engineering run. The Luminosity Monitor and Small-Angle Tagger (LMSAT) covers the angular region between 28 and 68 milliradians from the beam axis, while the Medium-Angle Silicon Calorimeter (MASC) covers the 68--190 milliradian region. Both are silicon-tungsten sampling calorimeters; the LMSAT employs 23 layers of 0.86 X 0 sampling, while the MASC has 10 layers of 1.74 X 0 sampling. We present results from the first run of the SLC with the SLD on beamline

  13. Physics with polarization at the SLD

    International Nuclear Information System (INIS)

    Burrows, P.N.

    1990-05-01

    The SLD detector is nearing completion and will start physics-quality data-taking at the SLC in 1991 with a longitudinally polarized electron beam and unpolarized positron beam. The current status of the detector is reviewed and the rich program of physics measurements possible with polarization and the SLD detector is briefly presented. In particular, the left-right polarization asymmetry, A LR , will be a unique measurement for the next few years and will allow tight bounds to be set upon the mass of the top quark. 14 refs., 1 fig

  14. Heavy Flavor Fragmentation and Decay at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Plano, Richard M

    1999-02-24

    Results on heavy quark fragmentation obtained using the SLD detector at the SLAC Linear Collider are presented. This talk will cover the ratio of vector to pseudoscalar charmed meson production, the inclusive B hadron energy distribution, the inclusive particle production in heavy jets compared to their production in light jets, and charged and neutral B meson lifetimes.

  15. SLD liquid argon calorimeter prototype test results

    International Nuclear Information System (INIS)

    Dubois, R.; Eigen, G.; Au, Y.

    1985-10-01

    The results of the SLD test beam program for the selection of a calorimeter radiator composition within a liquid argon system are described, with emphasis on the study of the use of uranium to obtain equalization of pion and electron responses

  16. Dicty_cDB: SLD420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLD420 (Link to dictyBase) - - - Contig-U16325-1 SLD420E (Link... to Original site) - - - - - - SLD420E 434 Show SLD420 Library SL (Link to library) Clone ID SLD420 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16325-1 Original site URL http://dict... 7 Homology vs DNA Score E Sequences producing significant alignments: (bits) Value N ( AF066071 ) Dict...yostelium discoideum SP85 (pspB) gene, comple... 860 0.0 1 ( AC117075 ) Dictyostelium

  17. The data acquisition system for SLD

    International Nuclear Information System (INIS)

    Sherden, D.J.

    1986-10-01

    This paper describes the data acquisition system planned for the SLD detector, which is being constructed for use with the SLAC Linear Collider (SLC). Analog electronics, heavily incorporating hybrid and custom VLSI circuitry, is mounted on the detector itself. Extensive use is made of multiplexing through optical fibers to a FASTBUS readout system. The low repetition rate of the SLC allows a relatively simple software-based trigger. Hardware and software processors within the acquisition modules are used to reduce the large volume of data per event and to calibrate the electronics. A farm of microprocessors is used for full reconstruction of a sample of events prior to transmission to the host

  18. Early radiological diagnostics for scapholunate dissociation (SLD); Radiologische Fruehdiagnostik der skapholunaeren Dissoziation (SLD)

    Energy Technology Data Exchange (ETDEWEB)

    Schmitt, R.; Froehner, S.; Fodor, S.; Christopoulos, G. [Herz- und Gefaessklinik GmbH, Institut fuer Diagnostische und Interventionelle Radiologie, Bad Neustadt an der Saale (Germany); Kalb, K.H. [Herz- und Gefaessklinik GmbH, Bad Neustadt an der Saale (Germany). Klinik fuer Handchirurgie

    2006-08-15

    The partial tear of the scapholunate ligament (pre-dynamic stage of SLD) as well as the complete tear (dynamic stage) does not lead to carpal malalignment. However, if the completely ruptured ligament is accompanied by lesions of the extrinsic ligaments, both the scaphoid and the lunate are malaligned already at rest (static stage of SLD). Later, osteoarthritis will develop, beginning in the radioscaphoid compartment, progressing to the midcarpal joint, and ending in a carpal collapse (osteoarthrotic stage of SLD). Dynamic SLD is detectable only in stress views and in cinematography. The high utility of MRI for directly visualizing the injured ligament is emphasized: reparation tissue is focally enhanced at the rupture site by intravenously applied contrast agent; the individual segments of the scapholunate ligament can be visualized in direct MR arthrography, therefore allowing differentiation of partial and complete ligamentous tears. (orig.) [German] Die Teilruptur des Lig. scapholunatum (praedynamisches Stadium) und die isolierte Komplettruptur (dynamisches Stadium) fuehren zu keiner karpalen Gefuegestoerung in Ruhe. Erst wenn die Komplettruptur von Laesionen der extrinsischen Bandstabilisatoren begleitet wird, stehen das Skaphoid und Lunatum bereits in Ruhe in Fehlstellung (statisches Stadium). Spaeter kommt es zur Handgelenkarthrose, zuerst radioskaphoidal, dann mediokarpal mit Ausbildung eines karpalen Kollapses (arthrotisches Stadium). Die dynamische Instabilitaet ist nur mit Stressaufnahmen und kinematographisch nachweisbar. Die MRT vermag das rupturierte Lig. scapholunatum direkt darzustellen: Intravenoes verabreichtes Kontrastmittel reichert sich fokal am Reparationsgewebe der Rupturstelle an; mit der direkten MR-Arthrogaphie koennen die Bandsegmente besser abgegrenzt und Partial- von Komplettrupturen unterschieden werden. (orig.)

  19. Status of ALR measurement at SLD

    International Nuclear Information System (INIS)

    Ash, W.W.

    1993-11-01

    The SLD Collaboration is making a precision measurement of the left-right asymmetry (A LR ) at the SLAC Linear Collider, exploiting the significantly improved luminosity and the high electron-beam polarization of over 60%. General features of the polarized source and polarimetry are described. The experimental method is briefly presented, together with the preliminary values of the raw asymmetry, which should lead to a precision in the measurement of sin 2 θ W eff of ±0.0008 ± 0.0005. The collaboration is preparing a proposal for an extended run for one million Z o s with improved polarimetry to reach an ultimate level of δ sin 2 θ W eff = ±0.00025

  20. B/sub s/ mixing at SLD

    CERN Document Server

    Usher, T

    2001-01-01

    A preliminary 95% C.L. exclusion on the oscillation frequency of B/sub s//sup 0/-B/sub s//sup 0/ mixing is presented by combining three analyses of a sample of 400,000 hadronic Z/sup 0/ decays collected by the SLD experiment at the SLC between 1996 and 1998. All three analyses exploit the large forward-backward asymmetry of polarized Z /sup 0/ to bbdecays, as well as information from the hemisphere opposite that of the reconstructed B decay, to determine the b-hadron flavor at production. The three analyses differ in their reconstruction of the proper time and flavor of the b-hadron at decay. The first analysis performs a full reconstruction of a cascade D/sub s / meson and a partial reconstruction of the b-hadron. In the second analysis, semileptonic decays are selected and the B decay point is reconstructed by vertexing a lepton with a partially reconstructed cascade D meson. The third analysis reconstructs B decay vertices inclusively using a topological technique, with separation between B /sub s//sup 0/ ...

  1. QCD tests with SLD and polarized beams

    Energy Technology Data Exchange (ETDEWEB)

    Strauss, M.G. [Univ. of Massachusetts, Amherst, MA (United States)

    1994-12-01

    The author presents a measurement of the strong coupling {alpha}{sub s} derived from multijet rates using data collected by the SLD experiment at SLAC and find that {alpha}{sub s}(M{sub Z}{sup 2}) = 0.118 {+-} 0.002(stat.) {+-} 0.003(syst.) {+-} 0.010(theory). He presents tests of the flavor independence of strong interactions via preliminary measurements of the ratios {alpha}{sub s}(b)/{alpha}{sub s}(udsc) and {alpha}{sub s}(uds)/{alpha}{sub s}(bc). In addition, the group has measured the difference in charged particle multiplicity between Z{sup 0} {yields} b{bar b} and Z{sup 0} {yields} u{bar u}, d{bar d}, s{bar s} events, and find that it supports the prediction of perturbative QCD that the multiplicity difference be independent of center-of-mass energy. Finally, the group has made a preliminary study of jet polarization using the jet handedness technique.

  2. Updated measurement of the tau lifetime at SLD

    International Nuclear Information System (INIS)

    1996-01-01

    We present an updated measurement of the tau lifetime at SLD. 4316 τ-pair events, selected from a 150k Z 0 data sample, are analyzed using three techniques: decay length, impact parameter, and impact parameter difference methods. The measurement benefits from the small and stable interaction region at the SLC and the precision CCD pixel vertex detector of the SLD. The combined result is: τ τ = 288.1 ± 6.1(stat) ± 3.3(syst) fs

  3. Performance of the SLD Warm Iron Calorimeter prototype

    International Nuclear Information System (INIS)

    Callegari, G.; Piemontese, L.; De Sangro, R.; Peruzzi, I.; Piccolo, M.; Busza, W.; Friedman, J.; Johnson, A.; Kendall, H.; Kistiakowsky, V.

    1986-03-01

    A prototype hadron calorimeter, of similar design to the Warm Iron Calorimeter (WIC) planned for the SLD experiment, has been built and its performance has been studied in a test beam. The WIC is an iron sampling calorimeter whose active elements are plastic streamer tubes similar to those used for the Mont-Blanc proton decay experiment. The construction and operation of the tubes will be briefly described together with their use in an iron calorimeter - muon tracker. Efficiency, resolution and linearity have been measured in a hadron/muon beam up to 11 GeV. The measured values correspond to the SLD design goals

  4. SLD Identification: A Survey of Methods Used by School Psychologists

    Science.gov (United States)

    Watson, Michael D., Jr.; Simon, Joan B.; Nunnley, Lenora

    2016-01-01

    IDEA 2004 opened the door for states, and in some cases districts, to choose among three different methods for identifying children with Specific Learning Disabilities (SLDs). This study provides an in-depth look at SLD identification practices in a state that allows school psychologists to use any of the three methods. Eighty-four school…

  5. A status report on the SLD data acquisition system

    International Nuclear Information System (INIS)

    1988-11-01

    The basic design of the SLD data acquisition system and its present status are reviewed. Aspects of the design that take particular advantage of the relatively low e + e/sup /minus// cross section and the low beam crossing rate of a linear collider are explained. 14 refs., 8 figs

  6. The first results from the CRID detector at SLD

    International Nuclear Information System (INIS)

    Va'vra, J.; Antilogus, P.; Aston, D.; Bienz, T.; Bird, F.; Dasu, S.; Dolinsky, S.; Dunwoodie, W.; hallewell, G.; Kawahara, H.; Kwon, Y.; Leith, D.W.G.S.; Mueller, G.; Muller, D.; Nagamine, T.; Pavel, T.J.; Ratcliff, B.; Rensing, P.; Schultz, D.; Shapiro, S.; Simopoulos, C.; Solodov, E.; Toge, N.; Williams, S.H.; Abe, K.; Hasegawa, K.; Hasegawa, Y.; Suekane, F.; Yuta, H.; Baird, K.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Word, G.; Bean, A.; Caldwell, D.O.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Yellin, S.; David, R.B.; Manly, S.; Snyder, J.; Sforza, M.C.; Coyle, P.; Coyne, D.; Liu, X.; Williams, D.A.; Coller, J.; Shank, J.T.; Whitaker, J.S.; d'Oliveira, A.; Johnson, R.A.; Martinez, J.; Meadows, B.; Nussbaum, M.; Santha, A.K.S.; Sokoloff, M.D.; Stockdale, I.; Turk, J.; Wilson, R.J.

    1992-10-01

    We report first results from the initial physics run of the Cherenkov Ring Imaging Detector (CRID) in the SLD experiment at the SLC. We describe the experimental conditions, show liquid and gas rings, report the number of photoelectrons per ring, and comment on resolution

  7. Measurements of Z0 Electroweak Couplings at SLD

    International Nuclear Information System (INIS)

    Mancinelli, Giampero

    1999-01-01

    In this paper we report a summary of the results of several electroweak measurements performed by the SLD experiment at the Stanford Linear Collider (SLC). Most of these results are preliminary and are based, unless otherwise indicated, on the full 1993-1998 dataset of 560,000 hadronic Z 0 decays, produced with an average electron beam polarization of 73%

  8. Polarized source performance in 1992 for SLC--SLD

    International Nuclear Information System (INIS)

    Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.

    1993-02-01

    In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met

  9. An improved inclusive measurement of Ac using the SLD detector

    International Nuclear Information System (INIS)

    1998-01-01

    The authors report a new measurement of A c using data obtained by SLD in 1993--97. This measurement uses a vertex tag technique, where the selection of a c hemisphere is based on the reconstructed mass of the charm hadron decay vertex. The method uses the 3D vertexting capabilities of SLD's CCD vertex detector and the small and stable SLC beams to obtain a high c-event tagging efficiency and purity of 28% and 81%, respectively. Charged kaons identified by the CRID detector and the charge of the reconstructed vertex provide an efficient quark-antiquark tag. They obtain a preliminary result of A c = 0.650 ± 0.041 ± 0.033

  10. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  11. The fluid systems for the SLD Cherenkov ring imaging detector

    International Nuclear Information System (INIS)

    Abe, K.; Hasegawa, K.; Hasegawa, Y.; Iwasaki, Y.; Suekane, F.; Yuta, H.; Baird, K.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Word, G.; Bean, A.; Caldwell, D.O.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Yellin, S.; Ben-David, R.; Manly, S.; Snyder, J.; Turk, J.; Cavalli-Sforza, M.; Coyle, P.; Coyne, D.; Gagnon, P.; Liu, X.; Schneider, M.; Williams, D.A.; Coller, J.; Shank, J.T.; Whitaker, J.S.; d'Oliveira, A.; Johnson, R.A.; Martinez, J.; Nussbaum, M.; Santha, A.K.S.; Sokoloff, M.D.; Stockdale, I.; Wilson, R.J.

    1992-10-01

    We describe the design and operation of the fluid delivery, monitor and control systems for the SLD barrel Cherenkov Ring Imaging Detector (CRID). The systems deliver drift gas (C 2 H 6 + TMAE), radiator gas (C 5 F 12 + N 2 ) and radiator liquid (C 6 F 14 ). Measured critical quantities such as electron lifetime in the drift gas and ultra-violet (UV) transparencies of the radiator fluids, together with the operational experience, are also reported

  12. Pulse to pulse monitoring of the SLD detector

    International Nuclear Information System (INIS)

    Bogart, J.; Huffer, M.; Russell, J.

    1993-04-01

    The SLAC Linear Collider produces bunches of positrons and polarized electrons which collide at 120 hertz inside the SLD detector. A limited amount of information is collected for each pulse in the modules which do real-time data acquisition. Buffers of approximately ten seconds' worth of this monitor data are periodically delivered to a VAX. The generation and uses of the monitor data will be discussed

  13. Construction and testing of the SLD Cerenkov ring imaging detector

    International Nuclear Information System (INIS)

    Cavalli-Sforza, M.; Coyle, P.; Coyne, D.; Gagnon, P.; Williams, D.A.; Abe, K.; Hasegawa, K.; Suekane, F.; Yuta, H.

    1990-01-01

    The authors report on the construction of the Cherenkov Ring Imaging Detector (CRID) for the SLD experiment at the SLAC Linear Collider and the testing of its components. The authors include results from testing the drift boxes, liquid radiator trays, and mirrors for the barrel CRID. The authors also discuss development of the support systems essential for the operation of the CRID: gas and liquid recirculator systems and monitoring

  14. Front-end data processing the SLD data acquisition system

    International Nuclear Information System (INIS)

    Nielsen, B.S.

    1986-07-01

    The data acquisition system for the SLD detector will make extensive use of parallel at the front-end level. Fastbus acquisition modules are being built with powerful processing capabilities for calibration, data reduction and further pre-processing of the large amount of analog data handled by each module. This paper describes the read-out electronics chain and data pre-processing system adapted for most of the detector channels, exemplified by the central drift chamber waveform digitization and processing system

  15. The SLD Cerenkov Ring Imaging Detector: Progress report

    International Nuclear Information System (INIS)

    Ashford, V.; Bienz, T.; Bird, F.

    1986-10-01

    We describe test beam results from a prototype Cerenkov Ring Imaging Detector (CRID) for the SLD experiment at the SLAC Linear Collider (SLC). The system includes both liquid and gas radiators, a long drift box containing gaseous TMAE and a proportional wire chamber with charge division readout. Measurements of the multiplicity and detection resolution of Cerenkov photons, from both radiators are presented. Various design aspects of a new engineering prototype, currently under construction, are discussed and recent R and D results relevant to this effort are reported

  16. The scanning Compton polarimeter for the SLD experiment

    International Nuclear Information System (INIS)

    Woods, M.

    1996-10-01

    For the 1994/95 run of the SLD experiment at SLAC, a Compton polarimeter measured the luminosity-weighted electron beam polarization to be (77.2 ± 0.5)%. This excellent accuracy is achieved by measuring the rate asymmetry of Compton-scattered electrons near the kinematic endpoint. The polarimeter takes data continuously while the electron and positron beams are in collision and achieves a statistical precision of better than 1% in a three minute run. To calibrate the polarimeter and demonstrate its accuracy, many scans are frequently done. These include scans of the laser polarization, the detector position with respect to the kinematic edge, and the laser power

  17. Final Results on Heavy Quarks at LEP and SLD

    CERN Document Server

    Stocchi, A

    2002-01-01

    In the last decade, the LEP and SLD experiments played a central role in the study of B hadrons (hadrons containing a b quark). New B hadrons have been observed ($B^0_s$, \\Lambda_b$, $\\Xi_b$ and $B^{**}$) and their production and decay properties have been measured. In this paper we will focus on measurements of the CKM matrix elements: $|V_{cb}|$, $|V_{ub}|$, $|V_{td}|$ and $|V_{ts}|$. We will show how all these measurements, together with theoretical developments, have significantly improved our knowledge on the flavour sector of the Standard Model.

  18. Identification and characterization of mouse PSF1-binding protein, SLD5

    International Nuclear Information System (INIS)

    Kong, Lingyu; Ueno, Masaya; Itoh, Machiko; Yoshioka, Katsuji; Takakura, Nobuyuki

    2006-01-01

    Although most somatic cells cannot proliferate, immature cells proliferate continuously to produce mature cells. Recently, we cloned mouse PSF1 from a hematopoietic stem cell specific cDNA library and reported that PSF1 is indispensable for the proliferation of immature cells. To identify the PSF1-binding protein, we used the yeast two-hybrid system with PSF1 as bait, and identified and cloned SLD5. SLD5 interacted with a central region of PSF1. Tissue distribution of SLD5 was quite similar to that of PSF1. When overexpressed, SLD5 protein was co-localized with PSF1. These data suggest that PSF1 and SLD5 may cooperate in the proliferation of immature cell populations

  19. Drosophila Sld5 is essential for normal cell cycle progression and maintenance of genomic integrity

    Energy Technology Data Exchange (ETDEWEB)

    Gouge, Catherine A. [Department of Biology, East Carolina University East Carolina University, Greenville, NC 27858 (United States); Christensen, Tim W., E-mail: christensent@ecu.edu [Department of Biology, East Carolina University East Carolina University, Greenville, NC 27858 (United States)

    2010-09-10

    Research highlights: {yields} Drosophila Sld5 interacts with Psf1, PPsf2, and Mcm10. {yields} Haploinsufficiency of Sld5 leads to M-phase delay and genomic instability. {yields} Sld5 is also required for normal S phase progression. -- Abstract: Essential for the normal functioning of a cell is the maintenance of genomic integrity. Failure in this process is often catastrophic for the organism, leading to cell death or mis-proliferation. Central to genomic integrity is the faithful replication of DNA during S phase. The GINS complex has recently come to light as a critical player in DNA replication through stabilization of MCM2-7 and Cdc45 as a member of the CMG complex which is likely responsible for the processivity of helicase activity during S phase. The GINS complex is made up of 4 members in a 1:1:1:1 ratio: Psf1, Psf2, Psf3, And Sld5. Here we present the first analysis of the function of the Sld5 subunit in a multicellular organism. We show that Drosophila Sld5 interacts with Psf1, Psf2, and Mcm10 and that mutations in Sld5 lead to M and S phase delays with chromosomes exhibiting hallmarks of genomic instability.

  20. Preliminary results on heavy flavor physics at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Usher, T. [Stanford Univ., CA (United States)

    1994-12-01

    The author reports on preliminary heavy flavor physics results from the SLD detector at the SLAC Linear Collider. Efficient tagging of b{bar b} events is achieved with an impact parameter technique that takes advantage of the small and stable interaction point of the SLC and all charged tracks in Z{sup 0} decays. This technique is applied to samples of Z{sup 0} events collected during the 1992 and 1993 physics runs. Preliminary measurements of the ratio R{sub b} = {Gamma}(Z{sup 0} {yields} b{bar b})/{Gamma}(Z{sup 0} {yields} hadrons) and the average B hadron lifetime <{tau}{sub B}> are reported. In a sample of 27K Z{sup 0} events, values of R{sub b} = 0.235 {+-} 0.006(stat.) {+-} 0.018(syst.) and <{tau}{sub B}> = 1.53 {+-} 0.006(stat.) {+-} 0.018(syst.) are obtained. In addition, the first measurement of the left-right asymmetry A{sub b} is reported. Using a sample of 38K Z{sup 0} events with a luminosity weighted electron polarization of 62%, the author obtains a preliminary value of A{sub b} = 0.94 {+-} 0.006(stat.) {+-} 0.018(syst.).

  1. A measurement of the tau Michel parameters at SLD

    International Nuclear Information System (INIS)

    Quigley, J.

    1997-05-01

    This thesis presents a measurement of the tau Michel parameters. This measurement utilizes the highly polarized SLC electron beam to extract these quantities directly from the measured tau decay spectra using the 1993--95 SLD sample of 4,528 tau pair events. The results are ρ e = 0.71 ± 0.14 ± 0.05, ξ e = 1.16 ± 0.52 ± 0.06, and (ξδ) e = 0.85 ± 0.43 ± 0.08 for tau decays to electrons and ρ μ = 0.54 ± 0.28 - 0.14, η μ = -0.59 ± 0.82 ± 0.45, ξ μ = 0.75 ± 0.50 ± 0.14, and (ξδ) μ = 0.82 ± 0.32 ± 0.07 for tau decays to muons. Combining all leptonic tau decays gives ρ = 0.72 ± 0.09 ± 0.03, ξ = 1.05 ± 0.35 ± 0.04, and Ξδ = 0.88 ± 0.27 ± 0.04. These results agree well with the current world average and the Standard Model

  2. Highlights of the SLD Physics Program at the SLAC Linear Collider

    International Nuclear Information System (INIS)

    Willocq, Stephane

    2001-01-01

    Starting in 1989, and continuing through the 1990s, high-energy physics witnessed a flowering of precision measurements in general and tests of the standard model in particular, led by e + e - collider experiments operating at the Z 0 resonance. Key contributions to this work came from the SLD collaboration at the SLAC Linear Collider. By exploiting the unique capabilities of this pioneering accelerator and the SLD detector, including a polarized electron beam, exceptionally small beam dimensions, and a CCD pixel vertex detector, SLD produced a broad array of electroweak, heavy-flavor, and QCD measurements. Many of these results are one of a kind or represent the world's standard in precision. This article reviews the highlights of the SLD physics program, with an eye toward associated advances in experimental technique, and the contribution of these measurements to our dramatically improved present understanding of the standard model and its possible extensions

  3. Highlights of the SLD Physics Program at the SLAC Linear Collider

    Energy Technology Data Exchange (ETDEWEB)

    Willocq, Stephane

    2001-09-07

    Starting in 1989, and continuing through the 1990s, high-energy physics witnessed a flowering of precision measurements in general and tests of the standard model in particular, led by e{sup +}e{sup -} collider experiments operating at the Z{sup 0} resonance. Key contributions to this work came from the SLD collaboration at the SLAC Linear Collider. By exploiting the unique capabilities of this pioneering accelerator and the SLD detector, including a polarized electron beam, exceptionally small beam dimensions, and a CCD pixel vertex detector, SLD produced a broad array of electroweak, heavy-flavor, and QCD measurements. Many of these results are one of a kind or represent the world's standard in precision. This article reviews the highlights of the SLD physics program, with an eye toward associated advances in experimental technique, and the contribution of these measurements to our dramatically improved present understanding of the standard model and its possible extensions.

  4. Phosphopeptide binding by Sld3 links Dbf4-dependent kinase to MCM replicative helicase activation.

    Science.gov (United States)

    Deegan, Tom D; Yeeles, Joseph Tp; Diffley, John Fx

    2016-05-02

    The initiation of eukaryotic DNA replication requires the assembly of active CMG (Cdc45-MCM-GINS) helicases at replication origins by a set of conserved and essential firing factors. This process is controlled during the cell cycle by cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK), and in response to DNA damage by the checkpoint kinase Rad53/Chk1. Here we show that Sld3, previously shown to be an essential CDK and Rad53 substrate, is recruited to the inactive MCM double hexamer in a DDK-dependent manner. Sld3 binds specifically to DDK-phosphorylated peptides from two MCM subunits (Mcm4, 6) and then recruits Cdc45. MCM mutants that cannot bind Sld3 or Sld3 mutants that cannot bind phospho-MCM or Cdc45 do not support replication. Moreover, phosphomimicking mutants in Mcm4 and Mcm6 bind Sld3 without DDK and facilitate DDK-independent replication. Thus, Sld3 is an essential "reader" of DDK phosphorylation, integrating signals from three distinct protein kinase pathways to coordinate DNA replication during S phase. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  5. Measurement of the polarized forward-backward asymmetry of s-quarks at SLD

    International Nuclear Information System (INIS)

    Narita, Shinya

    1998-03-01

    This thesis presents a direct measurement of the parity-violating parameter A s by analyzing the polarized forward-backward asymmetry of s quarks in e + e - → Z 0 → s anti s. The author has used the data taken at the Stanford Linear Accelerator Center (SLAC), from the SLAC Large Detector (SLD), which records the products of e + e - interactions at a center of mass energy √s = 91.2 GeV at the SLAC Linear Collider (SLC). The unique features of the SLC/SLD experimental apparatus provide interesting tests of the electroweak and the QCD physics. The small, stable SLC beam spot, and the precise tracking capability of the SLD allow the isolation of light flavor events. Charged hadrons are identified over wide momentum range with the Cherenkov Ring Imaging Detector (CRID). High momentum charged kaon, Λ 0 /anti Λ 0 , and K s 0 are used to select Z 0 → s anti s events and to identify the s-quark direction. The averaged polarization was 63.0% in 1993 SLD run and 77.3% in 1994--95 run. The author obtained A s = 0.86 ± 0.17(stat.) ± 0.10(syst.). This value is consistent with the prediction from the Standard Model and with the values of A b measurements from SLD and LEP experiments

  6. High-speed 405-nm superluminescent diode (SLD) with 807-MHz modulation bandwidth

    KAUST Repository

    Shen, Chao

    2016-08-25

    III-nitride LEDs are fundamental components for visible-light communication (VLC). However, the modulation bandwidth is inherently limited by the relatively long carrier lifetime. In this letter, we present the 405 nm emitting superluminescent diode (SLD) with tilted facet design on semipolar GaN substrate, showing a broad emission of ∼9 nm at 20 mW optical power. Owing to the fast recombination (τ<0.35 ns) through the amplified spontaneous emission, the SLD exhibits a significantly large 3-dB bandwidth of 807 MHz. A data rate of 1.3 Gbps with a bit-error rate of 2.9 × 10 was obtained using on-off keying modulation scheme, suggesting the SLD being a high-speed transmitter for VLC applications.

  7. VXD3: The SLD vertex detector upgrade based on a 307 Mpixel CCD system

    International Nuclear Information System (INIS)

    1995-07-01

    The SLD Collaboration is building a new CCD vertex detector (VXD3) comprising 96 3.2 Mpixel CCDs of 13 cm 2 each for a total of 307 million pixels. This system is an upgrade of the Pioneering CCD vertex detector VXD2 which has operated in SLD since 1992. The CCDs of VXD3 are mounted on beryllium ladders in three cylinders, providing three space point measurements along each track of about 5 microns resolution in all three coordinates. The design and construction of VXD3 builds on three years of successful performance of VXD2. Significant improvements are achieved with VXD3 in impact parameters resolution (about a factor of two) and acceptance (∼20%) through optimized geometry and reduced material. New readout electronics have been developed for this system. This new vertex detector will be installed in late 1995 for the future runs of SLD

  8. High-speed 405-nm superluminescent diode (SLD) with 807-MHz modulation bandwidth

    KAUST Repository

    Shen, Chao; Lee, Changmin; Ng, Tien Khee; Nakamura, Shuji; Speck, James S.; DenBaars, Steven P.; Alyamani, Ahmed Y.; El-Desouki, Munir M.; Ooi, Boon S.

    2016-01-01

    III-nitride LEDs are fundamental components for visible-light communication (VLC). However, the modulation bandwidth is inherently limited by the relatively long carrier lifetime. In this letter, we present the 405 nm emitting superluminescent diode (SLD) with tilted facet design on semipolar GaN substrate, showing a broad emission of ∼9 nm at 20 mW optical power. Owing to the fast recombination (τ<0.35 ns) through the amplified spontaneous emission, the SLD exhibits a significantly large 3-dB bandwidth of 807 MHz. A data rate of 1.3 Gbps with a bit-error rate of 2.9 × 10 was obtained using on-off keying modulation scheme, suggesting the SLD being a high-speed transmitter for VLC applications.

  9. Bs Physics at LEP, SLD, and CDF Delta m_s and Delta Gamma_s

    CERN Document Server

    Boix, G

    2001-01-01

    The current status of the experimental knowledge of $\\Bs$ meson physics is reviewed. Results from LEP and CDF on the width difference $\\dgs$ are presented, the corresponding average is found to be in good agreement with the present theoretical estimation. The $\\Bs$ oscillations have not yet been resolved, despite the progress recently achieved by SLD and ALEPH. The world combination, including results from the LEP experiments, SLD and CDF, is presented, together with the expected and observed lower limit on the $\\Bs$ oscillation frequency. A tantalizing hint of an oscillation is observed around $\\dms\\sim17 \\psin$, near future results could increase the significance of this hint.

  10. Performance of the SLD Barrel CRID during the 1992 physics data run

    International Nuclear Information System (INIS)

    Abe, K.; Hasegawa, K.; Hasegawa, Y.; Iwasaki, Y.; Suekane, F.; Toge, N.; Yuta, H.; Baird, K.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Word, G.; Bean, A.; Caldwell, D.O.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Yellin, S.; Ben-David, R.; Manly, S.; Snyder, J.; Turk, J.; Cavalli-Sforza, M.; Colye, P.; Coyne, D.; Liu, X.; Williams, D.A.; Coller, J.; Shank, J.T.; Whitaker, J.S.; d'Oliveira, A.; Johnson, R.A.; Martinez, J.; Meadows, B.; Nussbaum, M.; Santha, A.K.S.; Sokoloff, M.D.; Stockdale, I.; Wilson, R.J.

    1992-11-01

    The SLD Barrel Cherenkov Ring Imaging Detector was fully operational in the 1992 physics data run. The electron drift velocity and magnetic field deflection of electron trajectories have been measured. Cherenkov rings have been observed from both the liquid and gas radiators. The number and the resolution of the angle of Cherenkov photons have been measured to be approximately equal to design specifications

  11. Stress Levels of Kuwaiti Mothers of Children with SLD: Does Work and Educational Status Matter?

    Science.gov (United States)

    Alazemi, Saad S.; Hadadian, Azar; Merbler, John B.; Wang, Cen

    2015-01-01

    Existing research literature indicates that parents of children with disabilities have higher stress. The purpose of this study was to examine differences in stress levels between mothers in relation to their children with specific learning disabilities (SLD). A sub sample of 91 mothers participated in the study. The outcome of the research…

  12. Overview of the data acquisition electronics system design for the SLAC Linear Collider Detector (SLD)

    International Nuclear Information System (INIS)

    Larsen, R.S.

    1985-09-01

    The SLD Detector will contain five major electronics subsystems: Vertex, Drift, Liquid Argon Calorimeter, Cerenkov Ring Imaging, and Warm Iron Calorimeter. To implement the approximately 170,000 channels of electronics, extensive miniaturization and heavy use of multiplexing techniques are required. Design criteria for each subsystem, overall system architecture, and the R and D program are described

  13. Analysis and simulation of the SLD WIC [Warm Iron Calorimeter] PADS hybrid preamplifier circuitry

    International Nuclear Information System (INIS)

    Fox, J.D.; Horelick, D.

    1990-10-01

    The SLD PADS electronics consist of over 9000 channels of charge-sensitive preamplifiers followed by integrated sample/hold data storage, digitizing, and readout circuitry. This paper uses computer simulation techniques to analyze critical performance parameters of the preamplifier hybrid including its interactions with the detector system. Simulation results are presented and verified with measured performance. 6 refs., 9 figs

  14. The limited streamer tubes system for the SLD warm iron calorimeter

    International Nuclear Information System (INIS)

    Benvenuti, A.C.; Camanzi, B.; Piemontese, L.; Zucchelli, P.; Calcaterra, A.; De Sangro, R.; De Simone, P.; De Simone, S.; Gallinaro, M.; Peruzzi, I.; Piccolo, M.; Bacchetta, N.; Bisello, D.; Castro, A.; Galvagni, S.; Loreti, M.; Pescara, L.; Wyss, J.; Battiston, R.; Biasini, M.; Bilei, G.M.; Checcucci, B; Mancinelli, G.; Mantovani, G.; Pauluzzi, M.; Santocchia, A.; Servoli, L.; Carpinelli, M.; Castaldi, R.; Cazzola, U.; Dell'Orso, R.; Pieroni, E.; Vannini, C.; Verdini, P.G.; Byers, B.L.; Escalera, J.; Kharakh, D.; Messner, R.L.; Zdarko, R.W.; Johnson, J.R.

    1992-01-01

    The SLD detector at the Stanford Linear Accelerator Center is a general purpose device for studying e + ε - interaction at the Z 0 . The SLD calorimeter system consists of two parts: a lead Liquid Argon Calorimeter (LAC) with both electromagnetic (22 radiation lengths) and hadronic sections (2.8 absorption lengths) housed inside the coil, and the Warm Ion limited streamer tubes Calorimeter (WIC) outside the coil which uses as radiator the iron of the flux return for the magnetic field. The WIC completes the measurement of the hadronic shower energy (∼85% on average is contained in the LAC) and it provides identification and tracking for muons over 99% of the solid angle. In this note we report on the construction, test and commissioning of such a large system

  15. The analog processing system for the Liquid Argon Calorimeter for SLD at SLAC

    International Nuclear Information System (INIS)

    Haller, G.M.; Nelson, D.; Freytag, D.R.

    1986-09-01

    The analog processing system for the Liquid Argon Calorimeter for the SLD project at SLAC is described. Amplification, storage of the analog information, and multiplexing is realized on specially developed hybrids, which will be mounted directly on the detector. This leads to a substantial reduction of the cable plant. Test results for the amplifier and for the sampling and multiplexing hybrid (CDU hybrid) are presented. The latter hybird contains a custom monolithic device, the Calorimeter Data Unit

  16. The SLD Vertex Detector Upgrade (VXD3) and a study of b anti bg events

    International Nuclear Information System (INIS)

    Dervan, P.J.

    1998-04-01

    This thesis presents a variety of work concerning the design, construction and use of the SLD's vertex detector. SLD's pioneering 120 Mpixel vertex detector, VXD2, was replaced by VXD3, a 307Mpixel CCD vertex detector in january 1996. The motivation for the up-grade detector and its subsequent construction and testing are described in some detail. This work represents the collaborative work of a large number of people. The authors' work was mainly carried out at EEV on the testing of the CCDs and subsequent ladders. VXD3 was commissioned during the 1996 SLD run and performed very close to design specifications. Monitoring the position of VXD3 is crucial for reconstructing the data in the detector for physics analysis. This was carried out using a capacitive wire position monitoring system. The system indicated that VXD3 was very stable during the whole of the 1996 run, except for known controlled movements. VXD3 was aligned globally for each period in-between these known movements using the tracks from e + e - → Z 0 → hadrons. The structure of three-jet b anti bg events has been studied using hadronic Z 0 decays from the 1993--1995 SLD data. Three-jet final states were selected and the CCD-based vertex detector was used to identify two of the jets as a b or anti b. The distributions of the gluon energy and polar angle with respect to the electron beam direction were examined and were compared with perturbative QCD predictions. It was found that the QCD Parton Shower prediction was needed to describe the data well

  17. Precision electroweak physics with the SLD/SLC: The left-right polarization asymmetry

    International Nuclear Information System (INIS)

    Rowson, P.C.

    1994-12-01

    Following a brief review of a commonly used general framework for the analysis of radiative corrections and possible new physics, the recent precision results from the SLD/SLC are discussed and used to test the standard electroweak model. In the 1993 SLD/SLC run, the SLD recorded 50,000 Z events produced by the collision of longitudinally polarized electrons on unpolarized positrons at a center-of-mass energy of 91.26 GeV. The luminosity-weighted average polarization of the SLC electron beam was (63.0 ± 1.1)%. We measure the left-right cross-section asymmetry in Z boson production, A LR , to be 0.1628 ± 0.0071 (stat) ± 0.0028 (syst) which determines the effective weak mixing angle to be sin 2 θ W eff = 0.2292 ± 0.0009 (stat) ± 0.0004 (syst). When averaged with our 1992 result, we obtain sin 2 θ W eff = 0.2294 ± 0. 0010. This result differs from analogous LEP results at the level of about 2.5 σ. The world averages of electroweak data are comfortably in agreement with the standard model

  18. SLD-MOSCNT: A new MOSCNT with step-linear doping profile in the source and drain regions

    Science.gov (United States)

    Tahne, Behrooz Abdi; Naderi, Ali

    2017-01-01

    In this paper, a new structure, step-linear doping MOSCNT (SLD-MOSCNT), is proposed to improve the performance of basic MOSCNTs. The basic structure suffers from band to band tunneling (BTBT). We show that using SLD profile for source and drain regions increases the horizontal distance between valence and conduction bands at gate to source/drain junction which reduces BTBT probability. SLD performance is compared with other similar structures which have recently been proposed to reduce BTBT such as MOSCNT with lightly-doped drain and source (LDDS), and with double-light doping in source and drain regions (DLD). The obtained results using a nonequilibrium Green’s function (NEGF) method show that the SLD-MOSCNT has the lowest leakage current, power consumption and delay time, and the highest current ratio and voltage gain. The ambipolar conduction in the proposed structure is very low and can be neglected. In addition, these structures can improve short-channel effects. Also, the investigation of cutoff frequency of the different structures shows that the SLD has the highest cutoff frequency. Device performance has been investigated for gate length from 8 to 20 nm which demonstrates all discussions regarding the superiority of the proposed structure are also valid for different channel lengths. This improvement is more significant especially for channel length less than 12 nm. Therefore, the SLD can be considered as a candidate to be used in the applications with high speed and low power consumption.

  19. Component and system tests of the SLD Cerenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Antilogus, P.; Aston, D.; Bienz, T.; Bird, F.; Dasu, S.; Dolinsky, S.; Dunwoodie, W.; Hallewell, G.; Kawahara, H.; Kwon, Y.; Leith, D.; Muller, D.; Nagamine, T.; Pavel, T.; Ratcliff, B.; Rensing, P.; Schultz, D.; Shapiro, S.; Simopoulos, C.; Solodov, E.; Toge, N.; Va'vra, J.; Williams, S.; Cavalli-Sforza, M.; Coyle, P.; Coyne, D.; Gagnon, P.; Liu, X.; Williams, D.A.; Whitaker, J.S.; Wilson, R.J.; Bean, A.; Caldwell, D.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Witherell, M.; Yellin, S.; D'Oliveira, A.; Johnson, R.A.; Martinez, J.L.; Meadows, B.; Nussbaum, M.; Santha, A.K.S.; Shoup, A.; Stockdale, I.; Baird, K.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Word, G.; Abe, K.; Hasegawa, K.; Suekane, F.; Yuta, H.

    1991-02-01

    The components of the SLD barrel Cerenkov Ring Imaging Detector (CRID) are now built and are being installed. We report on tests of these, including tests of the fiber optic calibration system, detailed studies of electron drift paths on production drift boxes and detectors, tests of the dynamic gating system and its effect on drift path distortions due to space-charge, and a measurement of the electron lifetime in a production drift box. In addition, we report on the UV transmission of recirculated liquid C 6 F 14 and on the effects of CRID construction materials on electron lifetime. 9 refs., 11 figs

  20. A cryogenic monitor system for the Liquid Argon Calorimeter in the SLD detector

    International Nuclear Information System (INIS)

    Fox, M.J.; Fox, J.D.

    1988-10-01

    This paper describes the monitoring electronics system design for the Liquid Argon Calorimeter (LAC) portion of the SLD detector. This system measures temperatures and liquid levels inside the LAC cryostat and transfers the results over a fiber-optic serial link to an external monitoring computer. System requirements, unique design constraints, and detailed analog, digital and software designs are presented. Fault tolerance and the requirement for a single design to work in several different operating environments are discussed. 4 refs., 3 figs., 1 tab

  1. Component and system tests of the SLD Cerenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Antilogus, P.; Bird, F.; Aston, D.; Dasu, S.; Dunwoodie, W.; Hallewell, G.; Kawahara, H.; Kwon, Y.; Leith, D.; Nagamine, T.; Pavel, T.; Muller, D.; Williams, S.; Bienz, T.; Dolinsky, S.; Solodov, E.; Coyle, P.; Cavalli-Sforza, M.; Coyne, D.; Gagnon, P.; Liu, X.; Williams, D.A.

    1990-01-01

    The components of the SLD barrel Cerenkov Ring Imaging Detector (CRID) are now built and are being installed. This paper reports on tests of these components, including tests of the fiber optic calibration system, detailed studies of electron drift paths on production drift boxes and detectors, tests of the dynamic gating system and its effect on drift path distortions due to space-charge, and a measurement of the electron lifetime in a production drift box. In addition, the authors report on the UV transmission of recirculated liquid freon and on the effects of CRID construction materials on electron lifetime

  2. Component and system tests of the SLD Cerenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Antilogus, P.; Aston, D.; Bienz, T.; Bird, F.; Dasu, S.; Dolinsky, S.; Dunwoodie, W.; Hallewell, G.; Kawahara, H.; Kwon, Y.; Leith, D.; Muller, D.; Nagamine, T.; Pavel, T.; Ratcliff, B.; Rensing, P.; Schultz, D.; Shapiro, S.; Simopoulos, C.; Solodov, E.; Toge, N.; Va'vra, J.; Williams, S.; Cavalli-Sforza, M.; Coyle, P.; Coyne, D.; Gagnon, P.; Liu, X.; Williams, D.A.; Whitaker, J.S.; Wilson, R.J.; Bean, A.; Caldwell, D.; Duboscq, J.; Huber, J.; Lu, A.; Mathys, L.; McHugh, S.; Witherell, M.; Yellin, S.; d'Oliveira, A.; Johnson, R.A.; Martinez, J.; Meadows, B.; Nussbaum, M.; Santha, A.K.S.; Shoup, A.; Stockdale, I.; Jacques, P.; Kalelkar, M.; Plano, R.; Stamer, P.; Abe, K.; Hasegawa, K.; Suekane, F.; Yuta, H.

    1990-10-01

    The components of the SLD barrel Cerenkov Ring Imaging Detector (CRID) are now built and are being installed. We report on tests of these components, including tests of the fiber optic calibration system, detailed studies of electron drift paths on production drift boxes and detectors, tests of the dynamic gating systems and its effect on drift path distortions due to space-charge, and a measurement of the electron lifetime in a production drift box. In addition, we report on the UV transmission of recirculated liquid freon and on the effects of CRID construction materials on electron lifetime. 16 refs., 12 figs

  3. Lorentz angle studies for the SLD endcap Cerenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Coyle, P.; Cavalli-Sforza, M.; Coyne, D.

    1987-11-01

    The design of the endcap Cerenkov Ring Imaging Detectors for SLD requires a detailed understanding of how electrons drift in gases under the influence of crossed electric and magnetic fields. In this report, we present recent measurements of Lorentz angles and drift velocities in gases suitable for the endcap CRID photon detectors. We compare these measurements to predictions from a theoretical model; good agreement is observed. Based on our results we present a design for detectors operating in a 0.6 Tesla transverse magnetic field. 14 refs., 10 figs., 4 tabs

  4. STS-55 MS1/PLC Ross and Payload Specialist Walter work in SL-D2 module

    Science.gov (United States)

    1993-01-01

    STS-55 Mission Specialist 1 (MS1) and Payload Commander (PLC) Jerry L. Ross floats near cycle ergometer and Rack 9 Anthrorack (AR) (Human Physiology Laboratory) as German Payload Specialist 1 Ulrich Walter reviews a checklist in front of Rack 11 Experiment Rack. These experiment stations and the crewmembers are in the shirt-sleeve environment of the Spacelab Deutsche 2 (SL-D2) science module onboard the Earth-orbiting Columbia, Orbiter Vehicle (OV) 102. In the background is the SL-D2 aft end cone. Behind Ross and Walter is Rack 12 Experiment Rack with Baroreflex (BA).

  5. Measurement of the Z0 → $s\\bar{s}$ Coupling at the SLD

    Energy Technology Data Exchange (ETDEWEB)

    Staengle, Hermann

    1999-11-24

    This dissertation presents a direct measurement of the parity-violating coupling of the Z{sup 0} to strange quarks, A{sub s}, derived from e{sup +}e{sup -} collision data containing approximately 550,000 hadronic decays of polarized Z{sup 0} bosons. Data were recorded with the SLC Large Detector (SLD) at the SLAC Linear Collider (SLC) between 1993 and 1998 with an average electron beam polarization of 73% and 74% during the 1993-5 and 1996-8 run periods, respectively. Making use of several unique features of the SLC and SLD, this measurement relies on a new generation particle identification system, the Cherenkov Ring Imaging Detector, to test the Standard Model prediction of universality in the coupling of the Z{sup 0} to down-type quarks. Polarized Z{sup 0} --> s anti-s events are tagged by the presence in each event hemisphere of a high-momentum K {+-}, K{sub s}{sup 0} or Lambda{sup 0}/ anti-Lambda{sup 0} identified using particle identification and/or a mass tag. The background from heavy flavor events is suppressed with the CCD-based vertex detector. The event thrust axis is signed with the strangeness of the tagged particle to point in the direction of the initial s quark. The coupling A{sub s} is derived from a maximum likelihood fit to the polar angle distributions of the tagged s quark measured with left- and right-handed electron beams. To reduce the model dependence of the measurement, the background from u anti-u and d anti-d events as well as the analyzing power of the method for s anti-s events are constrained from the data. We obtain A{sub s} = 0.86 {+-} 0.08(stat.) {+-} 0.05(syst.). The result is consistent with both the Standard Model prediction and previous bottom quark coupling mA{sub b}, measurements performed by SLD and LEP, and therefore supports the predicted universality of the Z{sup 0} to down-type quark couplings.

  6. Strangeonium spectroscopy at 11 GeV/c and Cherenkov Ring Imaging at the SLD

    International Nuclear Information System (INIS)

    Bienz, T.L.

    1990-07-01

    This thesis is divided into two sections, which describe portions of the data acquisition system and online software for the Cherenkov Ring Imaging Detector (CRID) for the SLD, and analyses of several low cross section strangeonium channels in data from the LASS spectrometer. The CRID section includes a description of the data acquisition system, determination of the preamplifier gain, and development of an online pulse finding algorithm based on deconvolution. Deconvolution uses knowledge of the preamplifier impulse response to aid in pulse finding. The algorithm is fast and shows good single pulse resolution and excellent double pulse resolution in preliminary tests. The strangeonium analyses are based on data from a 4.1 event/nanobarn exposure of the LASS spectrometer in K - p interactions at 11 GeV/c, and include studies of Ληπ + π - , ΛΚ*Κ*, and Λφφ

  7. GINS complex protein Sld5 recruits SIK1 to activate MCM helicase during DNA replication.

    Science.gov (United States)

    Joshi, Kiranmai; Shah, Varun Jayeshkumar; Maddika, Subbareddy

    2016-12-01

    In eukaryotes, proper loading and activation of MCM helicase at chromosomal origins plays a central role in DNA replication. Activation of MCM helicase requires its association with CDC45-GINS complex, but the mechanism of how this complex activates MCM helicase is poorly understood. Here we identified SIK1 (salt-inducible kinase 1), an AMPK related protein kinase, as a molecular link that connects GINS complex with MCM helicase activity. We demonstrated that Sld5 a component of GINS complex interacts with SIK1 and recruits it to the sites of DNA replication at the onset of S phase. Depletion of SIK1 leads to defective DNA replication. Further, we showed that SIK1 phosphorylates MCM2 at five conserved residues at its N-terminus, which is essential for the activation of MCM helicase. Collectively, our results suggest SIK1 as a novel integral component of CMG replicative helicase during eukaryotic DNA replication. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Radiation aging studies of CO2 hydrocarbon mixtures for the SLD drift chamber

    International Nuclear Information System (INIS)

    Venuti, J.P.; Chadwick, G.B.

    1988-10-01

    The SLD drift chamber requires a 'slow' drifting gas and low diffusion to allow wave form digitization. CO 2 provides this but requires an admixture of a quencher to provide more gain. A test chamber with an 8 sense wire cell, such as will appear in the final chamber, was exposed to an x-ray tube while containing a variety of binary admixtures of Co 2 : 8% isobutane, 8% ethane, and 2% isopropanol. It was determined that adding small fractions of water (≤0.66%) or isopropanol (1--2%) to the Co 2 : 8% ethane, or 8% isobutane extended the useful life of the chamber so that integrated charge collections of /approximately/1 C/cm are permissible. Results and discussions are presented. 10 refs., 7 figs., 1 tab

  9. The left-right forward-backward asymmetry for B quarks at the SLD

    Energy Technology Data Exchange (ETDEWEB)

    Williams, David C. [Stanford Univ., CA (United States)

    1994-05-01

    The left-right asymmetry for b quarks, A{sub b}, is precisely predicted by the Weinberg-Salam-Glashow model of particle interactions, now the standard model for high-energy particle physics. As a test of this model, Ab is directly measured at the SLC Large Detector (SLD) by taking advantage of the unique polarized electron beam at the Stanford Linear Collider (SLC) and measuring the left-right forward-backward asymmetry of b quarks. To measure the asymmetry, b quarks are identified using muons of high total and transverse momenta. The result for the 1993 data sample of 37,843 hadronic Z`s is Ab = 0.91 ± 0.19 ± 0.06, where the first error is statistical and the second systematic. This result is in agreement with the standard model prediction of Ab = 0.935.

  10. The left-right forward-backward asymmetry for B quarks at the SLD

    International Nuclear Information System (INIS)

    Williams, D.C.

    1994-05-01

    The left-right asymmetry for b quarks, A b , is precisely predicted by the Weinberg-Salam-Glashow model of particle interactions, now the standard model for high-energy particle physics. As a test of this model, A b is directly measured at the SLC Large Detector (SLD) by taking advantage of the unique polarized electron beam at the Stanford Linear Collider (SLC) and measuring the left-right forward-backward asymmetry of b quarks. To measure the asymmetry, b quarks are identified using muons of high total and transverse momenta. The result for the 1993 data sample of 37,843 hadronic Z's is A b = 0.91 ± 0.19 ± 0.06, where the first error is statistical and the second systematic. This result is in agreement with the standard model prediction of A b = 0.935

  11. Expressive map design: OGC SLD/SE++ extension for expressive map styles

    Science.gov (United States)

    Christophe, Sidonie; Duménieu, Bertrand; Masse, Antoine; Hoarau, Charlotte; Ory, Jérémie; Brédif, Mathieu; Lecordix, François; Mellado, Nicolas; Turbet, Jérémie; Loi, Hugo; Hurtut, Thomas; Vanderhaeghe, David; Vergne, Romain; Thollot, Joëlle

    2018-05-01

    In the context of custom map design, handling more artistic and expressive tools has been identified as a carto-graphic need, in order to design stylized and expressive maps. Based on previous works on style formalization, an approach for specifying the map style has been proposed and experimented for particular use cases. A first step deals with the analysis of inspiration sources, in order to extract `what does make the style of the source', i.e. the salient visual characteristics to be automatically reproduced (textures, spatial arrangements, linear stylization, etc.). In a second step, in order to mimic and generate those visual characteristics, existing and innovative rendering techniques have been implemented in our GIS engine, thus extending the capabilities to generate expressive renderings. Therefore, an extension of the existing cartographic pipeline has been proposed based on the following aspects: 1- extension of the symbolization specifications OGC SLD/SE in order to provide a formalism to specify and reference expressive rendering methods; 2- separate the specification of each rendering method and its parameterization, as metadata. The main contribution has been described in (Christophe et al. 2016). In this paper, we focus firstly on the extension of the cartographic pipeline (SLD++ and metadata) and secondly on map design capabilities which have been experimented on various topographic styles: old cartographic styles (Cassini), artistic styles (watercolor, impressionism, Japanese print), hybrid topographic styles (ortho-imagery & vector data) and finally abstract and photo-realist styles for the geovisualization of costal area. The genericity and interoperability of our approach are promising and have already been tested for 3D visualization.

  12. GA-DoSLD: Genetic Algorithm Based Denial-of-Sleep Attack Detection in WSN

    Directory of Open Access Journals (Sweden)

    Mahalakshmi Gunasekaran

    2017-01-01

    Full Text Available Denial-of-sleep (DoSL attack is a special category of denial-of-service attack that prevents the battery powered sensor nodes from going into the sleep mode, thus affecting the network performance. The existing schemes used for the DoSL attack detection do not provide an optimal energy conservation and key pairing operation. Hence, in this paper, an efficient Genetic Algorithm (GA based denial-of-sleep attack detection (GA-DoSLD algorithm is suggested for analyzing the misbehaviors of the nodes. The suggested algorithm implements a Modified-RSA (MRSA algorithm in the base station (BS for generating and distributing the key pair among the sensor nodes. Before sending/receiving the packets, the sensor nodes determine the optimal route using Ad Hoc On-Demand Distance Vector Routing (AODV protocol and then ensure the trustworthiness of the relay node using the fitness calculation. The crossover and mutation operations detect and analyze the methods that the attackers use for implementing the attack. On determining an attacker node, the BS broadcasts the blocked information to all the other sensor nodes in the network. Simulation results prove that the suggested algorithm is optimal compared to the existing algorithms such as X-MAC, ZKP, and TE2P schemes.

  13. A Measurement of the Parity Violating Parameter Ab with a Muon Tag at the SLD

    Energy Technology Data Exchange (ETDEWEB)

    Bellodi, Giulia

    2001-02-12

    We present a direct measurement of the parity violation parameter A{sub b}, derived from the left-right forward-backward asymmetry of b quarks tagged via muons from semileptonic decays. The value of A{sub b} is extracted using a maximum likelihood fit to the differential cross section for fermion production. The novelty of this measurement consists in the use of topological vertexing information alongside the more traditional decay kinematics to discriminate among the different sources of tagged leptons. The small and stable SLC beam spot and the CCD based vertex detector are used to reconstruct secondary decay vertices and to provide precise kinematic information and a highly efficient and pure B mass tag. A multivariate approach has been used, with a total of 4 tagging variables, whose correlation with each other has been taken into account. The final result has been cross-checked both with a classical cut-and-count method and combining all the information into a neural net. Based on the full SLD dataset of 550K Z{sup 0} events with highly polarized electron beams, this measurement represents an improvement of a factor of 2 with respect to the previously published result (1993-1995 only and with no vertexing information). The statistical sensitivity achieved is around 4% for A{sub b}, making this a world-class single measurement. An estimate of A{sub c} has been simultaneously derived from a common fit, with a precision of about 10%.

  14. Design and construction of the front-end electronics data acquisition for the SLD CRID [Cherenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Hoeflich, J.; McShurley, D.; Marshall, D.; Oxoby, G.; Shapiro, S.; Stiles, P.; Spencer, E.

    1990-10-01

    We describe the front-end electronics for the Cherenkov Ring Imaging Detector (CRID) of the SLD at the Stanford Linear Accelerator Center. The design philosophy and implementation are discussed with emphasis on the low-noise hybrid amplifiers, signal processing and data acquisition electronics. The system receives signals from a highly efficient single-photo electron detector. These signals are shaped and amplified before being stored in an analog memory and processed by a digitizing system. The data from several ADCs are multiplexed and transmitted via fiber optics to the SLD FASTBUS system. We highlight the technologies used, as well as the space, power dissipation, and environmental constraints imposed on the system. 16 refs., 10 figs

  15. Measurement of the polarized forward-backward asymmetry of B quarks using momentum-weighted track charge at SLD

    International Nuclear Information System (INIS)

    Junk, T.R.

    1995-11-01

    This thesis presents a direct measurement of the parity-violating parameter A b by analyzing the polarized forward-backward asymmetry of b quarks in e + e - → Z 0 → b bar b. Data were taken at the Stanford Linear Accelerator Center (SLAC), with the Stanford Large Detector (SLD), which records the products of e + e - interactions at a center of mass energy √s = 91.2 GeV/c 2 at the SLAC Linear Collider (SLC). The SLC/SLD experimental apparatus provides a unique and ideal environment for measuring electroweak asymmetries. Heavy flavor decays of the Z 0 were identified inclusively by taking advantage of the long lifetime of B hadrons, the small, stable SLC beam spot, and SLD's precise tracking detectors. Two analysis techniques for measuring A b are presented: a binned fit to the left-right forward-backwards asymmetry of tagged events signed with momentum-weighted track charge, and a self-calibrating maximum-likelihood technique using momentum-weighted charge from the two hemispheres in each tagged event. From our 1994-1995 sample of 3.6 pb -1 , having a luminosity-weighted average e - polarization of 77.3%, and our 1993 sample of 1.8 pb -1 , having a luminosity-weighted polarization of 63.1%, we obtain A b = 0.848 ± 0.046(stat.) ± 0.050(syst.)

  16. Measurement of the polarized forward-backward asymmetry of B quarks using momentum-weighted track charge at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Junk, Thomas Robert [Stanford Univ., CA (United States)

    1995-11-01

    This thesis presents a direct measurement of the parity-violating parameter Ab by analyzing the polarized forward-backward asymmetry of b quarks in e+e- → Z0 → b$\\bar{b}$. Data were taken at the Stanford Linear Accelerator Center (SLAC), with the Stanford Large Detector (SLD), which records the products of e+e- interactions at a center of mass energy √s = 91.2 GeV/c2 at the SLAC Linear Collider (SLC). The SLC/SLD experimental apparatus provides a unique and ideal environment for measuring electroweak asymmetries. Heavy flavor decays of the Z0 were identified inclusively by taking advantage of the long lifetime of B hadrons, the small, stable SLC beam spot, and SLD`s precise tracking detectors. Two analysis techniques for measuring Ab are presented: a binned fit to the left-right forward-backwards asymmetry of tagged events signed with momentum-weighted track charge, and a self-calibrating maximum-likelihood technique using momentum-weighted charge from the two hemispheres in each tagged event. From our 1994-1995 sample of 3.6 pb-1, having a luminosity-weighted average e- polarization of 77.3%, and our 1993 sample of 1.8 pb-1, having a luminosity-weighted polarization of 63.1%, we obtain Ab = 0.848 ± 0.046(stat.) ± 0.050(syst.).

  17. Measurement of the B{sup +} and B{sup 0} lifetimes with topological vertexing at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Abe, K. [Nagoya Univ. (Japan); Abe, K. [Tohoku Univ., Sendai (Japan); Abt, I. [Univ. of Illinois, Urbana, IL (United States)] [and others; SLD Collaboration

    1996-07-01

    The lifetimes of the B{sup +} (B{sub u}) and B{sup 0} (B{sub d}) mesons have been measured using a sample of 150,000 hadronic Z{sup 0} decays collected by the SLD experiment at the SLC between 1993 and 1995. The analysis reconstructs the decay length and charge of the B meson using a novel topological technique. This method results in a high statistics sample of 6,033 (3,665) charged (neutral) vertices. The ratio of B{sup +}:B{sup 0} decays in the charged (neutral) sample is 1.8:1 (1:2.3).

  18. A measurement of the electroweak asymmetry parameter for the tau lepton using the 1993 and 1994--95 SLD data sample

    International Nuclear Information System (INIS)

    Bolen, B.D.

    1996-07-01

    A measurement of the electroweak asymmetry parameter A t is presented using e + E LR - → τ + τ - events from the 1993, 1994--95 data runs at the SLD experiment at SLAC. The analysis takes advantage of the polarized electron beam in the SLAC Linear Collider (SLC) to improve the precision of the analysis over the standard forward-backward asymmetry techniques

  19. Strange meson spectroscopy in K[omega] and K[phi] at 11 GeV/c and Cherenkov ring imaging at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Youngjoon.

    1993-01-01

    This thesis consists of two independent parts; development of Cherenkov Ring Imaging Detector (CRID) system and analysis of high-statistics data of strange meson reactions from the LASS spectrometer. Part 1: The CRID system is devoted to charged particle identification in the SLAC Large Detector (SLD) to study e[sup +]e[sup [minus

  20. Measurements of Γ(ZO → b bar b)/Γ(ZO → hadrons) using the SLD

    International Nuclear Information System (INIS)

    Neal, H.A. Jr. II.

    1995-07-01

    The quantity R b = Γ(Z o →b bar b)/Γ(Z o → hadrons) is a sensitive measure of corrections to the Zbb vertex. The precision necessary to observe the top quark mass dependent corrections is close to being achieved. LEP is already observing a 1.8σ deviation from the Standard Model prediction. Knowledge of the top quark mass combined with the observation of deviations from the Standard Model prediction would indicate new physics. Models which include charged Higgs or light SUSY particles yield predictions for R b appreciably different from the Standard Model. In this thesis two independent methods are used to measure R b . One uses a general event tag which determines R b from the rate at which events are tagged as Z o → b bar b in data and the estimated rates at which various flavors of events are tagged from the Monte Carlo. The second method reduces the reliance on the Monte Carlo by separately tagging each hemisphere as containing a b-decay. The rates of single hemisphere tagged events and both hemisphere tagged events are used to determine the tagging efficiency for b-quarks directly from the data thus eliminating the main sources of systematic error present in the event tag. Both measurements take advantage of the unique environment provided by the SLAC Linear Collider (SLC) and the SLAC Large Detector (SLD). From the event tag a result of R b = 0.230±0.004 statistical ±0.013 systematic is obtained. The higher precision hemisphere tag result obtained is R b = 0.218±0.004 statistical ±0.004 systematic ±0.003 Rc

  1. SLD Design Report

    International Nuclear Information System (INIS)

    1984-05-01

    This Design Report describes the plans for the construction of the second detector for the SLAC Linear Collider to study e + e - collisions at energies of up to 100 GeV in the center-of-mass. Particle tracking and momentum measurement are provided by a vertex detector, a high-precision central drift chamber, and pairs of endcap drift chambers, all in a 1 Tesla magnetic field produced by a superconducting solenoid. Particle identification is provided by CRIDs (Cerenkov Ring Imaging Detectors). Calorimetry is done in two parts; a liquid argon calorimeter (LAC) with uranium and iron radiators is located inside the coil, and the laminated iron of the flux return is instrumented with limited-streamer-mode tubes to complete the hadron calorimetry. The streamer tubes of this warm-iron calorimeter, called the WIC, are instrumented with strip readout to provide muon tracking in addition to calorimetry. The same technology is used on the end structures of the detector and the central region, thus providing uniform response in both regions

  2. Strange meson spectroscopy in Kω and KΦ at 11 GeV/c and Cherenkov ring imaging at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Youngjoon [Stanford Univ., CA (United States)

    1993-01-01

    This thesis consists of two independent parts; development of Cherenkov Ring Imaging Detector (CRID) system and analysis of high-statistics data of strange meson reactions from the LASS spectrometer. Part 1: The CRID system is devoted to charged particle identification in the SLAC Large Detector (SLD) to study e+e- collisions at √s = mZ0. By measuring the angles of emission of the Cherenkov photons inside liquid and gaseous radiators, {pi}/K/p separation will be achieved up to ~30 GeV/c. The signals from CRID are read in three coordinates, one of which is measured by charge-division technique. To obtain a ~1% spatial resolution in the charge-division, low-noise CRID preamplifier prototypes were developed and tested resulting in <1000 electrons noise for an average photoelectron signal with 2 x 105 gain. To help ensure the long-term stability of CRID operation at high efficiency, a comprehensive monitoring and control system was developed. Part 2: Results from the partial wave analysis of strange meson final states in the reactions K-p → K-ωp and K-p → $\\bar{K}$0Φn are presented. The analyses are based on data from a 4.1 event/nb exposure of the LASS spectrometer in K-p interactions at 11 GeV/c. The data sample of K-ωp final state contains {approximately}105 events. From the partial wave analysis, resonance structures of JP= 2-, 3- and 2+ amplitudes are observed in the Kω system. The analysis of 2- amplitudes provides an evidence for two strange meson states in the mass region around 1.75 GeV/c2. The appropriate branching fractions are calculated and compared with the SU(3) predictions. The partial wave analysis of $\\bar{K}$0Φ system favors JP = 1- and 2+ states in the 1.9--2.0 GeV/c2 region.

  3. Expression of alpha and beta subunit isoforms of Na,K-ATPase in the mouse inner ear and changes with mutations at the Wv or Sld loci.

    Science.gov (United States)

    Schulte, B A; Steel, K P

    1994-07-01

    Mice homozygous for mutations at the viable dominant spotting (Wv) and Steel-dickie (Sld) loci exhibit a similar phenotype which includes deafness. The auditory dysfunction derives from failure of the stria vascularis to develop normally and to generate a high positive endocochlear potential (EP). Because strial function is driven by Na,K-ATPase its expression was investigated in inner ears of Wv/Wv and Sld/Sld mice and their wild-type littermates by immunostaining with antisera against four of the enzyme's subunit isoforms. Wild-type mice from two different genetic backgrounds showed an identical distribution of subunit isoforms among inner ear transport cells. Several epithelial cell types coexpressed the alpha 1 and beta 1 subunits. Vestibular dark cells showed no reactivity for beta 1 but expressed abundant beta 2, whereas, strial marginal cells stained strongly for both beta isoforms. The only qualitative difference between mutant and wild-type mice was the absence of beta 1 subunit in marginal cells of the mutant's stria. However, it is unlikely that this difference accounts for failure of mutants to generate a high EP because the beta 1 subunit is not present in the stria vascularis of either rats or gerbils with normal EP values. Strong immunostaining for Na,K-ATPase in lateral wall fibrocytes of normal mice along with diminished immunoreactivity in the mutants supports the concept that these strategically located transport fibrocytes actively resorb K+ leaked across Reissner's membrane into scala vestibuli or effluxed from hair cells and nerves into scala tympani. It is further speculated that the resorbed K+ normally is siphoned down its concentration gradient into the intrastrial space through gap junctions between fibrocytes and strial basal and intermediate cells where it is recycled back to endolymph via marginal cells. Thus, failure of mutants to generate a positive EP could be explained by the absence of intermediate cells which may form the final

  4. Robust Replication Control Is Generated by Temporal Gaps between Licensing and Firing Phases and Depends on Degradation of Firing Factor Sld2

    Directory of Open Access Journals (Sweden)

    Karl-Uwe Reusswig

    2016-10-01

    Full Text Available Temporal separation of DNA replication initiation into licensing and firing phases ensures the precise duplication of the genome during each cell cycle. Cyclin-dependent kinase (CDK is known to generate this separation by activating firing factors and at the same time inhibiting licensing factors but may not be sufficient to ensure robust separation at transitions between both phases. Here, we show that a temporal gap separates the inactivation of firing factors from the re-activation of licensing factors during mitosis in budding yeast. We find that gap size critically depends on phosphorylation-dependent degradation of the firing factor Sld2 mediated by CDK, DDK, Mck1, and Cdc5 kinases and the ubiquitin-ligases Dma1/2. Stable mutants of Sld2 minimize the gap and cause increased genome instability in an origin-dependent manner when combined with deregulation of other replication regulators or checkpoint mechanisms. Robust separation of licensing and firing phases therefore appears indispensable to safeguard genome stability.

  5. Anti-Stokes effect CCD camera and SLD based optical coherence tomography for full-field imaging in the 1550nm region

    Science.gov (United States)

    Kredzinski, Lukasz; Connelly, Michael J.

    2012-06-01

    Full-field Optical coherence tomography is an en-face interferometric imaging technology capable of carrying out high resolution cross-sectional imaging of the internal microstructure of an examined specimen in a non-invasive manner. The presented system is based on competitively priced optical components available at the main optical communications band located in the 1550 nm region. It consists of a superluminescent diode and an anti-stokes imaging device. The single mode fibre coupled SLD was connected to a multi-mode fibre inserted into a mode scrambler to obtain spatially incoherent illumination, suitable for OCT wide-field modality in terms of crosstalk suppression and image enhancement. This relatively inexpensive system with moderate resolution of approximately 24um x 12um (axial x lateral) was constructed to perform a 3D cross sectional imaging of a human tooth. To our knowledge this is the first 1550 nm full-field OCT system reported.

  6. QCD test in three-jet Z0 decays at SLD and detector development for H0 → γγ searches in high energy hadron colliders

    International Nuclear Information System (INIS)

    Hwang, Hyun.

    1994-08-01

    Polarized Z degrees decays into three jets have been detected and measured in the SLAC Large Detector (SLD) experiment operating it the SLAC Linear Collider (SLC). The hadrons from the jets were detected in the SLD liquid argon calorimeter, providing a sensitivity over 98% of the solid angle. The spin of the gluon was tested by studying the scaled jet energies (x 1 , x 2 , x 3 ), the Ellis-Karliner angle (cosθ EK ) and the parameters of event plane orientation (α, α N , β). These measured variables are compared with quantum chromodynamics (QCD) and a scalar gluon model. Good agreement is found between data, and the vector QCD model for the distributions of (x 1 , x 2 , x 3 ) and (cosθ EK ). Two detector prototypes for the GEM detector of the Superconducting Super Collider have been studied: a prototype silicon-tungsten preradiator and a liquid argon hadron calorimeter. The silicon-tungsten preradiator was designed for the GEM detector to distinguish between single photons from Higgs decay and background photon pairs from π degrees decay. This preradiator was tested in a beam at Brookhaven National Laboratory in July, 1992. A lead glass array placed behind the silicon was used to determine energy resolution effects. The results from the test on spatial distributions and energy resolution, including correction for the energy deposited in the preradiator are presented, along with comparisons to EGS simulations. Data from a beam test of the liquid argon prototype was analyzed and compared to CALOR89 simulations. The studies concentrated on energy resolution optimization and electronic noise suppression

  7. Part I. A study of the decays D → Kππeν and D → K*πeν. Part II. SLD Cherenkov Ring Imaging Detector development

    International Nuclear Information System (INIS)

    Huber, J.S.

    1992-01-01

    A thesis in two independent halves. Part I. A search for the exclusive semileptonic decay modes D + → bar K ππ + ν e and D + → bar K * πe + ν e are presented using data from the Fermi-lab photoproduction experiment E691. With good sensitivity, the author observes no signals in the channels D + → K - π + π degrees e + ν e and D + → bar K degrees π + π - e + ν e , and set upper limits that represent only a small fraction of the inclusive semileptonic branching ration. The experiment was conducted at the Fermi-lab tagged Photon Laboratory, using a large acceptance spectrometer with silicon microvertex detector to extract a large, clean charm sample. Part II. The physics, design, and results of the Stanford Large Detector (SLD) Cherenkov Ring Imaging Detector (CRID) are described. The physics motivation and performance for the SLD CRID, the principles of Cherenkov detection, and a description of the SLD CRID are combined with a detailed description of the production and testing of the mirrors. In addition, results from the engineering run and cosmic ray tests demonstrate the current status of the system

  8. Dicty_cDB: SLD739 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Antarctic fish Dissostichus mawsoni adult... 42 6.5 1 ( FE221128 ) O019B05 Antarctic fish Dissostichus mawson...i adult... 42 6.5 1 ( FE203112 ) B385G09 Antarctic fish Dissostichus mawsoni ad...ult... 42 6.5 1 ( FE196180 ) B197B12 Antarctic fish Dissostichus mawsoni adult... 42 6.5 1 ( FE195928 ) B193...H07 Antarctic fish Dissostichus mawsoni adult... 42 6.5 1 dna update 2009. 3.21 Homology vs Protein Score E

  9. Dicty_cDB: SLD776 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AACATCGAATGTGTTATTTCATATGACGATATTAATAATTAGAAAAACATANATA AATAGTATAAATAAGTATATAAATAAATATACAAATATATAAATAACCAAAT...TTCATATGACGATATTAATAATTAGAAAAACATANATA AATAGTATAAATAAGTATATAAATAAATATACAAATATATAAATAACCAAATATATATTA ATAAACCA

  10. sld007.htm | epub DCs | presentations | epubworkshop | Indian ...

    Indian Academy of Sciences (India)

    Toggle navigation. Logo of the Indian Academy of Sciences. Indian Academy of Sciences. Home · About IASc · History · Memorandum of Association · Role of the Academy · Statutes · Council · Raman Chair · Jubilee Chair · Academy – Springer Nature chair · Academy Trust · Contact details · Office Staff · Office complaint ...

  11. Bimodal SLD Ice Accretion on a NACA 0012 Airfoil Model

    Science.gov (United States)

    Potapczuk, Mark; Tsao, Jen-Ching; King-Steen, Laura

    2016-01-01

    This presentation describes the results of ice accretion measurements on a NACA 0012 airfoil model, from the NASA Icing Research Tunnel, using an icing cloud composed of a bimodal distribution of Supercooled Large Droplets. The data consists of photographs, laser scans of the ice surface, and measurements of the mass of ice for each icing condition. The results of ice shapes accumulated as a result of exposure to an icing cloud with a bimodal droplet distribution were compared to the ice shapes resulting from an equivalent cloud composed of a droplet distribution with a standard bell curve shape.

  12. First results from SLD with polarized electron beam at SLC

    International Nuclear Information System (INIS)

    Fero, M.J.

    1992-12-01

    The SLAC Linear Collider (SLC) has been modified to collide a longitudinally polarized electron beam with the unpolarized positron beam. We review the beginning of polarized beam running at the SLC, and report on the measurement of the left-right cross section asymmetry (A LR ) made with a sample of 10,224 Z decays collected over the course of the 1992 run. The average beam polarization for this set of Z decays was 22.4 ± 0.6%(syst.). A LR was measured to be 0.100 ± 0.044(stat.) ± 0.004(syst.). From this measurement, the weak mixing angle defined at the Z boson pole is determined to be sin 2 θ eff W = 0.2378 ± 0.0056 ± 0.0005

  13. Monitor and control systems for the SLD Cherenkov Ring Imaging Detector

    International Nuclear Information System (INIS)

    Antilogus, P.; Aston, D.; Bienz, T.; Boston Univ., MA; California Univ., Santa Barbara, CA; California Univ., Santa Cruz, CA; Cincinnati Univ., OH; Rutgers--the State Univ., Piscataway, NJ; Tohoku Univ., Sendai

    1989-10-01

    To help ensure the stable long-term operation of a Cherenkov Ring Detector at high efficiency, a comprehensive monitor and control system is being developed. This system will continuously monitor and maintain the correct operating temperatures, and will provide an on-line monitor and maintain the correct operating temperatures, and will provide an on-line monitor of the pressures, flows, mixing, and purity of the various fluids. In addition the velocities and trajectories of Cherenkov photoelectrons drifting within the imaging chambers will be measured using a pulsed uv lamp and a fiberoptic light injection system. 9 refs., 6 figs

  14. Job Satisfaction among Practicing School Psychologists: The Impact of SLD Identification

    Science.gov (United States)

    Cottrell, Joseph M.; Barrett, Courtenay A.

    2016-01-01

    Research has documented high levels of job satisfaction among school psychologists. Given that school psychologists spend much of their time in special education decision making and identifying students with specific learning disabilities (SLDs), it is important to understand how assessment practices relate to job satisfaction. This study surveyed…

  15. New Mexico, 2010 Census State Legislative District (SLD) Lower Chamber State-based

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The TIGER/Line Files are shapefiles and related database files (.dbf) that are an extract of selected geographic and cartographic information from the U.S. Census...

  16. New Mexico, 2010 Census State Legislative District (SLD) Upper Chamber State-based

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The TIGER/Line Files are shapefiles and related database files (.dbf) that are an extract of selected geographic and cartographic information from the U.S. Census...

  17. Optogenetic Activation of the Sublaterodorsal (SLD) Nucleus Induces Rapid Muscle Inhibition

    Science.gov (United States)

    2015-09-01

    followed by 10% formalin with 15% sucrose, for cryoprotection. Brains were sectioned at 40 µm and tissue stained for Nissl and green fluorescent...injection location Figure 6A: A coronal brain section from rat CG4: The blue Nissl stain highlights neuronal cell bodies, while the darker black is an...coronal brain section from rat CG3: The blue Nissl stain highlights neuronal cell bodies, while the darker black is an anti-GFP stain to determine

  18. A laser-based beam profile monitor for the SLC/SLD interaction region

    International Nuclear Information System (INIS)

    Alley, R.; Arnett, D.; Bong, E.; Colocho, W.; Frisch, J.; Horton-Smith, S.; Inman, W.; Jobe, K.; Kotseroglou, T.; McCormick, D.; Nelson, J.; Scheeff, M.; Wagner, S.; Ross, M.C.

    1996-01-01

    Beam size estimates made using beam-beam deflections are used for optimization of the Stanford linear collider (SLC) electron-positron beam sizes. Typical beam sizes and intensities expected for 1996 operations are 2.1 x 0.6 μm (x, y) at 4.0.10 10 particles per pulse. Conventional profile monitors, such as scanning wires, fail at charge densities well below this. The laser-based profile monitor uses a finely-focused 350-nm wavelength tripled YLF laser pulse that traverses the particle beam path about 29 cm away from the e + /e - IP. Compton scattered photons and degraded e + /e - are detected as the beam is steered across the laser pulse. The laser pulse has a transverse size of 380 nm and a Rayleigh range of about 5 μm. (orig.)

  19. Identifying Best Practice in a Shifting Landscape: Making Sense of RTI in the Context of SLD Identification

    Science.gov (United States)

    Lindstrom, Jennifer H.; Sayeski, Kristin

    2013-01-01

    The Individuals with Disabilities Education Act (2004) has had substantial influence on special education in general and the field of learning disabilities in particular. Since its reauthorization in 2004, ongoing regulatory efforts have been underway to determine its operationalization and implementation. Of particular concern to those involved…

  20. TIGER/Line Shapefile, 2015, Series Information for the Current State Legislative District (SLD) Lower Chamber State-based Shapefile

    Data.gov (United States)

    US Census Bureau, Department of Commerce — State Legislative Districts (SLDs) are the areas from which members are elected to State legislatures. The SLDs embody the upper (senate) and lower (house) chambers...

  1. Effect of hemopoietic microenvironment on splenic suppressor macrophages in congenitally anemic mice of genotype Sl/Sld

    International Nuclear Information System (INIS)

    Shibata, Y.; Volkman, A.

    1985-01-01

    Mechanisms underlying mononuclear phagocyte specialization are being probed by studying suppressor macrophages (M phi) as a reference population in mouse models with impaired blood monocyte formation. Splenic suppressor M phi, defined by PGE-mediated inhibition of Con A-induced T lymphocyte proliferation are induced by the i.p. administration of Corynebacterium parvum (CP). Mice severely depleted of bone marrow and blood monocytes by treatment with 89Sr fail to show this suppressor M phi response to CP, although M phi-forming stem cells, assessed as splenic M-CFC in vitro, are increased 20-fold. These observations suggest that radiosensitive bone marrow stem cells are necessary for the generation of both suppressor M phi and monocytes and that one such stem cell may be common to both types of mononuclear phagocytes. This notion was explored further by employing congenitally anemic mice of the genotype S1/S1d in which the hemopoietic microenvironment is genetically defective and thus unable to support the proliferation, differentiation, and function of stem cells. The congenital defect was found to be additionally expressed in the S1/S1d mouse by a monocytopenia of less than 10% of the values in normal congenic littermate controls and by the failure of splenic M-CFC to increase in response to CP. PGE-producing suppressor M phi expressing Fc gamma 2b receptors, however, were induced by CP in S1/S1d mice with no significant diminution of suppressor activity. These data establish the fact that significant impairment of the formation of monocytes is part of the overall hemopoietic defect in S1/S1d mice. PGE-producing suppressor M phi, however, were inducible at normal functional levels in the presence of a profound monocytopenia, and therefore appear to be independent of the mechanisms that regulate blood monocyte formation

  2. Dicty_cDB: SLA508 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available e-101 SLD569 (SLD569Q) /CSM/SL/SLD5-C/SLD569Q.Seq.d/ 250 1e-65 SLD492 (SLD492Q) /CSM/SL/SLD4-D/SLD492...oideum slug cDNA, clone SLD569. 250 2e-62 1 ( AU052538 ) Dictyostelium discoideum slug cDNA, clone SLD492. 7

  3. TIGER/Line Shapefile, 2014, Series Information File for the Current State Legislative District (SLD) Upper Chamber State-based Shapefile

    Data.gov (United States)

    US Census Bureau, Department of Commerce — State Legislative Districts (SLDs) are the areas from which members are elected to State legislatures. The SLDs embody the upper (senate) and lower (house) chambers...

  4. Dicty_cDB: VHJ195 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available -B/AFN547Q.Seq.d/ 1342 0.0 SLE172 (SLE172Q) /CSM/SL/SLE1-C/SLE172Q.Seq.d/ 1102 0.0 SLD492 (SLD492Q) /CSM/SL/SLD4-D/SLD492...8502 ) Dictyostelium discoideum cDNA clone:dda28m11, 5' ... 839 0.0 2 ( AU052538 ) Dictyostelium discoideum slug cDNA, clone SLD492...2597 ) Dictyostelium discoideum slug cDNA, clone SLD569. 113 2e-20 1 ( AU061182 ) Dictyostelium discoideum slug cDNA, clone SLD492

  5. Dicty_cDB: SLE172 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available d/ 1126 0.0 VHJ195 (VHJ195Q) /CSM/VH/VHJ1-D/VHJ195Q.Seq.d/ 1102 0.0 SLD492 (SLD492Q) /CSM/SL/SLD4-D/SLD492... 0.0 1 ( AU052538 ) Dictyostelium discoideum slug cDNA, clone SLD492. 817 0.0 1 ( C83939 ) Dictyostelium dis

  6. UHMW Ziegler–Natta polyethylene: Synthesis, crystallization, and melt behavior

    KAUST Repository

    Atiqullah, Muhammad; Adamu, Sagir; Emwas, Abdul-Hamid M.

    2017-01-01

    nonisothermal crystallization model, Flory's equilibrium theory and ethylene sequence length distribution concept (SLD), Gibbs–Thompson equation, and DSC experiments. By using this approach, the effects of MW, 1-hexene incorporation, ethylene SLD, the level

  7. Study on superluminescent diodes using InGaAs-InAs chirped quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Han, Il Ki; Heo, Du Chang; Song, Jin Dong; Lee, Jung Il [Korea Institute Science and Technology, Seoul (Korea, Republic of); Lee, Joo In [Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2004-11-15

    We have fabricated superluminescent diodes (SLD) by using InGaAs-InAs chirped quantum dots (QD). The spectral bandwidth of the SLD was measured to be 170 nm. These results explain the possibility of QD-based SLD exceeding the performance of multi-quantum well-based ones.

  8. Deliberate Integration of Student Leadership Development in Doctor of Pharmacy Programs

    Science.gov (United States)

    Nelson, Michael H.; Bzowyckyj, Andrew S.; Fuentes, David G.; Rosenberg, Ettie; DiCenzo, Robert

    2016-01-01

    The CAPE 2013 Outcomes answered the call for increased student leadership development (SLD) by identifying leadership as a desired curricular goal. To meet this outcome, colleges and schools of pharmacy are advised to first identify a set of SLD competencies aligned with their institution’s mission and goals and then organize these competencies into a SLD framework/model. Student leadership development should be integrated vertically and horizontally within the curriculum in a deliberate and longitudinal manner. It should include all student pharmacists, begin at the point of admission, and extend beyond extracurricular activities. The school’s assessment plan should be aligned with the identified SLD competencies so student learning related to leadership is assessed. To accomplish these recommendations, a positive environment for SLD should be cultivated within the school, including administrative backing and resources, as well as support among the broader faculty for integrating SLD into the curriculum. PMID:26941428

  9. Deliberate Integration of Student Leadership Development in Doctor of Pharmacy Programs.

    Science.gov (United States)

    Janke, Kristin K; Nelson, Michael H; Bzowyckyj, Andrew S; Fuentes, David G; Rosenberg, Ettie; DiCenzo, Robert

    2016-02-25

    The CAPE 2013 Outcomes answered the call for increased student leadership development (SLD) by identifying leadership as a desired curricular goal. To meet this outcome, colleges and schools of pharmacy are advised to first identify a set of SLD competencies aligned with their institution's mission and goals and then organize these competencies into a SLD framework/model. Student leadership development should be integrated vertically and horizontally within the curriculum in a deliberate and longitudinal manner. It should include all student pharmacists, begin at the point of admission, and extend beyond extracurricular activities. The school's assessment plan should be aligned with the identified SLD competencies so student learning related to leadership is assessed. To accomplish these recommendations, a positive environment for SLD should be cultivated within the school, including administrative backing and resources, as well as support among the broader faculty for integrating SLD into the curriculum.

  10. Smart Location Database - Service

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Smart Location Database (SLD) summarizes over 80 demographic, built environment, transit service, and destination accessibility attributes for every census block...

  11. Smart Location Database - Download

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Smart Location Database (SLD) summarizes over 80 demographic, built environment, transit service, and destination accessibility attributes for every census block...

  12. Emotional and Meta-Emotional Intelligence as Predictors of Adjustment Problems in Students with Specific Learning Disorders

    Science.gov (United States)

    D'Amico, Antonella; Guastaferro, Teresa

    2017-01-01

    The purpose of this study was to analyse adjustment problems in a group of adolescents with a Specific Learning Disorder (SLD), examining to what extent they depend on the severity level of the learning disorder and/or on the individual's level of emotional intelligence. Adjustment problems,, perceived severity levels of SLD, and emotional and…

  13. Response to Intervention for Specific Learning Disabilities Identification: The Impact of Graduate Preparation and Experience on Identification Consistency

    Science.gov (United States)

    Maki, Kathrin E.

    2018-01-01

    Response to intervention (RTI) is increasingly being implemented in schools as a means to identify students with specific learning disabilities (SLD). Despite its wide use, there is limited research regarding school psychologists' graduate preparation in and familiarity with RTI for SLD identification. This study examined how school psychologists'…

  14. Past Accomplishments and Future Challenges

    Science.gov (United States)

    Danielson, Louis; Doolittle, Jennifer; Bradley, Renee

    2005-01-01

    Three broad issues continue to dramatically impact the education of children with specific learning disabilities (SLD): (1) the development and implementation of scientifically defensible methods of identification; (2) the development and implementation of scientific interventions to ensure that children with SLD have access to and make progress…

  15. Cognitive Clusters in Specific Learning Disorder.

    Science.gov (United States)

    Poletti, Michele; Carretta, Elisa; Bonvicini, Laura; Giorgi-Rossi, Paolo

    The heterogeneity among children with learning disabilities still represents a barrier and a challenge in their conceptualization. Although a dimensional approach has been gaining support, the categorical approach is still the most adopted, as in the recent fifth edition of the Diagnostic and Statistical Manual of Mental Disorders. The introduction of the single overarching diagnostic category of specific learning disorder (SLD) could underemphasize interindividual clinical differences regarding intracategory cognitive functioning and learning proficiency, according to current models of multiple cognitive deficits at the basis of neurodevelopmental disorders. The characterization of specific cognitive profiles associated with an already manifest SLD could help identify possible early cognitive markers of SLD risk and distinct trajectories of atypical cognitive development leading to SLD. In this perspective, we applied a cluster analysis to identify groups of children with a Diagnostic and Statistical Manual-based diagnosis of SLD with similar cognitive profiles and to describe the association between clusters and SLD subtypes. A sample of 205 children with a diagnosis of SLD were enrolled. Cluster analyses (agglomerative hierarchical and nonhierarchical iterative clustering technique) were used successively on 10 core subtests of the Wechsler Intelligence Scale for Children-Fourth Edition. The 4-cluster solution was adopted, and external validation found differences in terms of SLD subtype frequencies and learning proficiency among clusters. Clinical implications of these findings are discussed, tracing directions for further studies.

  16. Self-Disclosure Decisions of University Students with Learning Disabilities

    Science.gov (United States)

    Cole, Emma V.; Cawthon, Stephanie W.

    2015-01-01

    The number of students with learning disabilities (SLD) at postsecondary institutions has tripled over the past three decades and now constitutes about 11% of undergraduate students (Joyce & Rossen, 2006; U.S. Department of Education, 2013). Research has found that SLD who use accommodations at their postsecondary institution are more…

  17. STANFORD (SLAC): Precision electroweak result

    International Nuclear Information System (INIS)

    Anon.

    1994-01-01

    Precision testing of the electroweak sector of the Standard Model has intensified with the recent publication* of results from the SLD collaboration's 1993 run on the Stanford Linear Collider, SLC. Using a highly polarized electron beam colliding with an unpolarized positron beam, SLD physicists measured the left-right asymmetry at the Z boson resonance with dramatically improved accuracy over 1992

  18. Executive Functioning and Psychopathology in Psychotherapy for Adolescents with Specific Learning Disorders

    Science.gov (United States)

    Kopelman-Rubin, Daphne; Klomek, Anat Brunstein; Al-Yagon, Michal; Mufson, Laura; Apter, Alan; Mikulincer, Mario

    2017-01-01

    This study examined the contribution of executive functioning (EF) to improvements in psychiatric symptomatology following I Can Succeed (ICS; Kopelman-Rubin, 2012) psychotherapy, a skill-enhancement intervention designed to target EF and socio-emotional aspects of specific learning disabilities (SLD). Forty adolescents with SLD underwent ICS in…

  19. Psychosocial and Adaptive Deficits Associated with Learning Disability Subtypes

    Science.gov (United States)

    Backenson, Erica M.; Holland, Sara C.; Kubas, Hanna A.; Fitzer, Kim R.; Wilcox, Gabrielle; Carmichael, Jessica A.; Fraccaro, Rebecca L.; Smith, Amanda D.; Macoun, Sarah J.; Harrison, Gina L.; Hale, James B.

    2015-01-01

    Children with specific learning disabilities (SLD) have deficits in the basic psychological processes that interfere with learning and academic achievement, and for some SLD subtypes, these deficits can also lead to emotional and/or behavior problems. This study examined psychosocial functioning in 123 students, aged 6 to 11, who underwent…

  20. Understanding Impulsivity among Children with Specific Learning Disabilities in Inclusion Schools

    Science.gov (United States)

    Al-Dababneh, Kholoud Adeeb; Al-Zboon, Eman K.

    2018-01-01

    Impulsive behavior is a characteristic of children with specific learning disabilities (SLD), and is related to learning ability. The present study aims to identify impulsivity behavior in children with SLD who attend inclusion schools, from their resource room teachers' perspectives. A 31-item questionnaire that addressed four subscales was…

  1. Encouraging Free Play: Extramural Digital Game-Based Language Learning as a Complex Adaptive System

    Science.gov (United States)

    Scholz, Kyle

    2017-01-01

    Massively multiplayer online role-playing games like World of Warcraft are ideally suited to encourage and facilitate second language development (SLD) in the extramural setting, but to what extent do the language learners' actual trajectories of gameplay contribute to SLD? With the current propensity to focus research in digital game-based…

  2. A Time to Define: Making the Specific Learning Disability Definition Prescribe Specific Learning Disability

    Science.gov (United States)

    Kavale, Kenneth A.; Spaulding, Lucinda S.; Beam, Andrea P.

    2009-01-01

    Unlike other special education categories defined in U.S. law (Individuals with Disabilities Education Act), the definition of specific learning disability (SLD) has not changed since first proposed in 1968. Thus, although the operational definition of SLD has responded to new knowledge and understanding about the construct, the formal definition…

  3. Greek Young Adults with Specific Learning Disabilities Seeking Learning Assessments

    Science.gov (United States)

    Bonti, Eleni; Bampalou, Christina E.; Kouimtzi, Eleni M.; Kyritsis, Zacharias

    2018-01-01

    The purpose of this study is to investigate the reasons why Greek young adults with Specific Learning Disabilities (SLD) seek learning assessments. The study sample consisted of 106 adults meeting Diagnostic and Statistical Manual of Mental Disorders criteria for SLD. Data were collected through self-report records (clinical interview) of adults…

  4. Neuropsychological Profiles of Written Expression Learning Disabilities Determined by Concordance-Discordance Model Criteria.

    Science.gov (United States)

    Fenwick, Melanie E; Kubas, Hanna A; Witzke, Justin W; Fitzer, Kim R; Miller, Daniel C; Maricle, Denise E; Harrison, Gina L; Macoun, Sarah J; Hale, James B

    2016-01-01

    Children with specific learning disabilities (SLD) have disparate neuropsychological processing deficits that interfere with academic achievement in spelling, writing fluency, and/or written expression (WE). Although there are multiple potential causes of WE SLD, there is a paucity of research exploring this critical academic skill from a neuropsychological perspective. This study examined the neuropsychological profiles of WE SLD subtypes defined using the concordance-discordance model (C-DM) of SLD identification. Participants were drawn from a sample of 283 children (194 boys, 89 girls) aged 6 years to 16 years old (M(age) = 9.58 years, SD = 2.29 years) referred for comprehensive neuropsychological evaluations in school settings and subsequently selected based on C-DM determined spelling, writing fluency, and WE SLD. WE SLD subtypes differed on several psychomotor, memory, and executive function measures (F range = 2.48-5.07, p range = .049 to <.001), suggesting that these children exhibit distinct patterns of neuropsychological processing strengths and weaknesses. Findings have relevance for differential diagnosis of WE subtypes, discriminating WE SLD subtypes from low WE achievement, and developing differentiated evidence-based instruction and intervention for children with WE SLD. Limitations and future research will be addressed.

  5. Specific Learning Disabilities in DSM-5: Are the Changes for Better or Worse?

    Science.gov (United States)

    Tannock, Rosemary

    2013-01-01

    DSM-5, the fifth edition of the American Psychiatric Association's "Diagnostic and Statistical Manual of Mental Disorders," was published in May 2013, amidst a storm of controversy. This article focuses on changes made to the diagnostic criteria for Specific Learning Disorders (SLD). Primary criticisms of the changes in the SLD concern…

  6. Emotional and meta-emotional intelligence as predictors of adjustment problems in students with Specific Learning Disorders

    Directory of Open Access Journals (Sweden)

    Antonella D’Amico

    2017-11-01

    Full Text Available The purpose of this study was to analyse adjustment problems in a group of adolescents with a Specific Learning Disorder (SLD, examining to what extent they depend on the severity level of the learning disorder and/or on the individual‟s level of emotional intelligence. Adjustment problems,, perceived severity levels of SLD, and emotional and meta-emotional intelligence were examined in 34 adolescents with SLD. Results demonstrated that emotional beliefs, emotional self-concept and emotional intelligence are very important factors in the psychological adjustment of adolescents with SLD. These results provide evidence for the importance of considering meta-emotional intelligence in both diagnostic and intervention protocols, as well as in the inclusive education of students with SLD.

  7. Sublethal damages: their nature and repair

    Energy Technology Data Exchange (ETDEWEB)

    Saenko, A.S.; Synzynys, B.I.; Trofimova, S.F. (Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii, Obninsk (USSR)); Gotlib, V.Ya.; Pelevina, I.I. (AN SSSR, Moscow. Inst. Khimicheskoj Fiziki)

    1983-05-12

    The molecular nature of sublethal damage (SLD) arising after ionizing irradiation of cultured mammalian cells was considered on the basis of data on DNA repair and cell recovery after SLD observed in lymphosarcoma cells as well as of literature data. The rate of SLD recovery and that of restoration of the cell's ability to initiate DNA synthesis were shown to be similar in new replicons. These data along with knowledge about the role of exchange type chromosomal aberrations in reproductive death permitted us to propose the hypothesis that conformational changes of chromatine - most probably, relaxation of condensed chromosomal material - are damage registered as SLD at the cellular level. Double-strand breaks and a slowly repaired part of DNA single-strand breaks are candidates for SLD.

  8. Characterization report for the ferrocyanide safety issue

    International Nuclear Information System (INIS)

    Pulsipher, B.A.; Burger, L.L.; Liebetrau, A.M.; Scheele, R.D.

    1997-06-01

    Recently PNNL was tasked by DOE to develop and demonstrate a risk-based strategic approach to characterizing Hanford's Nuclear Waste Tanks. This strategic approach was documented in a report entitled ''A Risk-Based Focused Decision-Management Approach for Justifying Characterization of Hanford Tank Waste''. In support of the general approach, a specific strategy for addressing each of the several safety issues associated with the tanks was developed. This report documents the approach for the Ferrocyanide Safety Issue. The purpose of this report is to describe a structured logic diagram (SLD) for determining the risk associated with the ferrocyanide tank safety issue and provide the supporting information for the SLD. The SLD addresses the resolution of risks resulting from the presence of ferrocyanide layers within the Hanford tanks. The informational requirements for determining risk from any reaction stemming from ferrocyanide are outlined in the SLD. This report will describe the potential paths to a successful resolution of the ferrocyanide safety issue. Complete development of the intervention pathway is outside the scope of this current activity. General descriptions of the approach, key components of the SLD, and conclusions are provided in the body of this report. The complete SLD, descriptions of each box shown in the SLD, a discussion on how to fill data needs, and a list of contributors is provided in the appendices

  9. Second Line of Defense, Port of Buenos Aires and Exolgan Container Terminal Operational Testing and Evaluation Plan, Buenos Aires, Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, Bryan W.

    2012-08-23

    The Office of the Second Line of Defense (SLD) Megaports project team for Argentina will conduct operational testing and evaluation (OT&E) at Exolgan Container Terminal at the Port of Dock Sud from July 16-20, 2012; and at the Port of Buenos Aires from September 3-7, 2012. SLD is installing radiation detection equipment to screen export, import, and transshipment containers at these locations. The purpose of OT&E is to validate and baseline an operable system that meets the SLD mission and to ensure the system continues to perform as expected in an operational environment with Argentina Customs effectively adjudicating alarms.

  10. Verification and Planning Based on Coinductive Logic Programming

    Science.gov (United States)

    Bansal, Ajay; Min, Richard; Simon, Luke; Mallya, Ajay; Gupta, Gopal

    2008-01-01

    Coinduction is a powerful technique for reasoning about unfounded sets, unbounded structures, infinite automata, and interactive computations [6]. Where induction corresponds to least fixed point's semantics, coinduction corresponds to greatest fixed point semantics. Recently coinduction has been incorporated into logic programming and an elegant operational semantics developed for it [11, 12]. This operational semantics is the greatest fix point counterpart of SLD resolution (SLD resolution imparts operational semantics to least fix point based computations) and is termed co- SLD resolution. In co-SLD resolution, a predicate goal p( t) succeeds if it unifies with one of its ancestor calls. In addition, rational infinite terms are allowed as arguments of predicates. Infinite terms are represented as solutions to unification equations and the occurs check is omitted during the unification process. Coinductive Logic Programming (Co-LP) and Co-SLD resolution can be used to elegantly perform model checking and planning. A combined SLD and Co-SLD resolution based LP system forms the common basis for planning, scheduling, verification, model checking, and constraint solving [9, 4]. This is achieved by amalgamating SLD resolution, co-SLD resolution, and constraint logic programming [13] in a single logic programming system. Given that parallelism in logic programs can be implicitly exploited [8], complex, compute-intensive applications (planning, scheduling, model checking, etc.) can be executed in parallel on multi-core machines. Parallel execution can result in speed-ups as well as in larger instances of the problems being solved. In the remainder we elaborate on (i) how planning can be elegantly and efficiently performed under real-time constraints, (ii) how real-time systems can be elegantly and efficiently model- checked, as well as (iii) how hybrid systems can be verified in a combined system with both co-SLD and SLD resolution. Implementations of co-SLD resolution

  11. Comment on "Histories and Horoscopes: The Ethnographer as Fortune-Teller."

    Science.gov (United States)

    Luttrell, Wendy

    1998-01-01

    Explores the analogy of the researcher as fortune teller and the parallels between research histories and horoscopes and discusses the tension between what the subject is and what he or she is imagined to be by others. (SLD)

  12. Warriors Don't Cry: A Searing Memoir of the Battle to Integrate Little Rock's Central High.

    Science.gov (United States)

    Beals, Melba Pattillo

    1994-01-01

    Recounts experiences of the author as one of the black students who integrated Central High School in Little Rock (Arkansas) in 1957 and presents a retrospective as she looks back on her story and the civil rights movement. (SLD)

  13. Standard Errors for Matrix Correlations.

    Science.gov (United States)

    Ogasawara, Haruhiko

    1999-01-01

    Derives the asymptotic standard errors and intercorrelations for several matrix correlations assuming multivariate normality for manifest variables and derives the asymptotic standard errors of the matrix correlations for two factor-loading matrices. (SLD)

  14. Walkability Index

    Science.gov (United States)

    The Walkability Index dataset characterizes every Census 2010 block group in the U.S. based on its relative walkability. Walkability depends upon characteristics of the built environment that influence the likelihood of walking being used as a mode of travel. The Walkability Index is based on the EPA's previous data product, the Smart Location Database (SLD). Block group data from the SLD was the only input into the Walkability Index, and consisted of four variables from the SLD weighted in a formula to create the new Walkability Index. This dataset shares the SLD's block group boundary definitions from Census 2010. The methodology describing the process of creating the Walkability Index can be found in the documents located at ftp://newftp.epa.gov/EPADataCommons/OP/WalkabilityIndex.zip. You can also learn more about the Smart Location Database at https://edg.epa.gov/data/Public/OP/Smart_Location_DB_v02b.zip.

  15. Casing Out Evaluation: Expanding Student Interest in Program Evaluation through Case Competitions.

    Science.gov (United States)

    Obrecht, Michael; Porteous, Nancy; Haddock, Blair

    1998-01-01

    Describes the authors' experiences in organizing bilingual evaluation case competitions for the National Capital Chapter of the Canadian Evaluation Society for three years. Competition structure, eligibility, judging, contestant recruiting, and preparing cases are outlined. (SLD)

  16. Cellular and molecular repair of X-ray-induced damage: dependence on oxygen tension and nutritional status

    International Nuclear Information System (INIS)

    Spiro, I.J.; Kennedy, K.A.; Stickler, R.; Ling, C.C.

    1985-01-01

    Cellular and molecular repair was studied at 23 0 C using split-dose recovery and alkaline elution techniques, respectively, as a function of cellular oxygen and nutrient conditions. Hypoxic cells in full medium showed a partial reduction in the level of sublethal damage (SLD) repair relative to aerated cells; the respective repair kinetics were similar with a common repair half-time of 30 min. Similarly, hypoxic cells showed a slight reduction in strand break rejoining capacity compared to aerated cells. Under nutrient deprivation, anoxic cells displayed no SLD repair or strand break repair, while aerated cells exhibited the same level of SLD and strand break repair as for well-fed cells. In addition, nutrient deprived cells at low O 2 levels displayed normal SLD and strand break repair capability. These results indicate that both nutrient and O 2 deprivation are necessary for complete inhibition of cellular and molecular repair, and low levels of O 2 can effectively reverse this inhibition

  17. Women in Managerial Positions in Greek Education.

    Science.gov (United States)

    Athanassoula-Reppa, Anastasia; Koutouzis, Manolis

    2002-01-01

    Discusses the under representation of women in managerial positions in Greece and the evidence of barriers that inhibit women from pursuing and taking such positions, a type of covert discrimination that is counter to notions of democratic citizenship. (SLD)

  18. Ten Years after Tiananmen: Some Unsung Heroes of the Struggle.

    Science.gov (United States)

    American Educator, 1999

    1999-01-01

    Tells the life stories of some of the people who have worked for human rights and democracy in contemporary China. Five profiles show the obstacles faced by Chinese teachers in the human-rights struggle. (SLD)

  19. To Tell a New Story: Reinventing Narratives of Culture, Identity, and Education.

    Science.gov (United States)

    Florio-Ruane, Susan

    1997-01-01

    Reflects on stories educators tell about culture, identity, and education. If stories of self are to help educators reform institutions or build new communities, they must be reinvented to embrace others rather than to defend against contact with others. (SLD)

  20. Opinions on Current Reading.

    Science.gov (United States)

    Journal of Blacks in Higher Education, 1997

    1997-01-01

    Presents eight reviews of current books, covering issues of particular interest to black educators and historians. Topics considered include slavery, college admissions and affirmative action, the marginalization of black scientists, black politics, bigotry, and higher education. (SLD)

  1. Women in Academia: Work-Related Stresses.

    Science.gov (United States)

    Keim, Jeanmarie; Erickson, Chris

    1998-01-01

    Highlights some of the more common stressors and difficulties faced by women in academia, particularly those of junior rank, in the areas of teaching, scholarship, and service, and outlines effective strategies, including plans for institutions, for overcoming barriers. (SLD)

  2. Multimedia Learning: Beyond Modality. Commentary.

    Science.gov (United States)

    Reimann, P.

    2003-01-01

    Identifies and summarizes instructional messages in the articles in this theme issue and also identifies central theoretical issues, focusing on: (1) external representations; (2) dual coding theory; and (3) the effects of animations on learning. (SLD)

  3. High-brightness semipolar (2021¯) blue InGaN/GaN superluminescent diodes for droop-free solid-state lighting and visible-light communications

    KAUST Repository

    Shen, Chao

    2016-05-25

    A high-brightness, droop-free, and speckle-free InGaN/GaN quantum well blue superluminescent diode (SLD) was demonstrated on a semipolar (2021) GaN substrate. The 447-nm emitting SLD has a broad spectral linewidth of 6.3 nm at an optical power of 123 mW. A peak optical power of 256 mW was achieved at 700 mA CW injection current. By combining YAG:Ce phosphor, SLD-generated white light shows a color-rendering index (CRI) of 68.9 and a correlated color temperature (CCT) of 4340 K. The measured frequency response of the SLD revealed a -3 dB bandwidth of 560 MHz, thus demonstrating the feasibility of the device for both solid-state lighting (SSL) and visible-light communication (VLC) applications. © 2016 Optical Society of America.

  4. Contracting Maintenance Services: An Easy Question, but a Difficult Answer.

    Science.gov (United States)

    Geiger, Philip E.

    2003-01-01

    Discusses issues involved in outsourcing school maintenance and custodial services. There are many advantages to this approach, but it has definite drawbacks. In many instances, a combination of contract and employee services works well. (SLD)

  5. The Jackie Robinson I Remember.

    Science.gov (United States)

    Kahn, Roger

    1997-01-01

    This memoir describes Jackie Robinson's historic career as the first black player in major league baseball, emphasizing his courage and determination in the face of racism, and recounting the background to his entry into baseball. (SLD)

  6. The Magical Number Seven, Plus or Minus Two: Some Limits on Our Capacity for Processing Information.

    Science.gov (United States)

    Miller, George A.

    1994-01-01

    Capacity limitations in absolute judgment tasks are discussed in relation to information theory. Information theory can provide a quantitative way of resolving questions about limitations on the amount of information we can receive and the process of recoding. (SLD)

  7. Two Aspects of the Simplex Model: Goodness of Fit to Linear Growth Curve Structures and the Analysis of Mean Trends.

    Science.gov (United States)

    Mandys, Frantisek; Dolan, Conor V.; Molenaar, Peter C. M.

    1994-01-01

    Studied the conditions under which the quasi-Markov simplex model fits a linear growth curve covariance structure and determined when the model is rejected. Presents a quasi-Markov simplex model with structured means and gives an example. (SLD)

  8. ARMA-Based SEM When the Number of Time Points T Exceeds the Number of Cases N: Raw Data Maximum Likelihood.

    Science.gov (United States)

    Hamaker, Ellen L.; Dolan, Conor V.; Molenaar, Peter C. M.

    2003-01-01

    Demonstrated, through simulation, that stationary autoregressive moving average (ARMA) models may be fitted readily when T>N, using normal theory raw maximum likelihood structural equation modeling. Also provides some illustrations based on real data. (SLD)

  9. Mental Health, Social Context, Refugees and Immigrants: A Cultural Interface.

    Science.gov (United States)

    Mayadas, Nazneen S.; Ramanathan, Chathapuram S.; Suarez, Zulema

    1999-01-01

    Explores how the lack of awareness of human diversity can adversely affect the mental health care of nondominant ethnic groups. Proposes a three-dimensional cultural-interface model for assessing and treating mental health problems. (SLD)

  10. Solving the Policy Implementation Problem: The Case of Arizona Charter Schools.

    Science.gov (United States)

    Garn, Gregg A.

    1999-01-01

    Analyzes how Arizona charter school policymakers succeeded in preserving the legislative intentions of the state's charter school program. Identifies four key features of policy implementation that created the charter school policy: communication, financial resources, implementor attitudes, and bureaucratic structure. (SLD)

  11. [Research in high energy physics

    International Nuclear Information System (INIS)

    1991-01-01

    This report discusses progress in the following research in high energy physics: The crystal ball experiment; delco at PEP; proton decay experiment; MACRO detector; mark III detector; SLD detector; CLEO II detector; and the caltech L3 group

  12. Lost Promise. The Arrest of an Iowa Community-College President on Drug-Trafficking Charges Prompted a Universal Reaction: What Was He Thinking?

    Science.gov (United States)

    Evelyn, Jamilah

    2003-01-01

    Tells the story of David C. England, whose career as community college president, has been derailed by his arrest for trafficking in marijuana. The administrator denies selling marijuana, but admits he stored and grew large quantities. (SLD)

  13. Hospitality and Collegial Community: An Essay.

    Science.gov (United States)

    Bennett, John B.

    2000-01-01

    Explains a collegial ethic of hospitality as a cardinal academic virtue and suggests a way of building a "collegium," the covenantal community of academe. Discusses how academicians can develop hospitable teaching, hospitable scholarship, and hospitable service. (Author/SLD)

  14. Understanding and Developing Controversial Issues in College Courses.

    Science.gov (United States)

    Payne, Brian K.; Gainey, Randy R.

    2003-01-01

    Discusses common controversial issues in different college disciplines, such as the death penalty and drug legalization. Also suggests useful methods for encouraging enlightening discussions, such as verbal and physical cues, student-centered activities, and text selection. (SLD)

  15. Innovative Methods: Resources for Research, Publishing, and Teaching.

    Science.gov (United States)

    Gergen, Mary; Chrisler, Joan C.; LoCicero, Alice

    1999-01-01

    Reviews a selection of innovative methods congenial to research in feminist psychology and describes undergraduate and graduate courses that emphasize these methods in their curricula. Contains a bibliography of over 300 entries organized by type of innovative method. (SLD)

  16. Status of /hacek C/erenkov Ring Imaging systems

    International Nuclear Information System (INIS)

    Leith, D.W.G.S.

    1987-06-01

    Cerenkov Ring Imaging is briefly introduced, and the problems or choices of designing such a counter are discussed. Recent results from the DELPHI and SLD prototype are presented and compared to the expected performances. 13 refs., 33 figs., 2 tabs

  17. Homeless Families since 1980: Implications for Education.

    Science.gov (United States)

    McChesney, Kay Young

    1993-01-01

    Synthesizes research findings from 10 studies on urban homeless families; and details their demographic characteristics, including the number of children, race, ethnicity, and family composition. Focus is on mothers with children and the effects of homelessness on children. (SLD)

  18. Doing Gender in Management Education.

    Science.gov (United States)

    Marshall, Judi

    1999-01-01

    Explores teaching gender to management students, mainly those working toward Masters in Business Administration degrees. Introduces a gender awareness approach and illustrates it with two examples of "doing" gender using multiple associations of that term. (SLD)

  19. Does Attention Serve to Integrate Features?

    Science.gov (United States)

    Navon, David; Treisman, Anne

    1990-01-01

    An article and two commentaries consider the attentional feature-integration theory proposed by A. Treisman and colleagues. Hypotheses about the encoding of conjunctions are reviewed. Whether or not data support perceptual feature-integration is argued. (SLD)

  20. Determining Sample Size for Accurate Estimation of the Squared Multiple Correlation Coefficient.

    Science.gov (United States)

    Algina, James; Olejnik, Stephen

    2000-01-01

    Discusses determining sample size for estimation of the squared multiple correlation coefficient and presents regression equations that permit determination of the sample size for estimating this parameter for up to 20 predictor variables. (SLD)

  1. Unbundling Evaluation Use.

    Science.gov (United States)

    Alkin, Marvin; Taut, Sandy

    2003-01-01

    Provides a conceptual framework for considering the distinction between evaluation use and evaluation influence and the relationship between evaluation use and knowledge use. Clarifies and expands some of the established definitions of concepts related to evaluation use. (SLD)

  2. Pharmacological effects of two cytolysins isolated from the sea ...

    Indian Academy of Sciences (India)

    Prakash

    2009-12-07

    Email, cebimar@infomed.sld.cu) ... (Amersham Pharmacia Biotech, Uppsala, Sweden) and ionic exchange chromatography on CM-cellulose 52 (Whatman, ... In each well, a fixed concentration of toxin was present at a.

  3. Evaluating the Sonic Layer Depth Relative to the Mixed Layer Depth

    National Research Council Canada - National Science Library

    Helber, Robert W; Barron, Charlie N; Carnes, Michael R; Zingarelli, Robert A

    2008-01-01

    .... The SLD is computed from temperature and salinity profile pairs using a new tunable method while MLD is computed using recently developed methods and either temperature only profiles or temperature...

  4. Behaviorism and Neuroscience.

    Science.gov (United States)

    Thompson, Richard F.

    1994-01-01

    The influence of behaviorism's methods and theories on theory and research in the neurosciences is examined, partly in light of John B. Watson's 1913 essay. An attempt is made to reconcile classical behaviorism and modern cognitive psychology and neuroscience. (SLD)

  5. Food for Thought: Cross-Classification and Category Organization in a Complex Real-World Domain.

    Science.gov (United States)

    Ross, Brian H.; Murphy, Gregory L.

    1999-01-01

    Seven studies involving 256 undergraduates examined how people represent, access, and make inferences about the real-world category domain, foods. Results give a detailed picture of the use of cross-classification in a complex domain. (SLD)

  6. Advancing Democratic Leadership through Critical Theory.

    Science.gov (United States)

    Lees, Kimberly A.

    1995-01-01

    Examines how the concepts advanced by critical theorists exemplify democratic leadership. The concept of democratic leadership is explored as a moral imperative of human issues, and the implications of leadership behavior that emulate the principles of democracy are discussed. (SLD)

  7. Putting the APA "Publication Manual" in Context. Commentary.

    Science.gov (United States)

    Russo, Nancy Felipe

    1999-01-01

    Explores feminist criticism of the "Publications Manual" of the American Psychological Association and the ways in which feminist researchers have negotiated changes in the language of this style guide. (SLD)

  8. High-brightness semipolar (2021¯) blue InGaN/GaN superluminescent diodes for droop-free solid-state lighting and visible-light communications

    KAUST Repository

    Shen, Chao; Ng, Tien Khee; Leonard, John T.; Pourhashemi, Arash; Nakamura, Shuji; DenBaars, Steven P.; Speck, James S.; Alyamani, Ahmed Y.; El-desouki, Munir M.; Ooi, Boon S.

    2016-01-01

    A high-brightness, droop-free, and speckle-free InGaN/GaN quantum well blue superluminescent diode (SLD) was demonstrated on a semipolar (2021) GaN substrate. The 447-nm emitting SLD has a broad spectral linewidth of 6.3 nm at an optical power of 123 mW. A peak optical power of 256 mW was achieved at 700 mA CW injection current. By combining YAG:Ce phosphor, SLD-generated white light shows a color-rendering index (CRI) of 68.9 and a correlated color temperature (CCT) of 4340 K. The measured frequency response of the SLD revealed a -3 dB bandwidth of 560 MHz, thus demonstrating the feasibility of the device for both solid-state lighting (SSL) and visible-light communication (VLC) applications. © 2016 Optical Society of America.

  9. The Ethical Use of Evidence in Biomedicine.

    Science.gov (United States)

    Pellegrino, Edmund D.

    1999-01-01

    Examines the ethics of data collection and dissemination, suggesting criteria for the morally responsible treatment of evidence collection, dissemination, and use. Comments on the importance of V. Mike's proposal of an "ethics of evidence." (SLD)

  10. Jensen, Jensenism, and the Sociology of Intelligence.

    Science.gov (United States)

    Gottfredson, Linda S.

    1998-01-01

    Describes public controversy over Jensen's work on genetic differences in intelligence as an example of sociopolitical consequences that can accompany the dispersion in "g" (general factor of intelligence) in a society. (Author/SLD)

  11. On Sternberg's "Reply to Gottfredson."

    Science.gov (United States)

    Gottfredson, Linda S.

    2003-01-01

    Comments that R. Sternberg does not address criticisms previously made by L. Gottfredson, but rather discusses his theory of successful intelligence and answers only self-posed objections from unspecified critics. (SLD)

  12. Status of /hacek C/erenkov Ring Imaging systems

    Energy Technology Data Exchange (ETDEWEB)

    Leith, D.W.G.S.

    1987-06-01

    Cerenkov Ring Imaging is briefly introduced, and the problems or choices of designing such a counter are discussed. Recent results from the DELPHI and SLD prototype are presented and compared to the expected performances. 13 refs., 33 figs., 2 tabs.

  13. Resolved: Change Happens.

    Science.gov (United States)

    Hoover, Eric

    2003-01-01

    Describes the increasing interest in high school debate teams among minority group students. Participation in debate, no longer the province of white students alone, can result in increased college admissions, thanks in part to the Urban Debate League. (SLD)

  14. Several Bridges Too Far: A Commentary on Richard S. Prawat's "Dewey Meets the 'Mozart of Psychology' in Moscow: The Untold Story," in "American Educational Research Journal," Fall 2000.

    Science.gov (United States)

    Gredler, Margaret E.; Shields, Carol

    2003-01-01

    Identifies problems with the portrayals by R. Prawat of the reform effort in post-Revolutionary Russia, the career of Lev Vygotsky, the hypothesized exchange of ideas between Vygotsky and John Dewey, and the theoretical views of Vygotsky. (SLD)

  15. The World Is Waiting for the Sunrise: African Americans "yel Mundo Latino."

    Science.gov (United States)

    Widener, Danny

    1998-01-01

    Traces the long and varied history of interaction and collective action by African Americans and Latinos, focusing on common culture and political cooperation. Outlines issues related to the continued cooperation of African Americans and Latinos, and common political projects. (SLD)

  16. Interpreting Research on School Resources and Student Achievement: A Rejoinder to Hanushek.

    Science.gov (United States)

    Greenwald, Rob; Hedges, Larry V.; Laine, Richard

    1996-01-01

    Supports the findings of a meta-analysis that demonstrates that student achievement is related to the availability of resources, disagreeing with criticisms of method and sample selection made by E. Hanushek (1996). (SLD)

  17. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  18. Evaluating Outlier Identification Tests: Mahalanobis "D" Squared and Comrey "Dk."

    Science.gov (United States)

    Rasmussen, Jeffrey Lee

    1988-01-01

    A Monte Carlo simulation was used to compare the Mahalanobis "D" Squared and the Comrey "Dk" methods of detecting outliers in data sets. Under the conditions investigated, the "D" Squared technique was preferable as an outlier removal statistic. (SLD)

  19. Fetterman-House: A Process Use Distinction and a Theory.

    Science.gov (United States)

    Fetterman, David

    2003-01-01

    Discusses the concept of process use as an important distinction between the evaluation theories of E. House and D. Fetterman, thus helping to explain the discordant results of C. Christie for these two theories. (SLD)

  20. Youth and Evaluation: Empowered Social-Change Agents.

    Science.gov (United States)

    Fetterman, David

    2003-01-01

    Summarizes the chapters of this theme issue on youth participatory evaluation. The overarching theme from this collection is the shift from a focus on youth as defective to a view of youth as assets in community development. (SLD)

  1. Design and fabrication of advanced hybrid circuits for high energy physics

    International Nuclear Information System (INIS)

    Haller, G.M.; Moss, J.; Freytag, D.R.; Nelson, D.; Yim, A.; Lo, C.C.

    1987-10-01

    Current design and fabrication techniques of hybrid devices are explained for the Drift Chamber and the Liquid Argon Calorimeter for the Stanford Linear Collider Large Detector (SLD) at SLAC. Methods of developing layouts, ranging from hand-cut templates to advanced designs utilizing CAD tools with special hybrid design software were applied. Physical and electrical design rules for good yield and performance are discussed. Fabrication and assembly of the SLD hybrids are described. 7 refs., 10 figs

  2. IDAL: an interactive analysis language for high energy physics

    International Nuclear Information System (INIS)

    Burnett, T.H.

    1990-01-01

    The SLAC e + e - experiment SLD has adopted a unique off-line software environment, IDA. It provides a command processor shell for all code, from reconstruction and Monte Carlo production to user DST physics analysis. An essential component is an incrementally-compiled language, IDAL. IDAL allows symbolic access to SLD data structures, and supports special loop constructs to allow examination of all banks of a given type. IDAL also recognizes statements that simultaneously define histograms and generate code to fill them

  3. Integrative Analyses of miRNA-mRNA Interactions Reveal let-7b, miR-128 and MAPK Pathway Involvement in Muscle Mass Loss in Sex-Linked Dwarf Chickens

    Science.gov (United States)

    Luo, Wen; Lin, Shumao; Li, Guihuan; Nie, Qinghua; Zhang, Xiquan

    2016-01-01

    The sex-linked dwarf (SLD) chicken is an ideal model system for understanding growth hormone (GH)-action and growth hormone receptor (GHR) function because of its recessive mutation in the GHR gene. Skeletal muscle mass is reduced in the SLD chicken with a smaller muscle fiber diameter. Our previous study has presented the mRNA and miRNA expression profiles of the SLD chicken and normal chicken between embryo day 14 and seven weeks of age. However, the molecular mechanism of GHR-deficient induced muscle mass loss is still unclear, and the key molecules and pathways underlying the GHR-deficient induced muscle mass loss also remain to be illustrated. Here, by functional network analysis of the differentially expressed miRNAs and mRNAs between the SLD and normal chickens, we revealed that let-7b, miR-128 and the MAPK pathway might play key roles in the GHR-deficient induced muscle mass loss, and that the reduced cell division and growth are potential cellular processes during the SLD chicken skeletal muscle development. Additionally, we also found some genes and miRNAs involved in chicken skeletal muscle development, through the MAPK, PI3K-Akt, Wnt and Insulin signaling pathways. This study provides new insights into the molecular mechanism underlying muscle mass loss in the SLD chickens, and some regulatory networks that are crucial for chicken skeletal muscle development. PMID:26927061

  4. Diminished hepatic growth hormone receptor binding in sex-linked dwarf broiler and leghorn chickens.

    Science.gov (United States)

    Leung, F C; Styles, W J; Rosenblum, C I; Lilburn, M S; Marsh, J A

    1987-02-01

    Hepatic growth hormone (GH) receptor binding was compared in normal and sex-linked dwarfs (SLD) from both Hubbard and Cornell strain chickens. At 6, 8, and 20 weeks of age, hepatic GH receptor binding in the Hubbard SLD chickens was significantly lower than that of normal fast-growing birds. At 20 weeks of age, only 2 of 22 SLD chickens in the Hubbard broiler strain showed positive binding at a high enough level to allow for Scatchard analysis. The affinity constants and binding capacities of these two SLD chickens were numerically (but not significantly) lower than those of the normal fast-growing birds. We further examined hepatic GH receptor binding in two closely related White Leghorn strains of chickens that have been maintained as closed breeding populations for many years. We observed no detectable hepatic GH binding in the Cornell SLD chickens (N = 20), as compared to the normal-growing control strain (K strain). In both SLD strains, pretreatment with 4 M MgCl2 did not enhance GH binding, suggesting that there was no endogenous GH binding to the receptor. Based on these data, we suggest that the lack, or greatly reduced number, of GH receptors may be a major contributing factor to the dwarfism observed in these strains.

  5. Specific Learning Disorders: A Look Inside Children's and Parents' Psychological Well-Being and Relationships.

    Science.gov (United States)

    Bonifacci, Paola; Storti, Michele; Tobia, Valentina; Suardi, Alessandro

    2016-09-01

    Despite their ascertained neurobiological origin, specific learning disorders (SLD) often have been found to be associated with some emotional disturbances in children, and there is growing interest in the environmental and contextual variables that may modulate children's developmental trajectories. The present study was aimed at evaluating the psychological profile of parents and children and the relationships between their measures. Parents of children with SLD (17 couples, 34 participants) and parents of children with typical development (17 couples, 34 participants) were administered questionnaires assessing parenting styles, reading history, parenting stress, psychopathological indexes, and evaluations of children's anxiety and depression. Children (N = 34, 10.7 ± 1.2 years) were assessed with self-evaluation questionnaires on anxiety, depression, and self-esteem and with a scale assessing their perception of parents' qualities. Results showed that parents of children with SLD have higher parental distress, poorer reading history, and different parenting styles compared to parents of children with TD; there were no differences in psychopathological indexes. The SLD group also rated their children as more anxious and depressed. Children with SLD had lower scholastic and interpersonal self-esteem, but they report ratings of parents' qualities similar to those of TD children. Relationships between parents' and children's measures were further explored. Implications for research and practice are discussed. © Hammill Institute on Disabilities 2015.

  6. Investigation of distinctive characteristics of children with specific learning disorder and borderline intellectual functioning

    Directory of Open Access Journals (Sweden)

    Selcuk Ozkan

    Full Text Available Abstract Background Borderline intelligence function (BIF and specific learning disorder (SLD are common diagnoses in children who are brought up for learning problems and school failure. Objective The aim of our study was to determine whether there were distinctive aspects of cognitive testing routinely used in evaluating SLD and BIF and investigate emotion regulation skills and minor neurologic symptoms. Method Sixty children (30 SLD and 30 BIF who are currently attending primary school are selected for study. Visual Aural Digit Span Test – Form B, Gessel Figure Drawing Test, Bender Gestalt Visual Motor Perception Test, WISC-R, Emotion Regulation Scale (ERS and Neurological Evaluation Scale (NES was administered. Results There was no statistically significant difference between groups in cognitive tests. The emotional regulation ability measured by the emotional regulation subscale was better in the SLD group than the BIF group (p = 0.014. In the NES, sensory integration (p = 0.008, motor coordination (p = 0.047 and other (p < 0.001 subscales showed higher scores in the BIF group. Discussion It has been shown that cognitive tests don’t have distinguishing features in the evaluation of SLD and BIF. Emotion regulation subscale score of ERS and sensory integration, motor coordination, and total scores of NES can be used in both discrimination of groups.

  7. Single-Residue Sensitivity in Neutron Reflectivity and Resonant X-ray Reflectivity from Langmuir Monolayers of Synthetic Peptides

    Science.gov (United States)

    Strzalka, Joseph; Satija, Sushil; Dimasi, Elaine; Kuzmenko, Ivan; Gog, Thomas; Blasie, J. Kent

    2004-03-01

    Labeling groups with ^2H to distinguish them in the scattering length density (SLD) profile constitutes the chief advantage of neutron reflectivity (NR) in studying Langmuir monolayers (LM) of lipids and proteins. Solid phase synthesis (SPPS) permits the labeling of a single residue in a peptide. Recent work demonstrates the sensitivity of NR to single ^2H-labeled residues in LM of vectorially oriented α -helical bundle peptides. NR requires comparison of isomorphic samples of all-^1H and ^2H-labeled peptides. Alternately, resonant x-ray reflectivity (RXR) uses only one sample. RXR exploits energy-dependent changes in the scattering factor from heavy atoms to distinguish them within the SLD profile. Peptides may be labeled by SPPS (e.g. Br-Phe), or may have inherent labels (e.g. Fe in heme proteins). As test cases, we studied LM of Br-labeled lipids and peptides with RXR. Both approaches require a model-independent means of obtaining SLD profiles from the reflectivity data. We have applied box-refinement to obtain the gradient SLD profile. This is fit uniquely with a sum of Gaussians and integrated analytically [Blasie et al., PRB 67 224201 (2003)] to provide the SLD profile. Label positions can then be determined to sub-Ångstrom accuracy. This work supported by the NIH (GM55876).

  8. Analysis of time of death of prenatally lethal Steeloid mutations

    International Nuclear Information System (INIS)

    Rinchik, E.M.; Cummings, C.C.; Bangham, J.W.; Hunsicker, P.R.; Phipps, E.L.; Stelzner, K.F.

    1987-01-01

    Deletion mutations have been extremely useful in initiating the functional and molecular dissections of regions of the mouse genome. For the d-se and c regions, for example, it was observed that radiation mutations carrying lethal factors separable, by complementation analysis, from the primary d, se, or c mutation itself, could often be associated at both the genetic and molecular levels with multilocus chromosomal deletions. Since many of the Oak Ridge Sld mutations arose in radiation mutagenesis experiments, a substantial number may carry chromosomal deletions that involve the Sl locus in chromosome 10. Because of the great value of deletion mutations for the genetic and molecular analysis of chromosomal regions and complex genetic loci, they have initiated a series of experiments designed to test whether radiation-induced Sld mutations carry other lethal factors, in addition to the lethality caused by severe alleles of the Sl locus itself, as one prescreen for identifying Sld's that are caused by deletions

  9. Theory of elementary particles and accelerator theory: Task C: Experimental high energy physics

    International Nuclear Information System (INIS)

    Brau, J.E.

    1992-01-01

    The experimental high energy physics group at the University of Oregon broadened its effort during the past year. The SLD effort extends from maintaining and operating the SLD luminosity monitor which was built at Oregon, to significant responsibility in physics analysis, such as event selection and background analysis for the left-right asymmetry measurement. The OPAL work focussed on the luminosity monitor upgrade to a silicon-tungsten calorimeter. Building on the work done at Oregon for SLD, the tungsten for this upgrade was machined by the Oregon shops and shipped to CERN for assembly. The Oregon GEM effort now concentrates on tracking, specifically silicon tracking. Oregon also has developed a silicon strip preradiator prototype, and tested it in a Brookhaven beam

  10. Second Line of Defense Spares Program Assessment

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, Dale L.; Muller, George; Mercier, Theresa M.; Brigantic, Robert T.; Perkins, Casey J.; Cooley, Scott K.

    2012-11-20

    The Office of the Second Line of Defense (SLD) is part of the Department of Energy‘s (DOE) National Nuclear Security Administration (NNSA). The SLD Program accomplishes its critical global security mission by forming cooperative relationships with partner countries to install passive radiation detection systems that augment traditional inspection and law enforcement measures by alerting border officials to the presence of special nuclear or other radiological materials in cross-border traffic. An important tenet of the program is to work collaboratively with these countries to establish the necessary processes, procedures, infrastructure and conditions that will enable them to fully assume the financial and technical responsibilities for operating the equipment. As the number of operational deployments grows, the SLD Program faces an increasingly complex logistics process to promote the timely and efficient supply of spare parts.

  11. Corpus–Based Lexicographical Descriptions with a Special Focus on Pragmatics: The Case of the Slovene Lexical Database

    Directory of Open Access Journals (Sweden)

    Mojca Šorli

    2013-05-01

    Full Text Available The present paper focuses on ways in which the pragmatic (functional meaning that arises from various contextual features, known in corpus linguistics as semantic prosody, can become an integral part of lexicographical descriptions as they are represented in the Slovene Lexical Database (SLD. This is particularly important for the treatment of phraseology and idiomatics. First, the theoretical background is provided, with the focus on the prototype theory and its practical implications for monolingual lexicography. A parallel is drawn with the model of meaning analysis in the SLD. The second part begins with a brief introduction to semantic prosody and continues with an analysis of monolingual meaning descriptions in the SLD against a number of authentic corpus examples, investigating how their pragmatic components have been identified. The analysis of corpus data shows that pragmatics is an important contributor to the process of sense discrimination in works of lexical and lexicographic relevance.

  12. Review of SLC performance

    International Nuclear Information System (INIS)

    Phinney, N.

    1992-08-01

    The SLAC Linear Collider (SLC) has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper will discuss the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high-current, low-emittance beams and focusing the beams to the micron scale for collisions

  13. The SLAC linear collider

    International Nuclear Information System (INIS)

    Phinney, N.

    1992-01-01

    The SLAC Linear Collider has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper discusses the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high current, low emittance beams and focusing the beams to the micron scale for collisions. (Author) tab., 2 figs., 18 refs

  14. Elementary particle interactions. Progress report, October 1, 1994--September 30, 1995

    International Nuclear Information System (INIS)

    Bugg, W.M.; Condo, G.T.; Handler, T.; Hart, E.L.; Read, K.; Siopsis, G.; Ward, B.F.L.

    1995-10-01

    This year has been a busy and demanding one with completion of a long SLD run, much progress on light quark states from E-687 resulting in strong evidence for two new states, observation in E-144 of non-linear Compton scattering (multiphoton absorption by electrons) up to N-4 and initial evidence for e + e - pair production in Compton process. The authors have also made considerable progress toward preparation for a n-bar n oscillation experiment and have carried out experimental studies of quartz fiber calorimetry for SLD polarimeter and forward calorimeter for CMS and LHC including a thorough set of gamma ray and neutron radiation damage studies on quartz fiber. Two graduate students received their Ph.D.s this year, Kathy Danyo Blackett on data from Fermilab E-687 and Sharon White on SLD radiative Bhabha scattering

  15. Insights into the Initiation of Eukaryotic DNA Replication.

    Science.gov (United States)

    Bruck, Irina; Perez-Arnaiz, Patricia; Colbert, Max K; Kaplan, Daniel L

    2015-01-01

    The initiation of DNA replication is a highly regulated event in eukaryotic cells to ensure that the entire genome is copied once and only once during S phase. The primary target of cellular regulation of eukaryotic DNA replication initiation is the assembly and activation of the replication fork helicase, the 11-subunit assembly that unwinds DNA at a replication fork. The replication fork helicase, called CMG for Cdc45-Mcm2-7, and GINS, assembles in S phase from the constituent Cdc45, Mcm2-7, and GINS proteins. The assembly and activation of the CMG replication fork helicase during S phase is governed by 2 S-phase specific kinases, CDK and DDK. CDK stimulates the interaction between Sld2, Sld3, and Dpb11, 3 initiation factors that are each required for the initiation of DNA replication. DDK, on the other hand, phosphorylates the Mcm2, Mcm4, and Mcm6 subunits of the Mcm2-7 complex. Sld3 recruits Cdc45 to Mcm2-7 in a manner that depends on DDK, and recent work suggests that Sld3 binds directly to Mcm2-7 and also to single-stranded DNA. Furthermore, recent work demonstrates that Sld3 and its human homolog Treslin substantially stimulate DDK phosphorylation of Mcm2. These data suggest that the initiation factor Sld3/Treslin coordinates the assembly and activation of the eukaryotic replication fork helicase by recruiting Cdc45 to Mcm2-7, stimulating DDK phosphorylation of Mcm2, and binding directly to single-stranded DNA as the origin is melted.

  16. Second Line of Defense: Electronic Maintenance Reports, Local Maintenance Provider User Guide, Rev. 3

    Energy Technology Data Exchange (ETDEWEB)

    Leigh, Richard J.

    2012-09-01

    The Electronic Maintenance Report forms allow Local Maintenance Providers (LMP) and other program staff to enter maintenance information into a simple and secure system. This document describes the features and information required to complete the Maintenance Report forms. It is expected that all Corrective Maintenance Reports from LMPs will be submitted electronically into the SLD Portal. As an exception (e.g., when access to the SLD Portal is unavailable), Maintenance Reports can be submitted via a secure Adobe PDF form available through the Sustainability Manager assigned to each country.

  17. Leishmania donovani isolates with antimony-resistant but not -sensitive phenotype inhibit sodium antimony gluconate-induced dendritic cell activation.

    Directory of Open Access Journals (Sweden)

    Arun Kumar Haldar

    2010-05-01

    Full Text Available The inability of sodium antimony gluconate (SAG-unresponsive kala-azar patients to clear Leishmania donovani (LD infection despite SAG therapy is partly due to an ill-defined immune-dysfunction. Since dendritic cells (DCs typically initiate anti-leishmanial immunity, a role for DCs in aberrant LD clearance was investigated. Accordingly, regulation of SAG-induced activation of murine DCs following infection with LD isolates exhibiting two distinct phenotypes such as antimony-resistant (Sb(RLD and antimony-sensitive (Sb(SLD was compared in vitro. Unlike Sb(SLD, infection of DCs with Sb(RLD induced more IL-10 production and inhibited SAG-induced secretion of proinflammatory cytokines, up-regulation of co-stimulatory molecules and leishmanicidal effects. Sb(RLD inhibited these effects of SAG by blocking activation of PI3K/AKT and NF-kappaB pathways. In contrast, Sb(SLD failed to block activation of SAG (20 microg/ml-induced PI3K/AKT pathway; which continued to stimulate NF-kappaB signaling, induce leishmanicidal effects and promote DC activation. Notably, prolonged incubation of DCs with Sb(SLD also inhibited SAG (20 microg/ml-induced activation of PI3K/AKT and NF-kappaB pathways and leishmanicidal effects, which was restored by increasing the dose of SAG to 40 microg/ml. In contrast, Sb(RLD inhibited these SAG-induced events regardless of duration of DC exposure to Sb(RLD or dose of SAG. Interestingly, the inhibitory effects of isogenic Sb(SLD expressing ATP-binding cassette (ABC transporter MRPA on SAG-induced leishmanicidal effects mimicked that of Sb(RLD to some extent, although antimony resistance in clinical LD isolates is known to be multifactorial. Furthermore, NF-kappaB was found to transcriptionally regulate expression of murine gammaglutamylcysteine synthetase heavy-chain (mgammaGCS(hc gene, presumably an important regulator of antimony resistance. Importantly, Sb(RLD but not Sb(SLD blocked SAG-induced mgammaGCS expression in DCs by

  18. On the application of thermodynamics of corrosion for service life design of concrete structures

    DEFF Research Database (Denmark)

    Küter, Andre; Geiker, Mette Rica; Møller, Per

    2010-01-01

    There are unexploited possibilities in the application of thermodynamics of corrosion for service life design (SLD) of concrete structures. Thermodynamics provides means for insightful descriptions of corrosion mechanisms and of corrosion protection mechanisms. Strategies for corrosion protection...... of the application of thermodynamics for SLD and gives examples of two applications: description of corrosion processes and design of countermeasures. Emphasis is set on chloride induced corrosion....... can be based on thermodynamically consistent corrosion mechanisms and evaluation of existing and design of new countermeasures can be performed using thermodynamics. Similarly, materials concepts for embedded electrodes can be designed using thermodynamics. The present paper provides a brief outline...

  19. Unselective regrowth buried heterostructure long-wavelength superluminescent diode realized with MOVPE

    Energy Technology Data Exchange (ETDEWEB)

    Ding Ying [Institute of Semiconductors, Chinese Academy of Sciences, Beijing 100083 (China)]. E-mail: yingding@red.semi.ac.cn; Zhou Fan [Institute of Semiconductors, Chinese Academy of Sciences, Beijing 100083 (China); Chen Weixi [School of Physics, Peking University, Beijing 100871 (China); Wang Wei [Institute of Semiconductors, Chinese Academy of Sciences, Beijing 100083 (China)

    2007-01-15

    A novel unselective regrowth buried heterostructure (BH) long-wavelength superluminescent diode (SLD), which has a grade-strained bulk InGaAs active region, was developed by metalorganic vapor-phase epitaxy (MOVPE). The 3 dB emission spectrum bandwidth of the SLD is about 65 nm with the range from 1596 to 1661 nm at 90 mA and from 1585 to 1650 nm at 150 mA.An output power of 3.5 mW is obtained at 200 mA injection current under CW operation at room temperature.

  20. The production of π±, K±, p, k0 and Λ0 in hadronic Z0 decays

    International Nuclear Information System (INIS)

    Baird, K.

    1995-08-01

    The authors have measured production fractions and spectra for π ± , K ± and p, and production spectra for K 0 and Λ 0 in both hadronic Z 0 decays and a Z 0 → light quark (uds) subset at SLD. The SLD Cherenkov Ring Imaging Detector was used to identify charged hadrons. The CCD vertex detector was used to select the enriched uds sample. For the global sample, the results are consistent with previous experiments. The authors observe a clear flavor dependence in production spectra, but only a small effect in hadron fractions and ξ = ln(1/x p ) peak positions

  1. Inclusive search for b → sg

    International Nuclear Information System (INIS)

    1998-07-01

    The authors describe an inclusive search for flavor changing neutral current decays of the type b → s gluon in the SLD experiment. Models of b → sg indicate that the production of high momentum kaons is enhanced over background from standard B decays. If the branching ratio for b → sg is ∼ 10%, then such an enhancement should have a good signal to background ratio. The analysis makes use of the particle identification and high precision vertexing capabilities of SLD to search for such an enhancement. The data sample consists of 300K hadronic Z 0 decays collected between 1993 and 1997

  2. Histories and Horoscopes: The Ethnographer as Fortune-Teller.

    Science.gov (United States)

    Hamilton, Mary

    1998-01-01

    Focuses on different ways participants in a research project may understand the research and use it themselves by describing how 20 adult students and 14 community members, participants in a recent ethnographic study of adult literacy in England, responded to the invitation to collaborate with researchers in interpreting interview data. (SLD)

  3. An Artist in the University Medical Center. Review.

    Science.gov (United States)

    James, A. Everette, Jr.

    1991-01-01

    Reviews "An Artist in the University Medical Center" (M. Lesser, New Orleans: Tulane University Press, 1989), in which the artist captures the human side of the complex Tulane Medical Center in New Orleans (Louisiana). The interplay of drawings, etchings, watercolors, and prose conveys traditions of nurturing in the hospital. (SLD)

  4. Computer-Assisted Mathematics Instruction for Students with Specific Learning Disability: A Review of the Literature

    Science.gov (United States)

    Stultz, Sherry L.

    2017-01-01

    This review was conducted to evaluate the current body of scholarly research regarding the use of computer-assisted instruction (CAI) to teach mathematics to students with specific learning disability (SLD). For many years, computers are utilized for educational purposes. However, the effectiveness of CAI for teaching mathematics to this specific…

  5. An α-Helical Core Encodes the Dual Functions of the Chlamydial Protein IncA*

    Science.gov (United States)

    Ronzone, Erik; Wesolowski, Jordan; Bauler, Laura D.; Bhardwaj, Anshul; Hackstadt, Ted; Paumet, Fabienne

    2014-01-01

    Chlamydia is an intracellular bacterium that establishes residence within parasitophorous compartments (inclusions) inside host cells. Chlamydial inclusions are uncoupled from the endolysosomal pathway and undergo fusion with cellular organelles and with each other. To do so, Chlamydia expresses proteins on the surface of the inclusion using a Type III secretion system. These proteins, termed Incs, are located at the interface between host and pathogen and carry out the functions necessary for Chlamydia survival. Among these Incs, IncA plays a critical role in both protecting the inclusion from lysosomal fusion and inducing the homotypic fusion of inclusions. Within IncA are two regions homologous to eukaryotic SNARE (soluble N-ethylmaleimide-sensitive factor attachment receptor) domains referred to as SNARE-like domain 1 (SLD1) and SNARE-like domain 2 (SLD2). Using a multidisciplinary approach, we have discovered the functional core of IncA that retains the ability to both inhibit SNARE-mediated fusion and promote the homotypic fusion of Chlamydia inclusions. Circular dichroism and analytical ultracentrifugation experiments show that this core region is composed almost entirely of α-helices and assembles into stable homodimers in solution. Altogether, we propose that both IncA functions are encoded in a structured core domain that encompasses SLD1 and part of SLD2. PMID:25324548

  6. An α-helical core encodes the dual functions of the chlamydial protein IncA.

    Science.gov (United States)

    Ronzone, Erik; Wesolowski, Jordan; Bauler, Laura D; Bhardwaj, Anshul; Hackstadt, Ted; Paumet, Fabienne

    2014-11-28

    Chlamydia is an intracellular bacterium that establishes residence within parasitophorous compartments (inclusions) inside host cells. Chlamydial inclusions are uncoupled from the endolysosomal pathway and undergo fusion with cellular organelles and with each other. To do so, Chlamydia expresses proteins on the surface of the inclusion using a Type III secretion system. These proteins, termed Incs, are located at the interface between host and pathogen and carry out the functions necessary for Chlamydia survival. Among these Incs, IncA plays a critical role in both protecting the inclusion from lysosomal fusion and inducing the homotypic fusion of inclusions. Within IncA are two regions homologous to eukaryotic SNARE (soluble N-ethylmaleimide-sensitive factor attachment receptor) domains referred to as SNARE-like domain 1 (SLD1) and SNARE-like domain 2 (SLD2). Using a multidisciplinary approach, we have discovered the functional core of IncA that retains the ability to both inhibit SNARE-mediated fusion and promote the homotypic fusion of Chlamydia inclusions. Circular dichroism and analytical ultracentrifugation experiments show that this core region is composed almost entirely of α-helices and assembles into stable homodimers in solution. Altogether, we propose that both IncA functions are encoded in a structured core domain that encompasses SLD1 and part of SLD2. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. School Finance: Fifty Years of Expansion.

    Science.gov (United States)

    Guthrie, James W.

    1997-01-01

    Analyzes the increases in per-pupil expenditures in elementary and secondary education since World War II and discusses factors contributing to the increase. A significant cause is the 86% inflation-adjusted increase in teacher salaries between 1949-50 and 1971-72, although teacher salaries have increased little since that time. (SLD)

  8. Assessing High Order Thinking of Students Participating in the "WISE" Project in Israel.

    Science.gov (United States)

    Tal, Revital; Hochberg, Nurit

    2003-01-01

    Studied the higher order thinking of 53 Israeli ninth graders in 3 schools using the Web-Based Inquiry Science Environment (WISE) learning environment to study about malaria. Findings show that all students used higher order thinking skills and that their English was good enough to use the WISE learning environment in the Israeli setting. (SLD)

  9. Self-Assessment in Coursework Essays.

    Science.gov (United States)

    Longhurst, Nigel; Norton, Lin S.

    1997-01-01

    Self-assessments of coursework essays were compared with tutor grades for 67 college students. Students could accurately assess their overall essay grades and could give an overall rank for deep processing, but when judging essays on individual criteria they were not so accurate when compared to tutor evaluations. (SLD)

  10. Second-Grade Journeys on the Underground Railroad.

    Science.gov (United States)

    Crump-Stenberg, Linda; Beilke, Patricia F.

    1999-01-01

    Describes a curriculum used in a second grade classroom to expose the predominantly white students to the culture and experiences of African Americans through a study of slavery and the Underground Railroad. Includes a bibliography of African folk tales and literature related to the African American experience. (SLD)

  11. The Bulimia Test--Revised: Validation with "DSM-IV" Criteria for Bulimia Nervosa.

    Science.gov (United States)

    Thelen, Mark H.; And Others

    1996-01-01

    The Bulimia Test--Revised (BULIT-R) was given to 23 female subjects who met the criteria for bulimia in the "Diagnostic and Statistical Manual of Mental Disorders" (DSM-IV) and 124 female controls. The BULIT-R appears to be a valid instruction for identifying individuals who meet DSM-IV criteria for bulimia. (SLD)

  12. Underdevelopment in the U.S. Labor Market: The Case of African American Female Workers.

    Science.gov (United States)

    Ajanaku, Femi I.; And Others

    1991-01-01

    The work experience of the African-American woman is often overlooked. In this article, the development/underdevelopment model, usually applied to the depressed situation of the Third World, is used to assess the dynamics of race, class, and gender for African-American females in the labor market. (SLD)

  13. The Inside Story. Counseling for Tolerance in the Early Years Means Paying Attention to the Way Children Think and Feel about the World--and Themselves.

    Science.gov (United States)

    Aronson, David

    1995-01-01

    School counselors have developed effective approaches to reducing prejudice in the crucial early school years. Successful early intervention is based on the premise that hatred and prejudice are tools of the subconscious to ease feelings of inferiority through the illusion of superiority. (SLD)

  14. Boys Will Be Boys.

    Science.gov (United States)

    Broude, Gwen J.

    1999-01-01

    Many psychologists assert that boys are in dire straits in U.S. society, but in fact, there is no evidence of an emotional or behavioral epidemic for either sex. If there is any truth to the claim that boys are in trouble, it results from practices that foster aggression. It is a mistake to regard either gender as "fragile." (SLD)

  15. The Teacher as Applied Measurer: Realities of Classroom Measurement and Assessment.

    Science.gov (United States)

    Airasian, Peter W.; Jones, Ann M.

    1993-01-01

    The perspective of classroom measurement and assessment is broadened by providing a general description of classroom context and the measurements and assessments teachers use. A particular focus is how informal assessment is used to inform daily classroom decisions, and how these decisions spill over into formal measurement and assessment. (SLD)

  16. Understanding the Strengths of African American Families.

    Science.gov (United States)

    Littlejohn-Blake, Sheila M.; Darling, Carol Anderson

    1993-01-01

    Focuses on strengths of African-American families and how they function, relevant conceptual approaches, and trends and issues in studying African-American families that can facilitate understanding. A shift from studying dysfunctional families to more positive aspects can help African-American families meet societal challenges. (SLD)

  17. The Changing Role of School Psychologists in School-Wide Models of Response to Intervention

    Science.gov (United States)

    Landry, Dena F.

    2012-01-01

    The reauthorization of the Individuals with Disabilities Education Act (IDEA 2004) allows states the use of a process based on a child's response to scientific, research-based intervention as a means to assist in the determination of a specific learning disability (SLD). As a result, the traditional role of the school psychologist as a test…

  18. Compulsory Schooling, Child Study, Clinical Psychology, and Special Education: Origins of School Psychology.

    Science.gov (United States)

    Fagan, Thomas K.

    1992-01-01

    Discusses the history of school psychology, emphasizing the work of L. Witmer (1897, 1907, 1910, 1922) and G. S. Hall (1911, 1923). Providing psychological services in the schools is among the earliest instances of applied psychology. School psychology was one of many child-saving services originating from 1890 to 1920. (SLD)

  19. Life Imitates Pokemon: The Virtues and Necessities of Technology-Based Peer Education in Today's Schools.

    Science.gov (United States)

    Bloomfield, David

    1999-01-01

    As the Pokemon game craze illustrates, the combination of peer education and technology makes for powerful educational experiences. Educators need to accept technology-based peer education as a help rather than a hindrance to improve educational outcomes for students. (SLD)

  20. Genetic and Environmental Contributions to Cranial Capacity in Black and White Adolescents.

    Science.gov (United States)

    Rushton, J. Philippe; Osborne, R. Travis

    1995-01-01

    Data from 236 pairs of black twins and white twins aged 13-17 years were used to examine genetic and environmental factors influencing cranial size, an indirect estimate of brain volume. Genetic factors are required to account for the phenotypic variance in cranial capacity. (SLD)

  1. A Comparison of the Child-Rearing Goals of Russian and U.S. University Students.

    Science.gov (United States)

    Williams, Dannon; Ispa, Jean M.

    1999-01-01

    Examined the importance of four child-rearing goals rated by 77 Russian and 53 U.S. college students. Russians placed a lower value on rule conformity and a higher value on peer orientation and neatness/cleanliness. Both groups rated inquisitiveness as most important among the four goals evaluated. (SLD)

  2. Child Maltreatment and School Performance Declines: An Event-History Analysis.

    Science.gov (United States)

    Leiter, Jeffrey; Johnsen, Matthew C.

    1997-01-01

    Presents a longitudinal analysis of school performance declines among neglected and abused children, using the maltreatment and school histories of 1,369 children in Mecklenburg County, North Carolina. Significant relationships between maltreatment and declines in performance were found in diverse school outcomes. (SLD)

  3. Female and Male Perceptions of Ideal Body Shapes: Distorted Views among Caucasian College Students.

    Science.gov (United States)

    Cohn, Lawrence D.; Adler, Nancy E.

    1992-01-01

    Using body silhouettes, 87 college women and 118 college men indicated their own body shapes and shapes they and same-sex and other-sex peers find most attractive. Focus was on whether women overestimate desirability of thin figures among female peers. Males and females misjudged same-sex peers' preferences compared with ideals. (SLD)

  4. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  5. Fitting ARMA Time Series by Structural Equation Models.

    Science.gov (United States)

    van Buuren, Stef

    1997-01-01

    This paper outlines how the stationary ARMA (p,q) model (G. Box and G. Jenkins, 1976) can be specified as a structural equation model. Maximum likelihood estimates for the parameters in the ARMA model can be obtained by software for fitting structural equation models. The method is applied to three problem types. (SLD)

  6. Where Do We Go from Here?: Post-High School Choices of American Men.

    Science.gov (United States)

    Owens, Timothy J.

    1992-01-01

    Presents a post-high school context choice schema that attempts to identify the factors that lead young U.S. males to enter the work force, the military, or college. Data are from the Youth in Transition Study, a longitudinal study beginning in 1966. Twenty-five potentially important predictors are identified. (SLD)

  7. Afra-Hispanic Writers and Feminist Discourse.

    Science.gov (United States)

    DeCosta-Willis, Miriam

    1993-01-01

    Explores Afra-Hispanic literature, the writing of black Spanish-speaking women of the Caribbean and Central and South America. The literary texts of Afra-Hispanic women reveal an emerging feminist consciousness. A more detailed analysis is given of the poetry of Virginia Brindis de Salas and Aida Cartagena Portalatin. (SLD)

  8. Construct Validity of Neuropsychological Tests in Schizophrenia.

    Science.gov (United States)

    Allen, Daniel N.; Aldarondo, Felito; Goldstein, Gerald; Huegel, Stephen G.; Gilbertson, Mark; van Kammen, Daniel P.

    1998-01-01

    The construct validity of neuropsychological tests in patients with schizophrenia was studied with 39 patients who were evaluated with a battery of six tests assessing attention, memory, and abstract reasoning abilities. Results support the construct validity of the neuropsychological tests in patients with schizophrenia. (SLD)

  9. The Status of the Mastitubari.

    Science.gov (United States)

    Lei-Lanilau, Carolyn; Peyton-Caire, Lisa; Perkins, Judith

    2000-01-01

    This kinesthetic piece evokes and provokes the reader into a visceral experience that transfers the internal emotional reactions of women of color as they face a world that does not value their worth as leaders. Explores issues of leadership through parallels with masturbation. (Author/SLD)

  10. Going Native in the Academy: Choosing the Exotic over the Critical.

    Science.gov (United States)

    Marker, Michael

    1998-01-01

    Examines some of the problems and contradictions that arise when nonnative instructors attempt to perform aboriginal ceremonies and rituals in the higher-education classroom. Such practices often promote an indulgence in the exotic, rather than taking a more genuine approach to the history and reality of native people. (SLD)

  11. Color Blindness and Basket Making Are Not the Answers: Confronting the Dilemmas of Race, Culture, and Language Diversity in Teacher Education.

    Science.gov (United States)

    Cochran-Smith, Marilyn

    1995-01-01

    Better strategies for teaching multicultural education and lessons about non-Anglo cultures are not what is needed in teacher education. Instead, generative ways are needed for teachers to explore their own assumptions and to construct pedagogy that takes into account the values and practices of cultures different from their own. (SLD)

  12. Resiliency Programming for Adult Offenders in Georgia.

    Science.gov (United States)

    Rees, E. Frances

    2000-01-01

    Discusses resiliency programming as an alternative approach to program development for incarcerated adults, and describes a pilot project in a Georgia prison, Leadership Development, that uses the concept of resiliency to frame inmate education. Discusses implications of this model of correctional education. (SLD)

  13. An Exploratory Study of Parents' Perceived Educational Needs for Parenting a Child with Learning Disabilities

    Directory of Open Access Journals (Sweden)

    Wai-Tong Chien, PhD

    2013-03-01

    Conclusion: Our findings indicate a few important educational needs of parents in caring for a child with SLD that might be underestimated by mental health professionals and teachers, such as psychological support and information needs. To facilitate effective parenting, holistic and individualized needs assessment and education should be provided to address each parent's biopsychosocial and cultural needs in relation to caregiving.

  14. The Impact of Affiliate Stigma on the Psychological Well-Being of Mothers of Children with Specific Learning Disabilities in India: The Mediating Role of Subjective Burden

    Science.gov (United States)

    Banga, Gazal; Ghosh, Subharati

    2017-01-01

    Background: Knowledge of the impact of affiliate stigma on the wellbeing of caregivers to children with specific learning disability (SLD) in India is limited. To fill in this gap in knowledge a cross-sectional quantitative study was undertaken to assess the impact of affiliate stigma on the psychological well-being of mothers with children with…

  15. Extended Year, Extended Contracts: Increasing Teacher Salary Options.

    Science.gov (United States)

    Gandara, Patricia

    1992-01-01

    Reports on an attempt to raise teacher salaries through an extended contract made possible through year-round school schedules. Teacher satisfaction with the 1987 experiment in three California schools (the Orchard Plan) has been high. Elements that have contributed to job satisfaction are discussed. (SLD)

  16. Second Line of Defense Spares Program

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, Dale L.; Holmes, Aimee E.; Muller, George; Mercier, Theresa M.; Brigantic, Robert T.; Perkins, Casey J.; Cooley, Scott K.; Thorsen, Darlene E.

    2012-11-20

    During Fiscal Year 2012, a team from the Pacific Northwest National Laboratory (PNNL) conducted an assessment and analysis of the Second Line of Defense (SLD) Sustainability spare parts program. Spare parts management touches many aspects of the SLD Sustainability Program including contracting and integration of Local Maintenance Providers (LMP), equipment vendors, analyses and metrics on program performance, system state of health, and maintenance practices. Standardized spares management will provide better data for decisions during site transition phase and will facilitate transition to host country sustainability ownership. The effort was coordinated with related SLD Sustainability Program initiatives, including a configuration items baselining initiative, a metrics initiative, and a maintenance initiative. The spares study has also led to pilot programs for sourcing alternatives that include regional intermediate inventories and partnering agreements that leverage existing supply chains. Many partners from the SLD Sustainability program contributed to and were consulted in the course of the study. This document provides a description of the findings, recommendations, and implemented solutions that have resulted from the study.

  17. An Empirical Bayes Approach to Mantel-Haenszel DIF Analysis.

    Science.gov (United States)

    Zwick, Rebecca; Thayer, Dorothy T.; Lewis, Charles

    1999-01-01

    Developed an empirical Bayes enhancement to Mantel-Haenszel (MH) analysis of differential item functioning (DIF) in which it is assumed that the MH statistics are normally distributed and that the prior distribution of underlying DIF parameters is also normal. (Author/SLD)

  18. Using Loss Functions for DIF Detection: An Empirical Bayes Approach.

    Science.gov (United States)

    Zwick, Rebecca; Thayer, Dorothy; Lewis, Charles

    2000-01-01

    Studied a method for flagging differential item functioning (DIF) based on loss functions. Builds on earlier research that led to the development of an empirical Bayes enhancement to the Mantel-Haenszel DIF analysis. Tested the method through simulation and found its performance better than some commonly used DIF classification systems. (SLD)

  19. Heavy Flavor Decays of the Z0 and a Search for Flavor Changing Neutral Currents

    Energy Technology Data Exchange (ETDEWEB)

    Walston, S

    2004-06-22

    Presented here are the results of a direct search for flavor changing neutral currents via the rare process Z{sup 0} {yields} bs and a measurement of R{sub bs} = {Lambda}(Z{sup 0} {yields} bs)/{Lambda}(Z{sup 0} {yields} hadrons). Because the decays Z{sup 0} {yields} b{bar b} and Z{sup 0} {yields} c{bar c} contribute significant backgrounds to Z{sup 0} {yields} bs, simultaneous measurements of R{sub b} = {Lambda}(Z{sup 0} {yields} b{bar b})/{Lambda}(Z{sup 0} {yields} hadrons) and R{sub c} = {Lambda}(Z{sup 0} {yields} c{bar c})/{Lambda}(Z{sup 0} {yields} hadrons) were also made. The standard double tag technique was extended and self calibrating tags were used for s, c, and b quarks. These measurements were made possible by the unique capabilities of the SLAC Large Detector (SLD) at the Stanford Linear Accelerator Center (SLAC): The b and c tags relied upon the SLD's VXD3 307 megapixel CCD vertex detector for topological and kinematic reconstruction of the B and D decay vertices; the s tag identified K{sup {+-}} mesons using the particle identification capabilities of SLD's Cherenkov Ring Imaging Detector (CRID), and K{sub S}{sup 0} mesons and {Lambda} hadrons by kinematic reconstruction of their decay vertices in SLD's 5120 channel central drift chamber (CDC) particle tracking system.

  20. Elementary particle physics and high energy phenomena. Final technical report

    International Nuclear Information System (INIS)

    Barker, A.R.; Cumalat, J.P.; Alwis, S.P. de; Degrand, T.A.; Ford, W.T.; Mahanthappa, K.T.; Nauenberg, U.; Rankin, P.; Smith, J.G.

    1996-06-01

    This report covers progress made by Experimental Group 1 (Task A1). Brief summaries are given for the research in each of the following areas: (1) study of the properties of the Z 0 with the SLD detector; (2) the KTeV project: studies of CP violation; (4) detector development activities; (5) the B-Factory program; and (6) the NLC program

  1. A Split-Attention Effect in Multimedia Learning: Evidence for Dual Processing Systems in Working Memory.

    Science.gov (United States)

    Mayer, Richard E.; Moreno, Roxana

    1998-01-01

    Multimedia learners (n=146 college students) were able to integrate words and computer-presented pictures more easily when the words were presented aurally rather than visually. This split-attention effect is consistent with a dual-processing model of working memory. (SLD)

  2. Surface versus Edge-Based Determinants of Visual Recognition.

    Science.gov (United States)

    Biederman, Irving; Ju, Ginny

    1988-01-01

    The latency at which objects could be identified by 126 subjects was compared through line drawings (edge-based) or color photography (surface depiction). The line drawing was identified about as quickly as the photograph; primal access to a mental representation of an object can be modeled from an edge-based description. (SLD)

  3. Brain Size and Cerebral Glucose Metabolic Rate in Nonspecific Retardation and Down Syndrome.

    Science.gov (United States)

    Haier, Richard J.; And Others

    1995-01-01

    Brain size and cerebral glucose metabolic rate were determined for 10 individuals with mild mental retardation (MR), 7 individuals with Down syndrome (DS), and 10 matched controls. MR and DS groups both had brain volumes of about 80% compared to controls, with variance greatest within the MR group. (SLD)

  4. Comments on "Brain Size and Cerebral Glucose Metabolic Rate in Nonspecific Mental Retardation and Down Syndrome."

    Science.gov (United States)

    Willerman, Lee; Schultz, Robert T.

    1995-01-01

    The relationship between mental retardation and brain size is discussed. Research suggests that a common path for many otherwise idiopathic mild retardation cases (genetic or environmental) could be small brain size, indicating reduced information processing capacity. Suggestions are made for further research on neuron number. (SLD)

  5. The Influence of Hemispheric Dominance on Scores of the Myers-Briggs Type Indicator.

    Science.gov (United States)

    Hartman, Steve E.; And Others

    1997-01-01

    Results for 75 medical students and 248 undergraduates suggest that the Myers-Briggs Type Indicator appears to sample only 3 bipolar personality dimensions rather than the 4 that the use of "type tables" implies. One of these dimensions shares substantial variance with the cognitive model of hemispheric dominance. (SLD)

  6. Evaluation of HIV Risk Reduction and Intervention Programs via Latent Growth Model.

    Science.gov (United States)

    Wang, Jichuan; Siegal, Harvey A.; Falck, Russel S.; Carlson, Robert G.; Rahman, Ahmmed

    1999-01-01

    Demonstrates how the latent growth model can be applied to the evaluation of programs targeting HIV risk behavior among drug users. Multigroup piecewise latent growth models were fit to longitudinal data with three repeated response measures. Participants were 430 drug users and their sex partners. (SLD)

  7. A Cross-Cultural Study of Self-Report Depressive Symptoms among College Students.

    Science.gov (United States)

    Crittenden, Kathleen S.; And Others

    1992-01-01

    A study of self-report depressive symptoms measured by the Zung Self-Rating Depression Scale was conducted in Korea, the Philippines, Taiwan, and the United States with 953 college students. There are marked differences among countries in symptoms reported. Research designs and measurement strategies for cross-cultural research are discussed. (SLD)

  8. Work, Immigration, Gender: New Subjects of Cultural Politics.

    Science.gov (United States)

    Lowe, Lisa

    1998-01-01

    Discusses the construction of Asian immigrant women's work in the context of the "racialized feminization of labor" in the global restructuring of capitalism. Illustrates the intersection of work, immigration, and gender through a discussion of Asian female garment workers in the United States. (SLD)

  9. Feminist Theory and the Media Representation of a Woman-of-Color Superintendent: Is the World Ready for Cyborgs?

    Science.gov (United States)

    Nozaki, Yoshiko

    2000-01-01

    Discusses recent feminist theory, in particular feminist theory related to "cyborg" identity and examines some media representations of a woman-of-color superintendent. Suggests that the cyborg image offers alternative ways to consider the issue of diversity and educational leadership, including the superintendency. (Author/SLD)

  10. The Demonstration of Short-Term Consolidation.

    Science.gov (United States)

    Jolicoeur, Pierre; Dell'Acqua, Roberto

    1998-01-01

    Results of seven experiments involving 112 college students or staff using a dual-task approach provide evidence that encoding information into short-term memory involves a distinct process termed short-term consolidation (STC). Results suggest that STC has limited capacity and that it requires central processing mechanisms. (SLD)

  11. "Statistical Methods," 8th Edition, by George W. Snedecor and William G. Cochran [book review].

    Science.gov (United States)

    Jones, Douglas H.

    1994-01-01

    This book is a solid introduction to applied statistics emphasizing computational statistics that can be done with a simple calculator. Because of the progress in speed and power of computers since the first edition in the 1970s, the book is behind in giving information on practical computation. (SLD)

  12. Jack Stenner: The Lexile King.

    Science.gov (United States)

    Webster, Linda J.

    2000-01-01

    Traces the career of Jack Stenner. Stenner made the empirical discovery that observable readability could be entirely predicted from word familiarity and sentence length, and applied this "Lexile Framework"(R) to books and readers. Discusses the use of the Lexile Framework as a way to target specific readers. (SLD)

  13. For Whom Is a Picture Worth a Thousand Words? Extensions of a Dual-Coding Theory of Multimedia Learning.

    Science.gov (United States)

    Mayer, Richard E.; Sims, Valerie K.

    1994-01-01

    In 2 experiments, 162 high- and low-spatial ability students viewed a computer-generated animation and heard a concurrent or successive explanation. The concurrent group generated more creative solutions to transfer problems and demonstrated a contiguity effect consistent with dual-coding theory. (SLD)

  14. Word Identification in Reading and the Promise of Subsymbolic Psycholinguistics.

    Science.gov (United States)

    Van Orden, Guy C.; And Others

    1990-01-01

    It is argued that dual-process theory has misconstrued the correspondence between words' spelling and their phonology. A subsymbolic alternative to dual-processing theory is presented that includes a clear role for the process of phonologic coding. The subsymbolic approach is developed around a covariant learning hypothesis. (SLD)

  15. Aids to Computer-Based Multimedia Learning.

    Science.gov (United States)

    Mayer, Richard E.; Moreno, Roxana

    2002-01-01

    Presents a cognitive theory of multimedia learning that draws on dual coding theory, cognitive load theory, and constructivist learning theory and derives some principles of instructional design for fostering multimedia learning. These include principles of multiple representation, contiguity, coherence, modality, and redundancy. (SLD)

  16. Multimodal versus Unimodal Instruction in a Complex Learning Context.

    Science.gov (United States)

    Gellevij, Mark; van der Meij, Hans; de Jong, Ton; Pieters, Jules

    2002-01-01

    Compared multimodal instruction with text and pictures with unimodal text-only instruction as 44 college students used a visual or textual manual to learn a complex software application. Results initially support dual coding theory and indicate that multimodal instruction led to better performance than unimodal instruction. (SLD)

  17. A Survey of Managed Care Education at Optometry Schools.

    Science.gov (United States)

    Soroka, Mort; Reis, Lesley

    2003-01-01

    Studied the courses and topics offered at schools of optometry and the total hours devoted to managed care. Responses from the 17 schools of optometry reveal significant variations in curricular coverage of managed care, although a core set of materials was found to exist that could be the basis for more standard curriculum. (SLD)

  18. High Standards for All: The Struggle for Equality in the American High School Curriculum, 1890-1990.

    Science.gov (United States)

    Mirel, Jeffrey; Angus, David

    1994-01-01

    Close investigation of trends in high school student course taking indicates that curriculum differentiation has had a negative effect on the education of many young people, particularly working-class and black students. It is argued that national goals and standards, wisely developed and applied, can benefit American education. (SLD)

  19. Efficacy of vision therapy in children with learning disability and associated binocular vision anomalies

    Directory of Open Access Journals (Sweden)

    Jameel Rizwana Hussaindeen

    2018-01-01

    Conclusion: Children with specific learning disorders have a high frequency of binocular vision disorders and vision therapy plays a significant role in improving the BV parameters. Children with SLD should be screened for BV anomalies as it could potentially be an added hindrance to the reading difficulty in this special population.

  20. Fast simulation and topological vertex finding in JAVA

    International Nuclear Information System (INIS)

    Walkowiak, Wolfgang

    2001-01-01

    An overview of the fast Monte Carlo simulation for NLC detector studies as currently provided in the Java Analysis Studio environment is presented. Special emphasis is given to the simulation of tracks. In addition, the SLD collaboration's topological vertex finding algorithm (ZVTOP) has been implemented in the Java Analysis Studio framework

  1. Learning Disabilities in Neurofibromatosis Type 1

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2006-12-01

    Full Text Available The frequency of specific leaning disabilities (SLD in neurofibromatosis type 1 (NF1 was determined in a cohort of 81 patients (43 males, 38 females; mean age 11 years 6 months; age range 8-16 followed at Children's Hospital, Westmead, NSW, Australia.

  2. Waldorf Education in an Inner-City Public School.

    Science.gov (United States)

    McDermott, Ray; And Others

    1996-01-01

    Reports on the achievement of the first Waldorf public elementary school in Milwaukee (Wisconsin). Early experience indicates that Waldorf pedagogy, with its emphasis on the natural rhythms of everyday life, is an effective model for predominantly African American children in an inner city. (SLD)

  3. Columbia University's Franz Boas: He Led the Undoing of Scientific Racism.

    Science.gov (United States)

    Baker, Lee D.

    1999-01-01

    As early as 1887, the anthropologist Franz Boas began to combat scientific racism and the insistence that blacks were of lower intelligence than whites. Throughout his career, Boas guided anthropology to a consensus that people of color were not racially inferior and that they possessed unique and historically specific cultures. (SLD)

  4. "A History of Us." An Excerpt.

    Science.gov (United States)

    Hakim, Joy; And Others

    1993-01-01

    Introduces a new series of U.S. history textbooks geared to grade five (or grades four, five, and six). The 10-volume series, divided into short, manageable chapters, aims to make history come alive. An excerpt from Book 6 ("War, Terrible War") about the Civil War is presented. (SLD)

  5. Factorial Structure of a Measure of Acculturation in a Puerto Rican Population.

    Science.gov (United States)

    De Leon, Brunilda; Mendez, Serafin

    1996-01-01

    The psychometric characteristics of the Cultural Life Style Inventory were studied with a sample of 402 Puerto Rican college students. Factor analysis revealed high factorial stability for Puerto Ricans. Similarities and differences with a previously studied Mexican American population are discussed. (SLD)

  6. Give Me... Your Huddled Masses...

    Science.gov (United States)

    Wilkinson, Ray

    2000-01-01

    Explores the ambiguity in the attitudes of the U. S. and Canadian governments toward what are perceived as "real" refugees and more dubious asylum seekers. Outlines policies toward asylum seekers, points out inconsistencies, and notes some recently proposed changes in immigration law. (SLD)

  7. Examining Gender DIF on a Multiple-Choice Test of Mathematics: A Confirmatory Approach.

    Science.gov (United States)

    Ryan, Katherine E.; Fan, Meichu

    1996-01-01

    Results for 3,244 female and 3,033 male junior high school students from the Second International Mathematics Study show that applied items in algebra, geometry, and computation were easier for males but arithmetic items were differentially easier for females. Implications of these findings for assessment and instruction are discussed. (SLD)

  8. A Practical Guide for Estimating Dietary Fat and Fiber Using Limited Food Frequency Data.

    Science.gov (United States)

    Neale, Anne Victoria; And Others

    1992-01-01

    A methodology is presented for estimating daily intake of dietary fat and fiber based on limited food frequency data. The procedure, which relies on National Food Consumption Survey data and daily consumption rates, can provide baseline estimates of dietary patterns for health promotion policymakers. (SLD)

  9. A History of Women in Jazz.

    Science.gov (United States)

    Miller, Susanna L.

    1991-01-01

    The history of women jazz performers and composers, namely African Americans, in the United States is traced from its beginnings to contemporary artists. Women have played an integral role in jazz development. Separate women's festivals showcase many female talents, demonstrating that the future is very promising for women in jazz. (SLD)

  10. Differences between Australian and Japanese Students in Decisional Self-Esteem, Decisional Stress, and Coping Styles.

    Science.gov (United States)

    Radford, Mark H. B.; And Others

    1993-01-01

    Examines effects of culture on decisional self-esteem, decisional stress, and self-reported decision coping style for 743 Japanese and 309 Australian college students. Findings on coping styles in decision making are related to cross-cultural differences between the individualistic culture of Australia and the collectivistic culture of Japan. (SLD)

  11. Formative Evaluation of a Nutritional Marketing Project in City-Center Restaurants.

    Science.gov (United States)

    Demers, Andree; Renaud, Lise

    1992-01-01

    Formative evaluation of a community health project providing and promoting low-fat foods in five restaurants in Montreal (Canada) shows that restaurateurs are willing to collaborate in project implementation but not in training waiters and that the project did not cause an increase in market demand for low-fat menu offerings. (SLD)

  12. Equal Partners. Austin Teenagers Learn To Expect Respect in Dating Relationships.

    Science.gov (United States)

    Harrison, Mary M.

    1997-01-01

    Describes the Teen Dating Violence Project, a 24-week program in the Austin (Texas) schools that offers single sex support groups for young men and women involved in violent relationships. Learning to build equitable and respectful relationships often involves unlearning gender stereotypes, but the program shows that attitudes can change. (SLD)

  13. Learning from Others: Service-Learning in Costa Rica and Indonesia.

    Science.gov (United States)

    Williams, David D.; Eiserman, William D.

    1997-01-01

    An exploration of the roles service learning plays in universities in Indonesia and Costa Rica invites policymakers in the United States to re-examine university service, research, and teaching responsibilities. Increased faculty involvement is a key to expanding service learning as part of the university agenda. (SLD)

  14. WISC-R Subtest Pattern Stability and Learning Disabilities: A Profile Analysis.

    Science.gov (United States)

    Mealor, David J.; Abrams, Pamela F.

    Profile analysis was performed on Wechsler Intelligence Scale for Children-Revised (WISC-R) scores of 29 learning disabled students (6-10 years old) in a Specific Learning Disabilities (SLD) program, to determine whether subtest patterns for initial and re-evaluation WISC-R administrations would differ significantly. Profile analysis was applied…

  15. Confirmatory Factor Analysis of the WISC-III with Child Psychiatric Inpatients.

    Science.gov (United States)

    Tupa, David J.; Wright, Margaret O'Dougherty; Fristad, Mary A.

    1997-01-01

    Factor models of the Wechsler Intelligence Scale for Children-Third Edition (WISC-III) for one, two, three, and four factors were tested using confirmatory factor analysis with a sample of 177 child psychiatric inpatients. The four-factor model proposed in the WISC-III manual provided the best fit to the data. (SLD)

  16. The Wechsler Memory Scale: A Review of Research.

    Science.gov (United States)

    Ivison, David

    1990-01-01

    Research on the standardization, reliability, validity, factor structure, and subtests of the Wechsler Memory Scale (WMS) (1945) and its revised version (1987) is reviewed. Much research relating to the WMS appears to be relevant to the revised version. Use of the instrument in Australia is discussed. (SLD)

  17. Do Asian American Faculty Face a Glass Ceiling in Higher Education?

    Science.gov (United States)

    Lee, Sharon M.

    2002-01-01

    Evaluated the glass ceiling hypothesis in relation to Asian American faculty using data from the 1993 National Study of Post-Secondary Faculty for 1,019 Asian American faculty members. Data limitations prevent concluding that such faculty do or do not face a glass ceiling; however, baseline findings for future research are established. (SLD)

  18. What Glass Ceiling?

    Science.gov (United States)

    Lynch, Michael; Post, Katherine

    1996-01-01

    A recent study drawing on data from the Census Bureau and the Bureau of Labor Statistics suggests that the wage gap between men and women has virtually disappeared, and that the so-called "glass ceiling" results more from age and qualifications than from explicit discrimination. (SLD)

  19. A Reliability Generalization Study of the Marlowe-Crowne Social Desirability Scale.

    Science.gov (United States)

    Beretvas, S, Natasha; Meyers, Jason L.; Leite, Walter L.

    2002-01-01

    Conducted a reliability generalization study of the Marlowe-Crowne Social Desirability Scale (D. Crowne and D. Marlowe, 1960). Analysis of 93 studies show that the predicted score reliability for male adolescents was 0.53, and reliability for men's responses was lower than for women's. Discusses the need for further analysis of the scale. (SLD)

  20. A Marketing Approach to Evaluation: Four Lessons for Evaluators from the Honda Motor Company.

    Science.gov (United States)

    Mangano, Michael F.

    1992-01-01

    Describes lessons evaluators can learn from the Honda Motor Company and how an evaluation office within the Department of Health and Human Services has applied these lessons. The lessons include (1) sound market research; (2) creating top-notch production capabilities; (3) building a better mousetrap; and (4) aggressive product selling. (SLD)

  1. Comment on the Minnesota Transracial Adoption Study.

    Science.gov (United States)

    Levin, Michael; And Others

    1994-01-01

    Michael Levin argues that data from the study are consistent with a black/white IQ difference that is significantly genetic. Richard Lynn maintains that adoption by middle-class, white families has no effect on intelligence. Waldman, Weinberg, and Scarr respond to these criticisms and support the original conclusions. (SLD)

  2. "The Bell Curve" and Its Critical Progeny: A Review.

    Science.gov (United States)

    Davis, Alan

    1997-01-01

    Discusses R. Herrnstein's and C. Murray's attempt to persuade an educated white readership that they, the readers, are genetically, socially, and intellectually superior. The most effective criticisms are those that rely on scientific evidence about the manipulation of data and flawed analyses rather than the display of moral outrage. (SLD)

  3. Working with the Oglala Lakota: An Outsider's Perspective.

    Science.gov (United States)

    Broken Nose, Mary Ann

    1992-01-01

    Explores how difficult it is for a non-Indian to obtain an accurate view of American Indians. Helping professionals are not immune; they also have absorbed the views of the dominant culture. The author's work with the Oglala Lakota people of South Dakota illustrates the difficulties that therapists face. (SLD)

  4. Cine MRI: a new approach to the diagnosis of scapholunate dissociation.

    Science.gov (United States)

    Langner, I; Fischer, S; Eisenschenk, A; Langner, S

    2015-08-01

    To evaluate the feasibility of cine MRI for the detection of scapholunate dissociation (SLD) and to compare the sensitivity and specificity of cine MRI with those of cineradiography and arthroscopy. To evaluate feasibility, healthy subjects underwent cine MRI of the wrist. To evaluate sensitivity and specificity, patients with clinically suspected scapholunate ligament (SLL) injury after trauma to the wrist were prospectively included and underwent radiographic examination, cineradiography, and cine MRI. In 25 out of 38 patients, subsequent arthroscopy was performed. Results of cineradiography and cine MRI correlated with those of arthroscopy. Cine MRI was of diagnostic quality in all healthy subjects and patients with good interrater agreement. There was excellent correlation between cineradiography and cine MRI. Scapholunate distance differed significantly between healthy subjects and patients with scapholunate dissociation (p Cine MRI had 85% sensitivity and 90% specificity for the detection of SLD. Cine MRI of the wrist is a fast and reliable technique for the detection of SLD with diagnostic accuracy comparable to cineradiography. It can be easily implemented as a routine clinical MRI examination, facilitating diagnostic workup of patients with suspected SLD while avoiding radiation exposure.

  5. Recognition of Emotion by Chinese and Australian Children.

    Science.gov (United States)

    Markham, Roslyn; Wang, Lei

    1996-01-01

    Compared the recognition of emotion from facial expression by 72 Chinese and 72 Australian children using photographs of Chinese and Caucasian faces. Results provide some evidence for an ethnic bias effect in emotion recognition and demonstrate an increase in overall accuracy with age. Cultural differences are discussed. (SLD)

  6. The Educational Experience and Performance of Immigrant and Minority Students in Israel.

    Science.gov (United States)

    Eisikovits, Rivka A.

    1997-01-01

    Describes the educational needs, experiences, and performances of Jewish and Arab primary and secondary school students in Israel's two separate and parallel educational systems. Emphasis is placed on emerging trends in the educational treatment of immigrant children and shifts in educational policy and practices in the Arab sector. (SLD)

  7. Social Errors in Four Cultures: Evidence about Universal Forms of Social Relations.

    Science.gov (United States)

    Fiske, Alan Page

    1993-01-01

    To test the cross-cultural generality of relational-models theory, 4 studies with 70 adults examined social errors of substitution of persons for Bengali, Korean, Chinese, and Vai (Liberia and Sierra Leone) subjects. In all four cultures, people tend to substitute someone with whom they have the same basic relationship. (SLD)

  8. Teenage Parent Programs: A Synthesis of the Long-Term Effects of the New Chance Demonstration, Ohio's Learning, Earning, and Parenting Program, and the Teenage Parent Demonstration.

    Science.gov (United States)

    Granger, Robert C.; Cytron, Rachel

    1999-01-01

    Synthesizes the long-term findings of three major evaluations of programs that began in the late 1980s and were designed to improve the self-efficacy of teenage mothers on welfare. Economic outcomes for the mothers improved over time, and the interventions had some positive effects, although they did not affect fertility. (SLD)

  9. Using Differential Item Functioning Procedures to Explore Sources of Item Difficulty and Group Performance Characteristics.

    Science.gov (United States)

    Scheuneman, Janice Dowd; Gerritz, Kalle

    1990-01-01

    Differential item functioning (DIF) methodology for revealing sources of item difficulty and performance characteristics of different groups was explored. A total of 150 Scholastic Aptitude Test items and 132 Graduate Record Examination general test items were analyzed. DIF was evaluated for males and females and Blacks and Whites. (SLD)

  10. Failing To Marvel: The Nuances, Complexities, and Challenges of Multicultural Education.

    Science.gov (United States)

    Simoes de Carvalho, Paulo M.

    1998-01-01

    Reviews the complex nature of multicultural education, which as it advocates recognition of the values of many cultures, is nevertheless grounded in a Western culture and subject to Western deconstruction. Considers the challenge of the multicultural educator to recognize his or her own voice as representative of the dominant culture. (SLD)

  11. Special Issue: Outcome of Anorexia Nervosa with Teenage Onset.

    Science.gov (United States)

    Casper, Regina C., Ed.

    1996-01-01

    The articles of this special issue report on studies of the outcomes of treatment of adolescent anorexia nervosa. These studies leave no doubt about the mortality risk and debilitating nature of chronic anorexia nervosa, but they do suggest that the prognosis, given expert treatment, is favorable for the most part. (SLD)

  12. Metacognitive Reading Strategies in Learning Disability: Relations between Usage Level, Academic Self-Efficacy and Self-Concept

    Science.gov (United States)

    Girli, Alev; Öztürk, Halil

    2017-01-01

    The purpose of this study is to investigate the relationship between the usage levels of metacognitive reading strategies by students diagnosed with specific learning disability (SLD), academic self-efficacy and the concept of self, in comparison to their typically developing (TD) peers. The data to be used in the study were collected using the…

  13. Fundamentalism in Psychological Science. The Publication Manual as "Bible."

    Science.gov (United States)

    Walsh-Bowers, Richard

    1999-01-01

    Analyzes the content of the fourth edition of the "Publication Manual of the American Psychological Association" (1994) as if it were a biblical text. Draws on socio-historical studies and critical feminist perspectives to discuss the manual's function as a fundamentalist "bible" in relation to psychologists' culture. (SLD)

  14. Higher Education--The Flexible Employment Sector?

    Science.gov (United States)

    Scott, Jill; Ridgley, Clare; Spurgeon, Peter

    2003-01-01

    Explored the extent to which policies and practices promoting work-life balance (family friendly policies) have been taken up within the English higher education sector. Responses from 50 higher education institutions show that flexible working practices are more widespread than the formal policies of institutions would suggest. (SLD)

  15. Cases as Shared Inquiry: A Dialogical Model of Teacher Preparation.

    Science.gov (United States)

    Harrington, Helen L.; Garrison, James W.

    1992-01-01

    A dialogical model is proposed for connecting theory to practice in teacher education by conceiving of cases from case-based pedagogy as problems that initiate shared inquiry. Cases with genuine cognitive and axiological content can initiate self-directed, student-centered inquiry while building democratic dialogical communities. (SLD)

  16. Psychological Adjustment among Israeli Adolescent Immigrants: A Report on Life Satisfaction, Self-Concept, and Self-Esteem.

    Science.gov (United States)

    Ullman, Chana; Tatar, Moshe

    2001-01-01

    Examined self-concept, self-esteem, and life satisfaction among 119 immigrants to Israel from the former Soviet Union and 135 Israeli classmates. Immigrant adolescents reported less satisfaction with their lives and less congruence between their self-concept and the ways in which they were perceived by others. (SLD)

  17. Invisible No More.

    Science.gov (United States)

    King, Claire

    1999-01-01

    Describes the Romani (Gypsy) culture and refutes some stereotypes about this ethnic group. Discusses ways to improve educational opportunities for Romani children, whose culture has been wary of conventional public education and describes the importance of the Internet for Romani-American communication. (SLD)

  18. Strategic Management and Evaluation: Rivals, Partners, or Just Fellow Travelers?

    Science.gov (United States)

    Klay, William Earle

    1991-01-01

    Evaluation and strategic management are related in that each attempts to improve the quality of policy decisions and each has evolved from a product-centered focus to one in which implementation and utilization are vital. Evaluators should understand strategic management theory to evaluate its applications appropriately. (SLD)

  19. A King over Egypt, Which Knew Not Joseph.

    Science.gov (United States)

    Coffman, William E.

    1993-01-01

    Although it is true that today's education needs improvement, schools today are not all bad. The opinions of the following five experts, whose views are worth hearing are introduced: (1) Thomas Hopkins; (2) Ralph Tyler; (3) E. F. Lindquist; (4) Walter Cook; and (5) Harold Benjamin. (SLD)

  20. A Mediational Model of Autonomy, Self-Esteem, and Eating Disordered Attitudes and Behaviors.

    Science.gov (United States)

    Frederick, Christina M.; Grow, Virginia M.

    1996-01-01

    Findings from a study of the relationships among autonomy deficits, low self-esteem, and eating disorders of 71 college women supported a mediational model in which lack of autonomy was related to decreased global self-esteem, which in turn was associated with bulimia and body dissatisfaction. (SLD)

  1. Optimal Measurement Conditions for Spatiotemporal EEG/MEG Source Analysis.

    Science.gov (United States)

    Huizenga, Hilde M.; Heslenfeld, Dirk J.; Molenaar, Peter C. M.

    2002-01-01

    Developed a method to determine the required number and position of sensors for human brain electromagnetic source analysis. Studied the method through a simulation study and an empirical study on visual evoked potentials in one adult male. Results indicate the method is fast and reliable and improves source precision. (SLD)

  2. Dynamic Factor Analysis of Nonstationary Multivariate Time Series.

    Science.gov (United States)

    Molenaar, Peter C. M.; And Others

    1992-01-01

    The dynamic factor model proposed by P. C. Molenaar (1985) is exhibited, and a dynamic nonstationary factor model (DNFM) is constructed with latent factor series that have time-varying mean functions. The use of a DNFM is illustrated using data from a television viewing habits study. (SLD)

  3. Estimating and Testing the Sources of Evoked Potentials in the Brain.

    Science.gov (United States)

    Huizenga, Hilde M.; Molenaar, Peter C. M.

    1994-01-01

    The source of an event-related brain potential (ERP) is estimated from multivariate measures of ERP on the head under several mathematical and physical constraints on the parameters of the source model. Statistical aspects of estimation are discussed, and new tests are proposed. (SLD)

  4. A Structural Modeling Approach to a Multilevel Random Coefficients Model.

    Science.gov (United States)

    Rovine, Michael J.; Molenaar, Peter C. M.

    2000-01-01

    Presents a method for estimating the random coefficients model using covariance structure modeling and allowing one to estimate both fixed and random effects. The method is applied to real and simulated data, including marriage data from J. Belsky and M. Rovine (1990). (SLD)

  5. The Many Null Distributions of Person Fit Indices.

    Science.gov (United States)

    Molenaar, Ivo W.; Hoijtink, Herbert

    1990-01-01

    Statistical properties of person fit indices are reviewed as indicators of the extent to which a person's score pattern is in agreement with a measurement model. Distribution of a fit index and ability-free fit evaluation are discussed. The null distribution was simulated for a test of 20 items. (SLD)

  6. Work, Education, and Voluntarism in the 21st Century.

    Science.gov (United States)

    Densmore, Kathleen

    1996-01-01

    Jeremy Rifkin argues that machines are mainly responsible for growing unemployment and should be countered by having people do volunteer work. Providing educational services is among the types of work he suggests volunteers should undertake. Education should also prepare people for volunteer work in this proposed "third sector" of employment. (SLD)

  7. The Reviewing of Object Files: Object-Specific Integration of Information.

    Science.gov (United States)

    Kahneman, Daniel; And Others

    1992-01-01

    Seven experiments involving a total of 203 college students explored a form of object-specific priming and established a robust object-specific benefit that indicates that a new stimulus will be named faster if it physically matches a previous stimulus seen as part of the same perceptual object. (SLD)

  8. Gender Stereotyped Descriptors in Children's Picture Books: Does "Curious Jane" Exist in the Literature?

    Science.gov (United States)

    Turner-Bowker, Diane M.

    1996-01-01

    Subtle effects of gender stereotyping in children's literature were studied in 30 noted children's books from 1984 through 1994. Results show more males in titles and pictures, with no difference in central roles. Males were described as more active, but adjectives used for females were more positively evaluated. (SLD)

  9. Gender Differences in Emotional Language in Children's Picture Books.

    Science.gov (United States)

    Tepper, Clary A.; Cassidy, Kimberly Wright

    1999-01-01

    Examined gender differences in emotional language in children's picture books, using 178 books read to or by preschool children. Males had higher representations on titles, pictures, and central roles, but males and females were associated with equal amounts of emotional language and similar types of emotional words. (SLD)

  10. Concreteness and Imagery Effects in the Written Composition of Definitions.

    Science.gov (United States)

    Sadoski, Mark; Kealy, William A.; Goetz, Ernest T.; Paivio, Allan

    1997-01-01

    In two experiments, undergraduates (n=48 and n=50) composed written definitions of concrete and abstract nouns that were matched for frequency of use and meaningfulness. Results support previous research suggesting that common cognitive mechanisms underlie production of spoken and written language as explained by dual coding theory. (SLD)

  11. Elementary particle interactions

    International Nuclear Information System (INIS)

    Bugg, W.M.; Condo, G.T.; Handler, T.; Hart, E.L.; Ward, B.F.L.; Close, F.E.; Christophorou, L.G.

    1990-10-01

    This report discusses freon bubble chamber experiments exposed to μ + and neutrinos, photon-proton interactions; shower counter simulations; SLD detectors at the Stanford Linear Collider, and the detectors at the Superconducting Super Collider; elementary particle interactions; physical properties of dielectric materials used in High Energy Physics detectors; and Nuclear Physics

  12. Evidence of Decay of Flux Ratio of Fe to Fe–Ni Line Features with ...

    Indian Academy of Sciences (India)

    2010-08-18

    Aug 18, 2010 ... measuring of the intensity and mean energy of the Fe and Fe–Ni line ... The instrumentation of the SLD payload, its in-flight calibration and operation ... reconnection process and also decays faster compared to many other ... measure vary over time and these factors mainly control the shape of the line. The.

  13. Debating Inclusion in Synecdoche, New York: A Response to Gresham and MacMillan.

    Science.gov (United States)

    Ferguson, Dianne L.; Ferguson, Philip M.

    1997-01-01

    A comprehensive review of the debate over the inclusion of children with disabilities in educational programs needs to explore research and issues beyond those considered by F. Gresham and D. MacMillan. Some of those issues are reviewed, focusing on a shift away from the medical deficit model. (SLD)

  14. The Four Elementary Forms of Sociality: Framework for a Unified Theory of Social Relations.

    Science.gov (United States)

    Fiske, Alan Page

    1992-01-01

    A theory is presented that postulates that people in all cultures use four relational models to generate most kinds of social interaction, evaluation, and affect. Ethnographic and field studies (n=19) have supported cultural variations on communal sharing; authority ranking; equality matching; and market pricing. (SLD)

  15. Where Do We Stand? Views of Racial Conflict by Vietnamese American High-School Students in a Black-and-White Context.

    Science.gov (United States)

    Kiang, Peter N.; Kaplan, Jenny

    1994-01-01

    Qualitative research conducted with 14 Vietnamese American students in Boston (Massachusetts) shows that social exclusion and racial conflict are daily realities. Perspectives of these students challenge the validity of the dominant black-white model that defines public understanding of race relations. (SLD)

  16. Racial Cleavage in Local Voting: The Case of School and Tax Issue Referendums.

    Science.gov (United States)

    Button, James

    1993-01-01

    Explores voting behavior of African Americans and whites in local school and tax referenda to determine whether racial conflict is still a primal factor in noncandidate elections. Results for voters in 5 counties in Florida (over 1,699,000 voters) reveal African-American underregistration and the continuing importance of racial cleavage. (SLD)

  17. Contribution of Content Knowledge and Learning Ability to the Learning of Facts.

    Science.gov (United States)

    Kuhara-Kojima, Keiko; Hatano, Giyoo

    1991-01-01

    In 3 experiments, 1,598 Japanese college students were examined concerning the learning of facts in 2 content domains, baseball and music. Content knowledge facilitated fact learning only in the relevant domain; learning ability facilitated fact learning in both domains. Effects of content knowledge and learning ability were additive. (SLD)

  18. Non-Organic Failure-to-Thrive: Origins and Psychoeducational Implications.

    Science.gov (United States)

    Phelps, LeAdelle

    1991-01-01

    The passage of Public Law 99-457 relating to education for the handicapped increases the probability that the school psychologist will be asked to evaluate infants and children diagnosed as suffering from nonorganic failure-to-thrive (NOFT) disorder. Etiology, models, and interventions appropriate for NOFT children are discussed. (SLD)

  19. A Combination of Preliminary Electroweak Measurements and Constraints on the Standard Model

    DEFF Research Database (Denmark)

    Hansen, Jørgen Beck

    2001-01-01

    This note presents a combination of published and preliminary electroweak results from the four LEP collaborations and the SLD collaboration which were prepared for the 2000 summer conferences. Averages from Z0 resonance results are derived for hadronic and leptonic cross sections, the leptonic f...

  20. The Emergence of Voices: Vietnamese American Literature 1975-1990.

    Science.gov (United States)

    Truong, Monique Thuy-Dung

    1993-01-01

    The loose and porous body of work defined as Vietnamese American literature emerges from social and historical conflict. Vietnamese American literature speaks of death and irreconcilable loss and the longing for peace of mind. Texts by Vietnamese Americans can deliver the voices necessary to reexamine the Vietnam War. (SLD)

  1. Random-Number Generator Validity in Simulation Studies: An Investigation of Normality.

    Science.gov (United States)

    Bang, Jung W.; Schumacker, Randall E.; Schlieve, Paul L.

    1998-01-01

    The normality of number distributions generated by various random-number generators were studied, focusing on when the random-number generator reached a normal distribution and at what sample size. Findings suggest the steps that should be followed when using a random-number generator in a Monte Carlo simulation. (SLD)

  2. Discovering Moral Engagement: An Interview with Robert Coles.

    Science.gov (United States)

    Scott, Bradwell D.

    1995-01-01

    Educator Robert Coles argues that there is a need for a basis on which to teach and cultivate moral awareness in parents and children. Active parenting requires both inner-directed and outer-directed focuses to take advantage of the everyday events through which morality is developed. (SLD)

  3. Production of heavy flavors at the Z0 and electroweak couplings

    International Nuclear Information System (INIS)

    Wagner, S.R.

    1997-09-01

    The LEP experiments and SLD have measured the electroweak couplings of the b and c quarks using various tags of B and D hadron decays. The current status of these measurements is discussed, and is contrasted with other electroweak measurements at the Z 0

  4. Comparing the Incomparable: An Essay on the Importance of Big Assumptions and Scant Evidence.

    Science.gov (United States)

    Wainer, Howard

    1999-01-01

    Discusses the comparison of groups of individuals who were administered different forms of a test. Focuses on the situation in which there is little overlap in content between the test forms. Reviews equating problems in national tests in Canada and Israel. (SLD)

  5. Understanding the Authoritative Parenting-Early Adolescent Tobacco Use Link; The Mediating Role of Peer Tobacco Use.

    Science.gov (United States)

    Adamczyk-Robinette, Stacey L.; Fletcher, Anne C.; Wright, Kristie

    2002-01-01

    Studied the link between authoritative parenting style and early adolescent tobacco use through the self-reports of 156 eighth graders and independent reports on tobacco use from their friends. Results show that high levels of authoritative parenting are associated with lower levels of tobacco use among target adolescents. (SLD)

  6. Education, Ethnic Homogenization and Cultural Hybridization (Brussels, Belgium, and Cape Town, South Africa).

    Science.gov (United States)

    Leman, Johan, Ed.

    1999-01-01

    The eight chapters of this theme issue examine the ways in which autochthonous communities regard the supply side of education. The supply side is segregational in nature, and immigrants themselves move toward ethnic homogenization. The focus is on urban minorities in Brussels (Belgium). Compares the situation in Cape Town (South Africa). (SLD)

  7. Attitudes toward the Homeless: A U.S.-Japan Comparison.

    Science.gov (United States)

    Guzewicz, Tony D.; Takooshian, Harold

    1993-01-01

    Compares attitudes toward the homeless in Japan and the United States through a survey of 268 Japanese and 254 U.S. adults and adolescents interviewed in public places. In Japan, homelessness is seldom discussed, and poverty, which may be as widespread as in the United States, is often not recognized. (SLD)

  8. Educating Homeless Children in the United States.

    Science.gov (United States)

    Yon, Maria

    1995-01-01

    A survey of 102 urban school districts in large cities indicates that school districts have responded to the requirements of the Stewart B. McKinney Act for the education of homeless children to varying degrees. However, 69 percent of districts described the problem of homeless students as nonexistent or small. (SLD)

  9. Is Gender or Gender-Role Orientation a Better Predictor of Empathy in Adolescence?

    Science.gov (United States)

    Karniol, Rachel; Gabay, Rivi; Ochion, Yael; Harari, Yael

    1998-01-01

    Assessed the relative contribution of gender and gender role orientation to empathy and its development in 119 Israeli 8th and 11th graders. When the contribution of masculinity/femininity was covaried, empathy was found unrelated to gender. Findings are discussed in terms of socialization of emotions and gender role orientation. (SLD)

  10. Translation Fidelity of Psychological Scales: An Item Response Theory Analysis of an Individualism-Collectivism Scale.

    Science.gov (United States)

    Bontempo, Robert

    1993-01-01

    Describes a method for assessing the quality of translations based on item response theory (IRT). Results from the IRT technique with French and Chinese versions of a scale measuring individualism-collectivism for samples of 250 U.S., 357 French, and 290 Chinese undergraduates show how several biased items are detected. (SLD)

  11. Working Memory Difficulties and Eligibility for K-12 Special Education

    Science.gov (United States)

    Wilson, Corrie L.

    2017-01-01

    Working memory (WM) has long been associated with deficiencies in reading. Approximately 35% of students in the United States who receive special education services do so under the category of specific learning disability (SLD). The study's theoretical underpinning was Baddeley's model of WM; previous research revealed a significant literature gap…

  12. Contextual Cueing: Implicit Learning and Memory of Visual Context Guides Spatial Attention.

    Science.gov (United States)

    Chun, Marvin M.; Jiang, Yuhong

    1998-01-01

    Six experiments involving a total of 112 college students demonstrate that a robust memory for visual context exists to guide spatial attention. Results show how implicit learning and memory of visual context can guide spatial attention toward task-relevant aspects of a scene. (SLD)

  13. Attitudes toward Homosexuals among Students at a Canadian University.

    Science.gov (United States)

    Schellenberg, E. Glenn; Hirt, Jessie; Sears, Alan

    1999-01-01

    Examined attitudes toward homosexuals among 199 male and female students at a Canadian university. Attitudes toward gay men were more negative than attitudes toward lesbians. For male students, attitudes toward gay men improved with time spent at college, suggesting the influence of college in reducing antihomosexual prejudice. (SLD)

  14. The Psychology of Isolated and Confined Environments: Understanding Human Behavior in Antarctica.

    Science.gov (United States)

    Palinkas, Lawrence A.

    2003-01-01

    Reviews lessons learned from research in Antarctica with relevance to understanding human behavior in other isolated and confined environments. Outlines four distinct characteristics of psychosocial adaptation to such environments and discusses some of the benefits for individuals seeking challenging experiences. (Contains references.) (SLD)

  15. Eurocentrism, Afrocentrism, and William H. Ferris's "The African Abroad," 1911.

    Science.gov (United States)

    Moses, Wilson J.

    1991-01-01

    Traces the historical origins of the controversy surrounding Afrocentric education versus education based on the traditional canon of the Western world to W. H. Ferris' work and his 1913 study "The African abroad or His Evolution in Western Civilization, Tracing His Development under Caucasian Milieu," which has relevance today. (SLD)

  16. Psychosocial Adjustment and Family Relationships: A Typology of Italian Families with a Late Adolescent.

    Science.gov (United States)

    Scabini, Eugenia; Lanz, Margherita; Marta, Elena

    1999-01-01

    Derived a typology of family relationships for 692 Italian families with at least 1 late adolescent child and studied differences between the 2 extreme types (out of 8 identified) in terms of family satisfaction and adequate functioning. Results show a better communication process in the more satisfied families. (SLD)

  17. High Energy Physics: Report of research accomplishments and future goals, FY 1992

    International Nuclear Information System (INIS)

    1991-01-01

    This report discusses high energy physics research in the following areas: Research in theoretical physics; phenomenology; experimental computer facility at Caltech; Beijing BES; MACRO; CLEO II; SLD; L3 at LEP; the B Factory R ampersand D Program; SSC GEM Detector; and a high resolution barium fluoride calorimeter for the SSC

  18. The Legal Meaning of Specific Learning Disability for IDEA Eligibility: The Latest Case Law

    Science.gov (United States)

    Zirkel, Perry A.

    2013-01-01

    Specific learning disability (SLD), although moderately declining in recent years, continues to be the largest of the eligibility classifications under the Individuals with Disabilities Education Act (IDEA; NCES, 2012). The recognition of response to intervention (RTI) in the 2004 amendments of the IDEA as an approach for identifying students with…

  19. RTI: Court and Case Law--Confusion by Design

    Science.gov (United States)

    Daves, David P.; Walker, David W.

    2012-01-01

    Professional confusion, as well as case law confusion, exists concerning the fidelity and integrity of response to intervention (RTI) as a defensible procedure for identifying children as having a specific learning disability (SLD) under the Individuals with Disabilities Education Act (IDEA). Division is generated because of conflicting mandates…

  20. The Extended African American Family: A Pragmatic Strategy That Blunts the Blade of Injustice.

    Science.gov (United States)

    Ford, Donna Yvette; And Others

    1991-01-01

    Considers the extended African-American family, beginning with a historical perspective of the nuclear family and other family arrangements. The importance of the group rather than the individual for African-American culture is explored. Analyses of the function of the extended family indicate its role in adaptation and survival. (SLD)

  1. Collegiate Grading Practices and the Gender Pay Gap.

    Science.gov (United States)

    Dowd, Alicia C.

    2000-01-01

    Presents a theoretical analysis showing that relatively low grading quantitative fields and high grading verbal fields create a disincentive for college women to invest in quantitative study. Extends research by R. Sabot and J. Wakeman-Linn. Models pressures on grading practices using higher education production functions. (Author/SLD)

  2. Class Pictures: Representations of Race, Gender and Ability in a Century of School Photography.

    Science.gov (United States)

    Margolis, Eric

    2000-01-01

    Examined photographs taken of U.S. public school classes between the 1880s and the 1940s. Found significant gaps and historical amnesia, with segregated collections that reproduce images of hierarchy and dominance. The photographic archives searched convey biased views of the history of education and minority groups in the United States. (SLD)

  3. Refugee Data Center: Paving the Road to Resettlement.

    Science.gov (United States)

    Farkas, Livia J.

    1992-01-01

    Describes the Refugee Data Center (RDC) (New York City), a hub for linking refugees with voluntary resettlement agencies. The RDC maintains a database on refugees as they progress toward final resettlement in the United States. At present, RDC files include refugees from Asia, Africa, Europe, and Latin America. (SLD)

  4. High Energy Physics: Report of research accomplishments and future goals, FY 1992

    Energy Technology Data Exchange (ETDEWEB)

    None

    1991-09-05

    This report discusses high energy physics research in the following areas: Research in theoretical physics; phenomenology; experimental computer facility at Caltech; Beijing BES; MACRO; CLEO II; SLD; L3 at LEP; the B Factory R & D Program; SSC GEM Detector; and a high resolution barium fluoride calorimeter for the SSC.

  5. Cine MRI: a new approach to the diagnosis of scapholunate dissociation

    Energy Technology Data Exchange (ETDEWEB)

    Langner, I.; Eisenschenk, A. [University Medicine Greifswald, Division of Hand Surgery and Functional Microsurgery, Department of Trauma and Reconstructive Surgery, Greifswald (Germany); Fischer, S.; Langner, S. [University Medicine Greifswald, Institute for Diagnostic Radiology and Neuroradiology, Greifswald (Germany)

    2015-08-15

    To evaluate the feasibility of cine MRI for the detection of scapholunate dissociation (SLD) and to compare the sensitivity and specificity of cine MRI with those of cineradiography and arthroscopy. To evaluate feasibility, healthy subjects underwent cine MRI of the wrist. To evaluate sensitivity and specificity, patients with clinically suspected scapholunate ligament (SLL) injury after trauma to the wrist were prospectively included and underwent radiographic examination, cineradiography, and cine MRI. In 25 out of 38 patients, subsequent arthroscopy was performed. Results of cineradiography and cine MRI correlated with those of arthroscopy. Cine MRI was of diagnostic quality in all healthy subjects and patients with good interrater agreement. There was excellent correlation between cineradiography and cine MRI. Scapholunate distance differed significantly between healthy subjects and patients with scapholunate dissociation (p < 0.001), but not between imaging modalities in the patient group. Cine MRI had 85 % sensitivity and 90 % specificity for the detection of SLD. Cine MRI of the wrist is a fast and reliable technique for the detection of SLD with diagnostic accuracy comparable to cineradiography. It can be easily implemented as a routine clinical MRI examination, facilitating diagnostic workup of patients with suspected SLD while avoiding radiation exposure. (orig.)

  6. Impact of Self-Regulatory Influences on Writing Course Attainment.

    Science.gov (United States)

    Zimmerman, Barry J.; Bandura, Albert

    1994-01-01

    Using path analysis, studied the role of self-efficacy beliefs concerning academic attainment and regulation of writing, academic goals, and self-standards in writing-course attainment of 95 college freshmen. Different facets of perceived self-efficacy played a key role in writing-course attainment. (SLD)

  7. Gender and Age Patterns in Emotional Expression, Body Image, and Self-Esteem: A Qualitative Analysis.

    Science.gov (United States)

    Polce-Lynch, Mary; Myers, Barbara J.; Kilmartin, Christopher T.; Forssmann-Falck, Renate; Kliewer, Wendy

    1998-01-01

    Used written narratives to examine gender and age patterns in body image, emotional expression, and self-esteem for 209 students in grades 5, 8, and 12. Results indicate that boys restrict emotional expression in adolescence, whereas girls increase emotional expression in the same period. Girls also are more influenced by body image. (SLD)

  8. An Exploratory Study of a Gender Equity Program for Secondary School Students.

    Science.gov (United States)

    Freeman, John G.

    1996-01-01

    The effectiveness of a program designed to make secondary school students in Canada more aware of barriers to women in the workplace was studied in a preliminary development phase and a pilot test with 13 students and 23 comparisons. Results indicate that the instruction is effective in increasing student knowledge. (SLD)

  9. Black Women: Double Solos in the Workplace.

    Science.gov (United States)

    Fontaine, Deborah C.; Greenlee, Shelia P.

    1993-01-01

    Studies 12 black women in solo status positions in academia. Solo status is being the only member, or one of a small number, of a sex or racial group or both, in the workplace. As double solos, these women felt they had to outperform majority group counterparts. Common perceptions of barriers and facilitators are discussed. (SLD)

  10. An Examination of Violence and Gender Role Portrayals in Video Games: Implications for Gender Socialization and Aggressive Behavior.

    Science.gov (United States)

    Dietz, Tracy L.

    1998-01-01

    Examines the portrayal of women and the use of violent themes in 33 popular video games. The analysis reveals that traditional gender roles and violence are central to many games. There were no female characters in 41% of games with characters, and women were portrayed as sex objects in 28% of these games. (SLD)

  11. The Tunneling Method for Global Optimization in Multidimensional Scaling.

    Science.gov (United States)

    Groenen, Patrick J. F.; Heiser, Willem J.

    1996-01-01

    A tunneling method for global minimization in multidimensional scaling is introduced and adjusted for multidimensional scaling with general Minkowski distances. The method alternates a local search step with a tunneling step in which a different configuration is sought with the same STRESS implementation. (SLD)

  12. The Case Study as Research Heuristic: Lessons from the R&D Value Mapping Project.

    Science.gov (United States)

    Bozeman, Barry; Klein, Hans K.

    1999-01-01

    Examines the role of prototype case studies as the foundation for later evaluation through two studies from the "R&D Value Mapping Project," a study that will involve more than 30 cases. Explores the usefulness of case studies in defining and assessing subsequent research efforts. (SLD)

  13. Using an Evaluability Assessment To Select Methods for Evaluating State Technology Development Programs: The Case of the Georgia Research Alliance.

    Science.gov (United States)

    Youtie, Jan; Bozeman, Barry; Shapira, Philip

    1999-01-01

    Describes an evaluability assessment of the Georgia Research Alliance (GRA), a technology development program. Presents the steps involved in conducting an evaluability assessment, including development of an understanding of the program and its stakeholders. Analyzes and compares different methods by which the GRA could be evaluated. (SLD)

  14. Integration and Mainstreaming of Communicatively Disordered Children.

    Science.gov (United States)

    Moody, Janet B.; Bozeman, Rhoushelle

    The paper presents an overview of the factors involved in providing successful mainstreaming experiences to severely language disordered (SLD) children. Among aspects considered are individualization, behavior management procedures, independent problem solving and decision making, group test taking skills and experiences, social emotional growth,…

  15. Peace Works: Classroom Activities for Peacemaking.

    Science.gov (United States)

    Teaching Tolerance, 1993

    1993-01-01

    Classroom activities for examining effects of war and contemplating world peace are derived from the story of Sadako, a Japanese girl who died as a result of atomic bomb radiation. Making paper cranes, as Sadako did, and participating in schoolwide programs are suggested for primary, middle, and upper grades. (SLD)

  16. Financial Impact of Divorce on Children and Their Families.

    Science.gov (United States)

    Teachman, Jay D.; Paasch, Kathleen M.

    1994-01-01

    Examines the financial impact of divorce on children and their families. The preponderance of evidence suggests that women and children experience substantial declines after divorce whereas the relative income of divorced men remains stable or increases. The impact of public assistance is also considered. (SLD)

  17. FAA Perspective

    Science.gov (United States)

    Bond, Tom

    2009-01-01

    This viewgraph presentation describes the Federal Aviation Administration's perspective on improvements on aircraft icing. The most important areas that are discussed include: 1) Improvements in SLD engineering tools to meet concerns about means of compliance (MOC); and 2) 3-D iced aerodynamics.

  18. 78 FR 42127 - Self-Regulatory Organizations; National Securities Clearing Corporation; Notice of Filing...

    Science.gov (United States)

    2013-07-15

    ... states that it must consider this risk in crafting its risk management strategies, and agency brokers are... overstated by NSCC in crafting the SLD Proposal because those firms settle transactions on a delivery-versus-payment (``DVP'') basis. NSCC states, however, that agency brokers that execute market transactions that...

  19. Differentiating Second Language Acquisition from Specific Learning Disability: An Observational Tool Assessing Dual Language Learners' Pragmatic Competence

    Science.gov (United States)

    Farnsworth, Megan

    2018-01-01

    Overrepresentation of Dual Language Learners (DLLs) in special education remains a problem even after 40 years of inquiry. One factor is that the U.S. federal government has neither clearly explained the definition of Specific Learning Disability (SLD) nor operationally defined it to identify children for special education services. This lack of…

  20. Social Psychological Concomitants of Adolescents' Role Identities as Scholars and Athletes: A Longitudinal Analysis.

    Science.gov (United States)

    Snyder, Eldon E.; Spreitzer, Elmer

    1992-01-01

    Analyzes attitudinal and behavioral correlates of the following four categories of high school students from the High School and Beyond study: (1) scholar-athletes; (2) pure scholars; (3) pure athletes; and (4) nonscholar-nonathletes. Findings are discussed in terms of self-esteem, internal locus of control, and extracurricular involvement. (SLD)

  1. Can Addiction-Related Self-Help/Mutual Aid Groups Lower Demand for Professional Substance Abuse Treatment?

    Science.gov (United States)

    Humphreys, Keith

    1998-01-01

    Discusses the potential of self-help/mutual-aid groups as a way to reduce the demand for professional substance-abuse treatment and proposes a model that combines the two approaches for cost-effective and therapeutically effective networks of services. (SLD)

  2. Moral Reasoning in College Students: Effects of Two General Education Curricula.

    Science.gov (United States)

    Mustapha, Sherry L.; Seybert, Jeffrey A.

    1991-01-01

    Two different approaches to the undergraduate general education and liberal arts curricula were studied in terms of moral reasoning for 188 college students. Results reveal more advanced levels of moral reasoning for students in the integrated curriculum organized around decision making than for those in the traditional curriculum. (SLD)

  3. Univariate and Multivariate Specification Search Indices in Covariance Structure Modeling.

    Science.gov (United States)

    Hutchinson, Susan R.

    1993-01-01

    Simulated population data were used to compare relative performances of the modification index and C. Chou and P. M. Bentler's Lagrange multiplier test (a multivariate generalization of a modification index) for four levels of model misspecification. Both indices failed to recover the true model except at the lowest level of misspecification. (SLD)

  4. Family Structure and Eating Disorders: The Family Environment Scale and Bulimic-Like Symptoms.

    Science.gov (United States)

    Bailey, Carol A.

    1991-01-01

    Family variables derived from the Family Environment Scale are examined using data from 174 college women at a Pacific Northwest university and 2 universities in Houston (Texas) with varying degrees of bulimia. Subjects' self-reports indicate family dysfunctions, but the study illustrates the complexity of the family's role in bulimia. (SLD)

  5. Children's Recall of Television and Print News: A Media Comparison Study.

    Science.gov (United States)

    van der Molen, Juliette H. Walma; van der Voort, Tom H. A.

    1997-01-01

    Results of a cued-recall test taken by 152 Dutch fourth and sixth graders indicate that children who watch a children's news show on television recall more than those who read the same news in print regardless of reading proficiency or expectation of a memory test. (SLD)

  6. Blacks in Pop Music: A Short Story.

    Science.gov (United States)

    Rickelman, Melinda

    1991-01-01

    A short history of black pop music includes artists who have changed pop music or culture and highlights from the 1920s into the 1980s, from Fats Waller to Michael Jackson. In black pop music, there is a direct line of influence from the sharecropper to the current Top 40. (SLD)

  7. Using Critical Thinking To Conduct Effective Searches of Online Resources.

    Science.gov (United States)

    Brem, Sarah K.; Boyes, Andrea J.

    2000-01-01

    Complements guidelines addressing the mechanics of online searching by considering how treating searching as exercises in critical thinking can improve the use of online resources. Discusses metacognition, hypothesis testing, and argumentation, with illustrative examples and links to tools that facilitate the searching process. (SLD)

  8. A laboratory investigation of colour changes in two contemporary resin composites on exposure to spices.

    Science.gov (United States)

    Yew, H Z; Berekally, T L; Richards, L C

    2013-12-01

    The aim of this study was to evaluate colour stability upon exposure to spices of a nano-filled and a micro-hybrid resin composite finished either with Sof-Lex™ discs (SLD) or against plastic strips (PS). Forty cylindrical specimens of 3 mm thickness were fabricated from Filtek Supreme XT ™ (FS) and Gradia Direct X™ (GD). The top surface of each specimen was polished with SLD while the bottom surface was finished against PS. All samples were immersed in staining solutions (0.1% weight turmeric, paprika and tamarind) and distilled water at 37 °C. Colour after 0, 24, 72 and 168 hours of immersion was recorded with a reflection spectrophotometer using CIE L*a*b* parameters and the results were statistically analysed with repeated measures of ANOVA and Bonferroni post hoc tests. Among all the staining solutions tested, the highest colour deviation was obtained in the turmeric group. FS finished against PS showed significantly more colour changes compared to specimens polished with SLD, while GD finished against PS were found to be more resistant to colour changes. Within the limitations of this study all the spices tested have the potential to stain resin composites with turmeric causing the most significant discolouration. Micro-hybrid and nano-filled resin composites appeared to respond differently to staining by spices when either finished with PS or polished with SLD. © 2013 Australian Dental Association.

  9. The Double Helix: Why Science Needs Science Fiction.

    Science.gov (United States)

    Andreadis, Athena

    2003-01-01

    Discusses why science needs science fiction, commenting on the author's book about science that draws heavily on the "Star Trek" series. The best science, in spite of popular thinking, comes from leaps of intuition, and science fiction provides a creative spark that encourages participation in science. (SLD)

  10. Patterns of Social Expectations among Maori and European Children in New Zealand.

    Science.gov (United States)

    Rotheram-Borus, Mary Jane; Petrie, Keith J.

    1996-01-01

    Assessed social expectations of 163 Maori and European New Zealanders aged 9 and 12 in response to videotaped social encounters. Ethnic differences were greater among younger children. Among Maori children, an enculturated pattern was associated with less assertiveness and lower self-concept, but was not with cross-ethnic acceptance. (SLD)

  11. Delay of behavioral estrus in hamsters and phenobarbital.

    Science.gov (United States)

    Alleva, J J

    1989-01-01

    The onset of behavioral estrus was used as a phase marker of the hamster timing system in SLD 16:8 (dark 20:00-04:00). TZ was injected between 11:00 of cycle day 3 and noon of cycle day 4 when onset of estrus was determined. At no time did injection of TZ cause a phase advance in SLD 16:8. Small delays of estrus resulted from 11:00-16:00 injections but marked delays began with the 17:00 injection. Phenobarbital was injected between noon and 19:30 on cycle day 3. Injections between noon and 16:00 had no effect but all later injections beginning at 17:00 delayed estrus, the 17:30 injection causing the greatest delay. Diazepam also markedly delayed estrus when tested at 17:30. These results with three drugs support results with light pulses that 18:00 in SLD 16:8 marks the same phase of the 24-h hamster timing system as the onset of wheel running does in DD, LL, and WLD. These findings with three GABA potentiators extend to SLD previous evidence based on the onset of wheel running in DD, LL and WLD that GABA may be involved in hamster timekeeping and its responses to light and drugs.

  12. Can You Trust Self-Report Data Provided by Homeless Mentally Ill Individuals?

    Science.gov (United States)

    Calsyn, Robert J.; And Others

    1993-01-01

    Reliability and validity of self-report data provided by 178 mentally ill homeless persons were generally favorable. Self-reports of service use also generally agreed with treatment staff estimates, providing further validity evidence. Researchers and administrators can be relatively confident in using such data. (SLD)

  13. America Y2K: The Obsolescence of Educational Reforms.

    Science.gov (United States)

    Dorn, Sherman

    2000-01-01

    Notes the passing of the deadline for fulfillment of the national education goals in the United States, the beginning of the year 2000, and indicates that pressures on schools to solve social problems will continue to make school reform a politically opportune and very visible issue. (SLD)

  14. Young, Black, and Sentenced To Die: Black Males and the Death Penalty.

    Science.gov (United States)

    Joseph, Janice

    1996-01-01

    Explores the death penalty as imposed on young black males in the United States and examines the disparity in death penalty rates for homicides with black offenders and white victims. States continue to impose the death penalty rather than viewing youth violence as a failure of the social system. (SLD)

  15. School-to-Work Transition in Arizona: Does Public Policy Ignore Social Equality for Rural Populations?

    Science.gov (United States)

    Danzig, Arnold; Vandegrift, Judith A.

    1995-01-01

    Public policy implications for Arizona of the School-to-Work Opportunities Act are explored, specifically with regard to rural areas. It is argued that should additional resources become available to the state, population-based allocations to rural areas are likely to be insufficient for meaningful educational and economic-development reform. (SLD)

  16. Haitian Americans.

    Science.gov (United States)

    Catanese, Anthony V.

    1998-01-01

    Uses 1990 U.S. Census data to show the changing demographic profile of Haitian Americans. Haitian Americans are likely to live along the Atlantic seaboard and to have relatively low, although not the lowest, incomes. However, the demographic mosaic of Haitian Americans is diverse, showing the effects of Haitian national and ethnic history. (SLD)

  17. Surveillance of extensively drug-resistant tuberculosis in Europe, 2003-2007.

    NARCIS (Netherlands)

    Devaux, I.; Manissero, D.; Fernandez de la Hoz, K.; Kremer, K.; Soolingen, D. van

    2010-01-01

    This paper describes the results of second-line drug (SLD) susceptibility tests among multidrug-resistant tuberculosis (MDR TB) cases reported in 20 European countries aiming to identify extensively drug-resistant tuberculosis (XDR TB) cases. A project on molecular surveillance of MDR TB cases was

  18. Extrinsic Rewards and Intrinsic Motivation in Education: Reconsidered Once Again.

    Science.gov (United States)

    Deci, Edward L.; Koestner, Richard; Ryan, Richard M.

    2001-01-01

    Reviews the results of a meta analysis (E. Deci, R. Koestner, and R. Ryan, 1999) that shows that tangible extrinsic rewards do have a substantial undermining effect on intrinsic motivation. Discusses results, which support cognitive evaluation theory, in terms of their relevance for educational practice. (SLD)

  19. The Pervasive Negative Effects of Rewards on Intrinsic Motivation: Response to Cameron (2001).

    Science.gov (United States)

    Deci, Edward L.; Ryan, Richard M.; Koestner, Richard

    2001-01-01

    Replies to commentary by J. Cameron asserting that the negative results of extrinsic reward on intrinsic motivation are limited and avoidable. Suggests that the most recent meta analysis by Cameron and others shares methodological weaknesses with an earlier analysis, lacking ecological validity. (SLD)

  20. Negative Effects of Reward on Intrinsic Motivation--A Limited Phenomenon: Comment on Deci, Koestner, and Ryan (2001).

    Science.gov (United States)

    Cameron, Judy

    2001-01-01

    Prior meta analyses by J. Cameron and other researchers suggested that the negative effects of extrinsic reward on intrinsic motivation were limited and avoidable. E. Deci and others (2001) suggested that the analyses were flawed. This commentary makes the case that there is no inherent negative property of reward. (SLD)

  1. When Paradigms Clash: Comments on Cameron and Pierce's Claim That Rewards Do Not Undermine Intrinsic Motivation.

    Science.gov (United States)

    Ryan, Richard M.; Deci, Edward L.

    1996-01-01

    The conclusion of J. Cameron and W. D. Pierce that rewards do not pose a threat to intrinsic motivation (1994) is a misrepresentation of the literature based on a flawed meta-analysis. Their analysis is more an attempt to defend behaviorist turf rather than meaningful consideration of relevant data and issues. (Author/SLD)

  2. Variables Affecting Students' Intrinsic Motivation for School Mathematics: Two Empirical Studies Based on Deci and Ryan's Theory on Motivation.

    Science.gov (United States)

    Valas, Harald; Sovik, Nils

    1993-01-01

    Effects of the controlling strategies of the mathematics teacher on student achievement, interest, and mathematics self-concept were demonstrated in a longitudinal study involving 161 seventh graders and 164 eighth graders. This empirical test of the self-determination theory of Deci and Ryan provides insight into student motivation. (SLD)

  3. Caribbean Music.

    Science.gov (United States)

    Dean, Kris

    1991-01-01

    The Caribbean is a rich breeding ground for African-derived music. A synopsis is given of the music of the following countries and styles: (1) Jamaica; (2) Trinidad and Tobago; (3) Calypso; (4) steel pan; (5) Haiti; (6) Dominican Republic; (7) Cuba; (8) Puerto Rico; and (9) other islands. (SLD)

  4. South African Medical Journal - Vol 85, No 11 (1995)

    African Journals Online (AJOL)

    Erratum: Eradication rates and ulcer healing with two weeks lansoprazole based H. pylori (hp) eradication therapy · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. lA Louw, C van Rensburg, SK Price, AK Cariem, E Wilken, SlD O'Keefe, W Lucke, IN Marks ...

  5. Anti-D'Souza: The End of Racism and the Asian American [book review].

    Science.gov (United States)

    Prashad, Vijay

    1998-01-01

    Reviews Dinesh D'Souza's "The End of Racism: Principles for a Multiracial Society" (1995), exploring his neoconservative ideology in the context of concepts of the underclass and what it means to be Asian American or an immigrant. D'Souza perpetuates the Model Minority thesis, which is itself a form of inferential racism. (SLD)

  6. Polarized Light Sources for photocathode electron guns at SLAC

    International Nuclear Information System (INIS)

    Woods, M.; Frisch, J.; Witte, K.; Zolotorev, M.

    1992-12-01

    We describe current and future Polarized Light Sources at SLAC for use with photocathode electron guns to produce polarized electron beams. The SLAC experiments SLD and E142 are considered, and are used to define the required parameters for the Polarized Light Sources

  7. A Comparison of Procedures for Content-Sensitive Item Selection in Computerized Adaptive Tests.

    Science.gov (United States)

    Kingsbury, G. Gage; Zara, Anthony R.

    1991-01-01

    This simulation investigated two procedures that reduce differences between paper-and-pencil testing and computerized adaptive testing (CAT) by making CAT content sensitive. Results indicate that the price in terms of additional test items of using constrained CAT for content balancing is much smaller than that of using testlets. (SLD)

  8. Gender Issues in Education for Science and Technology: Current Situation and Prospects for Change.

    Science.gov (United States)

    Acker, Sandra; Oatley, Keith

    1993-01-01

    Prevailing explanations for the underrepresentation of females in mathematics, science, and technology in school and the workplace are reviewed, and disadvantageous features of higher education and the workplace are discussed. Educational innovation in the area of gender equity is considered, and questions are raised for further research. (SLD)

  9. Mitochondrial DNA Marker EST00083 Is Not Associated with High vs. Average IQ in a German Sample.

    Science.gov (United States)

    Moises, Hans W.; Yang, Liu; Kohnke, Michael; Vetter, Peter; Neppert, Jurgen; Petrill, Stephen A.; Plomin, Robert

    1998-01-01

    Tested the association of a mitochondrial DNA marker (EST00083) with high IQ in a sample of 47 German adults with high IQ scores and 77 adults with IQs estimated at lower than 110. Results do not support the hypothesis that high IQ is associated with this marker. (SLD)

  10. Toward a Definition of Sexual Harassment in the Workplace.

    Science.gov (United States)

    Vance, Suzy; Wendt, Anne

    2000-01-01

    Developed a construct of sexual issues/sexual harassment in the workplace based on survey responses of 101 participants in a training program on sexual harassment before the training and 111 participants after the training. Results show a progression of attitudes toward behaviors from safe to most dangerous. (SLD)

  11. Radiographic diagnosis of scapholunate dissociation among intra-articular fractures of the distal radius: interobserver reliability

    NARCIS (Netherlands)

    Gradl, Gertraud; Neuhaus, Valentin; Fuchsberger, Thomas; Guitton, Thierry G.; Prommersberger, Karl-Josef; Ring, David; Wahegaonkar, Abhijeet L.; Shafritz, Adam B.; Garcia, Aida E.; Caputo, Andrew E.; Terrono, Andrew L.; Spoor, Andy B.; Eschler, Anica; Vochteloo, Anne J. H.; Beumer, Annechien; Barquet, Antonio; Kristan, Anze; van der Zwan, Arnard L.; Berner, Arne; Ilyas, Asif; Jubel, Axel; Sutker, Ben; Nolan, Betsy M.; Petrisor, Brad; Cross, Brian J.; Wills, Brian P. D.; Barreto, Camilo J. R.; Fernandes, Carlos H.; Swigart, Carrie; Zalavras, Charalampos; Goldfarb, Charles A.; Cassidy, Charles; Eaton, Charles; Wilson, Chris; Cheng, Christine J.; Wall, Christopher J.; Walsh, Christopher J.; Jones, Christopher M.; Garnavos, Christos; Klostermann, Cyrus; Kirkpatrick, D. Kay; Eygendaal, Denise; Verbeek, Diederik O. F.; Beeres, Frank J. P.; Thomas, George; Ponsen, Kornelis J.; van den Bekerom, Michel P. J.; Schep, Niels; Kloen, Peter; Haverlag, Robert

    2013-01-01

    To evaluate the reliability and accuracy of diagnosis of scapholunate dissociation (SLD) among AO type C (compression articular) fractures of the distal radius. A total of 217 surgeons evaluated 21 sets of radiographs with type C fractures of the distal radius for which the status of the

  12. Illustrations as Adjuncts to Prose: A Text-Appropriate Processing Approach.

    Science.gov (United States)

    Waddill, Paula J.; And Others

    1988-01-01

    The effects of pictorial illustrations on memory for text were studied in 144 college students. Two experiments indicated that illustrations serve a supplementary function; adjunct pictures alone, without special processing instructions, do not help learners encode information that is not normally encoded in the first place. (SLD)

  13. Functions, Use and Effects of Embedded Support Devices in Printed Distance Learning Materials.

    Science.gov (United States)

    Martens, Rob; And Others

    1996-01-01

    To support distance learning, printed materials for the course are enriched with embedded support devices (ESD) such as schemes, illustrations, examples, questions, or margin texts. Results of 3 studies involving 900 Dutch university students indicated that students used and appreciated ESD, and that they led to better study results. (SLD)

  14. Cognitive Strategies for Learning from Static and Dynamic Visuals.

    Science.gov (United States)

    Lewalter, D.

    2003-01-01

    Studied the effects of including static or dynamic visuals in an expository text on a learning outcome and the use of learning strategies when working with these visuals. Results for 60 undergraduates for both types of illustration indicate different frequencies in the use of learning strategies relevant for the learning outcome. (SLD)

  15. Nonverbal imitation skills in children with specific language delay.

    Science.gov (United States)

    Dohmen, Andrea; Chiat, Shula; Roy, Penny

    2013-10-01

    Research in children with language problems has focussed on verbal deficits, and we have less understanding of children's deficits with nonverbal sociocognitive skills which have been proposed to be important for language acquisition. This study was designed to investigate elicited nonverbal imitation in children with specific language delay (SLD). It is argued that difficulties in nonverbal imitation, which do not involve the processing of structural aspects of language, may be indicative of sociocognitive deficits. Participants were German-speaking typically developing children (n=60) and children with SLD (n=45) aged 2-3 ½ years. A novel battery of tasks measured their ability to imitate a range of nonverbal target acts that to a greater or lesser extent involve sociocognitive skills (body movements, instrumental acts on objects, pretend acts). Significant group differences were found for all body movement and pretend act tasks, but not for the instrumental act tasks. The poorer imitative performance of the SLD sample was not explained by motor or nonverbal cognitive skills. Thus, it appeared that the nature of the task affected children's imitation performance. It is argued that the ability to establish a sense of connectedness with the demonstrator was at the core of children's imitation difficulty in the SLD sample. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Motivational Influences on Cognition: Task Involvement, Ego Involvement, and Depth of Information Processing.

    Science.gov (United States)

    Graham, Sandra; Golan, Shari

    1991-01-01

    Task involvement and ego involvement were studied in relation to depth of information processing for 126 fifth and sixth graders in 2 experiments. Ego involvement resulted in poorer word recall at deep rather than shallow information processing levels. Implications for the study of motivation are discussed. (SLD)

  17. Statistical Process Control in the Practice of Program Evaluation.

    Science.gov (United States)

    Posavac, Emil J.

    1995-01-01

    A technique developed to monitor the quality of manufactured products, statistical process control (SPC), incorporates several features that may prove attractive to evaluators. This paper reviews the history of SPC, suggests how the approach can enrich program evaluation, and illustrates its use in a hospital-based example. (SLD)

  18. Aging, Brain Size, and IQ.

    Science.gov (United States)

    Bigler, Erin D.; And Others

    1995-01-01

    Whether cross-sectional rates of decline for brain volume and the Performance Intellectual Quotient of the Wechsler Adult Intelligence Scale-Revised were equivalent over the years 16 to 65 was studied with 196 volunteers. Results indicate remarkably similar rates of decline in perceptual-motor functions and aging brain volume loss. (SLD)

  19. Anti-Sweatshop Groups Find It Difficult To Turn Campus Idealism into Real Change.

    Science.gov (United States)

    Van der Werf, Martin

    2001-01-01

    Describes some of the efforts colleges have undertaken to ensure that clothing with college logos is not produced in sweatshops. Outlines work by the Fair Labor Association and the Workers Rights Consortium, organizations to which many colleges belong, to set up programs to monitor factories in the United States and other countries. (SLD)

  20. The Affect Reading Scale: A Method of Measuring Prerequisites for Empathy.

    Science.gov (United States)

    Holm, Ulla

    1996-01-01

    A Swedish empathy test for professional helpers, the Affect Reading Scale, was developed and tested on several occasions with 1000 caregivers in different sectors. Results support the conceptual validity of the scale and demonstrate that it is responsive to educational experiences that influence empathy. (SLD)

  1. Current and Developing Conceptions of Use: Evaluation Use TIG Survey Results.

    Science.gov (United States)

    Preskill, Hallie; Caracelli, Valerie

    1997-01-01

    A survey was sent to members of the Evaluation Use Topical Interest Group (TIG) to determine their perceptions about and experiences with evaluation use. Responses from 282 members show agreement on the major purposes of evaluation and an increased use of performance-results oriented and formative evaluations. (SLD)

  2. A Computerized Approach to Trickle-Process, Random Assignment.

    Science.gov (United States)

    Braucht, G. Nicholas; Reichardt, Charles S.

    1993-01-01

    Procedures for implementing random assignment with trickle processing and ways they can be corrupted are described. A computerized method for implementing random assignment with trickle processing is presented as a desirable alternative in many situations and a way of protecting against threats to assignment validity. (SLD)

  3. Educational Change by Commission: Attempting "Trickle Down" Reform.

    Science.gov (United States)

    Ginsberg, Rick; Wimpelberg, Robert K.

    1987-01-01

    The processes and procedures of national commissions on education are discussed. Elements of commonality are presented with a review of competing explanations of the popularity of such commissions. A sociopolitical thesis of educational reform through commissions is advanced, based on the "trickle down" theory of economics. (SLD)

  4. Assessment of Self-Reported Anger Expression in Youth.

    Science.gov (United States)

    Musante, Linda; Treiber, Frank A.; Davis, Harry C.; Thompson, William O.; Waller, Jennifer L.

    1999-01-01

    Findings related to internal consistency, temporal stability, and principal components structures suggest that the Anger Expression Scale (C. Spielberger and others, 1985) and the Pediatric Anger Expression Scale (G. Jacobs and others, 1989), studied with a sample of 415 youth with a mean age of 14.7 years are acceptably reliable. (SLD)

  5. Academic Achievement and Memory Differences among Specific Learning Disabilities Subtypes

    Science.gov (United States)

    Carmichael, Jessica A.; Fraccaro, Rebecca L.; Miller, Daniel C.; Maricle, Denise E.

    2014-01-01

    Reading, writing, and math are academic skills involving a number of different executive functions, particularly working memory. Children with specific learning disabilities (SLD) may present myriad academic difficulties, depending on their specific area(s) of processing weakness. is study examined differences in academic achievement and working…

  6. A Taxonomy of Latent Structure Assumptions for Probability Matrix Decomposition Models.

    Science.gov (United States)

    Meulders, Michel; De Boeck, Paul; Van Mechelen, Iven

    2003-01-01

    Proposed a taxonomy of latent structure assumptions for probability matrix decomposition (PMD) that includes the original PMD model and a three-way extension of the multiple classification latent class model. Simulation study results show the usefulness of the taxonomy. (SLD)

  7. Special Feature: Epistemological Paradigms in Evaluation: Implications for Practice. Section 3: "Paradigm Complementarity" Case Studies.

    Science.gov (United States)

    Kamis-Gould, Edna; And Others

    1991-01-01

    Three studies are presented, which illustrate situations in which researchers and funders agreed on the primacy of either the experimental or pragmatic paradigms but acknowledged a role for the other. The studies involved evaluations of mental health care, information systems, and a curriculum for behavioral and academic dysfunction. (SLD)

  8. The Politics of Self-Esteem.

    Science.gov (United States)

    Kahne, Joseph

    1996-01-01

    Before analysts can assess self-esteem as a goal for policy and practice, they must consider the ideological orientations of those who use the term and the cultural norms that shape the debate. Explicit attention to the politics surrounding self-esteem is needed to evaluate the use of the term in policy contexts. (Author/SLD)

  9. Teaching about Domestic Violence: Strategies for Empowerment.

    Science.gov (United States)

    Gardner, Saundra

    1993-01-01

    Offers the author's experiences in teaching a college-level domestic violence sociology course, presenting specific strategies and a description of the syllabus. The course presents a feminist analysis of domestic violence and examines how the patriarchal structure and ideology of society create and perpetuate violence. (SLD)

  10. Black-Brown Relations: Are Alliances Possible?

    Science.gov (United States)

    Klor de Alva, J. Jorge; West, Cornel

    1997-01-01

    Dialogue between Cornel West and Jorge Klor de Alva explores the question of black-brown alliances, those between African Americans and Hispanic Americans. If minority groups can put aside the difference of skin color and join to combat economic and social racism, they can have far-reaching and meaningful impacts on society. (SLD)

  11. An Aspect of Political Socialization of Student Movement Participants in Korea.

    Science.gov (United States)

    Park, Byeong-chul

    1993-01-01

    Tests hypotheses from lineage socialization and generation unit perspectives on Korean student protest participation using 360 self-administered questionnaires collected at 3 Korean universities. Results indicate that these hypotheses are not mutually exclusive but support the generation unit model. (SLD)

  12. On the Reliability of Implicit and Explicit Memory Measures.

    Science.gov (United States)

    Buchner, Axel; Wippich, Werner

    2000-01-01

    Studied the reliability of implicit and explicit memory tests in experiments involving these tests. Results with 168, 84, 120, and 128 undergraduates show that methodological artifacts may cause implicit memory tests to have lower reliability than explicit memory tests, but that implicit tests need not necessarily be less reliable. (SLD)

  13. Sex Differences in Objective and Projective Dependency Tests: A Meta-Analytic Review.

    Science.gov (United States)

    Bornstein, Robert F.

    1995-01-01

    A meta-analysis of 97 studies published since 1950 that assessed sex differences in scores on objective and projective dependency tests indicated that women consistently obtained higher dependency scores on objective tests, and men obtained higher scores on projective tests. Findings are discussed in terms of sex role socialization. (SLD)

  14. Construct Validity of Three Self-Report Measures of Creativity.

    Science.gov (United States)

    Fleenor, John W.; Taylor, Sylvester

    1994-01-01

    Relations were examined among the CPI Creativity Scale (CPI-CT), the MBTI Creativity Index (MBTI-CI), and the Kirton Adaption-Innovation Inventory (KAI; a style measure of behavioral preference) for samples of 431 to 12,115 managers. KAI scores were related to CPI-CT and MBTI-CI creativity levels. (SLD)

  15. Academic Self-Esteem and Perceived Validity of Grades: A Test of Self-Verification Theory.

    Science.gov (United States)

    Okun, Morris A.; Fournet, Lee M.

    1993-01-01

    The hypothesis derived from self-verification theory that semester grade point average would be positively related to perceived validity of grade scores among high self-esteem undergraduates and inversely related for low self-esteem students was not supported in a study with 281 undergraduates. (SLD)

  16. Conditional Standard Errors of Measurement for Scale Scores.

    Science.gov (United States)

    Kolen, Michael J.; And Others

    1992-01-01

    A procedure is described for estimating the reliability and conditional standard errors of measurement of scale scores incorporating the discrete transformation of raw scores to scale scores. The method is illustrated using a strong true score model, and practical applications are described. (SLD)

  17. Empirical Bayes Approaches to Multivariate Fuzzy Partitions.

    Science.gov (United States)

    Woodbury, Max A.; Manton, Kenneth G.

    1991-01-01

    An empirical Bayes-maximum likelihood estimation procedure is presented for the application of fuzzy partition models in describing high dimensional discrete response data. The model describes individuals in terms of partial membership in multiple latent categories that represent bounded discrete spaces. (SLD)

  18. Cognitive Dissonance Reduction as Constraint Satisfaction.

    Science.gov (United States)

    Shultz, Thomas R.; Lepper, Mark R.

    1996-01-01

    It is argued that the reduction of cognitive dissonance can be viewed as a constraint satisfaction problem, and a computational model of the process of consonance seeking is proposed. Simulations from this model matched psychological findings from the insufficient justification and free-choice paradigms of cognitive dissonance theory. (SLD)

  19. For the Sake of the Children.

    Science.gov (United States)

    Gill, Richard T.

    1992-01-01

    Effects of divorce on children are reviewed, acknowledging two contradictory trends. On one hand, it is increasingly recognized that the intact biological parent family offers many advantages. On the other hand, there is increasing acceptance that divorce can be better than having parents stay together for their children's sake. (SLD)

  20. Effects of Remarriage Following Divorce on the Academic Achievement of Children.

    Science.gov (United States)

    Jeynes, William H.

    1999-01-01

    Used data from the National Educational Longitudinal Survey to study the effects of remarriage following divorce on children's academic achievement. Results indicate that children from reconstituted families score no higher, and often lower than children of divorce from single-parent families. (SLD)

  1. High-Conflict Divorce.

    Science.gov (United States)

    Johnston, Janet R.

    1994-01-01

    Reviews available research studies of high-conflict divorce and its effects on children. Factors believed to contribute to high-conflict divorce are explored, and a model of their interrelationships is proposed. Dispute resolution, intervention, and prevention programs are discussed, and implications for social policy are outlined. (SLD)

  2. Keeping Our Cultural and Linguistic Heritage Alive: A Canadian Literary Experience.

    Science.gov (United States)

    Mylopoulos, Chryssafi

    1992-01-01

    Describes how multicultural library services have contributed to the promotion, support, and preservation of the cultural and linguistic identity of the community being served, using the Public Library of Scarborough in Ontario (Canada) as a case study. Observation reveals the importance of commitment, planning, and methodology. (SLD)

  3. Understanding Youth's Health-Compromising Behaviors in Germany: An Application of the Risk-Behavior Framework.

    Science.gov (United States)

    Hazard, Barbara P.; Lee, Che-Fu

    1999-01-01

    Analyzed the health-compromising behaviors of German youth using responses of 2,330 seventh, eighth, and ninth graders from the German Youth Study. Smoking and drinking are not seen by these students as health-threatening behaviors, but as socially appealing behaviors. Discusses implications for health education. (SLD)

  4. The Role of International Law: Formulating International Legal Instruments and Creating International Institutions.

    Science.gov (United States)

    Szasz, Paul C.

    1991-01-01

    Using as a basis the threat of climatic change resulting from global warming, this article considers the functions that might be assigned to an international regime. For each function individually and collectively, the instruments and institutions that would be required for the various processes are examined. (SLD)

  5. Guidelines, Criteria, and Rules of Thumb for Evaluating Normed and Standardized Assessment Instruments in Psychology.

    Science.gov (United States)

    Cicchetti, Domenic V.

    1994-01-01

    In the context of developing assessment instruments in psychology, issues of standardization, norming procedures, and test reliability and validity are discussed. Criteria, guidelines, and rules of thumb are provided to help the clinician with instrument selection for a given psychological assessment. (SLD)

  6. Conflict Resolution and Peer Mediation Programs in Elementary and Secondary Schools: A Review of the Research.

    Science.gov (United States)

    Johnson, David W.; Johnson, Roger T.

    1996-01-01

    A review of studies of conflict and conflict resolution training in schools finds evidence suggesting that untrained students often use strategies with destructive outcomes. After training, outcomes of conflict are more likely to be constructive and students are more able to resolve their own conflicts. (SLD)

  7. Physical Activity and Adolescent Female Psychological Development.

    Science.gov (United States)

    Covey, Linda A.; Feltz, Deborah L.

    1991-01-01

    Relationships between self-reported past and present physical activity levels and self-image, sense of mastery, gender role identity, self-perceived physical ability, and self-perceived attractiveness were studied for 149 female high school sophomores, juniors, and seniors. Results are discussed in terms of adolescent emotional health. (SLD)

  8. Gender Gaps in Cincinnati Public Schools, Then and Now.

    Science.gov (United States)

    Bertaux, Nancy E.; Gerring, Lori F.

    1994-01-01

    Explores the gender gap in salaries and promotions among Cincinnati (Ohio) public school teachers from the beginning of the school system in 1830 to 1991. Current data show that, although increasing numbers of women are being promoted to principal, the proportion still lags behind that of men. (SLD)

  9. Benefits of Multiple Methods for Evaluating HIV Counseling and Testing Sites in Pennsylvania.

    Science.gov (United States)

    Encandela, John A.; Gehl, Mary Beth; Silvestre, Anthony; Schelzel, George

    1999-01-01

    Examines results from two methods used to evaluate publicly funded human immunodeficiency virus (HIV) counseling and testing in Pennsylvania. Results of written mail surveys of all sites and interviews from a random sample of 30 sites were similar in terms of questions posed and complementary in other ways. (SLD)

  10. Proyecto Aurora: Building a Community of Women.

    Science.gov (United States)

    Noya, Gladys R. Capella

    1997-01-01

    Describes the development of Proyecto Aurora, a program to develop and implement educational, support, and research programs to benefit low-income women in Puerto Rico. Portraits of some clients illustrate the rewards and challenges of working with this community and furthering their educational experiences and opportunities. (SLD)

  11. Computerized and Paper-and-Pencil Versions of the Rosenberg Self-Esteem Scale: A Comparison of Psychometric Features and Respondent Preferences.

    Science.gov (United States)

    Vispoel, Walter P.; Boo, Jaeyool; Bleiler, Timothy

    2001-01-01

    Evaluated the characteristics of computerized and paper-and-pencil versions of the Rosenberg Self-Esteem Scale (SES) using scores for 224 college students. Results show that mode of administration has little effect on the psychometric properties of the SES although the computerized version took longer and was preferred by examinees. (SLD)

  12. The Learning Community: A Program to Address Issues of Academic Achievement and Retention.

    Science.gov (United States)

    Hummel, Mary; Steele, Claude

    1996-01-01

    Describes the 21st Century Program at the University of Michigan, a program to address issues of academic achievement and student retention in higher education. The conceptual basis for this program comes from C. Steele's work that finds that there are disruptive pressures tied to racial stereotypes that in turn diminish academic performance. (SLD)

  13. Intergenerational Patterns of Values and Autonomy Expectations in Cultures of Relatedness and Separatedness.

    Science.gov (United States)

    Stewart, Sunita Mahtani; Bond, Michael Harris; Deeds, Osvelia; Chung, Siu Fung

    1999-01-01

    Investigated value priorities and autonomy expectations in 59 pairs of Caucasian and 66 pairs of Asian teenagers and their mothers in Hong Kong. Findings support models that predict persistent family interdependence despite adoption of many individualist values in modernizing collectivist cultures. (SLD)

  14. By Virtue of Being Human.

    Science.gov (United States)

    King, S. Claire

    1998-01-01

    Describes some efforts to ensure that teachers in the United States understand and teach about the Universal Declaration of Human Rights. Although the declaration is 50 years old, it is not as well known in the United States as it is in other parts of the world. Teaching its content and meaning to children is discussed. (SLD)

  15. Economic Justice: Necessary Condition for Human Rights.

    Science.gov (United States)

    Cloud, Fred

    1993-01-01

    Economic justice means taking the personhood of poor people into account; respecting their needs, personal ambitions, rights, and dignity; and affording equal opportunity and equal access to education, health care, housing, and jobs. Examples of injustice to minority groups are provided, citing the Universal Declaration of Human Rights. (SLD)

  16. The Academic Self-Schema: An Experimental Illustration.

    Science.gov (United States)

    Martinot, Delphine; Monteil, Jean-Marc

    1995-01-01

    Existence of an academic self-schema was studied with 142 French eighth and ninth graders and 50 high school students. Both success and failure schemas appeared to exist, but the academic failure schema was only observed for the variable self-description time. (SLD)

  17. Stressful Life Events: Moderators of the Relationships of Gender and Gender Roles to Self-Reported Depression and Suicidality among College Students.

    Science.gov (United States)

    Waelde, Lynn C.; And Others

    1994-01-01

    Examines whether relationships of self-reported depression and suicidality to gender roles or gender are moderated by stressful life events. Results with 290 female and 247 male undergraduates support the androgyny model of adjustment and a self-schema model of depression. (SLD)

  18. Development of a Scale to Measure Attitudes toward Inclusive Education.

    Science.gov (United States)

    Wilczenski, Felicia L.

    1995-01-01

    The Attitudes toward Inclusive Education Scale (ATIES) is a measure of positive and negative attitudes toward integrating children with disabilities into regular classes. Results with 445 teachers show that the ATIES defines a unidimensional attitudinal variable and yields interval measures of attitudes toward inclusive education. (SLD)

  19. A Tale of Two Classes: The Black Poor and the Black Middle Class.

    Science.gov (United States)

    Lewin, Arthur

    1991-01-01

    To understand the African-American family, the African-American poor and middle class must be investigated. Extra costs mean that it is much harder for African Americans to reach the middle class. Ways to improve the economic status of African-American families and to increase the middle class are discussed. (SLD)

  20. Training School Psychologists to Identify Specific Learning Disabilities: A Content Analysis of Syllabi

    Science.gov (United States)

    Barrett, Courtenay A.; Cottrell, Joseph M.; Newman, Daniel S.; Pierce, Benjamin G.; Anderson, Alisha

    2015-01-01

    Approximately 2.4 million children receive special education services for specific learning disabilities (SLDs), and school psychologists are key contributors to the SLD eligibility decision-making process. The Individuals with Disabilities Education Act (2004) enabled local education agencies to use response to intervention (RTI) instead of the…

  1. Edge-Assignment and Figure-Ground Segmentation in Short-Term Visual Matching.

    Science.gov (United States)

    Driver, Jon; Baylis, Gordon

    1996-01-01

    Eight experiments involving 99 college students examined the role of edge-assignment in a contour matching task. Edge-matching performance was not based solely on a raw description of the edges themselves. Results suggest a pervasive tendency within the visual system to go beyond the edges toward figural shapes. (SLD)

  2. Music Preferences, Personality Style, and Developmental Issues of Adolescents.

    Science.gov (United States)

    Schwartz, Kelly D.; Fouts, Gregory T.

    2003-01-01

    Studied the personality characteristics and developmental issues of three groups of adolescent music listeners divided by preferred type of music. Findings for 164 adolescents show that each of the three music preference groups is inclined to demonstrate a unique profile of personality dimensions and developmental issues. (SLD)

  3. Intelligence and Savant Syndrome: Is the Whole Greater than the Sum of the Fragments?

    Science.gov (United States)

    Nettelbeck, Ted; Young, Robyn

    1996-01-01

    It is argued that skills displayed by savants are not intelligent and that H. Gardner's theory of multiple intelligences fails by overstating the relevance of savant skills and because it disregards research evidence for a general factor. Intelligence theory must compile a structure that accounts for savant skills and intelligence. (SLD)

  4. Adolescence, Advertising, and the Ideology of Menstruation.

    Science.gov (United States)

    Merskin, Debra

    1999-01-01

    Conducted a content analysis of 10 years of feminine hygiene advertisements in "Seventeen" and "Teen" magazines. Finds that advertising copy in these magazines works to dispel myths about menstruation but that few black models are shown. Discusses advertising as an element of socialization for adolescent girls. (SLD)

  5. Substance Use and Personal Adjustment among Disadvantaged Teenagers: A Six-Month Prospective Study.

    Science.gov (United States)

    Luthar, Suniya S.; Cushing, Gretta

    1997-01-01

    Associations between substance abuse and emotional and behavioral adjustment were examined in a two-wave longitudinal design for 138 inner-city ninth graders. Drug use showed associations in expected directions with all indices of adjustment except for peer-related sociability. Implications for interventions are discussed. (SLD)

  6. Explaining Feast or Famine in Randomized Field Trials: Medical Science and Criminology Compared.

    Science.gov (United States)

    Shepherd, Jonathan P.

    2003-01-01

    Discusses the contrast between the frequency of randomized clinical trials in the health sciences and the relative famine of such studies in criminology. Attributes this difference to the contexts in which research is done and the difference in the status of situational research in the two disciplines. (SLD)

  7. A review of 4π Cerenkov ring imaging detectors

    International Nuclear Information System (INIS)

    Leith, D.W.G.S

    1989-06-01

    The design choices for 4π ring imaging Cerenkov counters -- both those of principle and those of practice -- are reviewed. The progress in construction and the performance of the devices being built for DELPHI and SLD are discussed. 13 refs., 22 figs

  8. Impact of Alzheimer's-Type Dementia and Information Source on the Assessment of Depression.

    Science.gov (United States)

    Gilley, David W.; And Others

    1995-01-01

    The level of agreement between the patient and a collateral source with regard to depressive symptomatology was compared for 185 patients with Alzheimer's-type dementia (AD), 57 patients with Parkinson's disease, and 54 nondemented geriatric referrals. Findings highlight the potential insensitivity of patient report in AD. (SLD)

  9. Roundup of Recent Releases on the Gay and Lesbian Experience.

    Science.gov (United States)

    Azzolina, David S.

    1993-01-01

    The 42 titles of this nonfiction bibliography are grouped as follows: (1) collected works; (2) general works; (3) autobiography; (4) cultural studies; (5) history; (6) legal and military issues; (7) literature, film, and the arts; (8) philosophy and religion; (9) science; and (10) vocational issues. (SLD)

  10. Numero Uno.

    Science.gov (United States)

    Palmaffy, Tyce

    1998-01-01

    Describes the Ysleta School District, El Paso (Texas), which has, despite high poverty and a constant inflow of immigrants with limited English skills, the best test scores of any urban district in Texas. In spite of the district's accomplishments, the school board seems determined to oust the current superintendent. (SLD)

  11. Asian American Cultural Resistance.

    Science.gov (United States)

    Libretti, Tim

    1997-01-01

    Explores the encounter of Marxism and Asian American literary theory and imagines an Asian American Marxism. To do so requires theorizing race, class, and gender not as substantive categories of antagonisms but as complementary and coordinated elements of a totality of social relations structuring racial patriarchal capitalism. (SLD)

  12. The Role of Item Feedback in Self-Adapted Testing.

    Science.gov (United States)

    Roos, Linda L.; And Others

    1997-01-01

    The importance of item feedback in self-adapted testing was studied by comparing feedback and no feedback conditions for computerized adaptive tests and self-adapted tests taken by 363 college students. Results indicate that item feedback is not necessary to realize score differences between self-adapted and computerized adaptive testing. (SLD)

  13. Antecedents of Toddler Gender Segregation: Cognitive Consonance, Gender-Typed Toy Preferences and Behavioral Compatibility.

    Science.gov (United States)

    Moller, Lora C.; Serbin, Lisa A.

    1996-01-01

    Possible antecedents of toddler gender separation were studied with 57 toddlers with a mean age of 35 months. There were no differences between gender-segregating and nonsegregating children regarding gender toy preferences or gender awareness, but teachers saw gender-segregating girls as more socially sensitive. (SLD)

  14. Child Sacrifice: Black America's Price of Paying the Media Piper.

    Science.gov (United States)

    Orange, Carolyn M.; George, Amiso M.

    2000-01-01

    Explores the sacrifice of African American children to the broadcast media and video games in terms of the players ("media pipers"), the messages ("piping"), and the consequences to children. Proposes some solutions for the problems associated with excessive television viewing and undesirable programming. (SLD)

  15. Perceived Competence Scale for Children: Testing for Factorial Validity and Invariance across Age and Ability.

    Science.gov (United States)

    Byrne, Barbara M.; Schneider, Barry H.

    1988-01-01

    For 241 normal and 132 gifted fifth graders and 113 normal and 117 gifted seventh graders in Ottawa (Ontario), exploratory and confirmatory factor analyses investigated the factorial validity of the Perceived Competence Scale for Children (PCSC). Overall, the PCSC demonstrated sound psychometric properties. (SLD)

  16. Globalization, Education, and Citizenship: Solidarity versus Markets?

    Science.gov (United States)

    Torres, Carlos Alberto

    2002-01-01

    Suggests that globalization places limits on state autonomy and national sovereignty, affecting education in various ways. Educational policy and its contributions to citizenship, democracy, and multiculturalism will face unprecedented challenges if the logic of fear, exacerbated by the events of September 11, 2001 prevails. (Author/SLD)

  17. The Culture of Redemption and the Administration of Freedom as Research.

    Science.gov (United States)

    Popkewitz, Thomas S.

    1998-01-01

    Argues that today's educational reform image of the teacher who collaborates and constructs knowledge in a decentralized system of education is used in different ideological images of school reform. Four principles of reason that function as unquestioned assumptions in reform are discussed. (SLD)

  18. The Theoretical and Methodological Crisis of the Afrocentric Conception.

    Science.gov (United States)

    Banks, W. Curtis

    1992-01-01

    Defines the theory of the Afrocentric conception, and comments on Afrocentric research methodology. The Afrocentric conception is likely to succeed if it constructs a particularist theory in contrast to cross-cultural relativism and because it relies on the methodology of the absolute rather than the comparative. (SLD)

  19. Assessing Students' Attitudes and Achievements in a Multicultural and Multilingual Science Classroom.

    Science.gov (United States)

    Hadi-Tabassum, Samina

    1999-01-01

    Takes a qualitative and quantitative look at the curriculum and teaching of a two-way immersion eighth-grade solar energy science classroom and examines its implications for education policy and reform. Results for a class of 25 students indicate that the approach increases the retention rate of Hispanic students. (SLD)

  20. Computers in the Cop Car: Impact of the Mobile Digital Terminal Technology on Motor Vehicle Theft Clearance and Recovery Rates in a Texas City.

    Science.gov (United States)

    Nunn, Samuel

    1993-01-01

    Assessed the impact of the Mobile Digital Terminal technology (computers used to communicate with remote crime databases) on motor vehicle theft clearance (arresting a perpetrator) and recovery rates in Fort Worth (Texas), using a time series analysis. Impact has been ambiguous, with little evidence of improved clearance or recovery. (SLD)

  1. Technology for the Struggling Reader: Free and Easily Accessible Resources

    Science.gov (United States)

    Berkeley, Sheri; Lindstrom, Jennifer H.

    2011-01-01

    A fundamental problem for many struggling readers, their parents, and their teachers is that there are few benchmarks to guide decision making about assistive technological supports when the nature of a disability is cognitive (e.g., specific learning disability, SLD) rather than physical. However, resources such as the National Center on…

  2. Complexity of Geometric Inductive Reasoning Tasks: Contribution to the Understanding of Fluid Intelligence.

    Science.gov (United States)

    Primi, Ricardo

    2002-01-01

    Created two geometric inductive reasoning matrix tests by manipulating four sources of complexity orthogonally. Results for 313 undergraduates show that fluid intelligence is most strongly associated with the part of the central executive component of working memory that is related to controlled attention processing and selective encoding. (SLD)

  3. Development of low noise preamplifier for the detection and position determination of single electrons in a Cerenkov Ring Imaging Detector by charge division

    International Nuclear Information System (INIS)

    Spencer, E.; Coyle, P.; Williams, D

    1987-10-01

    A preamplifier having 500 electrons noise (rms) has been developed for the detection and location of single electrons in a CRID detector at the SLD. A single channel contains preamp, RC-CR shaper, gain adjustment, driver, and calibration circuitry. Noise and linearity measurements are presented

  4. Australian Lesbian Teachers--A Reflection of Homophobic Harassment of High School Teachers in New South Wales Government Schools.

    Science.gov (United States)

    Ferfolja, Tania

    1998-01-01

    Examines the homophobic harassment of lesbian teachers working in government high schools in Sydney (Australia). The experiences of six lesbian teachers show that harassment based on sexual orientation is often an invisible issue in schools, as is homosexuality in general. Recommendations are made for teaching about homosexual tolerance. (SLD)

  5. A Variable-Selection Heuristic for K-Means Clustering.

    Science.gov (United States)

    Brusco, Michael J.; Cradit, J. Dennis

    2001-01-01

    Presents a variable selection heuristic for nonhierarchical (K-means) cluster analysis based on the adjusted Rand index for measuring cluster recovery. Subjected the heuristic to Monte Carlo testing across more than 2,200 datasets. Results indicate that the heuristic is extremely effective at eliminating masking variables. (SLD)

  6. Factor Analysis for Clustered Observations.

    Science.gov (United States)

    Longford, N. T.; Muthen, B. O.

    1992-01-01

    A two-level model for factor analysis is defined, and formulas for a scoring algorithm for this model are derived. A simple noniterative method based on decomposition of total sums of the squares and cross-products is discussed and illustrated with simulated data and data from the Second International Mathematics Study. (SLD)

  7. Environmental and Ethical Aspects of International Migration.

    Science.gov (United States)

    Abernethy, Virginia

    1996-01-01

    Well-intentioned U.S. immigration policy has two ill effects in that it encourages the belief that emigration can relieve overpopulation in third-world countries, maintaining high fertility rates, and it results in U.S. domestic population growth that threatens employment opportunities and the environment. (SLD)

  8. Combining Internal and External Evaluation: A Case for School-Based Evaluation.

    Science.gov (United States)

    Nevo, David

    1994-01-01

    School-based evaluation, the focus of this article, is conceived of as neither a synonym for internal evaluation nor an antonym for external evaluation, but as a combination that is examined through a review of recent research. A school-based evaluation in Israel illustrates combining these approaches in a complementary way. (SLD)

  9. Variability: A Pernicious Hypothesis.

    Science.gov (United States)

    Noddings, Nel

    1992-01-01

    The hypothesis of greater male variability in test results is discussed in its historical context, and reasons feminists have objected to the hypothesis are considered. The hypothesis acquires political importance if it is considered that variability results from biological, rather than cultural, differences. (SLD)

  10. Rosenberg's Self-Esteem Scale: Two Factors or Method Effects.

    Science.gov (United States)

    Tomas, Jose M.; Oliver, Amparo

    1999-01-01

    Results of a study with 640 Spanish high school students suggest the existence of a global self-esteem factor underlying responses to Rosenberg's (M. Rosenberg, 1965) Self-Esteem Scale, although the inclusion of method effects is needed to achieve a good model fit. Method effects are associated with item wording. (SLD)

  11. Hollywood, Race, and the Demonization of Youth: The "Kids" Are Not "Alright." Movie Review.

    Science.gov (United States)

    Giroux, Henry A.

    1996-01-01

    The sexually charged "Kids" was one of the most controversial films about teenage sexuality and youth of 1995. The pessimism and one-dimensionality of the film foster a conservative pedagogy and politics that fail to break dominant discourse about subordinate youth in this country. (SLD)

  12. "A Teacher Wrote This Movie": Challenging the Myths of "One Eight Seven" [movie review].

    Science.gov (United States)

    Fassett, Deanna L.; Warren, John T.

    1999-01-01

    Reviews "One Eight Seven," a film about a teacher working with at-risk students. The film is an indictment of U.S. schooling and a portrayal of the dangers teachers and students face in school with increasing frequency. The misrepresentations in this film reinforce the prevailing myths of urban education. (SLD)

  13. Simultaneous Optimization of Decisions Using a Linear Utility Function.

    Science.gov (United States)

    Vos, Hans J.

    1990-01-01

    An approach is presented to simultaneously optimize decision rules for combinations of elementary decisions through a framework derived from Bayesian decision theory. The developed linear utility model for selection-mastery decisions was applied to a sample of 43 first year medical students to illustrate the procedure. (SLD)

  14. Using Multiattribute Utility Theory as a Priority-Setting Tool in Human Services Planning.

    Science.gov (United States)

    Camasso, Michael J.; Dick, Janet

    1993-01-01

    The feasibility of applying multiattribute utility theory to the needs assessment and priority-setting activities of human services planning councils was studied in Essex County (New Jersey). Decision-making and information filtering processes are explored in the context of community planning. (SLD)

  15. School Leadership Development in Western Australia: An Impact Study.

    Science.gov (United States)

    Wildy, Helen; Wallace, John

    1995-01-01

    Reports an impact study of the Western Australian School Leadership Program, a development program for administrators. Questionnaires completed by 357 program participants and 287 colleagues indicated the impact of the training on leader behavior in schools. The effect was enhanced when several leaders from the same school had participated. (SLD)

  16. The Stability of Individual Differences in Mental Ability from Childhood to Old Age: Follow-up of the 1932 Scottish Mental Survey.

    Science.gov (United States)

    Deary, Ian J.; Whalley, Lawrence J.; Lemmon, Helen; Crawford, J. R.; Starr, John M.

    2000-01-01

    Tested 101 adults, aged 77, who had completed psychometric intelligence testing in 1932, with the same test of mental ability. Results of this study, the longest follow-up study reported to date, show substantial stability in mental ability differences from childhood to late life. (SLD)

  17. Social Perception and Social Reality: A Reflection-Construction Model.

    Science.gov (United States)

    Jussim, Lee

    1991-01-01

    A reflection-construction model of relations between social perception and social reality is presented that explicitly specifies several ways in which social perception may relate to social reality. Evidence supporting this model also supports a weaker version of the social-constructivist view. (SLD)

  18. Writing in Preliterate Children.

    Science.gov (United States)

    Gombert, Jean Emile; Fayol, Michel

    1992-01-01

    Dictated words and pictures by 48 young French children, aged 3 to 6 years, demonstrated that young children have the capacity to produce graphics that exhibit some of the characteristics of writing. Developmental stages in children's recognition that their own efforts were not true writing were identified. (SLD)

  19. Inspection Time and Intelligence: Practice, Strategies, and Attention.

    Science.gov (United States)

    Bors, Douglas A.; Stokes, Tonya L.; Forrin, Bert; Hodder, Shelley L.

    1999-01-01

    Examined the effects of practice, response strategies, and attentiveness on inspection time (IT) and its relation to IQ in 3 experiments involving 102 college students, testing the hypothesis that mental speed is the basis for the observed IT-IQ relation. Discusses the mixed results and evidence that the correlation is malleable. (SLD)

  20. Discrete Mathematics and Curriculum Reform.

    Science.gov (United States)

    Kenney, Margaret J.

    1996-01-01

    Defines discrete mathematics as the mathematics necessary to effect reasoned decision making in finite situations and explains how its use supports the current view of mathematics education. Discrete mathematics can be used by curriculum developers to improve the curriculum for students of all ages and abilities. (SLD)

  1. A Generalized Partial Credit Model: Application of an EM Algorithm.

    Science.gov (United States)

    Muraki, Eiji

    1992-01-01

    The partial credit model with a varying slope parameter is developed and called the generalized partial credit model (GPCM). Analysis results for simulated data by this and other polytomous item-response models demonstrate that the rating formulation of the GPCM is adaptable to the analysis of polytomous item responses. (SLD)

  2. A Comparison of Graded Response and Rasch Partial Credit Models with Subjective Well-Being.

    Science.gov (United States)

    Baker, John G.; Rounds, James B.; Zevon, Michael A.

    2000-01-01

    Compared two multiple category item response theory models using a data set of 52 mood terms with 713 undergraduate psychology students. Comparative model fit for the Samejima (F. Samejima, 1966) logistic model for graded responses and the Masters (G. Masters, 1982) partial credit model favored the former model for this data set. (SLD)

  3. An Extension of the Partial Credit Model with an Application to the Measurement of Change.

    Science.gov (United States)

    Fischer, Gerhard H.; Ponocny, Ivo

    1994-01-01

    An extension to the partial credit model, the linear partial credit model, is considered under the assumption of a certain linear decomposition of the item x category parameters into basic parameters. A conditional maximum likelihood algorithm for estimating basic parameters is presented and illustrated with simulation and an empirical study. (SLD)

  4. The CES Case Competition: A Valuable Resource for Community-Based Agencies.

    Science.gov (United States)

    Bergeron, Natasha; Welsh, Paul

    2003-01-01

    Illustrates the contribution that the Student Case Competition of the Canadian Evaluation Society can make to agencies with evaluation needs by describing the experience of an addiction and family services program whose gambling addiction treatment program used as the case in the qualifying round of the 1998 competition. (SLD)

  5. Solar X-ray Spectrometer (SOXS) Mission – Low Energy Payload ...

    Indian Academy of Sciences (India)

    Solar X-ray Spectrometer (SOXS)' mission, which was launched onboard GSAT-2 Indian spacecraft on 08 May 2003 by GSLV-D2 rocket to study the solar flares. The SOXS Low Energy Detector (SLD) payload was designed, developed and ...

  6. Solar X-ray Spectrometer (SOXS) Mission – Low Energy Payload

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... We present the first results from the 'Low Energy Detector' payload of 'Solar X-ray Spectrometer (SOXS)' mission, which was launched onboard GSAT-2 Indian spacecraft on 08 May 2003 by GSLV-D2 rocket to study the solar flares. The SOXS Low Energy Detector (SLD) payload was designed, developed ...

  7. Validation of the Social Interaction Anxiety Scale and the Social Phobia Scale across the Anxiety Disorders.

    Science.gov (United States)

    Brown, Elissa J.; And Others

    1997-01-01

    The psychometric adequacy of the Social Interaction Scale and the Social Phobia Scale (both by R. P. Mattick and J. C. Clark, 1989) was studied with 165 patients with anxiety disorders and 21 people without anxiety. Results support the usefulness of the scales for screening and treatment design and evaluation. (SLD)

  8. Notions of Gender in the Construction of English.

    Science.gov (United States)

    Thomas, Kim

    1991-01-01

    Feminism and gender in the construction of English as a university discipline and the historical development of English are discussed. Generally, English is studied by women and taught by men. The teaching of English today is examined through interviews with four university English department lecturers in the United Kingdom. (SLD)

  9. The Diverse Generation.

    Science.gov (United States)

    Howe, Neil; Strauss, Bill

    1993-01-01

    In this era of multiculturalism, young people find diversity so heavily emphasized that they may wonder whether centrifugal group loyalties may tear the nation apart. Most people born between 1961 and 1981 believe that they handle racial problems better than their elders did. (SLD)

  10. Creating a Comprehensive School Reform Model: The Talent Development High School with Career Academies.

    Science.gov (United States)

    Jordan, Will J.; McPartland, James M.; Legters, Nettie E.; Balfanz, Robert

    2000-01-01

    Discusses the need for comprehensive reforms in school organization, curriculum and instruction, and professional development to address the problems of large urban high schools. Describes the Talent Development High School with Career Academies model being developed to meet the needs of such schools. (SLD)

  11. Transforming High-Poverty Urban Middle Schools into Strong Learning Institutions: Lessons from the First Five Years of the Talent Development Middle School.

    Science.gov (United States)

    Balfanz, Robert; Mac Iver, Doug

    2000-01-01

    Two developers of the Talent Development Middle School model discuss 10 lessons from implementing, refining, and evaluating this model in 5 high-poverty middle schools in Philadelphia, Pennsylvania, and describe obstacles encountered and breakthroughs experienced in developing the knowledge base, materials, and infrastructure of the model. (SLD)

  12. The Fifth Edition of the APA "Publication Manual": Why Its Statistics Recommendations Are So Controversial.

    Science.gov (United States)

    Fidler, Fiona

    2002-01-01

    Identifies deficiencies in the new edition of the American Psychological Association's "Publication Manual," drawing on interviews with some critics and other parties. These include lack of follow-through with explanations and examples of how to report the statistics now recommended. (SLD)

  13. Exploring the APA Fifth Edition "Publication Manual"'s Impact on the Analytic Preferences of Journal Editorial Board Members.

    Science.gov (United States)

    Capraro, Mary Margaret; Capraro, Robert M.

    2003-01-01

    Studied the reporting preferences of editorial board members of four scholarly journals in education and psychology with regard to analytic practices in the fifth edition of the American Psychological Association "Publication Manual." Responses of 106 board members show the movement toward reform in research reporting practices. (SLD)

  14. Statistical Methods in Psychology Journals.

    Science.gov (United States)

    Willkinson, Leland

    1999-01-01

    Proposes guidelines for revising the American Psychological Association (APA) publication manual or other APA materials to clarify the application of statistics in research reports. The guidelines are intended to induce authors and editors to recognize the thoughtless application of statistical methods. Contains 54 references. (SLD)

  15. Rank Advancement in Academic Careers: Sex Differences and the Effects of Productivity.

    Science.gov (United States)

    Long, J. Scott; And Others

    1993-01-01

    Presents evidence on sex differences in rank advancement in academic careers, and considers the relative importance of quality and quantity of publications. Results for 556 male and 450 female biochemists show the importance of time in rank and number of publications and that rates of promotion are lower for women. (SLD)

  16. The TIMSS Videotape Classroom Study: Methods and Findings from an Exploratory Research Project on Eighth-Grade Mathematics Instruction in Germany, Japan, and the United States.

    Science.gov (United States)

    Stigler, James W.; Gonzales, Patrick; Kawanaka, Takako; Knoll, Steffen; Serrano, Ana

    1999-01-01

    Describes the methods and preliminary findings of the Videotape Classroom Study, a video survey of eighth-grade mathematics lessons in Germany, Japan, and the United States. Part of the Third International Mathematics and Science study, this research project is the first study of videotaped records from national probability samples. (SLD)

  17. Cross-national Retrospective Studies of Mathematics Olympians.

    Science.gov (United States)

    Campbell, James Reed, Ed.

    1996-01-01

    The eight chapters of this theme issue use quantitative and qualitative methods to explore the nature and nurture of young participants in the mathematics Olympiad from five countries. Parallel studies are presented of winners from China, Taiwan, and the United States, along with descriptions of programs in Japan and Russia. (SLD)

  18. Second Line of Defense Virtual Private Network Guidance for Deployed and New CAS Systems

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Surya V.; Thronas, Aaron I.

    2010-01-01

    This paper discusses the importance of remote access via virtual private network (VPN) for the Second Line of Defense (SLD) Central Alarm System (CAS) sites, the requirements for maintaining secure channels while using VPN and implementation requirements for current and future sites.

  19. Vineland-II adaptive behavior profile of children with attention-deficit/hyperactivity disorder or specific learning disorders.

    Science.gov (United States)

    Balboni, Giulia; Incognito, Oriana; Belacchi, Carmen; Bonichini, Sabrina; Cubelli, Roberto

    2017-02-01

    The evaluation of adaptive behavior is informative in children with attention-deficit/hyperactivity disorder (ADHD) or specific learning disorders (SLD). However, the few investigations available have focused only on the gross level of domains of adaptive behavior. To investigate which item subsets of the Vineland-II can discriminate children with ADHD or SLD from peers with typical development. Student's t-tests, ROC analysis, logistic regression, and linear discriminant function analysis were used to compare 24 children with ADHD, 61 elementary students with SLD, and controls matched on age, sex, school level attended, and both parents' education level. Several item subsets that address not only ADHD core symptoms, but also understanding in social context and development of interpersonal relationships, allowed discrimination of children with ADHD from controls. The combination of four item subsets (Listening and attending, Expressing complex ideas, Social communication, and Following instructions) classified children with ADHD with both sensitivity and specificity of 87.5%. Only Reading skills, Writing skills, and Time and dates discriminated children with SLD from controls. Evaluation of Vineland-II scores at the level of item content categories is a useful procedure for an efficient clinical description. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Ka Lama o ke Kaiaulu: Research on Teacher Education for a Hawaiian Community.

    Science.gov (United States)

    Au, Kathryn H.; Maaka, Margaret J.

    1998-01-01

    Introduces a three-year research project designed to answer the questions of how schools can better meet the educational needs of individuals from underrepresented groups. Provides overviews of a case study of a preservice teacher of Hawaiian ethnicity and a set of case studies of five Hawaiian women throughout their educations. (SLD)