WorldWideScience

Sample records for slc4-like anion exchanger

  1. Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis

    Science.gov (United States)

    Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.

    2010-01-01

    Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853

  2. Regulators of Slc4 bicarbonate transporter activity

    Directory of Open Access Journals (Sweden)

    Ian M. Thornell

    2015-06-01

    Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

  3. Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

    Science.gov (United States)

    Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2012-01-01

    Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

  4. Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.

    Science.gov (United States)

    Thurtle-Schmidt, Bryan H; Stroud, Robert M

    2016-09-20

    Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.

  5. Developmental expression of solute carrier family 26A member 4 (SLC26A4/pendrin) during amelogenesis in developing rodent teeth.

    Science.gov (United States)

    Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2011-12-01

    Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.

  6. Loss of Slc4a1b chloride/bicarbonate exchanger function protects mechanosensory hair cells from aminoglycoside damage in the zebrafish mutant persephone.

    Directory of Open Access Journals (Sweden)

    Dale W Hailey

    Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.

  7. Anion exchange membrane

    Science.gov (United States)

    Verkade, John G; Wadhwa, Kuldeep; Kong, Xueqian; Schmidt-Rohr, Klaus

    2013-05-07

    An anion exchange membrane and fuel cell incorporating the anion exchange membrane are detailed in which proazaphosphatrane and azaphosphatrane cations are covalently bonded to a sulfonated fluoropolymer support along with anionic counterions. A positive charge is dispersed in the aforementioned cations which are buried in the support to reduce the cation-anion interactions and increase the mobility of hydroxide ions, for example, across the membrane. The anion exchange membrane has the ability to operate at high temperatures and in highly alkaline environments with high conductivity and low resistance.

  8. Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA

    Science.gov (United States)

    Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus

    2008-01-01

    Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801

  9. Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

    Science.gov (United States)

    Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

    2018-01-01

    The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

  10. A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

    Directory of Open Access Journals (Sweden)

    Beever Jonathan E

    2010-05-01

    Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

  11. New anion-exchange polymers for improved separations

    International Nuclear Information System (INIS)

    Jarvinen, G.D.; Barr, M.E.; Marsh, S.F.

    1997-01-01

    Objective is to improve the understanding of how the structure of a new class of anion-exchange polymers controls the binding of anionic actinide complexes from solution. This is needed to develop practical separation systems that will reduce the cost of actinide processing operations within the DOE complex. In addition anion exchange is widely used in industry. Several new series of bifunctional anion- exchange polymers have been designed, synthesized, and tested for removing Pu(IV), Am(III), and U(VI) from nitric acid. The polymers contain a pyridinium site derived from the host poly(4-vinylpyridine) and a second cationic site attached through a chain of 2 to 6 methylene groups. The new polymers removed Pu four to ten times more efficiently than the best commercial materials

  12. Ion-exchange concentration of inorganic anions from aqueous solution

    Directory of Open Access Journals (Sweden)

    L. P. Bondareva

    2016-01-01

    Full Text Available Monitoring of natural waters in the present time - consuming process, the accuracy of which is influenced by many factors: the composition of water, the presence of impurities and "interfering" components. The water sample preparation process includes the step of concentration and separation of ions determined. The most versatile, efficient, and frequently used method is the concentration of inorganic anions from aqueous solutions by ion exchanger, which can optimize the composition of water to the optimal for identification and quantitative determination of anions. The characteristics of sorption chloride, nitrate and sulfate ions of basic anion exchange resin AВ-17 and Purolite A430 were compared in the article. The constants of protolysis of ion exchangers both AB 17 and Purolite A430 are the same and equal 0.037 ± 0,002. The value of total capacity (POE Purolite A430 was 4.3 mmol/g, AB 17 – 3.4 mmol/g. The studied ion exchangers have the same type of ionic groups – quaternary ammonium, but their number and denotes differ. The number of quaternary ammonium groups is higher in Purolite A430, respectively the number of absorbed anions of these ion exchanger is higher. The values of dynamic exchange capacity (DOE of ion exchanger Purolite A430 is higher than these values of AB-17 and equal to 1.48 ± 0.03 mmol / dm3 for chloride ion, 1.50 ± 0.03 mmol / dm3 for nitrate ion, 1.62 ± 0.03 mmol / dm3 for sulfate ion. The values of the POE and DOE of anion-exchange resins Purolite A430 and AV-17 and the characteristics of the individual sorption of chloride, nitrate, sulfate ions showed an advantage of the Purolite for the concentrationing of anions. It is found that times of anions sorption from triple-anion solutions by Purolite A430 are significantly different for different anions, and these times are close for anion-exchanger AV-17. It proves the possibility of quantitative separation and concentration by anion-exchanger Purolite A430.

  13. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Directory of Open Access Journals (Sweden)

    Anna Rita Cappello

    2018-04-01

    Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  14. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Science.gov (United States)

    Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

    2018-04-01

    The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  15. Pu Anion Exchange Process Intensification

    International Nuclear Information System (INIS)

    Taylor-Pashow, Kathryn M. L.

    2017-01-01

    This research is focused on improving the efficiency of the anion exchange process for purifying plutonium. While initially focused on plutonium, the technology could also be applied to other ion-exchange processes. Work in FY17 focused on the improvement and optimization of porous foam columns that were initially developed in FY16. These foam columns were surface functionalized with poly(4-vinylpyridine) (PVP) to provide the Pu specific anion-exchange sites. Two different polymerization methods were explored for maximizing the surface functionalization with the PVP. The open-celled polymeric foams have large open pores and large surface areas available for sorption. The fluid passes through the large open pores of this material, allowing convection to be the dominant mechanism by which mass transport takes place. These materials generally have very low densities, open-celled structures with high cell interconnectivity, small cell sizes, uniform cell size distributions, and high structural integrity. These porous foam columns provide advantages over the typical porous resin beads by eliminating the slow diffusion through resin beads, making the anion-exchange sites easily accessible on the foam surfaces. The best performing samples exceeded the Pu capacity of the commercially available resin, and also offered the advantage of sharper elution profiles, resulting in a more concentrated product, with less loss of material to the dilute heads and tails cuts. An alternate approach to improving the efficiency of this process was also explored through the development of a microchannel array system for performing the anion exchange.

  16. Pu Anion Exchange Process Intensification

    Energy Technology Data Exchange (ETDEWEB)

    Taylor-Pashow, Kathryn M. L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-10-06

    This research is focused on improving the efficiency of the anion exchange process for purifying plutonium. While initially focused on plutonium, the technology could also be applied to other ion-exchange processes. Work in FY17 focused on the improvement and optimization of porous foam columns that were initially developed in FY16. These foam columns were surface functionalized with poly(4-vinylpyridine) (PVP) to provide the Pu specific anion-exchange sites. Two different polymerization methods were explored for maximizing the surface functionalization with the PVP. The open-celled polymeric foams have large open pores and large surface areas available for sorption. The fluid passes through the large open pores of this material, allowing convection to be the dominant mechanism by which mass transport takes place. These materials generally have very low densities, open-celled structures with high cell interconnectivity, small cell sizes, uniform cell size distributions, and high structural integrity. These porous foam columns provide advantages over the typical porous resin beads by eliminating the slow diffusion through resin beads, making the anion-exchange sites easily accessible on the foam surfaces. The best performing samples exceeded the Pu capacity of the commercially available resin, and also offered the advantage of sharper elution profiles, resulting in a more concentrated product, with less loss of material to the dilute heads and tails cuts. An alternate approach to improving the efficiency of this process was also explored through the development of a microchannel array system for performing the anion exchange.

  17. Asymmetry of inverted-topology repeats in the AE1 anion exchanger suggests an elevator-like mechanism

    Science.gov (United States)

    Faraldo-Gómez, José D.

    2017-01-01

    The membrane transporter anion exchanger 1 (AE1), or band 3, is a key component in the processes of carbon-dioxide transport in the blood and urinary acidification in the renal collecting duct. In both erythrocytes and the basolateral membrane of the collecting-duct α-intercalated cells, the role of AE1 is to catalyze a one-for-one exchange of chloride for bicarbonate. After decades of biochemical and functional studies, the structure of the transmembrane region of AE1, which catalyzes the anion-exchange reaction, has finally been determined. Each protomer of the AE1 dimer comprises two repeats with inverted transmembrane topologies, but the structures of these repeats differ. This asymmetry causes the putative substrate-binding site to be exposed only to the extracellular space, consistent with the expectation that anion exchange occurs via an alternating-access mechanism. Here, we hypothesize that the unknown, inward-facing conformation results from inversion of this asymmetry, and we propose a model of this state constructed using repeat-swap homology modeling. By comparing this inward-facing model with the outward-facing experimental structure, we predict that the mechanism of AE1 involves an elevator-like motion of the substrate-binding domain relative to the nearly stationary dimerization domain and to the membrane plane. This hypothesis is in qualitative agreement with a wide range of biochemical and functional data, which we review in detail, and suggests new avenues of experimentation. PMID:29167180

  18. Asymmetry of inverted-topology repeats in the AE1 anion exchanger suggests an elevator-like mechanism.

    Science.gov (United States)

    Ficici, Emel; Faraldo-Gómez, José D; Jennings, Michael L; Forrest, Lucy R

    2017-12-04

    The membrane transporter anion exchanger 1 (AE1), or band 3, is a key component in the processes of carbon-dioxide transport in the blood and urinary acidification in the renal collecting duct. In both erythrocytes and the basolateral membrane of the collecting-duct α-intercalated cells, the role of AE1 is to catalyze a one-for-one exchange of chloride for bicarbonate. After decades of biochemical and functional studies, the structure of the transmembrane region of AE1, which catalyzes the anion-exchange reaction, has finally been determined. Each protomer of the AE1 dimer comprises two repeats with inverted transmembrane topologies, but the structures of these repeats differ. This asymmetry causes the putative substrate-binding site to be exposed only to the extracellular space, consistent with the expectation that anion exchange occurs via an alternating-access mechanism. Here, we hypothesize that the unknown, inward-facing conformation results from inversion of this asymmetry, and we propose a model of this state constructed using repeat-swap homology modeling. By comparing this inward-facing model with the outward-facing experimental structure, we predict that the mechanism of AE1 involves an elevator-like motion of the substrate-binding domain relative to the nearly stationary dimerization domain and to the membrane plane. This hypothesis is in qualitative agreement with a wide range of biochemical and functional data, which we review in detail, and suggests new avenues of experimentation. © 2017 Ficici et al.

  19. Graphene-coated polymeric anion exchangers for ion chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai; Cao, Minyi; Lou, Chaoyan [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China); Wu, Shuchao, E-mail: wushch2002@163.com [Zhejiang Institute of Geology and Mineral Resources, Hangzhou 310007 (China); Zhang, Peimin [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China); Zhi, Mingyu [Hangzhou Vocational & Technical College, Hangzhou, 310018 (China); Zhu, Yan, E-mail: zhuyan@zju.edu.cn [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China)

    2017-06-01

    Carbonaceous stationary phases have gained much attention for their peculiar selectivity and robustness. Herein we report the fabrication and application of a graphene-coated polymeric stationary phase for anion exchange chromatography. The graphene-coated particles were fabricated by a facile evaporation-reduction method. These hydrophilic particles were proven appropriate substrates for grafting of hyperbranched condensation polymers (HBCPs) to make pellicular anion exchangers. The new phase was characterized by zeta potentials, Fourier transform infrared spectroscopy, thermogravimetry and scanning electron microscope. Frontal displacement chromatography showed that the capacities of the anion exchangers were tuned by both graphene amount and HBCPs layer count. The chromatographic performance of graphene-coated anion exchangers was demonstrated with separation of inorganic anions, organic acids, carbohydrates and amino acids. Good reproducibility was obtained by consecutive injections, indicating high chemical stability of the coating. - Highlights: • Graphene-coated polymeric particles were fabricated by a facile method. • Hyperbranched condensation polymers (HBCPs) were grafted from graphene-coated particles to make anion exchangers. • Graphene amount and HBCPs layer count had significant effects on the anion exchange capacities. • Separation of diverse anionic analytes on the anion exchangers was demonstrated. • The prepared anion exchangers exhibited high stability.

  20. Anion- or Cation-Exchange Membranes for NaBH4/H2O2 Fuel Cells?

    Science.gov (United States)

    Sljukić, Biljana; Morais, Ana L; Santos, Diogo M F; Sequeira, César A C

    2012-07-19

    Direct borohydride fuel cells (DBFC), which operate on sodium borohydride (NaBH4) as the fuel, and hydrogen peroxide (H2O2) as the oxidant, are receiving increasing attention. This is due to their promising use as power sources for space and underwater applications, where air is not available and gas storage poses obvious problems. One key factor to improve the performance of DBFCs concerns the type of separator used. Both anion- and cation-exchange membranes may be considered as potential separators for DBFC. In the present paper, the effect of the membrane type on the performance of laboratory NaBH4/H2O2 fuel cells using Pt electrodes is studied at room temperature. Two commercial ion-exchange membranes from Membranes International Inc., an anion-exchange membrane (AMI-7001S) and a cation-exchange membrane (CMI-7000S), are tested as ionic separators for the DBFC. The membranes are compared directly by the observation and analysis of the corresponding DBFC's performance. Cell polarization, power density, stability, and durability tests are used in the membranes' evaluation. Energy densities and specific capacities are estimated. Most tests conducted, clearly indicate a superior performance of the cation-exchange membranes over the anion-exchange membrane. The two membranes are also compared with several other previously tested commercial membranes. For long term cell operation, these membranes seem to outperform the stability of the benchmark Nafion membranes but further studies are still required to improve their instantaneous power load.

  1. Single-Crystal-to-Single-Crystal Anion Exchange in a Gadolinium MOF: Incorporation of POMs and [AuCl4]−

    Directory of Open Access Journals (Sweden)

    Javier López-Cabrelles

    2016-04-01

    Full Text Available The encapsulation of functional molecules inside porous coordination polymers (also known as metal-organic frameworks, MOFs has become of great interest in recent years at the field of multifunctional materials. In this article, we present a study of the effects of size and charge in the anion exchange process of a Gd based MOF, involving molecular species like polyoxometalates (POMs, and [AuCl4]−. This post-synthetic modification has been characterized by IR, EDAX, and single crystal diffraction, which have provided unequivocal evidence of the location of the anion molecules in the framework.

  2. Rejuvenation processes applied to 'poisoned' anion exchangers in uranium processing

    International Nuclear Information System (INIS)

    Gilmore, A.J.

    1979-11-01

    The removal of 'poisons' from anion exchangers in uranium processing of Canadian radioactive ores is commonly called rejuvenation or regeneration. The cost of the ion exchange recovery of uranium is adversely affected by a decrease in the capacity and efficiency of the anion exchangers, due to their being 'poisoned' by silica, elemental sulphur, molybdenum and tetrathionates. These 'poisons' have a high affinity for the anion exchangers, are adsorbed in preference to the uranyl complex, and do not desorb with the reagents used normally in the uranyl desorption phase. The frequency of rejuvenation and the reagents required for rejuvenation are determined by the severity of the 'poisoning' accumulated by the exchanger in contact with the uranium leach liquor. Caustic soda (NaOH) at approximately equal to 18 cents/lb is commonly used to remove uranium anion exchangers of tetrathionate ((S 4 0 6 )/-/-) 'poisons'. A potential saving in operating cost would be of consequence if other reagents, e.g. sodium carbonate (Na 2 CO 3 ) at approximately equal to 3.6 cents/lb or calcium hydroxide (Ca(OH) 2 ) at approximately equal to 1.9 cents/lb, were effective in removing (S 4 0 6 )/-/-) from a 'poisoned' exchanger. A rejuvenation process for a test program was adopted after a perusal of the literature

  3. APLIKASI PENGOLAHAN POLUTAN ANION KHROM(VI DENGAN MENGGUNAKAN AGEN PENUKAR ION HYDROTALCIT ZN-AI-SO4 (Synthesis of and its Application to Treat Chrom(VI Pollutant Using Hydrotalcite Zn-Al_SO4 as Anion Exchanger

    Directory of Open Access Journals (Sweden)

    Roto Roto

    2009-03-01

    Full Text Available ABSTRAK Keberadaan logam khrom di dalam sistem perairan bersifat polutan yang harus ditangani dengan baik, dan untuk khrom (Vl yang sering dijumpai dalam bentuk anion dapat diolah dengan menggunakan mekanisme pertukaran ion. Suatu agen penukar anion telah dibuat berupa senyawa hidrotalsit Zn-Al-SOa melalui proses sintesis, karakterisasi serta dilakukan pula pengujian aplikasinya untuk pengurangan polutant anion khrom (VI dalam bentuk ion dikromat. Sintesis hidrotalsit Zn-Al-SOa dilakukan dengan metode stoikiometri pada pH 8 dan perlakuan hidrotermal. Aplikasi pertukaran dikromat dengan anion sulfat dalam antar lapis hidrotalsit serta uji regenerasi bahan diamati dengan bantuan analisis struktur dan analisis kinetika reaksi pertukaran. Produk pertukaran ion dikarakterisasi dengan XRD, spektrofotometri IR dan spektrometri serapan atom. Rumus kimia hidrotalsit produk diketahui adalah Zn0,74Al0,26(OH1,74(SO40,13.0,52H2O. Anion dikromat dapat menukar sulfat dalam antarlapis hidrotalsit yang ditunjukkan dalam spektra IR dan pola XRD. Kapasitas pertukaran anion untuk dikromat diketahui 216,84 mek/100 g, sedangkan kinetika reaksi pertukaran ion mengikuti orde dua dengan k = 3 x 10-8 ppm-1.detik-1. Hasil menunjukkan Zn-Al-Cr2O7 dapat mudah diregenerasi.    ABSTRACT  Chrom as pollutant in aquatics system usually establishes as crom (VI and should be worked with special treatment and as an example is ion exchanger. Material Zn-Al-SO4 hydrotalcite product have been synthesized and its application as anion exchanger for dichromate have been studied. Synthesis of Zn-Al-SO4 hydrotalcite was carried out by stoichiometric method at pH 8 and hydrothermal treatment. Sulphate in hydrotalcite interlayer was exchanged by dichromate. Kinetics of ion exchange was also investigated. The product of ion exchange was characterized by XRD, IR spectrophotometry and atomic adsorption  spectrometry. The chemical formula of the  hydrotalcite is Zn0.74Al0.26(OH1.74(SO4 0

  4. Test procedure for anion exchange chromatography

    International Nuclear Information System (INIS)

    Cooper, T.D.

    1994-01-01

    Plutonium from stored nitrate solutions will be sorbed onto anion exchange resins and converted to storable plutonium dioxide. Useful information will be simultaneously gained on the thermal stability and ion exchange capacity of four commercially available anion exchange resins over several years and under severe degradative conditions. This information will prove useful in predicting the safe and efficient lifetimes of these resins

  5. Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

    Science.gov (United States)

    Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

    2010-01-01

    The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

  6. Determination of Pb-210 and actinides by extraction chromatography and anion exchange chromatography

    International Nuclear Information System (INIS)

    Kalmykov, St.N.; Sapozhnikov, Yu.A.

    1997-01-01

    This work is devoted to the determination of Pb-210 and actinides (Pu-238, Pu-239, Am-241, U-235, U-238, Th-232) by means of highly selective chromatographic resins and anion exchangers. The special interest was paid to the analysis of large quantities of samples with high concentration of competitive ions like ocean sediments, bone ash and others.The commercially available TRU-Spec chromatographic resins was used for separation of actinides from the matrix. Then U, Th, Am, and Pu were separated from other using anion exchange chromatography with AG-1X4 anionite in Cl - form, electro-deposed and α-counted.Pb-21- and Bi-210 were determined by liquid scintillation counting. The developed procedure is rather express, effective and could be adopted for the determination of radionuclides like Ba-133, Ra, Np-239

  7. Dynamics of anion exchange of lanthanides in aqueous-organic complexing media

    International Nuclear Information System (INIS)

    Sheveleva, I.V.; Bogatyrev, I.O.

    1987-01-01

    Effect of organic solvents (ethanol, acetone, acetonitrile) on change in kinetic parameters of the anion exchange process (anion-exchange column chromatography) of r.e.e. (europium and gadolinium) in complexing nitric acid media has been studied. It is established that complex LnA 4 anion is the only sorbing form of europium and gadolinium on anionite. When the organic component content of the solution being the same, the dynamic parameters of lanthanide exchange have higher values in aqueous-acetonitrile and aqueous-acetone media in comparison with aqueous-enthanol solutions of nitric acid. Lesser mobility of complex lanthanide anions in aqueous-alcoholic solutions can be explained by stronger solvation in the presence of solvents with higher acceptor properties

  8. Modelling the transport of carbonic acid anions through anion-exchange membranes

    International Nuclear Information System (INIS)

    Nikonenko, V.; Lebedev, K.; Manzanares, J.A.; Pourcelly, G.

    2003-01-01

    Electrodiffusion of carbonate and bicarbonate anions through anion-exchange membranes (AEM) is described on the basis of the Nernst-Planck equations taking into account coupled hydrolysis reactions in the external diffusion boundary layers (DBLs) and internal pore solution. The model supposes local electroneutrality as well as chemical and thermodynamic equilibrium. The transport is considered in three layers being an anion exchange membrane and two adjoining diffusion layers. A mechanism of competitive transport of HCO 3 - and CO 3 2- anions through the membrane which takes into account Donnan exclusion of H + ions is proposed. It is predicted that the pH of the depleting solution decreases and that of the concentrating solution increases during electrodialysis (ED). Eventual deviations from local electroneutrality and local chemical equilibrium are discussed

  9. Determination of arsenate in water by anion selective membrane electrode using polyurethane–silica gel fibrous anion exchanger composite

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Asif Ali, E-mail: asifkhan42003@yahoo.com; Shaheen, Shakeeba, E-mail: shakeebashaheen@ymail.com

    2014-01-15

    Highlights: • PU–Si gel is new anion exchanger material synthesized and characterized. • This material used as anion exchange membrane is applied for electroanalytical studies. • The method for detection and determination of AsO{sub 4}{sup 3−} in traces amounts discussed. • The results are also verified from arsenic analyzer. -- Abstract: Polyurethane (PU)–silica (Si gel) based fibrous anion exchanger composites were prepared by solid–gel polymerization of polyurethane in the presence of different amounts of silica gel. The formation of PU–Si gel fibrous anion exchanger composite was characterized by Fourier transform infra-red spectroscopy (FTIR), X-ray diffraction (XRD), thermogravimetric analysis (TGA-DTA), scanning electron microscopy (SEM) and elemental analysis. The membrane having a composition of 5:3 (PU:Si gel) shows best results for water content, porosity, thickness and swelling. Our studies show that the present ion selective membrane electrode is selective for arsenic, having detection limit (1 × 10{sup −8} M to 1 × 10{sup −1} M), response time (45 s) and working pH range (5–8). The selectivity coefficient values for interfering ions indicate good selectivity for arsenate (AsO{sub 4}{sup 3−}) over interfering anions. The accuracy of the detection limit results was compared by PCA-Arsenomat.

  10. NCBI nr-aa BLAST: CBRC-AGAM-01-0081 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0081 ref|XP_001652863.1| anion exchange protein 2, slc4a2 [Aedes aegyp...ti] gb|EAT47616.1| anion exchange protein 2, slc4a2 [Aedes aegypti] XP_001652863.1 0.0 78% ...

  11. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  12. Separation of transfer ribonucleic acids on polystyrene anion exchangers

    Energy Technology Data Exchange (ETDEWEB)

    Singhal, R.P.; Griffin, G.D.; Novelli, G.D.

    1976-11-16

    The transfer RNA separation by chromatography on strong-base-polystyrene exchange materials is examined and compared with the widely used reversed-phase chromatography. Results indicate important differences in some transfer RNA (tRNA) elution patterns by the anion-exchange chromatography, as compared with the reversed-phase chromatography. Transfer RNAs containing hydrophobic groups are adsorbed more strongly. The anion exchanger has twice the number of theoretical plates. Single peaks of tRNA/sub 2//sup Glu/ and tRNA/sub 1//sup Phe/ obtained from the reversed-phase column give multiple peaks on polystyrene anion-exchange chromatography. All six leucine tRNAs (Escherichia coli) and differences in tRNA populations synthesized during early and late stages of the dividing lymphocytes from normal human blood can be characterized by the anion-exchange chromatography. Different separation profiles are obtained by two separation systems for tyrosine tRNAs from mouse liver and mouse-plasma-cell tumor. The results indicate that, in contrast to the reversed-phase chromatography, strong-base-polystyrene anion-exchange chromatography is capable of separating tRNAs with minor structural differences.

  13. The cyanobacterial bicarbonate transporter BicA: its physiological role and the implications of structural similarities with human SLC26 transporters.

    Science.gov (United States)

    Price, G Dean; Howitt, Susan M

    2011-04-01

    The cyanobacterial Na+-dependent HCO3- transporter BicA is a member of the ubiquitous and important SulP/SLC26 family of anion transporters found in eukaryotes and prokaryotes. BicA is an important component of the cyanobacterial CO2 concentrating mechanism, an adaptation that contributes to cyanobacteria being able to achieve an estimated 25% of global primary productivity, largely in the oceans. The human SLC26 members are involved in a range of key cellular functions involving a diverse range of anion transport activities including Cl-/HCO3-, I-/HCO3-, and SO42-/HCO3- exchange; mutations in SLC26 members are known to be associated with debilitating diseases such as Pendred syndrome, chondrodysplasias, and congenital chloride diarrhoea. We have recently experimentally determined the membrane topology of BicA using the phoA-lacZ reporter system and here consider some of the extrapolated implications for topology of the human SLC26 family and the Sultr plant sulphate transporters.

  14. A study of model systems in anionic exchange

    International Nuclear Information System (INIS)

    Haegele, R.; Boeyens, J.C.A.

    1977-01-01

    Preliminary experiments are reported on the preparation and characterization of anionic sulphate and chloride complexes of UO 2+ 2 and iron(III), benzyl-trimethylammonium cation being used as a model substance for the simulation of positive sites in an anionic-exchange resin. The structure of (BTMA) 4 [UO 2 CL 3 -O 2 -CL 3 UO 2 ], a binuclear uranyl-peroxocomplex that has not been reported in the literature, was elucidated by single-crystal x-ray examination, and is described and discussed [af

  15. The histidine transporter SLC15A4 coordinates mTOR-dependent inflammatory responses and pathogenic antibody production.

    Science.gov (United States)

    Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko

    2014-09-18

    SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Chloride Anions Regulate Kinetics but Not Voltage-Sensor Qmax of the Solute Carrier SLC26a5.

    Science.gov (United States)

    Santos-Sacchi, Joseph; Song, Lei

    2016-06-07

    In general, SLC26 solute carriers serve to transport a variety of anions across biological membranes. However, prestin (SLC26a5) has evolved, now serving as a motor protein in outer hair cells (OHCs) of the mammalian inner ear and is required for cochlear amplification, a mechanical feedback mechanism to boost auditory performance. The mechanical activity of the OHC imparted by prestin is driven by voltage and controlled by anions, chiefly intracellular chloride. Current opinion is that chloride anions control the Boltzmann characteristics of the voltage sensor responsible for prestin activity, including Qmax, the total sensor charge moved within the membrane, and Vh, a measure of prestin's operating voltage range. Here, we show that standard narrow-band, high-frequency admittance measures of nonlinear capacitance (NLC), an alternate representation of the sensor's charge-voltage (Q-V) relationship, is inadequate for assessment of Qmax, an estimate of the sum of unitary charges contributed by all voltage sensors within the membrane. Prestin's slow transition rates and chloride-binding kinetics adversely influence these estimates, contributing to the prevalent concept that intracellular chloride level controls the quantity of sensor charge moved. By monitoring charge movement across frequency, using measures of multifrequency admittance, expanded displacement current integration, and OHC electromotility, we find that chloride influences prestin kinetics, thereby controlling charge magnitude at any particular frequency of interrogation. Importantly, however, this chloride dependence vanishes as frequency decreases, with Qmax asymptoting at a level irrespective of the chloride level. These data indicate that prestin activity is significantly low-pass in the frequency domain, with important implications for cochlear amplification. We also note that the occurrence of voltage-dependent charge movements in other SLC26 family members may be hidden by inadequate

  17. Reducing nitrogen crossover in microbial reverse-electrodialysis cells by using adjacent anion exchange membranes and anion exchange resin

    KAUST Repository

    Wallack, Maxwell J.; Geise, Geoffrey M.; Hatzell, Marta C.; Hickner, Michael A.; Logan, Bruce E.

    2015-01-01

    Microbial reverse electrodialysis cells (MRECs) combine power generation from salinity gradient energy using reverse electrodialysis (RED), with power generation from organic matter using a microbial fuel cell. Waste heat can be used to distill ammonium bicarbonate into high (HC) and low salt concentration (LC) solutions for use in the RED stack, but nitrogen crossover into the anode chamber must be minimized to avoid ammonia loses, and foster a healthy microbial community. To reduce nitrogen crossover, an additional low concentration (LC) chamber was inserted before the anode using an additional anion exchange membrane (AEM) next to another AEM, and filled with different amounts of anion or cation ion exchange resins. Addition of the extra AEM increased the ohmic resistance of the test RED stack from 103 Ω cm2 (1 AEM) to 295 Ω cm2 (2 AEMs). However, the use of the anion exchange resin decreased the solution resistance of the LC chamber by 74% (637 Ω cm2, no resin; 166 Ω cm2 with resin). Nitrogen crossover into the anode chamber was reduced by up to 97% using 50% of the chamber filled with an anion exchange resin compared to the control (no additional chamber). The added resistance contributed by the use of the additional LC chamber could be compensated for by using additional LC and HC membrane pairs in the RED stack.

  18. Anion exchange of 58 elements in hydrobromic acid and in hydriodic acid

    International Nuclear Information System (INIS)

    Marsh, S.F.; Alarid, J.E.; Hammond, C.F.; McLeod, M.J.; Roensch, F.R.; Rein, J.E.

    1978-02-01

    Anion exchange distributions of 58 elements have been measured from 0.1-8.7M HBr and from 0.1-7.4M HI onto three strong-base resins, 8 and 4% cross-linked and macroporous. Data were obtained by 16- to 18-h dynamic batch contacts. Anion exchange in these media is compared to that in HCl. The effect of resin cross-linkage is considerably greater in HI media than in HBr and HCl media. Examples are presented of potentially useful separations using HBr and HI media alone and in combination with HCl

  19. Modeling and simulation of anion-exchange membrane chromatography for purification of Sf9 insect cell-derived virus-like particles.

    Science.gov (United States)

    Ladd Effio, Christopher; Hahn, Tobias; Seiler, Julia; Oelmeier, Stefan A; Asen, Iris; Silberer, Christine; Villain, Louis; Hubbuch, Jürgen

    2016-01-15

    Recombinant protein-based virus-like particles (VLPs) are steadily gaining in importance as innovative vaccines against cancer and infectious diseases. Multiple VLPs are currently evaluated in clinical phases requiring a straightforward and rational process design. To date, there is no generic platform process available for the purification of VLPs. In order to accelerate and simplify VLP downstream processing, there is a demand for novel development approaches, technologies, and purification tools. Membrane adsorbers have been identified as promising stationary phases for the processing of bionanoparticles due to their large pore sizes. In this work, we present the potential of two strategies for designing VLP processes following the basic tenet of 'quality by design': High-throughput experimentation and process modeling of an anion-exchange membrane capture step. Automated membrane screenings allowed the identification of optimal VLP binding conditions yielding a dynamic binding capacity of 5.7 mg/mL for human B19 parvovirus-like particles derived from Spodoptera frugiperda Sf9 insect cells. A mechanistic approach was implemented for radial ion-exchange membrane chromatography using the lumped-rate model and stoichiometric displacement model for the in silico optimization of a VLP capture step. For the first time, process modeling enabled the in silico design of a selective, robust and scalable process with minimal experimental effort for a complex VLP feedstock. The optimized anion-exchange membrane chromatography process resulted in a protein purity of 81.5%, a DNA clearance of 99.2%, and a VLP recovery of 59%. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Synthesis and characterization of cobalt ferrocyanides loaded on organic anion exchanger

    Energy Technology Data Exchange (ETDEWEB)

    Valsala, T.P. [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India)], E-mail: tpvalsala@yahoo.co.in; Joseph, Annie [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Shah, J.G. [Back End Technology Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Raj, Kanwar [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Venugopal, V. [Radiochemistry and Isotope Group, Bhabha Atomic Research Centre, Trombay 400 085 (India)

    2009-02-15

    Transition metal ferrocyanides have important applications in the selective removal of radioactive caesium from low level and intermediate level radioactive liquid waste streams. The microcrystalline nature of these materials renders them useless for application in column mode operations. Special preparation procedures have been developed to prepare granular solids by in situ precipitation of metal ferrocyanides on organic anion exchangers, which is suitable for column mode operations. The elemental compositions of the metal ferrocyanides precipitated inside the pores of anion exchanger were determined by analysing the dissolved samples using ICP-AES system and flame photometer. From the XRD and EDX analyses and the elemental composition of the synthesized materials, the nature of the compound formed inside the anion exchanger was found to be cobalt ferrocyanide. From SEM analysis of the samples, the particle size of the cobalt ferrocyanide precipitated inside the anion exchanger was found to be much less than that of cobalt ferrocyanide precipitated outside. The efficiency of these materials for removal of Cs was evaluated by measuring the distribution coefficient (Kd), ion exchange capacity and kinetics of Cs uptake. The Kd of the materials loaded on anion exchanger was found to be of the order of 10{sup 5} ml/g. The Cs uptake kinetics of the materials loaded on anion exchanger was slower than that of precipitated materials. The ion exchange capacity of the cobalt ferrocyanide loaded on anion exchanger was found to be much higher than that of the precipitated cobalt ferrocyanide.

  1. Water permeation through anion exchange membranes

    Science.gov (United States)

    Luo, Xiaoyan; Wright, Andrew; Weissbach, Thomas; Holdcroft, Steven

    2018-01-01

    An understanding of water permeation through solid polymer electrolyte (SPE) membranes is crucial to offset the unbalanced water activity within SPE fuel cells. We examine water permeation through an emerging class of anion exchange membranes, hexamethyl-p-terphenyl poly (dimethylbenzimidazolium) (HMT-PMBI), and compare it against series of membrane thickness for a commercial anion exchange membrane (AEM), Fumapem® FAA-3, and a series of proton exchange membranes, Nafion®. The HMT-PMBI membrane is found to possess higher water permeabilities than Fumapem® FAA-3 and comparable permeability than Nafion (H+). By measuring water permeation through membranes of different thicknesses, we are able to decouple, for the first time, internal and interfacial water permeation resistances through anion exchange membranes. Permeation resistances on liquid/membrane interface is found to be negligible compared to that for vapor/membrane for both series of AEMs. Correspondingly, the resistance of liquid water permeation is found to be one order of magnitude smaller compared to that of vapor water permeation. HMT-PMBI possesses larger effective internal water permeation coefficient than both Fumapem® FAA-3 and Nafion® membranes (60 and 18% larger, respectively). In contrast, the effective interfacial permeation coefficient of HMT-PMBI is found to be similar to Fumapem® (±5%) but smaller than Nafion®(H+) (by 14%).

  2. Sorption of vanillin on highly basic anion exchanger under static conditions

    Science.gov (United States)

    Sholokhova, A. Yu.; Eliseeva, T. V.; Voronyuk, I. V.

    2017-11-01

    The kinetics of the sorption of vanillin by a granulated anion exchanger is studied under static conditions. A comparison of the kinetic curves of the uptake of hydroxybenzaldehyde by gel and macroporous anion exchanger shows that macroporous sorbent has better kinetic characteristics. The effect temperature has on the capacity of an anion exchanger and the time needed to establish sorption equilibrium is found, and the activation energy of vanillin uptake is determined. Studying the effect experimental factors have on the rate of sorption and using the formal kinetics approach, it is established that in the investigated range of concentrations, the limiting stage of the uptake of vanillin by an anion exchanger with the functional groups of a quaternary ammonium base is that of external diffusion. Vanillin sorption by a highly basic anion exchanger in hydroxyl form is characterized by polymolecular uptake best described by a BET isotherm; at the same time, the uptake of sorbate by a chloride form is of a monomolecular character and can be described by a Freindlich isotherm. Structural changes in the anion exchanger sorbed hydroxybenzaldehyde are identified via FTIR spectroscopy.

  3. Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

    Science.gov (United States)

    Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

    2018-03-05

    Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

  4. Organic resin anion exchangers for the treatment of radioactive wastes

    International Nuclear Information System (INIS)

    Dyer, A.; McGinnes, D.F.

    1988-07-01

    Organic anion exchange resins are evaluated for 99-TcO 4 - (pertechnate) removed from aqueous nuclear waste streams. Chemical, thermal and radiation stabilities were studied. Selected resins were examined in detail for their selectivities in the presence of I - , NO 3 - , SO 4 = , CO 3 = , Cl - and OH - . Ion exchange equilibria and kinetic mechanisms were determined. Preliminary investigations of cement encapsulation in polymer modified form were made and some leach studies carried out. (author)

  5. Anion- or Cation-Exchange Membranes for NaBH4/H2O2 Fuel Cells?

    Directory of Open Access Journals (Sweden)

    César A. C. Sequeira

    2012-07-01

    Full Text Available Direct borohydride fuel cells (DBFC, which operate on sodium borohydride (NaBH4 as the fuel, and hydrogen peroxide (H2O2 as the oxidant, are receiving increasing attention. This is due to their promising use as power sources for space and underwater applications, where air is not available and gas storage poses obvious problems. One key factor to improve the performance of DBFCs concerns the type of separator used. Both anion- and cation-exchange membranes may be considered as potential separators for DBFC. In the present paper, the effect of the membrane type on the performance of laboratory NaBH4/H2O2 fuel cells using Pt electrodes is studied at room temperature. Two commercial ion-exchange membranes from Membranes International Inc., an anion-exchange membrane (AMI-7001S and a cation-exchange membrane (CMI-7000S, are tested as ionic separators for the DBFC. The membranes are compared directly by the observation and analysis of the corresponding DBFC’s performance. Cell polarization, power density, stability, and durability tests are used in the membranes’ evaluation. Energy densities and specific capacities are estimated. Most tests conducted, clearly indicate a superior performance of the cation-exchange membranes over the anion-exchange membrane. The two membranes are also compared with several other previously tested commercial membranes. For long term cell operation, these membranes seem to outperform the stability of the benchmark Nafion membranes but further studies are still required to improve their instantaneous power load.

  6. ZEOLITE PERFORMANCE AS AN ANION EXCHANGER FOR ARSENIC SEQUESTRATION IN WATER

    Science.gov (United States)

    Zeolites are well known for their use in ion exchange and acid catalysis reactions. The use of zeolites in anion or ligand exchange reactions is less studied. The NH4+ form of zeolite Y (NY6, Faujasite) has been tested in this work to evaluate its performance for arsenic removal...

  7. Sorption of Pu(IV) from nitric acid by bifunctional anion-exchange resins

    International Nuclear Information System (INIS)

    Bartsch, R.A.; Zhang, Z.Y.; Elshani, S.; Zhao, W.; Jarvinen, G.D.; Barr, M.E.; Marsh, S.F.; Chamberlin, R.M.

    1999-01-01

    Anion exchange is attractive for separating plutonium because the Pu(IV) nitrate complex is very strongly sorbed and few other metal ions form competing anionic nitrate complexes. The major disadvantage of this process has been the unusually slow rate at which the Pu(IV) nitrate complex is sorbed by the resin. The paper summarizes the concept of bifunctional anion-exchange resins, proposed mechanism for Pu(IV) sorption, synthesis of the alkylating agent, calculation of K d values from Pu(IV) sorption results, and conclusions from the study of Pu(IV) sorption from 7M nitric acid by macroporous anion-exchange resins including level of crosslinking, level of alkylation, length of spacer, and bifunctional vs. monofunctional anion-exchange resins

  8. Acute and chronic influence of temperature on red blood cell anion exchange.

    Science.gov (United States)

    Jensen, F B; Wang, T; Brahm, J

    2001-01-01

    Unidirectional (36)Cl(-) efflux via the red blood cell anion exchanger was measured under Cl(-) self-exchange conditions (i.e. no net flow of anions) in rainbow trout Oncorhynchus mykiss and red-eared freshwater turtle Trachemys scripta to examine the effects of acute temperature changes and acclimation temperature on this process. We also evaluated the possible adaptation of anion exchange to different temperature regimes by including our previously published data on other animals. An acute temperature increase caused a significant increase in the rate constant (k) for unidirectional Cl(-) efflux in rainbow trout and freshwater turtle. After 3 weeks of temperature acclimation, 5 degrees C-acclimated rainbow trout showed only marginally higher Cl(-) transport rates than 15 degrees C-acclimated trout when compared at the same temperature. Apparent activation energies for red blood cell Cl(-) exchange in trout and turtle were lower than values reported in endothermic animals. The Q(10) for red blood cell anion exchange was 2.0 in trout and 2.3 in turtle, values close to those for CO(2) excretion, suggesting that, in ectothermic animals, the temperature sensitivity of band-3-mediated anion exchange matches the temperature sensitivity of CO(2) transport (where red blood cell Cl(-)/HCO(3)(-) exchange is a rate-limiting step). In endotherms, such as man and chicken, Q(10) values for red blood cell anion exchange are considerably higher but are no obstacle to CO(2) transport, because body temperature is normally kept constant at values at which anion exchange rates are high. When compared at constant temperature, red blood cell Cl(-) permeability shows large differences among species (trout, carp, eel, cod, turtle, alligator, chicken and man). Cl(-) permeabilities are, however, remarkable similar when compared at preferred body temperatures, suggesting an appropriate evolutionary adaptation of red blood cell anion exchange function to the different thermal niches occupied

  9. Uranium isotopic effect studies on cation and anion exchange resins

    International Nuclear Information System (INIS)

    Sarpal, S.K.; Gupta, A.R.

    1975-01-01

    Uranium isotope effects in exchange reactions involving hexavalent and tetravalent uranium, on ion exchange resins, have been re-examined. The earlier work on uranium isotope effects in electron exchange reactions involving hexavalent and tetravalent uranium, has been critically reviewed. New experimental data on these systems in hydrochloric acid medium, has been obtained, using break-through technique on anion-exchange columns. The isotope effects in these break-through experiments have been reinterpreted in a way which is consistent with the anion exchange behaviour of the various uranium species in these systems. (author)

  10. Preparation and performance evaluation of novel alkaline stable anion exchange membranes

    Science.gov (United States)

    Irfan, Muhammad; Bakangura, Erigene; Afsar, Noor Ul; Hossain, Md. Masem; Ran, Jin; Xu, Tongwen

    2017-07-01

    Novel alkaline stable anion exchange membranes are prepared from various amounts of N-methyl dipicolylamine (MDPA) and brominated poly (2,6-dimethyl-1,4-phenylene oxide) (BPPO). The dipicolylamine and MDPA are synthesized through condensation reaction and confirmed by 1H NMR spectroscopy. The morphologies of prepared membranes are investigated by atomic force microscopy (AFM), fourier transform infrared spectroscopy (FTIR), 1H NMR spectroscopy and scanning electron microscopy (SEM). The electrochemical and physical properties of AEMs are tested comprising water uptake (WU), ion exchange capacity (IEC), alkaline stability, linear expansion ratio (LER), thermal stability and mechanical stability. The obtained hydroxide conductivity of MDPA-4 is 66.5 mS/cm at 80 °C. The MDPA-4 membrane shows good alkaline stability, high hydroxide conductivity, low methanol permeability (3.43 × 10-7 cm2/s), higher selectivity (8.26 × 107 mS s/cm3), less water uptake (41.1%) and lower linear expansion (11.1%) despite of high IEC value (1.62 mmol/g). The results prove that MDPA membranes have great potential application in anion exchange membrane fuel cell.

  11. Nitrate Anion Exchange in Pu-238 Aqueous Scrap Recovery Operations

    International Nuclear Information System (INIS)

    Pansoy-Hjelvik, M.E.; Silver, G.L.; Reimus, M.A.H.; Ramsey, K.B.

    1999-01-01

    Strong base, nitrate anion exchange (IX) is crucial to the purification of 238 Pu solution feedstocks with gross levels of impurities. This paper discusses the work involved in bench scale experiments to optimize the nitrate anion exchange process. In particular, results are presented of experiments conducted to (a) demonstrate that high levels of impurities can be separated from 238 Pu solutions via nitrate anion exchange and, (b) work out chemical pretreatment methodology to adjust and maintain 238 Pu in the IV oxidation state to optimize the Pu(IV)-hexanitrato anionic complex sorption to Reillex-HPQ resin. Additional experiments performed to determine the best chemical treatment methodology to enhance recovery of sorbed Pu from the resin, and VIS-NIR absorption studies to determine the steady state equilibrium of Pu(IV), Pu(III), and Pu(VI) in nitric acid are discussed

  12. Development of Preparation Methods for Alkaline Anion Exchange Membranes by Radiation

    International Nuclear Information System (INIS)

    Shin, Jun Hwa; Nho, Young Chang; Sohn, Joon Yong

    2010-01-01

    The objective of this project is to contribute to the environmentally friendly fuel cell system by developing a radiation grafting method for the preparation of anion exchange membranes for alkaline fuel cell and finally to the radiation technology industry. In this project, the preparation methods for the VBC-grafted fluoropolymer films using radiation have been developed and anion exchange membranes have been prepared via the reaction between the VBC-grafted fluoropolymer films and amines. The prepared anion exchange membranes were characterized and the performance of the membranes were evaluated

  13. Congenital Chloride-Losing Diarrhea in a Mexican child with the novel homozygous SLC26A3 mutation G393W

    Directory of Open Access Journals (Sweden)

    Fabian R. Reimold

    2015-06-01

    Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.

  14. A Simple Halide-to-Anion Exchange Method for Heteroaromatic Salts and Ionic Liquids

    Directory of Open Access Journals (Sweden)

    Neus Mesquida

    2012-04-01

    Full Text Available A broad and simple method permitted halide ions in quaternary heteroaromatic and ammonium salts to be exchanged for a variety of anions using an anion exchange resin (A− form in non-aqueous media. The anion loading of the AER (OH− form was examined using two different anion sources, acids or ammonium salts, and changing the polarity of the solvents. The AER (A− form method in organic solvents was then applied to several quaternary heteroaromatic salts and ILs, and the anion exchange proceeded in excellent to quantitative yields, concomitantly removing halide impurities. Relying on the hydrophobicity of the targeted ion pair for the counteranion swap, organic solvents with variable polarity were used, such as CH3OH, CH3CN and the dipolar nonhydroxylic solvent mixture CH3CN:CH2Cl2 (3:7 and the anion exchange was equally successful with both lipophilic cations and anions.

  15. Hybrid capacitive deionization with anion-exchange membranes for lithium extraction

    Directory of Open Access Journals (Sweden)

    Siekierka Anna

    2017-01-01

    Full Text Available Lithium is considered to be a critical material for various industrial fields. We present our studies on extraction lithium from diluted aqueous solution by novel hybrid system based on a membrane capacitive deionization and batteries desalination. Hybrid CDI is comprised by a lithium selective adsorbent, activated carbon electrode and anion-exchange membranes. Here, we demonstrated implication of various type of anion-exchange membranes and influence their properties on effective capacity and energy requirements in charge/discharge steps. We described a configuration with anion-exchange membrane characterized by adsorption capacity of 35 mg/g of Li+ with 0.08Wh/g and removal efficiency of 60 % of lithium ions, using novel selective desalination technique.

  16. Hybrid capacitive deionization with anion-exchange membranes for lithium extraction

    Science.gov (United States)

    Siekierka, Anna; Bryjak, Marek

    2017-11-01

    Lithium is considered to be a critical material for various industrial fields. We present our studies on extraction lithium from diluted aqueous solution by novel hybrid system based on a membrane capacitive deionization and batteries desalination. Hybrid CDI is comprised by a lithium selective adsorbent, activated carbon electrode and anion-exchange membranes. Here, we demonstrated implication of various type of anion-exchange membranes and influence their properties on effective capacity and energy requirements in charge/discharge steps. We described a configuration with anion-exchange membrane characterized by adsorption capacity of 35 mg/g of Li+ with 0.08Wh/g and removal efficiency of 60 % of lithium ions, using novel selective desalination technique.

  17. Fundamental characteristics study of anion-exchange PVDF-SiO(2) membranes.

    Science.gov (United States)

    Zuo, Xingtao; Shi, Wenxin; Yu, Shuili; He, Jiajie

    2012-01-01

    A new type of poly(vinylidene fluoride)(PVDF)-SiO(2) hybrid anion-exchange membrane was prepared by blending method. The anion-exchange groups were introduced by the reaction of epoxy groups with trimethylamine (TMA). Contact angle between water and the membrane surface was measured to characterize the hydrophilicity change of the membrane surface. The effects of nano-sized SiO(2) particles in the membrane-forming materials on the membrane mechanical properties and conductivity were also investigated. The experimental results indicated that PVDF-SiO(2) anion-exchange membranes exhibited better water content, ion-exchange capacity, conductivity and mechanic properties, and so may find potential applications in alkaline membrane fuel cells and water treatment processes.

  18. Ammonium Bicarbonate Transport in Anion Exchange Membranes for Salinity Gradient Energy

    KAUST Repository

    Geise, Geoffrey M.

    2013-09-17

    Many salinity gradient energy technologies such as reverse electrodialysis (RED) rely on highly selective anion transport through polymeric anion exchange membranes. While there is considerable interest in using thermolytic solutions such as ammonium bicarbonate (AmB) in RED processes for closed-loop conversion of heat energy to electricity, little is known about membrane performance in this electrolyte. The resistances of two commercially available cation exchange membranes in AmB were lower than their resistances in NaCl. However, the resistances of commercially available anion exchange membranes (AEMs) were much larger in AmB than in NaCl, which would adversely affect energy recovery. The properties of a series of quaternary ammonium-functionalized poly(phenylene oxide) and Radel-based AEMs were therefore examined to understand the reasons for increased resistance in AmB to overcome this performance penalty due to the lower mobility of bicarbonate, 4.59 × 10-4 cm2/(V s), compared to chloride, 7.90 × 10-4 cm2/(V s) (the dilute aqueous solution mobility ratio of HCO3 - to Cl- is 0.58). Most membrane resistances were generally consistent with the dilute solution mobilities of the anions. For a few key samples, however, increased water uptake in AmB solution reduced the ionic resistance of the polymer compared to its resistance in NaCl solution. This increased water uptake was attributed to the greater hydration of the bicarbonate ion compared to the chloride ion. The increased resistance due to the use of bicarbonate as opposed to chloride ions in AEMs can therefore be mitigated by designing polymers that swell more in AmB compared to NaCl solutions, enabling more efficient energy recovery using AmB thermolytic solutions in RED. © 2013 American Chemical Society.

  19. Ammonium Bicarbonate Transport in Anion Exchange Membranes for Salinity Gradient Energy

    KAUST Repository

    Geise, Geoffrey M.; Hickner, Michael A.; Logan, Bruce E.

    2013-01-01

    Many salinity gradient energy technologies such as reverse electrodialysis (RED) rely on highly selective anion transport through polymeric anion exchange membranes. While there is considerable interest in using thermolytic solutions such as ammonium bicarbonate (AmB) in RED processes for closed-loop conversion of heat energy to electricity, little is known about membrane performance in this electrolyte. The resistances of two commercially available cation exchange membranes in AmB were lower than their resistances in NaCl. However, the resistances of commercially available anion exchange membranes (AEMs) were much larger in AmB than in NaCl, which would adversely affect energy recovery. The properties of a series of quaternary ammonium-functionalized poly(phenylene oxide) and Radel-based AEMs were therefore examined to understand the reasons for increased resistance in AmB to overcome this performance penalty due to the lower mobility of bicarbonate, 4.59 × 10-4 cm2/(V s), compared to chloride, 7.90 × 10-4 cm2/(V s) (the dilute aqueous solution mobility ratio of HCO3 - to Cl- is 0.58). Most membrane resistances were generally consistent with the dilute solution mobilities of the anions. For a few key samples, however, increased water uptake in AmB solution reduced the ionic resistance of the polymer compared to its resistance in NaCl solution. This increased water uptake was attributed to the greater hydration of the bicarbonate ion compared to the chloride ion. The increased resistance due to the use of bicarbonate as opposed to chloride ions in AEMs can therefore be mitigated by designing polymers that swell more in AmB compared to NaCl solutions, enabling more efficient energy recovery using AmB thermolytic solutions in RED. © 2013 American Chemical Society.

  20. The reactivity of anion-exchange resins by applying OT-for-OH exchange reaction in the equilibrium state

    International Nuclear Information System (INIS)

    Kano, Naoki; Nihei, Makoto; Imaizumi, Hiroshi

    1996-01-01

    In order to reveal the behavior of hydroxyl group in isotope exchange reaction, OT-for-OH exchange reaction between each anion-exchange resin (OH - form) and tritiated water (abbreviated as HTO water below) was observed at 80degC under the equilibrium. Anion-exchange resins used were Amberlite IRA-400, IRA-410 (both strongly basic), and IRA-94S (weakly basic). It can be thought that an HTO molecule dissociates into H + +OT - (or T + +OH - ). The activity of each resin based on OT-for-OH exchange reaction was measured with a liquid scintillation counter. From the above-mentioned, the following five were found. Isotope exchange reaction as 'atomic group' occurred between the OH group in each anion-exchange resin and the OT group in HTO water. The reactivity of strongly basic anion-exchange resin is larger than that of weakly basic one. The ratio of the reactivity of these resins can roughly be expressed as follows: (IRA-410): (IRA-400): (IRA-94S)=42: 7: 1. The degree of OT-for-OH exchange reaction may be smaller than that of T-for-H exchange reaction. The method used and results obtained in this work may be helpful to obtain the data for the prevention of T-contamination, especially to obtain the data from certain atomic groups including T. (author)

  1. Removal of 125I from radioactive experimental waste with an anion exchange paper membrane

    International Nuclear Information System (INIS)

    Inoue, Hiroyoshi; Kagoshima, Mayumi

    2000-01-01

    The behavior of radioactive iodide and chloride ions through an anion exchange paper membrane to remove 125 I from radioactive experimental waste has been studied with nonequilibrium thermodynamic analyses. Anion exchange paper membrane was found to be electroconductively more permeable to iodide ion than to chloride ion. The iodide ion bound more strongly to the anion exchange site within a membrane phase than the chloride ion by more than twice. The results suggested that an anion exchange paper membrane was appropriate for the filtration removal system

  2. Studies on resin degradation products encountered during purification of plutonium by anion exchange

    International Nuclear Information System (INIS)

    Ramanujam, A.; Dhami, P.S.; Gopalakrishnan, V.; Dhumwad, R.K.

    1991-01-01

    Among the methods available for the purification of plutonium in Purex process, anion exchange method offers several advantages. However, on repeated use, the resin gets degraded due to thermal, radiolytic and chemical attacks resulting in chemical as well as physical damage. Frequently, plutonium product eluted from such resin contains significant quantities of white precipitates. A few anion exchange resins were leached with 8 M HNO 3 at 60-80degC and the resin degradation products (RDP) in the leach-extract were found to give similar precipitates with tetravalent metal ions like Pu(IV), Th(IV) etc. Tetra propyl ammonium hydroxide in 8 M HNO 3 (TPAN) also gave a white precipitate with plutonium similar to the one found in the elution streams. The results indicate that delinked quaternary ammonium functional groups might be responsible for the formation of precipitate. The characteristics of precipitates Th-RDP, Th-TPAN and that isolated from elution stream have been investigated. In a separate study a tentative formula for Th-RDP compound is proposed. The influence of RDP on the extraction of plutonium and other components in Purex process was studied and it was found that RDP complexes metal ions thus marginally affecting the kd values. A spectrophotometric method has been standardised to monitor the extent of degradation of anion exchange resins which is based on the ability of RDP to reduce the colour intensity of Th-thoron complex. This technique can be used to study the stability of the anion exchange resins. (author). 8 refs., 8 tabs., 5 figs.,

  3. New anion-exchange resins for improved separations of nuclear materials

    International Nuclear Information System (INIS)

    Barr, M.E.; Bartsch, R.A.

    1998-01-01

    'The overall objective of this research is to develop a predictive capability which allows the facile design and implementation of multi-functionalized anion-exchange materials which selectively sorb metal complexes of interest from targeted process, waste, and environmental streams. The basic scientific issues addressed are actinide complex speciation along with modeling of the metal complex/functional-site interactions in order to determine optimal binding-site characteristics. The new ion-exchange resins interface the rapidly developing field of ion-specific chelating ligands with robust, commercial ion-exchange technology. Various Focus Areas and Crosscutting Programs have described needs that would be favorably impacted by the new materials: Efficient Separations and Processing; Plutonium; Plumes; Mixed Waste; High-Level Tank Waste. Sites within the DOE complex which would benefit from the improved anion-exchange technology include Hanford, INEL, Los Alamos, Oak Ridge, and Savannah River. As of April 1998, this report summarizes work after 1.6 years of a 3-year project. The authors technical approach combines empirical testing with theoretical modeling (applied in an iterative mode) in order to determine optimal binding-site characteristics. They determine actinide-complex speciation in specific media, then develop models for the metal complex/functional-site interactions Synthesis and evaluation of multi-functionalized extractants and ion-exchange materials that implement key features of the optimized binding site provide feedback to the modeling and design activities. Resin materials which actively facilitate the uptake of actinide complexes from solution should display both improved selectivity and kinetic properties. The implementation of the bifunctionality concept involves N-derivatization of pyridinium units from a base poly(4-vinylpyridine) resin with a second cationic site such that the two anion-exchange sites are linked by spacer arms of varying

  4. Preparation of anion exchange membrane using polyvinyl chloride (PVC) for alkaline water electrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Gab-Jin; Bong, Soo-Yeon; Ryu, Cheol-Hwi [Hoseo University, Asan (Korea, Republic of); Lim, Soo-Gon [Energy and Machinery Korea Co., Ltd., Changwon (Korea, Republic of); Choi, Ho-Sang [Kyungil University, Gyeongsan (Korea, Republic of)

    2015-09-15

    An anion exchange membrane was prepared by the chloromethylation and the amination of polyvinyl chloride (PVC), as the base polymer. The membrane properties of the prepared anion exchange membrane, including ionic conductivity, ion exchange capacity, and water content were measured. The ionic conductivity of the prepared anion exchange membrane was in the range of 0.098x10{sup -2} -7.0x10{sup -2}S cm{sup -1}. The ranges of ion exchange capacity and water content were 1.9-3.7meq./g-dry-membrane and 35.1-63.1%, respectively. The chemical stability of the prepared anion exchange membrane was tested by soaking in 30 wt% KOH solution to determine its availability as a separator in the alkaline water electrolysis. The ionic conductivity during the chemical stability test largely did not change.

  5. Rejuvenation of the anion exchanger used for uranium recovery

    International Nuclear Information System (INIS)

    Yan, T.-Y.; Espenscheid, W.F.

    1986-01-01

    The present invention is directed to improving the performance of strong base anionic exchange resins used in uranium recovery that exhibit an undesirable decrease in loading capacity and in total exchange capacity. The invention comprises treating an anionic exchange resin to remove physically adsorbed and occluded fouling agents and to remove poisons which may be chemically bound to active ion groups on the resin. The process involves treating the resin, after the uranium ion exchange stage, with an alkaline carbonate solution, preferably treating the resin with an acid eluant first. The acid treatment dissolves insoluble fouling agents which are physically occluded or adsorbed by the resin and that the weak base treatment augments that result and probably removes poisons which are physically or chemically bound to the resin

  6. Hybrid capacitive deionization with anion-exchange membranes for lithium extraction

    OpenAIRE

    Siekierka Anna; Bryjak Marek

    2017-01-01

    Lithium is considered to be a critical material for various industrial fields. We present our studies on extraction lithium from diluted aqueous solution by novel hybrid system based on a membrane capacitive deionization and batteries desalination. Hybrid CDI is comprised by a lithium selective adsorbent, activated carbon electrode and anion-exchange membranes. Here, we demonstrated implication of various type of anion-exchange membranes and influence their properties on effective capacity an...

  7. SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

    Directory of Open Access Journals (Sweden)

    Chi-Jiunn Pan

    Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

  8. Importance of balancing membrane and electrode water in anion exchange membrane fuel cells

    Science.gov (United States)

    Omasta, T. J.; Wang, L.; Peng, X.; Lewis, C. A.; Varcoe, J. R.; Mustain, W. E.

    2018-01-01

    Anion exchange membrane fuel cells (AEMFCs) offer several potential advantages over proton exchange membrane fuel cells (PEMFCs), most notably to overcome the cost barrier that has slowed the growth and large scale implementation of fuel cells for transportation. However, limitations in performance have held back AEMFCs, specifically in the areas of stability, carbonation, and maximum achievable current and power densities. In order for AEMFCs to contend with PEMFCs for market viability, it is necessary to realize a competitive cell performance. This work demonstrates a new benchmark for a H2/O2 AEMFC with a peak power density of 1.4 W cm-2 at 60 °C. This was accomplished by taking a more precise look at balancing necessary membrane hydration while preventing electrode flooding, which somewhat surprisingly can occur both at the anode and the cathode. Specifically, radiation-grafted ETFE-based anion exchange membranes and anion exchange ionomer powder, functionalized with benchmark benzyltrimethylammonium groups, were utilized to examine the effects of the following parameters on AEMFC performance: feed gas flow rate, the use of hydrophobic vs. hydrophilic gas diffusion layers, and gas feed dew points.

  9. Anion exchange purification of plutonium at lower acidities (Preprint No. CT-6)

    International Nuclear Information System (INIS)

    Kartha, P.K.S.; Ravi, S.; Achuthan, P.V.; Das, S.K.; Madhusudan, A.; Janardhanan, C.; Rao, K.S.; Ramanujam, A.; Dhumwad, R.K.

    1988-02-01

    During concentration and purification of plutonium by anion exchange, 7.2 M HNO 3 is used as loading acidity for absorbing Pu(IV). In this study, the feasibility of utilizing lower acidities like 5.2 and 6.2 M has been investigated. The results indicate that lower acidities can be used in this step if reduced resin capacities are acceptable. (author)

  10. Separation of metal ions by anion exchange in mixtures of hydrochloric acid and hydrofluoric acid

    International Nuclear Information System (INIS)

    Faris, J.P.

    1978-12-01

    Distribution coefficients were determined for the adsorption of more than 40 elements on anion-exchange resins from mixtures of HCl (0.1 to 12M) and HF (0.1-8M). Two resins, Dowex 1 x 10, 200 to 400 mesh and Dowex 1 x 4, 100 to 200 mesh, were used. Distribution coefficients were also determined for the adsorption of many elements on both resins from 0.1 to 12M HCl and 0.1 to 12M HF. Anion exchange in the presence of HF was found useful for separating impurities from various materials for their subsequent determination, and specific procedures used in our spectrochemical laboratory for this purpose are outlined. The results of a literature search on the use of anion exchange in hydrofluoric acid and fluoride-containing media are presented in an extensive bibliography. 404 references, 9 tables

  11. Rapid anion exchange separation of fermium with mineral acid-methyl alcohol mixed media

    International Nuclear Information System (INIS)

    Usuda, S.; Shinohara, N.; Ichikawa, S.; Suzuki, T.

    1987-01-01

    Anion exchange separation of 250 Fm (30 m) synthesized by the 12 C+ 242 Pu and 16 O+ 238 U reactions was investigated with mineral acid-methyl alcohol mixed media at elevated temperature. Fermium was chromatographically separated from the other transplutonium elements, the target materials and an Al catcher foil by anion exchange with mixtures of nitric acid and methyl alcohol. By use of the mixed media of hydrochloric acid and methyl alcohol, Fm together with Cf was separated from Al, Am, Cm, Pu, U and from major fission products. The separation systems are suitable for rapid separation and immediate alpha-counting source preparation of Fm. (author) 22 refs.; 4 figs

  12. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  13. Formation of Aqueous MgUO2(CO3)32- Complex and Uranium Anion Exchange Mechanism onto an Exchange Resin

    International Nuclear Information System (INIS)

    Dong, Wenming; Brooks, Scott C

    2008-01-01

    The formation of and stability constants for aqueous Mg-UO2-CO3 complexes were determined using an anion exchange method. Magnesium concentration was varied (up to 20 mmol/L) at constant ionic strength (I = 0.101, 0.202, 0.304, 0.406, and 0.509 mol/kg NaNO3), pH = 8.1, total [U(VI)] = 10.4 mol/L under equilibrium with atmospheric CO2. The results indicate that only the MgUO2(CO3)32- complex is formed. The cumulative formation constant extrapolated to zero ionic strength is similar regardless of the activity correction convention used: log = 25.8 b 0.5 using Davies equation and = 25.02 b 0.08 using specific ion interaction theory (SIT). Uranium sorption onto the exchange resin decreased in the presence of Mg putatively due to the formation of MgUO2(CO3)32- that had a lower affinity for the resin than UO2(CO3)34-. Uranium sorption results are consistent with an equivalent anion exchange reaction between NO3- and UO2(CO3)34- species to retain charge neutrality regardless of Mg concentration. No Mg was associated with the anion exchange resin indicating that the MgUO2(CO3)32- complex did not sorb

  14. Polyvinyl alcohol (PVA) and sulfonated polyetheretherketone (SPEEK) anion exchange membrane for fuel cell

    CSIR Research Space (South Africa)

    Luo, H

    2010-08-31

    Full Text Available less than proton exchange membrane systems using alcohol as fuel. Many anion exchange membranes based on quaternised polymers have been developed and studied for AMFC3-5. The quaternary ammonium functional groups are the anion conductors...

  15. Preparation of Two-Layer Anion-Exchange Poly(ethersulfone Based Membrane: Effect of Surface Modification

    Directory of Open Access Journals (Sweden)

    Lucie Zarybnicka

    2016-01-01

    Full Text Available The present work deals with the surface modification of a commercial microfiltration poly(ethersulfone membrane by graft polymerization technique. Poly(styrene-co-divinylbenzene-co-4-vinylbenzylchloride surface layer was covalently attached onto the poly(ethersulfone support layer to improve the membrane electrochemical properties. Followed by amination, a two-layer anion-exchange membrane was prepared. The effect of surface layer treatment using the extraction in various solvents on membrane morphological and electrochemical characteristics was studied. The membranes were tested from the point of view of water content, ion-exchange capacity, specific resistance, permselectivity, FT-IR spectroscopy, and SEM analysis. It was found that the two-layer anion-exchange membranes after the extraction using tetrahydrofuran or toluene exhibited smooth and porous surface layer, which resulted in improved ion-exchange capacity, electrical resistance, and permselectivity of the membranes.

  16. The assessment of pellicular anion-exchange resins for the determination of anions by ion chromatography

    International Nuclear Information System (INIS)

    Pohlandt, C.

    1981-01-01

    Because pellicular anion-exchange resins suitable for the determination, by ion chromatography, of anions with alkaline eluents were unavailable in South Africa at the inception of this work, an attempt was made to prepare such resins. In this study it is shown that the pellicular resins produced are more efficient than the surface-aminated resins used previously. The simultaneous separation and determination of five common anions is demonstrated. The method was applied to the analysis of uranium leach liquors, effluent samples, and a solid sample of ferric oxide (goethite)

  17. Anion-exchange membranes in electrochemical energy systems

    NARCIS (Netherlands)

    Varcoe, J.R.; Atanassov, P.; Dekel, D.R.; Herring, A.M.; Hickner, M.A.; Kohl, P.A.; Kucernak, A. R.; Mustain, W.E.; Nijmeijer, K.; Scott, Keith; Xu, Tongwen; Zhuang, Lin

    2014-01-01

    This article provides an up-to-date perspective on the use of anion-exchange membranes in fuel cells, electrolysers, redox flow batteries, reverse electrodialysis cells, and bioelectrochemical systems (e.g. microbial fuel cells). The aim is to highlight key concepts, misconceptions, the current

  18. Radiation stability of anion-exchange resins based on epichlorohydrin and vinylpyridines

    International Nuclear Information System (INIS)

    Zainutdinov, S.S.; Dzhalilov, A.T.; Askarov, M.A.

    1983-01-01

    The vigorous development of nuclear technology and atomic energy and the hydrometallurgy of the rare and radioactive metals has made it necessary to create and use ion-exchange materials possessing a high resistance to the action of ionizing radiations and the temperature. In view of this, the necessity has arisen for obtaining ion-exchange materials possessing adequate radiation stability. The results of an investigation of the radiation stability of anion-exchange resins based on the products of spontaneous polymerization in the interaction of epichlorohydrin with vinylpyridines show that they possess higher radiation resistance than the industrial anion-exchange resin AN-31 used at the present time

  19. Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

    Science.gov (United States)

    Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

    2013-01-01

    To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

  20. Overexpression of Interleukin-4 in the Thyroid of Transgenic Mice Upregulates the Expression of Duox1 and the Anion Transporter Pendrin

    Science.gov (United States)

    Achouri, Younes; Hahn, Stephan; Many, Marie-Christine; Craps, Julie; Refetoff, Samuel; Liao, Xiao-Hui; Dumont, Jacques E.; Van Sande, Jacqueline; Corvilain, Bernard; Miot, Françoise; De Deken, Xavier

    2016-01-01

    Background: The dual oxidases (Duox) are involved in hydrogen peroxide generation, which is essential for thyroid hormone synthesis, and therefore they are markers of thyroid function. During inflammation, cytokines upregulate DUOX gene expression in the airway and the intestine, suggesting a role for these proteins in innate immunity. It was previously demonstrated that interleukin-4 (IL-4) upregulates DUOX gene expression in thyrocytes. Although the role of IL-4 in autoimmune thyroid diseases has been studied extensively, the effects of IL-4 on thyroid physiology remain largely unknown. Therefore, a new animal model was generated to study the impact of IL-4 on thyroid function. Methods: Transgenic (Thyr-IL-4) mice with thyroid-targeted expression of murine IL-4 were generated. Transgene expression was verified at the mRNA and protein level in thyroid tissues and primary cultures. The phenotype of the Thyr-IL-4 animals was characterized by measuring serum thyroxine (T4) and thyrotropin levels and performing thyroid morphometric analysis, immunohistochemistry, whole transcriptome sequencing, quantitative reverse transcription polymerase chain reaction, and ex vivo thyroid function assays. Results: Thyrocytes from two Thyr-IL-4 mouse lines (#30 and #52) expressed IL-4, which was secreted into the extracellular space. Although 10-month-old transgenic animals had T4 and thyrotropin serum levels in the normal range, they had altered thyroid follicular structure with enlarged follicles composed of elongated thyrocytes containing numerous endocytic vesicles. These follicles were positive for T4 staining the colloid, indicating their capacity to produce thyroid hormones. RNA profiling of Thyr-IL-4 thyroid samples revealed modulation of multiple genes involved in inflammation, while no major leukocyte infiltration could be detected. Upregulated expression of Duox1, Duoxa1, and the pendrin anion exchanger gene (Slc26a4) was detected. In contrast, the iodide symporter gene

  1. Separation of boron isotopes by ion exchange chromatography: studies on regeneration of strong base anion exchange resins

    International Nuclear Information System (INIS)

    Sharma, B.K.; Subramanian, R.; Mathur, P.K.

    1994-01-01

    The optimum conditions for the regeneration of strong base anion exchange resins of type-I and type-II were determined for cost-effective separation of isotopes of boron by ion exchange chromatography where the hydroxyl form of an anion exchange resin is equilibrated with boric acid solution containing mannitol as a complexing reagent. The possibility of using unspent alkali content of the effluent was also exploited. Removal of carbonate impurity from Rayon grade caustic lye (used as regenerant after dilution) and recycling of Ba(OH) 2 was studied to avoid waste disposal problems. (author)

  2. Inorganic anion exchangers for the treatment of radioactive wastes

    International Nuclear Information System (INIS)

    Dyer, A.; Jamil, M.A.

    1987-07-01

    Inorganic anion exchangers are evaluated for Tc, I and S isotope removal from aqueous nuclear waste streams. Chemical, thermal, and radiation stabilities were examined. Selected exchangers were examined in detail for their selectivities, kinetics and mechanism of the sorption process (especially in NO 3 - , OH - and BO 3 - environments). Cement encapsulation and leaching experiments were made on the exchangers showing most promise for 'radwaste' treatment. (author)

  3. Dowex anion exchanger-loaded-baker's yeast as bi-functionalized biosorbents for selective extraction of anionic and cationic mercury(II) species

    International Nuclear Information System (INIS)

    Mahmoud, Mohamed E.; Yakout, Amr A.; Osman, Maher M.

    2009-01-01

    Dowex anion exchanger-immobilized-baker's yeast [Dae-yeast] were synthesized and potentially applied as environmental friendly biosorbents to evaluate the up-take process of anionic and cationic mercury(II) species as well as other metal ions. Optimization of mass ratio of Dowex anion exchanger versus yeast (1:1-1:10) in presence of various interacting buffer solutions (pH 4.0-9.0) was performed and evaluated. Surface modification of [Dae-yeast] was characterized by scanning electron microscopy (SEM) and infrared spectroscopy. The maximum metal biosorption capacity values of [Dae-yeast] towards mercury(II) were found in the range of 0.800-0.960, 0.840-0.950 and 0.730-0.900 mmol g -1 in presence of buffer solutions pH 2.0, 4.0 and 7.0, respectively. Three possible and different mechanisms are proposed to account for the biosorption of mercury and mercuric species under these three buffering conditions based on ion exchange, ion pair and chelation interaction processes. Factors affecting biosorption of mercury from aqueous medium including the pH effect of aqueous solutions (1.0-7.0), shaking time (1-30 min) and interfering ions were searched. The potential applications of modified biosorbents for selective biosorption and extraction of mercury from different real matrices including dental filling waste materials, industrial waste water samples and mercury lamp waste materials were also explored. The results denote to excellent percentage extraction values, from nitric acid as the dissolution solvent with a pH 2.0, as determined in the range of 90.77-97.91 ± 3.00-5.00%, 90.00-93.40 ± 4.00-5.00% and 92.31-100.00 ± 3.00-4.00% for the three tested samples, respectively.

  4. Fixation of metallic sulfosalicylate complexes on an anionic exchange resin

    International Nuclear Information System (INIS)

    Cahuzac, S.

    1969-06-01

    Since sulfosalicylate ions have acid-base properties, sulfosalicylate complexes have an apparent stability which varies with the ph. As a result, the fixation of sulfo-salicylates on an anionic exchange resin depends on the ph of the solution in equilibrium with the resin. This research has been aimed at studying the influence of the ph on the fixation on an anionic exchange resin (Dowex 1 x 4) of sulfosalicylate anions on the one hand, and of metallic sulfosalicylate complexes on the other hand. In the first part of this work, a determination has been made, by frontal analysis of the distribution of sulfosalicylate ions in the resin according to the total sulfosalicylate I concentration in the aqueous solution in equilibrium with the resin. The exchange constants of these ions between the resin and the solution have been calculated. In the second part, a study has been made of the fixation of anionic sulfosalicylate complexes of Fe(III), Al(III), Cr(III), Cu(II), Ni(II), Co(II), Zn(II), Mn(II), Cd(II), Fe(II) and UO 2 2+ . By measuring the partition coefficients of these different elements between the resin and the solution it has been possible to give interpretation for the modes of fixation of the metallic ions, and to calculate their exchange constant between the resin and the solution. The relationship has been established for each metallic element studied, between its partition coefficient, the ph and the total concentration of the complexing agent in solution. Such a relationship makes it possible to predict, for given conditions, the nature of the species in solution and in the resin, as well as the partition coefficient of a metallic, element. Finally, in the third part of the work, use has been made of results obtained previously, to carry out some separations (Ni 2+ - Co 2+ ; Ni 2+ - Co 2+ - Cu 2+ ; UO 2 2+ - Fe 3+ ; UO 2 2+ - Cr 3+ ; UO 2 2+ - Cu 2+ ; UO 2 2+ - Ni 2+ ; UO 2 2+ - Co 2+ ; UO 2 2+ - Mn 2+ and UO 2 2+ - Cd 2+ ), as well as the purification

  5. Design of Anion Exchange Membranes and Electrodialysis Studies for Water Desalination

    Directory of Open Access Journals (Sweden)

    Muhammad Imran Khan

    2016-05-01

    Full Text Available Anion exchange membranes are highly versatile and nowadays have many applications, ranging from water treatment to sensing materials. The preparation of anion exchange membranes (AEMs from brominated poly(2,6-dimethyl-1,6-phenylene oxide (BPPO and methyl(diphenylphosphine (MDPP for electrodialysis was performed. The physiochemical properties and electrochemical performance of fabricated membranes can be measured by changing MDPP contents in the membrane matrix. The influence of a quaternary phosphonium group associated with the removal of NaCl from water is discussed. The prepared membranes have ion exchange capacities (IEC 1.09–1.52 mmol/g, water uptake (WR 17.14%–21.77%, linear expansion ratio (LER 7.96%–11.86%, tensile strength (TS 16.66–23.97 MPa and elongation at break (Eb 485.57%–647.98%. The prepared anion exchange membranes were employed for the electrodialytic removal of 0.1 M NaCl aqueous solution at a constant applied voltage. It is found that the reported membranes could be the promising candidate for NaCl removal via electrodialysis.

  6. Hydrothermal carbon nanosphere-based agglomerated anion exchanger for ion chromatography.

    Science.gov (United States)

    Zhao, Qiming; Wu, Shuchao; Zhang, Kai; Lou, Chaoyan; Zhang, Peiming; Zhu, Yan

    2016-10-14

    This work reports the application of hydrothermal carbon nanospheres (HCNSs) as stationary phases in ion chromatography. HCNSs were facilely quaternized through polycondensation of methylamine and 1,4-butanediol diglycidyl ether. The quaternization was confirmed by Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy. Owing to the electrostatic interaction, quaternized HCNSs were equably attached onto the surface of sulfonated polystyrene-divinylbenzene (PS-DVB) beads to construct the anion exchangers. The aggregation was verified by scanning electron microscopy and elemental analysis. Common anions, aliphatic monocarboxylic acids, polarizable anions, and aromatic acids were well separated on the stationary phases with good stability and symmetry. The prepared column was further applied to detect phosphate content in Cola drink samples. The limit of detection (S/N=3) was 0.09mg/L, and the relative standard deviation (n=10) of retention time was 0.31%. The average recovery was 99.58%. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. The many ways of making anionic clays

    Indian Academy of Sciences (India)

    Together with hydrotalcite-like layered double hydroxides, bivalent and trivalent metal hydroxides and their hydroxy salts are actually anionic clays consisting of positively charged hydroxide layers with anions intercalated in the interlayer region. The anionic clays exhibit anion sorption, anion diffusion and exchange ...

  8. Synthesis, characterisation and anion exchange properties of copper, magnesium, zinc and nickel hydroxy nitrates

    Science.gov (United States)

    Biswick, Timothy; Jones, William; Pacuła, Aleksandra; Serwicka, Ewa

    2006-01-01

    Anion exchange reactions of four structurally related hydroxy salts, Cu 2(OH) 3NO 3, Mg 2(OH) 3NO 3, Ni 2(OH) 3NO 3 and Zn 3(OH) 4(NO 3) 2 are compared and trends rationalised in terms of the strength of the covalent bond between the nitrate group and the matrix cation. Powder X-ray diffraction (PXRD), Fourier-transform infrared (FTIR) spectroscopy, thermogravimetric analysis (TGA) and elemental analysis are used to characterise the materials. Replacement of the nitrate anions in the zinc and copper salts with benzoate anions is possible although exchange of the zinc salt is accompanied by modification of the layer structure from one where zinc is exclusively six-fold coordinated to a structure where there is both six- and four-fold zinc coordination. Magnesium and nickel hydroxy nitrates, on the other hand, hydrolyse to their respective metal hydroxides.

  9. Gaseous anion chemistry. Hydrogen-deuterium exchange in mono- and dialcohol alkoxide ions: ionization reactions in dialcohols

    International Nuclear Information System (INIS)

    Lloyd, J.R.; Agosta, W.C.; Field, F.H.

    1980-01-01

    The subject of this work is H-D exchange in certain gaseous anions using D 2 as the exchanging agent. The anions involved are produced from ethylene glycol, 1,3-propanediol, 1,4-butanediol, ethanol, 1-propanol, and 1-butanol. Spectra and postulated ionization reactions for these mono- and dialcohols are given. Hydrogen-deuterium exchange occurs in the (M - 1) - and (2M - 1) - ions of ethylene glycol, 1,3-propanediol, and 1,4-butanediol. The amount of exchange occurring is 3-8 times greater in (2M - 1) - than in (M - 1) - . The amount of H-D exchange occurring in ethanol, 1-propanol, and 1-butanol is small or zero in the (2M - 1) - ions and in the (M - 1) - ion for 1-butanol [the only (M - 1) - ion which could be examined experimentally]. The amount of exchange occurring in the (2M - 1) - and (M - 1) - ions from ethylene glycol is not affected by the total pressure or composition of the reaction mixture in the ionization chamber of the mass spectrometer. A novel hydrogen-bridging mechanism is suggested to account for the observed exchange occurring in the dialcohols

  10. Anion-exchange Studies of Radioactive Trace Elements in Sulphuric Acid Solutions

    Energy Technology Data Exchange (ETDEWEB)

    Samsahl, K

    1963-01-15

    As part of a chemical group separation procedure used as a pretreatment in gamma spectrometric analysis, a study has been made of the adsorption from sulphuric acid solutions on strongly basic anion exchange resins, prepared in the hydroxide and the sulphate forms, of trace activities of Na, P, K, Ca, Sc, Cr, Mn, Fe, Co, Ni, Cu, Zn, Ga, Rb, Sr, Zr, Nb, Mo, Tc, Ag, Cd, In, Cs, Ba, La, Ce, Hf, Ta, W, Ir, Pa and Np. Besides adsorbing some of the trace elements in the solution, the anion exchange resin in the hydroxide form will neutralize the bulk of the sulphuric acid. This makes possible the subsequent sequential separation of chloride complexes on short anion-exchange columns by a stepwise increasing of the HCl concentration of the solution. On the basis of the results obtained in the present and earlier experiments, a new improved chemical group-separation procedure for mixtures of radioactive trace elements is outlined.

  11. Design and fabrication of enhanced corrosion resistance Zn-Al layered double hydroxides films based anion-exchange mechanism on magnesium alloys

    International Nuclear Information System (INIS)

    Zhou, Meng; Yan, Luchun; Ling, Hao; Diao, Yupeng; Pang, Xiaolu; Wang, Yanlin; Gao, Kewei

    2017-01-01

    Highlights: • Zn-Al LDHs film loaded nitrate anions has been fabricated on a magnesium alloy substrate via a facile hydrothermal crystallization method. • The Zn-Al-Cl LDHs and Zn-Al-VO_x LDHs film were obtained based on anion-exchange mechanism. • The Zn-Al-Cl LDHs and Zn-Al-VO_x LDHs film could effectively protect magnesium alloy. - Abstract: Layered double hydroxides (LDHs) with brucite-like layer structure and the facile exchangeability of intercalated anions had attracted tremendous interest in many fields because of their great importance for both fundamental studies and practical applications. Herein zinc-aluminum layered double hydroxides (Zn-Al LDHs) films intercalated with nitrate anions on the magnesium alloy substrate were designed and fabricated via a facile hydrothermal crystallization method. In order to obtain better corrosion resistance, chloride and vanadate anions were intercalated into the LDHs interlayers via the anion-exchange reaction. X-ray diffraction (XRD), Fourier transform infrared (FT-IR) spectroscopy and scanning electronic microscopy (SEM) were used to examine structure, composition and morphology of the Zn-Al-NO_3 LDHs, Zn-Al-Cl LDHs and Zn-Al-VO_x LDHs films. The corrosion resistance of the Zn-Al LDHs with different anion films was estimated by the electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization measurement. EIS and polarization curves measurements revealed that the magnesium alloy could be effectively protected by the Zn-Al-Cl LDHs and Zn-Al-VO_x LDHs films due to the blocking effect of chloride anions and the control-release ability of vanadate anions.

  12. Design and fabrication of enhanced corrosion resistance Zn-Al layered double hydroxides films based anion-exchange mechanism on magnesium alloys

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Meng; Yan, Luchun; Ling, Hao; Diao, Yupeng; Pang, Xiaolu; Wang, Yanlin; Gao, Kewei, E-mail: kwgao@yahoo.com

    2017-05-15

    Highlights: • Zn-Al LDHs film loaded nitrate anions has been fabricated on a magnesium alloy substrate via a facile hydrothermal crystallization method. • The Zn-Al-Cl LDHs and Zn-Al-VO{sub x} LDHs film were obtained based on anion-exchange mechanism. • The Zn-Al-Cl LDHs and Zn-Al-VO{sub x} LDHs film could effectively protect magnesium alloy. - Abstract: Layered double hydroxides (LDHs) with brucite-like layer structure and the facile exchangeability of intercalated anions had attracted tremendous interest in many fields because of their great importance for both fundamental studies and practical applications. Herein zinc-aluminum layered double hydroxides (Zn-Al LDHs) films intercalated with nitrate anions on the magnesium alloy substrate were designed and fabricated via a facile hydrothermal crystallization method. In order to obtain better corrosion resistance, chloride and vanadate anions were intercalated into the LDHs interlayers via the anion-exchange reaction. X-ray diffraction (XRD), Fourier transform infrared (FT-IR) spectroscopy and scanning electronic microscopy (SEM) were used to examine structure, composition and morphology of the Zn-Al-NO{sub 3} LDHs, Zn-Al-Cl LDHs and Zn-Al-VO{sub x} LDHs films. The corrosion resistance of the Zn-Al LDHs with different anion films was estimated by the electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization measurement. EIS and polarization curves measurements revealed that the magnesium alloy could be effectively protected by the Zn-Al-Cl LDHs and Zn-Al-VO{sub x} LDHs films due to the blocking effect of chloride anions and the control-release ability of vanadate anions.

  13. based anion exchange membrane for alkaline polymer electrolyte

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Hydroxyl ion (OH–) conducting anion exchange membranes based on modified poly (phenylene oxide) are fabricated for their application in alkaline polymer electrolyte fuel cells (APEFCs). In the present study, chloromethylation of poly(phenylene oxide) (PPO) is performed by aryl substitution rather than benzyl.

  14. Determination of nitrate by anion exchange with ultraviolet detection

    Energy Technology Data Exchange (ETDEWEB)

    McComas, J.G.

    1976-01-01

    A weak base anion exchange resin is synthesized by surface bonding 3-aminopropyltriethoxysilane to silica gel. This silylated silica gel is used to separate nitrate from interferences. The nitrate is then determined by measuring its absorbance at 220 nm. An interference study was performed and no anions commonly found in potable water interferes. A comparison of this method was made with the brucine method on real samples and satisfactory agreement was obtained between the two methods.

  15. Diclofenac removal in urine using strong-base anion exchange polymer resins.

    Science.gov (United States)

    Landry, Kelly A; Boyer, Treavor H

    2013-11-01

    One of the major sources of pharmaceuticals in the environment is wastewater effluent of which human urine contributes the majority of pharmaceuticals. Urine source separation has the potential to isolate pharmaceuticals at a higher concentration for efficient removal as well as produce a nutrient byproduct. This research investigated the efficacy of using strong-base anion exchange polymer resins to remove the widely detected and abundant pharmaceutical, diclofenac, from synthetic human urine under fresh and ureolyzed conditions. The majority of experiments were conducted using a strong-base, macroporous, polystyrene resin (Purolite A520E). Ion-exchange followed a two-step removal rate with rapid removal in 1 h and equilibrium removal in 24 h. Diclofenac removal was >90% at a resin dose of 8 mL/L in both fresh and ureolyzed urine. Sorption of diclofenac onto A520E resin was concurrent with desorption of an equivalent amount of chloride, which indicates the ion-exchange mechanism is occurring. The presence of competing ions such as phosphate and citrate did not significantly impact diclofenac removal. Comparisons of three polystyrene resins (A520E, Dowex 22, Dowex Marathon 11) as well as one polyacrylic resin (IRA958) were conducted to determine the major interactions between anion exchange resin and diclofenac. The results showed that polystyrene resins provide the highest level of diclofenac removal due to electrostatic interactions between quaternary ammonium functional groups of resin and carboxylic acid of diclofenac and non-electrostatic interactions between resin matrix and benzene rings of diclofenac. Diclofenac was effectively desorbed from A520E resin using a regeneration solution that contained 4.5% (m/m) NaCl in an equal-volume mixture of methanol and water. The greater regeneration efficiency of the NaCl/methanol-water mixture over the aqueous NaCl solution supports the importance of non-electrostatic interactions between resin matrix and benzene rings

  16. Meningococcal X polysaccharide quantification by high-performance anion-exchange chromatography using synthetic N-acetylglucosamine-4-phosphate as standard.

    Science.gov (United States)

    Micoli, F; Adamo, R; Proietti, D; Gavini, M; Romano, M R; MacLennan, C A; Costantino, P; Berti, F

    2013-11-15

    A method for meningococcal X (MenX) polysaccharide quantification by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) is described. The polysaccharide is hydrolyzed by strong acidic treatment, and the peak of glucosamine-4-phosphate (4P-GlcN) is detected and measured after chromatography. In the selected conditions of hydrolysis, 4P-GlcN is the prevalent species formed, with GlcN detected for less than 5% in moles. As standard for the analysis, the monomeric unit of MenX polysaccharide, N-acetylglucosamine-4-phosphate (4P-GlcNAc), was used. This method for MenX quantification is highly selective and sensitive, and it constitutes an important analytical tool for the development of a conjugate vaccine against MenX. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Design and fabrication of enhanced corrosion resistance Zn-Al layered double hydroxides films based anion-exchange mechanism on magnesium alloys

    Science.gov (United States)

    Zhou, Meng; Yan, Luchun; Ling, Hao; Diao, Yupeng; Pang, Xiaolu; Wang, Yanlin; Gao, Kewei

    2017-05-01

    Layered double hydroxides (LDHs) with brucite-like layer structure and the facile exchangeability of intercalated anions had attracted tremendous interest in many fields because of their great importance for both fundamental studies and practical applications. Herein zinc-aluminum layered double hydroxides (Zn-Al LDHs) films intercalated with nitrate anions on the magnesium alloy substrate were designed and fabricated via a facile hydrothermal crystallization method. In order to obtain better corrosion resistance, chloride and vanadate anions were intercalated into the LDHs interlayers via the anion-exchange reaction. X-ray diffraction (XRD), Fourier transform infrared (FT-IR) spectroscopy and scanning electronic microscopy (SEM) were used to examine structure, composition and morphology of the Zn-Al-NO3 LDHs, Zn-Al-Cl LDHs and Zn-Al-VOx LDHs films. The corrosion resistance of the Zn-Al LDHs with different anion films was estimated by the electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization measurement. EIS and polarization curves measurements revealed that the magnesium alloy could be effectively protected by the Zn-Al-Cl LDHs and Zn-Al-VOx LDHs films due to the blocking effect of chloride anions and the control-release ability of vanadate anions.

  18. SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

    Science.gov (United States)

    Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

    2010-01-01

    Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

  19. Preparation of Cationic MOFs with Mobile Anions by Anion Stripping to Remove 2,4-D from Water

    Directory of Open Access Journals (Sweden)

    Tao Chen

    2017-07-01

    Full Text Available A cationic porous framework with mobile anions (MIL-101(Cr-Cl was easily and successfully synthesized by utilizing the stronger affinity of F− to Al3+ than Cr3+ in the charge-balanced framework of MIL-101(Cr. The structure, morphology and porosity of MIL-101(Cr-Cl were characterized. The obtained new materials retain the high surface area, good thermostability, and structure topology of MIL-101(Cr. With the mobile Cl− anion, MIL-101(Cr-Cl can be used as an ion-exchange material for anionic organic pollutions. In this work, 2,4-dichlorophenoxyacetic acid (2,4-D was used as a model to test the absorption performance of this new material. This new material exhibited improved adsorbability compared to that of the original metal-organic frameworks (MOFs. At the same time, this material also shows high anti-interference performance with changing solution pH.

  20. Dicty_cDB: SLC443 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

  1. Dicty_cDB: SLC428 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

  2. Dicty_cDB: SLC495 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

  3. Bicarbonate adsorption band of the chromatography for carbon isotope separation using anion exchangers

    International Nuclear Information System (INIS)

    Takeda, Kunihiko; Obanawa, Heiichiro; Hata, Masahisa; Sato, Katsuya

    1985-01-01

    The equilibria of bicarbonate ion between two phases were studied for the carbon isotope separation using anion exchangers. The condition of the formation of a bicarbonate adsorption band was quantitatively discussed. The formation of the adsorption band depends on the difference of S-potential which is the sum of the standard redection chemical potentials and L-potential which is the sum of the reduction chemical potential. The isotopic separation factor observed was about 1.012, independent of the concentrations of acid and alkali in the solutions. The isotopic separation factor was considered to be determined by the reaction of bicarbonate ion on anion exchangers and carbon dioxide dissolved in solutions. The enriched carbon isotope whose isotopic abundance ratio ( 13 C/ 12 C) was 1.258 was obtained with the column packed with anion exchangers. (author)

  4. Dicty_cDB: SLC413 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

  5. Dicty_cDB: SLC489 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

  6. Separation and determination of alditols and sugars by high-pH anion-exchange chromatography with pulsed amperometric detection

    DEFF Research Database (Denmark)

    Andersen, Rikke; Sørensen, A.

    2000-01-01

    Carbohydrates such as alditols (polyols or sugar alcohols), monosaccharides and disaccharides are separated as anions by anion-exchange chromatography with a sodium hydroxide eluent, MA1 CarboPac column and pulsed amperometric detection. We report a high-pH anion-exchange chromatographic-pulsed a......Carbohydrates such as alditols (polyols or sugar alcohols), monosaccharides and disaccharides are separated as anions by anion-exchange chromatography with a sodium hydroxide eluent, MA1 CarboPac column and pulsed amperometric detection. We report a high-pH anion-exchange chromatographic......-pulsed amperometric detection (HPAEC-PAD) method that determines all the polyols used as food additives in food products and the most commonly found mono- and disaccharides on a routine basis. The linearity, repeatability, internal reproducibility and accuracy are described. The applicability of the method has been...

  7. Novel fluoropolymer anion exchange membranes for alkaline direct methanol fuel cells.

    Science.gov (United States)

    Zhang, Yanmei; Fang, Jun; Wu, Yongbin; Xu, Hankun; Chi, Xianjun; Li, Wei; Yang, Yixu; Yan, Ge; Zhuang, Yongze

    2012-09-01

    A series of novel fluoropolymer anion exchange membranes based on the copolymer of vinylbenzyl chloride, butyl methacrylate, and hexafluorobutyl methacrylate has been prepared. Fourier transform infrared (FT-IR) spectroscopy and elemental analysis techniques are used to study the chemical structure and chemical composition of the membranes. The water uptake, ion-exchange capacity (IEC), conductivity, methanol permeability, and chemical stability of the membranes are also determined. The membranes exhibit high anionic conductivity in deionized water at 65 °C ranging from 3.86×10(-2) S cm(-1) to 4.36×10(-2) S cm(-1). The methanol permeability coefficients of the membranes are in the range of 4.21-5.80×10(-8) cm(2) s(-1) at 65 °C. The novel membranes also show good chemical and thermal stability. An open-circuit voltage of 0.7 V and a maximum power density of 53.2 mW cm(-2) of alkaline direct methanol fuel cell (ADMFC) with the membrane C, 1 M methanol, 1 M NaOH, and humidified oxygen are achieved at 65 °C. Therefore, these membranes have great potential for applications in fuel cell systems. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Removal of plutonium from nitric acid-oxalic acid solutions using anion exchange method

    International Nuclear Information System (INIS)

    Kasar, U.M.; Pawar, S.M.; Joshi, A.R.

    1999-01-01

    An anion exchange method using Amberlyst A-26 (MP) resin was developed for removal of Pu from nitric acid-oxalic acid solutions without destroying oxalate. The method consists of sorption of Pu(IV) on Amberlyst A-26, a macroporous anion exchange resin, from nitric acid-oxalic acid medium in the presence of Al(NO 3 ) 3 . Pu(IV) breakthrough capacity of Amberlyst A-26 using synthetic feed solution was determined. (author)

  9. Dicty_cDB: SLC404 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

  10. Dicty_cDB: SLC469 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

  11. Dicty_cDB: SLC452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

  12. Dicty_cDB: SLC402 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

  13. Dicty_cDB: SLC441 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

  14. Role of adaptor proteins and clathrin in the trafficking of human kidney anion exchanger 1 (kAE1) to the cell surface.

    Science.gov (United States)

    Junking, Mutita; Sawasdee, Nunghathai; Duangtum, Natapol; Cheunsuchon, Boonyarit; Limjindaporn, Thawornchai; Yenchitsomanus, Pa-thai

    2014-07-01

    Kidney anion exchanger 1 (kAE1) plays an important role in acid-base homeostasis by mediating chloride/bicarbornate (Cl-/HCO3-) exchange at the basolateral membrane of α-intercalated cells in the distal nephron. Impaired intracellular trafficking of kAE1 caused by mutations of SLC4A1 encoding kAE1 results in kidney disease - distal renal tubular acidosis (dRTA). However, it is not known how the intracellular sorting and trafficking of kAE1 from trans-Golgi network (TGN) to the basolateral membrane occurs. Here, we studied the role of basolateral-related sorting proteins, including the mu1 subunit of adaptor protein (AP) complexes, clathrin and protein kinase D, on kAE1 trafficking in polarized and non-polarized kidney cells. By using RNA interference, co-immunoprecipitation, yellow fluorescent protein-based protein fragment complementation assays and immunofluorescence staining, we demonstrated that AP-1 mu1A, AP-3 mu1, AP-4 mu1 and clathrin (but not AP-1 mu1B, PKD1 or PKD2) play crucial roles in intracellular sorting and trafficking of kAE1. We also demonstrated colocalization of kAE1 and basolateral-related sorting proteins in human kidney tissues by double immunofluorescence staining. These findings indicate that AP-1 mu1A, AP-3 mu1, AP-4 mu1 and clathrin are required for kAE1 sorting and trafficking from TGN to the basolateral membrane of acid-secreting α-intercalated cells. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Simultaneous determination of 13 carbohydrates using high-performance anion-exchange chromatography coupled with pulsed amperometric detection and mass spectrometry.

    Science.gov (United States)

    Zhao, Dan; Feng, Feng; Yuan, Fei; Su, Jin; Cheng, Yan; Wu, Hanqiu; Song, Kun; Nie, Bo; Yu, Lian; Zhang, Feng

    2017-04-01

    A simple, accurate, and highly sensitive method was developed for the determination of 13 carbohydrates in polysaccharide of Spirulina platensis based on high-performance anion-exchange chromatography coupled with pulsed amperometric detection and mass spectrometry. Samples were extracted with deionized water using ultrasonic-assisted extraction, and the ultrasound-assisted extraction conditions were optimized by Box-Behnken design. Then the extracted polysaccharide was hydrolyzed by adding 1 mol/L trifluoroacetic acid before determination by high-performance anion-exchange chromatography coupled with pulsed amperometric detection and confirmed by high-performance anion-exchange chromatography coupled with mass spectrometry. The high-performance anion-exchange chromatography coupled with pulsed amperometric detection method was performed on a CarboPac PA20 column by gradient elution using deionized water, 0.1 mol/L sodium hydroxide solution, and 0.4 mol/L sodium acetate solution. Excellent linearity was observed in the range of 0.05-10 mg/L. The average recoveries ranged from 80.7 to 121.7%. The limits of detection and limits of quantification for 13 carbohydrates were 0.02-0.10 and 0.2-1.2  μg/kg, respectively. The developed method has been successfully applied to ambient samples, and the results indicated that high-performance anion-exchange chromatography coupled with pulsed amperometric detection and mass spectrometry could provide a rapid and accurate method for the simultaneous determination of carbohydrates. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Dicty_cDB: SLC405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

  17. Dicty_cDB: SLC492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

  18. Dicty_cDB: SLC432 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

  19. Analysis of human milk oligosaccharides using high-performance anion-exchange chromatography with pulsed amperometric detection

    DEFF Research Database (Denmark)

    Lie, Aleksander; Pedersen, Lars Haastrup

    ) and lacto-N-neotetraose (Galβ1-4GlcNAcβ1-3Galβ1-4Glc), among others. High-performance anion-exchange chromatography (HPAE) with pulsed amperometric detection (PAD) is an analysis method highly suited for carbohydrates. HPAE with alkaline eluents results in retention of neutral carbohydrates depending...... on the number of charged group in the molecule, pH and concentration of competing anions, while the PAD has sensitivity for carbohydrates in the pmol-range (Lee 1990). As a basis for the development and optimisation of HPAE elution methods, the parameter space was investigated in terms of eluent concentrations...

  20. The immobilization of anion exchange resins in polymer modified cements

    International Nuclear Information System (INIS)

    Dyer, A.; Morgan, P.D.

    1991-09-01

    Organic anion exchange resins, loaded with 99-Tc as the pertechnate ion, were incorporated into polymer modified cements (Flexocrete Ltd, Preston). BFS/OPC (9:1 mix) also was modified by three polymers from the same source (styrene acrylic (2) styrene butadiene) and loaded with anion exchanger containing the pertechnate. Composites were tested for initial compressive strengths, under water and radiation stability and leach rate. IAEA standard leach testing was with simulated sea and ground waters. Ground water leaching also was carried out on composites subjected to 1.10 9 rads (γ). Leach testing correlated well with compressive strength. Modified composites performed better than the BFS/OPC mix under all conditions studied and were able to encapsulate higher resin loadings. (author)

  1. Dicty_cDB: SLC434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

  2. Separation of boron isotopes using NMG type anion exchange resin

    International Nuclear Information System (INIS)

    Itagaki, Takaharu; Kosuge, Masao; Fukuda, Junji; Fujii, Yasuhiko.

    1992-01-01

    Ion exchange separation of boron isotopes (B-10 and B-11) has been studied by using a special boron selective ion exchange resin; NMG (n-methyl glucamine)-type anion exchange resin. The resin has shown a large isotope separation coefficient of 1.02 at the experimental conditions of temperature, 80degC, and boric acid concentration, 0.2 M (mole/dm 3 ). Enriched B-10 (92%) was obtained after the migration of 1149 m by a recyclic operation of ion exchange columns in a merry-go-round method. (author)

  3. SLC26A4 mutations are associated with a specific inner ear malformation.

    Science.gov (United States)

    Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa

    2007-03-01

    Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.

  4. Radiation-induced decomposition of anion exchange resins

    International Nuclear Information System (INIS)

    Baidak, Aliaksandr; LaVerne, Jay A.

    2010-01-01

    Radiation-induced degradation of the strongly basic anion exchange resin Amberlite TM IRA400 in NO 3 - , Cl - and OH - forms has been studied. The research focused on the formation of molecular hydrogen in the gamma-radiolysis of water slurries of these quaternary ammonium resins with varying water content. Extended studies with various electron scavengers (NO 3 - , N 2 O and O 2 ) prove an important role of e solv - in the formation of H 2 from these resins. An excess production of H 2 in these systems at about 85% water weight fraction was found to be due to trimethylamine, dimethylamine and other compounds that leach from the resin to the aqueous phase. Irradiations with 5 MeV 4 He ions were performed to simulate the effects of α-particles.

  5. Dicty_cDB: SLC490 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

  6. Dicty_cDB: SLC484 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  7. Dicty_cDB: SLC442 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

  8. Dicty_cDB: SLC465 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

  9. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  10. Dicty_cDB: SLC424 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

  11. Sulfur isotope separation by anion exchange chromatography: 34 S isotope enrichment

    International Nuclear Information System (INIS)

    Bendassolli, Jose Albertino; Trivelin, Paulo Cesar O.; Carneiro Junior, Francisco

    1995-01-01

    The 34 S isotope separation was carried out by isotopic exchange reactions between sulphurous acid in solution and bisulphite anions adsorbed on an ammonium quaternary (Dowex 1 x 8 and Dowex 2 x 8, 100-200 mesh) anion exchange resin packed in columns. Each resin column had 130 cm length and 2.2 cm diameter. The columns were connected in series during displacement of bisulphite bands. For the experiments, a band of bisulphite was fixed to the anion resin, initially in the hydroxyl ion form, and subsequently eluted with 0.2 0.3, 0.4 and 0.6 mol L -1 HCL solution. The hydrochloric acid solution was kept under a nitrogen atmosphere at 245 KPa of pressure, in order to prevent the evolution of gases and also the oxidation of the bisulphite. The experiments showed that the best results were obtained with the elution of bisulphite with 0.2 mol.L -1 HCL, with the Dowex 1 x 8 resin. Enrichments in 34 S of 17.33 atoms% were obtained using Dowex 1 x 8 resin, 0.2 mol.L -1 HCL solution and band displacement of 50 m. Replacing the depleted portion of the band with natural bisulphite, for each 10 m of band displacement, produced 6.79 mmol of sulphurous acid enriched with approximately 17% of 34 S, after 14 m of band dislocation. (author). 7 refs., 1 fig., 2 tabs

  12. Dicty_cDB: SLC451 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

  13. Dicty_cDB: SLC474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

  14. Dicty_cDB: SLC425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

  15. Substrate specificity of the electrogenic sodium/bicarbonate cotransporter NBCe1-A (SLC4A4, variant A) from humans and rabbits.

    Science.gov (United States)

    Lee, Seong-Ki; Boron, Walter F; Parker, Mark D

    2013-04-01

    In the basolateral membrane of proximal-tubule cells, NBCe1-A (SLC4A4, variant A), operating with an apparent Na(+):HCO(3)(-) stoichiometry of 1:3, contributes to the reclamation of HCO(3)(-) from the glomerular filtrate, thereby preventing whole body acidosis. Others have reported that NBCe1-like activity in human, rabbit, and rat renal preparations is substantially influenced by lithium, sulfite, oxalate, and harmaline. These data were taken as evidence for the presence of distinct Na(+) and CO(3)(2-) binding sites in NBCe1-A, favoring a model of 1 Na(+):1 HCO(3)(-):1 CO(3)(2-). Here, we reexamine these findings by expressing human or rabbit NBCe1-A clones in Xenopus oocytes. In oocytes, NBCe1-A exhibits a 1:2 stoichiometry and could operate in one of five thermodynamically equivalent transport modes: 1) cotransport of Na(+) + 2 HCO(3)(-), 2) cotransport of Na(+) + CO(3)(2-), 3) transport of NaCO(3)(-), 4) exchange of Na(+) + HCO(3)(-) for H(+), or 5) HCO(3)(-)-activated exchange of Na(+) for 2 H(+). In contrast to the behavior of NBCe1-like activity in renal preparations, we find that cloned NBCe1-A is only slightly stimulated by Li(+), not at all influenced by sulfite or oxalate, and only weakly inhibited by harmaline. These negative data do not uniquely support any of the five models above. In addition, we find that NBCe1-A mediates a small amount of Na(+)-independent NO(3)(-) transport and that NBCe1-A is somewhat inhibited by extracellular benzamil. We suggest that the features of NBCe1-like activity in renal preparations are influenced by yet-to-be-identified renal factors. Thus the actual ionic substrates of NBCe1 remain to be identified.

  16. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  17. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  18. Dicty_cDB: SLC473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

  19. Dicty_cDB: SLC444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

  20. New Anion-Exchange Resins for Improved Separations of Nuclear Materials

    International Nuclear Information System (INIS)

    Bartsch, Richard A.; Barr, Mary E.

    2001-01-01

    Improved separations of nuclear materials will have a significant impact upon a broad range of DOE activities. DOE-EM Focus Areas and Crosscutting Programs have identified improved methods for the extraction and recovery of radioactive metal ions from process, waste, and environmental waters as critical needs for the coming years. We propose to develop multifunctional anion-exchange resins that facilitate anion uptake by carefully controlling the structure of the anion receptor site. Our new ion-exchange resins interface the field of ion-specific chelating ligands with robust, commercial ion-exchange technology to provide materials which exhibit superior selectivity and kinetics of sorption and desorption. The following Focus Areas and Crosscutting Programs have described needs that would be favorably impacted by the new material: Efficient Separations and Processing - radionuclide removal from aqueous phases; Plutonium - Pu, Am or total alpha removal to meet regulatory requirement s before discharge to the environment; Plumes - U and Tc in groundwater, U, Pu, Am, and Tc in soils; Mixed Waste - radionuclide partitioning; High-Level Tank Waste - actinide and Tc removal from supernatants and/or sludges. The basic scientific issues which need to be addressed are actinide complex speciation along with modeling of metal complex/functional site interactions in order to determine optimal binding-site characteristics. Synthesis of multifunctionalized extractants and ion-exchange materials that implement key features of the optimized binding site, and testing of these materials, will provide feedback to the modeling and design activities. Resin materials which actively facilitate the uptake of actinide complexes from solution should display both improved selectivity and kinetic properties. The long-range implications of this research, however, go far beyond the nuclear complex. This new methodology of ''facilitated uptake'' could revolutionize ion-exchange technology

  1. Dicty_cDB: SLC483 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

  2. Dicty_cDB: SLC435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

  3. Crosslinked anion exchange membranes prepared from poly(phenylene oxide) (PPO) for non-aqueous redox flow batteries

    Science.gov (United States)

    Li, Yun; Sniekers, Jeroen; Malaquias, João C.; Van Goethem, Cedric; Binnemans, Koen; Fransaer, Jan; Vankelecom, Ivo F. J.

    2018-02-01

    A stable and eco-friendly anion-exchange membrane (AEM) was prepared and applied in a non-aqueous all-copper redox flow battery (RFB). The AEM was prepared via a simple procedure, leading to a cross-linked structure containing quaternary ammonium groups without involvement of harmful trimethylamine. A network was thus constructed which ensured both ion transport and solvent resistance. The ion exchange capacity (IEC) of the membrane was tuned from 0.49 to 1.03 meq g-1 by varying the content of the 4, 4‧-bipyridine crosslinking agent. The membrane showed a good anion conductivity and retention of copper ions. As a proof of principle, a RFB single cell with this crosslinked membrane yielded a coulombic efficiency of 89%, a voltage efficiency of 61% and an energy efficiency of 54% at 7.5 mA cm-2.

  4. Anion exchange behavior of Ti, Zr, Hf, Nb and Ta as homologues of Rf and Db in mixed HF-acetone solutions

    International Nuclear Information System (INIS)

    Aksenov, N.V.; Bozhikov, G.A.; Starodub, G.Ya.; Dmitriev, S.N.; Filosofov, D.V.; Jon Sun Jin; Radchenko, V.I.; Lebedev, N.A.; Novgorodov, A.F.

    2009-01-01

    We studied in detail the sorption behavior of Ti, Zr, Hf, Nb and Ta on AG 1 anion exchange resin in HF-acetone mixed solutions as a function of organic cosolvent and acid concentrations. Anion exchange behavior was found to be strongly acetone concentration dependent. The distribution coefficients of Ti, Zr, Hf and Nb increased and those of Ta decreased with increasing content of acetone in HF solutions. With increasing HF concentration, anion exchange equilibrium analysis indicated the formation of fluoride complexes of group-4 elements with charge -3 and Ta with charge -2. For Nb the slope of -2 increased up to -5. Optimal conditions for separation of the elements using AIX chromatography were found. Group-4 elements formed MF 7 3- (M = Ti, Zr, Hf) complexes whose sorption decreased Ti > Hf > Zr in reverse order of complex stability. This fact is of particular interest for studying ion exchange behavior of Rf compared to Ti. The advantages of studying chemical properties of Rf and Db in aqueous HF solutions mixed with organic solvents are briefly discussed

  5. Dicty_cDB: SLC448 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  6. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  7. Characteristics of floc formation of anion and cation exchange resin in precoat filter using powdered ion exchange resin

    International Nuclear Information System (INIS)

    Adachi, Tetsurou; Sawa, Toshio; Shindoh, Toshikazu.

    1989-01-01

    The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of floc formation. The physical, chemical and electrochemical properties of powdered ion exchange resin were measured and the factors related to floc formation of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index. It was found that these factors were mixing ratio, nature of resins and particle size of resins. In addition, it was assumed on the bases of these results that the amount of resin floc was related to sum of the surface electric charges of both resins. The filling ratio of resin floc was related to their product by multiplication and an experimental expression was obtained. The specific settle volume of resin floc could then be simulated by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author)

  8. Characteristics of floc formation of anion and cation exchange resin in precoat filter using powdered ion exchange resin

    Energy Technology Data Exchange (ETDEWEB)

    Adachi, Tetsurou (Nitto Denko Corp., Ibaraki, Osaka (Japan)); Sawa, Toshio; Shindoh, Toshikazu

    1989-09-01

    The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of floc formation. The physical, chemical and electrochemical properties of powdered ion exchange resin were measured and the factors related to floc formation of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index. It was found that these factors were mixing ratio, nature of resins and particle size of resins. In addition, it was assumed on the bases of these results that the amount of resin floc was related to sum of the surface electric charges of both resins. The filling ratio of resin floc was related to their product by multiplication and an experimental expression was obtained. The specific settle volume of resin floc could then be simulated by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author).

  9. Dicty_cDB: SLC464 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

  10. Dicty_cDB: SLC494 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

  11. Dicty_cDB: SLC485 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

  12. Dicty_cDB: SLC470 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

  13. Dicty_cDB: SLC487 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

  14. Determination of the ion-exchange capacity of anion-selective membranes

    Czech Academy of Sciences Publication Activity Database

    Karas, F.; Hnát, J.; Paidar, M.; Schauer, Jan; Bouzek, K.

    2014-01-01

    Roč. 39, č. 10 (2014), s. 5054-5062 ISSN 0360-3199 Institutional support: RVO:61389013 Keywords : ion-exchange capacity * anion-selective membranes * titration Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.313, year: 2014

  15. Dicty_cDB: SLC429 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

  16. Dicty_cDB: SLC460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

  17. Dicty_cDB: SLC496 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

  18. Dicty_cDB: SLC449 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

  19. Dicty_cDB: SLC458 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

  20. Characteristics of resin floc dispersion of anion and cation exchange resin in precoat filter using powdered ion exchange resin

    Energy Technology Data Exchange (ETDEWEB)

    Adachi, Tetsurou (Nitto Denko Corp., Ibaraki, Osaka (Japan)); Sawa, Toshio; Shindoh, Toshikazu

    1989-09-01

    The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of resin floc dispersion. The factors related to resin floc dispersion of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index in addition to the measurement of physical, chemical and electrochemical properties of powdered ion exchange resin. The effect of adsorption of iron oxide and polymer electrolyte and of ion exchange were determined. In addition, considered floc dispersion with adsorbing iron oxide, it was assumed that the amount and filling ratio of resin floc were related to summation and multiplication of surface electric charge respectively. An experimental expression was obtained for simulation of the change of specific settle volume of resin floc by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author).

  1. Characteristics of resin floc dispersion of anion and cation exchange resin in precoat filter using powdered ion exchange resin

    International Nuclear Information System (INIS)

    Adachi, Tetsurou; Sawa, Toshio; Shindoh, Toshikazu.

    1989-01-01

    The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of resin floc dispersion. The factors related to resin floc dispersion of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index in addition to the measurement of physical, chemical and electrochemical properties of powdered ion exchange resin. The effect of adsorption of iron oxide and polymer electrolyte and of ion exchange were determined. In addition, considered floc dispersion with adsorbing iron oxide, it was assumed that the amount and filling ratio of resin floc were related to summation and multiplication of surface electric charge respectively. An experimental expression was obtained for simulation of the change of specific settle volume of resin floc by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author)

  2. A novel anion exchange membrane from polystyrene (ethylene butylene) polystyrene: Synthesis and characterization

    Energy Technology Data Exchange (ETDEWEB)

    Vinodh, Rajangam; Ilakkiya, Arjunan; Elamathi, Swaminathan [Department of Chemistry, Anna University Chennai, Sardar Patel Road, Chennai 600025, Tamil Nadu (India); Sangeetha, Dharmalingam, E-mail: sangeetha@annauniv.ed [Department of Chemistry, Anna University Chennai, Sardar Patel Road, Chennai 600025, Tamil Nadu (India)

    2010-02-25

    We look forward for an eco-friendly hydrocarbon polymer with higher molecular weight for the preparation of an anion exchange membrane. Polystyrene ethylene butylene polystyrene (PSEBS) was chosen as the polymer matrix. The anion exchange membrane was prepared from PSEBS tri-block co-polymer and then the properties were characterized for alkaline fuel cell application. The preparation of anion exchange polymer involved two steps namely chloromethylation and quaternization. The anion exchange membrane with high conductivity has been prepared by introducing quaternary ammonium groups in to the polymer. Finally, the membrane was prepared using solution casting method. The solution casting method yields highly hydrophilic membranes with uniform structure that were suitable for electrochemical applications. The efficiency of the entrapment was monitored by swelling ratio, chemical stability and ion exchange measurement. The characteristic structural properties of the membrane were investigated by FT-IR spectroscopy and {sup 1}H NMR spectroscopy. The thermal stability of the membrane was characterized by TGA, DSC and DMA (dynamic mechanical analysis). The prepared uniform electrolyte membrane in this study has high thermal and chemical stability. The surface morphology and elemental composition of the quaternized PSEBS was determined by SEM-EDXA techniques, respectively. The measured hydroxyl ion conductivity of the synthesized alkaline PSEBS polymer electrolyte membrane showed ionic conductivity in the range of 10{sup -3} S/cm in deionized water at room temperature. It was found that the substitution provided a flexible, chemically and thermally stable membrane. Hence, the membrane will have potential application in the alkaline fuel cell.

  3. A novel anion exchange membrane from polystyrene (ethylene butylene) polystyrene: Synthesis and characterization

    International Nuclear Information System (INIS)

    Vinodh, Rajangam; Ilakkiya, Arjunan; Elamathi, Swaminathan; Sangeetha, Dharmalingam

    2010-01-01

    We look forward for an eco-friendly hydrocarbon polymer with higher molecular weight for the preparation of an anion exchange membrane. Polystyrene ethylene butylene polystyrene (PSEBS) was chosen as the polymer matrix. The anion exchange membrane was prepared from PSEBS tri-block co-polymer and then the properties were characterized for alkaline fuel cell application. The preparation of anion exchange polymer involved two steps namely chloromethylation and quaternization. The anion exchange membrane with high conductivity has been prepared by introducing quaternary ammonium groups in to the polymer. Finally, the membrane was prepared using solution casting method. The solution casting method yields highly hydrophilic membranes with uniform structure that were suitable for electrochemical applications. The efficiency of the entrapment was monitored by swelling ratio, chemical stability and ion exchange measurement. The characteristic structural properties of the membrane were investigated by FT-IR spectroscopy and 1 H NMR spectroscopy. The thermal stability of the membrane was characterized by TGA, DSC and DMA (dynamic mechanical analysis). The prepared uniform electrolyte membrane in this study has high thermal and chemical stability. The surface morphology and elemental composition of the quaternized PSEBS was determined by SEM-EDXA techniques, respectively. The measured hydroxyl ion conductivity of the synthesized alkaline PSEBS polymer electrolyte membrane showed ionic conductivity in the range of 10 -3 S/cm in deionized water at room temperature. It was found that the substitution provided a flexible, chemically and thermally stable membrane. Hence, the membrane will have potential application in the alkaline fuel cell.

  4. Layered double hydroxides as the next generation inorganic anion exchangers: Synthetic methods versus applicability.

    Science.gov (United States)

    Chubar, Natalia; Gilmour, Robert; Gerda, Vasyl; Mičušík, Matej; Omastova, Maria; Heister, Katja; Man, Pascal; Fraissard, Jacques; Zaitsev, Vladimir

    2017-07-01

    This work is the first report that critically reviews the properties of layered double hydroxides (LDHs) on the level of speciation in the context of water treatment application and dynamic adsorption conditions, as well as the first report to associate these properties with the synthetic methods used for LDH preparation. Increasingly stronger maximum allowable concentrations (MAC) of various contaminants in drinking water and liquid foodstuffs require regular upgrades of purification technologies, which might also be useful in the extraction of valuable substances for reuse in accordance with modern sustainability strategies. Adsorption is the main separation technology that allows the selective extraction of target substances from multicomponent solutions. Inorganic anion exchangers arrived in the water business relatively recently to achieve the newly approved standards for arsenic levels in drinking water. LDHs (or hydrotalcites, HTs) are theoretically the best anion exchangers due to their potential to host anions in their interlayer space, which increases their anion removal capacity considerably. This potential of the interlayer space to host additional amounts of target aqueous anions makes the LDHs superior to bulk anion exchanger. The other unique advantage of these layered materials is the flexibility of the chemical composition of the metal oxide-based layers and the interlayer anions. However, until now, this group of "classical" anion exchangers has not found its industrial application in adsorption and catalysis at the industrial scale. To accelerate application of LDHs in water treatment on the industrial scale, the authors critically reviewed recent scientific and technological knowledge on the properties and adsorptive removal of LDHs from water on the fundamental science level. This also includes review of the research tools useful to reveal the adsorption mechanism and the material properties beyond the nanoscale. Further, these properties are

  5. A 7666-bp genomic deletion is frequent in Chinese Han deaf patients with non-syndromic enlarged vestibular aqueduct but without bi-allelic SLC26A4 mutations.

    Science.gov (United States)

    Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao

    2015-12-01

    To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Dicty_cDB: SLC403 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

  7. Dicty_cDB: SLC481 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

  8. Microsystems for anion exchange separation of radionuclides in nitric acid media

    Energy Technology Data Exchange (ETDEWEB)

    Losno, M.; Brennetot, R.; Mariet, C. [DEN/Service d' Etudes Analytiques et de Reactivite des Surfaces - SEARS, CEA, Centre de Saclay, Universite Paris-Saclay, F-91191, Gif sur Yvette (France); Ferrante, I.; Descroix, S. [MMBM Group, Institut Curie Research Center, CNRS UMR 168, Paris (France)

    2016-07-01

    An efficient and reproducible photo-polymerized poly(ethylene glycol methacrylate methacrylate-co- allyl methacrylate) monolith was synthesized and a photo-grafting process based on the ene-thiol click-chemistry has been performed to give anion exchange properties to the monolith. Since their introduction in the early 1990's polymethacrylate monoliths have emerged as a powerful alternative for microscale separations or sample treatment. Their relatively simple implementation in columns with small internal diameters makes them particularly attractive for the new chromatographic challenges of complex matrices analysis and on-chip separations. Despite their relatively poor ion-exchange capacity due to their highly porous structure, their use as anion exchangers is of large interest for nuclear analysis as numerous separations are based on this process. This paper presents a systematic study of the synthesis of the polymeric porous monolith and the versatile and robust functionalization method developed for the specific strong acidic media used in radiochemical procedures. The robustness of the stationary phase was tested in concentrated nitric acid. It appears that the C-S bond formed via thiol-ene chemistry is strong enough to be used to graft function of interest for separation in strong nitric acid medium. The photo-grafted anion exchanger, a quaternary ammonium, presents sufficient resistance to be used for radionuclide separation in [HNO{sub 3}]=5 mol.L{sup -1}so the next step is its integration in the cyclo olefin copolymer (COC) micro-system.

  9. Functional identification of the promoter of SLC4A5, a gene associated with cardiovascular and metabolic phenotypes in the HERITAGE Family Study.

    Science.gov (United States)

    Stütz, Adrian M; Teran-Garcia, Margarita; Rao, D C; Rice, Treva; Bouchard, Claude; Rankinen, Tuomo

    2009-11-01

    The sodium bicarbonate cotransporter gene SLC4A5, associated earlier with cardiovascular phenotypes, was tested for associations in the HERITAGE Family Study, and possible mechanisms were investigated. Twelve tag-single nucleotide polymorphisms (SNPs) covering the SLC4A5 gene were analyzed in 276 Black and 503 White healthy, sedentary subjects. Associations were tested using a variance components-based (QTDT) method with data adjusted for age, sex and body size. In Whites, rs6731545 and rs7571842 were significantly associated with resting and submaximal exercise pulse pressure (PP) (0.0004 HERITAGE Family Study are likely due to neither variation in the promoter nor known coding SNPs of SLC4A5.

  10. Dicty_cDB: SLC418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

  11. Dicty_cDB: SLC450 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

  12. Adding PCs to SLC Control System

    International Nuclear Information System (INIS)

    Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.

    1993-05-01

    The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code

  13. Dicty_cDB: SLC436 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

  14. Dicty_cDB: SLC478 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

  15. Dicty_cDB: SLC411 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

  16. Dicty_cDB: SLC456 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

  17. Dicty_cDB: SLC455 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

  18. Dicty_cDB: SLC431 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

  19. Dicty_cDB: SLC415 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

  20. Dicty_cDB: SLC477 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

  1. Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

  2. Selection of anion exchangers for detoxification of dilute-acid hydrolysates from spruce.

    Science.gov (United States)

    Horváth, Ilona Sárvári; Sjöde, Anders; Nilvebrant, Nils-Olof; Zagorodni, Andrei; Jönsson, Leif J

    2004-01-01

    Six anion-exchange resins with different properties were compared with respect to detoxification of a dilute-acid hydrolysate of spruce prior to ethanolic fermentation with Saccharomyces cerevisiae. The six resins encompassed strong and weak functional groups as well as styrene-, phenol-, and acrylic-based matrices. In an analytical experimental series, fractions from columns packed with the different resins were analyzed regarding pH, glucose, furfural, hydroxymethylfurfural, phenolic compounds, levulinic acid, acetic acid, formic acid, and sulfate. An initial adsorption of glucose occurred in the strong alkaline environment and led to glucose accumulation at a later stage. Acetic and levulinic acid passed through the column before formic acid, whereas sulfate had the strongest affinity. In a preparative experimental series, one fraction from each of six columns packed with the different resins was collected for assay of the fermentability and analysis of glucose, mannose, and fermentation inhibitors. The fractions collected from strong anion-exchange resins with styrene-based matrices displayed the best fermentability: a sevenfold enhancement of ethanol productivity compared with untreated hydrolysate. Fractions from a strong anion exchanger with acrylic-based matrix and a weak exchanger with phenol-based resin displayed an intermediate improvement in fermentability, a four- to fivefold increase in ethanol productivity. The fractions from two weak exchangers with styrene- and acrylic-based matrices displayed a twofold increase in ethanol productivity. Phenolic compounds were more efficiently removed by resins with styrene- and phenol-based matrices than by resins with acrylic-based matrices.

  3. Dicty_cDB: SLC407 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

  4. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Synthesis and anion exchange reactions of a layered copper–zinc ...

    Indian Academy of Sciences (India)

    Unknown

    replaced by Zn2+. Keywords. Copper–zinc hydroxides; Cu–Zn hydroxysalts; anion exchange. ... be broadly separated into two structural types, based on the structure of ... thermogravimetry (a lab-built system, heating rate. 5°C per minute) and ...

  6. Dicty_cDB: SLC433 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

  7. Dicty_cDB: SLC420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

  8. Dicty_cDB: SLC438 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

  9. Dicty_cDB: SLC440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

  10. Dicty_cDB: SLC480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

  11. Carbonylation of 1-hexene in the presence of palladium-anion-exchange resin catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, A.L.; Pirozhkov, S.D.; Buiya, M.A.; Lunin, A.F.; Karapetyan, L.P.; Saldadze, K.M.

    1986-06-20

    Activated charcoal, silica gel, and zeolites containing palladium are active in the carbonylation of lower olefins by carbon monoxide. In the present work, they studied the carbonylation of 1-hexene in the presence of a series of palladium catalysts containing An-221, An-251, and AN-511 anion-exchange catalysts produced in the USSR as the supports. A catalyst obtained by the deposition of palladium(II) on weakly basic anion-exchange resins displays high efficiency in the carbonylation of 1-hexene with the formation of a nixture of enanthoic and 2-methylcaproic acids.

  12. Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4 to gestational diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Sofia Blazevic

    Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.

  13. Dicty_cDB: SLC419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

  14. Dicty_cDB: SLC409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

  15. Comparing and Optimizing Nitrate Adsorption from Aqueous Solution Using Fe/Pt Bimetallic Nanoparticles and Anion Exchange Resins

    International Nuclear Information System (INIS)

    Daud, M.; Khan, Z.; Ashgar, A.; Danish, M. I.; Qazi, I. A.

    2015-01-01

    This research work was carried out for the removal of nitrate from raw water for a drinking water supply. Nitrate is a widespread ground water contaminant. Methodology employed in this study included adsorption on metal based nanoparticles and ion exchange using anionic resins. Fe/Pt bimetallic nanoparticles were prepared in the laboratory, by the reduction of their respective salts using sodium borohydride. Scanning electron microscope, X-ray diffraction, energy dispersive spectrometry, and X-ray florescence techniques were utilized for characterization of bimetallic Fe/Pt nanoparticles. Optimum dose, ph, temperature, and contact time were determined for removal through batch tests, both for metal based nanoparticles and anionic exchange resin. Adsorption data fitted well the Langmuir isotherm and conformed to the pseudo first-order kinetic model. Results indicated 97% reduction in nitrate by 0.25 mg/L of Fe/Pt nanoparticles at ph 7 and 83% reduction in nitrate was observed using 0.50 mg/L anionic exchange resins at ph 4 and contact time of one hour. Overall, Fe/Pt bimetallic nanoparticles demonstrated greater removal efficiency due to the small particle size, extremely large surface area (627 m 2 /g), and high adsorption capacity.

  16. ABH antigens as recognition sites for the activation of red blood cell anion exchange by the lectin ulex europaeus agglutinin I.

    Science.gov (United States)

    Engelmann, B

    1993-11-01

    The blood group antigen H (blood group O) and fucose-specific lectin Ulex europaeus agglutinin I (UEA1) (10 micrograms/ml) was found to increase the rate constant of Cl- efflux into 100 mM Na+ oxalate media by about 40% in erythrocytes taken from antigen H donors. In 100 mM K+ oxalate, 150 mM Na+ pyruvate and in 150 mM Na+ acetate media the lectin elevated the rate constant of Cl- efflux by 20-50%. The acceleration of Cl- efflux by UEA1 was completely blocked by 10 microM 4,4'-diisothiocyanato-stilbene-2,2'-disulfonic acid (DIDS) indicating that the effect of the lectin is mediated by the anion exchanger of human erythrocytes (band 3 protein). In antigen A1 erythrocytes no significant stimulation of anion exchange by UEA1 was seen. The activation of Cl- efflux was completely prevented by addition of 1 mM fucose to the medium. These results suggest that the effect of UEA1 is mediated through interaction with the fucose residues of H antigens. Increasing extracellular Ca++ from 0.5 to 5 mM in Na+ pyruvate or Na+ acetate media slightly reduced the acceleration of anion exchange by the lectin. On the other hand, replacing part of extracellular chloride by bicarbonate did not considerably alter the (previously reported) stimulatory effect of UEA1 on red blood cell Ca++ uptake. This suggests that the acceleration of anion exchange and of Ca++ uptake by UEA1, respectively, are mediated by different mechanisms. It is concluded that UEA1 activates anion exchange of human erythrocytes most probably by a direct interaction with H antigens present on extracellular domains of the band 3 protein.

  17. Synthesis, anion exchange, and delamination of Co-Al layered double hydroxide: assembly of the exfoliated nanosheet/polyanion composite films and magneto-optical studies.

    Science.gov (United States)

    Liu, Zhaoping; Ma, Renzhi; Osada, Minoru; Iyi, Nobuo; Ebina, Yasuo; Takada, Kazunori; Sasaki, Takayoshi

    2006-04-12

    This paper describes a systematic study on the synthesis, anion exchange, and delamination of Co-Al layered double hydroxide (LDH), with the aim of achieving fabrication and clarifying the properties of LDH nanosheet/polyanion composite films. Co-Al-CO3 LDH hexagonal platelets of 4 mum in lateral size were synthesized by the urea method under optimized reaction conditions. The as-prepared CO3(2-)-LDH was converted to Cl- -LDH by treating with a NaCl-HCl mixed solution, retaining its high crystallinity and hexagonal platelike morphology. LDHs intercalated with a variety of anions (such as NO3-, ClO4-, acetate, lactate, dodecyl sulfate, and oleate) were further prepared from Cl- -LDH via an anion-exchange process employing corresponding salts. Exchanged products in various anion forms were found to show different delamination behaviors in formamide. Among them, best results were observed for NO3- -LDH in terms of the exfoliating degree and the quality of the exfoliated nanosheets. The delamination gave a pink transparent suspension containing well-defined nanosheets with lateral sizes of up to 2 microm. The resulting nanosheets were assembled layer-by-layer with an anionic polymer, poly(sodium styrene 4-sulfonate) (PSS), onto quartz glass substrates to produce composite films. Magnetic circular dichroism (MCD) measurements revealed that the assembled multilayer films exhibited an interesting magneto-optical response.

  18. Removal of tartrazine from aqueous solutions by strongly basic polystyrene anion exchange resins.

    Science.gov (United States)

    Wawrzkiewicz, Monika; Hubicki, Zbigniew

    2009-05-30

    The removal of tartrazine from aqueous solutions onto the strongly basic polystyrene anion exchangers of type 1 (Amberlite IRA-900) and type 2 (Amberlite IRA-910) was investigated. The experimental data obtained at 100, 200, 300 and 500 mg/dm(3) initial concentrations at 20 degrees C were applied to the pseudo-first order, pseudo-second order and Weber-Morris kinetic models. The calculated sorption capacities (q(e,cal)) and the rate constant of the first order adsorption (k(1)) were determined. The pseudo-second order kinetic constants (k(2)) and capacities were calculated from the plots of t/q(t) vs. t, 1/q(t) vs. 1/t, 1/t vs. 1/q(t) and q(t)/t vs. q(t) for type 1, type 2, type 3 and type 4 of the pseudo-second order expression, respectively. The influence of phase contact time, solution pH and temperature on tartrazine removal was also discussed. The FTIR spectra of pure anion exchangers and those loaded with tartrazine were recorded, too.

  19. Inhibition of filiform corrosion on organic-coated AA2024-T3 by smart-release cation and anion-exchange pigments

    International Nuclear Information System (INIS)

    Williams, G.; McMurray, H.N.

    2012-01-01

    Highlights: ► Filiform corrosion (FFC) inhibition by various smart-release pigments was evaluated by SKP. ► Rare earth cation-containing pigments were ineffective at halting FFC propagation. ► Metal oxo-anions and organic copper-specific agents were exchanged into hydrotalcite. ► Effective inhibition of FFC was demonstrated by anions which stopped copper re-plating. - Abstract: In-coating cation and anion exchange pigments are studied with respect to their ability to inhibit chloride-induced filiform corrosion (FFC) on organic-coated AA2024-T3 aluminium alloy substrates. In-situ scanning Kelvin probe potentiometry is used to quantify both underfilm potentials associated with populations of propagating corrosion filaments and the kinetics of coating disbondment. Smart-release bentonite pigments containing exchangeable cerium (III) and yttrium (III) cations are shown to be largely ineffective in reducing rates of FFC propagation. The reasons for this are discussed in terms of the chemistry of the electrolyte-filled corrosion filament head. In contrast, anion-exchange hydrotalcite (HT) based pigments are highly effective inhibitors of FFC. A comparison of the extent of FFC observed for various inorganic exchangeable anions is made with as-received HT comprising carbonate anions. Of the anions evaluated, exchangeable chromate unsurprisingly provides the highest FFC inhibition efficiency. It is also demonstrated that exchanging the native carbonate ions for certain organic species which act as complexing agents for copper ions, gives rise to an equivalent level of FFC inhibition. The implication of these findings with respect to the mechanism of FFC on copper containing aluminium alloys is considered.

  20. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  1. Determination of chromium(VI) in water by PIXE analysis using ion exchange paper. Limit of detection and interference by coexisting anions

    International Nuclear Information System (INIS)

    Thomyasirigul, Sureerat; Fukuda, Hitoshi; Hasegawa, Jun; Oguri, Yoshiyuki

    2009-01-01

    Concerning the PIXE analysis of Cr(VI) in water using ion-exchange filters, the limit of detection (LOD) and the influence of matrix anions were investigated. In order to look for the experimental condition for obtaining the minimum LOD, we measured the Cr-Kα X-ray counts and background counts under the Kα X-ray peak as a function of the incident proton energy and the thickness of the Mylar absorber foil in front of the detector. To investigate the interference by coexisting anions, each of PO 4 3- , SO 4 2- , NO 3 - , Cl - , and F - ions and Cr(VI) ions were mixed in aqueous solutions and adsorbed on DE81-DEAE cellulose paper, a weakly basic anion exchanger with diethylaminoethyl functional groups. Then the filter samples were measured by PIXE using 2.5 MeV proton beams. We obtained a LOD of 0.16 μg or 8 ppb for 20 mL samples at a proton energy of 2.5 MeV and a Mylar film thickness of 50 or 100 μm. The experimental results on the mixed solutions indicated that NO 3 - , Cl - , and F - as coexisting ions didn't interfere significantly with determination of a 50 μg/L Cr(VI) concentration for 40 mL total solution volume, despite the total amount of anions was about 90% of ion exchange capacity of a filter. On the other hand, slight interferences by PO 4 3- ions were observed. However, under the same condition, we found that if the total amount of SO 4 2- ions was higher than 20% of ion exchange capacity, they induced significant interferences in determining Cr(VI). (author)

  2. Formation of zeolite-like zinc 1,3,5-benzenetriphosphonate open-frameworks by topotactic pillaring of anionic layers.

    Science.gov (United States)

    Maeda, Kazuyuki; Takamatsu, Ryohei; Mochizuki, Miki; Kawawa, Kanako; Kondo, Atsushi

    2013-08-07

    An ab initio powder X-ray crystal structure analysis revealed that layered zinc 1,3,5-benzenetriphosphonates containing interlayer tetramethylammonium (ZBP-TMA) or 4,4'-bipyridinium cations (ZBP-bpy) are transformed to novel isomorphous 3D open-framework compounds ZBP-M (M: K, Rb, and Cs) by treatment in aqueous alkali metal chloride solutions. ZBP-Ms have a pillared layer-type of anionic framework containing 2D zigzag channels connected with cage-like spaces. The potassium atoms in ZBP-K are located near 8MR windows in the 2D zigzag channels, and the potassium cations are successfully exchanged with ammonium cations retaining the open-framework structure. The ammonium form (ZBP-NH4) showed remarkable cation exchange selectivity for Rb(+) and Cs(+) in a mixture of alkali metal cations. It is assumed that zinc ions partially dissolved from the starting layered ZBP precursors are intercalated in ZBP layers to form pillared layered 3D open-frameworks. These results clearly show that topotactic pillared layer approaches are applicable not only to zeolite-related materials but also to novel open-framework metal organophosphonates.

  3. Investigation of SLC6A4 gene expression in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Şener

    2015-06-01

    Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

  4. Synthesis and anion exchange properties of a Zn/Ni double hydroxide salt with a guarinoite structure

    International Nuclear Information System (INIS)

    Delorme, F.; Seron, A.; Licheron, M.; Veron, E.; Giovannelli, F.; Beny, C.; Jean-Prost, V.; Martineau, D.

    2009-01-01

    In this study, the first route to synthesize a compound with the guarinoite structure (Zn,Co,Ni) 6 (SO 4 )(OH,Cl) 10 .5H 2 O is reported. Zn/Ni guarinoite is obtained from the reaction of NiSO 4 .7H 2 O with solid ZnO in aqueous solution. The resulting green Zn/Ni guarinoite ((Zn 3.52 Ni 1.63 )(SO 4 ) 1.33 (OH 7.64 ).4.67H 2 O) was characterized by X-ray diffraction, infrared spectrometry, UV-Visible spectrometry and thermal analysis. It is shown that its structure is similar to the one described for the layered Zn sulfate hydroxide hydrate, i.e. brucite layers with 1/4 empty octahedra presenting tetrahedrally coordinated divalent atoms above and below the empty octahedra. Ni atoms are located in the octahedra and zinc atoms in tetrahedra and octahedra. In this structure the exchangeable anions are located at the apex of tetrahedra. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) observations show that the Zn/Ni guarinoite is composed of aggregates of hexagonal plates of several hundreds of nanometers. Due to its interest for industrial or environmental applications, the exchange of sulfate groups by carbonates has been investigated. Results show a limited exchange and a higher affinity of the Zn/Ni guarinoite for sulfates compared to carbonates. - Graphical abstract: SEM micrograph (secondary electrons) of the synthesized Zn/Ni guarinoite showing that aggregates are composed of small plate-like particles.

  5. Efficient Separation of Lanthanides Using Poly (Styrene-Divinyl Benzene) Aminated Anion Exchanger

    International Nuclear Information System (INIS)

    Borai, E.H.; Hassan, R.S.; El- Dessouky, M.I.; Ghonem, A.

    2008-01-01

    New chromatographic method was developed for the determination and separation of lanthanides using AS4A anionic column. The behavior of the column towards lanthanides was studied through many parameters, From the data obtained it is found that, affinity of the column toward investigated ions increase by increasing eluent concentration and it decrease retention factors. With the two investigated eluent (oxalic and citric acids), elution order for lanthanide elements was obtained in their atomic number from La to Lu. Retention times and retention orders obtained at these conditions clearly show that, lanthanides in AS4A are displaced according to anion exchange mechanism. More over separation of lanthanides using AS4A was studied using isocratic and gradient elution programs. Light and the first intermediate lanthanide elements were separated successfully by applying a gradient program containing 70% oxalic acid (100 mM) and 30% water. The problem of separation for heavy and the last intermediate lanthanide elements was solved using 100 mM alpha hydroxy isobutyric acid (α-HIBA)

  6. Diversity in the glucose transporter-4 gene (SLC2A4 in humans reflects the action of natural selection along the old-world primates evolution.

    Directory of Open Access Journals (Sweden)

    Eduardo Tarazona-Santos

    Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.

  7. Enhanced DOC removal using anion and cation ion exchange resins.

    Science.gov (United States)

    Arias-Paic, Miguel; Cawley, Kaelin M; Byg, Steve; Rosario-Ortiz, Fernando L

    2016-01-01

    Hardness and DOC removal in a single ion exchange unit operation allows for less infrastructure, is advantageous for process operation and depending on the water source, could enhance anion exchange resin removal of dissolved organic carbon (DOC). Simultaneous application of cationic (Plus) and anionic (MIEX) ion exchange resin in a single contact vessel was tested at pilot and bench scales, under multiple regeneration cycles. Hardness removal correlated with theoretical predictions; where measured hardness was between 88 and 98% of the predicted value. Comparing bench scale DOC removal of solely treating water with MIEX compared to Plus and MIEX treated water showed an enhanced DOC removal, where removal was increased from 0.5 to 1.25 mg/L for the simultaneous resin application compared to solely applying MIEX resin. A full scale MIEX treatment plant (14.5 MGD) reduced raw water DOC from 13.7 mg/L to 4.90 mg/L in the treated effluent at a bed volume (BV) treatment rate of 800, where a parallel operation of a simultaneous MIEX and Plus resin pilot (10 gpm) measured effluent DOC concentrations of no greater than 3.4 mg/L, even at bed volumes of treatment 37.5% greater than the full scale plant. MIEX effluent compared to simultaneous Plus and MIEX effluent resulted in differences in fluorescence intensity that correlated to decreases in DOC concentration. The simultaneous treatment of Plus and MIEX resin produced water with predominantly microbial character, indicating the enhanced DOC removal was principally due to increased removal of terrestrially derived organic matter. The addition of Plus resin to a process train with MIEX resin allows for one treatment process to remove both DOC and hardness, where a single brine waste stream can be sent to sewer at a full-scale plant, completely removing lime chemical addition and sludge waste disposal for precipitative softening processes. Published by Elsevier Ltd.

  8. Dicty_cDB: SLC466 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

  9. Dicty_cDB: SLC461 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

  10. Dicty_cDB: SLC437 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

  11. Uranium extraction from sulfuric acid solution using anion exchange resin

    International Nuclear Information System (INIS)

    Sheta, M. E.; Abdel Aal, M. M.; Kandil, A. T.

    2012-12-01

    Uranium is currently recovered from sulfuric acid leach liquor using anion exchange resin as Amberlite IRA 402 (CT). This technology is based on fact that, uranium exists as anionic complexes. This takes place by controlling the pH of the solution, agitation time, temperature and resin to solution ratio (R/S). In this work, batch stirrer tank used for uranium extraction from sulfate medium and after extraction, elution process was done using 1M NaCl solution. After extraction and elution process, the resin was separated from the system and uranium was determined in the solution. (Author)

  12. Plasma-polymerized alkaline anion-exchange membrane: Synthesis and structure characterization

    International Nuclear Information System (INIS)

    Hu Jue; Meng Yuedong; Zhang Chengxu; Fang Shidong

    2011-01-01

    After-glow discharge plasma polymerization was developed for alkaline anion-exchange membranes synthesis using vinylbenzyl chloride as monomer. X-ray photoelectron spectroscopy and attenuated total reflection Fourier transform infrared spectroscopy were used to characterize the chemical structure properties of plasma-polymerized membranes. Ion-exchange capacities of quaternized poly(vinylbenzyl chloride) (QPVBC) membranes were measured to evaluate their capability of hydroxyl ion transport. A mechanism of plasma polymerization using VBC as monomer that accounts for the competitive effects of free radicals polymerization and plasma ablation in the plasma polymerization process was proposed. Our results indicate that plasma discharge power influences the contents of functional groups and the structure of the plasma polymer membranes, which attribute to the coactions of polymerization and ablation. The properties of uniform morphology, good adhesion to the substrate, high thermal stability and satisfying anion conduction level suggest the potential application of QPVBC membrane deposited at discharge power of 20 W in alkaline direct methanol fuel cells.

  13. Surface- vs Diffusion-Limited Mechanisms of Anion Exchange in CsPbBr3 Nanocrystal Cubes Revealed through Kinetic Studies.

    Science.gov (United States)

    Koscher, Brent A; Bronstein, Noah D; Olshansky, Jacob H; Bekenstein, Yehonadav; Alivisatos, A Paul

    2016-09-21

    Ion-exchange transformations allow access to nanocrystalline materials with compositions that are inaccessible via direct synthetic routes. However, additional mechanistic insight into the processes that govern these reactions is needed. We present evidence for the presence of two distinct mechanisms of exchange during anion exchange in CsPbX3 nanocrystals (NCs), ranging in size from 6.5 to 11.5 nm, for transformations from CsPbBr3 to CsPbCl3 or CsPbI3. These NCs exhibit bright luminescence throughout the exchange, allowing their optical properties to be observed in real time, in situ. The iodine exchange presents surface-reaction-limited exchanges allowing all anionic sites within the NC to appear chemically identical, whereas the chlorine exchange presents diffusion-limited exchanges proceeding through a more complicated exchange mechanism. Our results represent the first steps toward developing a microkinetic description of the anion exchange, with implications not only for understanding the lead halide perovskites but also for nanoscale ion exchange in general.

  14. Neurotransmitter Transporter-Like: a male germline-specific SLC6 transporter required for Drosophila spermiogenesis.

    Directory of Open Access Journals (Sweden)

    Nabanita Chatterjee

    2011-01-01

    Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.

  15. Treatment of Simulated Soil Decontamination Waste Solution by Ferrocyanide-Anion Exchange Resin Beads

    Energy Technology Data Exchange (ETDEWEB)

    Won, Hui Jun; Kim, Min Gil; Kim, Gye Nam; Jung, Chung Hun; Park, Jin Ho; Oh, Won Zin [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2005-03-15

    Preparation of ferrocyanide-anion exchange resin and adsorption test of the prepared resin on the Cs{sup -} ion were performed. Adsorption capability of the prepared resin on the Cs{sup -} ion in the simulated citric acid based soil decontamination waste solution was 4 times greater than that of the commercial cation exchange resin. Adsorption equilibrium of the prepared resin on the Cs{sup -} ion reached within 360 minutes. Adsorption capability on the Cs{sup -} ion became to decrease above the necessary Co{sup 2-} ion concentration in the experimental range. Recycling test of the spent ion exchange resin by the successive application of hydrogen peroxide and hydrazine was also performed. It was found that desorption of Cs{sup -} ion from the resin occurred to satisfy the electroneutrality condition without any degradation of the resin.

  16. The effects and mechanisms of SLC34A2 on maintaining stem cell-like phenotypes in CD147+ breast cancer stem cells.

    Science.gov (United States)

    Lv, Yonggang; Wang, Ting; Fan, Jing; Zhang, Zhenzhen; Zhang, Juliang; Xu, Cheng; Li, Yongping; Zhao, Ge; He, Chenyang; Meng, Huimin; Yang, Hua; Wang, Zhen; Liu, Jiayun; Chen, Jianghao; Wang, Ling

    2017-04-01

    The cancer stem cell (CSC) hypothesis has gained significant recognition in describing tumorigenesis. Identification of the factors critical to development of breast cancer stem cells (BCSCs) may provide insight into the improvement of effective therapies against breast cancer. In this study, we aim to investigate the biological function of SLC34A2 in affecting the stem cell-like phenotypes in BCSCs and its underlying mechanisms. We demonstrated that CD147 + cells from breast cancer tissue samples and cell lines possessed BCSC-like features, including the ability of self-renewal in vitro, differentiation, and tumorigenic potential in vivo. Flow cytometry analysis showed the presence of a variable fraction of CD147 + cells in 9 of 10 tumor samples. Significantly, SLC34A2 expression in CD147 + BCSCs was enhanced compared with that in differentiated adherent progeny of CD147 + BCSCs and adherently cultured cell line cells. In breast cancer patient cohorts, SLC34A2 expression was found increased in 9 of 10 tumor samples. By using lentiviral-based approach, si-SLC34A2-transduced CD147 + BCSCs showed decreased ability of sphere formation, cell viability in vitro, and tumorigenicity in vivo, which suggested the essential role of SLC34A2 in CD147 + BCSCs. Furthermore, PI3K/AKT pathway and SOX2 were found necessary to maintain the stemness of CD147 + BCSCs by using LY294002 or lentiviral-si-SOX2. Finally, we indicated that SLC34A2 could regulate SOX2 to maintain the stem cell-like features in CD147 + BCSCs through PI3K/AKT pathway. Therefore, our report identifies a novel role of SLC34A2 in BCSCs' state regulation and establishes a rationale for targeting the SLC34A2/PI3K/AKT/SOX2 signaling pathway for breast cancer therapy.

  17. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

    Science.gov (United States)

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-09-30

    Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

  18. The anion exchanger Ae2 is required for enamel maturation in mouse teeth

    NARCIS (Netherlands)

    Lyaruu, D.M.; Bronckers, A.L.J.J.; Mulder, L.; Mardones, P.; Medina, J.F.; Kellokumpu, S.; Oude Elferink, R.P.J.; Everts, V.

    2008-01-01

    One of the mechanisms by which epithelial cells regulate intracellular pH is exchanging bicarbonate for Cl-. We tested the hypothesis that in ameloblasts the anion exchanger-2 (Ae2) is involved in pH regulation during maturation stage amelogenesis. Quantitative X-ray microprobe mineral content

  19. The anion exchanger Ae2 is required for enamel maturation in mouse teeth

    NARCIS (Netherlands)

    Lyaruu, D. M.; Bronckers, A. L. J. J.; Mulder, L.; Mardones, P.; Medina, J. F.; Kellokumpu, S.; Oude Elferink, R. P. J.; Everts, V.

    2008-01-01

    One of the mechanisms by which epithelial cells regulate intracellular pH is exchanging bicarbonate for Cl(-). We tested the hypothesis that in ameloblasts the anion exchanger-2 (Ae2) is involved in pH regulation during maturation stage amelogenesis. Quantitative X-ray microprobe mineral content

  20. SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

    Directory of Open Access Journals (Sweden)

    Hassen Hadj-Kacem

    2010-01-01

    Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

  1. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Yan Xiaofei

    2011-09-01

    Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

  2. Comparing and Optimizing Nitrate Adsorption from Aqueous Solution Using Fe/Pt Bimetallic Nanoparticles and Anion Exchange Resins

    Directory of Open Access Journals (Sweden)

    Muhammad Daud

    2015-01-01

    Full Text Available This research work was carried out for the removal of nitrate from raw water for a drinking water supply. Nitrate is a widespread ground water contaminant. Methodology employed in this study included adsorption on metal based nanoparticles and ion exchange using anionic resins. Fe/Pt bimetallic nanoparticles were prepared in the laboratory, by the reduction of their respective salts using sodium borohydride. Scanning electron microscope, X-ray diffraction, energy dispersive spectrometry, and X-ray florescence techniques were utilized for characterization of bimetallic Fe/Pt nanoparticles. Optimum dose, pH, temperature, and contact time were determined for NO3- removal through batch tests, both for metal based nanoparticles and anionic exchange resin. Adsorption data fitted well the Langmuir isotherm and conformed to the pseudofirst-order kinetic model. Results indicated 97% reduction in nitrate by 0.25 mg/L of Fe/Pt nanoparticles at pH 7 and 83% reduction in nitrate was observed using 0.50 mg/L anionic exchange resins at pH 4 and contact time of one hour. Overall, Fe/Pt bimetallic nanoparticles demonstrated greater NO3- removal efficiency due to the small particle size, extremely large surface area (627 m2/g, and high adsorption capacity.

  3. Imidazolium-Based Polymeric Materials as Alkaline Anion-Exchange Fuel Cell Membranes

    Science.gov (United States)

    Narayan, Sri R.; Yen, Shiao-Ping S.; Reddy, Prakash V.; Nair, Nanditha

    2012-01-01

    Polymer electrolyte membranes that conduct hydroxide ions have potential use in fuel cells. A variety of polystyrene-based quaternary ammonium hydroxides have been reported as anion exchange fuel cell membranes. However, the hydrolytic stability and conductivity of the commercially available membranes are not adequate to meet the requirements of fuel cell applications. When compared with commercially available membranes, polystyrene-imidazolium alkaline membrane electrolytes are more stable and more highly conducting. At the time of this reporting, this has been the first such usage for imidazolium-based polymeric materials for fuel cells. Imidazolium salts are known to be electrochemically stable over wide potential ranges. By controlling the relative ratio of imidazolium groups in polystyrene-imidazolium salts, their physiochemical properties could be modulated. Alkaline anion exchange membranes based on polystyrene-imidazolium hydroxide materials have been developed. The first step was to synthesize the poly(styrene-co-(1-((4-vinyl)methyl)-3- methylimidazolium) chloride through a free-radical polymerization. Casting of this material followed by in situ treatment of the membranes with sodium hydroxide solutions provided the corresponding hydroxide salts. Various ratios of the monomers 4-chloromoethylvinylbenzine (CMVB) and vinylbenzine (VB) provided various compositions of the polymer. The preferred material, due to the relative ease of casting the film, and its relatively low hygroscopic nature, was a 2:1 ratio of CMVB to VB. Testing confirmed that at room temperature, the new membranes outperformed commercially available membranes by a large margin. With fuel cells now in use at NASA and in transportation, and with defense potential, any improvement to fuel cell efficiency is a significant development.

  4. Fe electron transfer and atom exchange in goethite: influence of Al-substitution and anion sorption.

    Science.gov (United States)

    Latta, Drew E; Bachman, Jonathan E; Scherer, Michelle M

    2012-10-02

    The reaction of Fe(II) with Fe(III) oxides and hydroxides is complex and includes sorption of Fe(II) to the oxide, electron transfer between sorbed Fe(II) and structural Fe(III), reductive dissolution coupled to Fe atom exchange, and, in some cases mineral phase transformation. Much of the work investigating electron transfer and atom exchange between aqueous Fe(II) and Fe(III) oxides has been done under relatively simple aqueous conditions in organic buffers to control pH and background electrolytes to control ionic strength. Here, we investigate whether electron transfer is influenced by cation substitution of Al(III) in goethite and the presence of anions such as phosphate, carbonate, silicate, and natural organic matter. Results from (57)Fe Mössbauer spectroscopy indicate that both Al-substitution (up to 9%) and the presence of common anions (PO(4)(3-), CO(3)(2-), SiO(4)(4-), and humic acid) does not inhibit electron transfer between aqueous Fe(II) and Fe(III) in goethite under the conditions we studied. In contrast, sorption of a long-chain phospholipid completely shuts down electron transfer. Using an enriched isotope tracer method, we found that Al-substitution in goethite (10%), does, however, significantly decrease the extent of atom exchange between Fe(II) and goethite (from 43 to 12%) over a month's time. Phosphate, somewhat surprisingly, appears to have little effect on the rate and extent of atom exchange between aqueous Fe(II) and goethite. Our results show that electron transfer between aqueous Fe(II) and solid Fe(III) in goethite can occur under wide range of geochemical conditions, but that the extent of redox-driven Fe atom exchange may be dependent on the presence of substituting cations such as Al.

  5. NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse

    NARCIS (Netherlands)

    Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.

    2014-01-01

    During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate

  6. Evaluation of indigenous anion exchange resins for plutonium purification

    International Nuclear Information System (INIS)

    Kumaresan, R.; Sabharwal, K.N.; Srinivasan, T.G.; Vasudeva Rao, P.R.; Thite, B.S.; Ajithlal, R.T.; Sinalkar, Nitin; Dharampurikar, G.R.; Janardhanan, C.; Michael, K.M.; Vijayan, K.; Jambunathan, U.; Dey, P.K.

    2004-01-01

    Preliminary data with pure plutonium nitrate solution indicate that indigenous anion exchange resin can be used for the purification and concentration of plutonium. However, further studies are required to be conducted on larger scale with actual plant feed solutions before arriving to final conclusions. This includes repeated loading and elution cycles studies with the same bed and evaluation of the performance after each cycle

  7. Synthesis and Properties of Anion Exchangers Derived from Chloromethyl Styrene Codivinylbenzene and Their Use in Water Treatment

    Directory of Open Access Journals (Sweden)

    Hesham A. Ezzeldin

    2010-01-01

    Full Text Available Amination of vinylbenzyl chloride-divinylbenzene (VBC-DVB copolymers is an effective method for preparation of ion-exchange resins. Conventionally, the starting polymer is produced by chloromethylation of a styrene-divinylbenzene copolymer that utilizes chloromethyl methyl ether, a known carcinogen. An alterative approach is to copolymerize vinylbenzyl chloride with divinylbenzene to generate the necessary VBC-DVB. This method provides precise control over the density of the ion-exchange groups. The regiochemistry of the vinylbenzyl chloride methods was realized using solvent-ion exchange groups. In this investigation, an improved solvent system was found for the preparation of anion exchange resins by the vinylbenzyl chloride route. The effectiveness of amination of the intermediate VBC-DVB polymers with a variety of trimethylamine reagents was investigated, and ethanolic trimethylamine produced the highest degree of amination. These resulting ion-exchange polymers were characterized by a variety of techniques such as analytical titrations, nitrogen analysis, Fourier transform infrared spectroscopy and thermal gravimetric analysis. Testing of these copolymers for breakthrough was performed. The results indicate that these anion exchangers have a meaningful increase in thermal stability over commercial anionic exchange beads.

  8. Adsorption of phosphate in hydrocalumite-like layered double hydroxides: a comparison between memory effect and ion exchange processes

    International Nuclear Information System (INIS)

    Bernardo, M.P.; Moreira, F.K.V.; Ribeiro, C.

    2016-01-01

    Phosphorus is an essential element for agriculture, but the excessive use of this element has caused severe damages to the environment. Layered double hydroxide (LDHs) are excellent candidates to remove PO 4 3- anions through adsorption process. In this work, the phosphate adsorption on hydrocalumite-like (Ca-Al) LDHs was evaluated over the ion exchange and memory effect processes. X-ray diffraction measurements revealed formation of analogous crystalline phases from both process as the phosphate concentration was increased. However, the phosphate quantity adsorbed varied according to the process used. The ion exchange route is the most efficient process to remove phosphate from aqueous medium. (author)

  9. Synthesis and characterizations of anion exchange organic-inorganic hybrid materials based on poly(2,6-dimethyl-1,4-phenylene oxide) (PPO)

    International Nuclear Information System (INIS)

    Zhang Shaoling; Wu Cuiming; Xu Tongwen; Gong Ming; Xu Xiaolong

    2005-01-01

    A series of poly(2,6-dimethyl-1,4-phenylene oxide) (PPO)-based organic-inorganic hybrid materials for anion exchange were prepared through sol-gel process of polymer precursors PPO-Si(OCH 3 ) 3 . PPO-Si(OCH 3 ) 3 were obtained from the reaction of bromomethylated PPO with 3-aminopropyl-trimethoxysilane (A1110). These polymer precursors then underwent hydrolysis and condensation with additional A1110 to generate hybrid materials. The reaction to produce polymer precursors was identified by FTIR; while FTIR, TGA, XRD, SEM, as well as conventional ion exchange capacity (IEC) measurements were conducted for the structures and properties of the prepared hybrids. TGA results show that this series of hybrid materials possess high thermal stability; XRD and SEM indicate that the prepared hybrid materials are amorphous and the inorganic and organic contents show good compatibility if the ratio between them is proper. The IEC values of the hybrid materials due to the amine groups range from 1.13 mmol/gBPPO (material i) to 4.80 mmol/gBPPO (material iv)

  10. Review of cell performance in anion exchange membrane fuel cells

    Science.gov (United States)

    Dekel, Dario R.

    2018-01-01

    Anion exchange membrane fuel cells (AEMFCs) have recently received increasing attention since in principle they allow for the use of non-precious metal catalysts, which dramatically reduces the cost per kilowatt of power in fuel cell devices. Until not long ago, the main barrier in the development of AEMFCs was the availability of highly conductive anion exchange membranes (AEMs); however, improvements on this front in the past decade show that newly developed AEMs have already reached high levels of conductivity, leading to satisfactory cell performance. In recent years, a growing number of research studies have reported AEMFC performance results. In the last three years, new records in performance were achieved. Most of the literature reporting cell performance is based on hydrogen-AEMFCs, although an increasing number of studies have also reported the use of fuels others than hydrogen - such as alcohols, non-alcohol C-based fuels, as well as N-based fuels. This article reviews the cell performance and performance stability achieved in AEMFCs through the years since the first reports in the early 2000s.

  11. Structural and microstructural changes during anion exchange of CoAl layered double hydroxides. An in situ X-ray powder diffraction study

    International Nuclear Information System (INIS)

    Johnsen, Rune E.; Krumeich, Frank; Norby, Poul

    2010-01-01

    Anion-exchange processes in cobalt-aluminium layered double hydroxides (LDHs) were studied by in situ synchrotron X-ray powder diffraction (XRPD). The processes investigated were CoAl-CO 3 →CoAl-Cl →CoAl-CO 3 , CoAl-Cl→CoAl-NO 3 and CoAl-CO 3 →CoAl-SO 4 . The XRPD data show that the CoAl-CO 3 →CoAl-Cl process is a two-phase transformation, where the amount of the CoAl-CO 3 phase decreases exponentially while that of the CoAl-Cl phase increases exponentially. Energy-dispersive X-ray spectroscopy (EDXS) studies of a partially chloride-exchanged CoAl-CO 3 LDH sample along with in situ XRPD data suggested that the individual particles in the CoAl-CO 3 sample are generally anion-exchanged with chloride one at a time. In contrast with the CoAl-CO 3 →CoAl-Cl transformation, the XRPD data show that the reverse CoAl-Cl→CoAl-CO 3 process is a one-phase transformation. Rietveld refinements indicate that the occupancy factors of the carbon and oxygen sites of the carbonate group increase, while that of the chloride site decreases. In the CoAl-Cl→CoAl-NO 3 anion-exchange reaction, the XRPD patterns reveal the existence of two intermediate phases in addition to the initial CoAl-Cl and final CoAl-NO 3 phases. The in situ data indicate that one of these intermediates is a mixed nitrate- and chloride-based LDH phase, where the disorder decreases as the nitrate content increases. The XRPD data of the partial CoAl-CO 3 →CoAl-SO 4 anion-exchange reaction show that the process is a two-phase transformation involving a sulfate-containing LDH with a 1H polytype structure. (orig.)

  12. Layered rare-earth hydroxide nanocones with facile host composition modification and anion-exchange feature: topotactic transformation into oxide nanocones for upconversion.

    Science.gov (United States)

    Zhong, Yishun; Chen, Gen; Liu, Xiaohe; Zhang, Dan; Zhang, Ning; Li, Junhui; Liang, Shuquan; Ma, Renzhi; Qiu, Guanzhou

    2017-06-22

    Conical structures with hollow interiors, namely, nanocones (NCs), may exhibit better carrier transport properties than nanorods or nanotubes, which make them promising candidates for potential applications in optical/display devices, electronics and optoelectronics. Generally, conical structures belong to a metastable state between lamellar and tubular forms due to the extreme curvature causing the increase of internal strain energy. Therefore, it is very difficult to prepare NCs in high yield and purity under mild conditions. Here we firstly demonstrate a general strategy for the synthesis of layered rare-earth hydroxide (LRH) NCs intercalating dodecyl sulfate anions (C 12 H 25 SO 4 - , DS - ) using hexamethylenetetramine (C 6 H 12 N 4 , HMT) hydrolysis. The rare-earth cations (RE 3+ ) in the host layer can be conveniently modified and/or doped, resulting in a large family of monometallic (Y, Tb, Er), bi- (Y-Tb, Y-Er) and even tri-metallic (Y-Yb-Er) LRH NCs with adjustable ratios. Moreover, the DS - -intercalated LRH NCs can be readily modified with various inorganic or organic anions (e.g., NO 3 - , Cl - , and CH 3 COO - , etc.) through a conventional anion-exchange procedure, and the original conical morphology can be perfectly maintained. The anion-exchanged product, for example, NO 3 - -intercalated NCs, can be more easily and topotactically transformed into oxide NCs than the original DS - -intercalated form, exempt from the formation of rare-earth oxysulfates induced by the combustion of interlayer DS anions. Taking advantage of this protocol, tri-metallic (Y-Yb-Er) LRH NCs were anion-exchanged into the NO 3 - -intercalated form and subsequently calcined into Y 2 O 3 :Yb,Er oxide NCs, which showed efficient upconversion photoluminescence properties. The current strategy may become a general method for the designed synthesis of other related hydroxide and oxide NCs for a wide range of potential applications.

  13. Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

    Science.gov (United States)

    Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

    2017-07-01

    Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

  14. Effect of the chemical structure of anion exchange resin on the adsorption of humic acid: behavior and mechanism.

    Science.gov (United States)

    Shuang, Chendong; Wang, Jun; Li, Haibo; Li, Aimin; Zhou, Qing

    2015-01-01

    Polystyrenic (PS) anion-exchange resin and polyacrylic (PA) anion-exchange resin were used to investigate the effect of resin chemical structure on the adsorption of humic acid (HA). Due to the rearrangement of HA to form layers that function as barricades to further HA diffusion, PS resin exhibited 12.4 times slower kinetics for the initial adsorption rate and 8.4 times for the diffusion constant in comparison to that of the PA resin. An HA layer and a spherical cluster of HA can be observed on the surface of the PS and PA resins after adsorption, respectively. The considerable difference in HA adsorption between the PS and PA resins was due to the difference in molecule shape for interaction with different resin structures, which can essentially be explained by the hydrophobicity and various interactions of the PS resin. A given amount of HA occupies more positively charged sites and hydrophobic sites on the PS resin than were occupied by the same amount of HA on the PA resin. Increased pH resulted in an increase of HA adsorption onto the PA resin but a decrease in adsorption onto PS resin, as the non-electrostatic adsorption led to electrostatic repulsion between the HA attached to the resin and the HA dissolved in solution. These results suggest higher rates of adsorption and higher regeneration efficiency for interaction of HA with more hydrophilic anion exchange materials. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Anion Effects on the Ion Exchange Process and the Deformation Property of Ionic Polymer Metal Composite Actuators

    Directory of Open Access Journals (Sweden)

    Wataru Aoyagi

    2016-06-01

    Full Text Available An ionic polymer-metal composite (IPMC actuator composed of a thin perfluorinated ionomer membrane with electrodes plated on both surfaces undergoes a large bending motion when a low electric field is applied across its thickness. Such actuators are soft, lightweight, and able to operate in solutions and thus show promise with regard to a wide range of applications, including MEMS sensors, artificial muscles, biomimetic systems, and medical devices. However, the variations induced by changing the type of anion on the device deformation properties are not well understood; therefore, the present study investigated the effects of different anions on the ion exchange process and the deformation behavior of IPMC actuators with palladium electrodes. Ion exchange was carried out in solutions incorporating various anions and the actuator tip displacement in deionized water was subsequently measured while applying a step voltage. In the step voltage response measurements, larger anions such as nitrate or sulfate led to a more pronounced tip displacement compared to that obtained with smaller anions such as hydroxide or chloride. In AC impedance measurements, larger anions generated greater ion conductivity and a larger double-layer capacitance at the cathode. Based on these mechanical and electrochemical measurements, it is concluded that the presence of larger anions in the ion exchange solution induces a greater degree of double-layer capacitance at the cathode and results in enhanced tip deformation of the IPMC actuators.

  16. DEVELOPMENT AND CHARACTERIZATION OF POLYVINYLIDENE FLUORIDE - IMIDAZOLIUM FUNCTIONALIZED POLYSULFONE BLEND ANION EXCHANGE MEMBRANE

    Directory of Open Access Journals (Sweden)

    S. VELU

    2015-09-01

    Full Text Available Anion exchange membrane (AEM is one of the core components of an alkaline fuel cell influencing the fuel cell’s performance, durability and stability. Out of the many anion exchange membranes reported so far, imidazolium functionalized polysulfone (PSf-ImOH membrane has been identified to have high hydroxide ionic conductivity, reaching up to 50 mS cm-1 at 20oC. However, at high levels of ion exchange capacity, the membrane’s water uptake and swelling ratio increases significantly with temperature thus destabilizing it and making it unfit for potential use in high temperature alkaline fuel cells. This limitation of PSf-ImOH membranes has been overcome by blending it with polyvinylidene fluoride (PVDF polymer, which is a thermally stable and highly hydrophobic polymer. PSf-ImOH membrane with a high degree of chloromethylation (180% was synthesized and blended with PVDF at different weight ratios (PVDF / PSf-ImOH: 30/70, 50/50 and 70/30 to create a series of novel anion exchange membranes. The prepared membranes were characterized to study their structure, water uptake, swelling ratio, solubility in low boiling water soluble solvents, thermal stability, ion exchange capacity (IEC and ionic conductivity (IC at different temperatures. The 70% PVDF blend membrane demonstrated the better performance in terms of IEC, IC and water uptake properties compared to other membranes. Comparative studies on the water uptake and IC variation between the 70% PVDF blend membrane and pure PSfImOH membrane (having the same IEC as that of the blend membrane, clearly indicated the superiority and the promising use of the blend membrane in alkaline fuel cell especially for high temperature working condition.

  17. Test procedure for anion exchange testing with Argonne 10-L solutions

    International Nuclear Information System (INIS)

    Compton, J.A.

    1995-01-01

    Four anion exchange resins will be tested to confirm that they will sorb and release plutonium from/to the appropriate solutions in the presence of other cations. Certain cations need to be removed from the test solutions to minimize adverse behavior in other processing equipment. The ion exchange resins will be tested using old laboratory solutions from Argonne National Laboratory; results will be compared to results from other similar processes for application to all plutonium solutions stored in the Plutonium Finishing Plant

  18. Preparation of nuclear grade strongly basic anion exchange resin in hydroxide from

    International Nuclear Information System (INIS)

    Ke Weiqing

    1989-01-01

    The two-step transformation method was used to prepare 90 kg nuclear grade strongly basic anion exchange resins by using the industrial grade baking soda and caustic soda manufacutred by mercury-cathode electrolysis. The chloride and biscarbonate fraction on resin is 0.8% and 1.25% respectively, when the baking soda and caustic soda consumption is 8.6 and 13.7 times the total exchange capacity of the strongly basic resin

  19. Investigation of Electrochemical and Morphological Properties of Mixed Matrix Polysulfone-Silica Anion Exchange Membrane

    Directory of Open Access Journals (Sweden)

    Khoiruddin

    2016-02-01

    Full Text Available Mixed matrix anion exchange membranes (AEMs were synthesized using dry-wet phase inversion. The casting solutions were prepared by dispersing finely ground anion-exchange resin particles in N,N-dimethylacetamide (DMAc solutions of polysulfone (PSf. Subsequently, nanosilica particles were introduced into the membranes. The results show that evaporation time (tev and solution composition contributed to membrane properties formation. A longer tev produces membranes with reduced void fraction inside the membranes, thus the amount of water adsorbed and membrane conductivity are reduced. Meanwhile, the permselectivity was improved by increasing tev, since a longer tev produces membranes with a narrower channel for ion migration and more effective Donnan exclusion. The incorporation of 0.5 %-wt nanosilica particles into the polymer matrix led to conductivity improvement (from 2.27 to 3.41 mS.cm-1. This may be associated with additional pathway formation by hydroxyl groups on the silica surface that entraps water and assists ion migration. However, at further silica loading (1.0 and 1.5 %-wt, these properties decreased (to 1.9 and 1.4 mS.cm-1 respectively, which attributed to inaccessibility of ion-exchange functional groups due to membrane compactness. It was found from the results that nanosilica contributes to membrane formation (increases casting solution viscosity then reduces void fraction and membrane functional group addition (provides hydroxyl groups.

  20. Production and application of cation/anion exchange membranes of high performance

    International Nuclear Information System (INIS)

    Xu Zhili; Tan Chunhong; Yang Xiangmin

    1995-01-01

    A third affiliated factory of our university has been established for the production in batches of cation/anion exchange membranes of high performance, trade marks of which are HF-1 and HF-2. Membrane products have been applied in various fields (including industries and research institutions) with great success

  1. Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

    OpenAIRE

    Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

    2002-01-01

    Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...

  2. Evaluating of arsenic(V) removal from water by weak-base anion exchange adsorbents.

    Science.gov (United States)

    Awual, M Rabiul; Hossain, M Amran; Shenashen, M A; Yaita, Tsuyoshi; Suzuki, Shinichi; Jyo, Akinori

    2013-01-01

    Arsenic contamination of groundwater has been called the largest mass poisoning calamity in human history and creates severe health problems. The effective adsorbents are imperative in response to the widespread removal of toxic arsenic exposure through drinking water. Evaluation of arsenic(V) removal from water by weak-base anion exchange adsorbents was studied in this paper, aiming at the determination of the effects of pH, competing anions, and feed flow rates to improvement on remediation. Two types of weak-base adsorbents were used to evaluate arsenic(V) removal efficiency both in batch and column approaches. Anion selectivity was determined by both adsorbents in batch method as equilibrium As(V) adsorption capacities. Column studies were performed in fixed-bed experiments using both adsorbent packed columns, and kinetic performance was dependent on the feed flow rate and competing anions. The weak-base adsorbents clarified that these are selective to arsenic(V) over competition of chloride, nitrate, and sulfate anions. The solution pH played an important role in arsenic(V) removal, and a higher pH can cause lower adsorption capacities. A low concentration level of arsenic(V) was also removed by these adsorbents even at a high flow rate of 250-350 h(-1). Adsorbed arsenic(V) was quantitatively eluted with 1 M HCl acid and regenerated into hydrochloride form simultaneously for the next adsorption operation after rinsing with water. The weak-base anion exchange adsorbents are to be an effective means to remove arsenic(V) from drinking water. The fast adsorption rate and the excellent adsorption capacity in the neutral pH range will render this removal technique attractive in practical use in chemical industry.

  3. Adsorption Equilibrium Equation of Carboxylic Acids on Anion-Exchange Resins in Water.

    Science.gov (United States)

    Kanazawa, Nobuhiro; Urano, Kohei; Kokado, Naohiro; Urushigawa, Yoshikuni

    2001-06-01

    The adsorption of propionic acid and benzoic acid on anion-exchange resins was analyzed, and an adsorption equilibrium equation of carboxylic acids was proposed. The adsorption of carboxylic acids on the anion-exchange resins was considered to be the sum of the physical adsorption of the molecule and the ion-exchange adsorption of the ion, which were independent of each other. For the physical adsorption of carboxylic acids, it was conformed to the Freundlich equation. For the ion-exchange adsorption of carboxylate ions, the equilibrium equation corresponded well with the experimental results for wide ranges of concentration and pH. The equation contains a selectivity coefficient S(A)(Cl) for the chloride ion versus the carboxylate ion, which was considered essentially a constant. The influent of the bicarbonate ion from carbon dioxide in air could also be expressed by the additional equilibrium equation with the selectivity coefficient S(HCO(3))(Cl) for the chloride ion versus the bicarbonate ion. Consequently, an adsorption equilibrium equation can estimate the equilibrium adsorption amounts. Even the effect of a coexisting bicarbonate ion is inconsequential when the parameters of the Freundlich isotherm equation and the selectivity coefficients of the carboxylate ion and the bicarbonate ion in each resin are determined in advance. Copyright 2001 Academic Press.

  4. Synthesis and Properties of Anion Exchangers Derived from Chloromethyl Styrene Co divinylbenzene and Their Use in Water Treatment

    International Nuclear Information System (INIS)

    Ezzeldin, H.A.; Apblett, A.; Foutch, G.L.

    2010-01-01

    Amination of vinylbenzyl chloride-divinylbenzene (VBC-DVB) copolymers is an effective method for preparation of ion-exchange resins. Conventionally, the starting polymer is produced by chloromethylation of a styrene-divinylbenzene copolymer that utilizes chloromethyl methyl ether, a known carcinogen. An alterative approach is to co polymerize vinylbenzyl chloride with divinylbenzene to generate the necessary Vb-Dvb. This method provides precise control over the density of the ion-exchange groups. The regiochemistry of the vinylbenzyl chloride methods was realized using solvent-ion exchange groups. In this investigation, an improved solvent system was found for the preparation of anion exchange resins by the vinylbenzyl chloride route. The effectiveness of amination of the intermediate VBC-DVB polymers with a variety of trimethylamine reagents was investigated, and ethanolic trimethylamine produced the highest degree of amination. These resulting ion-exchange polymers were characterized by a variety of techniques such as analytical titrations, nitrogen analysis, Fourier transform infrared spectroscopy and thermal gravimetric analysis. Testing of these copolymers for breakthrough was performed. The results indicate that these anion exchangers have a meaningful increase in thermal stability over commercial anionic exchange beads

  5. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Directory of Open Access Journals (Sweden)

    Wu Bailin

    2008-11-01

    Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the

  6. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Science.gov (United States)

    Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C

    2008-01-01

    Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to

  7. Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

    Science.gov (United States)

    Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

    2016-08-08

    Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Anion exchange membrane based on alkali doped poly(2,5-benzimidazole) for alkaline membrane fuel cell

    CSIR Research Space (South Africa)

    Luo, H

    2010-03-01

    Full Text Available was prepared. The alkali doped poly(2,5-benzimidazole) membrane is a promising candidate as anion exchange membrane for fuel cell application. The alkali doped poly(2,5-benzimidazole) membrane reached an anion conductivity of 2.3×10-2 S cm-1 at room temperature...

  9. Removal of Congo Red from Aqueous Solution by Anion Exchange Membrane (EBTAC): Adsorption Kinetics and Themodynamics

    Science.gov (United States)

    Khan, Muhammad Imran; Akhtar, Shahbaz; Zafar, Shagufta; Shaheen, Aqeela; Khan, Muhammad Ali; Luque, Rafael; ur Rehman, Aziz

    2015-01-01

    The adsorption behavior of anionic dye congo red (CR) from aqueous solutions using an anion exchange membrane (EBTAC) has been investigated at room temperature. The effect of several factors including contact time, membrane dosage, ionic strength and temperature were studied. Kinetic models, namely pseudo-first-order and pseudo-second-order, liquid film diffusion and Elovich models as well as Bangham and modified freundlich Equations, were employed to evaluate the experimental results. Parameters such as adsorption capacities, rate constant and related correlation coefficients for every model were calculated and discussed. The adsorption of CR on anion exchange membranes followed pseudo-second-order Kinetics. Thermodynamic parameters, namely changes in Gibbs free energy (∆G°), enthalpy (∆H°) and entropy (∆S°) were calculated for the adsorption of congo red, indicating an exothermic process. PMID:28793430

  10. Purification of degraded TBP solvent using macroreticular anion exchange resin

    International Nuclear Information System (INIS)

    Kartha, P.K.S.; Kutty, P.V.E.; Janaradanan, C.; Ramanujam, A.; Dhumwad, R.K.

    1989-01-01

    Tri-n-butyl phosphate (TBP) diluted with a suitable diluent is commonly used for solvent extraction in Purex process for the recovery of uranium and plutonium from irradiated nuclear fuels. This solvent gets degraded due to various factors, the main degradation product being dibutyl phosphoric acid (HDBP). A solvent cleanup step is generally incorporated in the process for removing the degradation products from the used solvent. A liquid-liquid cleanup system using sodium carbonate or sodium hydroxide solution is routinely used. Considering certain advantages, like the possibility of loading the resin almost to saturation capacity and the subsequent disposal of the spent resin by incineration and the feasibility of adopting it to the process, a liquid-solid system has been tried as an alternate method, employing various available macroreticular anion exchange resins in OH - form for the sorption of HDBP from TBP. After standardizing the various conditions for the satisfactory removal of HDBP from TBP using synthetic mixtures, resins were tested with process solvent in batch contacts. The parameters studied were (1) capacity of different resins for HDBP sorption (2) influence of acidity, uranium and HDBP on the sorption behaviour of the latter (3) removal of fission products from the solvent by the resin and (4) regeneration and recycling of the resin. (author). 2 figs., 13 tabs., 17 refs

  11. Effects of pH and Competing Anions on the Solution Speciation of Arsenic by Ion Exchange Resins

    Energy Technology Data Exchange (ETDEWEB)

    Impellitteri, Christopher A.; Ryan, JAmes A.; Al-Abed, Souhail R.; Scheckel, Kirk G.; Randall, Paul M.; Richardson, Collin A.

    2003-03-26

    Anion-exchange resins (AER) are used to differentiate As(V) and As(III) by retaining As(V) and allowing As(III) to pass through. AERs allow rapid speciation of As in the field which precludes the effects of sample preservation on As speciation. Aqueous environmental samples contain anions that may interfere with the speciation of As. This study compares the speciation of As by two commercially available AERs. A silica-based AER was selected for further study. As(V) and As(III) were passed through the AER in the presence of NO3 -, SO4 2-, HPO4 2-, Cl- and HCO3 - at pH 4, 6 and 8. Recoveries of As species in mixed systems range between 90 to 100%. Breakthrough curves for As(V) are presented which allow calculation of loading rates. HPO4 2- has the greatest effect on the speciation of As by AER.

  12. New inorganic (an)ion exchangers with a higher affinity for arsenate and a competitive removal capacity towards fluoride, bromate, bromide, selenate, selenite, arsenite and borate

    KAUST Repository

    Chubar, Natalia

    2011-12-01

    Highly selective materials and effective technologies are needed to meet the increasingly stronger drinking water standards for targeted ionic species. Inorganic ion exchangers based on individual and mixed-metal hydrous oxides (or mixed adsorbents that contain inorganic ion exchangers in their composition) are adsorptive materials that are capable of lowering the concentrations of anionic contaminants, such as H 2AsO 4 -, H 3AsO 3, F -, Br -, BrO 3 -, HSeO 4 -, HSeO 3 - and H 3BO 3, to 10 μg/L or less. To achieve a higher selectivity towards arsenate, a new ion exchanger based on Mg-Al hydrous oxides was developed by a novel, cost-effective and environmentally friendly synthesis method via a non-traditional (alkoxide-free) sol-gel approach. The exceptional adsorptive capacity of the Mg-Al hydrous oxides towards H 2AsO 4 - (up to 200 mg[As]/gdw) is due to the high affinity of this sorbent towards arsenate (steep equilibrium isotherms) and its fast adsorption kinetics. Because of the mesoporous (as determined by N 2 adsorption and SEM) and layered (as determined by XRD and FTIR) structure of the ion-exchange material as well as the abundance of anion exchange sites (as determined by XPS and potentiometric titration) on its surface the material demonstrated very competitive (or very high) removal capacity towards other targeted anions, including fluoride, bromide, bromate, selenate, selenite, and borate. © 2011 IWA Publishing.

  13. Influence of some factors on kinetics of boron ions sorption by inorganic anion exchanger of MNG type

    International Nuclear Information System (INIS)

    Leont'eva, G.V.

    1991-01-01

    Consideration is given to the influence of particle size of anion exchanger and boron ion concentration on boron sorption from the solution of the following composition (kg/m 3 ): Na + -71.3; K + - 1.9; Ca 2+ - 43.8; Mg 2+ - 5.7; B 2 O 3 -0.32-1.50; Cl - - 204.6, SO 4 2- - 0.02, CO 3 2+ - 0.40; HCO 3 - - 1.74; pH=8.1; density - 1225 kg/m 3 . Increase of dispersivity of ion-exchange material promotes the elevation of sorption rate. Increase of boron ion concentration in the solution leads to exchange capacity growth and reduction of latent period of nucleation; this results to increase of sorption rate

  14. The recovery of zinc from hot galvanizing slag in an anion-exchange membrane electrolysis reactor

    International Nuclear Information System (INIS)

    Ren Xiulian; Wei Qifeng; Hu Surong; Wei Sijie

    2010-01-01

    This paper reports the optimization of the process parameters for recovery of zinc from hot galvanizing slag in an anion-exchange membrane electrolysis reactor. The experiments were carried out in an ammoniacal ammonium chloride system. The influence of composition of electrolytes, pH, stirring rate, current density and temperature, on cathodic current efficiency, specific power consumption and anodic dissolution of Zn were investigated. The results indicate that the cathode current efficiency increases and the hydrogen evolution decreased with increasing the cathode current density. The partial current for electrodeposition of Zn has liner relationship with ω 1/2 (ω: rotation rate). The highest current efficiency for dissolving zinc was obtained when NH 4 Cl concentration was 53.46 g L -1 and the anodic dissolution of zinc was determined by mass transfer rate at stirring rate 0-300 r min -1 . Increase in temperature benefits to improve CE and dissolution of Zn, and reduce cell voltage. Initial pH of electrolytes plays an important role in the deposition and anodic dissolution of Zn. The results of single factor experiment show that about 50% energy consumption was saved for electrodeposition of Zn in the anion-exchange membrane electrolysis reactor.

  15. Anion concurrence and anion selectivity in the sorption of radionuclides by organotones

    International Nuclear Information System (INIS)

    Behnsen, Julia G.

    2007-01-01

    Some long-lived and radiologically important nuclear fission products, such as I-129 (half-life t 1/2 = 1,6 . 10 7 a), Tc-99 (t 1/2 = 2,1 . 10 5 a), and Se-79 (t 1/2 = 6,5 . 10 4 a) are anionic in aqueous environments. This study focuses on the adsorption of such anions to organoclays and the understanding of the selectivity of the process. The organoclays used in this study were prepared from a bentonite (MX-80) and a vermiculite clay, and the cationic surfactants hexadcylpyridium, hexadecyltrimethylammonium, and benzethonium. Surfactant adsorption to the bentonite exceeds the cation exchange capacity of the clay, with the surplus positive charge being balanced by the co-adsorption of chloride. The interlayer distance of the bentonites is increased sufficiently to contain bi- and pseudotrimolecular structures of the surfactants. Adsorption experiments were carried out using the batch technique. Anion adsorption of iodide, perrhenate, selenite, nitrate, and sulphate is mainly due to ion exchange with chloride. As an additional adsorption mechanism, the incorporation of inorganic ion pairs into the interlayer space of the clay is proposed as a result of experiments showing differences in the adsorption levels of sodium and potassium iodide. Anion adsorption results show a clear selectivity of the organoclays, with the affinity sequence being: ReO - 4 > I - > NO - 3 > Cl - > SO 2- 4 > SeO 2- 3 . This sequence corresponds to the sequence of increasing hydration energies of the anions, thus selectivity could be due to the process of minimization of free energy of the system. (orig.)

  16. Organic solute carrier 22 (SLC22 family: Potential for interactions with food, herbal/dietary supplements, endogenous compounds, and drugs

    Directory of Open Access Journals (Sweden)

    Raymond E. Lai

    2018-04-01

    Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport

  17. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    OpenAIRE

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-01-01

    Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged ...

  18. Ion-exchange equilibrium of N-acetyl-D-neuraminic acid on a strong anionic exchanger.

    Science.gov (United States)

    Wu, Jinglan; Ke, Xu; Zhang, Xudong; Zhuang, Wei; Zhou, Jingwei; Ying, Hanjie

    2015-09-15

    N-acetyl-D-neuraminic acid (Neu5Ac) is a high value-added product widely applied in the food industry. A suitable equilibrium model is required for purification of Neu5Ac based on ion-exchange chromatography. Hence, the equilibrium uptake of Neu5Ac on a strong anion exchanger, AD-1 was investigated experimentally and theoretically. The uptake of Neu5Ac by the hydroxyl form of the resin occurred primarily by a stoichiometric exchange of Neu5Ac(-) and OH(-). The experimental data showed that the selectivity coefficient for the exchange of Neu5Ac(-) with OH(-) was a non-constant quantity. Subsequently, the Saunders' model, which took into account the dissociation reactions of Neu5Ac and the condition of electroneutrality, was used to correlate the Neu5Ac sorption isotherms at various solution pHs and Neu5Ac concentrations. The model provided an excellent fit to the binary exchange data for Cl(-)/OH(-) and Neu5Ac(-)/OH(-), and an approximate prediction of equilibrium in the ternary system Cl(-)/Neu5Ac(-)/OH(-). This basic information combined with the general mass transfer model could lay the foundation for the prediction of dynamic behavior of fixed bed separation process afterwards. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. The SLC24 gene family of Na⁺/Ca²⁺-K⁺ exchangers: from sight and smell to memory consolidation and skin pigmentation.

    Science.gov (United States)

    Schnetkamp, Paul P M

    2013-01-01

    Members of the SLC24 gene family encode K(+)-dependent Na(+)/Ca(2+) exchangers (NCKX) that utilize both the inward Na(+) and outward K(+) gradients to extrude Ca(2+) from cells. There are five human SLC24 genes that play a role in biological process as diverse as vision in retinal rod and cone photoreceptors, olfaction, skin pigmentation and at least three of the five genes are also widely expressed in the brain. Here I review the functional, physiological and structural features of NCKX proteins that have emerged in the past few years. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Enolate Stabilization by Anion-π Interactions: Deuterium Exchange in Malonate Dilactones on π-Acidic Surfaces.

    Science.gov (United States)

    Miros, François N; Zhao, Yingjie; Sargsyan, Gevorg; Pupier, Marion; Besnard, Céline; Beuchat, César; Mareda, Jiri; Sakai, Naomi; Matile, Stefan

    2016-02-18

    Of central importance in chemistry and biology, enolate chemistry is an attractive topic to elaborate on possible contributions of anion-π interactions to catalysis. To demonstrate the existence of such contributions, experimental evidence for the stabilization of not only anions but also anionic intermediates and transition states on π-acidic aromatic surfaces is decisive. To tackle this challenge for enolate chemistry with maximal precision and minimal uncertainty, malonate dilactones are covalently positioned on the π-acidic surface of naphthalenediimides (NDIs). Their presence is directly visible in the upfield shifts of the α-protons in the (1) H NMR spectra. The reactivity of these protons on π-acidic surfaces is measured by hydrogen-deuterium (H-D) exchange for 11 different examples, excluding controls. The velocity of H-D exchange increases with π acidity (NDI core substituents: SO2 R>SOR>H>OR>OR/NR2 >SR>NR2 ). The H-D exchange kinetics vary with the structure of the enolate (malonates>methylmalonates, dilactones>dithiolactones). Moreover, they depend on the distance to the π surface (bridge length: 11-13 atoms). Most importantly, H-D exchange depends strongly on the chirality of the π surface (chiral sulfoxides as core substituents; the crystal structure of the enantiopure (R,R,P)-macrocycle is reported). For maximal π acidity, transition-state stabilizations up to -18.8 kJ mol(-1) are obtained for H-D exchange. The Brønsted acidity of the enols increases strongly with π acidity of the aromatic surface, the lowest measured pKa =10.9 calculates to a ΔpKa =-5.5. Corresponding to the deprotonation of arginine residues in neutral water, considered as "impossible" in biology, the found enolate-π interactions are very important. The strong dependence of enolate stabilization on the unprecedented seven-component π-acidity gradient over almost 1 eV demonstrates quantitatively that such important anion-π activities can be expected only from

  1. Modulation of sodium-bicarbonate co-transporter (SLC4A4/NBCe1) protein and mRNA expression in rat's uteri by sex-steroids and at different phases of the oestrous cycle.

    Science.gov (United States)

    Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib

    2014-02-01

    Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Hydration and sorption characteristics of a polyfunctional weak-base anion exchanger after the sorption of vanillin and ethylvanillin

    Science.gov (United States)

    Rodionova, D. O.; Voronyuk, I. V.; Eliseeva, T. V.

    2016-07-01

    Features of the sorption of substituted aromatic aldehydes by a weak-base anion exchanger under equilibrium conditions are investigated using vanillin and ethylvanillin as examples. Analysis of the sorption isotherms of carbonyl compounds at different temperatures allows us to calculate the equilibrium characteristics of their sorption and assess the entropy and enthalpy contributions to the energy of the process. Hydration characteristics of the macroporous weak-base anion exchanger before and after the sorption of aromatic aldehydes are compared.

  3. Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

    Science.gov (United States)

    Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

    2017-10-01

    Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

  4. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  5. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  6. Electrodialytic Transport Properties of Anion-Exchange Membranes Prepared from Poly(vinyl alcohol) and Poly(vinyl alcohol-co-methacryloyl aminopropyl trimethyl ammonium chloride).

    Science.gov (United States)

    Jikihara, Atsushi; Ohashi, Reina; Kakihana, Yuriko; Higa, Mitsuru; Kobayashi, Kenichi

    2013-01-02

    Random-type anion-exchange membranes (AEMs) have been prepared by blending poly(vinyl alcohol) (PVA) and the random copolymer-type polycation, poly(vinyl alcohol-co-methacryloyl aminopropyl trimethyl ammonium chloride) at various molar percentages of anion-exchange groups to vinyl alcohol groups, Cpc, and by cross-linking the PVA chains with glutaraldehyde (GA) solution at various GA concentrations, CGA. The characteristics of the random-type AEMs were compared with blend-type AEMs prepared in our previous study. At equal molar percentages of the anion exchange groups, the water content of the random-type AEMs was lower than that of the blend-type AEMs. The effective charge density of the random-type AEMs increased with increasing Cpc and reached a maximum value. Further, the maximum value of the effective charge density increased with increasing CGA. The maximum value of the effective charge density, 0.42 mol/dm3, was obtained for the random-type AEM with Cpc = 4.2 mol % and CGA = 0.15 vol %. A comparison of the random-type and blend-type AEMs with almost the same Cpc showed that the random-type AEMs had lower membrane resistance than the blend-type ones. The membrane resistance and dynamic transport number of the random-type AEM with Cpc = 6.0 mol % and CGA = 0.15 vol % were 4.8 Ω cm2 and 0.83, respectively.

  7. Removal of chromium (VI) from electroplating wastewater using an anion exchanger derived from rice straw.

    Science.gov (United States)

    Cao, Wei; Dang, Zhi; Yia, Xiao-Yun; Yang, Chen; Lu, Gui-Ning; Liu, Yun-Feng; Huang, Se-Yan; Zheng, Liu-Chun

    2013-01-01

    An anion exchanger from rice straw was used to remove Cr (VI) from synthetic wastewater and electroplating effluent. The exchanger was characterized using Fourier transform infrared (FTIR) spectrum and scanning electron microscopy (SEM), and it was found that the quaternary amino group and hydroxyl group are the main functional groups on the fibrous surface of the exchanger. The effect of contact time, initial concentration and pH on the removal of Cr (VI), and adsorption isotherms at different temperature, was investigated. The results showed that the removal of Cr (VI) was very rapid and was significantly affected by the initial pH of the solution. Although acidic conditions (pH = 2-6) facilitated Cr (VI) adsorption, the exchanger was effective in neutral solution and even under weak base conditions. The equilibrium data fitted well with Langmuir adsorption model, and the maximum Cr (VI) adsorption capacities at pH 6.4 were 0.35, 0.36 and 0.38 mmol/g for 15, 25 and 35 degrees C, respectively. The exchanger was finally tested with real electroplating wastewater, and at sorbent dosage of 10 g/L, the removal efficiencies for Cr (VI) and total Cr were 99.4% and 97.8%, respectively. In addition, the positive relationship between adsorbed Cr (VI) and desorbed Cl- suggested that Cr (VI) was mainly removed by ion exchange with chlorine.

  8. Rapid isolation of plutonium in environmental solid samples using sequential injection anion exchange chromatography followed by detection with inductively coupled plasma mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Qiao Jixin, E-mail: jixin.qiao@risoe.d [Radiation Research Division, Riso National Laboratory for Sustainable Energy, Technical University of Denmark, DK-4000 Roskilde (Denmark); Hou Xiaolin; Roos, Per [Radiation Research Division, Riso National Laboratory for Sustainable Energy, Technical University of Denmark, DK-4000 Roskilde (Denmark); Miro, Manuel [Department of Chemistry, Faculty of Sciences, University of the Balearic Islands, Carretera de Valldemossa km. 7.5, E-07122 Palma de Mallorca, Illes Balears (Spain)

    2011-01-31

    This paper reports an automated analytical method for rapid determination of plutonium isotopes ({sup 239}Pu and {sup 240}Pu) in environmental solid extracts. Anion exchange chromatographic columns were incorporated in a sequential injection (SI) system to undertake the automated separation of plutonium from matrix and interfering elements. The analytical results most distinctly demonstrated that the crosslinkage of the anion exchanger is a key parameter controlling the separation efficiency. AG 1-x4 type resin was selected as the most suitable sorbent material for analyte separation. Investigation of column size effect upon the separation efficiency revealed that small-sized (2 mL) columns sufficed to handle up to 50 g of environmental soil samples. Under the optimum conditions, chemical yields of plutonium exceeded 90% and the decontamination factors for uranium, thorium and lead ranged from 10{sup 3} to 10{sup 4}. The determination of plutonium isotopes in three standard/certified reference materials (IAEA-375 soil, IAEA-135 sediment and NIST-4359 seaweed) and two reference samples (Irish Sea sediment and Danish soil) revealed a good agreement with reference/certified values. The SI column-separation method is straightforward and less labor intensive as compared with batch-wise anion exchange chromatographic procedures. Besides, the automated method features low consumption of ion-exchanger and reagents for column washing and elution, with the consequent decrease in the generation of acidic waste, thus bearing green chemical credentials.

  9. Poly(vinylbenzylchloride) Based Anion-Exchange Blend Membranes (AEBMs): Influence of PEG Additive on Conductivity and Stability.

    Science.gov (United States)

    Kerres, Jochen A; Krieg, Henning M

    2017-06-16

    In view of the many possible applications such as fuel cells and electrolysers, recent interest in novel anion exchange membranes (AEMs) has increased significantly. However, their low conductivity and chemical stability limits their current suitability. In this study, the synthesis and characterization of several three- and four-component anion exchange blend membranes (AEBMs) is described, where the compositions have been systematically varied to study the influence of the AEBM's composition on the anion conductivities as well as chemical and thermal stabilities under strongly alkaline conditions. It was shown that the epoxide-functionalized poly(ethylene glycol)s that were introduced into the four-component AEBMs resulted in increased conductivity as well as a marked improvement in the stability of the AEBMs in an alkaline environment. In addition, the thermal stability of the novel AEBMs was excellent showing the suitability of these membranes for several electrochemical applications.

  10. Determination of iridium in the Bering Sea and Arctic Ocean seawaters by anion exchange preconcentration-neutron activation analysis

    International Nuclear Information System (INIS)

    Li Shihong; Mao Xueying; Chai Zhifang

    2004-01-01

    Anion exchange method is investigated to separate and enrich iridium in seawater by radiotracer 192 Ir. The adsorption of Ir in the resin increases with the decreasing acidity in the 0.05-1.2 mol/L HCl media, The recovery of iridium in pH=1.5 seawater reaches 89% by a single anion-exchange column. The polyethylene container of acidity of pH=1.5 are suitable for storing trace Ir in seawater. An anion exchange preconcentration-neutron activation analysis procedure is developed to determine iridium in seawaters sampled from the Bering Sea and Arctic Ocean at different depth. The reagent blank value of the whole procedures is (0.18-0.20) x 10 -12 g Ir. The iridium concentrations in the Bering Sea and Arctic Ocean seawater samples are (0.85-3.58) x 10 -12 g/L (0-3504 m) and (1.26-1.97) x 10 -12 g/L (25-1900 m), respectively

  11. Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.

    Science.gov (United States)

    Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J

    2017-07-01

    To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

  12. Probiotic Bifidobacterium species stimulate human SLC26A3 gene function and expression in intestinal epithelial cells

    Science.gov (United States)

    Kumar, Anoop; Hecht, Cameron; Priyamvada, Shubha; Anbazhagan, Arivarasu N.; Alakkam, Anas; Borthakur, Alip; Alrefai, Waddah A.; Gill, Ravinder K.

    2014-01-01

    SLC26A3, or downregulated in adenoma (DRA), plays a major role in mediating Cl− absorption in the mammalian intestine. Disturbances in DRA function and expression have been implicated in intestinal disorders such as congenital Cl− diarrhea and gut inflammation. We previously showed that an increase in DRA function and expression by Lactobacillus acidophilus and its culture supernatant (CS) might underlie antidiarrheal effects of this probiotic strain. However, the effects of Bifidobacterium species, important inhabitants of the human colon, on intestinal Cl−/HCO3− exchange activity are not known. Our current results demonstrate that CS derived from Bifidobacterium breve, Bifidobacterium infantis, and Bifidobacterium bifidum increased anion exchange activity in Caco-2 cells (∼1.8- to 2.4-fold). Consistent with the increase in DRA function, CS also increased the protein, as well as the mRNA, level of DRA (but not putative anion transporter 1). CS of all three Bifidobacterium sp. increased DRA promoter activity (−1,183/+114 bp) in Caco-2 cells (1.5- to 1.8-fold). Furthermore, the increase in DRA mRNA expression by CS of B. breve and B. infantis was blocked in the presence of the transcription inhibitor actinomycin D (5 μM) and the ERK1/2 MAPK pathway inhibitor U0126 (10 μM). Administration of live B. breve, B. infantis, and B. bifidum by oral gavage to mice for 24 h increased DRA mRNA and protein levels in the colon. These data demonstrate an upregulation of DRA via activation of the ERK1/2 pathway that may underlie potential antidiarrheal effects of Bifidobacterium sp. PMID:25143346

  13. The importance of OH − transport through anion exchange membrane in microbial electrolysis cells

    KAUST Repository

    Ye, Yaoli; Logan, Bruce

    2018-01-01

    In two-chamber microbial electrolysis cells (MECs) with anion exchange membranes (AEMs), a phosphate buffer solution (PBS) is typically used to avoid increases in catholyte pH as Nernst equation calculations indicate that high pHs adversely impact

  14. Effects of the anion salt nature on the rate constants of the aqueous proton exchange reactions.

    Science.gov (United States)

    Paredes, Jose M; Garzon, Andres; Crovetto, Luis; Orte, Angel; Lopez, Sergio G; Alvarez-Pez, Jose M

    2012-04-28

    The proton-transfer ground-state rate constants of the xanthenic dye 9-[1-(2-methyl-4-methoxyphenyl)]-6-hydroxy-3H-xanthen-3-one (TG-II), recovered by Fluorescence Lifetime Correlation Spectroscopy (FLCS), have proven to be useful to quantitatively reflect specific cation effects in aqueous solutions (J. M. Paredes, L. Crovetto, A. Orte, J. M. Alvarez-Pez and E. M. Talavera, Phys. Chem. Chem. Phys., 2011, 13, 1685-1694). Since these phenomena are more sensitive to anions than to cations, in this paper we have accounted for the influence of salts with the sodium cation in common, and the anion classified according to the empirical Hofmeister series, on the proton transfer rate constants of TG-II. We demonstrate that the presence of ions accelerates the rate of the ground-state proton-exchange reaction in the same order than ions that affect ion solvation in water. The combination of FLCS with a fluorophore undergoing proton transfer reactions in the ground state, along with the desirable feature of a pseudo-dark state when the dye is protonated, allows one unique direct determination of kinetic rate constants of the proton exchange chemical reaction. This journal is © the Owner Societies 2012

  15. The recovery of zinc from hot galvanizing slag in an anion-exchange membrane electrolysis reactor

    Energy Technology Data Exchange (ETDEWEB)

    Ren Xiulian [College of Ocean, Harbin Institute of Technology at Weihai, Weihai 264209 (China); Wei Qifeng, E-mail: weiqifeng163@163.com [College of Ocean, Harbin Institute of Technology at Weihai, Weihai 264209 (China); Hu Surong; Wei Sijie [College of Ocean, Harbin Institute of Technology at Weihai, Weihai 264209 (China)

    2010-09-15

    This paper reports the optimization of the process parameters for recovery of zinc from hot galvanizing slag in an anion-exchange membrane electrolysis reactor. The experiments were carried out in an ammoniacal ammonium chloride system. The influence of composition of electrolytes, pH, stirring rate, current density and temperature, on cathodic current efficiency, specific power consumption and anodic dissolution of Zn were investigated. The results indicate that the cathode current efficiency increases and the hydrogen evolution decreased with increasing the cathode current density. The partial current for electrodeposition of Zn has liner relationship with {omega}{sup 1/2} ({omega}: rotation rate). The highest current efficiency for dissolving zinc was obtained when NH{sub 4}Cl concentration was 53.46 g L{sup -1} and the anodic dissolution of zinc was determined by mass transfer rate at stirring rate 0-300 r min{sup -1}. Increase in temperature benefits to improve CE and dissolution of Zn, and reduce cell voltage. Initial pH of electrolytes plays an important role in the deposition and anodic dissolution of Zn. The results of single factor experiment show that about 50% energy consumption was saved for electrodeposition of Zn in the anion-exchange membrane electrolysis reactor.

  16. The recovery of zinc from hot galvanizing slag in an anion-exchange membrane electrolysis reactor.

    Science.gov (United States)

    Ren, Xiulian; Wei, Qifeng; Hu, Surong; Wei, Sijie

    2010-09-15

    This paper reports the optimization of the process parameters for recovery of zinc from hot galvanizing slag in an anion-exchange membrane electrolysis reactor. The experiments were carried out in an ammoniacal ammonium chloride system. The influence of composition of electrolytes, pH, stirring rate, current density and temperature, on cathodic current efficiency, specific power consumption and anodic dissolution of Zn were investigated. The results indicate that the cathode current efficiency increases and the hydrogen evolution decreased with increasing the cathode current density. The partial current for electrodeposition of Zn has liner relationship with omega(1/2) (omega: rotation rate). The highest current efficiency for dissolving zinc was obtained when NH(4)Cl concentration was 53.46 g L(-1) and the anodic dissolution of zinc was determined by mass transfer rate at stirring rate 0-300 r min(-1). Increase in temperature benefits to improve CE and dissolution of Zn, and reduce cell voltage. Initial pH of electrolytes plays an important role in the deposition and anodic dissolution of Zn. The results of single factor experiment show that about 50% energy consumption was saved for electrodeposition of Zn in the anion-exchange membrane electrolysis reactor. Copyright 2010 Elsevier B.V. All rights reserved.

  17. Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

    Science.gov (United States)

    Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

    2012-06-01

    Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

  18. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

    Directory of Open Access Journals (Sweden)

    Kaifeng Yin

    2017-05-01

    Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

  19. Gamma radiation effect on gas production in anion exchange resins

    Energy Technology Data Exchange (ETDEWEB)

    Traboulsi, A. [CEA Marcoule, DEN/DTCD/SPDE/LCFI, BP 17171, 30207 Bagnols-sur-Cèze Cedex (France); E.A. LISA – METICA, Aix Marseille Université, Pôle de l’Etoile, case 451, 13397 Marseille Cedex 20 (France); Labed, V., E-mail: veronique.labed@cea.fr [CEA Marcoule, DEN/DTCD/SPDE/LCFI, BP 17171, 30207 Bagnols-sur-Cèze Cedex (France); Dauvois, V. [CEA Saclay, DEN/DANS/DPC/SECR/LSRM, 91191 Gif sur Yvette Cedex (France); Dupuy, N.; Rebufa, C. [E.A. LISA – METICA, Aix Marseille Université, Pôle de l’Etoile, case 451, 13397 Marseille Cedex 20 (France)

    2013-10-01

    Radiation-induced decomposition of Amberlite IRA400 anion exchange resin in hydroxide form by gamma radiolysis has been studied at various doses in different atmospheres (anaerobic, anaerobic with liquid water, and aerobic). The effect of these parameters on the degradation of ion exchange resins is rarely investigated in the literature. We focused on the radiolysis gases produced by resin degradation. When the resin was irradiated under anaerobic conditions with liquid water, the liquid phase over the resin was also analyzed to identify any possible water-soluble products released by degradation of the resin. The main products released are trimethylamine (TMA), molecular hydrogen (H{sub 2g}) and carbon dioxide (CO{sub 2g}). TMA and H{sub 2g} are produced in all the irradiation atmospheres. However, TMA was in gaseous form under anaerobic and aerobic conditions and in aqueous form in presence of liquid water. In the latter conditions, TMA{sub aq} was associated with aqueous dimethylamine (DMA{sub aq}), monomethylamine (MMA{sub aq}) and ammonia (NH{sub 4}{sup +}{sub aq}). CO{sub 2g} is formed in the presence of oxygen due to oxidation of organic compounds present in the system, in particular the degradation products such as TMA{sub g}.

  20. Anion-induced structural transformation of a sulfate-incorporated 2D Cd(II)–organic framework

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Li-Wei [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Institute of Materials Science and Engineering, National Central University, Taoyuan 320, Taiwan (China); Luo, Tzuoo-Tsair [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Wang, Chih-Min [Department of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung 202, Taiwan (China); Lee, Gene-Hsiang; Peng, Shie-Ming [Department of Chemistry, National Taiwan University, Taipei 107, Taiwan (China); Liu, Yen-Hsiang [Department of Chemistry, Fu Jen Catholic University, New Taipei City 242, Taiwan (China); Lee, Sheng-Long [Institute of Materials Science and Engineering, National Central University, Taoyuan 320, Taiwan (China); Lu, Kuang-Lieh [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China)

    2016-07-15

    A Cd(II)–organic framework {[Cd_2(tpim)_4(SO_4)(H_2O)_2]·(SO_4)·21H_2O}{sub n} (1) was synthesized by reacting CdSO{sub 4}·8/3H{sub 2}O and 2,4,5-tri(4-pyridyl)imidazole (tpim) under hydrothermal conditions. A structural analysis showed that compound 1 adopts a layered structure in which the [Cd(tpim){sub 2}]{sub n} chains are linked by sulfate anions. These 2D layers are further packed into a 3D supramolecular framework via π–π interactions. The structure contains two types of SO{sub 4}{sup 2−} anions, i.e., bridging SO{sub 4}{sup 2−} and free SO{sub 4}{sup 2−} anions, the latter of which are included in the large channels of the framework. Compound 1 exhibits interesting anion exchange behavior. In the presence of SCN{sup −} anions, both the bridging and free SO{sub 4}{sup 2−} anions in 1 were completely exchanged by SCN{sup −} ligands to form a 1D species [Cd(tpim){sub 2}(SCN){sub 2}] (1A), in which the SCN{sup –} moieties function as a monodentate ligand. On the other hand, when compound 1 was ion exchanged with N{sub 3}{sup −} anions in aqueous solution, the bridging SO{sub 4}{sup 2−} moieties remained intact, and only the free guest SO{sub 4}{sup 2−} were replaced by N{sub 3}{sup −} anions. The gas adsorption behavior of the activated compound 1 was also investigated. - Highlights: • An interesting anion-induced structural transformation of a sulfate-incorporated 2D Cd(II)–organic framework is reported. • The sulfate-incorporated 2D layer compound exhibits very different anion exchange behavior with respect to SCN{sup −} and N{sub 3}{sup −}. • Both the bridging and free SO{sub 4}{sup 2−} anions in the 2D structure were completely exchanged by SCN{sup −} ligands, resulting in the formation of a 1D species. However, in the case of N{sub 3}{sup −} anions, only the free guest SO{sub 4}{sup 2−} in the structure was replaced.

  1. CD8+ T cells undergo activation and programmed death-1 repression in the liver of aged Ae2a,b-/- mice favoring autoimmune cholangitis

    NARCIS (Netherlands)

    Concepcion, Axel R.; Salas, January T.; Sáez, Elena; Sarvide, Sarai; Ferrer, Alex; Portu, Ainhoa; Uriarte, Iker; Hervás-Stubbs, Sandra; Oude Elferink, Ronald P. J.; Prieto, Jesús; Medina, Juan F.

    2015-01-01

    Primary biliary cirrhosis (PBC) is a chronic cholestatic disease of unknown etiopathogenesis showing progressive autoimmune-mediated cholangitis. In PBC patients, the liver and lymphocytes exhibit diminished expression of AE2/SLC4A2, a Cl-/HCO3- anion exchanger involved in biliary bicarbonate

  2. The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

    Science.gov (United States)

    Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

    2017-01-01

    Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

  3. Composite anion-exchangers modified with nanoparticles of hydrated oxides of multivalent metals

    Science.gov (United States)

    Maltseva, T. V.; Kolomiets, E. O.; Dzyazko, Yu. S.; Scherbakov, S.

    2018-02-01

    Organic-inorganic composite ion-exchangers based on anion exchange resins have been obtained. Particles of one-component and two-component modifier were embedded using the approach, which allows us to realize purposeful control of a size of the embedded particles. The approach is based on Ostwald-Freundlich equation, which was adapted to deposition in ion exchange matrix. The equation was obtained experimentally. Hydrated oxides of zirconium and iron were applied to modification, concentration of the reagents were varied. The embedded particles accelerate sorption, the rate of which is fitted by the model equation of chemical reactions of pseudo-second order. When sorption of arsenate ions from very diluted solution (50 µg dm-3) occurs, the composites show higher distribution coefficients comparing with the pristine resin.

  4. Preparation of high-capacity, weak anion-exchange membranes by surface-initiated atom transfer radical polymerization of poly(glycidyl methacrylate) and subsequent derivatization with diethylamine

    International Nuclear Information System (INIS)

    Qian, Xiaolei; Fan, Hua; Wang, Chaozhan; Wei, Yinmao

    2013-01-01

    Ion-exchange membrane is of importance for the development of membrane chromatography. In this work, a high-capacity anion-exchange membrane was prepared by grafting of glycidyl methacrylate (GMA) onto the surface of regenerated cellulose (RC) membranes via surface-initiated atom transfer radical polymerization (SI-ATRP) and subsequent derivatization with diethylamine. Attenuated total reflectance Fourier-transform infrared (ATR-FTIR), X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) were used to characterize changes in the chemical functionality, surface topography and pore morphology of the modified membranes. The static capacity of the prepared anion-exchange membrane was evaluated with bovine serum albumin (BSA) as a model protein. The results indicated that the anion-exchange membrane which could reach a maximum capacity of 96 mg/mL for static adsorption possesses a higher adsorption capacity, and the adsorption capacity increases with the polymerization time. The effect of pH and salt concentration confirmed that the adsorption of BSA followed ion-exchange mechanism. The established method would have potential application in the preparation of anion-exchange membrane.

  5. Vps35-deficiency impairs SLC4A11 trafficking and promotes corneal dystrophy.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available Vps35 (vacuolar protein sorting 35 is a major component of retromer that selectively promotes endosome-to-Golgi retrieval of transmembrane proteins. Dysfunction of retromer is a risk factor for the pathogenesis of Parkinson's disease (PD and Alzheimer's disease (AD. However, Vps35/retromer's function in the eye or the contribution of Vps35-deficiency to eye degenerative disorders remains to be explored. Here we provide evidence for a critical role of Vps35 in mouse corneal dystrophy. Vps35 is expressed in mouse and human cornea. Mouse cornea from Vps35 heterozygotes (Vps35+/- show features of dystrophy, such as loss of both endothelial and epithelial cell densities, disorganizations of endothelial, stroma, and epithelial cells, excrescences in the Descemet membrane, and corneal edema. Additionally, corneal epithelial cell proliferation was reduced in Vps35-deficient mice. Intriguingly, cell surface targeting of SLC4A11, a membrane transport protein (OH- /H+ /NH3 /H2O of corneal endothelium, whose mutations have been identified in patients with corneal dystrophy, was impaired in Vps35-deficient cells and cornea. Taken together, these results suggest that SLC4A11 appears to be a Vps35/retromer cargo, and Vps35-regulation of SLC4A11 trafficking may underlie Vps35/retromer regulation of corneal dystrophy.

  6. A green approach for preparing anion exchange membrane based on cardo polyetherketone powders

    Science.gov (United States)

    Hu, Jue; Zhang, Chengxu; Zhang, Xiaodong; Chen, Longwei; Jiang, Lin; Meng, Yuedong; Wang, Xiangke

    2014-12-01

    Anion exchange membranes (AEMs) have attracted great attention due to their irreplaceable role in platinum-free fuel cell applications. The majority of AEM preparations have been performed in two steps: the grafting of functional groups and quaternization. Here, we adopted a simpler, more eco-friendly approach for the first time to prepare AEMs by atmospheric-pressure plasma-grafting. This approach enables the direct introduction of anion exchange groups (benzyltrimethylammonium groups) into the polymer matrix, overcoming the need for toxic chloromethyl ether and quaternization reagents. Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy and 1H NMR spectroscopy results demonstrate that benzyltrimethylammonium groups have been successfully grafted into the cardo polyetherketone (PEK-C) matrix. Thermogravimetric analysis reveals that the plasma-grafting technique is a facile and non-destructive method able to improve the thermal stability of the polymer matrix due to the strong preservation of the PEK-C backbone structure and the cross-linking of the grafted side chains. The plasma-grafted PG-NOH membrane, which shows satisfactory alcohol resistance (ethanol permeability of 6.3 × 10-7 cm2 s-1), selectivity (1.2 × 104 S s cm-3), thermal stability (safely used below 130 °C), chemical stability, anion conductivity (7.7 mS cm-1 at 20 °C in deionized water) and mechanical properties is promising for the construction of high-performance fuel cells.

  7. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  8. Study of plutonium IV elution from macromolecular anion exchange resin by 0.5 M nitric acid

    International Nuclear Information System (INIS)

    Nadkarni, M.N.; Mayankutty, P.C.; Pillai, N.S.; Shinde, S.S.

    1976-01-01

    Preliminary studies indicated that macroreticular resins possess more or less the same capacities and absorption characteristics for thorium, uranium and plutonium from nitric acid solutions as the conventional resins. Detailed studies were, then, conducted. It was found that Pu(IV) can be loaded on the macroreticular anion exchange resin, Amberlyst A-26 from 7.2 M nitric acid in much the same way as Dowex 1x4. It was also observed that the elution of Pu(IV) from Amberlyst A-26 by 0.5 M nitric acid is much more rapid and quantitative than from Dowex 1x4. (author)

  9. Halloysite-derived nitrogen doped carbon electrocatalysts for anion exchange membrane fuel cells

    Science.gov (United States)

    Lu, Yaxiang; Wang, Lianqin; Preuß, Kathrin; Qiao, Mo; Titirici, Maria-Magdalena; Varcoe, John; Cai, Qiong

    2017-12-01

    Developing the low-cost, highly active carbonaceous materials for oxygen reduction reaction (ORR) catalysts has been a high-priority research direction for durable fuel cells. In this paper, two novel N-doped carbonaceous materials with flaky and rod-like morphology using the natural halloysite as template are obtained from urea nitrogen source as well as glucose (denoted as GU) and furfural (denoted as FU) carbon precursors, respectively, which can be directly applied as metal-free electrocatalysts for ORR in alkaline electrolyte. Importantly, compared with a benchmark Pt/C (20wt%) catalyst, the as-prepared carbon catalysts demonstrate higher retention in diffusion limiting current density (after 3000 cycles) and enhanced methanol tolerances with only 50-60mV negative shift in half-wave potentials. In addition, electrocatalytic activity, durability and methanol tolerant capability of the two N-doped carbon catalysts are systematically evaluated, and the underneath reasons of the outperformance of rod-like catalysts over the flaky are revealed. At last, the produced carbonaceous catalysts are also used as cathodes in the single cell H2/O2 anion exchange membrane fuel cell (AEMFC), in which the rod-like FU delivers a peak power density as high as 703 mW cm-2 (vs. 1106 mW cm-2 with a Pt/C benchmark cathode catalyst).

  10. Prevention of the disrupted enamel phenotype in Slc4a4-null mice using explant organ culture maintained in a living host kidney capsule.

    Directory of Open Access Journals (Sweden)

    Xin Wen

    Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.

  11. Design and performance evaluation of a microfluidic ion-suppression module for anion-exchange chromatography.

    Science.gov (United States)

    Wouters, Sam; Wouters, Bert; Jespers, Sander; Desmet, Gert; Eghbali, Hamed; Bruggink, Cees; Eeltink, Sebastiaan

    2014-08-15

    A microfluidic membrane suppressor has been constructed to suppress ions of alkaline mobile-phases via an acid-base reaction across a sulfonated poly(tetrafluoroethylene)-based membrane and was evaluated for anion-exchange separations using conductivity detection. The membrane was clamped between two chip substrates, accommodating rectangular microchannels for the eluent and regenerant flow, respectively. Additionally, a clamp-on chip holder has been constructed which allows the alignment and stacking of different chip modules. The response and efficacy of the microfluidic chip suppressor was assessed for a wide range of eluent (KOH) concentrations, using 127 and 183μm thick membranes, while optimizing the flow rate and concentration of the regenerant solution (H2SO4). The optimal operating eluent flow rate was determined at 5μL/min, corresponding to the optimal van-Deemter flow velocity of commercially-available column technology, i.e. a 0.4mm i.d.×250mm long column packed with 7.5μm anion-exchange particles. When equilibrated at 10mM KOH, a 99% decrease in conductivity signal could be obtained within 5min when applying 10mM H2SO4 regenerant at 75μL/min. A background signal as low as 1.2μS/cm was obtained, which equals the performance of a commercially-available electrolytic hollow-fiber suppressor. When increasing the temperature of the membrane suppressor from 15 to 20°C, ion suppression was significantly improved allowing the application of 75mM KOH. The applicability of the chip suppressor has been demonstrated with an isocratic baseline separation of a mixture of seven inorganic ions, yielding plate numbers between 5300 and 10,600 and with a gradient separation of a complex ion mixture. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Organic anion transporter (Slc22a) family members as mediators of toxicity

    International Nuclear Information System (INIS)

    Sweet, Douglas H.

    2005-01-01

    Exposure of the body to toxic organic anions is unavoidable and occurs from both intentional and unintentional sources. Many hormones, neurotransmitters, and waste products of cellular metabolism, or their metabolites, are organic anions. The same is true for a wide variety of medications, herbicides, pesticides, plant and animal toxins, and industrial chemicals and solvents. Rapid and efficient elimination of these substances is often the body's best defense for limiting both systemic exposure and the duration of their pharmacological or toxicological effects. For organic anions, active transepithelial transport across the renal proximal tubule followed by elimination via the urine is a major pathway in this detoxification process. Accordingly, a large number of organic anion transport proteins belonging to several different gene families have been identified and found to be expressed in the proximal nephron. The function of these transporters, in combination with the high volume of renal blood flow, predisposes the kidney to increased toxic susceptibility. Understanding how the kidney mediates the transport of organic anions is integral to achieving desired therapeutic outcomes in response to drug interactions and chemical exposures, to understanding the progression of some disease states, and to predicting the influence of genetic variation upon these processes. This review will focus on the organic anion transporter (OAT) family and discuss the known members, their mechanisms of action, subcellular localization, and current evidence implicating their function as a determinant of the toxicity of certain endogenous and xenobiotic agents

  13. A basic study for the boron thermal regeneration system using anion exchange resins

    International Nuclear Information System (INIS)

    Frantiesek, P.; Kotaka, Masahiro; Okamoto, Makoto; Kakihana, Hidetake.

    1979-01-01

    For the boron thermal regeneration system (BTRS), the basic characteristics of commercial anion exchange resin have been investigated on the swelling characteristics, absorption, desorption and temperature coefficient of exchange capacity for boric acid. The equilibrium capacity increases as decrease of temperature and depends strongly on the degrees of cross linking having a maximum point at about 7% of DVB. The temperature coefficient of equilibrium capacity of boric acid is also a function of the concentration of external solution and of the cross linking having a maximum point around 7% of DVB. (author)

  14. Dicty_cDB: SLC832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

  15. Evidence for F-/SiO- anion exchange in the framework of As-synthesized all-silica zeolites

    KAUST Repository

    Liu, Xiaolong

    2011-05-12

    Not everything changes: Charge-compensating anions can be exchanged in as-synthesized zeolite frameworks with changes in both the density of defect sites and of the hydrophobic character of the zeolite. The reversible transformation occurs without dissolution/recrystallization of the zeolite and preserves the size and shape of the crystals (see picture). Fluoride removal is not possible in all-silica D4R units, for which fluoride ions play a structure-directing role. © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. An Anion-Exchange Method for the Separation of P-32 Activity in Neutron-Irradiated Biological Material

    Energy Technology Data Exchange (ETDEWEB)

    Samsahl, K

    1964-06-15

    Strong hydrochloric-acid solutions containing small amounts of orthophosphoric and citric acid and radioactive tracers of the elements Na, P, K, Ca, Se, Cr, Mn, Ni, Rb, Sr, Cs, Ba, La, and Ce were titrated with a water suspension of strongly basic anion-exchange resin in the hydroxide form. The titration was carried out to pH = 3.0. It was followed by filtration of the mixture on the top of a small anion-exchange column in the chloride form and a final washing with water. Phosphorus was quantitatively adsorbed by the resin and the scandium retention was better than 96 per cent. The remaining elements passed quantitatively into the effluent, with the exception of nickel, which was adsorbed to a very small extent.

  17. An Anion-Exchange Method for the Separation of P-32 Activity in Neutron-Irradiated Biological Material

    International Nuclear Information System (INIS)

    Samsahl, K.

    1964-06-01

    Strong hydrochloric-acid solutions containing small amounts of orthophosphoric and citric acid and radioactive tracers of the elements Na, P, K, Ca, Se, Cr, Mn, Ni, Rb, Sr, Cs, Ba, La, and Ce were titrated with a water suspension of strongly basic anion-exchange resin in the hydroxide form. The titration was carried out to pH = 3.0. It was followed by filtration of the mixture on the top of a small anion-exchange column in the chloride form and a final washing with water. Phosphorus was quantitatively adsorbed by the resin and the scandium retention was better than 96 per cent. The remaining elements passed quantitatively into the effluent, with the exception of nickel, which was adsorbed to a very small extent

  18. Anion exchange removal of Al3+ from Li+-Al3+ aqueous solution (originating from lithium recovery from brine

    Directory of Open Access Journals (Sweden)

    Anissa Somrani

    2014-06-01

    Full Text Available The purpose of this study is to separate aluminum(III ion from an aqueous solution containing Li+ at 25°C. Al3+ was transferred into [Al(C2O43]3- by means of complexation and removed by an anion exchange resin. This resin was anionic type Amberlite IRA 402 regenerated by sodium chloride. Hence, a theoretical study based on speciation diagrams was carried out to determine the best pH domain for separation. The complexation of aluminum ions by ammonium oxalate was studied. The motar ratio of Ox/Al and pH was investigated. Optimum values of these factors were found to be 3 and 4 respectively. In this case, the remaining lithium is 98.5%.

  19. Influence of the type of oxidant on anion exchange properties of fibrous Cladophora cellulose/polypyrrole composites.

    Science.gov (United States)

    Razaq, Aamir; Mihranyan, Albert; Welch, Ken; Nyholm, Leif; Strømme, Maria

    2009-01-15

    The electrochemically controlled anion absorption properties of a novel large surface area composite paper material composed of polypyrrole (PPy) and cellulose derived from Cladophora sp. algae, synthesized with two oxidizing agents, iron(III) chloride and phosphomolybdic acid (PMo), were analyzed in four different electrolytes containing anions (i.e., chloride, aspartate, glutamate, and p-toluenesulfonate) of varying size.The composites were characterized with scanning and transmission electron microscopy, N2 gas adsorption,and conductivity measurements. The potential-controlled ion exchange properties of the materials were studied by cyclic voltammetry and chronoamperometry at varying potentials. The surface area and conductivity of the iron(III) chloride synthesized sample were 58.8 m2/g and 0.65 S/cm, respectively, while the corresponding values for the PMo synthesized sample were 31.3 m2/g and 0.12 S/cm. The number of absorbed ions per sample mass was found to be larger for the iron(III) chloride synthesized sample than for the PMo synthesized one in all four electrolytes. Although the largest extraction yields were obtained in the presence of the smallest anion (i.e., chloride) for both samples, the relative degree of extraction for the largest ions (i.e., glutamate and p-toluenesulfonate) was higher for the PMo sample. This clearly shows that it is possible to increase the extraction yield of large anions by carrying out the PPy polymerization in the presence of large anions. The results likewise show that high ion exchange capacities, as well as extraction and desorption rates, can be obtained for large anions with high surface area composites coated with relatively thin layers of PPy.

  20. Application of a weak base anion exchange resin for recovery of uranium at Uravan, Colorado, U.S.A

    International Nuclear Information System (INIS)

    Gardner, N.E.; Kunin, R.

    1976-01-01

    Resin ion-exchange technology has been used to recover uranium at the Uravan, Colorado plant for over 18 years; however, since the end of U.S. Atomic Energy Commission purchase of U 3 O 8 concentrate in 1970, it has become necessary to develop techniques for upgrading the product to meet the more stringent specifications of private sales. The standard gel type quaternary ammonium anion exchange resin had been used previously. The development of the tertiary amine anion exchange resin, Amberlite XE-299, led to an experimental program of laboratory and pilot plant work to evaluate the resin on actual plant solutions. General information on ion-exchange resin structure and chemistry is discussed. Summary data of specific test work on loading the resin, various elution schemes, resin regeneration and product purity from the pilot plant tests and comments on actual plant operation using Amberlite XE-299 resin are presented. (author)

  1. Sodium citrate-assisted anion exchange strategy for construction of Bi2O2CO3/BiOI photocatalysts

    International Nuclear Information System (INIS)

    Song, Peng-Yuan; Xu, Ming; Zhang, Wei-De

    2015-01-01

    Highlights: • Heterostructured Bi 2 O 2 CO 3 /BiOI microspheres were prepared via anion exchange. • Sodium citrate-assisted anion exchange for construction of composite photocatalysts. • Bi 2 O 2 CO 3 /BiOI composites show high visible light photocatalytic activity. - Abstract: Bi 2 O 2 CO 3 /BiOI heterojuncted photocatalysts were constructed through a facile partial anion exchange strategy starting from BiOI microspheres and urea with the assistance of sodium citrate. The content of Bi 2 O 2 CO 3 in the catalysts was regulated by modulating the amount of urea as a precursor, which was decomposed to generate CO 3 2− in the hydrothermal process. Citrate anion plays a key role in controlling the morphology and composition of the products. The Bi 2 O 2 CO 3 /BiOI catalysts display much higher photocatalytic activity than pure BiOI and Bi 2 O 2 CO 3 towards the degradation of rhodamine B (RhB) and bisphenol A (BPA). The enhancement of photocatalytic activity of the heterojuncted catalysts is attributed to the formation of p–n junction between p-BiOI and n-Bi 2 O 2 CO 3 , which is favorable for retarding the recombination of photoinduced electron-hole pairs. Moreover, the holes are demonstrated to be the main active species for the degradation of RhB and BPA

  2. Multi-layer membrane model for mass transport in a direct ethanol fuel cell using an alkaline anion exchange membrane

    Science.gov (United States)

    Bahrami, Hafez; Faghri, Amir

    2012-11-01

    A one-dimensional, isothermal, single-phase model is presented to investigate the mass transport in a direct ethanol fuel cell incorporating an alkaline anion exchange membrane. The electrochemistry is analytically solved and the closed-form solution is provided for two limiting cases assuming Tafel expressions for both oxygen reduction and ethanol oxidation. A multi-layer membrane model is proposed to properly account for the diffusive and electroosmotic transport of ethanol through the membrane. The fundamental differences in fuel crossover for positive and negative electroosmotic drag coefficients are discussed. It is found that ethanol crossover is significantly reduced upon using an alkaline anion exchange membrane instead of a proton exchange membrane, especially at current densities higher than 500 A m

  3. Highly conductive side chain block copolymer anion exchange membranes.

    Science.gov (United States)

    Wang, Lizhu; Hickner, Michael A

    2016-06-28

    Block copolymers based on poly(styrene) having pendent trimethyl styrenylbutyl ammonium (with four carbon ring-ionic group alkyl linkers) or benzyltrimethyl ammonium groups with a methylene bridge between the ring and ionic group were synthesized by reversible addition-fragmentation radical (RAFT) polymerization as anion exchange membranes (AEMs). The C4 side chain polymer showed a 17% increase in Cl(-) conductivity of 33.7 mS cm(-1) compared to the benzyltrimethyl ammonium sample (28.9 mS cm(-1)) under the same conditions (IEC = 3.20 meq. g(-1), hydration number, λ = ∼7.0, cast from DMF/1-propanol (v/v = 3 : 1), relative humidity = 95%). As confirmed by small angle X-ray scattering (SAXS), the side chain block copolymers with tethered ammonium cations showed well-defined lamellar morphologies and a significant reduction in interdomain spacing compared to benzyltrimethyl ammonium containing block copolymers. The chemical stabilities of the block copolymers were evaluated under severe, accelerated conditions, and degradation was observed by (1)H NMR. The block copolymer with C4 side chain trimethyl styrenylbutyl ammonium motifs displayed slightly improved stability compared to that of a benzyltrimethyl ammonium-based AEM at 80 °C in 1 M NaOD aqueous solution for 30 days.

  4. Kinetics of boron ions sorption from solution by inorganic anion exchanger of MNH type

    International Nuclear Information System (INIS)

    Leont'eva, G.V.

    1990-01-01

    By the method of restricted volume in case of boron excess in solution kinetics of boron sorption by inorganic anion-exchanger of the composition (Mg 0.55 Ni 0.45 )(OH) 2 has been studied. The sorption was carried out from solution containing Na + , K + , Ca 2+ , Mg 2+ , Cl - , SO 4 2- , CO 3 2- , HCO 3 at 283, 293, 303 and 313 K and pH 8.1, while the density of solution was 1225 kg/m 3 . The sorption mechanism was considered. It is shown that heterogeneity of the character of kinetic curves is caused by the change in the mechanism of limiting stages of the sorption

  5. Ion exchange equilibrium for some uni-univalent and uni-divalent reaction systems using strongly basic anion exchange resin Duolite A-102 D

    Directory of Open Access Journals (Sweden)

    R.S. Lokhande

    2008-04-01

    Full Text Available The study on thermodynamics of ion exchange equilibrium for uni-univalent Cl-/I-, Cl-/Br-, and uni-divalent Cl-/SO42-, Cl-/C2O42- reaction systems was carried out using ion exchange resin Duolite A-102 D. The equilibrium constant K was calculated by taking into account the activity coefficient of ions both in solution as well as in the resin phase. The K values calculated for uni-univalent and uni-divalent anion exchange reaction systems was observed to increase with rise in temperature, indicating the endothermic exchange reactions having enthalpy values of 13.7, 38.0, 23.9, 22.9 kJ/mol, respectively.

  6. Active Hydrophilic Components of the Medicinal Herb Salvia miltiorrhiza (Danshen Potently Inhibit Organic Anion Transporters 1 (Slc22a6 and 3 (Slc22a8

    Directory of Open Access Journals (Sweden)

    Li Wang

    2012-01-01

    Full Text Available Many active components of herbal products are small organic anions, and organic anion transporters were previously demonstrated to be a potential site of drug-drug interactions. In this study, we assessed the inhibitory effects of six hydrophilic components of the herbal medicine Danshen, lithospermic acid, protocatechuic acid, rosmarinic acid, salvianolic acid A, salvianolic acid B, and tanshinol, on the function of the murine organic anion transporters, mOat1 and mOat3. All of Danshen components significantly inhibited mOat1- and mOat3-mediated substrate uptake (<0.001 with lithospermic acid (LSA, protocatechuic acid, rosmarinic acid (RMA, and salvianolic acid A (SAA producing virtually complete inhibition under test conditions. Kinetic analysis demonstrated that LSA, RMA, and SAA were competitive inhibitors. As such, values were estimated as 14.9±4.9 μM for LSA, 5.5±2.2 μM for RMA, and 4.9±2.2 μM for SAA on mOat1-mediated transport, and as 31.1±7.0 μM for LSA, 4.3±0.2 μM for RMA, and 21.3±7.7 μM for SAA on mOat3-mediated transport. These data suggest that herb-drug interactions may occur in vivo on the human orthologs of these transporters in situations of polypharmacy involving Danshen and clinical therapeutics known to be organic anion transporter substrates.

  7. C(3i)-symmetric octanuclear cadmium cages: double-anion-templated synthesis, formation mechanism, and properties.

    Science.gov (United States)

    Sun, Jie; Sun, Di; Yuan, Shuai; Tian, Dongxu; Zhang, Liangliang; Wang, Xingpo; Sun, Daofeng

    2012-12-14

    A series of C(3i)-symmetric bicapped trigonal antiprismatic Cd(8) cages [2X@Cd(8)L(6)(H(2)O)(6)]⋅n Y⋅solvents (X = Cl(-), Y = NO(3)(-), n = 2: MOCC-4; X = Br(-), Y = NO(3)(-), n = 2: MOCC-5; X = NO(3)(-), Y = NO(3)(-), n = 2: MOCC-6; X = NO(3)(-), Y = BF(4)(-), n = 2: MOCC-7; X = NO(3)(-), Y = ClO(4)(-), n = 2: MOCC-8; X = CO(3)(2-), n = 0: MOCC-9), doubly anion templated by different anions, were solvothermally synthesized by means of a flexible ligand. Interestingly, the CO(3)(2-) template for MOCC-9 was generated in situ by two-step decomposition of DMF solvent. For other MOCCs, spherical or trigonal monovalent anions could also play the role of template in their formation. The template abilities of these anions in the formation of the cages were experimentally studied and are discussed for the first time. Anion exchange of MOCC-8 was carried out and showed anion-size selectivity. All of the cage-like compounds emit strong luminescence at room temperature. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Ion chromatographic determination of fluoride and chloride in UO2 using microbore anion exchange columns

    International Nuclear Information System (INIS)

    Kelkar, Anoop; Meena, D.L.; Das, D.K.; Behere, P.G.; Mohd Afzal

    2015-01-01

    Chemical characterization of nuclear fuels is required to ensure that nuclear fuel meets the technical specifications of the fuel. Trace non- metallic impurities like Cl and F is important as they affect clad corrosion. Their effect is more severe in presence of moisture. Chlorine and Fluorine is routinely analysed by ion selective electrode or conventional ion chromatography after pyrohydrolyzing the sample in moist O 2 atmosphere at 950°. Both the technique generates large quantity of liquid waste. Generally 1 ml/min flow rate required for the separation of F - and Cl - in conventional ion-chromatographic separation of F - and Cl - on 4.6- 4.0 mm id analytical column. The waste produced per sample injection is ∼ 30-40 ml with suppressed conductivity detection in ion chromatography. There is a need to reduce this analytical waste in analyzing the radioactive samples for the determination of F - and Cl - . Waste generation could be effectively reduced by using microbore anion exchange analytical column. Present paper describe the use of Metrosep A Supp 16 - 100/2.0 column with Na 2 CO 3 +NaOH mobile phase for the determination of F - and Cl - in UO 2 samples using suppressed conductivity detection

  9. Reducing elution in anion exchange chromatography as a pretreatment of colorimetry of chromium(VI) and vanadium(V)

    International Nuclear Information System (INIS)

    Shigetomi, Yasumasa; Hatamoto, Takeji; Nagoshi, Kimie; Yamashige, Takashi.

    1976-01-01

    In order to increase the selectivity of the colorimetry of chromium and vanadium, the separation by means of anion exchange chromatography was tested. The column, phi 0.8x5.0 cm packing (50--100 mesh) Dowex 1x4 anion exchange resin was used for the separation of chromium. The solution containing chromium (VI), zinc(II), cadmium(II), iron(III) and reducing organic substances contained in industrial waste water was introduced into the column and then the substances other than chromium(VI) were removed by washing the column with distilled water. Finally chromium(VI) was reduced to chromium(III) by hydroxylamine in the eluent and eluted. The concentration of sulfuric acid and hydroxylamine in the eluent were 0.1 mol/l and 0.001 mol/l respectively. For analyzing chromium(III) in the mixture of chromium(VI) and chromium(III), after removal of chromium(VI) it should be oxidized to chromium(VI) anion with the oxidant, e.g., sodium peroxide or hydrogen peroxide, before introducing it into the column. In terms of the pretreatment by using the acetate form resin column, chromium (VI) and chromium(III) can be determined separately in the solution whose concentration ranges from 0.05 ppm to 0.5 ppm despite the presence of contaminants, which interfere with the colorimetric determination of chromium(VI) using diphenylcarbonohydrazide, in the original solution. The separation of vanadium(V) in the solution containing copper(II), cobalt(II) and etc. was made using the mixed solution of hydrochloric acid (2 mol/l) and hydroxylamine (0.2 mol/l) similarly to chromium(VI). In terms of the similar pretreatment vanadium could be determined precisely as far as 0.1 ppm by the colorimetry using 4-(2-pyridylazo) resorcinol despite the presence of copper(II), cobalt(II), nickel(II) and etc in the original solution. (auth.)

  10. Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

    Directory of Open Access Journals (Sweden)

    Lindholm Carlström Eva

    2012-05-01

    Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

  11. Separation of human milk oligosaccharides using high-performance anion-exchange chromatography with pulsed amperometric detection

    DEFF Research Database (Denmark)

    Lie, Aleksander; Pedersen, Lars Haastrup

    individual mothers is considerable, ranging from as few as 23 and up to 130 different oligosaccharides. HMOs are known as beneficial for infant health and development, and have received increasing attention in recent years (Bode & Jantscher-Krenn 2012). High-performance anion-exchange chromatography (HPAE......) with pulsed amperometric detection (PAD) is an analysis method highly suited for carbohydrates. HPAE with alkaline eluents results in retention of neutral carbohydrates depending on the number of charged groups in the molecule, pH and concentration of competing anions, while PAD has sensitivity...

  12. Evaluation of ferrocyanide anion exchange resins regarding the uptake of Cs+ ions and their regeneration

    International Nuclear Information System (INIS)

    Won, Hui Jun; Mooon, Jei Kwon; Jung, Chong Hun; Chung, Won Yang

    2008-01-01

    Ferrocyanide-anion exchange resin was prepared and the prepared ion exchange resins were tested on the ability to uptake Cs + ion. The prepared ion exchange resins were resin-KCoFC, resin-KNiFC, and resin-KCuFC. The three tested ion exchange resins showed ion exchange selectivity on the Cs + ion of the surrogate soil decontamination solution, and resin- KCoFC showed the best Cs + ion uptake capability among the tested ion exchange resins. The ion exchange behaviors were explained well by the modified Dubinin-Polanyi equation. A regeneration feasibility study of the spent ion exchange resins was also performed by the successive application of hydrogen peroxide and hydrazine. The desorption of the Cs + ion from the ion exchange resin satisfied the electroneutrality condition in the oxidation step; the desorption of the Fe 2+ ion in the reduction step could also be reduced by adding the K + ion

  13. Preparation of anionic clay–birnessite manganese oxide composites by interlayer oxidation of oxalate ions by permanganate

    International Nuclear Information System (INIS)

    Arulraj, James; Rajamathi, Michael

    2013-01-01

    Oxalate intercalated anionic clay-like nickel zinc hydroxysalt was obtained starting from nickel zinc hydroxyacetate, Ni 3 Zn 2 (OH) 8 (OAc) 2 ·2H 2 O, by anion exchange. The intercalated oxalate species was reacted with potassium permanganate in such a way that the layered manganese oxide formed was within the interlayer region of the anionic clay resulting in a layered composite in which the negative charges on the birnessite type manganese oxide layers compensate the positive charges on the anionic clay layers. Birnessite to anionic clay ratio could be varied by varying the reaction time or the amount of potassium permanganate used. - Graphical abstract: Nickel zinc hydroxyoxalate was reacted with potassium permanganate to get nickel zinc hydroxide birnessite composites in which the positive charges on the hydroxide layers are neutralized by the negative charges on birnessite layers. Highlights: ► Anionic and cationic layered solid composites prepared. ► Ni–Zn hydroxyoxalate reacted with KMnO 4 to deposit MnO 2 in the interlayer. ► Birnessite layers coexist with anionic clay layers in the composites. ► Birnessite/anionic clay ratio controlled by amount of KMnO 4 used and reaction time

  14. Adsorption and intercalation of anionic surfactants onto layered ...

    Indian Academy of Sciences (India)

    Layered double hydroxides (LDH) with brucite like structure was modified with various anionic surfactants containing sulfonate, carboxyl, phosphonate and sulfate end group through ion-exchange method. XRD reports indicated that the sulfonate group containing surfactants led to an adsorption process whereas the sulfate ...

  15. Synthesis and anion exchange properties of a Zn/Ni double hydroxide salt with a guarinoite structure

    Science.gov (United States)

    Delorme, F.; Seron, A.; Licheron, M.; Veron, E.; Giovannelli, F.; Beny, C.; Jean-Prost, V.; Martineau, D.

    2009-09-01

    In this study, the first route to synthesize a compound with the guarinoite structure (Zn,Co,Ni) 6(SO 4)(OH,Cl) 10·5H 2O is reported. Zn/Ni guarinoite is obtained from the reaction of NiSO 4·7H 2O with solid ZnO in aqueous solution. The resulting green Zn/Ni guarinoite ((Zn 3.52Ni 1.63)(SO 4) 1.33(OH 7.64)·4.67H 2O) was characterized by X-ray diffraction, infrared spectrometry, UV-Visible spectrometry and thermal analysis. It is shown that its structure is similar to the one described for the layered Zn sulfate hydroxide hydrate, i.e. brucite layers with {1}/{4} empty octahedra presenting tetrahedrally coordinated divalent atoms above and below the empty octahedra. Ni atoms are located in the octahedra and zinc atoms in tetrahedra and octahedra. In this structure the exchangeable anions are located at the apex of tetrahedra. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) observations show that the Zn/Ni guarinoite is composed of aggregates of hexagonal plates of several hundreds of nanometers. Due to its interest for industrial or environmental applications, the exchange of sulfate groups by carbonates has been investigated. Results show a limited exchange and a higher affinity of the Zn/Ni guarinoite for sulfates compared to carbonates.

  16. Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

  17. Separation of 99Tc from low level radioactive liquid waste using anion exchange resin

    International Nuclear Information System (INIS)

    Sonar, N.L.; Mittal, V.K.; Dhara, Amrita; Thakur, D.A.; Valsala, T.P.; Vishwaraj, I.

    2016-01-01

    Technetium-99 is one of the fission products with very high yield (∼6%) in thermal neutron induced fission of 235 U. 99 Tc exists as pertechnate ( 99 TcO 4 ) ion in reprocessing streams. The high solubility in water and high mobility of pertechnate ions, coupled with very high half life of 99 Tc (t1/2 = 2 × 105 y, âmax = 290 KeV) makes it a potential candidate for long term hazard to the environment. Major radionuclides present in the intermediate level waste (ILW) generated at reprocessing plant is conventionally treated by ion exchange method for removal of 137 Cs. The Low level effluent waste (LLW) from the IX column contains 99 Tc as a major isotope. Though the concentration of 99 Tc in the waste is in ppm level, the presence of molar level of competing nitrates makes its separation very difficult. Many efforts have been reported on selective separation of 99 Tc from various waste streams. In this paper, separation of 99 Tc from ion exchange column effluent waste stream using selected commercially available anion exchange resins has been detailed

  18. High Br- Content CsPb(Cl yBr1- y)3 Perovskite Nanocrystals with Strong Mn2+ Emission through Diverse Cation/Anion Exchange Engineering.

    Science.gov (United States)

    Li, Fei; Xia, Zhiguo; Pan, Caofeng; Gong, Yue; Gu, Lin; Liu, Quanlin; Zhang, Jin Z

    2018-04-11

    The unification of tunable band edge (BE) emission and strong Mn 2+ doping luminescence in all-inorganic cesium lead halide perovskite nanocrystals (NCs) CsPbX 3 (X = Cl and Br) is of fundamental importance in fine tuning their optical properties. Herein, we demonstrate that benefiting from the differentiation of the cation/anion exchange rate, ZnBr 2 and preformed CsPb 1- x Cl 3 : xMn 2+ NCs can be used to obtain high Br - content Cs(Pb 1- x- z Zn z )(Cl y Br 1- y ) 3 : xMn 2+ perovskite NCs with strong Mn 2+ emission, and the Mn 2+ substitution ratio can reach about 22%. More specifically, the fast anion exchange could be realized by the soluble halide precursors, leading to anion exchange within a few seconds as observed from the strong BE emission evolution, whereas the cation exchange instead generally required at least a few hours; moreover, their exchange mechanism and dynamics process have been evaluated. The Mn 2+ emission intensity could be further varied by controlling the replacement of Mn 2+ by Zn 2+ with prolonged ion exchange reaction time. White light emission of the doped perovskite NCs via this cation/anion synergistic exchange strategy has been realized, which was also successfully demonstrated in a prototype white light-emitting diode (LED) device based on a commercially available 365 nm LED chip.

  19. Evidence for F-/SiO- anion exchange in the framework of As-synthesized all-silica zeolites

    KAUST Repository

    Liu, Xiaolong; Ravon, Ugo; Tuel, Alain

    2011-01-01

    Not everything changes: Charge-compensating anions can be exchanged in as-synthesized zeolite frameworks with changes in both the density of defect sites and of the hydrophobic character of the zeolite. The reversible transformation occurs without

  20. Pathogenic substitution of IVS15 + 5G > A in SLC26A4 in patients of Okinawa Islands with enlarged vestibular aqueduct syndrome or Pendred syndrome.

    Science.gov (United States)

    Ganaha, Akira; Kaname, Tadashi; Yanagi, Kumiko; Naritomi, Kenji; Tono, Tetsuya; Usami, Shin-ichi; Suzuki, Mikio

    2013-05-24

    Pendred syndrome (PS) and nonsyndromic hearing loss associated with enlarged vestibular aqueduct (EVA) are caused by SLC26A4 mutations. The Okinawa Islands are the southwestern-most islands of the Japanese archipelago. And ancestral differences have been reported between people from Okinawa Island and those from the main islands of Japan. To confirm the ethnic variation of the spectrum of SLC26A4 mutations, we investigated the frequencies of SLC26A4 mutations and clinical manifestations of patients with EVA or PS living in the Okinawa Islands. We examined 22 patients with EVA or PS from 21 unrelated families in Okinawa Islands. The patient's clinical history, findings of physical and otoscopic examinations, hearing test, and computed tomography (CT) scan of the temporal bones were recorded. To detect mutations, all 21 exons and the exon-intron junctions of SLC26A4 were sequenced for all subjects. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for SLC26A4 and calculations using the comparative CT (2(-ΔΔCT)) method were used to determine the pathogenicity associated with gene substitutions. SLC26A4 mutations were identified in 21 of the 22 patients. We found a compound heterozygous mutation for IVS15 + 5G > A/H723R in nine patients (41%), a homozygous substitution of IVS15 + 5G > A in six patients (27%), and homozygous mutation for H723R in five patients (23%). The most prevalent types of SLC26A4 alleles were IVS15 + 5G > A and H723R, which both accounted for 15/22 (68%) of the patients. There were no significant correlations between the types of SLC26A4 mutation and clinical manifestations. Based on qRT-PCR results, expression of SLC26A4 was not identified in patients with the homozygous substitution of IVS15 + 5G > A. The substitution of IVS15 + 5G > A in SLC26A4 was the most common mutation in uniquely found in patients with PS and EVA in Okinawa Islands. This suggested that the spectrum of SLC26A4 mutation differed

  1. Studies concerning the anion ex-change resins catalyzed esterification of epichlorohydrin with organic acids

    Directory of Open Access Journals (Sweden)

    E.I. Muresan

    2009-09-01

    Full Text Available The paper studies the esterification of carboxylic acids with epichlorohydrin over two macroporous strong base anion exchange resins with different polymer matrix. For both resins, the influence of reaction parameters (temperature, catalyst loading, molar ratio on the reaction rate and the yields of the two isomeric esters were investigated.

  2. Characterization and anion exchange removal of uranium from Hanford ground water

    International Nuclear Information System (INIS)

    Delegard, C.H.; Weiss, R.L.; Kimura, R.T.; Law, A.G.; Routson, R.C.

    1986-01-01

    In February 1985, uranium concentrations increased abruptly to 0.1 kgU/m/sup 3/ in ground waters underlying a retired liquid waste disposal facility in the United States Department of Energy-Richland Operations Hanford Site. Characterization tests showed the uranium was present as an anionic carbonate complex not sorbable by Hanford sediments. The uranium was mobilized by flow from a perched zone of water caused by recent nearby cooling water disposal above an impermeable sediment layer. In a unique demonstration of the concept of ''as low as reasonably achievable,'' efforts were immediately undertaken to minimize the spread of the plume and to reduce the amount of uranium in the ground water. An anion exchange-based uranium removal process flowsheet was rapidly developed and implemented. Operational for six months, the process has treated over 30,000 m/sup 3/ of ground water and collected 94% of the uranium while producing a treated effluent that meets criteria for discharge to the soil column

  3. Hydrogen-deuterium exchange of the anionic group 6B transition-metal hydrides. Convenient, in-situ-deuterium transfer reagents

    International Nuclear Information System (INIS)

    Gaus, P.L.; Kao, S.C.; Darensbourg, M.Y.; Arndt, L.W.

    1984-01-01

    The facile exchange of hydrogen for detuerium in the anionic group 6B carbonyl hydrides HM(CO) 4 L - (M = Cr, W; L = CO P(OMe) 3 ) has been studied in THF 4 (tetrahydrofuran) with CH 3 OD, D 2 O, and CH 3 CO 2 D. This has provided a synthesis of the deuterides, DM(CO) 4 L - , as well as a convenient in situ source of deuteride reducing reagents for organic halides. A number of such reductions are described, using 2 H NMR to demonstrate both selectivity and stereospecificity for certain systems. The carbonyl region of the infrared spectra of the hydrides is not affected by deuteration of the hydrides, suggesting that the M-H or M-D vibrational modes are not coupled significantly to CO vibrations in these hydrides. The mechanism of the H/D exchange and of a related H 2 elimination reaction is discussed

  4. An investigation of the sorption/desorption of organics from natural waters by solid adsorbents and anion exchangers

    International Nuclear Information System (INIS)

    Larin, B.M.; Sedlov, A.S.

    2006-01-01

    The results of laboratory and operational tests at thermal and nuclear power stations on anion exchangers and solid adsorbents of makeup water treatment plants with regard to the sorption/desorption of organic substances in natural water and condensate are presented. The resins Amberlite trademark IRA-67, IRA-900, IRA-958Cl, Purolite registered 2 A-500P, Dowex TM3 Marathon, and others were tested. Retention of up to 60-80% of the ''organic'' material on the anion exchangers and organic absorbers installed at different places in the technological scheme of the water processing unit was attained. The possibility of a partial ''poisoning'' of the resins and the degradation of the working characteristics over the first year of operation are discussed. (orig.)

  5. Mimicking the cell membrane: bio-inspired simultaneous functions with monovalent anion selectivity and antifouling properties of anion exchange membrane

    Science.gov (United States)

    Zhao, Yan; Liu, Huimin; Tang, Kaini; Jin, Yali; Pan, Jiefeng; der Bruggen, Bart Van; Shen, Jiangnan; Gao, Congjie

    2016-01-01

    A new bio-inspired method was applied in this study to simultaneously improve the monovalent anion selectivity and antifouling properties of anion exchange membranes (AEMs). Three-layer architecture was developed by deposition of polydopamine (PDA) and electro-deposition of N-O-sulfonic acid benzyl chitosan (NSBC). The innermost and outermost layers were PDA with different deposition time. The middle layer was prepared by NSBC. Fourier transform infrared spectroscopy and scanning electron microscopy confirmed that PDA and NSBC were successfully modified on the surfaces of AEMs. The contact angle of the membranes indicated an improved hydrophilicity of the modified membranes. A series of electrodialysis experiments in which Cl−/SO42− separation was studied, demonstrating the monovalent anion selectivity of the samples. The Cl−/SO42− permselectivity of the modified membranes can reach up to 2.20, higher than that of the commercial membrane (only 0.78) during 90 minutes in electrodialysis (ED). The increase value of the resistance of the membranes was also measured to evaluate the antifouling properties. Sodium dodecyl benzene sulfonate (SDBS) was used as the fouling material in the ED process and the membrane area resistance of modified membrane increase value of was only 0.08 Ωcm2 30 minutes later. PMID:27853255

  6. Mimicking the cell membrane: bio-inspired simultaneous functions with monovalent anion selectivity and antifouling properties of anion exchange membrane

    Science.gov (United States)

    Zhao, Yan; Liu, Huimin; Tang, Kaini; Jin, Yali; Pan, Jiefeng; der Bruggen, Bart Van; Shen, Jiangnan; Gao, Congjie

    2016-11-01

    A new bio-inspired method was applied in this study to simultaneously improve the monovalent anion selectivity and antifouling properties of anion exchange membranes (AEMs). Three-layer architecture was developed by deposition of polydopamine (PDA) and electro-deposition of N-O-sulfonic acid benzyl chitosan (NSBC). The innermost and outermost layers were PDA with different deposition time. The middle layer was prepared by NSBC. Fourier transform infrared spectroscopy and scanning electron microscopy confirmed that PDA and NSBC were successfully modified on the surfaces of AEMs. The contact angle of the membranes indicated an improved hydrophilicity of the modified membranes. A series of electrodialysis experiments in which Cl-/SO42- separation was studied, demonstrating the monovalent anion selectivity of the samples. The Cl-/SO42- permselectivity of the modified membranes can reach up to 2.20, higher than that of the commercial membrane (only 0.78) during 90 minutes in electrodialysis (ED). The increase value of the resistance of the membranes was also measured to evaluate the antifouling properties. Sodium dodecyl benzene sulfonate (SDBS) was used as the fouling material in the ED process and the membrane area resistance of modified membrane increase value of was only 0.08 Ωcm2 30 minutes later.

  7. Purification of bacteriophage M13 by anion exchange chromatography.

    Science.gov (United States)

    Monjezi, Razieh; Tey, Beng Ti; Sieo, Chin Chin; Tan, Wen Siang

    2010-07-01

    M13 is a non-lytic filamentous bacteriophage (phage). It has been used widely in phage display technology for displaying foreign peptides, and also for studying macromolecule structures and interactions. Traditionally, this phage has been purified by cesium chloride (CsCl) density gradient ultracentrifugation which is highly laborious and time consuming. In the present study, a simple, rapid and efficient method for the purification of M13 based on anion exchange chromatography was established. A pre-packed SepFast Super Q column connected to a fast protein liquid chromatography (FPLC) system was employed to capture released phages in clarified Escherichia coli fermented broth. An average yield of 74% was obtained from a packed bed mode elution using citrate buffer (pH 4), containing 1.5 M NaCl at 1 ml/min flow rate. The purification process was shortened substantially to less than 2 h from 18 h in the conventional ultracentrifugation method. SDS-PAGE revealed that the purity of particles was comparable to that of CsCl gradient density ultracentrifugation method. Plaque forming assay showed that the purified phages were still infectious. Copyright 2010 Elsevier B.V. All rights reserved.

  8. The next generation fuel cells: anion exchange membrane fuel cells (AEMFC)

    International Nuclear Information System (INIS)

    Tauqir, A.; Zahoor, S.

    2013-01-01

    Many environmentally friendly alternatives (solar, wind, hydroelectric, and geothermal power) can only be used in particular environments. In contrast, fuel cells can have near-zero emissions, are quiet and efficient, and can work in any environment where the temperature is lower than the cell's operating temperature. Among various types of fuel cells, the AEMFC is the most recent one and has advantages such as excellent performance compared to other candidate fuel cells due to its active O/sub 2/ electrode kinetics and flexibility to use a wide range of electro-catalysts such as silver and nickels contrary to expensive one (Platinum) required for proton exchange membrane fuel cell (PEMFC). Anion exchange membrane (AEM) is a crucial part in AEMFC, determining durability and electrochemical performances of membrane electrode assembly (MEA). The role of an AEM is to conduct hydroxyl ions from cathode to anode. If this conduction is not sufficiently high and selective, the corresponding fuel cell will not find any practical application. One of the major problems associated with AEMFC is much lower conductivities of anion compare to proton conductivity in PEMFCs, even upon similar working condition. Thus AEMs is only practical, if it is chemically and mechanically stable against severe basic operation conditions and highly hydroxyl ions conductive. The conventional AEMs based on animated aliphatic and aromatic hydrocarbon or even fluorinated polymers tend to be attacked by hydroxyl ions, causing the degradation during operation is strongly basic conditions. (author)

  9. Flat beams in the SLC

    International Nuclear Information System (INIS)

    Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.

    1993-01-01

    The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC

  10. Electron exchange reaction in anion exchangers as observed in uranium isotope separation

    International Nuclear Information System (INIS)

    Obanawa, Heiichiro; Takeda, Kunihiko; Seko, Maomi

    1991-01-01

    The mechanism of electron exchange in an ion exchanger, as occurring between U 4+ and UO 2 2+ in uranium isotope separation, was investigated. The height of the separation unit (H q ) in the presence of metal ion catalysts, as obtained from the separation experiments, was found to be almost coincident with the theoretical value of H q as calculated on the basis of the intrasolution acceleration mechanism of the metal ion, suggesting that the electron exchange mechanism in the ion-exchanger is essentially the same as that in the solution when metal ion catalysts are present. Separation experiments with no metal ion catalyst, on the other hand, showed the electron exchange reaction in the ion exchanger to be substantially higher than that in the solution, suggesting an acceleration of the electron exchange reaction by the ion-exchanger which is due to the close existence of higher order Cl - complexes of UO 2 2+ and U 4+ in the vicinity of the ion-exchange group. (author)

  11. Optimized anion exchange column isolation of zirconium-89 (89Zr) from yttrium cyclotron target: Method development and implementation on an automated fluidic platform.

    Science.gov (United States)

    O'Hara, Matthew J; Murray, Nathaniel J; Carter, Jennifer C; Morrison, Samuel S

    2018-04-13

    Zirconium-89 ( 89 Zr), produced by the (p, n) reaction from naturally monoisotopic yttrium ( nat Y), is a promising positron emitting isotope for immunoPET imaging. Its long half-life of 78.4 h is sufficient for evaluating slow physiological processes. A prototype automated fluidic system, coupled to on-line and in-line detectors, has been constructed to facilitate development of new 89 Zr purification methodologies. The highly reproducible reagent delivery platform and near-real time monitoring of column effluents allows for efficient method optimization. The separation of Zr from dissolved Y metal targets was evaluated using several anion exchange resins. Each resin was evaluated against its ability to quantitatively capture Zr from a load solution high in dissolved Y. The most appropriate anion exchange resin for this application was identified, and the separation method was optimized. The method is capable of a high Y decontamination factor (>10 5 ) and has been shown to remove Fe, an abundant contaminant in Y foils, from the 89 Zr elution fraction. Finally, the method was evaluated using cyclotron bombarded Y foil targets; the method was shown to achieve >95% recovery of the 89 Zr present in the foils. The anion exchange column method described here is intended to be the first 89 Zr isolation stage in a dual-column purification process. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Formation of hydrotalcite in aqueous solutions and intercalation of ATP by anion exchange.

    Science.gov (United States)

    Tamura, Hiroki; Chiba, Jun; Ito, Masahiro; Takeda, Takashi; Kikkawa, Shinichi; Mawatari, Yasuteru; Tabata, Masayoshi

    2006-08-15

    The formation reaction and the intercalation of adenosine triphosphate (ATP) were studied for hydrotalcite (HT), a layered double hydroxide (LDH) of magnesium and aluminum. Hydrotalcite with nitrate ions in the interlayer (HT-NO(3)) was formed (A) by dropwise addition of a solution of magnesium and aluminum nitrates (pH ca. 3) to a sodium hydroxide solution (pH ca. 14) until the pH decreased from 14 to 10 and (B) by dropwise addition of the NaOH solution to the solution of magnesium and aluminum nitrates with pH increasing from 3 to 10. The precipitate obtained with method B was contaminated with aluminum hydroxide and the crystallinity of the product was low, possibly because aluminum hydroxide precipitates at pH 4 or 5 and remains even after HT-NO(3) forms at pH above 8. With method A, however, the precipitate was pure HT-NO(3) with increased crystallinity, since the solubility of aluminum hydroxide at pH above and around 10 is high as dissolved aluminate anions are stable in this high pH region, and there was no aluminum hydroxide contamination. The formed HT-NO(3) had a composition of [Mg(0.71)Al(0.29)(OH)(2)](NO(3))(0.29).0.58H(2)O. To intercalate ATP anions into the HT-NO(3), HT-NO(3) was dispersed in an ATP solution at pH 7. It was found that the interlayer nitrate ions were completely exchanged with ATP anions by ion exchange, and the interlayer distance expanded almost twice with a free space distance of 1.2 nm. The composition of HT-ATP was established as [Mg(0.68)Al(0.32)(OH)(2)](ATP)(0.080)0.88H(2)O. The increased distance could be explained with a calculated molecular configuration of the ATP as follows: An ATP molecule is bound to an interlayer surface with the triphosphate group, the adenosine group bends owing to its bond angles and projects into the interlayer to a height of 1 nm, and the adenosine groups aligned in the interlayer support the interlayer distance.

  13. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  14. Anion-exchange enrichment and spectrophotometric determination of uranium in sea-water

    International Nuclear Information System (INIS)

    Kuroda, Rokuro; Oguma, Koichi; Mukai, Noriko; Iwamoto, Masatoshi

    1987-01-01

    A method is proposed for the determination of uranium in sea-water. The uranium is strongly sorbed on a strongly basic anion-exchange resin (Cl - form) from acidified sea-water containing sodium azide (0.3M) and is easily eluted with 1M hydrochloric acid. Uranium in the effluent can be determined spectrophotometrically with Arsenazo III. The combined method allows easy and selective determination of uranium in sea-water without using a sophisticated adsorbent. The overall recovery and precision are satisfactory at the 3 μg/1. level. (author)

  15. Removing uranium from drinking water by metal hydroxides and anion-exchange resin

    International Nuclear Information System (INIS)

    Lee, S.Y.; Bondietti, E.A.

    1983-01-01

    Results of bench-scale testing on uranium removal from a natural water that was chosen as a good representative of uranium-bearing waters indicated that conventional coagulant and lime softening treatment removes more than 85 percent of dissolved uranium (83 μg U/L) when an optimum pH and dosage were provided. A strong base anion-exchange column is a recommended option for the treatment of private well waters containing uranium at higher than desirable levels

  16. Separation of plutonium on the anion exchanger BIO-RAD 1-X2 and its application to radiochemical analysis

    International Nuclear Information System (INIS)

    Bajo, S.; Gann, C.; Eikenberg, J.; Wyer, L.; Beer, H.; Ruethi, M.; Jaeggi, M.; Zumsteg, I.

    2007-12-01

    The element Pu (Z = 94) is a member of the actinide series of the elements (Z = 89 -103). The actinides have similar chemical properties and are also similar to the lanthanides (Z = 57 -71). Sixteen isotopes of Pu have been synthesized, all of which are radioactive. The Pu present in the environment originates from the atmospheric nuclear tests from 1950 to 1963, which produced the so-called 'global fallout'. As a result, 6.5 · 10 15 Bq 239 Pu (2.8 tons), 4.4 · 10 15 Bq 240 Pu (0.52 tons), and 3.7 · 10 4 Bq 241 Pu (0.04 tons) were dispersed over the world. A contribution also to the global fallout was the ignition of the satellite SWAP 9A in the atmosphere in 1964, equipped with a battery powered by 6.3 · 10 14 Bq (1 kg) of 238 Pu. In addition to these sources, nuclear reactors, reprocessing plants and radioactive waste facilities may contribute with their emissions to increase locally the Pu concentration in their environment. In the PSI laboratory, we are confronted with the determination of traces of 238 Pu, 239 Pu and 240 Pu in environmental and biological materials. Because of the low quantity of Pu in the analyzed samples, which is usually below 100 mBq, it is mandatory to separate the Pu from all other accompanying elements. The separated Pu is then measured by alpha spectrometry. In this work, the anion exchanger BIO-RAD AG 1 is extensively used for the separation of Pu from different matrices. This exchanger is superior when only Pu is determined in the sample. In addition, it is also very suitable when other actinides, such as Am and Cm, are also determined. No preconcentration step is necessary for the Pu separation. The resins introduced by the company Eichrom Industries in the 90's, which allow the separation of the actinides from the major environmental elements and from each other, requires relatively small volumes of sample solution. This report describes the extensive utilization of the classical anion exchanger BIO-RAD 1-X2 in 8 molar nitric

  17. AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits-dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  18. AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.

    Directory of Open Access Journals (Sweden)

    Rachel Bachner-Melman

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits--dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  19. Effect of pore structure on the removal of clofibric acid by magnetic anion exchange resin.

    Science.gov (United States)

    Tan, Liang; Shuang, Chendong; Wang, Yunshu; Wang, Jun; Su, Yihong; Li, Aimin

    2018-01-01

    The effect of pore structure of resin on clofibric acid (CA) adsorption behavior was investigated by using magnetic anion exchange resins (ND-1, ND-2, ND-3) with increasing pore diameter by 11.68, 15.37, 24.94 nm. Resin with larger pores showed faster adsorption rates and a higher adsorption capacity because the more opened tunnels provided by larger pores benefit the CA diffusion into the resin matrix. The ion exchange by the electrostatic interactions between Cl-type resin and CA resulted in chloride releasing to the solution, and the ratio of released chloride to CA adsorption amount decreased from 0.90 to 0.65 for ND-1, ND-2 and ND-3, indicating that non-electrostatic interactions obtain a larger proportional part of the adsorption into the pores. Co-existing inorganic anions and organic acids reduced the CA adsorption amounts by the competition effect of electrostatic interaction, whereas resins with more opened pore structures weakened the negative influence on CA adsorption because of the existence of non-electrostatic interactions. 85.2% and 65.1% adsorption amounts decrease are calculated for resin ND-1 and ND-3 by the negative influence of 1 mmol L -1 NaCl. This weaken effect of organic acid is generally depends on its hydrophobicity (Log Kow) for carboxylic acid and its ionization degree (pKb) for sulfonic acid. The resins could be reused with the slightly decreases by 1.9%, 3.2% and 5.4% after 7 cycles of regeneration, respectively for ND-1, ND-2 and ND-3, suggesting the ion exchange resin with larger pores are against its reuse by the brine solution regeneration. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. The mechanism of ion exchange on ammonium 12-molybdophosphate (AMP)

    International Nuclear Information System (INIS)

    Boeyens, J.C.A.; McDougall, G.J.; Smit, J. van R.

    1987-01-01

    This paper reviews some published and unpublished data on the ion-exchange properties of AMP. The three NH 4 + ions are only partially exchanged for large monovalent ions. In the case of NH 4 + /K + exchange, the energy lost by the breaking of H bonds between the NH 4 + ions and anionic cage oxygen atoms beyond the point of maximum exchange is no longer compensated for by bond strengthening in the anion due to contraction of the cage. With Rb + , Cs + and T1 + , limited convertibility results from the lattice expansion required to accommodate these larger ions. During exchange, part of the cations pass through the anionic cages, thereby causing considerable lattice disorder. The maximum exchange capacity of AMP for the alkali metal ions is not a simple function of cation radius. (author)

  1. Ab initio theoretical study of dipole-bound anions of molecular complexes: (HF)3- and (HF)4- anions

    Science.gov (United States)

    Ramaekers, Riet; Smith, Dayle M. A.; Smets, Johan; Adamowicz, Ludwik

    1997-12-01

    Ab initio calculations have been performed to determine structures and vertical electron detachment energy (VDE) of the hydrogen fluoride trimer and tetramer anions, (HF)3- and (HF)4-. In these systems the excess electron is bound by the dipole field of the complex. It was determined that, unlike the neutral complexes which prefer the cyclic structures, the equilibrium geometries of the anions have "zig-zag" shapes. For both complexes the predicted VDEs are positive [210 meV and 363 meV for (HF)3- and (HF)4-, respectively], indicating that the anions are stable systems with respect to the vertical electron detachment. These results were obtained at the coupled-cluster level of theory with single, double and triple excitations [CCSD(T) method; the triple-excitation contribution in this method is calculated approximately using the perturbation approach] with the anion geometries obtained using the second-order Møller-Plesset perturbation theory (MP2) method. The same approach was also used to determine the adiabatic electron affinities (AEA) of (HF)3 and (HF)4. In addition to the electronic contribution, we also calculated the contributions (using the harmonic approximation) resulting from different zero-point vibration energies of the neutral and anionic clusters. The calculations predicted that while the AEA of (HF)3 is positive (44 meV), the AEA for (HF)4 is marginally negative (-16 meV). This suggests that the (HF)3- anion should be a stable system, while the (HF)4- is probably metastable.

  2. Behavior of cationic, anionic and colloidal species of titanium, zirconium and thorium in presence of ion exchange resins

    International Nuclear Information System (INIS)

    Souza Filho, G. de; Abrao, A.

    1976-01-01

    The distribution of titanium, zirconium and thorium is aqueous and resin phases has been studied using strong cationic resin in the R-NH 4 form. Solutions of the above elements in perchloric, nitric, hydrochloric and suphuric media were used. Each set of experiments was made by separately varying one of the five parameters - type of anion present, acidity of solution, temperature of percolation, age of solution and concentration of the element. It was found that, depending on the particular balance of these parameters, the elements investigated may be found in acidic solutions either as cationic, anionic or colloidal species. It is emphasized that the colloidal species of titanium, zirconium or thorium are not retained by the ion exchangers, and from this property a method for the separation and purification of the above elements has been outlined [pt

  3. Radio-iodide uptake by modified poly (glycidyl methacrylate) as anion exchange resin

    Energy Technology Data Exchange (ETDEWEB)

    Othman, Sameh H. [Atomic Energy Authority, Cairo (Egypt). Nuclear Research Center; Atomic Energy Authority, Cairo (Egypt). Second Research Reactor; Elbarbary, Ahmed M. [Atomic Energy Authority, Cairo (Egypt). Radiation Research of Polymer Chemistry Dept.; Rashad, Ghada; Fasih, T.W. [Atomic Energy Authority, Cairo (Egypt). Hot Laboratories Center

    2017-03-01

    Poly(glycidyl methacrylate) (PGMA) microspheres were prepared by radiation induced polymerization of glycidyl methacrylate (GMA) monomer. The factors affecting the degree of polymerization and yield (%) of PGMA such as type of solvent, monomer concentration, and irradiation dose were investigated. It was found that the PGMA yield (%) increases with increasing monomer concentration up to 50% and absorbed dose of 5 kGy. The resulting PGMA containing the epoxy group was chemically modified by hydroxyl amine to act as anion-exchange resin for uptake of {sup 131}I{sup -} ions. The modified PGMA (MPGMA) was characterized by Fourier transform infrared (FT-IR) spectrophotometer, thermal gravimetric analysis (TGA) and scanning electron microscopy (SEM). I-131 is produced from the fission of U-235 with low-enrichment uranium (LEU) targets in the Egyptian Second Research Reactor (ETRR-2). Separation of iodide from the radioactive solution by batchwise and column techniques was employed to determine the adsorption capacity of the MPGMA. Quality control of {sup 131}I product solution and radiochemical purity was examined by using the ascending paper chromatography method. The uptake behavior of MPGMA towards {sup 131}I{sup -} ions were studied at different experimental conditions and achieved by X-ray fluorescence (XRF). The synthesized MPGMA showed good results as anion-exchange and an effective adsorbent for uptaking {sup 131}I{sup -} ions.

  4. Structural and microstructural changes during anion exchange of CoAl layered double hydroxides: an in situ X-ray powder diffraction study

    DEFF Research Database (Denmark)

    Johnsen, Rune; Krumeich, Frank; Norby, Poul

    2010-01-01

    Anion-exchange processes in cobalt-aluminium layered double hydroxides (LDHs) were studied by in situ synchrotron X-ray powder diffraction (XRPD). The processes investigated were CoAl-CO3 CoAl-Cl CoAl-CO3, CoAl-Cl CoAl-NO3 and CoAl-CO3 CoAl-SO4. The XRPD data show that the CoAl-CO3 CoAl-Cl process...

  5. Determination of traces of silver in waters by anion exchange and atomic absorption spectrophotometry

    Science.gov (United States)

    Chao, T.T.; Fishman, M. J.; Ball, J.W.

    1969-01-01

    A method has been developed for the accurate determination of 0.1-1 ??g of silver per liter of water. The method permits stabilization of silver in water without loss to container walls. Optimum conditions have been established for the complete recovery of silver from water with an anion-exchange column, for quantitative elution of silver from the resin, and for measurement of silver by atomic absorption spectrophotometry after chelation with ammonium pyrrolidine dithiocarbamate and extraction of the chelate with MIBK. Silver in the 1-10 ??g 1 range can be determined by extraction without pre-concentration on an ion-exchange resin. ?? 1969.

  6. Preparation of anionic clay-birnessite manganese oxide composites by interlayer oxidation of oxalate ions by permanganate

    Energy Technology Data Exchange (ETDEWEB)

    Arulraj, James [Materials Research Group, Department of Chemistry, St. Joseph' s College, 36 Langford Road, Bangalore 560 027 (India); Rajamathi, Michael, E-mail: mikerajamathi@rediffmail.com [Materials Research Group, Department of Chemistry, St. Joseph' s College, 36 Langford Road, Bangalore 560 027 (India)

    2013-02-15

    Oxalate intercalated anionic clay-like nickel zinc hydroxysalt was obtained starting from nickel zinc hydroxyacetate, Ni{sub 3}Zn{sub 2}(OH){sub 8}(OAc){sub 2}{center_dot}2H{sub 2}O, by anion exchange. The intercalated oxalate species was reacted with potassium permanganate in such a way that the layered manganese oxide formed was within the interlayer region of the anionic clay resulting in a layered composite in which the negative charges on the birnessite type manganese oxide layers compensate the positive charges on the anionic clay layers. Birnessite to anionic clay ratio could be varied by varying the reaction time or the amount of potassium permanganate used. - Graphical abstract: Nickel zinc hydroxyoxalate was reacted with potassium permanganate to get nickel zinc hydroxide birnessite composites in which the positive charges on the hydroxide layers are neutralized by the negative charges on birnessite layers. Highlights: Black-Right-Pointing-Pointer Anionic and cationic layered solid composites prepared. Black-Right-Pointing-Pointer Ni-Zn hydroxyoxalate reacted with KMnO{sub 4} to deposit MnO{sub 2} in the interlayer. Black-Right-Pointing-Pointer Birnessite layers coexist with anionic clay layers in the composites. Black-Right-Pointing-Pointer Birnessite/anionic clay ratio controlled by amount of KMnO{sub 4} used and reaction time.

  7. Fixing of metallic acetates on an anion-exchange resin; Fixation d'acetates metalliques dans une resine echangeuse d'anions

    Energy Technology Data Exchange (ETDEWEB)

    Brigaudeau-Vaissiere, M [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etude Nucleaires

    1966-06-01

    After giving a brief review of the theoretical principles governing the fixation of anionic complexes of metallic elements on an anion exchange resin, we consider the particular case of uranyl acetate. By plotting the partition curves we have been able to calculate the exchange constants in the resin. By studying the changes in the logarithm of the limiting partition coefficient as a function of the logarithm of the free acetate ion concentration, it has been possible to calculate the dissociation constants for the complexes in solution. The fixation of a large number of metallic acetates has been studied. All the tests have been negative except in the case of mercury. For this reason we have been able to consider the possibility of separating uranium from a certain number of elements. Some of these separations are possible even in the presence of interfering anions such as chlorides which have a greater affinity for the resin than have the acetate ions. In the case of water-ethanol and water-isopropanol mixtures, we have improved the conditions under which copper acetate and mercury acetate may be fixed. This study has enabled us to calculate the dissociation constant for the CuAc{sub 3}{sup -} complex in the mixtures water +40% (by weight) isopropanol and water +50% (by weight) isopropanol. It should also make it possible to use separation conditions which could not hitherto be applied in aqueous media. (author) [French] Apres avoir rappele les principes theoriques de la fixation des complexes anioniques des elements metalliques dans une resine echangeuse d'anions, nous avons etudie tout particulierement le cas de l'acetate d'uranyle. Le trace des courbes de partage nous a permis de calculer les constantes d'echange dans la resine. L'etude des variations du logarithme du coefficient limite de partage avec le logarithme de la concentration des ions acetate libres nous a conduits aux calculs des constantes de dissociation des complexes en solution. La fixation d

  8. Separation of rare earth elements in monazite sand by anion exchange resin (pt. II)

    International Nuclear Information System (INIS)

    Cha, K.W.; Lee, J.H.; Yoon, S.H.; Ha, Y.G.

    1980-01-01

    An anion exchange method for separating Y, La, Ce, Pr, and Nd element in monazaites and into enriched fractions has been developed. The complexed rare earth ions with EDTA at pH 8.4 passed through the resin column of the various size and eluted with 0.0301 M EDTA as eluent at flow rate of 1 ml/min and 2 ml/min. The result of separation is good in the high column length rather than the low on using the resin of the same amount and the volume of eluent required in eluting all the rare earths at 2 ml/min flow rare is larger than that at 1 ml/min and the result of separation obtained here is unsatisfactory. (author)

  9. Perchlorate adsorption and desorption on activated carbon and anion exchange resin.

    Science.gov (United States)

    Yoon, In-Ho; Meng, Xiaoguang; Wang, Chao; Kim, Kyoung-Woong; Bang, Sunbaek; Choe, Eunyoung; Lippincott, Lee

    2009-05-15

    The mechanisms of perchlorate adsorption on activated carbon (AC) and anion exchange resin (SR-7 resin) were investigated using Raman, FTIR, and zeta potential analyses. Batch adsorption and desorption results demonstrated that the adsorption of perchlorate by AC and SR-7 resin was reversible. The reversibility of perchlorate adsorption by the resin was also proved by column regeneration test. Solution pH significantly affected perchlorate adsorption and the zeta potential of AC, while it did not influence perchlorate adsorption and the zeta potential of resin. Zeta potential measurements showed that perchlorate was adsorbed on the negatively charged AC surface. Raman spectra indicated the adsorption resulted in an obvious position shift of the perchlorate peak, suggesting that perchlorate was associated with functional groups on AC at neutral pH through interactions stronger than electrostatic interaction. The adsorbed perchlorate on the resin exhibited a Raman peak at similar position as the aqueous perchlorate, indicating that perchlorate was adsorbed on the resin through electrostatic attraction between the anion and positively charged surface sites.

  10. Evaluation of ferrocyanide anion exchange resins regarding the uptake of Cs{sup +} ions and their regeneration

    Energy Technology Data Exchange (ETDEWEB)

    Won, Hui Jun; Mooon, Jei Kwon; Jung, Chong Hun [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Chung, Won Yang [Kangwon University, Chuncheon (Korea, Republic of)

    2008-10-15

    Ferrocyanide-anion exchange resin was prepared and the prepared ion exchange resins were tested on the ability to uptake Cs{sup +} ion. The prepared ion exchange resins were resin-KCoFC, resin-KNiFC, and resin-KCuFC. The three tested ion exchange resins showed ion exchange selectivity on the Cs{sup +} ion of the surrogate soil decontamination solution, and resin- KCoFC showed the best Cs{sup +} ion uptake capability among the tested ion exchange resins. The ion exchange behaviors were explained well by the modified Dubinin-Polanyi equation. A regeneration feasibility study of the spent ion exchange resins was also performed by the successive application of hydrogen peroxide and hydrazine. The desorption of the Cs{sup +} ion from the ion exchange resin satisfied the electroneutrality condition in the oxidation step; the desorption of the Fe{sup 2+} ion in the reduction step could also be reduced by adding the K{sup +} ion.

  11. Mouse Models for Pendrin-Associated Loss of Cochlear and Vestibular Function

    Directory of Open Access Journals (Sweden)

    Philine Wangemann

    2013-12-01

    Full Text Available The human gene SLC26A4 and the mouse ortholog Slc26a4 code for the protein pendrin, which is an anion exchanger expressed in apical membranes of selected epithelia. In the inner ear, pendrin is expressed in the cochlea, the vestibular labyrinth and the endolymphatic sac. Loss-of-function and hypo-functional mutations cause an enlargement of the vestibular aqueduct (EVA and sensorineural hearing loss. The relatively high prevalence of SLC26A4 mutations provides a strong imperative to develop rational interventions that delay, ameliorate or prevent pendrin-associated loss of cochlear and vestibular function. This review summarizes recent studies in mouse models that have been developed to delineate the role of pendrin in the physiology of hearing and balance and that have brought forward the concept that a temporally and spatially limited therapy may be sufficient to secure a life-time of normal hearing in children bearing mutations of SLC26A4.

  12. Behavior of copper (II )and uranium ( VI) in precipitation chromatography in the system anion exchange resin - hexacyanoferrate (II )

    International Nuclear Information System (INIS)

    Seneda, Jose Antonio

    1997-01-01

    In this work it is shown the efficiency of precipitation chromatography for separation and concentration of metallic elements by using a strong anionic-exchange resin saturated with hexacyanoferrate (II). Metallic cations, like Cu (II) and U (VI), are retained from highly diluted solutions and enriched into the resin, in the form of the correspondent insoluble hexacyanoferrate (II), precipitated inside the resin, which permitted the visual observation of a chromatographic zone on the top of the column. It will be discussed the conditions of sorption and elution of the cations uptake by the resin. This system permits the enrichment of the above mentioned cations onto the resin and offers the possibility of interesting separations as well. (author)

  13. Ectopic expression of the erythrocyte band 3 anion exchange protein, using a new avian retrovirus vector

    DEFF Research Database (Denmark)

    Fuerstenberg, S; Beug, H; Introna, M

    1990-01-01

    into protein. Using the Escherichia coli beta-galactosidase gene cloned into the vector as a test construct, expression of enzyme activity could be detected in 90 to 95% of transfected target cells and in 80 to 85% of subsequently infected cells. In addition, a cDNA encoding the avian erythrocyte band 3 anion...... exchange protein has been expressed from the vector in both chicken embryo fibroblasts and QT6 cells and appears to function as an active, plasma membrane-based anion transporter. The ectopic expression of band 3 protein provides a visual marker for vector function in these cells....

  14. A colorimetric tetrathiafulvalene-calix 4 pyrrole anion sensor

    DEFF Research Database (Denmark)

    Nielsen, K. A.

    2012-01-01

    The interaction and colorimetric sensing properties of a tetrathiafulvalene substituted calix[4]pyrrole sensor with anions were investigated using H-1 NMR and absorption spectroscopic techniques. Visual color changes were observed upon addition of different anions (Cl-, Br-, CN-, and Ac......O-) to a solution of the sensor. (C) 2012 Elsevier Ltd. All rights reserved....

  15. Effects of Cationic Pendant Groups on Ionic Conductivity for Anion Exchange Membranes: Structure Conductivity Relationships

    Science.gov (United States)

    Kim, Sojeong; Choi, Soo-Hyung; Lee, Won Bo

    Anion exchange membranes(AEMs) have been widely studied due to their various applications, especially for Fuel cells. Previous proton exchange membranes(PEMs), such as Nafions® have better conductivity than AEMs so far. However, technical limitations such as slow electrode kinetics, carbon monoxide (CO) poisoning of metal catalysts, high methanol crossover and high cost of Pt-based catalyst detered further usages. AEMs have advantages to supplement its drawbacks. AEMs are environmentally friendly and cost-efficient. Based on the well-defined block copolymer, self-assembled morphology is expected to have some relationship with its ionic conductivity. Recently AEMs based on various cations, including ammonium, phosphonium, guanidinium, imidazolium, metal cation, and benzimidazolium cations have been developed and extensively studied with the aim to prepare high- performance AEMs. But more fundamental approach, such as relationships between nanostructure and conductivity is needed. We use well-defined block copolymer Poly(styrene-block-isoprene) as a backbone which is synthesized by anionic polymerization. Then we graft various cationic functional groups and analysis the relation between morphology and conductivity. Theoretical and computational soft matter lab.

  16. Use of Anion Exchange Resins for One-Step Processing of Algae from Harvest to Biofuel

    Directory of Open Access Journals (Sweden)

    Martin Poenie

    2012-07-01

    Full Text Available Some microalgae are particularly attractive as a renewable feedstock for biodiesel production due to their rapid growth, high content of triacylglycerols, and ability to be grown on non-arable land. Unfortunately, obtaining oil from algae is currently cost prohibitive in part due to the need to pump and process large volumes of dilute algal suspensions. In an effort to circumvent this problem, we have explored the use of anion exchange resins for simplifying the processing of algae to biofuel. Anion exchange resins can bind and accumulate the algal cells out of suspension to form a dewatered concentrate. Treatment of the resin-bound algae with sulfuric acid/methanol elutes the algae and regenerates the resin while converting algal lipids to biodiesel. Hydrophobic polymers can remove biodiesel from the sulfuric acid/methanol, allowing the transesterification reagent to be reused. We show that in situ transesterification of algal lipids can efficiently convert algal lipids to fatty acid methyl esters while allowing the resin and transesterification reagent to be recycled numerous times without loss of effectiveness.

  17. Separation of plutonium on the anion exchanger BIO-RAD 1-X2 and its application to radiochemical analysis

    Energy Technology Data Exchange (ETDEWEB)

    Bajo, S.; Gann, C.; Eikenberg, J.; Wyer, L.; Beer, H.; Ruethi, M.; Jaeggi, M.; Zumsteg, I

    2007-12-15

    The element Pu (Z = 94) is a member of the actinide series of the elements (Z = 89 -103). The actinides have similar chemical properties and are also similar to the lanthanides (Z = 57 -71). Sixteen isotopes of Pu have been synthesized, all of which are radioactive. The Pu present in the environment originates from the atmospheric nuclear tests from 1950 to 1963, which produced the so-called 'global fallout'. As a result, 6.5 {center_dot} 10{sup 15} Bq {sup 239}Pu (2.8 tons), 4.4 {center_dot} 10{sup 15} Bq {sup 240}Pu (0.52 tons), and 3.7 {center_dot} 10{sup 4} Bq {sup 241}Pu (0.04 tons) were dispersed over the world. A contribution also to the global fallout was the ignition of the satellite SWAP 9A in the atmosphere in 1964, equipped with a battery powered by 6.3 {center_dot} 10{sup 14} Bq (1 kg) of {sup 238}Pu. In addition to these sources, nuclear reactors, reprocessing plants and radioactive waste facilities may contribute with their emissions to increase locally the Pu concentration in their environment. In the PSI laboratory, we are confronted with the determination of traces of {sup 238}Pu, {sup 239}Pu and {sup 240}Pu in environmental and biological materials. Because of the low quantity of Pu in the analyzed samples, which is usually below 100 mBq, it is mandatory to separate the Pu from all other accompanying elements. The separated Pu is then measured by alpha spectrometry. In this work, the anion exchanger BIO-RAD AG 1 is extensively used for the separation of Pu from different matrices. This exchanger is superior when only Pu is determined in the sample. In addition, it is also very suitable when other actinides, such as Am and Cm, are also determined. No preconcentration step is necessary for the Pu separation. The resins introduced by the company Eichrom Industries in the 90's, which allow the separation of the actinides from the major environmental elements and from each other, requires relatively small volumes of sample solution

  18. New magnetic organic-inorganic composites based on hydrotalcite-like anionic clays for drug delivery

    Energy Technology Data Exchange (ETDEWEB)

    Carja, Gabriela [Department of Physical Chemistry, Faculty of Industrial Chemistry, Technical University of Iasi, 71 Mangeron Boulevard, 700050 Iasi (Romania); Chiriac, Horia [National Institute of Research and Development for Technical Physics, 47 Mangeron Boulevard, 700050 Iasi (Romania)]. E-mail: hchiriac@phys-iasi.ro; Lupu, Nicoleta [National Institute of Research and Development for Technical Physics, 47 Mangeron Boulevard, 700050 Iasi (Romania)

    2007-04-15

    The structural 'memory effect' of anionic clays was used to obtain layered double hydroxides (LDHs) with tailored magnetic properties, by loading iron oxides and/or spinel structures on iron partially substituted hydrotalcite-like materials. The obtained magnetic layered structures were further used as precursors for new hybrid nanostructures, such as aspirin-hydrotalcite-like anionic clays. Transmission electron microscopy (TEM) analysis shows that small iron oxide or spinel nanoparticles coexist with the fibrous drug particles on the surface of partially aggregated typical clay-like particles. The specific saturation magnetization of the loaded LDHs can be increased up to 70 emu/g by using specific post-synthesis treatments.

  19. New magnetic organic-inorganic composites based on hydrotalcite-like anionic clays for drug delivery

    International Nuclear Information System (INIS)

    Carja, Gabriela; Chiriac, Horia; Lupu, Nicoleta

    2007-01-01

    The structural 'memory effect' of anionic clays was used to obtain layered double hydroxides (LDHs) with tailored magnetic properties, by loading iron oxides and/or spinel structures on iron partially substituted hydrotalcite-like materials. The obtained magnetic layered structures were further used as precursors for new hybrid nanostructures, such as aspirin-hydrotalcite-like anionic clays. Transmission electron microscopy (TEM) analysis shows that small iron oxide or spinel nanoparticles coexist with the fibrous drug particles on the surface of partially aggregated typical clay-like particles. The specific saturation magnetization of the loaded LDHs can be increased up to 70 emu/g by using specific post-synthesis treatments

  20. Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

    Directory of Open Access Journals (Sweden)

    Mignon Laurence

    2010-02-01

    Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

  1. Copper Selenidophosphates Cu4P2Se6, Cu4P3Se4, Cu4P4Se3, and CuP2Se, Featuring Zero-, One-, and Two-Dimensional Anions.

    Science.gov (United States)

    Kuhn, Alexander; Schoop, Leslie M; Eger, Roland; Moudrakovski, Igor; Schwarzmüller, Stefan; Duppel, Viola; Kremer, Reinhard K; Oeckler, Oliver; Lotsch, Bettina V

    2016-08-15

    Five new compounds in the Cu/P/Se phase diagram have been synthesized, and their crystal structures have been determined. The crystal structures of these compounds comprise four previously unreported zero-, one-, and two-dimensional selenidophosphate anions containing low-valent phosphorus. In addition to two new modifications of Cu4P2Se6 featuring the well-known hexaselenidohypodiphosphate(IV) ion, there are three copper selenidophosphates with low-valent P: Cu4P3Se4 contains two different new anions, (i) a monomeric (zero-dimensional) selenidophosphate anion [P2Se4](4-) and (ii) a one-dimensional selenidophosphate anion [Formula: see text], which is related to the well-known gray-Se-like [Formula: see text] Zintl anion. Cu4P4Se3 contains one-dimensional [Formula: see text] polyanions, whereas CuP2Se contains the 2D selenidophosphate [Formula: see text] polyanion. It consists of charge-neutral CuP2Se layers separated by a van der Waals gap which is very rare for a Zintl-type phase. Hence, besides black P, CuP2Se constitutes a new possible source of 2D oxidized phosphorus containing layers for intercalation or exfoliation experiments. Additionally, the electronic structures and some fundamental physical properties of the new compounds are reported. All compounds are semiconducting with indirect band gaps of the orders of around 1 eV. The phases reported here add to the structural diversity of chalcogenido phosphates. The structural variety of this family of compounds may translate into a variety of tunable physical properties.

  2. Anion-exchange and anthracene-encapsulation within copper(II) and manganese(II)-triazole metal-organic confined space in a single crystal-to-single crystal transformation fashion.

    Science.gov (United States)

    Liu, Ju-Yan; Wang, Qian; Zhang, Li-Jun; Yuan, Bin; Xu, Yao-Yao; Zhang, Xin; Zhao, Cong-Ying; Wang, Dan; Yuan, Yue; Wang, Ying; Ding, Bin; Zhao, Xiao-Jun; Yue, Min Min

    2014-06-16

    A new multidentate ligand 1-(9-(1H-1,2,4-triazol-1-yl)anthracen-10-yl)-1H-1,2,4-triazole (tatrz) was designed and synthesized. Using tatrz as a building block, three novel coordination frameworks, namely, {[Cu(tatrz)2(NO3)2]·(CH3OH)·4H2O}n (1), {[Cu(tatrz)2(H2O)2](BF4)2}n (2), and [Mn(tatrz)2(SCN)2(CH3OH)]·2H2O (3) can be isolated. Anion-exchange experiment indicates that NO3(-) anions in the two-dimensional (2D) copper framework of 1 can be completely exchanged by ClO4(-) in an irreversible single crystal-to-single crystal (SC-SC) transformation fashion, as evidenced by the anion-exchange products of {[Cu(tatrz)2(H2O)2](ClO4)2·4CH3OH} (1a). Further, if 1a was employed as a precursor in N,N-dimethylformamide (DMF), an isomorphic solvate of {[Cu(tatrz)2(DMF)2](ClO4)2·2H2O}n (1b) can be generated during the reversible dynamic transformation process. When 1 was immersed in CH3OH, a distinct 2D layer {[Cu(tatrz)2(NO3)2]·4.4CH3OH·0.6H2O}n (1c) was isolated. Interestingly, the solvent-exchange conversion is also invertible between 1 and 1c, which exhibits spongelike dynamic behavior with retention of crystalline integrity. If the 2-fold interpenetrating three-dimensional (3D) framework 2 is selected, it can be transformed into another 2-fold interpenetrating 3D framework {[Cu(tatrz)2(H2O)2](ClO4)2·5.56H2O}n (2a) in a reversible SC-SC transformation fashion. However, when the light yellow crystals of mononuclear complex 3 were exposed to trichloromethane containing aromatic organic anthracene (atan), through our careful observation, the crystals of 3 were dissolved and reassembled into dark brown crystals of 2D crystalline coordination framework {[Mn(tatrz)2(SCN)2]·(atan)}n (3a). X-ray diffraction revealed that in 3a, atan acting as an organic template was encapsulated in the confined space of the 2D grid. Luminescent measurements illustrate that 3a is the first report of multidimensional polymers based on triazole derivatives as luminescent probes of Mg(2+).

  3. Method of solidifying radioactive ion exchange resin

    International Nuclear Information System (INIS)

    Minami, Yuji; Tomita, Toshihide

    1989-01-01

    Spent anion exchange resin formed in nuclear power plants, etc. generally catch only a portion of anions in view of the ion exchange resins capacity and most of the anions are sent while possessing activities to radioactive waste processing systems. Then, the anion exchange resins increase the specific gravity by the capture of the anions. Accordingly, anions are caused to be captured on the anion exchange resin wastes such that the specific gravity of the anion exchange resin wastes is greater than that of the thermosetting resins to be mixed. This enables satisfactory mixing with the thermosetting resins and, in addition, enables to form integral solidification products in which anion exchange resins and cation exchange resins are not locallized separately and which are homogenous and free from cracks. (T.M.)

  4. Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy

    Directory of Open Access Journals (Sweden)

    Yangzom D. Bhutia

    2017-02-01

    Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy

  5. Unprecedented connection mode of [V{sub 16}Sb{sub 4}O{sub 42}(H{sub 2}O)]{sup 8-} cluster anions by Mn{sup 2+} centered complexes. Solvothermal synthesis and properties of {[Mn(teta)]_4V_1_6Sb_4O_4_2(H_2O)}{sub n}.[(H{sub 2}O){sub 12}]{sub n}

    Energy Technology Data Exchange (ETDEWEB)

    Rasmussen, Maren; Naether, Christian; Bensch, Wolfgang [Institute of Inorganic Chemistry, Christian-Albrechts-University of Kiel (Germany); Leusen, Jan van; Koegerler, Paul [Institute of Inorganic Chemistry, RWTH Aachen University, Aachen (Germany)

    2017-11-17

    The new compound {[Mn(teta)]_4V_1_6Sb_4O_4_2}{sub n}.[(H{sub 2}O){sub 12}]{sub n} (teta = triethylenetetraamine) was synthesized under solvothermal conditions. The crystal structure features the high nuclearity [V{sub 16}{sup IV}Sb{sub 4}{sup III}O{sub 42}(H{sub 2}O)]{sup 8-} cluster anion, which consists of two rings composed of 8 edge-sharing VO{sub 5} polyhedra. The rings are perpendicular to each other generating four niches, which are occupied by two VO{sub 5} pyramids and two handle-like Sb{sub 2}O{sub 5} units. The two unique anions are each surrounded by eight Mn{sup 2+} centered complexes via Mn-O{sub term}-V bonds. Such an expansion has never been observed in heterometal polyoxovanadate chemistry. The connection mode between cluster anions and complex cations generates two individual layers stacked onto each other. Between the layers weak Sb..O contacts are observed. The crystal water molecules are mainly located in the empty space between the layers. Upon heating H{sub 2}O molecules are removed, while the crystal structure remains intact. The magnetic behavior is dominated by strong antiferromagnetic exchange interactions between the central V{sup 4+} ions, while the interaction between the cluster anion and central Mn{sup 2+} ions is significantly less pronounced. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  6. Synthesis, characterization and metal adsorption properties of the new ion exchanger polymer 3-n-propyl(4-methylpyridinium) silsesquioxane chloride.

    Science.gov (United States)

    Magosso, H A; Panteleimonov, A V; Kholin, Y V; Gushikem, Y

    2006-11-01

    The preparation and anion exchange properties of 3-n-propyl(4-methylpyridinium) silsesquioxane chloride polymer are described. This new polymer was prepared by the sol-gel processing method and is designated as SiPic+Cl-. It is insoluble in water and showed an anion exchange capacity of 1.46x10(-3) mol g-1. The adsorption isotherms of ZnCl2, CdCl2 and HgCl2 were determined from aqueous solutions and the adsorption equilibria simulations fit the model of fixed bidentate centers with the absence of lateral interactions and energetic heterogeneity between them. The metal ions diffuse into the solid solution interface and are dominantly present as MCl2-(4) species for Zn(II), MCl(2-)4 and MCl-3 species for Cd(II) and MCl-3 species for Hg(II).

  7. Synthesis of Isotactic-block-Syndiotactic Poly(methyl Methacrylate via Stereospecific Living Anionic Polymerizations in Combination with Metal-Halogen Exchange, Halogenation, and Click Reactions

    Directory of Open Access Journals (Sweden)

    Naoya Usuki

    2017-12-01

    Full Text Available Isotactic (it- and syndiotactic (st- poly(methyl methacrylates (PMMAs form unique crystalline stereocomplexes, which are attractive from both fundamental and application viewpoints. This study is directed at the efficient synthesis of it- and st-stereoblock (it-b-st- PMMAs via stereospecific living anionic polymerizations in combination with metal-halogen exchange, halogenation, and click reactions. The azide-capped it-PMMA was prepared by living anionic polymerization of MMA, which was initiated with t-BuMgBr in toluene at –78 °C, and was followed by termination using CCl4 as the halogenating agent in the presence of a strong Lewis base and subsequent azidation with NaN3. The alkyne-capped st-PMMA was obtained by living anionic polymerization of MMA, which was initiated via an in situ metal-halogen exchange reaction between 1,1-diphenylhexyl lithium and an α-bromoester bearing a pendent silyl-protected alkyne group. Finally, copper-catalyzed alkyne-azide cycloaddition (CuAAC between these complimentary pairs of polymers resulted in a high yield of it-b-st-PMMAs, with controlled molecular weights and narrow molecular weight distributions. The stereocomplexation was evaluated in CH3CN and was affected by the block lengths and ratios.

  8. Boron isotope separation by ion exchange chromatography using weakly basic anion exchange resin

    International Nuclear Information System (INIS)

    Sakuma, Yoichi; Aida, Masao; Okamoto, Makoto; Kakihana, Hidetake

    1980-01-01

    Isotopic plateau displacement chromatography, a useful method for isotope separation is presented. The boric acid band formed in a column of weakly basic anion exchange resin Diaion WA21 can be eluted with pure water. In order to obtain good accumulation of the isotope effect, a series of experiments with different migration length were carried out. The boron-10 enriched part of the boric acid absorbed band was always preceded by the isotopic plateau part, in which the atomic fraction of boron-10 was maintained at its original value. The atomic fraction of boron-10 at the end of the chromatogram increased with migration length, and in the case of 256-m migration, boron-10 was enriched from its original atomic fraction of 19.84 to 91.00%, the separation factor S being constant irrespective of migration length: S = 1.0100 +- 0.0005. (author)

  9. Ion-exchange equilibrium of Fe3+-Cl- and UO22+-Cl- systems in a porous anion exchanger

    International Nuclear Information System (INIS)

    Takeda, Kunihiko; Kawakami, Fumiaki; Sasaki, Mitsunaga

    1985-01-01

    The ion-exchange equilibrium behavior of complex ions was investigatided in the systems of UO 2 2+ - Cl - and Fe 3+ - Cl - using an anion exchanger. It was performed by examining the dependency of adsorption distribution and selectivity of complexes on the micro structure of ion-exchangers, and temperature-dependency of selectivity. Changes in micropore structure of the ion-exchanger were found to have a significant effect on selectivity; the coefficient of selectivity and the average valence of the adsorbed species increased as the discrete pore ratio used as the index for pore structure decreased. In this study, equilibrium reactions were regarded as a sort of addition reaction for a easier analysis. This analysis based on the concept of addition chemical potential suggested that decreases in the discrete pore ratio were advantageous for the adsorption of complex ion species with higher valence, and average valence of the adsorbed species within the exchanger was shifted to the higher side. For this reason, it is assumed that the coefficient of selectivity became larger with a decrease in the discrete pore ratio. There is also a marked change in the coefficient of selectivity with temperature, and this becomes greater the higher the temperature. The ΔH of the present system accompanying the complex forming reaction is estimated to be 7 to 8 kcal/mol, and this value suggests that the temperature effect of the complex forming reaction contributes greatly to the change in selectivity with temperature. (author)

  10. Potential for food-drug interactions by dietary phenolic acids on human organic anion transporters 1 (SLC22A6), 3 (SLC22A8), and 4 (SLC22A11).

    Science.gov (United States)

    Wang, Li; Sweet, Douglas H

    2012-10-15

    Phenolic acids exert beneficial health effects such as anti-oxidant, anti-carcinogenic, and anti-inflammatory activities and show systemic exposure after consumption of common fruits, vegetables, and beverages. However, knowledge regarding which components convey therapeutic benefits and the mechanism(s) by which they cross cell membranes is extremely limited. Therefore, we determined the inhibitory effects of nine food-derived phenolic acids, p-coumaric acid, ferulic acid, gallic acid, gentisic acid, 4-hydroxybenzoic acid, protocatechuic acid, sinapinic acid, syringic acid, and vanillic acid, on human organic anion transporter 1 (hOAT1), hOAT3, and hOAT4. In the present study, inhibition of OAT-mediated transport of prototypical substrates (1 μM) by phenolic acids (100 μM) was examined in stably expressing cell lines. All compounds significantly inhibited hOAT3 transport, while just ferulic, gallic, protocatechuic, sinapinic, and vanillic acid significantly blocked hOAT1 activity. Only sinapinic acid inhibited hOAT4 (~35%). For compounds exhibiting inhibition > ~60%, known clinical plasma concentration levels and plasma protein binding in humans were examined to select compounds to evaluate further with dose-response curves (IC(50) values) and drug-drug interaction (DDI) index determinations. IC(50) values ranged from 1.24 to 18.08 μM for hOAT1 and from 7.35 to 87.36 μM for hOAT3. Maximum DDI indices for gallic and gentisic acid (≫0.1) indicated a very strong potential for DDIs on hOAT1 and/or hOAT3. This study indicates that gallic acid from foods or supplements, or gentisic acid from salicylate-based drug metabolism, may significantly alter the pharmacokinetics (efficacy and toxicity) of concomitant therapeutics that are hOAT1 and/or hOAT3 substrates. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Selective separation of uranium using alizarin red S (ARS)-modified anion-exchange resin or by flotation of U-ARS chelate

    International Nuclear Information System (INIS)

    Khalifa, M.E.

    1998-01-01

    An alizarin red S (ARS)-modified anion exchange resin was prepared by a simple reaction of ARS with the anion exchange Doulite A101 and used for the efficient sorption of uranium from aqueous media. The effect of various parameters on the sorption of U(VI) (pH effect, sorption kinetics, resin capacity and breakthrough curves) was investigated. The modified resin sorbs U(VI) over a wide range of pH (2.8--5) with a maximum sorption capacity of 0.68 mmol/g at pH 3.2 to 4.0. Iron(III), Zr(IV), Ti(IV), Cu(II), and Th(IV) ions are also sorbed to different extents, but Be(II), Bi(III), Ca(II), Mg(II), Pb(II), Hg(II), Zn(II), Cd(II), Al(III), Mn(II), Co(II) and Ni(II) are not sorbed; thus, conditions for separating U(VI) from these metal ions have been identified. For eluting U(VI) from the resin, 0.2 mol/L HCl was used and the recovery recorded was as high as 99.9%. The use of ARS is extended to float uranium quantitatively and selectively from aqueous media at pH ∼ 4 by using oleic acid as a surfactant. The different parameters affecting the flotation process have also been investigated. Uranium(VI) has been effectively separated from natural water samples and certified uranium ores using both procedures

  12. Colloidal Nanocrystals of Lead-Free Double-Perovskite (Elpasolite) Semiconductors: Synthesis and Anion Exchange To Access New Materials.

    Science.gov (United States)

    Creutz, Sidney E; Crites, Evan N; De Siena, Michael C; Gamelin, Daniel R

    2018-02-14

    Concerns about the toxicity and instability of lead-halide perovskites have driven a recent surge in research toward alternative lead-free perovskite materials, including lead-free double perovskites with the elpasolite structure and visible bandgaps. Synthetic approaches to this class of materials remain limited, however, and no examples of heterometallic elpasolites as nanomaterials have been reported. Here, we report the synthesis and characterization of colloidal nanocrystals of Cs 2 AgBiX 6 (X = Cl, Br) elpasolites using a hot-injection approach. We further show that postsynthetic modification through anion exchange and cation extraction can be used to convert these nanocrystals to new materials including Cs 2 AgBiI 6 , which was previously unknown experimentally. Nanocrystals of Cs 2 AgBiI 6 , synthesized via a novel anion-exchange protocol using trimethylsilyl iodide, have strong absorption throughout the visible region, confirming theoretical predictions that this material could be a promising photovoltaic absorber. The synthetic methodologies presented here are expected to be broadly generalizable. This work demonstrates that nanocrystal ion-exchange reactivity can be used to discover and develop new lead-free halide perovskite materials that may be difficult or impossible to access through direct synthesis.

  13. Activation of lysosomal P2X4 by ATP transported into lysosomes via VNUT/SLC17A9 using V‐ATPase generated voltage gradient as the driving force

    Science.gov (United States)

    Zhong, Xi Zoë; Cao, Qi; Sun, Xue

    2016-01-01

    Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609

  14. Rifampicin Induces Bicarbonate-Rich Choleresis in Rats: Involvement of Anion Exchanger 2.

    Science.gov (United States)

    Wang, Wei; Ren, Xiaofei; Cai, Yi; Chen, Lihong; Zhang, Weiping; Xu, Jianming

    2016-01-01

    Previous studies have shown that rifampicin induced choleresis, the mechanisms of which have not been described. The aim of this study was to investigate the mechanisms underlying in vivo rifampicin-induced choleresis. In one experimental set, rats were treated chronically with rifampicin on days 1, 3 and 7. Serum and biliary parameters were assayed, and mRNA and protein levels, as well as the locations of the hepatic export transporters were analyzed by real-time PCR, western blot and immunofluorescence. Ductular mass was evaluated immunohistochemically. In another experimental set, rats received an acute infusion of rifampicin. The amount of rifampicin in bile was detected using HPLC. Biliary parameters were monitored following intrabiliary retrograde fluxes of the Cl(-)/HCO3 (-) exchange inhibitor 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS) or 5-nitro-2-(3-phenylpropylamino)benzoic acid (NPPB) in the infused rats. Biliary bicarbonate output increased in parallel to the augmented bile flow in response to rifampicin, and this effect was abolished with intrabiliary administration of DIDS, but not NPPB. The biliary secretion of rifampicin with increases in bile flow and biliary rifampicin in response to different infused doses of the antibiotic show no significant correlations. After rifampicin treatment, the expression level of anion exchanger 2 (AE2) increased, while the location of hepatic transporters did not change. However, RIF treatment did not increase ductular mass significantly. These results indicate that the increase in bile flow induced by rifampicin is mainly due to increased HCO3 (-) excretion mediated by increased AE2 protein expression and activity.

  15. Catalytic hydrodechlorination of triclosan using a new class of anion-exchange-resin supported palladium catalysts.

    Science.gov (United States)

    Han, Bing; Liu, Wen; Li, Jingwen; Wang, Jin; Zhao, Dongye; Xu, Rui; Lin, Zhang

    2017-09-01

    We prepared a new class of anion-exchange-resin supported Pd catalysts for efficient hydrodechlorination of triclosan in water. The catalysts were prepared through an initial ion-exchange uptake of PdCl 4 2- and subsequent reduction of Pd(II) to Pd(0) nanoparticles at ambient temperature. Two standard strong-base anion exchange resins (IRA-900 and IRA-958) with different matrices (polystyrene and polyacrylic) were chosen as the supports. SEM and TEM images showed that Pd(0) nanoparticles were evenly attached on the resin surface with a mean size of 3-5 nm. The resin supported Pd catalysts (Pd@IRA-900 and Pd@IRA-958) were able to facilitate rapid and complete hydrodechlorination of triclosan. At a Pd loading of 2.0 wt.%, the observed pseudo first-order rate constant (k obs ) was 1.25 ± 0.06 and 1.6 ± 0.1 L/g/min for Pd@IRA-900 and Pd@IRA-958, respectively. The catalysts were more resistant to Cl - poisoning and natural organic matter fouling than other supported-Pd catalysts. The presence of 10 mM NaCl suppressed the k obs value by 31% and 23% for Pd@IRA-900 and Pd@IRA-958, whereas the presence of humic acid at 30 mg/L as TOC lowered the rates by 28% and 27%, respectively. The better performance of Pd@IRA-958 was attributed to the polymeric matrix properties (i.e., hydrophobicity, pore size, and surface area) as well as Pd particle size. GC/MS analyses indicated that very low concentrations of chlorinated intermediates were detected in the early stage of the hydrodechlorination process, with 2-phenoxyphenol being the main byproduct. The catalysts can be repeatedly used in multiple operations without significant bleeding. The catalysts eliminate the need for calcination in preparing conventional supported catalysts, and the resin supports conveniently facilitate control of Pd loading and material properties. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain serotonin synthesis and childhood physical aggression.

    Directory of Open Access Journals (Sweden)

    Dongsha Wang

    Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.

  17. Optimized anion exchange column isolation of zirconium-89 ( 89 Zr) from yttrium cyclotron target: Method development and implementation on an automated fluidic platform

    Energy Technology Data Exchange (ETDEWEB)

    O’Hara, Matthew J.; Murray, Nathaniel J.; Carter, Jennifer C.; Morrison, Samuel S.

    2018-04-01

    Zirconium-89 (89Zr), produced by the (p,n) reaction from naturally monoisotopic yttrium (natY), is a promising positron emitting isotope for immunoPET imaging. Its long half-life of 78.4 h is sufficient for evaluating slow physiological processes. A prototype automated fluidic system, coupled to on-line and in-line detectors, has been constructed to facilitate development of new 89Zr purification methodologies. The highly reproducible reagent delivery platform and near-real time monitoring of column effluents allows for efficient method optimization. The separation of Zr from dissolved Y metal targets was evaluated using several anion exchange resins. Each resin was evaluated against its ability to quantitatively capture Zr from a load solution that is high in dissolved Y. The most appropriate anion exchange resin for this application was identified, and the separation method was optimized. The method is capable of a high Y decontamination factor (>105) and has been shown to separate Fe, an abundant contaminant in Y foils, from the 89Zr elution fraction. Finally, the performance of the method was evaluated using cyclotron bombarded Y foil targets. The separation method was shown to achieve >95% recovery of the 89Zr present in the foils. The 89Zr eluent, however, was in a chemical matrix not immediately conducive to labeling onto proteins. The main intent of this study was to develop a tandem column 89Zr purification process, wherein the anion exchange column method described here is the first separation in a dual-column purification process.

  18. A series of poly(butylimidazolium) ionic liquid functionalized copolymers for anion exchange membranes

    Science.gov (United States)

    Ouadah, Amina; Xu, Hulin; Luo, Tianwei; Gao, Shuitao; Wang, Xing; Fang, Zhou; Jing, Chaojun; Zhu, Changjin

    2017-12-01

    A new series of ionic liquid functionalized copolymers for anion exchange membranes (AEM) is prepared. Poly(butylvinylimidazolium)(b-VIB) is copolymerized with para-methyl styrene (p-MS) by the radical polymerization formed block copolymers b-VIB/p-MS, which is crosslinked with poly(diphenylether bibenzimidazole) (DPEBI) providing the desired materials b-VIB/p-MS/DPEBI. Structures are characterized via H1NMR, FTIR spectra and elemental analysis. The b-VIB blocks offer the anion conduction function while DPEBI moieties contribute to enhancing other properties. The prepared membranes display chloride conductivity as high as 19.5 mS/cm at 25 °C and 69.2 mS/cm at 100 °C-higher than that of the commercial membrane tokuyuama A201-. Their hydroxide conductivity reaches 35.7 Scm-1 at 25 °C and 73.1 Scm-1 at 100 °C. The membranes showed a linear Arrhenius behavior in the anion conduction, low activation energies and distinguished nanophase separation of hydrophilic/hydrophobic regions by the transmission electron microscopy (TEM) studies. Thermal investigations using TGA and DSC confirm that the membranes are stable up to 250 °C. Particularly, drastically alkaline stability due to no decrease in the hydroxide conductivity after 168 h of treatment with 2M KOH.

  19. In-situ ionic liquid dispersive liquid-liquid microextraction using a new anion-exchange reagent combined Fe3O4 magnetic nanoparticles for determination of pyrethroid pesticides in water samples.

    Science.gov (United States)

    Fan, Chen; Liang, You; Dong, Hongqiang; Ding, Guanglong; Zhang, Wenbing; Tang, Gang; Yang, Jiale; Kong, Dandan; Wang, Deng; Cao, Yongsong

    2017-07-04

    In this work, in-situ ionic liquid dispersive liquid-liquid microextraction combined ultrasmall Fe 3 O 4 magnetic nanoparticles was developed as a kind of pretreatment method to detect pyrethroid pesticides in water samples. New anion-exchange reagents including Na[DDTC] and Na[N(CN) 2 ] were optimized for in-situ extraction pyrethroids, which showed enhanced microextraction performance. Pyrethroids were enriched by hydrophilic ionic liquid [P 4448 ][Br] (aqueous solution, 200 μL, 0.2 mmol mL -1 ) reaction in-situ with anion-exchange reagent Na[N(CN) 2 ] (aqueous solution, 300 μL, 0.2 mmol mL -1 ) forming hydrophobic ionic liquid as extraction agent in water sample (10 mL). Ultrasmall superparamagnetic iron oxide nanoparticles (30 mg) were used to collect the mixture of ionic liquid and pyrethroids followed by elution with acetonitrile. The extraction of ionic liquid strategies was unique and efficiently fulfilled with high enrichment factors (176-213) and good recoveries (80.20-117.31%). The method was successively applied to the determination of pyrethroid pesticides in different kinds of water samples with the limits of detection ranged from 0.16 to 0.21 μg L -1 . The proposed method is actually nanometer-level microextraction (average size 80 nm) with the advantages of simplicity, rapidity, and sensitivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. The determination of Plutonium content in urine using anion exchange resin method

    International Nuclear Information System (INIS)

    Mukh-Syaifudin

    1996-01-01

    The possibility of internal contamination by plutonium is usually determined through urine analysis. The technique involved the co-precipitation of plutonium with rhodizonic acid by the addition of sodium hydroxide, the re-extraction of Pu into concentrated HCl, dissolution of Pu in 8 N HCI + Cl 2 solution, and the purification of plutonium through AGI-X8 anion exchange resin in columns with a diameter of 4 and 7 mm. The eluent was evaporated and the residu was dissolved in 8 N HCI and then deposited directly onto a Lexan slide or electrodeposited onto a stainless steel disc and the alpha emission of Pu was counted by using alpha spectrometry. The results showed that the recoveries of Pu-242 tracer by using column 7 mm and direct deposition and electrodeposition methods were 28.783% and 16.444%, respectively. The recoveries of Pu-242 by using column 4 mm and direct deposition and electrodeposition methods were 64.834% and 55.661%, respectively. From the percentage of recovery, it can be concluded that the direct deposition method was relatively better than the electrodeposition method. The recovery of Pu-242 by using column of 4 mm in diameter was higher than that of column 7 mm

  1. Mechanism of protodesorption—exchange of heavy metal cations for protons in a heterophase system of H{sub 2}O–H{sub 2}SO{sub 4}–MSO{sub 4}—cellulose sorbent

    Energy Technology Data Exchange (ETDEWEB)

    Kozlov, V.A.; Nikiforova, T.E., E-mail: tatianaenik@mail.ru; Loginova, V.A.; Koifman, O.I.

    2015-12-15

    Highlights: • Protodesorption takes place with participation of anions. • The interphase indicator MSO{sub 4} is used in ion exchange investigation. • In ion exchange process salt and acid participate in equivalent proportions. • In a protodesorption process proton acts in degree of ½. • M{sup 2+}/2Na{sup +} and M{sup 2+}/2H{sup +} exchanges take place in ion and molecular forms. - Abstract: The influence of pH on the distribution of metal cations [Cd(II), Cu(II), Fe(II), Ni(II), Zn(II)] in a four-component heterophase system (H{sub 2}O–H{sub 2}SO{sub 4}–MSO{sub 4}–cellulose sorbent) was studied. Protodesorption of metal cations was studied with indicator and constant quantities of [MSO{sub 4}] salts and constant solvent–sorbent ratio. Linear dependence lgK{sub DM2+} = f(pH) with tgα = 1/2 of the K{sub DM2+} metal ions distribution coefficients from the acidity of the aqueous phase is observed in logarithmic coordinates. Depression of the exponent corresponding to proton involvement in protodesorption from 2 (theory) to 0.5 (experiment) indicates that anions of the aqueous phase are involved in the process of exchange of metal cation for proton on the anionic centers of the sorbent, which corresponds to participation of the salt and acid components of the system in molecular non-dissociated form in an equivalent proportion H{sub 2}SO{sub 4}/MSO{sub 4} = 1/1. Different behavior of the salt and acid components in ion exchange of cations for cations and cations for protons is due to the differences in the constraint coefficients of their molecular and ionic forms which must be taken into consideration in equations describing thermodynamics of the interphase exchange.

  2. Transcript levels of members of the SLC2 and SLC5 families of glucose transport proteins in eel swimbladder tissue: the influence of silvering and the influence of a nematode infection.

    Science.gov (United States)

    Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd

    2018-04-01

    The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.

  3. Anion exchanger and the resistance against thermal haemolysis.

    Science.gov (United States)

    Ivanov, I T; Zheleva, A; Zlatanov, I

    2011-01-01

    4,4'-Diiso-thiocyanato stilbene-2,2'-disulphonic acid (DIDS) is a membrane-impermeable, highly specific covalent inhibitor and powerful thermal stabiliser of the anion exchanger (AE1), the major integral protein of erythrocyte membrane (EM). Suspensions of control and DIDS-treated (15 µM, pH 8.2) human erythrocytes were heated from 20° to 70°C using various but constant heating rates (1-8°C/min). The cellular electrolyte leakage exhibited a sigmoidal response to temperature as detected by conductometry. The critical midpoint temperature of leakage, T(mo), extrapolated to low heating rate (0.5°C/min) was used as a measure for EM thermostability. T(mo) was greater for DIDS-treated erythrocytes, 63.2° ± 0.3°C, than for intact erythrocytes, 60.7° ± 0.2°C. The time, t(1/2), for 50% haemolysis of erythrocytes, exposed to 53°C was used as a measure for the resistance of erythrocytes against thermal haemolysis. The t(1/2) was also greater for DIDS-treated erythrocytes, 63 ± 3 min, than for intact erythrocytes, 38 ± 2 min. The fluorescent label N-(3-pyrenyl)maleimide and EPR spin label 3-maleimido-proxyl, covalently bound to sulphydryl groups of major EM proteins, were used to monitor the changes in molecular motions during transient heating. Both labels reported an intensification of the motional dynamics at the denaturation temperatures of spectrin (50°C) and AE1 (67°C), and, surprisingly, immobilisation of a major EM protein, presumably the AE1, at T(mo). The above results are interpreted in favour of the possible involvement of a predenaturational rearrangement of AE1 copies in the EM thermostability and the resistance against thermal haemolysis.

  4. The role of polymer nanolayer architecture on the separation performance of anion-exchange membrane adsorbers: I. Protein separations.

    Science.gov (United States)

    Bhut, Bharat V; Weaver, Justin; Carter, Andrew R; Wickramasinghe, S Ranil; Husson, Scott M

    2011-11-01

    This contribution describes the preparation of strong anion-exchange membranes with higher protein binding capacities than the best commercial resins. Quaternary amine (Q-type) anion-exchange membranes were prepared by grafting polyelectrolyte nanolayers from the surfaces of macroporous membrane supports. A focus of this study was to better understand the role of polymer nanolayer architecture on protein binding. Membranes were prepared with different polymer chain graft densities using a newly developed surface-initiated polymerization protocol designed to provide uniform and variable chain spacing. Bovine serum albumin and immunoglobulin G were used to measure binding capacities of proteins with different size. Dynamic binding capacities of IgG were measured to evaluate the impact of polymer chain density on the accessibility of large size protein to binding sites within the polyelectrolyte nanolayer under flow conditions. The dynamic binding capacity of IgG increased nearly linearly with increasing polymer chain density, which suggests that the spacing between polymer chains is sufficient for IgG to access binding sites all along the grafted polymer chains. Furthermore, the high dynamic binding capacity of IgG (>130 mg/mL) was independent of linear flow velocity, which suggests that the mass transfer of IgG molecules to the binding sites occurs primarily via convection. Overall, this research provides clear evidence that the dynamic binding capacities of large biologics can be higher for well-designed macroporous membrane adsorbers than commercial membrane or resin ion-exchange products. Specifically, using controlled polymerization leads to anion-exchange membrane adsorbers with high binding capacities that are independent of flow rate, enabling high throughput. Results of this work should help to accelerate the broader implementation of membrane adsorbers in bioprocess purification steps. Copyright © 2011 Wiley Periodicals, Inc.

  5. Use of new tandem cation/anion exchange system with clinical-scale generators provides high specific volume solutions of technetium-99m and rhenium-188

    International Nuclear Information System (INIS)

    Knapp, F.F. Jr.; Beets, A.L.; Mirzadeh, S.; Guhlke, S.

    1998-01-01

    In this paper we describe the first application of our simple and inexpensive post-elution tandem cation/anion exchange column system which is based on generator elution with salts of weak acids such as ammonium acetate instead of saline solution to provide very high specific volume solutions of technetium-99m and rhenium-188 from clinical-scale molybdenum-99/technetium-99m generator prepared from low specific activity (n,y) molybdenum-99, and tungsten-188/rhenium-188 generators, respectively. Initial passage of the bolus through a strong cation exchange cartridge converts the ammonium acetate to acetic acid which is essentially not ionized at the acidic pH, allowing specific subsequent amine-type (QMA SepPak TM ) anion exchange cartridge column trapping of the microscopic levels of the pertechnetate or perrhenate. Subsequent elution of the anion cartridge with a small volume ( 500 mCi/mL) from the alumina-based tungsten-188/rhenium-188 generator. (author)

  6. Isolation of nitrosylruthenium nitrato complexes by ion exchange and extraction chromatography

    International Nuclear Information System (INIS)

    Huang, H.; Liu, L.

    TBP Levextrel and cation exchange resins were used to separate RuNO nitrato complexes of different nitric acid concentrations. 7402 quaternary ammonium salt Levextrel was used instead of an anionic exchange resin to separate anionic and neutral complex ions. The results indicated that D 3 and D 4 , which can easily be extracted by TBP, were anionic and neutral complex ions

  7. [Analysis the relationship between SLC26A4 mutation and current diagnosis of inner ear malformation in children with sensorineural hearing loss].

    Science.gov (United States)

    Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao

    2014-11-01

    Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.

  8. Mutation analysis of SLC26A4 for Pendred syndrome and nonsyndromic hearing loss by high-resolution melting

    DEFF Research Database (Denmark)

    Chen, Neng; Tranebjærg, Lisbeth; Rendtorff, Nanna Dahl

    2011-01-01

    Pendred syndrome and DFNB4 (autosomal recessive nonsyndromic congenital deafness, locus 4) are associated with autosomal recessive congenital sensorineural hearing loss and mutations in the SLC26A4 gene. Extensive allelic heterogeneity, however, necessitates analysis of all exons and splice sites...

  9. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    International Nuclear Information System (INIS)

    Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi

    2009-01-01

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  10. Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

    Science.gov (United States)

    Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

    2016-01-01

    To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

  11. Adsorption behaviour of scandium, yttrium, cerium and uranium from xylenol orange solutions onto anion-exchange resins

    Energy Technology Data Exchange (ETDEWEB)

    Chao, H E; Suzuki, N [Tohoku Univ., Sendai (Japan). Faculty of Science

    1981-04-01

    The effects of concentration, pH and anions on the adsorption behaviour of xylenol orange (XO) on the strong anion exchangers, Amberlite IRA-400 and Hitachi 2632 are described. The adsorption behaviour of the XO complexes of Ce(III), Y(III), Sc(III) and U(VI) on the Amberlite IRA-400 resin as a function of XO concentration and pH is reported. A continuous-flow radiometric detector is used to investigate the separations of the Ce(III)-Sc(III), Y(III)-Sc(III), and Ce(III)-Y(III) pairs on the XO-form Hitachi 2632 resin column by pH control. Satisfactory separations of the Ce(III)-Sc(III) and Y(III)-Sc(III) pairs are achieved.

  12. Anion Exchange in II-VI Semiconducting Nanostructures via Atomic Templating.

    Science.gov (United States)

    Agarwal, Rahul; Krook, Nadia M; Ren, Ming-Liang; Tan, Liang Z; Liu, Wenjing; Rappe, Andrew M; Agarwal, Ritesh

    2018-03-14

    Controlled chemical transformation of nanostructures is a promising technique to obtain precisely designed novel materials, which are difficult to synthesize otherwise. We report high-temperature vapor-phase anion-exchange reactions to chemically transform II-VI semiconductor nanostructures (100-300 nm length scale) while retaining the single crystallinity, crystal structure, morphology, and even defect distribution of the parent material via atomic templating. The concept of atomic templating is employed to obtain kinetically controlled, thermodynamically metastable structural phases such as zincblende CdSe and CdS from zincblende CdTe upon complete chemical replacement of Te with Se or S. The underlying transformation mechanisms are explained through first-principles density functional theory calculations. Atomic templating is a unique path to independently tune materials' phase and composition at the nanoscale, allowing the synthesis of novel materials.

  13. SLC-2000: A luminosity upgrade for the SLC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

    1996-01-01

    We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

  14. Separation of anionic oligosaccharides by high-performance liquid chromatography

    International Nuclear Information System (INIS)

    Green, E.D.; Baenziger, J.U.

    1986-01-01

    The authors have developed methods for rapid fractionation of anionic oligosaccharides containing sulfate and/or sialic acid moieties by high-performance liquid chromatography (HPLC). Ion-exchange HPLC on amine-bearing columns (Micropak AX-10 and AX-5) at pH 4.0 is utilized to separate anionic oligosaccharides bearing zero, one, two, three, or four charges, independent of the identity of the anionic moieties (sulfate and/or sialic acid). Ion-exchange HPLC at pH 1.7 allows separation of neutral, mono-, di-, and tetrasialylated, monosulfated, and disulfated oligosaccharides. Oligosaccharides containing three sialic acid residues and those bearing one each of sulfate and sialic acid, however, coelute at pH 1.7. Since the latter two oligosaccharide species separate at pH 4.0, analysis at pH 4.0 followed by analysis at pH 1.7 can be utilized to completely fractionate complex mixtures of sulfated and sialylated oligosaccharides. Ion-suppression amine adsorption HPLC has previously been shown to separate anionic oligosaccharides on the basis of net carbohydrate content (size). In this study they demonstrate the utility of ion-suppression amine adsorption HPLC for resolving sialylated oligosaccharide isomers which differ only in the linkages of sialic acid residues (α2,3 vs α2,6) and/or location of α2,3- and α2,6-linked sialic acid moieties on the peripheral branches of oligosaccharides. These two methods can be used in tandem to separate oligosaccharides, both analytically and preparatively, based on their number, types, and linkages of anionic moieties

  15. Design of expanded bed supports for the recovery of plasmid DNA by anion exchange adsorption

    DEFF Research Database (Denmark)

    Theodossiou, Irini; Søndergaard, M.; Thomas, Owen R. T.

    2001-01-01

    In this study we detail the rational design of new chromatographic adsorbents tailored for the capture of plasmid DNA. Features present on current chromatographic supports that can significantly enhance plasmid binding capacity have been identified in packed bed chromatography experiments...... and blueprints for improved expanded bed adsorbents have been put forward. The characterisation and testing of small (20-40 mum) high density (>3.7 g cm(-3)) pellicular expanded bed materials functionalised with various anion exchange structures is presented. In studies with calf thymus DNA, dynamic binding...... capacities of 1.2 and 3.4 mg ml(-1) were recorded for prototype diethylaminoethyl-and polyethylene imine-linked adsorbents which were respectively 25 and 70 fold higher than those of equivalently derivatised commercial expanded bed materials. The prototype polyethylene imine-coupled material exhibited severe...

  16. Cell wall bound anionic peroxidases from asparagus byproducts.

    Science.gov (United States)

    Jaramillo-Carmona, Sara; López, Sergio; Vazquez-Castilla, Sara; Jimenez-Araujo, Ana; Rodriguez-Arcos, Rocio; Guillen-Bejarano, Rafael

    2014-10-08

    Asparagus byproducts are a good source of cationic soluble peroxidases (CAP) useful for the bioremediation of phenol-contaminated wastewaters. In this study, cell wall bound peroxidases (POD) from the same byproducts have been purified and characterized. The covalent forms of POD represent >90% of the total cell wall bound POD. Isoelectric focusing showed that whereas the covalent fraction is constituted primarily by anionic isoenzymes, the ionic fraction is a mixture of anionic, neutral, and cationic isoenzymes. Covalently bound peroxidases were purified by means of ion exchange chromatography and affinity chromatography. In vitro detoxification studies showed that although CAP are more effective for the removal of 4-CP and 2,4-DCP, anionic asparagus peroxidase (AAP) is a better option for the removal of hydroxytyrosol (HT), the main phenol present in olive mill wastewaters.

  17. Recent Advances in Solid Catalysts Obtained by Metalloporphyrins Immobilization on Layered Anionic Exchangers: A Short Review and Some New Catalytic Results

    Directory of Open Access Journals (Sweden)

    Shirley Nakagaki

    2016-02-01

    Full Text Available Layered materials are a very interesting class of compounds obtained by stacking of two-dimensional layers along the basal axis. A remarkable property of these materials is their capacity to interact with a variety of chemical species, irrespective of their charge (neutral, cationic or anionic. These species can be grafted onto the surface of the layered materials or intercalated between the layers, to expand or contract the interlayer distance. Metalloporphyrins, which are typically soluble oxidation catalysts, are examples of molecules that can interact with layered materials. This work presents a short review of the studies involving metalloporphyrin immobilization on two different anionic exchangers, Layered Double Hydroxides (LDHs and Layered Hydroxide Salts (LHSs, published over the past year. After immobilization of anionic porphyrins, the resulting solids behave as reusable catalysts for heterogeneous oxidation processes. Although a large number of publications involving metalloporphyrin immobilization on LDHs exist, only a few papers have dealt with LHSs as supports, so metalloporphyrins immobilized on LHSs represent a new and promising research field. This work also describes new results on an anionic manganese porphyrin (MnP immobilized on Mg/Al-LDH solids with different nominal Mg/Al molar ratios (2:1, 3:1 and 4:1 and intercalated with different anions (CO32− or NO3−. The influence of the support composition on the MnP immobilization rates and the catalytic performance of the resulting solid in cyclooctene oxidation reactions will be reported.

  18. Recent Advances in Solid Catalysts Obtained by Metalloporphyrins Immobilization on Layered Anionic Exchangers: A Short Review and Some New Catalytic Results.

    Science.gov (United States)

    Nakagaki, Shirley; Mantovani, Karen Mary; Machado, Guilherme Sippel; Castro, Kelly Aparecida Dias de Freitas; Wypych, Fernando

    2016-02-29

    Layered materials are a very interesting class of compounds obtained by stacking of two-dimensional layers along the basal axis. A remarkable property of these materials is their capacity to interact with a variety of chemical species, irrespective of their charge (neutral, cationic or anionic). These species can be grafted onto the surface of the layered materials or intercalated between the layers, to expand or contract the interlayer distance. Metalloporphyrins, which are typically soluble oxidation catalysts, are examples of molecules that can interact with layered materials. This work presents a short review of the studies involving metalloporphyrin immobilization on two different anionic exchangers, Layered Double Hydroxides (LDHs) and Layered Hydroxide Salts (LHSs), published over the past year. After immobilization of anionic porphyrins, the resulting solids behave as reusable catalysts for heterogeneous oxidation processes. Although a large number of publications involving metalloporphyrin immobilization on LDHs exist, only a few papers have dealt with LHSs as supports, so metalloporphyrins immobilized on LHSs represent a new and promising research field. This work also describes new results on an anionic manganese porphyrin (MnP) immobilized on Mg/Al-LDH solids with different nominal Mg/Al molar ratios (2:1, 3:1 and 4:1) and intercalated with different anions (CO₃(2-) or NO₃(-)). The influence of the support composition on the MnP immobilization rates and the catalytic performance of the resulting solid in cyclooctene oxidation reactions will be reported.

  19. Use of a new tandem cation/anion exchange system with clinical-scale generators provides high specific volume solutions of technetium-99m and rhenium-188

    International Nuclear Information System (INIS)

    Knapp, F.R. Jr.; Beets, A.L.; Mirzadeh, S.; Guhlke, S.; Univ. of Bonn

    1998-03-01

    In this paper the authors describe the first application of a simple and inexpensive post elution tandem cation-anion exchange column system which is based on generator elution with salts of weak acids such as ammonium acetate instead of saline solution to provide very high specific volume solutions of technetium-99m and rhenium-188 from clinical scale molybdenum-99/technetium-99m generator prepared from low specific activity (n,y) molybdenum-99, and tungsten-188/rhenium-188 generators, respectively. Initial passage of the bolus through a strong cation exchange cartridge converts the ammonium acetate to acetic acid which is essentially not ionized at the acidic pH, allowing specific subsequent amine type (QMA SepPak trademark) anion exchange cartridge column trapping of the microscopic levels of the pertechnetate or perrhenate. Subsequent elution of the anion cartridge with a small volume ( 500 mCi/mL) from the alumina-based tungsten-188/rhenium-188 generator

  20. Recent SLC developments

    International Nuclear Information System (INIS)

    Ross, M.

    1993-04-01

    The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

  1. Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes.

    Science.gov (United States)

    Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A

    2017-10-01

    This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.

  2. Organic anion and cation SLC22 "drug" transporter (Oat1, Oat3, and Oct1 regulation during development and maturation of the kidney proximal tubule.

    Directory of Open Access Journals (Sweden)

    Thomas F Gallegos

    Full Text Available Proper physiological function in the pre- and post-natal proximal tubule of the kidney depends upon the acquisition of selective permeability, apical-basolateral epithelial polarity and the expression of key transporters, including those involved in metabolite, toxin and drug handling. Particularly important are the SLC22 family of transporters, including the organic anion transporters Oat1 (originally identified as NKT and Oat3 as well as the organic cation transporter Oct1. In ex vivo cultures of metanephric mesenchyme (MM; the embryonic progenitor tissue of the nephron Oat function was evident before completion of nephron segmentation and corresponded with the maturation of tight junctions as measured biochemically by detergent extractability of the tight junction protein, ZO-1. Examination of available time series microarray data sets in the context of development and differentiation of the proximal tubule (derived from both in vivo and in vitro/ex vivo developing nephrons allowed for correlation of gene expression data to biochemically and functionally defined states of development. This bioinformatic analysis yielded a network of genes with connectivity biased toward Hnf4α (but including Hnf1α, hyaluronic acid-CD44, and notch pathways. Intriguingly, the Oat1 and Oat3 genes were found to have strong temporal co-expression with Hnf4α in the cultured MM supporting the notion of some connection between the transporters and this transcription factor. Taken together with the ChIP-qPCR finding that Hnf4α occupies Oat1, Oat3, and Oct1 proximal promoters in the in vivo differentiating rat kidney, the data suggest a network of genes with Hnf4α at its center plays a role in regulating the terminal differentiation and capacity for drug and toxin handling by the nascent proximal tubule of the kidney.

  3. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2009-11-20

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  4. An improved, computer-based, on-line gamma monitor for plutonium anion exchange process control

    International Nuclear Information System (INIS)

    Pope, N.G.; Marsh, S.F.

    1987-06-01

    An improved, low-cost, computer-based system has replaced a previously developed on-line gamma monitor. Both instruments continuously profile uranium, plutonium, and americium in the nitrate anion exchange process used to recover and purify plutonium at the Los Alamos Plutonium Facility. The latest system incorporates a personal computer that provides full-feature multichannel analyzer (MCA) capabilities by means of a single-slot, plug-in integrated circuit board. In addition to controlling all MCA functions, the computer program continuously corrects for gain shift and performs all other data processing functions. This Plutonium Recovery Operations Gamma Ray Energy Spectrometer System (PROGRESS) provides on-line process operational data essential for efficient operation. By identifying abnormal conditions in real time, it allows operators to take corrective actions promptly. The decision-making capability of the computer will be of increasing value as we implement automated process-control functions in the future. 4 refs., 6 figs

  5. Effects of inorganic anions on carbon isotope fractionation during Fenton-like degradation of trichloroethene

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yunde [State Key Laboratory of Biogeology and Environmental Geology, China University of Geosciences, Wuhan 430074 (China); School of Environmental Studies, China University of Geosciences, Wuhan 430074 (China); Laboratory of Basin Hydrology and Wetland Eco-restoration, China University of Geosciences, Wuhan 430074 (China); Zhou, Aiguo, E-mail: aiguozhou@cug.edu.cn [State Key Laboratory of Biogeology and Environmental Geology, China University of Geosciences, Wuhan 430074 (China); School of Environmental Studies, China University of Geosciences, Wuhan 430074 (China); Gan, Yiqun; Li, Xiaoqian [State Key Laboratory of Biogeology and Environmental Geology, China University of Geosciences, Wuhan 430074 (China); School of Environmental Studies, China University of Geosciences, Wuhan 430074 (China)

    2016-05-05

    Highlights: • The effect of inorganic anions on carbon isotope fractionation was evaluated. • The enrichment factors was independent concentration of NO{sub 3}{sup −}, or SO{sub 4}{sup 2−}. • Cl{sup −} significantly influenced the carbon isotope fractionation. - Abstract: Understanding the magnitude and variability in isotope fractionation with respect to specific processes is crucial to the application of stable isotopic analysis as a tool to infer and quantify transformation processes. The variability of carbon isotope fractionation during Fenton-like degradation of trichloroethene (TCE) in the presence of different inorganic ions (nitrate, sulfate, and chloride), was investigated to evaluate the potential effects of inorganic anions on carbon isotope enrichment factor (ε value). A comparison of ε values obtained in deionized water, nitrate solution, and sulfate solution demonstrated that the ε values were identical and not affected by the presence of nitrate and sulfate. In the presence of chloride, however, the ε values (ranging from −6.3 ± 0.8 to 10 ± 1.3‰) were variable and depended on the chloride concentration, indicating that chloride could significantly affect carbon isotope fractionation during Fenton-like degradation of TCE. Thus, caution should be exercised in selecting appropriate ε values for the field application of stable isotope analysis, as various chloride concentrations may be present due to naturally present or introduced with pH adjustment and iron salts during Fenton-like remediation. Furthermore, the effects of chloride on carbon isotope fractionation may be able to provide new insights about reaction mechanisms of Fenton-like processes.

  6. Effects of inorganic anions on carbon isotope fractionation during Fenton-like degradation of trichloroethene

    International Nuclear Information System (INIS)

    Liu, Yunde; Zhou, Aiguo; Gan, Yiqun; Li, Xiaoqian

    2016-01-01

    Highlights: • The effect of inorganic anions on carbon isotope fractionation was evaluated. • The enrichment factors was independent concentration of NO_3"−, or SO_4"2"−. • Cl"− significantly influenced the carbon isotope fractionation. - Abstract: Understanding the magnitude and variability in isotope fractionation with respect to specific processes is crucial to the application of stable isotopic analysis as a tool to infer and quantify transformation processes. The variability of carbon isotope fractionation during Fenton-like degradation of trichloroethene (TCE) in the presence of different inorganic ions (nitrate, sulfate, and chloride), was investigated to evaluate the potential effects of inorganic anions on carbon isotope enrichment factor (ε value). A comparison of ε values obtained in deionized water, nitrate solution, and sulfate solution demonstrated that the ε values were identical and not affected by the presence of nitrate and sulfate. In the presence of chloride, however, the ε values (ranging from −6.3 ± 0.8 to 10 ± 1.3‰) were variable and depended on the chloride concentration, indicating that chloride could significantly affect carbon isotope fractionation during Fenton-like degradation of TCE. Thus, caution should be exercised in selecting appropriate ε values for the field application of stable isotope analysis, as various chloride concentrations may be present due to naturally present or introduced with pH adjustment and iron salts during Fenton-like remediation. Furthermore, the effects of chloride on carbon isotope fractionation may be able to provide new insights about reaction mechanisms of Fenton-like processes.

  7. Characterization of Low-Molecular-Weight Heparins by Strong Anion-Exchange Chromatography.

    Science.gov (United States)

    Sadowski, Radosław; Gadzała-Kopciuch, Renata; Kowalkowski, Tomasz; Widomski, Paweł; Jujeczka, Ludwik; Buszewski, Bogusław

    2017-11-01

    Currently, detailed structural characterization of low-molecular-weight heparin (LMWH) products is an analytical subject of great interest. In this work, we carried out a comprehensive structural analysis of LMWHs and applied a modified pharmacopeial method, as well as methods developed by other researchers, to the analysis of novel biosimilar LMWH products; and, for the first time, compared the qualitative and quantitative composition of commercially available drugs (enoxaparin, nadroparin, and dalteparin). For this purpose, we used strong anion-exchange (SAX) chromatography with spectrophotometric detection because this method is more helpful, easier, and faster than other separation techniques for the detailed disaccharide analysis of new LMWH drugs. In addition, we subjected the obtained results to statistical analysis (factor analysis, t-test, and Newman-Keuls post hoc test).

  8. Radiolytic preparation of ETFE and PFA based anion exchange membranes for alkaline fuel cell

    International Nuclear Information System (INIS)

    Ko, Beom-Seok; Sohn, Joon-Yong; Nho, Young-Chang; Shin, Junhwa

    2011-01-01

    In this study, a versatile monomer, vinylbenzyl chloride (VBC) was radiolytically grafted onto a partially fluorinated ETFE and perfluorinated polymer PFA films. The VBC grafted films were treated with trimethylamine to prepare the alkaline anion exchange membranes (AAEMs). No significant differences in the ion exchange capacities and water uptakes were observed between the ETFE and PFA based AAEMs with similar degree of grafting (DOG). However, the distribution patterns of the graft chains over the cross-section of the ETFE and PFA based AAEMs were found to be quite different; the even distribution was observed from the ETFE based AAEMs while the uneven distribution was observed from the PFA based AAEMs. It was also found that the PFA based AAEMs have the higher ionic conductivity and chemical stability, compared to the ETFE based AAEMs.

  9. Process optimisation for anion exchange monolithic chromatography of 4.2kbp plasmid vaccine (pcDNA3F).

    Science.gov (United States)

    Ongkudon, Clarence M; Danquah, Michael K

    2010-10-15

    Anion exchange monolithic chromatography is increasingly becoming a prominent tool for plasmid DNA purification but no generic protocol is available to purify all types of plasmid DNA. In this work, we established a simple framework and used it to specifically purify a plasmid DNA model from a clarified alkaline-lysed plasmid-containing cell lysate. The framework involved optimising ligand functionalisation temperature (30-80°C), mobile phase flow rate (0.1-1.8mL/min), monolith pore size (done by changing the porogen content in the polymerisation reaction by 50-80%), buffer pH (6-10), ionic strength of binding buffer (0.3-0.7M) and buffer gradient elution slope (1-10% buffer B/min). We concluded that preferential pcDNA3F adsorption and optimum resolution could be achieved within the tested conditions by loading the clarified cell lysate into 400nm pore size of monolith in 0.7M NaCl (pH 6) of binding buffer followed by increasing the NaCl concentration to 1.0M at 3%B/min. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Distribution of 14 elements from two solutions simulating Hanford HLW Tank 102-SY (acid-dissolved sludge and acidified supernate) on four cation exchange resins and five anion exchange resins having different functional groups

    International Nuclear Information System (INIS)

    Marsh, S.F.; Svitra, Z.V.; Bowen, S.M.

    1995-01-01

    As part of the Tank Waste Remediation System program at Los Alamos, we evaluated a series of cation exchange and anion exchange resins for their ability to remove hazardous components from radioactive high-level waste (HLW). The anion exchangers were Reillex TM HPQ, a polyvinyl pyridine resin, and four strong-base polystyrene resins having trimethyl, tri ethyl, tri propyl, and tributyl amine as their respective functional groups. The cation exchange resins included Amberlyst TM 15 and Amberlyst tM XN-1010 with sulfonic acid functionality, Duolite TM C-467 with phosphonic acid functionality, and poly functional Diphonix TM with di phosphonic acid, sulfonic acid, and carboxylic acid functionalities. We measured the distributions of 14 elements on these resins from solutions simulating acid-dissolved sludge (pH 0.6) and acidified supernate (pH 3.5) from underground storage tank 102-SY at the Hanford Reservation near Richland, Washington, USA. To these simulants, we added the appropriate radionuclides and used gamma spectrometry to measure fission products (Ce, Cs, Sr, Tc, and Y), actinides (U, Pu, and Am), and matrix elements (Cr, Co, Fe, Mn, Zn, and Zr). For each of the 252 element/resin/solution combinations, distribution coefficients (Kds) were measured for dynamic contact periods of 30 minutes, 2 hours, and 6 hours to obtain information about sorption kinetics from these complex media. Because we measured the sorption of many different elements, the tabulated results indicate which unwanted elements are most likely to interfere with the sorption of elements of special interest. On the basis of these 756 measured Kd values, we conclude that some of the tested resins appear suitable for partitioning hazardous components from Hanford HLW. (author). 10 refs., 11 tabs

  11. Adsorption of phosphate in hydrocalumite-like layered double hydroxides: a comparison between memory effect and ion exchange processes; Adsorcao de fosfato em [Ca-Al]-HDL: comparacao entre o efeito de memoria e troca ionica

    Energy Technology Data Exchange (ETDEWEB)

    Bernardo, M.P., E-mail: marcelapiassib@gmail.com [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil); Moreira, F.K.V.; Ribeiro, C. [Embrapa Instrumentacao (LNNA), Sao Carlos, SP (Brazil). Laboratorio Nacional de Nanotecnologia para o Agronegocio

    2016-07-01

    Phosphorus is an essential element for agriculture, but the excessive use of this element has caused severe damages to the environment. Layered double hydroxide (LDHs) are excellent candidates to remove PO{sub 4}{sup 3-} anions through adsorption process. In this work, the phosphate adsorption on hydrocalumite-like (Ca-Al) LDHs was evaluated over the ion exchange and memory effect processes. X-ray diffraction measurements revealed formation of analogous crystalline phases from both process as the phosphate concentration was increased. However, the phosphate quantity adsorbed varied according to the process used. The ion exchange route is the most efficient process to remove phosphate from aqueous medium. (author)

  12. Determination of trace amount of titanium in 2.5% Nb-Zr alloy by anion exchange separation and sulfo salicylic acid photometry

    International Nuclear Information System (INIS)

    Sakai, Fumiaki; Wachi, Isamu; Tsuji, Nobuo; Satoh, Hitoshi

    1973-01-01

    A trace amount of Ti in 2.5% Nb-Zr alloy can be determined by a combined method of the characteristic anion exchange separation of Ti from Nb and the absorption photometry of Ti with sulfo salicylic acid. The alloy (1g) was dissolved in 5 ml of HF (1 + 1), and 5 ml of HNO 3 was added to them. The resultant 5M HF - 6M HNO 3 mixed acid solution was passed into an anion exchange resin column with 10 mm internal diameter and 100 mm high, at the rate of 1 to 2 ml/min. Niobium was adsorbed on to the column, through which Ti passed. The collected passing and washing solutions were converted into H 2 SO 4 medium by twice successive fuming treatments. The solution was transferred into a volumetric flask of 50 ml, and 10 ml of 10% sulfo salicylic acid in H 2 SO 4 was added. Diluting to a mark with H 2 SO 4 , the solution was allowed to stand for 15 min. Titanium was then determined by measuring absorption intensity at the wavelength of 410 mm. The influence of coexisting elements on the coloration of Ti and some adsorption conditions of Nb was experimentally investigated by using 95 Nb as a tracer. The experiment revealed that the removal of Nb is essential, and that higher HF concentration and lower HNO 3 concentration contribute to higher Nb adsorption. A variable rate type cockless column is useful for this routine analysis. The standard deviation and the coefficient of variation of analysis are 1.3 and 4.06% respectively for the concentration level of 32 ppm Ti (NZ-3). (Iwakiri, K.)

  13. SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

    Science.gov (United States)

    Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

    2013-01-01

    Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  14. Influence of glucose and urea on 125I transport across an anion exchange paper membrane

    International Nuclear Information System (INIS)

    Inoue, Hiroyoshi

    2001-01-01

    In order to study the influence of glucose and urea on the 125 I transport across an anion exchange paper membrane, the transmembrane potential, the fluxes, and the concentrations of 125 I, glucose and urea within the membrane were measured in the Na 125 I concentration-cell system containing glucose or urea. Glucose and urea increased the membrane/solution distribution of the iodide ion, but scarcely affected the diffusion process of iodide ion within the membrane

  15. Molecular Properties of Drugs Interacting with SLC22 Transporters OAT1, OAT3, OCT1, and OCT2: A Machine-Learning Approach.

    Science.gov (United States)

    Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K

    2016-10-01

    Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue

  16. ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

    Directory of Open Access Journals (Sweden)

    Etienne Masle-Farquhar

    2017-05-01

    Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

  17. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    Science.gov (United States)

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  18. Using solvent extraction to process nitrate anion exchange column effluents

    International Nuclear Information System (INIS)

    Yarbro, S.L.

    1987-10-01

    Octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO), a new organophosphorous extractant, and a new centrifugal mixer-settler both recently developed at Argonne were evaluated for their potential use in the recovery of actinides from nitrate anion exchange column effluents. The performance of the extractant was evaluated by measuring the extraction coefficient values as a function of acid and salt concentration. Additional performance parameters include extraction coefficient behavior as a function of the total metal concentration in the organic phase, and comparison of different stripping and organic scrubbing techniques. A simulated effluent stream was used to evaluate the performance of the centrifugal mixer-settlers by comparing experimental and calculated interstage concentration profiles. Both the CMPO extractant and the centrifugal mixer-settlers have potential for processing nitrate column effluents, particularly if the stripping behavior can be improved. Details of the proposed process are presented in the flowsheet and contactor design analyses

  19. Using solvent extraction to process nitrate anion exchange column effluents

    Energy Technology Data Exchange (ETDEWEB)

    Yarbro, S.L.

    1987-10-01

    Octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO), a new organophosphorous extractant, and a new centrifugal mixer-settler both recently developed at Argonne were evaluated for their potential use in the recovery of actinides from nitrate anion exchange column effluents. The performance of the extractant was evaluated by measuring the extraction coefficient values as a function of acid and salt concentration. Additional performance parameters include extraction coefficient behavior as a function of the total metal concentration in the organic phase, and comparison of different stripping and organic scrubbing techniques. A simulated effluent stream was used to evaluate the performance of the centrifugal mixer-settlers by comparing experimental and calculated interstage concentration profiles. Both the CMPO extractant and the centrifugal mixer-settlers have potential for processing nitrate column effluents, particularly if the stripping behavior can be improved. Details of the proposed process are presented in the flowsheet and contactor design analyses.

  20. Study on the process variables in the anion exchange plutonium separation process

    Energy Technology Data Exchange (ETDEWEB)

    Nishimura, D T

    1957-11-15

    This report discusses the study of the process variables in the Anion Exchange Process Pilot Plant for the separation of plutonium from irradiated uranium. Variables associated with the feed, wash and elution cycles were studied with the aim of improving the quality of the final plutonium product, reduce cycling time and reagent requirements, and also to obtain data for prediction of resin column behaviour under various feed conditions. A cation resin column and a silica gel column were installed in the system and these were studied for plutonium recovery and product quality. The product obtained from the plant was acceptable in all the impurities except the associated gamma activity which was too high for easy product handling. (author)

  1. Anionic chromogenic chemosensors highly selective for fluoride or cyanide based on 4-(4-Nitrobenzylideneamine)phenol

    Energy Technology Data Exchange (ETDEWEB)

    Nicoleti, Celso R; Marini, Vanderleia G; Zimmermann, Lizandra M; Machado, Vanderlei G., E-mail: vanderlei.machado@ufsc.br [Departamento de Quimica, Universidade Federal de Santa Catarina (UFSC), Florianopolis, SC (Brazil)

    2012-08-15

    4-(4-Nitrobenzylideneamine)phenol was used in two strategies allowing the highly selective detection of F{sup -} and CN{sup -}. Firstly, the compound in acetonitrile acts as a chromogenic chemosensor based on the idea that more basic anions cause its deprotonation (colorless solution), generating a colored solution containing phenolate. The discrimination of CN{sup -} over F{sup -} was obtained by adding 1.4% water to acetonitrile: water preferentially solvates F{sup -}, leaving the CN{sup -} free to deprotonate the compound. Another strategy involved an assay comprised of the competition between phenolate dye and the analyte for calyx[4]pyrrole in acetonitrile, a receptor highly selective for F{sup -}. Phenolate and calyx[4]pyrrole form a hydrogen-bonded complex, which changes the color of the medium. On the addition of various anions, only F{sup -} was able to restore the original color corresponding to phenolate in solution due to the fact that the anion dislodges phenolate from the complexation site. (author)

  2. Anionic chromogenic chemosensors highly selective for fluoride or cyanide based on 4-(4-Nitrobenzylideneamine)phenol

    International Nuclear Information System (INIS)

    Nicoleti, Celso R.; Marini, Vanderleia G.; Zimmermann, Lizandra M.; Machado, Vanderlei G.

    2012-01-01

    4-(4-Nitrobenzylideneamine)phenol was used in two strategies allowing the highly selective detection of F - and CN - . Firstly, the compound in acetonitrile acts as a chromogenic chemosensor based on the idea that more basic anions cause its deprotonation (colorless solution), generating a colored solution containing phenolate. The discrimination of CN - over F - was obtained by adding 1.4% water to acetonitrile: water preferentially solvates F - , leaving the CN - free to deprotonate the compound. Another strategy involved an assay comprised of the competition between phenolate dye and the analyte for calyx[4]pyrrole in acetonitrile, a receptor highly selective for F - . Phenolate and calyx[4]pyrrole form a hydrogen-bonded complex, which changes the color of the medium. On the addition of various anions, only F - was able to restore the original color corresponding to phenolate in solution due to the fact that the anion dislodges phenolate from the complexation site. (author)

  3. Selective preconcentration of iodide in presence of iodate using a plasticized anion-exchange membrane

    International Nuclear Information System (INIS)

    Bhagat, Preeti; Rajurkar, N.S.; Acharya, R.; Pandey, A.K.; Nair, A.G.C.; Reddy, A.V.R.

    2006-01-01

    In the present work, the hydrophobic anion-exchange membranes were prepared by physical immobilization of Aliquat-336 (AL) in the cellulose triacetate (CTA) matrix plasticized with dioctyl phthalate (DOP). The uptake of I - in this membrane was examined in aqueous sample in the presence of IO 3 - ions in varying concentrations. In order to provide better discrimination between I - and IO 3 - ions, the uptake studies were carried out using three different counterions (CL - , Br - and NO 3 - ) in the membrane. The results of these studies are described in this paper

  4. Radioanalytical determination of plutonium and americium using ion exchange and extraction chromatography technique in urine

    International Nuclear Information System (INIS)

    Santhanakrishnan, V.; Sreedevi, K.R.; Rajaram, S.; Ravi, P.M.

    2011-01-01

    The use of anion exchange chromatography for the separation of Pu and extraction chromatography technique for the separation of Am from urine samples was studied. In the earlier method, Pu separation was carried out by anion exchange chromatography followed by Am separation by cation exchange chromatography. The chemical recovery of Am obtained by cation exchange separation method was inconsistent and low in the range 30-70%. In this study, the average Pu recovery obtained using anion exchange chromatography was 89.2 with standard deviation of 10.4 and the average Am recovery obtained using extraction chromatography with TRU resin was 77.4 with standard deviation of 14.8. Moreover, Am separation could be completed within three hours using the TRU column compared to two days that were required for the cation exchange chromatography. (author)

  5. Further characterisation of the recently described SLC26A4 c.918+2T>C mutation and reporting of a novel variant predicted to be damaging.

    Science.gov (United States)

    Gonçalves, A C; Santos, R; O'Neill, A; Escada, P; Fialho, G; Caria, H

    2016-06-01

    Pendred syndrome (PS) is the second most common type of autosomal recessive syndromic hearing loss (HL). It is characterised by sensorineural HL and goiter with occasional hypothyroidism. These features are generally accompanied by malformations of the inner ear, as enlarged vestibular aqueduct (EVA). In about 50% of probands, mutations in the SLC26A4 gene are the cause of the disease. Here we report the case of a Portuguese female, aged 47, presenting with severe to profound HL and hypothyroidism. Her mother and sister, both deceased, had suffered from HL and goiter. By MRI and CT, an enlarged vestibular aqueduct and endolymphatic sac were observed. Molecular study of the patient included screening for GJB2 coding mutations and GJB6 common deletions followed by screening of all SLC26A4 exons, as well as intronic regions 8 and 14. Mutation c.918+2T>C was found for the first time in homozygosity in the intronic region 7 of the SLC26A4 gene. Whilst sequencing the control samples, a novel mutation c.821C>G was found in heterozygosity in the exon 7 of SLC26A4 gene and was predicted to be damaging. This study thus led to the finding of two novel SLC26A4 genotypes and provides new insight on the phenotypic features associated with PS. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.

  6. Adsorption of Monobutyl Phthalate from Aqueous Phase onto Two Macroporous Anion-Exchange Resins

    Directory of Open Access Journals (Sweden)

    Zhengwen Xu

    2014-01-01

    Full Text Available As new emerging pollutants, phthalic acid monoesters (PAMs pose potential ecological and human health risks. In the present study, adsorption performance of monobutyl phthalate (MBP onto two macroporous base anion-exchange resins (D-201 and D-301 was discussed. It was found that the adsorption isotherms were best fitted by the Langmuir equation while the adsorption kinetics were well described by pseudo-first-order model. Analyses of sorption isotherms and thermodynamics proved that the adsorption mechanisms for DBP onto D-201 were ion exchange. However, the obtained enthalpy values indicate that the sorption process of MBP onto D-301 is physical adsorption. The equilibrium adsorption capacities and adsorption rates of DBP on two different resins increased with the increasing temperature of the solution. D-301 exhibited a higher adsorption capacity of MBP than D-201. These results proved that D-301, as an effective sorbent, can be used to remove phthalic acid monoesters from aqueous solution.

  7. Anion retention in soil: Possible application to reduce migration of buried technetium and iodine

    International Nuclear Information System (INIS)

    Gu, B.; Schulz, R.K.

    1991-10-01

    This report summarizes a literature review of our present knowledge of the anion exchange properties of a number of soils and minerals, which may potentially be used as anion exchangers to retard migration of such anions as iodide (I - ), iodate (IO 3 - ) and pertechnetate (TcO 4 - ) away from disposal site. The amorphous clays allophane and imogolite, are found to be among the most important soil components capable of developing appreciable amounts of positive charge for anion exchange even at about neutral pH. Decreases in the SiO 2 /Al 2 O 3 ratio and soil pH result in an increase in soil AEC. Allophane and imogolite rich soils have an AEC ranging from 1 to 18 meq/100g at pH about 6. Highly weathered soils dominated by Fe and Al oxides and kaolinite may develop a significant amount of AEC as soil pH falls. The retention of iodine (I) and technetium (T c ), by soils is associated with both soil organic matter, and Fe and Al oxides, whereas sorption on layer silicate minerals in negligible. Fe and Al oxides become more important in the retention of anionic I - , IO 3 - , and TcO 4 - as pH falls, since more positive charge is developed on the oxide surfaces. Although few studies, if any, have been conducted on I and T c sorption by soil allophane and imogolite, it is estimated that a surface plough soil (2 million pounds soil per acre) with 5 meq/100g AEC, as is commonly found in andisols, shall retain approximately 5900 kg I and 4500 kg T c . It is conceivable that an anion exchanger such as an andisol could be used to modify the near field environment of a radioactive waste disposal facility. This whole disposal system would then offer similar migration resistance to anions as is normally afforded to cations by usual and normal soils. 93 refs., 10 figs., 7 tabs

  8. Anion retention in soil: Possible application to reduce migration of buried technetium and iodine

    Energy Technology Data Exchange (ETDEWEB)

    Gu, B.; Schulz, R.K. (California Univ., Berkeley, CA (United States). Dept. of Soil Science)

    1991-10-01

    This report summarizes a literature review of our present knowledge of the anion exchange properties of a number of soils and minerals, which may potentially be used as anion exchangers to retard migration of such anions as iodide (I{sup {minus}}), iodate (IO{sub 3}{sup {minus}}) and pertechnetate (TcO{sub 4}{sup {minus}}) away from disposal site. The amorphous clays allophane and imogolite, are found to be among the most important soil components capable of developing appreciable amounts of positive charge for anion exchange even at about neutral pH. Decreases in the SiO{sub 2}/Al{sub 2}O{sub 3} ratio and soil pH result in an increase in soil AEC. Allophane and imogolite rich soils have an AEC ranging from 1 to 18 meq/100g at pH about 6. Highly weathered soils dominated by Fe and Al oxides and kaolinite may develop a significant amount of AEC as soil pH falls. The retention of iodine (I) and technetium ({Tc}), by soils is associated with both soil organic matter, and Fe and Al oxides, whereas sorption on layer silicate minerals in negligible. Fe and Al oxides become more important in the retention of anionic I{sup {minus}}, IO{sub 3}{sup {minus}}, and TcO{sub 4}{sup {minus}} as pH falls, since more positive charge is developed on the oxide surfaces. Although few studies, if any, have been conducted on I and {Tc} sorption by soil allophane and imogolite, it is estimated that a surface plough soil (2 million pounds soil per acre) with 5 meq/100g AEC, as is commonly found in andisols, shall retain approximately 5900 kg I and 4500 kg {Tc}. It is conceivable that an anion exchanger such as an andisol could be used to modify the near field environment of a radioactive waste disposal facility. This whole disposal system would then offer similar migration resistance to anions as is normally afforded to cations by usual and normal soils. 93 refs., 10 figs., 7 tabs.

  9. CryoEM structure of the human SLC4A4 sodium-coupled acid-base transporter NBCe1.

    Science.gov (United States)

    Huynh, Kevin W; Jiang, Jiansen; Abuladze, Natalia; Tsirulnikov, Kirill; Kao, Liyo; Shao, Xuesi; Newman, Debra; Azimov, Rustam; Pushkin, Alexander; Zhou, Z Hong; Kurtz, Ira

    2018-03-02

    Na + -coupled acid-base transporters play essential roles in human biology. Their dysfunction has been linked to cancer, heart, and brain disease. High-resolution structures of mammalian Na + -coupled acid-base transporters are not available. The sodium-bicarbonate cotransporter NBCe1 functions in multiple organs and its mutations cause blindness, abnormal growth and blood chemistry, migraines, and impaired cognitive function. Here, we have determined the structure of the membrane domain dimer of human NBCe1 at 3.9 Å resolution by cryo electron microscopy. Our atomic model and functional mutagenesis revealed the ion accessibility pathway and the ion coordination site, the latter containing residues involved in human disease-causing mutations. We identified a small number of residues within the ion coordination site whose modification transformed NBCe1 into an anion exchanger. Our data suggest that symporters and exchangers utilize comparable transport machinery and that subtle differences in their substrate-binding regions have very significant effects on their transport mode.

  10. Rapid analysis of carbohydrates in aqueous extracts and hydrolysates of biomass using a carbonate-modified anion-exchange column.

    Science.gov (United States)

    Sevcik, Richard S; Mowery, Richard A; Becker, Christopher; Chambliss, C Kevin

    2011-03-04

    Quantitative liquid-chromatography techniques used to characterize carbohydrates present in biomass samples can suffer from long analysis times, limited analyte resolution, poor stability, or a combination of these factors. The current manuscript details a novel procedure enabling resolution of glucose, xylose, arabinose, galactose, mannose, fructose, and sucrose via isocratic elution in less than 5 min. Equivalent conditions also enable analysis of cellobiose and maltose with a minimal increase in chromatographic run time (ca. 3 and 6 min, respectively). Noted chromatographic performance requires that a commercially available anion-exchange column be modified with carbonate prior to analysis. Analytical performance of a modified column was assessed over a 5-day period via repeated analyses of 4 samples, resulting from aqueous extraction or quantitative saccharification of a potential biofuel feedstock (i.e., corn stover or switchgrass). A simple solid phase extraction procedure was utilized to clean up each sample prior to analysis. Analytical accuracy of the extraction protocol was assessed by evaluation of matrix spike recoveries which typically ranged from 84% to 98%. The instrumental variability of measured concentrations in real samples over the 5-day period was generally less than 5% RSD for all detected analytes, independent of sample type. Finally, it is important to note that the modified column exhibited exceptional stability over approximately 800 injections of biofeedstock-based samples. These data demonstrate that a carbonate-modified anion-exchange column can be employed for rapid determination of carbohydrates in biomass samples of lignocellulosic origin. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Americium Separations from High-Salt Solutions Using Anion Exchange

    International Nuclear Information System (INIS)

    Barr, Mary E.; Jarvinen, Gordon D.; Stark, Peter C.; Chamberlin, Rebecca M.; Bartsch, Richard A.; Zhang, Z.Y.; Zhao, W.

    2001-01-01

    The aging of the US nuclear stockpile presents a number of challenges, including the increasing radioactivity of plutonium residues due to the ingrowth of 241 Am from the β-decay of 241 Pu. We investigated parameters that affect the sorption of Am onto anion-exchange resins from concentrated effluents derived from nitric acid processing of plutonium residues. These postevaporator wastes are nearly saturated solutions of acidic nitrate salts, and americium removal is complicated by physical factors, such as solution viscosity and particulates, as well as by the presence of large quantities of competing metals and acid. Single- and double-contact batch distribution coefficients for americium and neodymium from simple and complex surrogate solutions are presented. Varied parameters include the nitrate salt concentration and composition and the nitric acid concentration. We find that under these extremely concentrated conditions, Am(III) removal efficiencies can surpass 50% per contact. Distribution coefficients for both neodymium and americium are insensitive to solution acidity and appear to be driven primarily by low water activities of the solutions

  12. Properties of solvated electrons, alkali anions and other species in metal solutions and kinetics of cation and electron exchange reactions. Final report

    International Nuclear Information System (INIS)

    Dye, J.L.

    1979-01-01

    The properties of solutions of alkali metals in amine solvents were studied by optical, ETR, NMR and electrochemical methods. Complexation of the alkali cations by crown ethers and cryptands permitted the preparation of concentrated solutions of alkali metals in amine and ether solvents. Extensive alkali metal NMR studies of the exchange of M + with crown-ethers and cryptands and of the alkali metal anion, M - , were made. The first crystalline salt of an alkali metal anion, Na + Cryptand [2.2.2]Na - was synthesized and characterized and led to the preparation of other alkali metal anion salts. This research provided the foundation for continuing studies of crystalline alkalide salts

  13. Selection of magnetic anion exchange resins for the removal of dissolved organic and inorganic matters.

    Science.gov (United States)

    Wang, Qiongjie; Li, Aimin; Wang, Jinnan; Shuang, Chengdong

    2012-01-01

    Four magnetic anion exchange resins (MAERs) were used as adsorbents to purify drinking water. The effect of water quality (pH, temperature, ionic strength, etc.) on the performance of MAER for the removal of dissolved organic matter (DOM) was also investigated. Among the four studied MAERs, the strong base resin named NDMP-1 with high water content and enhanced exchange capacity exhibited the highest removal rate of dissolved organic carbon (DOC) (48.9% removal rate) and UV-absorbing substances (82.4% removal rate) with a resin dose of 10 mL/L after 30 min of contact time. The MAERs could also effectively remove inorganic matter such as sulfate, nitrate and fluoride. Because of the higher specific UV absorbance (SUVA) value, the DOM in the raw water was found to be removed more effectively than that in the clarified water by NDMP resin. The temperature showed a weak influence on the removal of DOC from 6 to 26 degrees C, while a relatively strong one at 36 degrees C. The removal of DOM by NDMP was also affected to some extent by the pH value. Moreover, increasing the sulfate concentration in the raw water could decrease the removal rates of DOC and UV-absorbing substances.

  14. Progress in liquid ion exchangers

    International Nuclear Information System (INIS)

    Nakagawa, Genkichi

    1974-01-01

    Review is made on the extraction with anion exchangers and the extraction with liquid cation exchangers. On the former, explanation is made on the extraction of acids, the relation between anion exchange and the extraction of metals, the composition of the metallic complexes that are extracted, and the application of the extraction with anion exchangers to analytical chemistry. On the latter, explanation is made on the extraction of metals and its application to analytical chemistry. The extraction with liquid ion exchangers is suitable for the operation in chromatography, because the distribution of extracting agents into aqueous phase is small, and extraction equilibrium is quickly reached, usually within 1 to several minutes. The separation by means of anion exchangers is usually made from hydrochloric acid solution. For example, Brinkman et al. determined Rf values for more than 50 elements by thin layer chromatography. Tables are given for showing the structure of the liquid ion exchangers and the polymerized state of various amines. (Mori, K.)

  15. Zeolite-like Metal–Organic Framework (MOF) Encaged Pt(II)-Porphyrin for Anion-Selective Sensing

    KAUST Repository

    Masih, Dilshad

    2018-03-26

    The selectivity and sensitivity of sensors are of great interest to the materials chemistry community, and a lot of effort is now devoted to improving these characteristics. More specifically, the selective sensing of anions is one of the largest challenges impeding the sensing-research area due to their similar physical and chemical behaviors. In this work, platinum–metalated porphyrin (Pt(II)TMPyP) was successfully encapsulated in a rho-type zeolite-like metal–organic framework (rho-ZMOF) and applied for anion-selective sensing. The sensing activity and selectivity of the MOF-encaged Pt(II)TMPyP for various anions in aqueous and methanolic media were compared to that of the free (nonencapsulated) Pt(II)TMPyP. While the photoinduced triplet-state electron transfer of Pt(II)TMPyP showed a very low detection limit for anions with no selectivity, the Pt(II)TMPyP encapsulated in the rho-ZMOF framework possessed a unique chemical structure to overcome such limitations. This new approach has the potential for use in other complex sensing applications, including biosensors, which require ion selectivity.

  16. Determination of trace amount of titanium in 2. 5% Nb-Zr alloy by anion exchange separation and sulfo salicylic acid photometry

    Energy Technology Data Exchange (ETDEWEB)

    Sakai, F; Wachi, I; Tsuji, N; Satoh, Hitoshi [Power Reactor and Nuclear Fuel Development Corp., Tokyo (Japan)

    1973-04-01

    A trace amount of Ti in 2.5% Nb-Zr alloy can be determined by a combined method of the characteristic anion exchange separation of Ti from Nb and the absorption photometry of Ti with sulfo salicylic acid. The alloy (1g) was dissolved in 5 ml of HF (1 + 1), and 5 ml of HNO/sub 3/ was added to them. The resultant 5M HF - 6M HNO/sub 3/ mixed acid solution was passed into an anion exchange resin column with 10 mm internal diameter and 100 mm high, at the rate of 1 to 2 ml/min. Niobium was adsorbed on to the column, through which Ti passed. The collected passing and washing solutions were converted into H/sub 2/SO/sub 4/ medium by twice successive fuming treatments. The solution was transferred into a volumetric flask of 50 ml, and 10 ml of 10% sulfo salicylic acid in H/sub 2/SO/sub 4/ was added. Diluting to a mark with H/sub 2/SO/sub 4/, the solution was allowed to stand for 15 min. Titanium was then determined by measuring absorption intensity at the wavelength of 410 mm. The influence of coexisting elements on the coloration of Ti and some adsorption conditions of Nb was experimentally investigated by using /sup 95/Nb as a tracer. The experiment revealed that the removal of Nb is essential, and that higher HF concentration and lower HNO/sub 3/ concentration contribute to higher Nb adsorption. A variable rate type cockless column is useful for this routine analysis. The standard deviation and the coefficient of variation of analysis are 1.3 and 4.06% respectively for the concentration level of 32 ppm Ti (NZ-3).

  17. In-situ anion exchange fabrication of porous ZnO/ZnSe heterostructural microspheres with enhanced visible light photocatalytic activity

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Hairui, E-mail: liuhairui1@126.com [College of Physics & Electrics Engineering, Henan Normal University, Henan Key Laboratory of Photovoltaic Materials, Xinxiang 453007 (China); Key Laboratory of Interface Science and Engineering in Advanced Materials (Taiyuan University of Technology), Ministry of Education, Taiyuan, Shanxi, 030024 (China); College of Materials Science and Engineering, Taiyuan University of Technology, Taiyuan, Shanxi 030024 (China); Hu, Yanchun [College of Physics & Electrics Engineering, Henan Normal University, Henan Key Laboratory of Photovoltaic Materials, Xinxiang 453007 (China); He, Xia [Key Laboratory of Interface Science and Engineering in Advanced Materials (Taiyuan University of Technology), Ministry of Education, Taiyuan, Shanxi, 030024 (China); Jia, Husheng, E-mail: jia_husheng@126.com [Key Laboratory of Interface Science and Engineering in Advanced Materials (Taiyuan University of Technology), Ministry of Education, Taiyuan, Shanxi, 030024 (China); College of Materials Science and Engineering, Taiyuan University of Technology, Taiyuan, Shanxi 030024 (China); Liu, Xuguang; Xu, Bingshe [Key Laboratory of Interface Science and Engineering in Advanced Materials (Taiyuan University of Technology), Ministry of Education, Taiyuan, Shanxi, 030024 (China)

    2015-11-25

    Porous ZnO microspheres were fabricated by an ultrasonic irradiation technique. Subsequently, through a facile in-situ anion exchange reaction between the ZnO microsphere and sodium selenite, spherical ZnO/ZnSe heterostructures with different ratios of the two components were fabricated. The as-obtained products were characterized by field emission scanning electron microscopy (FE-SEM), energy-dispersive X-ray (EDX) spectroscopy, transmission electron microscopy (TEM), X-ray diffraction (XRD), and UV–vis spectrometry. The results reveal that the secondary ZnSe nanoparticles are grown on the surface of pre-grown ZnO microspheres. Compared with pure ZnO microspheres, the ZnO/ZnSe hetero-microspheres show enhance visible-light photocatalytic activity for degradation of methylene blue (MB) and 4-nitrophenol (4-NP). The enhanced photocatalytic performance is attributed to fast separation and transport of photogenerated electrons and holes derived from the coupling effect of ZnSe and ZnO heterostructure. Photoluminescent spectra further indicate that the ZnO/ZnSe heterostructures greatly suppress the charge recombination of photogenerated electron–hole pairs, which would be beneficial to improve their photocatalytic activity. Finally, the photocatalytic mechanism of the ZnO/ZnSe heterostructures is proposed. - Graphical abstract: Porous ZnO/ZnSe heterostructures with different ratios of the two components were fabricated and present enhance visible-light photocatalytic activity for degradation of methylene blue (MB) and 4-nitrophenol (4-NP). The enhanced photocatalytic performance is attributed to fast separation and transport of photogenerated electrons and holes derived from the coupling effect of ZnSe and ZnO heterostructure. - Highlights: • Spherical ZnO/ZnSe porous composites were fabricated by in-situ anion exchange. • ZnO/ZnSe composites exhibited enhanced visible-light photocatalytic activity. • The matching band gap improves the separation of

  18. Stability of a Cu0.7Co2.3O4 electrode during the oxygen evolution reaction for alkaline anion-exchange membrane water electrolysis

    Science.gov (United States)

    Kang, Kyoung Eun; Kim, Chi Ho; Lee, Myung Sup; Jung, Chang Wook; Kim, Yang Do; Lee, Jae Ho

    2018-01-01

    The electrode materials for oxygen evolution, especially non-platinum group metal oxides, have attracted increasing attention. Among the spinel-type transition metal oxides, Cu0.7Co2.3O4 powders were evaluated as a potential replacement for expensive dimensionally stabilized anode materials. Cu0.7Co2.3O4 powder for use as an electrode material for oxygen evolution in an alkaline anion-exchange membrane water electrolyzer was prepared using a thermal decomposition method. The Cu0.7Co2.3O4 powders heat-treated at 250 °C exhibited the same X-ray diffraction patterns without any secondary phases as the Co3O4 spinel structure did. The Cu0.7Co2.3O4 powders heat-treated at 250 °C for 30 minutes showed the smallest mean particle size of approximately 376 nm with the powders having a homogeneous shape and size distribution. The fine powders with a relatively homogeneous size distribution showed a higher current density during the oxygen evolution reaction. The lifetime of the Cu0.7Co2.3O4 electrode was relatively long at a low current density, but was quickly shortened due to physical detachment of the Cu0.7Co2.3O4 powders as the current density was increased. This study showed that the efficiency and the stability of Cu0.7Co2.3O4 powders during the oxygen evolution reaction were related directly to the active electrode area.

  19. Crosslinked anion exchange membranes with primary diamine-based crosslinkers for vanadium redox flow battery application

    Science.gov (United States)

    Cha, Min Suc; Jeong, Hwan Yeop; Shin, Hee Young; Hong, Soo Hyun; Kim, Tae-Ho; Oh, Seong-Geun; Lee, Jang Yong; Hong, Young Taik

    2017-09-01

    A series of polysulfone-based crosslinked anion exchange membranes (AEMs) with primary diamine-based crosslinkers has been prepared via simple a crosslinking process as low-cost and durable membranes for vanadium redox flow batteries (VRFBs). Chloromethylated polysulfone is used as a precursor polymer for crosslinked AEMs (CAPSU-x) with different degrees of crosslinking. Among the developed AEMs, CAPSU-2.5 shows outstanding dimensional stability and anion (Cl-, SO42-, and OH-) conductivity. Moreover, CAPSU-2.5 exhibits much lower vanadium ion permeability (2.72 × 10-8 cm2 min-1) than Nafion 115 (2.88 × 10-6 cm2 min-1), which results in an excellent coulombic efficiency of 100%. The chemical and operational stabilities of the membranes have been investigated via ex situ soaking tests in 0.1 M VO2+ solution and in situ operation tests for 100 cycles, respectively. The excellent chemical, physical, and electrochemical properties of the CAPSU-2.5 membrane make it suitable for use in VRFBs.

  20. New borohydride anion B6H7-

    International Nuclear Information System (INIS)

    Kuznetsov, I.Yu.; Vinitskij, D.M.; Solntsev, K.A.

    1985-01-01

    The [Ni(Bipy) 3 ] (B 6 H 7 ) 2 , (Ph 4 P)B 6 H 7 , [Ni(Phen) 3 ](B 6 H 7 ) 2 crystals (where Bipy = bipyridine, Phen = phenathroline, Ph = phenyl) are obtained via the exchange reaction with a subsequent recrystallization from aqua-acetonic and acetonic solutions. The structure is studied of a new borohydride anion B 6 H 7 - possessing a four-valence bond unique for polyhedral borohydride anions. A triangular face of boride skeleton coordinating a hydrogen atom is considerably larger than other faces, and the electron density on this hydrogen atom is evidently much higher than at the end hydride hydrogen atoms. The trend of B 6 H 7 - anion to form statistically disordered structurs testifies to a rather slight effect of the seventh hydrogen atom position on the structure pattern of the ionic crystal lattice

  1. Steady state and transient simulation of anion exchange membrane fuel cells

    Science.gov (United States)

    Dekel, Dario R.; Rasin, Igal G.; Page, Miles; Brandon, Simon

    2018-01-01

    We present a new model for anion exchange membrane fuel cells. Validation against experimental polarization curve data is obtained for current densities ranging from zero to above 2 A cm-2. Experimental transient data is also successfully reproduced. The model is very flexible and can be used to explore the system's sensitivity to a wide range of material properties, cell design specifications, and operating parameters. We demonstrate the impact of gas inlet relative humidity (RH), operating current density, ionomer loading and ionomer ion exchange capacity (IEC) values on cell performance. In agreement with the literature, high air RH levels are shown to improve cell performance. At high current densities (>1 A cm-2) this effect is observed to be especially significant. Simulated hydration number distributions across the cell reveal the related critical dependence of cathode hydration on air RH and current density values. When exploring catalyst layer design, optimal intermediate ionomer loading values are demonstrated. The benefits of asymmetric (cathode versus anode) electrode design are revealed, showing enhanced performance using higher cathode IEC levels. Finally, electrochemical reaction profiles across the electrodes uncover inhomogeneous catalyst utilization. Specifically, at high current densities the cathodic reaction is confined to a narrow region near the membrane.

  2. Identification of IGF1, SLC4A4, WWOX, and SFMBT1 as hypertension susceptibility genes in Han Chinese with a genome-wide gene-based association study.

    Directory of Open Access Journals (Sweden)

    Hsin-Chou Yang

    Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to

  3. Use of inorganic materials for the uptake of anions from simulated nuclear wastes

    International Nuclear Information System (INIS)

    Usman, J.N.

    1991-01-01

    Investigations on some commercially available hydrous oxides (Ferrox, Zirox, Alumina, Oxti and Oxtain) have been carried out with a view to understanding their sorption properties for anions (such as 36 C1 - , 51 Cr 2 O 4 2- , 99 MoO 4 - and 106 Ru complexes) and to assess their suitability in specific applications in the nuclear fuel cycle. All the materials exhibited sorption for the anions with oxtain showing the lowest of sorption in various media solutions. Sorption was most effective at solution pH 2-9 following the amphotericism of these materials. The presence of competing anions had a marked effect on the sorption properties of the exchangers for all the anions investigated. TG and DTG results revealed a general weight loss presumably due to loss of moisture. The selectivity for NO 3 - and 36 C1 - was studied by plotting ion-exchange isotherms for each exchanger. All isotherms displayed large hysteresis. The fixed-bed column experiments revealed a high affinity for 36 C1 - on Ferrox, Zirox and Alumina than was observed in the K d measurements. In-vivo γ-radiation effects on the materials and their sorption properties were investigated. Prolonged chemical treatment had little or no effect on the sorption properties of the exchangers, and revealed that none of the materials withstood long term exposure to acid or alkaline conditions. The leachability of isotopically labelled exchangers contained in cement (OPC) composites was studied along deionised water, synthetic sea-water and synthetic ground water as leachants. The effect of cement additives (BFS) on the leachability of the composites was also studied. The diffusion coefficients for the leaching process were evaluated by using the Carman-Haul equation. Results clearly showed that BFS had little or no effect on the leachability of 36 C1 - . (author)

  4. Feedback systems in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

    1987-02-01

    Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

  5. An Automated Anion-Exchange Method forthe Selective Sorption of five Groups ofTrace Elements in Neutron-IrradiatedBiological Material

    International Nuclear Information System (INIS)

    Samsahl, K.

    1966-02-01

    An anion-exchange method based on fast selective sorption steps from mixtures of sulfuric, hydrobromic, and hydrochloric acid solutions has been developed for the separation of five different groups of radioactive trace elements in neutron-irradiated biological material. The separations are performed automatically with a simple proportioning pump apparatus. The apparatus allows the exact adjustment of influent solutions to the series of ion-exchange columns. The practical application of the method is described in detail. The successful use of the method is practically independent on the level of Na activity present in the sample

  6. New inorganic (an)ion exchangers based on Mg–Al hydrous oxides: (Alkoxide-free) sol–gel synthesis and characterisation

    KAUST Repository

    Chubar, Natalia

    2011-01-01

    New inorganic ion exchangers based on double Mg-Al hydrous oxides were generated via the new non-traditional sol-gel synthesis method which avoids using metal alkoxides as raw materials. Surface chemical and adsorptive properties of the final products were controlled by several ways of hydrogels and xerogels treatments which produced the materials of the layered structure, mixed hydrous oxides or amorphous adsorbents. The final adsorptive materials obtained via thermal treatment of xerogels were the layered mesoporous materials with carbonate in the interlayer space, surface abundance with hydroxylic groups and maximum adsorptive capacity to arsenate. Higher affinity of Mg-Al hydrous oxides towards H2AsO4- is confirmed by steep adsorption isotherms having plateau (removal capacity) at 220. mg[As]. gdw-1 for the best sample at pH = 7, fast adsorption kinetics and little pH effect. Adsorption of arsenite, fluoride, bromate, bromide, selenate, borate by Mg-Al hydrous oxides was few times high either competitive (depending on the anion) as compare with the conventional inorganic ion exchange adsorbents. © 2011 Elsevier Inc.

  7. New inorganic (an)ion exchangers based on Mg–Al hydrous oxides: (Alkoxide-free) sol–gel synthesis and characterisation

    KAUST Repository

    Chubar, Natalia

    2011-05-01

    New inorganic ion exchangers based on double Mg-Al hydrous oxides were generated via the new non-traditional sol-gel synthesis method which avoids using metal alkoxides as raw materials. Surface chemical and adsorptive properties of the final products were controlled by several ways of hydrogels and xerogels treatments which produced the materials of the layered structure, mixed hydrous oxides or amorphous adsorbents. The final adsorptive materials obtained via thermal treatment of xerogels were the layered mesoporous materials with carbonate in the interlayer space, surface abundance with hydroxylic groups and maximum adsorptive capacity to arsenate. Higher affinity of Mg-Al hydrous oxides towards H2AsO4- is confirmed by steep adsorption isotherms having plateau (removal capacity) at 220. mg[As]. gdw-1 for the best sample at pH = 7, fast adsorption kinetics and little pH effect. Adsorption of arsenite, fluoride, bromate, bromide, selenate, borate by Mg-Al hydrous oxides was few times high either competitive (depending on the anion) as compare with the conventional inorganic ion exchange adsorbents. © 2011 Elsevier Inc.

  8. Lessons from the SLC for future LC control systems

    International Nuclear Information System (INIS)

    Humphrey, R.

    1992-01-01

    The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)

  9. Removal of radioactive caesium from low level radioactive waste (LLW) streams using cobalt ferrocyanide impregnated organic anion exchanger

    Energy Technology Data Exchange (ETDEWEB)

    Valsala, T.P., E-mail: tpvalsala@yahoo.co.in [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Roy, S.C. [PREFRE Division, Bhabha Atomic Research Centre, Tarapur 401 502 (India); Shah, J.G. [Back End Technology Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Gabriel, J.; Raj, Kanwar [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Venugopal, V. [Radiochemistry Division, Bhabha Atomic Research Centre, Trombay 400 085 (India)

    2009-07-30

    The volumes of low level waste (LLW) generated during the operation of nuclear reactor are very high and require a concentration step before suitable matrix fixation. The volume reduction (concentration) is achieved either by co-precipitating technique or by the use of highly selective sorbents and ion exchange materials. The present study details the preparation of cobalt ferrocyanide impregnated into anion exchange resin and its evaluation with respect to removal of Cs in LLW streams both in column mode and batch mode operations. The Kd values of the prepared exchanger materials were found to be very good in actual reactor LLW solutions also. It was observed that the exchanger performed very well in the pH range of 3-9. A batch size of 6 g l{sup -1} of the exchanger was enough to give satisfactory decontamination for Cs in actual reactor LLW streams. The lab scale and pilot plant scale performance of the exchanger material in both batch mode and column mode operations was very good.

  10. 3.5 Radiation stability of ion exchangers

    International Nuclear Information System (INIS)

    Marhol, M.

    1976-01-01

    The main knowledge is summed up of the radiation stability of ion exchangers. No basic changes occur in inorganic ion exchangers with the exception of the exchange capacity at doses of up to 10 9 rad. This also applies to coal-based ion exchangers. Tables are given showing the changes in specific volume, exchange capacity and weight of different types of organic ion exchangers in dependence on the radiation dose. The effects are discussed of the structure of organic cation and anion exchangers, polymeric strong basic anion exchangers, polycondensate anion exchangers and ion exchange membranes on their radiation stability. General experimental procedures are given for laboratory tests of the radiation stability of exchangers. (L.K.)

  11. Heterometallic modular metal-organic 3D frameworks assembled via new tris-β-diketonate metalloligands: nanoporous materials for anion exchange and scaffolding of selected anionic guests.

    Science.gov (United States)

    Carlucci, Lucia; Ciani, Gianfranco; Maggini, Simona; Proserpio, Davide M; Visconti, Marco

    2010-11-02

    -48% of the cell volume and include the anions and many guest solvent molecules. The guest solvent molecules can be reversibly removed by thermal activation with retention of the framework structure, which proved to be stable up to about 270°C, as confirmed by TGA and powder XRD monitoring. The anions could be easily exchanged in single-crystal to single-crystal processes, thereby allowing the insertion of selected anions into the framework channels.

  12. Cobalt sulfide aerogel prepared by anion exchange method with enhanced pseudocapacitive and water oxidation performances

    Science.gov (United States)

    Gao, Qiuyue; Shi, Zhenyu; Xue, Kaiming; Ye, Ziran; Hong, Zhanglian; Yu, Xinyao; Zhi, Mingjia

    2018-05-01

    This work introduces the anion exchange method into the sol-gel process for the first time to prepare a metal sulfide aerogel. A porous Co9S8 aerogel with a high surface area (274.2 m2 g‑1) and large pore volume (0.87 cm3 g‑1) has been successfully prepared by exchanging cobalt citrate wet gel in thioacetamide and subsequently drying in supercritical ethanol. Such a Co9S8 aerogel shows enhanced supercapacitive performance and catalytic activity toward oxygen evolution reaction (OER) compared to its oxide aerogel counterpart. High specific capacitance (950 F g‑1 at 1 A g‑1), good rate capability (74.3% capacitance retention from 1 to 20 A g‑1) and low onset overpotential for OER (220 mV) were observed. The results demonstrated here have implications in preparing various sulfide chalcogels.

  13. The influence of plutonium concentration and solution flow rate on the effective capacity of macroporous anion exchange resin

    International Nuclear Information System (INIS)

    Marsh, S.F.; Gallegos, T.D.

    1987-07-01

    The principal aqueous process used to recover and purify plutonium at the Los Alamos Plutonium Facility is anion exchange in nitric acid. Previous studies with gel-type anion exchange resin have shown an inverse relationship between plutonium concentration in the feed solution and the optimum flow rate for this process. Because gel-type resin has been replaced with macroporous resin at Los Alamos, the relationship between plutonium concentration and solution flow rate was reexamined with the selected Lewatit MP-500-FK resin using solutions of plutonium in nitric acid and in nitric acid with high levels of added nitrate salts. Our results with this resin differ significantly from previous data obtained with gel-type resin. Flow-rate variation from 10 to 80 liters per hour had essentially no effect on the measured quantities of plutonium sorbed by the macroporous resin. However, the effect of plutonium concentration in the feed solutions was pronounced, as feed solutions that contained the highest concentrations of plutonium also produced the highest resin loadings. The most notable effect of high concentrations of dissolved nitrate salts in these solutions was an increased resin capacity for plutonium at low flow rates. 16 refs., 7 figs., 2 tabs

  14. Studies on the absorption of uranium and plutonium on macroporous anion-exchange resins from mixed solvent media

    International Nuclear Information System (INIS)

    Chetty, K.V.; Mapara, P.M.; Godbole, A.G.; Swarup, Rajendra

    1995-01-01

    The ion-exchange studies on uranium and plutonium using macroporous anion-exchange resins from an aqueous-organic solvent mixed media were carried out to develop a method for their separation. Out of the several water miscible organic solvents tried, methanol and acetone were found to be best suited. Distribution data for U(VI) and Pu(IV) for three macroporous resins Tulsion A-27(MP) (strong base), Amberlyst A-26(MP) (strong base) and Amberlite XE-270(MP) (weak base) as a function of (i) nitric acid concentration (ii) organic solvent concentration were obtained. Based on the data separation factors for Pu/U were calculated. Column experiments using Tulsion A-27(MP) from a synthetic feed (HNO 3 - methanol and HNO 3 - acetone) containing Pu and U in different ratios were carried out. Plutonium was recovered from the bulk of the actual solution generated during the dissolution of plutonium bearing fuels. The method has the advantage of loading plutonium from as low as 1M nitric acid in presence of methanol or acetone and could be used satisfactorily for its recovery from solutions containing plutonium and uranium. (author). 11 refs., 4 figs., 16 tabs

  15. Preparation and regulating cell adhesion of anion-exchangeable layered double hydroxide micropatterned arrays.

    Science.gov (United States)

    Yao, Feng; Hu, Hao; Xu, Sailong; Huo, Ruijie; Zhao, Zhiping; Zhang, Fazhi; Xu, Fujian

    2015-02-25

    We describe a reliable preparation of MgAl-layered double hydroxide (MgAl-LDH) micropatterned arrays on gold substrate by combining SO3(-)-terminated self-assembly monolayer and photolithography. The synthesis route is readily extended to prepare LDH arrays on the SO3(-)-terminated polymer-bonded glass substrate amenable for cell imaging. The anion-exchangeable MgAl-LDH micropattern can act both as bioadhesive region for selective cell adhesion and as nanocarrier for drug molecules to regulate cell behaviors. Quantitative analysis of cell adhesion shows that selective HepG2 cell adhesion and spreading are promoted by the micropatterned MgAl-LDH, and also suppressed by methotrexate drug released from the LDH interlayer galleries.

  16. Performance of polyethylene based radiation grafted anion exchange membrane with polystyrene-b-poly (ethylene/butylene)-b-polystyrene based ionomer using NiCo2O4 catalyst for water electrolysis

    Science.gov (United States)

    Gupta, Gaurav; Scott, Keith; Mamlouk, Mohamed

    2018-01-01

    A soluble anion exchange ionomer with high OH- ion conductivity comparable to that of H+ conductivity of Nafion is synthesised by chloromethylation of polystyrene-b-poly (ethylene/butylene)-b-polystyrene (SEBS) and used with NiCo2O4 electro-catalyst for water electrolysis. The ionomer has an ion exchange capacity of 1.9 mmol g-1 and ionic conductivity of 0.14 S cm-2 at 50 °C. The cell voltage at 20 °C at 100 mA cm-2 is 1.77 and 1.72 V in, 0.1 and 1.0 M NaOH, respectively, for an optimum loading of 10 mg cm-2 NiCo2O4. At 10 mg cm-2 NiCo2O4 electrolyser cell performance is at least equal to or superior to that of IrO2 at 2 mg cm-2 with excellent stability over 1 h. When the catalyst is sprayed on the GDL instead of CCM, the performance is further improved to 1.65 V at 100 mA cm-2 at 60 °C & 0.1 M KOH. The limited AEM electrolyser performance when operating with deionised water in comparison to PEM and alkaline electrolyser arises from the sluggish OER in the AEM environment equivalent to pH of 11.5 and the two orders of magnitude lower HER activity with respect to acid medium combined with the high Tafel slope of 120 mV dec-1.

  17. Selective anion extraction and recovery using a Fe{sup II}{sub 4}L{sub 4} cage

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Dawei; Ronson, Tanya K.; Mosquera, Jesus; Nitschke, Jonathan R. [Department of Chemistry, University of Cambridge (United Kingdom); Martinez, Alexandre [Aix Marseille Univ, CNRS, Centrale Marseille, iSm2, Marseille (France)

    2018-03-26

    Selective anion extraction is useful for the recovery and purification of valuable chemicals, and in the removal of pollutants from the environment. Here we report that Fe{sup II}{sub 4}L{sub 4} cage 1 is able to extract an equimolar amount of ReO{sub 4}{sup -}, a high-value anion and a nonradioactive surrogate of TcO{sub 4}{sup -}, from water into nitromethane. Importantly, the extraction was efficiently performed even in the presence of 10 other common anions in water, highlighting the high selectivity of 1 for ReO{sub 4}{sup -}. The extracted guest could be released into water as the cage disassembled in ethyl acetate, and then 1 could be recycled by switching the solvent to acetonitrile. The versatile solubility of the cage also enabled complete extraction of ReO{sub 4}{sup -} (as the tetrabutylammonium salt) from an organic phase into water by using the sulfate salt of 1 as the extractant. (copyright 2018 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  18. Progressive irreversible hearing loss is caused by stria vascularis degeneration in an Slc26a4-insufficient mouse model of large vestibular aqueduct syndrome.

    Science.gov (United States)

    Ito, T; Nishio, A; Wangemann, P; Griffith, A J

    2015-12-03

    Hearing loss of patients with enlargement of the vestibular aqueduct (EVA) can fluctuate or progress, with overall downward progression. The most common detectable cause of EVA is mutations of SLC26A4. We previously described a transgenic Slc26a4-insufficient mouse model of EVA in which Slc26a4 expression is controlled by doxycycline administration. Mice that received doxycycline from conception until embryonic day 17.5 (DE17.5; doxycycline discontinued at embryonic day 17.5) had fluctuating hearing loss between 1 and 6 months of age with an overall downward progression after 6 months of age. In this study, we characterized the cochlear functional and structural changes underlying irreversible hearing loss in DE17.5 mice at 12 months of age. The endocochlear potential was decreased and inversely correlated with auditory brainstem response thresholds. The stria vascularis was thickened and edematous in ears with less severe hearing loss, and thinned and atrophic in ears with more severe hearing loss. There were pathologic changes in marginal cell morphology and gene expression that were not observed at 3 months. We conclude that strial dysfunction and degeneration are the primary causes of irreversible progressive hearing loss in our Slc26a4-insufficient mouse model of EVA. This model of primary strial atrophy may be used to explore the mechanisms of progressive hearing loss due to strial dysfunction. Published by Elsevier Ltd.

  19. Simultaneous separation and determination of six arsenic species in rice by anion-exchange chromatography with inductively coupled plasma mass spectrometry.

    Science.gov (United States)

    Ma, Li; Yang, Zhaoguang; Tang, Jie; Wang, Lin

    2016-06-01

    The simultaneous separation and determination of arsenite As(III), arsenate As(V), monomethylarsonic acid (MMA), dimethylarsinic acid (DMA), arsenobetaine (AsB), and arsenocholine (AsC) in rice samples have been carried out in one single anion-exchange column run by high-performance liquid chromatography with inductively coupled plasma mass spectrometry. To estimate the effect of variables on arsenic (As) speciation, the chromatographic conditions including type of competing anion, ionic strength, pH of elution buffer, and flow rate of mobile phase have been investigated by a univariate approach. Under the optimum chromatographic conditions, baseline separation of six As species has been achieved within 10 min by gradient elution program using 4 mM NH4 HCO3 at pH 8.6 as mobile phase A and 4 mM NH4 HCO3 , 40 mM NH4 NO3 at pH 8.6 as mobile phase B. The method detection limits for As(III), As(V), MMA, DMA, AsB, and AsC were 0.4, 0.9, 0.2, 0.4, 0.5, and 0.3 μg/kg, respectively. The proposed method has been applied to separation and quantification of As species in real rice samples collected from Hunan Province, China. The main As species detected in all samples were As(III), As(V) and DMA, with inorganic As accounting for over 80% of total As in these samples. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Intercalation of anionic organic ultraviolet ray absorbers into layered zinc hydroxide nitrate.

    Science.gov (United States)

    Cursino, Ana Cristina Trindade; Gardolinski, José Eduardo Ferreira da Costa; Wypych, Fernando

    2010-07-01

    Layered zinc hydroxide nitrate (ZHN) was synthesized and nitrate ions were topotactically exchanged with three different anionic species of commercial organic ultraviolet (UV) ray absorbers: 2-mercaptobenzoic acid, 2-aminobenzoic acid, and 4-aminobenzoic acid. The exchange reactions were confirmed by X-ray powder diffraction (XRPD), Fourier transform infrared spectroscopy (FTIR), ultraviolet visible (UV-Vis) spectroscopy, and thermal analysis (thermogravimetry, TGA, and differential thermal analysis, DTA). In all the anionic exchanged products, evidence of grafting of the organic species onto the inorganic matrix was obtained. In general, after intercalation/grafting, the UV absorption ability was improved in relation to the use of the parent organic material, showing that layered hydroxide salts (LHS) can be good alternative matrixes for the immobilization of organic species with UV-blocking properties in cosmetic products. Copyright 2010 Elsevier Inc. All rights reserved.

  1. Anion exchange separation of the light lanthanoids with nitric acid-methyl alcohol mixed media at elevated temperature

    International Nuclear Information System (INIS)

    Usuda, S.; Magara, M.

    1987-01-01

    Anion exchange chromatography with nitric acid-methyl alcohol mixed media at elevated temperature was applied to mutual separation of the light lanthanoids, La, Ce, Pr, Nd and Pm. The individual elements could be effectively separated from each other, main fission products and actinoids with 0.01M HNO 3 -90% CH 3 OH or 0.5M HNO 3 -80% CH 3 OH eluent at 90 deg C. (author) 14 refs.; 3 tables

  2. Determination of carbohydrates using pulsed amperometric detection combined with anion exchange separations

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, W.T.; Pohl, C.A.; Rubin, R.

    1987-06-01

    Carbohydrates, including the monosaccharides commonly found in wood and wood pulp hydrolyzates, are separated by anion exchange chromatography using hydroxide and acetate eluants and are determined using pulsed amperometric detection. The detection method is based on oxidizing the sugars in a flow-through electrochemical cell equipped with a gold working electrode. A repeating cycle of three potentials is used: the first to oxidize the carbohydrates and measure the current generated, and two subsequent pulses to clean the electrode surface of oxidation products. The method is fast, sensitive, and requires no pre-column derivatization. It is applied to a sample of hydrolyzed wood pulp, which can be analyzed after minimal sample preparation. Detection limits are of the order of 1 mg/kg for monosaccharides in a 50 micro L injection. (Refs. 8).

  3. Influence of concentration and hydrodynamic factors in sorption of iodine by anion-exchangers of the mass-transfer rate

    International Nuclear Information System (INIS)

    Sokolov, V.V.; Smirnov, N.N.

    1982-01-01

    An investigation of the joint influence of hydrodynamic and concentration factors in sorption of iodine by AV-17-8 and anion exchange resins on the mass-transfer coefficient is the subject of this report. The method of central composite rotatable experimental design was used for quantitative assessment and derivation of the appropriate equations. The investigation yielded the necessary regression equations satisfactorily describing the influence of all the factors in the mass-transfer coefficient. the optimal mass-transfer conditions were determined. On the basis of the values obtained, recommendations are made on the optimal hydrodynamic conditions of operation of equipment with pneumatic circulation of the ion-exchanger

  4. Fixation and separation of the elements thorium and uranium using anion exchange resins in nitrate solution

    International Nuclear Information System (INIS)

    Korgaonkar, V.

    1967-10-01

    The exchange of thorium and uranium between a strong base anion resin and a mixed water + ethanol solvent containing nitrate ions is studied. It is assumed that in the resin the thorium and uranium are fixed in the form of the complexes Th(NO 3 ) 6 2- and UO 2 (NO 3 ) 4 2- in solution these elements are present in the form of complexes having the general formula: Th(NO 3 ) 6-n n-2 and UO 2 (NO 3 ) 4-n n-2 It has been possible to deduce a law for the changes in the partition functions of thorium and uranium as a function of the concentrations of the various species in solution and of the complexing ion NO 3 . From this has been deduced the optimum operational conditions for separating a mixture of these two elements. Finally, in these conditions, the influence of a few interfering ions has been studied: Ba, Bi, Ce, La, Mo, Pb, Zr. The method proposed can be used either as a preparation, or for the dosage of thorium by a quantitative separation. (author) [fr

  5. Expression of the Sodium/Calcium/Potassium Exchanger, NCKX4, in Ameloblasts

    Science.gov (United States)

    Hu, Ping; Lacruz, Rodrigo S.; Smith, Charles E.; Smith, Susan M.; Kurtz, Ira; Paine, Michael L.

    2012-01-01

    Transcellular calcium transport is an essential activity in mineralized tissue formation, including dental hard tissues. In many organ systems, this activity is regulated by membrane-bound sodium/calcium (Na+/Ca2+) exchangers, which include the NCX and NCKX [sodium/calcium-potassium (Na+/Ca2+-K+ ) exchanger] proteins. During enamel maturation, when crystals expand in thickness, Ca2+ requirements vastly increase but exactly how Ca2+ traffics through ameloblasts remains uncertain. Previous studies have shown that several NCX proteins are expressed in ameloblasts, although no significant shifts in expression were observed during maturation which pointed to the possible identification of other Ca2+ membrane transporters. NCKX proteins are encoded by members of the solute carrier gene family, Slc24a, which include 6 different proteins (NCKX1–6). NCKX are bidirectional electrogenic transporters regulating Ca2+ transport in and out of cells dependent on the transmembrane ion gradient. In this study we show that all NCKX mRNAs are expressed in dental tissues. Real-time PCR indicates that of all the members of the NCKX group, NCKX4 is the most highly expressed gene transcript during the late stages of amelogenesis. In situ hybridization and immunolocalization analyses clearly establish that in the enamel organ, NCKX4 is expressed primarily by ameloblasts during the maturation stage. Further, during the mid-late maturation stages of amelogenesis, the expression of NCKX4 in ameloblasts is most prominent at the apical poles and at the lateral membranes proximal to the apical ends. These data suggest that NCKX4 might be an important regulator of Ca2+ transport during amelogenesis. PMID:22677781

  6. Evolutionary relationships and functional diversity of plant sulfate transporters.

    Science.gov (United States)

    Takahashi, Hideki; Buchner, Peter; Yoshimoto, Naoko; Hawkesford, Malcolm J; Shiu, Shin-Han

    2011-01-01

    Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR, and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal SUL and animal anion exchangers (SLC26). The lineage of plant SULTR family is expanded into four subfamilies (SULTR1-SULTR4) in land plant species. By contrast, the putative SULTR homologs from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4), and the other diverged before the appearance of lineages for SUL, SULTR, and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13) and plant tonoplast-localized dicarboxylate transporters (TDT). The putative sulfur-sensing protein (SAC1) and SAC1-like transporters (SLT) of Chlorophyte green algae, bryophyte, and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.

  7. Evolutionary relationships and functional diversity of plant sulfate transporters

    Directory of Open Access Journals (Sweden)

    Hideki eTakahashi

    2012-01-01

    Full Text Available Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal sulfate transporters (SUL and animal anion exchangers (SLC26. The lineage of plant SULTR family is expanded into four subfamilies (SULTR1 to SULTR4 in land plant species. By contrast, the putative SULTR homologues from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4, and the other diverged before the appearance of lineages for SUL, SULTR and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13 and plant tonoplast-localized dicarboxylate transporters (TDT. The putative sulfur-sensing protein (SAC1 and SAC1-like transporters (SLT of Chlorophyte green algae, bryophyte and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is completely absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.

  8. Quantification of genetically modified soya using strong anion exchange chromatography and time-of-flight mass spectrometry.

    Science.gov (United States)

    Chang, Po-Chih; Reddy, P Muralidhar; Ho, Yen-Peng

    2014-09-01

    Stable-isotope dimethyl labeling was applied to the quantification of genetically modified (GM) soya. The herbicide-resistant gene-related protein 5-enolpyruvylshikimate-3-phosphate synthase (CP4 EPSPS) was labeled using a dimethyl labeling reagent, formaldehyde-H2 or -D2. The identification and quantification of CP4 EPSPS was performed using matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS). The CP4 EPSPS protein was separated from high abundance proteins using strong anion exchange chromatography and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Then, the tryptic peptides from the samples and reference were labeled with formaldehyde-H2 and formaldehyde-D2, respectively. The two labeled pools were mixed and analyzed using MALDI-MS. The data showed a good correlation between the peak ratio of the H- and D-labeled peptides and the GM soya percentages at 0.5, 1, 3, and 5 %, with R (2) of 0.99. The labeling reagents are readily available. The labeling experiments and the detection procedures are simple. The approach is useful for the quantification of GM soya at a level as low as 0.5 %.

  9. Expression of Anion Exchanger 1 Sequestrates p16 in the Cytoplasm in Gastric, Colonic Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Wei-Wei Shen

    2007-10-01

    Full Text Available p16INK4A (p16 binds to cyclin-dependent kinase 4/6, negatively regulates cell growth. Recent studies have led to an understanding of additional biologic functions for p16; however, the detailed mechanisms involved are still elusive. In this article, we show an unexpected expression of anion exchanger 1 (AEi in the cytoplasm in poorly, moderately differentiated gastric, colonic adenocarcinoma cells, in its interaction with p16, thereby sequestrating the protein in the cytoplasm. Genetic alterations of p16, AEi were not detectable. Forced expression of AEi in these cells sequestrated more p16 in the cytoplasm, whereas small interfering RNA-mediated silencing of AEi in the cells induced the release of p16 from the cytoplasm to the nucleus, leading to cell death, growth inhibition of tumor cells. By analyzing tissue samples obtained from patients with gastric, colonic cancers, we found that 83.33% of gastric cancers, 56.52% of colonic cancers coexpressed AEi, p16 in the cytoplasm. We conclude that AEi plays a crucial role in the pathogenesis of gastric, colonic adenocarcinoma, that p16 dysfunction is a novel pathway of carcinogenesis.

  10. STANFORD: Highly polarized SLC electron beams

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium

  11. Multiple Calcium Export Exchangers and Pumps Are a Prominent Feature of Enamel Organ Cells

    Science.gov (United States)

    Robertson, Sarah Y. T.; Wen, Xin; Yin, Kaifeng; Chen, Junjun; Smith, Charles E.; Paine, Michael L.

    2017-01-01

    Calcium export is a key function for the enamel organ during all stages of amelogenesis. Expression of a number of ATPase calcium transporting, plasma membrane genes (ATP2B1-4/PMCA1-4), solute carrier SLC8A genes (sodium/calcium exchanger or NCX1-3), and SLC24A gene family members (sodium/potassium/calcium exchanger or NCKX1-6) have been investigated in the developing enamel organ in earlier studies. This paper reviews the calcium export pathways that have been described and adds novel insights to the spatiotemporal expression patterns of PMCA1, PMCA4, and NCKX3 during amelogenesis. New data are presented to show the mRNA expression profiles for the four Atp2b1-4 gene family members (PMCA1-4) in secretory-stage and maturation-stage rat enamel organs. These data are compared to expression profiles for all Slc8a and Slc24a gene family members. PMCA1, PMCA4, and NCKX3 immunolocalization data is also presented. Gene expression profiles quantitated by real time PCR show that: (1) PMCA1, 3, and 4, and NCKX3 are most highly expressed during secretory-stage amelogenesis; (2) NCX1 and 3, and NCKX6 are expressed during secretory and maturation stages; (3) NCKX4 is most highly expressed during maturation-stage amelogenesis; and (4) expression levels of PMCA2, NCX2, NCKX1, NCKX2, and NCKX5 are negligible throughout amelogenesis. In the enamel organ PMCA1 localizes to the basolateral membrane of both secretory and maturation ameloblasts; PMCA4 expression is seen in the basolateral membrane of secretory and maturation ameloblasts, and also cells of the stratum intermedium and papillary layer; while NCKX3 expression is limited to Tomes' processes, and the apical membrane of maturation-stage ameloblasts. These new findings are discussed in the perspective of data already present in the literature, and highlight the multiplicity of calcium export systems in the enamel organ needed to regulate biomineralization. PMID:28588505

  12. Multiple Calcium Export Exchangers and Pumps Are a Prominent Feature of Enamel Organ Cells

    Directory of Open Access Journals (Sweden)

    Sarah Y. T. Robertson

    2017-05-01

    Full Text Available Calcium export is a key function for the enamel organ during all stages of amelogenesis. Expression of a number of ATPase calcium transporting, plasma membrane genes (ATP2B1-4/PMCA1-4, solute carrier SLC8A genes (sodium/calcium exchanger or NCX1-3, and SLC24A gene family members (sodium/potassium/calcium exchanger or NCKX1-6 have been investigated in the developing enamel organ in earlier studies. This paper reviews the calcium export pathways that have been described and adds novel insights to the spatiotemporal expression patterns of PMCA1, PMCA4, and NCKX3 during amelogenesis. New data are presented to show the mRNA expression profiles for the four Atp2b1-4 gene family members (PMCA1-4 in secretory-stage and maturation-stage rat enamel organs. These data are compared to expression profiles for all Slc8a and Slc24a gene family members. PMCA1, PMCA4, and NCKX3 immunolocalization data is also presented. Gene expression profiles quantitated by real time PCR show that: (1 PMCA1, 3, and 4, and NCKX3 are most highly expressed during secretory-stage amelogenesis; (2 NCX1 and 3, and NCKX6 are expressed during secretory and maturation stages; (3 NCKX4 is most highly expressed during maturation-stage amelogenesis; and (4 expression levels of PMCA2, NCX2, NCKX1, NCKX2, and NCKX5 are negligible throughout amelogenesis. In the enamel organ PMCA1 localizes to the basolateral membrane of both secretory and maturation ameloblasts; PMCA4 expression is seen in the basolateral membrane of secretory and maturation ameloblasts, and also cells of the stratum intermedium and papillary layer; while NCKX3 expression is limited to Tomes' processes, and the apical membrane of maturation-stage ameloblasts. These new findings are discussed in the perspective of data already present in the literature, and highlight the multiplicity of calcium export systems in the enamel organ needed to regulate biomineralization.

  13. Subsidence of the pit slab at SLC experimental hall

    International Nuclear Information System (INIS)

    Inaba, J.; Himeno, Yoichi; Katsura, Yutaka

    1992-01-01

    Detectors installed at particle accelerator facilities are quite heavy, weighing thousands of tons. On the other hand, ground subsidence caused by the installation of a detector adversely affects the beam line alignment of the collider. It becomes, therefore, very important to figure out the expected amount of ground settlement by means of adequate evaluation methods in advance. At Stanford Linear Accelerator Center (SLAC), a 1700 mT (metric tons) Mark II detector was replaced with a 4000 mT SLD detector in Stanford Linear Collider (SLC). The exchange started in December 1990 and lasted until March 1991, and the amount of ground settlement was measured by SLAC during that period. We performed simulation studies to evaluate the subsidence of the pit slab using several analysis methods. Parameters used for the analyses were decided based on the information of the SLC structure and the ground conditions at the SLAC area. The objective of this study is to verify the applicability of several simulation methods by comparing the analytical results with the actual subsidence data obtained by SLAC

  14. Separation of gold, palladium and platinum in chromite by anion exchange chromatography for inductively coupled plasma atomic emission spectrometric analysis

    International Nuclear Information System (INIS)

    Choi, Kwang Soon; Lee, Chang Heon; Park, Yeong Jae; Joe, Kih Soo; Kim, Won Ho

    2001-01-01

    A study has been carried out on the separation of gold, iridium, palladium, rhodium, ruthenium and platinum in chromite samples and their quantitative determination using inductively coupled plasma atomic emission spectrometry (ICP-AES). The dissolution condition of the minerals by fusion with sodium peroxide was optimized and chromatographic elution behavior of the rare metals was investigated by anion exchange chromatography. Spectral interference of chromium, a matrix of the minerals, was investigated on determination of gold. Chromium interfered on determination of gold at the concentration of 500 mg/L and higher. Gold plus trace amounts of iridium, palladium, rhodium and ruthenium, which must be preconcentrated before ICP-AES was separated by anion exchange chromatography after reducing Cr(VI) to Cr(III) by H 2 O 2 . AuCl - 4 retained on the resin column was selectively eluted with acetone- HNO 3 -H 2 O as an eluent. In addition, iridium, palladium, rhodium and ruthenium remaining on the resin column were eluted as a group with concentrated HCl. However, platinum was eluted with concentrated HNO 3 . The recovery yield of gold with acetone-HNO 3 -H 2 O was 100.7 ± 2.0 % , and the yields of palladium and platinum with concentrated HCl and HNO 3 were 96.1 ± 1.8% and 96.6 ± 1.3%, respectively. The contents of gold and platinum in a Mongolian chromite sample were 32.6 ± 2.2 μg/g and 1.6 ± 0.14 μg/g, respectively. Palladium was not detected

  15. The SLC control system - status and development

    International Nuclear Information System (INIS)

    Phinney, N.; Shoaee, H.

    1987-03-01

    The SLC control system is installed and operational in the full SLC through the Linac, Damping Rings, Positron Source, Arcs and Final Focus. The system now includes a host VAX 11/785, a development VAX 11/780, 4 VAX workstations, a distributed network of 70 microprocessors, and about 270 Camac crates with more than 4000 modules. The micros are used for control and monitoring of the hardware, for pulse-to-pulse feedback, and for consoles (COWs). High level model-driven host software provides a variety of tools for beam setup, optimization, diagnosis, and stabilization. This paper will summarize the current status and projects under development

  16. Simultaneous determination of neonicotinoid insecticides and insect growth regulators residues in honey using LC-MS/MS with anion exchanger-disposable pipette extraction.

    Science.gov (United States)

    Song, Shiming; Zhang, Cuifang; Chen, Zhaojie; He, Fengmei; Wei, Jie; Tan, Huihua; Li, Xuesheng

    2018-07-06

    In this study, we developed an anion exchanger-disposable pipette extraction (DPX) method to detect the residual concentrations of eight neonicotinoid insecticides (dinotefuran, acetamiprid, clothianidin, thiacloprid, imidachloprid, imidaclothiz, nitenpyram, and thiamethoxam) and eight insect growth regulators (IGRs; triflumuron, cyromazine, buprofezin, methoxyfenozide, tebufenozide, chromafenozide, fenoxycarb, and RH 5849) in Chinese honey samples collected from different floral sources and different geographical regions using liquid chromatography tandem mass spectrometry (LC-MS/MS). QAE Sephadex A-25 was used as the anion exchanger in the DPX column for the purification and cleanup of honey samples. Analytes were eluted with a mixture of acetonitrile and 0.1 M HCl, and the elution was subjected to LC analysis. This method was thoroughly validated for its reproducibility, linearity, trueness, and recovery. Satisfactory recovery of pesticides was obtained ranging from 72% to 111% with intraday RSDs (n = 5) of 1%-10%. High linearity (R 2  ≥ 0.9987) was observed for all 16 pesticides. Limits of detection and quantification for all 16 compounds ranged from 0.3 to 3 μg/kg and from 1 to 10 μg/kg, respectively. Pesticide residues (9-113 μg/kg) were found in Chinese honey samples. The anion exchanger-DPX method was effective for removing sugars and retaining target analytes. Moreover, this method was highly reliable and sensitive for detecting neonicotinoids and IGRs in different floral sources of honey and will be applicable to matrixes with high sugar content. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Anion exchange chromatography of 99mTc(Sn)-EHDP complexes: determination of the charge of the components and influence of pH and ligand concentration

    International Nuclear Information System (INIS)

    Huigen, Y.M.; Diender, M.; Gelsema, W.J.; De Ligny, C.L.

    1991-01-01

    The components of a 99m Tc(Sn)-EHDP complex mixture were separated by means of normal pressure and high-pressure anion exchange chromatography. Precautions were taken to prevent the dissociation of the complexes during chromatography. The charges of the components were determined according to the methods of Wilson and Pinkerton (1985) and Russell and Bischoff (1985). The values of the charges obtained with the two methods are not in agreement. Russell and Bischoff's method, in which a reference ion is used, must be preferred. However, even with this method the accuracy of the data obtained is probably limited, due to the difficulty of making corrections for activity coefficients of highly-charge ions at the rather high electrolyte concentrations that must be used in the ion exchange method. So, we think that it is only warranted to conclude that the mean charge of the components of 99m Tc(Sn)-EHDP is about -6 at pH 7, and that the charges of the individual components are in the range of -4 to -9. The influence of pH and ligand concentration in the reaction mixture was determined with high pressure anion exchange chromatography. It was found that a decrease in the pH of the reaction mixture favours the production of complexes with a long retention time, which leads to a slightly higher mean charge. The ligand concentration of the reaction mixture scarcely influenced the relative concentrations of the components. (author)

  18. A new route of oxygen isotope exchange in the solid phase: demonstration in CuSO4.5H2O.

    Science.gov (United States)

    Danon, Albert; Saig, Avraham; Finkelstein, Yacov; Koresh, Jacob E

    2005-11-10

    Temperature-programmed desorption mass spectrometry (TPD-MS) measurements on [(18)O]water-enriched copper sulfate pentahydrate (CuSO(4).5H(2)(18)O) reveal an unambiguous occurrence of efficient oxygen isotope exchange between the water of crystallization and the sulfate in its CuSO(4) solid phase. To the best of our knowledge, the occurrence of such an exchange was never observed in a solid phase. The exchange process was observed during the stepwise dehydration (50-300 degrees C) of the compound. Specifically, the exchange promptly occurs somewhere between 160 and 250 degrees C; however, the exact temperature could not be resolved conclusively. It is shown that only the fifth, sulfate-associated, anionic H(2)O molecule participates in the exchange process and that the exchange seems to occur in a preferable fashion with, at the most, one oxygen atom in SO(4). Such an exchange, occurring below 250 degrees C, questions the common conviction of unfeasible oxygen exchange under geothermic conditions. This new oxygen exchange phenomenon is not exclusive to copper sulfate but is unambiguously observed also in other sulfate- and nitrate-containing minerals.

  19. The SLC polarized electron source

    International Nuclear Information System (INIS)

    Clendenin, J.E.

    1990-10-01

    A polarized electron source consisting of a 3-electrode photocathode gun and a flashlamp-pumped dye laser has been designed and built for the SLC and is currently undergoing commissioning. The source is described, and the operating configuration is discussed. The present status of the source and future plans are briefly indicated. 7 refs., 4 figs

  20. Ion-exclusion/cation-exchange chromatography with dual detection of the conductivity and spectrophotometry for the simultaneous determination of common inorganic anionic species and cations in river and wastewater.

    Science.gov (United States)

    Nakatani, Nobutake; Kozaki, Daisuke; Mori, Masanobu; Hasebe, Kiyoshi; Nakagoshi, Nobukazu; Tanaka, Kazuhiko

    2011-01-01

    Simultaneous determinations of common inorganic anionic species (SO(4)(2-), Cl(-), NO(3)(-), phosphate and silicate) and cations (Na(+), NH(4)(+), K(+), Mg(2+) and Ca(2+)) were conducted using an ion-chromatography system with dual detection of conductivity and spectrophotometry in tandem. The separation of ionic species on a weakly acidic cation-exchange resin was accomplished using a mixture of 100 mM ascorbic acid and 4 mM 18-crown-6 as an acidic eluent (pH 2.6), after which the ions were detected using a conductivity detector. Subsequently, phosphate and silicate were analyzed based on derivatization with molybdate and spectrophotometry at 700 nm. The detection limits at S/N = 3 ranged from 0.11 to 2.9 µM for analyte ionic species. This method was applied to practical river water and wastewater with acceptable criteria for the anion-cation balance and comparisons of the measured and calculated electrical conductivity, demonstrating the usefulness of the present method for water quality monitoring.

  1. Partitioning of hydrophobic pesticides within a soil-water-anionic surfactant system.

    Science.gov (United States)

    Wang, Peng; Keller, Arturo A

    2009-02-01

    Surfactants can be added to pesticide-contaminated soils to enhance the treatment efficiency of soil washing. Our results showed that pesticide (atrazine and diuron) partitioning and desorbability within a soil-water-anionic surfactant system is soil particle-size dependent and is significantly influenced by the presence of anionic surfactant. Anionic surfactant (linear alkylbenzene sulphonate, LAS) sorption was influenced by its complexation with both the soluble and exchangeable divalent cations in soils (e.g. Ca2+, Mg2+). In this study, we propose a new concept: soil system hardness which defines the total amount of soluble and exchangeable divalent cations associated with a soil. Our results showed that anionic surfactant works better with soils having lower soil system hardness. It was also found that the hydrophobic organic compounds (HOCs) sorbed onto the LAS-divalent cation precipitate, resulting in a significant decrease in the aqueous concentration of HOC. Our results showed that the effect of exchangeable cations and sorption of HOC onto the surfactant precipitates needs to be considered to accurately predict HOC behavior within soil-water-anionic surfactant systems.

  2. IMPROVING OF ANION EXCHANGERES REGENERATION

    Directory of Open Access Journals (Sweden)

    Muzher M. Ibrahim

    2013-05-01

    Full Text Available Inthis study, Different basis [NaOH and KOH] of variable concentration are usedto reactivate Anion exchangers employing different schemes .The Laboratoryresults showed large improvement in efficiency of these exchangers ( i.eoperating time was increased from 12 to 42 hours .The results of this work showed that the environmentalload (waste water can be reduced greatly when using the proposed regenerationscheme .

  3. Simultaneous determination of inorganic and organic anions by ion chromatography

    International Nuclear Information System (INIS)

    Park, Yang Soon; Joe, Ki Soo; Han, Sun Ho; Park, Soon Dal; Choi, Kwang Soon

    1999-06-01

    Four methods were investigated for the simultaneous determination of several inorganic and organic anions in aqueous solution by ion chromatography. The first is two columns coupled system. The second is the gradient elution system with an anion exchange column. The third is the system with a mixed-mode stationary phase. The fourth is the system with an anion exchange column and the eluant of low conductivity without ion suppressor. The advantages and disadvantages of individual systems were discussed. The suitable methods were proposed for the application to the samples of the nuclear power industry and the environment. (author)

  4. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    Science.gov (United States)

    Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495

  5. A common SLC26A4-linked haplotype underlying non-syndromic hearing loss with enlargement of the vestibular aqueduct

    DEFF Research Database (Denmark)

    Chattaraj, Parna; Munjal, Tina; Honda, Keiji

    2017-01-01

    BACKGROUND: Enlargement of the vestibular aqueduct (EVA) is the most common radiological abnormality in children with sensorineural hearing loss. Mutations in coding regions and splice sites of the SLC26A4 gene are often detected in Caucasians with EVA. Approximately one-fourth of patients with E...

  6. Enhanced biocatalytic production of L-cysteine by Pseudomonas sp. B-3 with in situ product removal using ion-exchange resin.

    Science.gov (United States)

    Wang, Pu; He, Jun-Yao; Yin, Jiang-Feng

    2015-03-01

    Bioconversion of DL-2-amino-Δ(2)-thiazoline-4-carboxylic acid (DL-ATC) catalyzed by whole cells of Pseudomonas sp. was successfully applied for the production of L-cysteine. It was found, however, like most whole-cell biocatalytic processes, the accumulated L-cysteine produced obvious inhibition to the activity of biocatalyst and reduced the yield. To improve L-cysteine productivity, an anion exchange-based in situ product removal (ISPR) approach was developed. Several anion-exchange resins were tested to select a suitable adsorbent used in the bioconversion of DL-ATC for the in situ removal of L-cysteine. The strong basic anion-exchange resin 201 × 7 exhibited the highest adsorption capacity for L-cysteine and low adsorption for DL-ATC, which is a favorable option. With in situ addition of 60 g L(-1) resin 201 × 7, the product inhibition can be reduced significantly and 200 mmol L(-1) of DL-ATC was converted to L-cysteine with 90.4 % of yield and 28.6 mmol L(-1 )h(-1) of volumetric productivity. Compared to the bioconversion without the addition of resin, the volumetric productivity of L-cysteine was improved by 2.27-fold using ISPR method.

  7. A procedure for reducing the concentration of hydrogen ions in acid anionic eluate and equipment therefore

    International Nuclear Information System (INIS)

    Parobek, P.; Baloun, S.; Plevac, S.

    1989-01-01

    The method is described of reducing the concentration of hydrogen ions in acid anionic eluate produced in the separation of uranium or other metals, in which anion exchanger elution, precipitation, filtration and precipitate and anion exchanger washing are used. The technological line for such elution comprises at least one ion exchange column and at least one container. They together form the first and the second stages of preparation of the acid anion elution solution, the sorption-elution separation of hydrogen ions on an cation exchanger being inserted between them. The preparation of the solution is divide into two stages. In the first stage, the acid and part of the solution for the preparation of the acid anion elution solution are supplied. The resulting enriched acid elution solution is fe onto the cation exchanger where the hydrogen ion concentration i reduced. It is then carried into the second stage where it is mixed with the remaining part of the solution. (B.S.)

  8. Beam-based alignment technique for the SLC [Stanford Linear Collider] linac

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Lavine, T.L.; Atwood, W.B.

    1989-03-01

    Misalignment of quadrupole magnets and beam position monitors (BPMs) in the linac of the SLAC Linear Collider (SLC) cause the electron and positron beams to be steered off-center in the disk-loaded waveguide accelerator structures. Off-center beams produce wakefields which limit the SLC performance at high beam intensities by causing emittance growth. Here, we present a general method for simultaneously determining quadrupole magnet and BPM offsets using beam trajectory measurements. Results from the application of the method to the SLC linac are described. The alignment precision achieved is approximately 100 μm, which is significantly better than that obtained using optical surveying techniques. 2 refs., 4 figs

  9. Method for the direct determination of available carbohydrates in low-carbohydrate products using high-performance anion exchange chromatography.

    Science.gov (United States)

    Ellingson, David; Potts, Brian; Anderson, Phillip; Burkhardt, Greg; Ellefson, Wayne; Sullivan, Darryl; Jacobs, Wesley; Ragan, Robert

    2010-01-01

    An improved method for direct determination of available carbohydrates in low-level products has been developed and validated for a low-carbohydrate soy infant formula. The method involves modification of an existing direct determination method to improve specificity, accuracy, detection levels, and run times through a more extensive enzymatic digestion to capture all available (or potentially available) carbohydrates. The digestion hydrolyzes all common sugars, starch, and starch derivatives down to their monosaccharide components, glucose, fructose, and galactose, which are then quantitated by high-performance anion-exchange chromatography with photodiode array detection. Method validation consisted of specificity testing and 10 days of analyzing various spike levels of mixed sugars, maltodextrin, and corn starch. The overall RSD was 4.0% across all sample types, which contained within-day and day-to-day components of 3.6 and 3.4%, respectively. Overall average recovery was 99.4% (n = 10). Average recovery for individual spiked samples ranged from 94.1 to 106% (n = 10). It is expected that the method could be applied to a variety of low-carbohydrate foods and beverages.

  10. Anion complexation by calix[4]arene–TTF conjugates

    Czech Academy of Sciences Publication Activity Database

    Flídrová, K.; Tkadlecová, M.; Lang, Kamil; Lhoták, P.

    2012-01-01

    Roč. 92, č. 1 (2012), s. 668-673 ISSN 0143-7208 R&D Projects: GA ČR GA203/09/0691 Institutional research plan: CEZ:AV0Z40320502 Keywords : calix[4]arene * tetrathiafulvalene * anion recognition * receptor * NMR titration * UV/vis spectroscopy Subject RIV: CA - Inorganic Chemistry Impact factor: 3.532, year: 2012

  11. Anion exchange membranes based on terminally crosslinked methyl morpholinium-functionalized poly(arylene ether sulfone)s

    Science.gov (United States)

    Kwon, Sohyun; Rao, Anil H. N.; Kim, Tae-Hyun

    2018-01-01

    Azide-assisted terminal crosslinking of methyl morpholinium-functionalized poly(arylene ether sulfone) block copolymers yields products (xMM-PESs) suitable for use as anion exchange membranes. By combining the advantages of bulky morpholinium conductors and our unique polymer network crosslinked only at the termini of the polymer chains, we can produce AEMs that after the crosslinking show minimal loss in conductivity, yet with dramatically reduced water uptake. Terminal crosslinking also significantly increases the thermal, mechanical and chemical stability levels of the membranes. A high ion conductivity of 73.4 mS cm-1 and low water uptake of 26.1% at 80 °C are obtained for the crosslinked membrane with higher amount of hydrophilic composition, denoted as xMM-PES-1.5-1. In addition, the conductivity of the crosslinked xMM-PES-1.5-1 membrane exceeds that of its non-crosslinked counterpart (denoted as MM-PES-1.5-1) above 60 °C at 95% relative humidity because of its enhanced water retention capacity caused by the terminally-crosslinked structure.

  12. Study of ion exchange equilibrium and determination of heat of ion exchange by ion chromatography

    International Nuclear Information System (INIS)

    Liu Kailu; Yang Wenying

    1996-01-01

    Ion chromatography using pellicularia ion exchange resins and dilute solution can be devoted to the study of ion exchange thermodynamics and kinetics. Ion exchange equilibrium equation was obtained, and examined by the experiments. Based on ion exchange equilibrium, the influence of eluent concentration and resin capacity on adjusted retention volumes was examined. The effect of temperature on adjusted retention volumes was investigated and heats of ion exchange of seven anions were determined by ion chromatography. The interaction between anions and skeleton structure of resins were observed

  13. Effects of arginine on multimodal anion exchange chromatography.

    Science.gov (United States)

    Hirano, Atsushi; Arakawa, Tsutomu; Kameda, Tomoshi

    2015-12-01

    The effects of arginine on binding and elution properties of a multimodal anion exchanger, Capto adhere, were examined using bovine serum albumin (BSA) and a monoclonal antibody against interleukin-8 (mAb-IL8). Negatively charged BSA was bound to the positively charged Capto adhere and was readily eluted from the column with a stepwise or gradient elution using 1M NaCl at pH 7.0. For heat-treated BSA, small oligomers and remaining monomers were also eluted using a NaCl gradient, whereas larger oligomers required arginine for effective elution. The positively charged mAb-IL8 was bound to Capto adhere at pH 7.0. Arginine was also more effective for elution of the bound mAb-IL8 than was NaCl. The results imply that arginine interacts with the positively charged Capto adhere. The mechanism underlying the interactions of arginine with Capto adhere was examined by calculating the binding free energy between an arginine molecule and a Capto adhere ligand in water through molecular dynamics simulations. The overall affinity of arginine for Capto adhere is attributed to the hydrophobic and π-π interactions between an arginine side chain and the aromatic moiety of the ligand as well as hydrogen bonding between arginine and the ligand hydroxyl group, which may account for the characteristics of protein elution using arginine. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Matrix influences on the determination of common ions by using ion chromatography part 1--determination of inorganic anions.

    Science.gov (United States)

    Michalski, Rajmund; Lyko, Aleksandra; Kurzyca, Iwona

    2012-07-01

    Ion chromatography is the most popular instrumental analytical method used for the determination of anions and cations in water and wastewater. Isocratic ion chromatography with suppressed conductivity detection is frequently used in laboratories carrying out routine analyses of inorganic anions. The paper presents the results of the research into the influence of selected inorganic anions dominant in environmental samples (Cl(-), NO(3)(-), SO(4)(2-)) on the possibility of simultaneous determination of F(-), Cl(-), NO(2)(-), NO(3)(-), PO(4)(3-) and SO(4)(2-) with the application of this most popular ion chromatography type in standard separation conditions. Four Dionex and four Metrohm anion-exchange columns were tested in standard separation conditions recommended by their manufacturers with both standard solutions and environmental samples with complex matrix.

  15. Glycophorin C (Gerbich Antigen Blood Group) and Band 3 Polymorphisms in Two Malaria Holoendemic Regions of Papua New Guinea

    Science.gov (United States)

    Patel, Sheral S.; King, Christopher L.; Mgone, Charles S.; Kazura, James W.; Zimmerman, Peter A.

    2013-01-01

    The geographic overlap between the prevalence of erythrocyte polymorphisms and malaria endemicity is thought to be an example of natural selection on human populations. In Papua New Guinea (PNG), the Gerbich-negative phenotype is caused by an exon 3 deletion in the glycophorin C gene (GYPCΔex3) while heterozygosity for a 27-base pair deletion in the SLC4A1 gene (anion exchanger 1 or erythrocyte membrane protein, band 3), SLC4A1Δ27, results in Southeast Asian ovalocytosis. Two geographically and ethnically distinct malaria endemic regions of PNG (the Wosera [East Sepik Province] and Liksul [Madang Province]) were studied to illustrate the distribution of two prominent deletion polymorphisms (GYPCΔex3 and SLC4A1Δ27) and to determine if the genetic load associated with SLC4A1Δ27 would constrain independent assortment of GYPCΔex3 heterozygous and homozygous genotypes. The frequency of the GYPCΔex3 allele was higher in the Wosera (0.463) than Liksul (0.176) (χ2; P < 0.0001). Conversely, the frequency of the SLC4A1Δ27 allele was higher in Liksul (0.0740) than the Wosera (0.0005) (χ2; P < 0.0001). No individuals were homozygous for SLC4A1Δ27. In 355 Liksul residents, independent assortment of these two deletion polymorphisms resulted in 14 SLC4A1Δ27 carriers heterozygous for GYPCΔex3 and one SLC4A1Δ27 carrier homozygous for GYPCΔex3 (Fisher’s exact test; P = 0.8040). While homozygosity for SLC4A1Δ27 appears to be nonviable, the GYPCΔex3 allele is not lethal when combined with SLC4A1Δ27. Neither mutation was associated with altered susceptibility to asymptomatic Plasmodium falciparum or P. vivax infection. While these erythrocyte polymorphisms apparently have no effect on blood-stage malaria infection, their contribution to susceptibility to clinical malaria morbidity requires further study. PMID:14695625

  16. Therapeutic IgG4 antibodies engage in Fab-arm exchange with endogenous human IgG4 in vivo

    NARCIS (Netherlands)

    Labrijn, Aran F.; Buijsse, Antonio Ortiz; van den Bremer, Ewald T. J.; Verwilligen, Annemiek Y. W.; Bleeker, Wim K.; Thorpe, Susan J.; Killestein, Joep; Polman, Chris H.; Aalberse, Rob C.; Schuurman, Janine; van de Winkel, Jan G. J.; Parren, Paul W. H. I.

    Two humanized IgG4 antibodies, natalizumab and gemtuzumab, are approved for human use, and several others, like TGN1412, are or have been in clinical development. Although IgG4 antibodies can dynamically exchange half-molecules(1), Fab-arm exchange with therapeutic antibodies has not been

  17. Therapeutic IgG4 antibodies engage in Fab-arm exchange with endogenous human IgG4 in vivo

    NARCIS (Netherlands)

    Labrijn, Aran F.; Buijsse, Antonio Ortiz; van den Bremer, Ewald T. J.; Verwilligen, Annemiek Y. W.; Bleeker, Wim K.; Thorpe, Susan J.; Killestein, Joep; Polman, Chris H.; Aalberse, Rob C.; Schuurman, Janine; van de Winkel, Jan G. J.; Parren, Paul W. H. I.

    2009-01-01

    Two humanized IgG4 antibodies, natalizumab and gemtuzumab, are approved for human use, and several others, like TGN1412, are or have been in clinical development. Although IgG4 antibodies can dynamically exchange half-molecules, Fab-arm exchange with therapeutic antibodies has not been demonstrated

  18. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    Science.gov (United States)

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  19. Radiotracer application for characterization of nuclear grade anion exchange resins Tulsion A-23 and Dowex SBR LC

    International Nuclear Information System (INIS)

    Singare, P.U.

    2015-01-01

    Radio isotopic tracer technique as one of the versatile nondestructive technique is employed to evaluate the performance of nuclear grade anion exchange resins Tulsion A-23 and Dowex SBR LC. The evaluation was made on the basis of ion-isotopic exchange reaction kinetics by using 131 I and 82 Br radioactive tracer isotopes. It was observed that for both the resins, the values of specific reaction rate (min -1 ), amount of ion exchanged (mmol) and initial rate of ion exchange (mmol/min) were calculated to be lower for bromide ion-isotopic exchange reaction than that for iodide ion-isotopic exchange reaction. It was observed that for iodide ion-isotopic exchange reaction under identical experimental conditions of 30.0 C, 1.000 g of ion exchange resins and 0.001 mol/L labeled iodide ion solution, the values of specific reaction rate (min -1 ), amount of iodide ion exchanged (mmol), initial rate of iodide ion exchange (mmol/min) and log K d were calculated as 0.377, 0.212, 0.080 and 15.5 respectively for Dowex SBR LC resin, which was higher than 0.215, 0.144, 0.031 and 14.1 respectively as that obtained for Tulsion A23 resins. Also at a constant temperature of 30.0 C, as the concentration of labeled iodide ion solution increases from 0.001 mol/L to 0.004 mol/L, the percentage of iodide ions exchanged increases from 84.75 % to 90.20 % for Dowex SBR LC resins which was higher than increases from 57.66 % to 62.38 % obtained for Tulsion A23 resins. The identical trend was observed for the two resins during bromide ion-isotopic exchange reaction. The overall results indicate superior performance of Dowex SBR LC over Tulsion A23 resins under identical experimental conditions.

  20. Mixed retention mechanism of proteins in weak anion-exchange chromatography.

    Science.gov (United States)

    Liu, Peng; Yang, Haiya; Geng, Xindu

    2009-10-30

    Using four commercial weak anion-exchange chromatography (WAX) columns and 11 kinds of different proteins, we experimentally examined the involvement of hydrophobic interaction chromatography (HIC) mechanism in protein retention on the WAX columns. The HIC mechanism was found to operate in all four WAX columns, and each of these columns had a better resolution in the HIC mode than in the corresponding WAX mode. Detailed analysis of the molecular interactions in a chromatographic system indicated that it is impossible to completely eliminate hydrophobic interactions from a WAX column. Based on these results, it may be possible to employ a single WAX column for protein separation by exploiting mixed modes (WAX and HIC) of retention. The stoichiometric displacement theory and two linear plots were used to show that mechanism of the mixed modes of retention in the system was a combination of two kinds of interactions, i.e., nonselective interactions in the HIC mode and selective interactions in the IEC mode. The obtained U-shaped elution curve of proteins could be distinguished into four different ranges of salt concentration, which also represent four retention regions.