Congenital Chloride-Losing Diarrhea in a Mexican child with the novel homozygous SLC26A3 mutation G393W

Directory of Open Access Journals (Sweden)

Fabian R. Reimold

2015-06-01

Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.

Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

Science.gov (United States)

Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

2009-01-01

Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

The dopamine transporter protein gene (SLC6A3): Primary linage mapping and linkage studies in Tourette syndrome

Energy Technology Data Exchange (ETDEWEB)

Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others

1995-12-10

The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.

Hypothesis: SLC12A3 Polymorphism modifies thiazide hypersensitivity of antenatal Bartter syndrome to thiazide resistance.

Science.gov (United States)

Mammen, Cherry; Rupps, Rosemarie; Trnka, Peter; Boerkoel, Cornelius F

2012-02-01

We report a 5-year-old boy with thiazide-resistant Bartter syndrome. This is highly unusual since thiazide hypersensitivity is a common diagnostic finding in Bartter syndrome patients. Subsequent molecular testing identified compound heterozygosity for two novel mutations in KCNJ1, (c.556A > G and c.683G > A) which is associated with Bartter syndrome, and a paternally inherited polymorphism in SLC12A3 (c.791G > C). Mutations in SLC12A3 cause the thiazide-resistant tubulopathy Gitelman syndrome. Based on published studies of this polymorphism in SLC12A3 and the features of the proband's father, we postulate that this polymorphism modifies the phenotype of Bartter syndrome in the proband to thiazide resistance. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

Science.gov (United States)

Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

2009-10-15

3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

Identification of seven novel mutations including the first two genomic rearrangements in SLC26A3 mutated in congenital chloride diarrhea.

Science.gov (United States)

Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J

2001-09-01

Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.

Associação entre polimorfismo SLC6A3 3’UTR VNTR e a resposta ao tratamento da dependência de nicotina

Directory of Open Access Journals (Sweden)

Guilherme Rubino de Azevedo Focchi

2011-01-01

Full Text Available Objetivo: Avaliar a associação entre a resposta ao tratamento da dependência de nicotina com bupropiona e a presença do polimorfismo SLC6A3 3’UTR VNTR, localizado no gene que codifica o transportador dopaminérgico. Método: Foram acompanhados no Ambulatório de Tabagismo do Instituto de Psiquiatria da Faculdade de Medicina da USP 100 pacientes do sexo masculino com diagnóstico de dependência de nicotina, sem outras patologias. Todos receberam bupropiona até 300 mg ao dia por 12 semanas, associada à terapia cognitivo-comportamental em grupo. A Escala de Fagerström foi aplicada no início e no final do tratamento, e avaliou-se a parada do uso de cigarros na última semana de tratamento e um mês após. Os pacientes tiveram 10 ml de sangue colhidos e genotipados para a existência do polimorfismo SLC6A3 3’UTR VNTR. Resultados: Não foi encontrada associação entre cessação do uso de cigarro e presença do polimorfismo. Conclusão: São necessários mais estudos para avaliar se a presença do polimorfismo SLC6A3 3’UTR VNTR estaria relacionada à melhor resposta ao tratamento da dependência de nicotina.

SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

Science.gov (United States)

Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

2016-11-01

Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

Novel SLC19A3 Promoter Deletion and Allelic Silencing in Biotin-Thiamine-Responsive Basal Ganglia Encephalopathy.

Directory of Open Access Journals (Sweden)

Irene Flønes

Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.

SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

Science.gov (United States)

Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

2017-07-01

Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

Anesthetic propofol attenuates the isoflurane-induced caspase-3 activation and Aβ oligomerization.

Directory of Open Access Journals (Sweden)

Yiying Zhang

Full Text Available Accumulation and deposition of β-amyloid protein (Aβ are the hallmark features of Alzheimer's disease. The inhalation anesthetic isoflurane has been shown to induce caspase activation and increase Aβ accumulation. In addition, recent studies suggest that isoflurane may directly promote the formation of cytotoxic soluble Aβ oligomers, which are thought to be the key pathological species in AD. In contrast, propofol, the most commonly used intravenous anesthetic, has been reported to have neuroprotective effects. We therefore set out to compare the effects of isoflurane and propofol alone and in combination on caspase-3 activation and Aβ oligomerization in vitro and in vivo. Naïve and stably-transfected H4 human neuroglioma cells that express human amyloid precursor protein, the precursor for Aβ; neonatal mice; and conditioned cell culture media containing secreted human Aβ40 or Aβ42 were treated with isoflurane and/or propofol. Here we show for the first time that propofol can attenuate isoflurane-induced caspase-3 activation in cultured cells and in the brain tissues of neonatal mice. Furthermore, propofol-mediated caspase inhibition occurred when there were elevated levels of Aβ. Finally, isoflurane alone induces Aβ42, but not Aβ40, oligomerization, and propofol can inhibit the isoflurane-mediated oligomerization of Aβ42. These data suggest that propofol may mitigate the caspase-3 activation by attenuating the isoflurane-induced Aβ42 oligomerization. Our findings provide novel insights into the possible mechanisms of isoflurane-induced neurotoxicity that may aid in the development of strategies to minimize potential adverse effects associated with the administration of anesthetics to patients.

Hypotonic activation of the myo-inositol transporter SLC5A3 in HEK293 cells probed by cell volumetry, confocal and super-resolution microscopy.

Directory of Open Access Journals (Sweden)

Joseph Andronic

Full Text Available Swelling-activated pathways for myo-inositol, one of the most abundant organic osmolytes in mammalian cells, have not yet been identified. The present study explores the SLC5A3 protein as a possible transporter of myo-inositol in hyponically swollen HEK293 cells. To address this issue, we examined the relationship between the hypotonicity-induced changes in plasma membrane permeability to myo-inositol P ino [m/s] and expression/localization of SLC5A3. P ino values were determined by cell volumetry over a wide tonicity range (100-275 mOsm in myo-inositol-substituted solutions. While being negligible under mild hypotonicity (200-275 mOsm, P ino grew rapidly at osmolalities below 200 mOsm to reach a maximum of ∼ 3 nm/s at 100-125 mOsm, as indicated by fast cell swelling due to myo-inositol influx. The increase in P ino resulted most likely from the hypotonicity-mediated incorporation of cytosolic SLC5A3 into the plasma membrane, as revealed by confocal fluorescence microscopy of cells expressing EGFP-tagged SLC5A3 and super-resolution imaging of immunostained SLC5A3 by direct stochastic optical reconstruction microscopy (dSTORM. dSTORM in hypotonic cells revealed a surface density of membrane-associated SLC5A3 proteins of 200-2000 localizations/μm2. Assuming SLC5A3 to be the major path for myo-inositol, a turnover rate of 80-800 myo-inositol molecules per second for a single transporter protein was estimated from combined volumetric and dSTORM data. Hypotonic stress also caused a significant upregulation of SLC5A3 gene expression as detected by semiquantitative RT-PCR and Western blot analysis. In summary, our data provide first evidence for swelling-mediated activation of SLC5A3 thus suggesting a functional role of this transporter in hypotonic volume regulation of mammalian cells.

Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

Science.gov (United States)

Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

2013-01-01

Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

Directory of Open Access Journals (Sweden)

Karen M Vernau

Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

Association between the SLC6A3 A1343G polymorphism and schizophrenia Associação entre o polimorfismo A1343G do SLC6A3 e esquizofrenia

Directory of Open Access Journals (Sweden)

Quirino Cordeiro

2010-10-01

Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,05SLC6A3 A1343G mostrou associação com esquizofrenia na amostra estudada.

Lack of Association between a 3'UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

Science.gov (United States)

Aperecida da Silva, Maria; Cordeiro, Quirino; Louza, Mario; Vallada, Homero

2011-01-01

Objective: To investigate a possible association between a 3'UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients ("DSM-IV" criteria) and 479 healthy controls. The primers' sequence used were: 3'UTR-Forward: 5' TGT GGT…

Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families

Directory of Open Access Journals (Sweden)

Hemant Kulkarni

2016-01-01

Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.

The renal urate transporter SLC17A1 locus: confirmation of association with gout.

Science.gov (United States)

Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

2012-04-27

Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

A mild form of SLC29A3 disorder: a frameshift deletion leads to the paradoxical translation of an otherwise noncoding mRNA splice variant.

Directory of Open Access Journals (Sweden)

Alexandre Bolze

Full Text Available We investigated two siblings with granulomatous histiocytosis prominent in the nasal area, mimicking rhinoscleroma and Rosai-Dorfman syndrome. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous frameshift deletion in SLC29A3, which encodes human equilibrative nucleoside transporter-3 (hENT3. Germline mutations in SLC29A3 have been reported in rare patients with a wide range of overlapping clinical features and inherited disorders including H syndrome, pigmented hypertrichosis with insulin-dependent diabetes, and Faisalabad histiocytosis. With the exception of insulin-dependent diabetes and mild finger and toe contractures in one sibling, the two patients with nasal granulomatous histiocytosis studied here displayed none of the many SLC29A3-associated phenotypes. This mild clinical phenotype probably results from a remarkable genetic mechanism. The SLC29A3 frameshift deletion prevents the expression of the normally coding transcripts. It instead leads to the translation, expression, and function of an otherwise noncoding, out-of-frame mRNA splice variant lacking exon 3 that is eliminated by nonsense-mediated mRNA decay (NMD in healthy individuals. The mutated isoform differs from the wild-type hENT3 by the modification of 20 residues in exon 2 and the removal of another 28 amino acids in exon 3, which include the second transmembrane domain. As a result, this new isoform displays some functional activity. This mechanism probably accounts for the narrow and mild clinical phenotype of the patients. This study highlights the 'rescue' role played by a normally noncoding mRNA splice variant of SLC29A3, uncovering a new mechanism by which frameshift mutations can be hypomorphic.

Single nucleotide polymorphism rs13042395 in the SLC52A3 gene as a biomarker for regional lymph node metastasis and relapse-free survival of esophageal squamous cell carcinoma patients

International Nuclear Information System (INIS)

Tan, Hua-Zhen; Wu, Zhi-Yong; Wu, Jian-Yi; Long, Lin; Jiao, Ji-Wei; Peng, Yu-Hui; Xu, Yi-Wei; Li, Shan-Shan; Wang, Wei; Zhang, Jian-Jun; Li, En-Min; Xu, Li-Yan

2016-01-01

SLC52A3 was recently identified as a susceptibility gene for esophageal squamous cell carcinoma (ESCC). However, associations between the single nucleotide polymorphisms (SNPs) rs13042395 (C > T) and rs3746803 (G > A) in SLC52A3 and risk, tumor characteristics and survival of ESCC patients remain inconclusive and of unknown prognostic significance. Analyses of the association between SNPs in SLC52A3 and ESCC risk were performed on 479 ESCC cases, together with 479 controls, in a case-control study. Blood samples for cases and controls were collected and genotyped by real-time polymerase chain reaction (PCR) using TaqMan assays. Among the 479 ESCC cases, 343 cases with complete clinical data were used to investigate the association between SNPs and ESCC clinical characteristics; 288 cases with complete clinical data and 5-year follow-up data were used to analyze the association between SNPs and prognosis. Dual luciferase reporter assays and electrophoretic mobility shift assays (EMSAs) were used to investigate the biological function of rs13042395. No association was found between SLC52A3 rs3746803 and susceptibility, tumor characteristics or survival of ESCC patients. For rs13042395, TT genotype carriers were likely to have reduced lymph node metastasis (odds ratio (OR) = 0.55, 95 % confidence interval (CI), 0.31–0.98) and longer relapse-free survival time (P = 0.03) . Also, both rs13042395 (hazard ratio (HR) = 0.62, 95 % CI, 0.38–0.99) and regional lymph node metastasis (HR = 2.06, 95 % CI, 1.36–3.13 for N1 vs. N0; HR = 2.88, 95 % CI, 1.70–4.86 for N2 vs. N0; HR = 2.08, 95 % CI, 1.01–4.30 for N3 vs. N0) were independent factors affecting relapse-free survival for ESCC patients who underwent surgery. Dual luciferase reporter assays and EMSAs suggested that the CC genotype of rs13042395 enhanced SLC52A3 expression, probably via binding with specific transcription factors. The rs13042395 polymorphism in SLC52A3 is associated with regional lymph node

Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

LENUS (Irish Health Repository)

Murphy, Therese M

2012-02-01

BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

The cellular and subcellular localization of zinc transporter 7 in the mouse spinal cord

Science.gov (United States)

The present work addresses the cellular and subcellular localization of the zinc transporter 7 (ZNT7, SLC30a7) protein and the distribution of zinc ions (Zn2+) in the mouse spinal cord. Our results indicated that the ZNT7 immunoreactive neurons were widely distributed in the Rexed’s laminae of the g...

Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

OpenAIRE

Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

2014-01-01

Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

Implication of the oligomeric state of the N-terminal PTX3 domain in cumulus matrix assembly.

Science.gov (United States)

Ievoli, Elena; Lindstedt, Ragnar; Inforzato, Antonio; Camaioni, Antonella; Palone, Francesca; Day, Anthony J; Mantovani, Alberto; Salvatori, Giovanni; Salustri, Antonietta

2011-06-01

Pentraxin 3 (PTX3) plays a key role in the formation of the hyaluronan-rich matrix of the cumulus oophorus surrounding ovulated eggs that is required for successful fertilization and female fertility. PTX3 is a multimeric protein consisting of eight identical protomers held together by a combination of non-covalent interactions and disulfide bonds. Recent findings suggest that the oligomeric status of PTX3 is important for stabilizing the cumulus matrix. Because the role of PTX3 in the cumulus resides in the unique N-terminal sequence of the protomer, we investigated further this issue by testing the ability of distinct Cys/Ser mutants of recombinant N-terminal region of PTX3 (N(_)PTX3) with different oligomeric arrangement to promote in vitro normal expansion in cumuli from Ptx3-null mice. Here we report that the dimer of the N(_)PTX3 is unable to rescue cumulus matrix organization, and that the tetrameric assembly of the protein is the minimal oligomeric state required for accomplishing this function. We have previously demonstrated that PTX3 binds to HCs of IαI and TSG-6, which are essential for cumulus matrix formation and able to interact with hyaluronan. Interestingly, here we show by solid-phase binding experiments that the dimer of the N(_)PTX3 retains the ability to bind to both IαI and TSG-6, suggesting that the octameric structure of PTX3 provides multiple binding sites for each of these ligands. These findings support the hypothesis that PTX3 contributes to cumulus matrix organization by cross-linking HA polymers through interactions with multiple HCs of IαI and/or TSG-6. The N-terminal PTX3 tetrameric oligomerization was recently reported to be also required for recognition and inhibition of FGF2. Given that this growth factor has been detected in the mammalian preovulatory follicle, we wondered whether FGF2 negatively influences cumulus expansion and PTX3 may also serve in vivo to antagonize its activity. We found that a molar excess of FGF2, above

Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).

Science.gov (United States)

Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M

2015-12-07

The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.

Screening of ZnT8 autoantibodies in the diagnosis of autoimmune diabetes in a large French cohort.

Science.gov (United States)

Garnier, Lorna; Marchand, Lucien; Benoit, Marine; Nicolino, Marc; Bendelac, Nathalie; Wright, Catherine; Moulin, Philippe; Lombard, Christine; Thivolet, Charles; Fabien, Nicole

2018-03-01

Evaluate the added value of screening anti-ZnT8 antibodies (ZnT8A) in addition to the classical anti-GAD (GADA) and anti-IA-2 (IA-2A) antibodies for the diagnosis of type-1 diabetes (T1D) within a large cohort of both children and adults. Retrospective 2-year study including 516 patients (215 children, 301 adults) who had blood tests at diabetes onset and/or for diabetes classification. ZnT8A, GADA, and IA-2A were analyzed in all samples. Among those individuals included, 142 (28%) were ZnT8A-positive. A total of 228/516 suffered from T1D, of whom 110 (48%) were ZnT8A-positive and 166 (73%) GADA and/or IA-2A positive. When adding ZnT8A to GADA/IA-2A, 184 (81%) patients were positive for ≥1 Ab. Regarding the 122 patients at T1D onset, 75 (61%) were positive for ZnT8A and the proportion of patients with T1D with ≥1 Ab reached 89%. The highest prevalence of ZnT8A was observed in children aged 6-10years. Fourteen of the 124 patients positive for ZnT8A with a known clinical diagnosis suffered from a disease other than T1D. ZnT8A should be included in routine evaluation at diabetes onset and is a valuable biological marker to classify newly-diagnosed diabetics. The predictive value in our high-risk subjects has to be confirmed. Copyright © 2018 Elsevier B.V. All rights reserved.

Loss of synaptic zinc transport in progranulin deficient mice may contribute to progranulin-associated psychopathology and chronic pain.

Science.gov (United States)

Hardt, Stefanie; Heidler, Juliana; Albuquerque, Boris; Valek, Lucie; Altmann, Christine; Wilken-Schmitz, Annett; Schäfer, Michael K E; Wittig, Ilka; Tegeder, Irmgard

2017-11-01

Affective and cognitive processing of nociception contributes to the development of chronic pain and vice versa, pain may precipitate psychopathologic symptoms. We hypothesized a higher risk for the latter with immanent neurologic diseases and studied this potential interrelationship in progranulin-deficient mice, which are a model for frontotemporal dementia, a disease dominated by behavioral abnormalities in humans. Young naïve progranulin deficient mice behaved normal in tests of short-term memory, anxiety, depression and nociception, but after peripheral nerve injury, they showed attention-deficit and depression-like behavior, over-activity, loss of shelter-seeking, reduced impulse control and compulsive feeding behavior, which did not occur in equally injured controls. Hence, only the interaction of 'pain x progranulin deficiency' resulted in the complex phenotype at young age, but neither pain nor progranulin deficiency alone. A deep proteome analysis of the prefrontal cortex and olfactory bulb revealed progranulin-dependent alterations of proteins involved in synaptic transport, including neurotransmitter transporters of the solute carrier superfamily. In particular, progranulin deficiency was associated with a deficiency of nuclear and synaptic zinc transporters (ZnT9/Slc30a9; ZnT3/Slc30a3) with low plasma zinc. Dietary zinc supplementation partly normalized the attention deficit of progranulin-deficient mice, which was in part reminiscent of autism-like and compulsive behavior of synaptic zinc transporter Znt3-knockout mice. Hence, the molecular studies point to defective zinc transport possibly contributing to progranulin-deficiency-associated psychopathology. Translated to humans, our data suggest that neuropathic pain may precipitate cognitive and psychopathological symptoms of an inherent, still silent neurodegenerative disease. Copyright © 2017. Published by Elsevier B.V.

Molecular Properties of Drugs Interacting with SLC22 Transporters OAT1, OAT3, OCT1, and OCT2: A Machine-Learning Approach.

Science.gov (United States)

Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K

2016-10-01

Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue

Neuropathological characteristics of the brain in two patients with SLC19A3 mutations related to the biotin-thiamine-responsive basal ganglia disease

Directory of Open Access Journals (Sweden)

Maciej Pronicki

2017-06-01

Full Text Available Biotin-thiamine-responsive basal ganglia disease is a severe form of a rare neurogenetic disorder caused by pathogenic molecular variants in the thiamine transporter gene. Nowadays, a potentially effective treatment is known, therefore the early diagnosis is mandatory. The aim of the paper was to assess the contribution of neuropathological and magnetic resonance imaging (MRI studies to a proper diagnosis. We present the brain study of two Polish patients with SLC19A3 mutations, including (1 an infant with an intriguing “walnut” appearance of the brain autopsied many years before the discovery of the SLC19A3 defect, and (2 a one-year-old patient with clinical features of Leigh syndrome. In patient 2, biotin/thiamine responsiveness was not tested at the time of diagnosis and causal treatment started with one-year delay. The central nervous system lesions found in the patients displayed almost clearly a specific pattern for SLC19A3 defect, as previously proposed in diagnostic criteria. Our study presents a detailed description of neuropathological and MRI findings of both patients. We confirm that the autopsy and/or MRI of the brain is sufficient to qualify a patient with an unknown neuropathological disorder directly for SLC19A3 mutations testing and a prompt trial of specific treatment.

MicroRNA-129-5p Regulates Glycolysis and Cell Proliferation by Targeting the Glucose Transporter SLC2A3 in Gastric Cancer Cells

Directory of Open Access Journals (Sweden)

Di Chen

2018-05-01

Full Text Available Tumor cells increase their glucose consumption through aerobic glycolysis to manufacture the necessary biomass required for proliferation, commonly known as the Warburg effect. Accumulating evidences suggest that microRNAs (miRNAs interact with their target genes and contribute to metabolic reprogramming in cancer cells. By integrating high-throughput screening data and the existing miRNA expression datasets, we explored the roles of candidate glycometabolism-regulating miRNAs in gastric cancer (GC. Subsequent investigation of the characterized miRNAs indicated that miR-129-5p inhibits glucose metabolism in GC cells. miRNA-129-5p directly targets the 3′-UTR of SLC2A3, thereby suppressing glucose consumption, lactate production, cellular ATP levels, and glucose uptake of GC cells. In addition, the PI3K-Akt and MAPK signaling pathways are involved in the effects of the miR-129-5p/SLC2A3 axis, regulating GC glucose metabolism and growth. These results reveal a novel role of the miR-129-5p/SLC2A3 axis in reprogramming the glycometabolism process in GC cells and indicate a potential therapeutic target for the treatment of this disease.

Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

Science.gov (United States)

Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

2010-01-01

The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

Meta-analysis of the association of the SLC6A3 3'-UTR VNTR with cognition.

Science.gov (United States)

Ettinger, Ulrich; Merten, Natascha; Kambeitz, Joseph

2016-01-01

The gene coding for the dopamine transporter (DAT), SLC6A3, contains a 40-base pair variable number of tandem repeats (VNTR) polymorphism (rs28363170) in its 3' untranslated region. This VNTR has been associated with attention deficit hyperactivity disorder (ADHD) and has been investigated in relation to cognition and brain function. Here, we report the results of a comprehensive meta-analysis with meta-regression examining the association of the VNTR with different domains of cognition in healthy adults. We extracted data from 28 independent studies and carried out meta-analyses for associations with working memory (k=10 samples, N=1193 subjects), inhibition (k=8 samples, N=829 subjects), executive functions including inhibition (k=10 samples, N=984 subjects), attention (k=6 samples, N=742 subjects) and declarative long-term memory (k=5 samples, N=251 subjects). None of the investigated dimensions showed significant associations with the VNTR (all p>0.26). Meta-regression including year of publication, gender, age, ethnicity and percentage of 10R-homozygotes similarly did not attain significance. We conclude that there is no evidence that rs28363170 may be a significant predictor of cognitive function in healthy adults. Copyright © 2015 Elsevier Ltd. All rights reserved.

Spa47 is an oligomerization-activated type three secretion system (T3SS) ATPase from Shigella flexneri.

Science.gov (United States)

Burgess, Jamie L; Jones, Heather B; Kumar, Prashant; Toth, Ronald T; Middaugh, C Russell; Antony, Edwin; Dickenson, Nicholas E

2016-05-01

Gram-negative pathogens often use conserved type three secretion systems (T3SS) for virulence. The Shigella type three secretion apparatus (T3SA) penetrates the host cell membrane and provides a unidirectional conduit for injection of effectors into host cells. The protein Spa47 localizes to the base of the apparatus and is speculated to be an ATPase that provides the energy for T3SA formation and secretion. Here, we developed an expression and purification protocol, producing active Spa47 and providing the first direct evidence that Spa47 is a bona fide ATPase. Additionally, size exclusion chromatography and analytical ultracentrifugation identified multiple oligomeric species of Spa47 with the largest greater than 8 fold more active for ATP hydrolysis than the monomer. An ATPase inactive Spa47 point mutant was then engineered by targeting a conserved Lysine within the predicted Walker A motif of Spa47. Interestingly, the mutant maintained a similar oligomerization pattern as active Spa47, but was unable to restore invasion phenotype when used to complement a spa47 null S. flexneri strain. Together, these results identify Spa47 as a Shigella T3SS ATPase and suggest that its activity is linked to oligomerization, perhaps as a regulatory mechanism as seen in some related pathogens. Additionally, Spa47 catalyzed ATP hydrolysis appears to be essential for host cell invasion, providing a strong platform for additional studies dissecting its role in virulence and providing an attractive target for anti-infective agents. © 2016 The Protein Society.

In situ oligomerization of 2-(thiophen-3-yl)acetate intercalated into Zn{sub 2}Al layered double hydroxide

Energy Technology Data Exchange (ETDEWEB)

Tronto, Jairo, E-mail: jairotronto@ufv.br [Universidade Federal de Viçosa, Instituto de Ciências Exatas e Tecnológicas, Campus de Rio Parsanaíba, Rodovia BR 354 km 310, Cx. Postal 22, CEP, 38.810-000 Rio Paranaíba, MG (Brazil); Pinto, Frederico G.; Costa, Liovando M. da [Universidade Federal de Viçosa, Instituto de Ciências Exatas e Tecnológicas, Campus de Rio Parsanaíba, Rodovia BR 354 km 310, Cx. Postal 22, CEP, 38.810-000 Rio Paranaíba, MG (Brazil); Leroux, Fabrice; Dubois, Marc [Clermont Université, Université Blaise Pascal, Institut de Chimie de Clermont-Ferrand, BP 10448, F-63000 Clermont-Ferrand (France); CNRS, UMR 6296, ICCF, BP 80026, F-6317 Clermont-Ferrand (France); Valim, João B. [Universidade de São Paulo, Faculdade de Filosofia Ciências e Letras de Ribeirão Preto, Departamento de Química, Av. dos Bandeirantes 3900, CEP 14.040-901, Ribeirão Preto, SP (Brazil)

2015-01-15

A layered double hydroxide (LDH) with cation composition Zn{sub 2}Al was intercalated with 2-(thiophen-3-yl)acetate (3-TA) monomers. To achieve in situ polymerization and/or oligomerization of the intercalated monomers, soft thermal treatments were carried out, and subsequent hybrid LDH materials were analyzed by means of several characterization techniques using powder X-ray diffraction (PXRD), Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TGA), {sup 13}C CP–MAS nuclear magnetic resonance (NMR), electron spin resonance (EPR), scanning electron microscopy (SEM), and transmission electron microscopy (TEM), inductively coupled plasma optical emission spectroscopy (ICP–OES), and elemental analysis. PXRD analysis suggested that the intercalated monomers formed a bilayer. Thermal treatment of the hybrid LDH assembly above 120 °C provokes partially the breakdown of the layered structure, generating the phase zincite. EPR results indicated that vicinal monomers (oligomerization) were bound to each other after hydrothermal or thermal treatment, leading to a polaron response characteristic of electron conductivity localized on a restricted number of thiophene-based monomer segments. Localized unpaired electrons exist in the material and interact with the {sup 27}Al nuclei of the LDH layers by superhyperfine coupling. These unpaired electrons also interact with the surface of ZnO (O{sup 2−} vacancies), formed during the thermal treatments. - Graphical abstract: We synthesized a layered double hydroxide (LDH) with cation composition Zn{sub 2}Al, intercalated with 2-(thiophen-3-yl)acetate (3-TA) monomers, by coprecipitation at constant pH. We thermally treated the material, to achieve in situ polymerization and/or oligomerization of the intercalated monomers. - Highlights: • A Zn{sub 2}Al–LDH was intercalated with 2-(thiophen-3-yl)acetate monomers. • To achieve in situ oligomerization of the monomers, thermal treatments were made. �

Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

Science.gov (United States)

Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

2018-03-05

Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

Perinatal ω-3 polyunsaturated fatty acid supply modifies brain zinc homeostasis during adulthood

Science.gov (United States)

Jayasooriya, Anura P.; Ackland, M. Leigh; Mathai, Michael L.; Sinclair, Andrew J.; Weisinger, Harrison S.; Weisinger, Richard S.; Halver, John E.; Kitajka, Klára; Puskás, László G.

2005-01-01

Dietary ω-3 polyunsaturated fatty acid (PUFA) influences the expression of a number of genes in the brain. Zinc transporter (ZnT) 3 has been identified as a putative transporter of zinc into synaptic vesicles of neurons and is found in brain areas such as hippocampus and cortex. Neuronal zinc is involved in the formation of amyloid plaques, a major characteristic of Alzheimer's disease. The present study evaluated the influence of dietary ω-3 PUFA on the expression of the ZnT3 gene in the brains of adult male Sprague-Dawley rats. The rats were raised and/or maintained on a control (CON) diet that contained ω-3 PUFA or a diet deficient (DEF) in ω-3 PUFA. ZnT3 gene expression was analyzed by using real-time PCR, free zinc in brain tissue was determined by zinquin staining, and total zinc concentrations in plasma and cerebrospinal fluid were determined by atomic absorption spectrophotometry. Compared with CON-raised animals, DEF-raised animals had increased expression of ZnT3 in the brain that was associated with an increased level of free zinc in the hippocampus. In addition, compared with CON-raised animals, DEF-raised animals had decreased plasma zinc level. No difference in cerebrospinal fluid zinc level was observed. The results suggest that overexpression of ZnT3 due to a perinatal ω-3 PUFA deficiency caused abnormal zinc metabolism in the brain. Conceivably, the influence of dietary ω-3 PUFA on brain zinc metabolism could explain the observation made in population studies that the consumption of fish is associated with a reduced risk of dementia and Alzheimer's disease. PMID:15883362

Perinatal omega-3 polyunsaturated fatty acid supply modifies brain zinc homeostasis during adulthood.

Science.gov (United States)

Jayasooriya, Anura P; Ackland, M Leigh; Mathai, Michael L; Sinclair, Andrew J; Weisinger, Harrison S; Weisinger, Richard S; Halver, John E; Kitajka, Klára; Puskás, László G

2005-05-17

Dietary omega-3 polyunsaturated fatty acid (PUFA) influences the expression of a number of genes in the brain. Zinc transporter (ZnT) 3 has been identified as a putative transporter of zinc into synaptic vesicles of neurons and is found in brain areas such as hippocampus and cortex. Neuronal zinc is involved in the formation of amyloid plaques, a major characteristic of Alzheimer's disease. The present study evaluated the influence of dietary omega-3 PUFA on the expression of the ZnT3 gene in the brains of adult male Sprague-Dawley rats. The rats were raised and/or maintained on a control (CON) diet that contained omega-3 PUFA or a diet deficient (DEF) in omega-3 PUFA. ZnT3 gene expression was analyzed by using real-time PCR, free zinc in brain tissue was determined by zinquin staining, and total zinc concentrations in plasma and cerebrospinal fluid were determined by atomic absorption spectrophotometry. Compared with CON-raised animals, DEF-raised animals had increased expression of ZnT3 in the brain that was associated with an increased level of free zinc in the hippocampus. In addition, compared with CON-raised animals, DEF-raised animals had decreased plasma zinc level. No difference in cerebrospinal fluid zinc level was observed. The results suggest that overexpression of ZnT3 due to a perinatal omega-3 PUFA deficiency caused abnormal zinc metabolism in the brain. Conceivably, the influence of dietary omega-3 PUFA on brain zinc metabolism could explain the observation made in population studies that the consumption of fish is associated with a reduced risk of dementia and Alzheimer's disease.

Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

Directory of Open Access Journals (Sweden)

Kaifeng Yin

2017-05-01

Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

Catalytic Oligomerization of Terminal Alkynes by Lanthanide Carbyls (η5-C5Me5)2LnCH(SiMe3)2 (Ln = Y, La, Ce)

NARCIS (Netherlands)

Heeres, H.J.; Teuben, J.H.

1991-01-01

Lanthanide and group 3 carbyls Cp*2LnCH(SiMe3)2 (1, Ln = Y; 2, Ln = La; 3, Ln = Ce) are active catalyst precursors for the oligomerization of terminal alkynes HC≡CR (R = alkyl, aryl, SiMe3). The regioselectivity and the extent of oligomerization depend strongly on the lanthanide applied as well as

An Intramolecular Salt Bridge in Bacillus thuringiensis Cry4Ba Toxin Is Involved in the Stability of Helix α-3, Which Is Needed for Oligomerization and Insecticidal Activity.

Science.gov (United States)

Pacheco, Sabino; Gómez, Isabel; Sánchez, Jorge; García-Gómez, Blanca-Ines; Soberón, Mario; Bravo, Alejandra

2017-10-15

Bacillus thuringiensis three-domain Cry toxins kill insects by forming pores in the apical membrane of larval midgut cells. Oligomerization of the toxin is an important step for pore formation. Domain I helix α-3 participates in toxin oligomerization. Here we identify an intramolecular salt bridge within helix α-3 of Cry4Ba (D111-K115) that is conserved in many members of the family of three-domain Cry toxins. Single point mutations such as D111K or K115D resulted in proteins severely affected in toxicity. These mutants were also altered in oligomerization, and the mutant K115D was more sensitive to protease digestion. The double point mutant with reversed charges, D111K-K115D, recovered both oligomerization and toxicity, suggesting that this salt bridge is highly important for conservation of the structure of helix α-3 and necessary to promote the correct oligomerization of the toxin. IMPORTANCE Domain I has been shown to be involved in oligomerization through helix α-3 in different Cry toxins, and mutations affecting oligomerization also elicit changes in toxicity. The three-dimensional structure of the Cry4Ba toxin reveals an intramolecular salt bridge in helix α-3 of domain I. Mutations that disrupt this salt bridge resulted in changes in Cry4Ba oligomerization and toxicity, while a double point reciprocal mutation that restored the salt bridge resulted in recovery of toxin oligomerization and toxicity. These data highlight the role of oligomer formation as a key step in Cry4Ba toxicity. Copyright © 2017 American Society for Microbiology.

Lack of association between VNTR polymorphism of dopamine transporter gene (SLC6A3 and schizophrenia in a Brazilian sample Ausência de associação entre o polimorfismo VNTR do gene do transportador de dopamina (SLC6A3 e esquizofrenia em uma população brasileira

Directory of Open Access Journals (Sweden)

Quirino Cordeiro

2004-12-01

Full Text Available A role of dopaminergic dysfunction has been postulated in the aetiology of schizophrenia. We hypothesized that variations in the dopamine transporter gene (SLC6A3 may be associated with schizophrenia. We conducted case-control and family based analysis on the polymorphic SLC6A3 variable number tandem repeat (VNTR in a sample of 220 schizophrenic patients, 226 gender and ethnic matched controls, and 49 additional case-parent trios. No differences were found in allelic or genotypic distributions between cases and controls and no significant transmission distortions from heterozygous parents to schizophrenic offspring were detected. Thus, our results do not support an association of the SLC6A3 VNTR with schizophrenia in our sample.Genes do sistema dopaminérgico são de escolha para a pesquisa de susceptibilidade para a esquizofrenia. Desse modo, possível contribuição do polimorfismo do gene do transportador de dopamina (SLC6A3 no aumento da vulnerabilidade para a esquizofrenia foi investigada no presente estudo. Analisou-se a distribuição do sítio polimórfico do gene do transportador de dopamina (VNTR em uma população de 220 pacientes com esquizofrenia (critério diagnóstico: DSM-IV e comparou-se com a distribuição em uma população controle de 226 indivíduos pareados para sexo e etnia. Nenhuma diferença foi observada na distribuição dos alelos entre casos e controles. O mesmo polimorfismo também foi investigado em uma segunda amostra composta por 49 trios (pais e probando. O resultado também foi negativo. Tais dados não dão suporte para a participação do polimorfismo do gene do transportador de dopamina no aumento de susceptibilidade para esquizofrenia na amostra estudada.

Zinc Transporter 3 Is Involved in Learned Fear and Extinction, but Not in Innate Fear

Science.gov (United States)

Martel, Guillaume; Hevi, Charles; Friebely, Olivia; Baybutt, Trevor; Shumyatsky, Gleb P.

2010-01-01

Synaptically released Zn[superscript 2+] is a potential modulator of neurotransmission and synaptic plasticity in fear-conditioning pathways. Zinc transporter 3 (ZnT3) knock-out (KO) mice are well suited to test the role of zinc in learned fear, because ZnT3 is colocalized with synaptic zinc, responsible for its transport to synaptic vesicles,…

checkCIF/PLATON report Datablock: ZnT

Indian Academy of Sciences (India)

THIS REPORT IS FOR GUIDANCE ONLY. IF USED AS PART OF A REVIEW PROCEDURE. FOR PUBLICATION, IT SHOULD NOT REPLACE THE EXPERTISE OF AN EXPERIENCED. CRYSTALLOGRAPHIC REFEREE. No syntax errors found. CIF dictionary Interpreting this report. Datablock: ZnT. Bond precision:.

SLC5A8-Mediated Switching of STAT3 from a Pro-Oncogenic Signal into a Pro-Apoptotic Signal in Breast Cancer

Science.gov (United States)

2011-06-01

provokes lung metastasis. (5) Both STAT3 and SLC5A8 knockout showed the similar phenotype, like mammary gland involution delay, mastitis and...100 ng/ml cholera toxin, 0.01mg/ml bovine insulin and 500 ng/ml hydrocortisone. HBL100 cells was grown in McCoy 5A with 10% FBS. MCF7 and BT20

Dicty_cDB: SLC403 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

Science.gov (United States)

González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

2015-01-01

Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

Dicty_cDB: SLC494 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

Dicty_cDB: SLC473 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

Dicty_cDB: SLC455 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC483 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

Dicty_cDB: SLC433 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC487 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC480 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

OpenAIRE

Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

2013-01-01

Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine cal...

Induced oligomerization targets Golgi proteins for degradation in lysosomes.

Science.gov (United States)

Tewari, Ritika; Bachert, Collin; Linstedt, Adam D

2015-12-01

Manganese protects cells against forms of Shiga toxin by down-regulating the cycling Golgi protein GPP130. Down-regulation occurs when Mn binding causes GPP130 to oligomerize and traffic to lysosomes. To determine how GPP130 is redirected to lysosomes, we tested the role of GGA1 and clathrin, which mediate sorting in the canonical Golgi-to-lysosome pathway. GPP130 oligomerization was induced using either Mn or a self-interacting version of the FKBP domain. Inhibition of GGA1 or clathrin specifically blocked GPP130 redistribution, suggesting recognition of the aggregated GPP130 by the GGA1/clathrin-sorting complex. Unexpectedly, however, GPP130's cytoplasmic domain was not required, and redistribution also occurred after removal of GPP130 sequences needed for its normal cycling. Therefore, to test whether aggregate recognition might be a general phenomenon rather than one involving a specific GPP130 determinant, we induced homo-oligomerization of two unrelated Golgi-targeted constructs using the FKBP strategy. These were targeted to the cis- and trans-Golgi, respectively, using domains from mannosidase-1 and galactosyltransferase. Significantly, upon oligomerization, each redistributed to peripheral punctae and was degraded. This occurred in the absence of detectable UPR activation. These findings suggest the unexpected presence of quality control in the Golgi that recognizes aggregated Golgi proteins and targets them for degradation in lysosomes. © 2015 Tewari et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

HNA-3a and HNA-3b antigens among 9 ethnic populations and the Han population in Southwest China.

Science.gov (United States)

Ou, Guo-Jin; Su, Pin-Can; Yu, Hao; Ji, Xin; Liu, Fan; Wang, Sheng-Lan; Kong, Yu-Jie; Li, Ling; Wang, Jue; Liu, Zhong; Flegel, Willy Albert

2018-03-14

Human neutrophil antigen 3 (HNA-3) is encoded by the SLC44A2 gene. Antibodies against HNAs can cause severe, often fatal, transfusion reactions, known as transfusion-related acute lung injury, and neonatal neutropenia. We explored the 2 common HNA-3 variants in 9 ethnic populations residing in Sichuan and Yunnan provinces of China as compared to the Han population. We genotyped for SLC44A2 (rs2288904) by polymerase chain reaction sequence-based typing among blood donors, for a total of 2206 individuals in Yunnan and 376 in Sichuan. The SLC44A2*02 allele (HNA-3b antigen) frequency varied between 0.24 and 0.33 for all 9 ethnic populations in Yunnan, including Zhuang, Derung, Hani, Lisu, Bai, Miao, Dai, Naxi, and Yi. Specifically, the Yi ethnicity did not present an unusually great SLC44A2*02 frequency at any of the 4 locations examined in Yunnan. Except of the Yi ethnicity in Sichuan (0.40), the Han ethnicity, as the majority population group, had the greatest SLC44A2*02 frequency with 0.39 in Yunnan and 0.35 in Sichuan. The ethnic populations in Southwest China are not at an increased risk for anti-HNA3a compared to the Han population, with the possible exception of Yi in Sichuan. Our data, however, corroborated the known high prevalence of SLC44A2*02 in Han populations. Hence, the Han populations in Yunnan, Sichuan and elsewhere in China are at a comparatively great risk for developing HNA-3a antibodies.

Protein phosphatase 2a (PP2A binds within the oligomerization domain of striatin and regulates the phosphorylation and activation of the mammalian Ste20-Like kinase Mst3

Directory of Open Access Journals (Sweden)

Jones Candace A

2011-10-01

Full Text Available Abstract Background Striatin, a putative protein phosphatase 2A (PP2A B-type regulatory subunit, is a multi-domain scaffolding protein that has recently been linked to several diseases including cerebral cavernous malformation (CCM, which causes symptoms ranging from headaches to stroke. Striatin association with the PP2A A/C (structural subunit/catalytic subunit heterodimer alters PP2A substrate specificity, but targets and roles of striatin-associated PP2A are not known. In addition to binding the PP2A A/C heterodimer to form a PP2A holoenzyme, striatin associates with cerebral cavernous malformation 3 (CCM3 protein, the mammalian Mps one binder (MOB homolog, Mob3/phocein, the mammalian sterile 20-like (Mst kinases, Mst3, Mst4 and STK25, and several other proteins to form a large signaling complex. Little is known about the molecular architecture of the striatin complex and the regulation of these sterile 20-like kinases. Results To help define the molecular organization of striatin complexes and to determine whether Mst3 might be negatively regulated by striatin-associated PP2A, a structure-function analysis of striatin was performed. Two distinct regions of striatin are capable of stably binding directly or indirectly to Mob3--one N-terminal, including the coiled-coil domain, and another more C-terminal, including the WD-repeat domain. In addition, striatin residues 191-344 contain determinants necessary for efficient association of Mst3, Mst4, and CCM3. PP2A associates with the coiled-coil domain of striatin, but unlike Mob3 and Mst3, its binding appears to require striatin oligomerization. Deletion of the caveolin-binding domain on striatin abolishes striatin family oligomerization and PP2A binding. Point mutations in striatin that disrupt PP2A association cause hyperphosphorylation and activation of striatin-associated Mst3. Conclusions Striatin orchestrates the regulation of Mst3 by PP2A. It binds Mst3 likely as a dimer with CCM3 via

Kicker thyratron experience from SLC

International Nuclear Information System (INIS)

Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.

1991-05-01

The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs

A genetic-demographic approach reveals a gender-specific association of SLC6A3/DAT1 40 bp-VNTR with life-expectancy.

Science.gov (United States)

Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio

2015-06-01

Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".

The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

Directory of Open Access Journals (Sweden)

Anna Rita Cappello

2018-04-01

Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

Science.gov (United States)

Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

2018-04-01

The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

Preparation and photoluminescence properties of Tm{sup 3+}-doped ZrO{sub 2} nanotube arrays

Energy Technology Data Exchange (ETDEWEB)

Wang, Mingli [School of Materials Science and Engineering, Hebei University of Technology, Tianjin 300130 (China); Zhao, Jianling, E-mail: hebutzhaoj@126.com [School of Materials Science and Engineering, Hebei University of Technology, Tianjin 300130 (China); Xu, Rongqing [Tianjin Zhonghuan Advanced Material & Technology Co., LTD, Tianjin 300384 (China); Fu, Ning [School of Materials Science and Engineering, Hebei University of Technology, Tianjin 300130 (China); Wang, Xixin, E-mail: xixinwang@126.com [School of Materials Science and Engineering, Hebei University of Technology, Tianjin 300130 (China)

2016-07-25

Tm{sup 3+}-doped ZrO{sub 2} nanotube arrays were prepared by anodization of a Zr–Tm alloy (3 at.% Tm) obtained by a powder metallurgical method. The morphologies, structures, elemental valence, and photoluminescence properties were characterized by using scanning electron microscope, X-ray diffractometer, X-ray photoelectron spectrometer and photoluminescence analyser, respectively. Results show that preparing conditions and annealing temperatures have significant effects on the crystalline structure and photoluminescence performance. The sample TmZNT-Org prepared in formamide + glycerol organic solution is mainly monoclinic phase and the sample TmZNT-Aq prepared in aqueous solution is mainly tetragonal phase. The sample TmZNT-Org had the strongest photoluminescence peak when annealed at 800 °C, whereas both TmZNT-Aq samples annealed at 600 °C and 800 °C had the strongest photoluminescence peak. The monoclinic phase was conductive to the emission at 454 nm while the tetragonal phase was conductive to the emission at 460 nm. - Highlights: • Tm{sup 3+}-doped ZrO{sub 2} nanotube arrays were prepared by anodization of a Zr-Tm alloy. • Crystal structure had remarkable effects on the photoluminescence properties. • The monoclinic phase was conductive to the emission at 454 nm. • The tetragonal phase was conductive to the emission at 460 nm.

Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

Science.gov (United States)

Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

2017-10-01

Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

SLC6A3 polymorphism and response to methylphenidate in children with ADHD: A systematic review and meta-analysis.

Science.gov (United States)

Soleimani, Robabeh; Salehi, Zivar; Soltanipour, Soheil; Hasandokht, Tolou; Jalali, Mir Mohammad

2018-04-01

Methylphenidate (MPH) is the most commonly used treatment for attention-deficit hyperactivity disorder (ADHD) in children. However, the response to MPH is not similar in all patients. This meta-analysis investigated the potential role of SLC6A3 polymorphisms in response to MPH in children with ADHD. Clinical trials or naturalistic studies were selected from electronic databases. A meta-analysis was conducted using a random-effects model. Cohen's d effect size and 95% confidence intervals (CIs) were determined. Sensitivity analysis and meta-regression were performed. Q-statistic and Egger's tests were conducted to evaluate heterogeneity and publication bias, respectively. The Grading of Recommendations Assessment, Development and Evaluation (GRADE) system was used to assess the quality of evidence. Sixteen studies with follow-up periods of 1-28 weeks were eligible. The mean treatment acceptability of MPH was 97.2%. In contrast to clinical trials, the meta-analysis of naturalistic studies indicated that children without 10/10 repeat carriers had better response to MPH (Cohen's d: -0.09 and 0.44, respectively). The 9/9 repeat polymorphism had no effect on the response rate (Cohen's d: -0.43). In the meta-regression, a significant association was observed between baseline severity of ADHD, MPH dosage, and combined type of ADHD in some genetic models. Sensitivity analysis indicated the robustness of our findings. No publication bias was observed in our meta-analysis. The GRADE evaluations revealed very low levels of confidence for each outcome of response to MPH. The results of clinical trials and naturalistic studies regarding the effect size between different polymorphisms of SLC6A3 were contradictory. Therefore, further research is recommended. © 2017 Wiley Periodicals, Inc.

Structure/functional aspects of the human riboflavin transporter-3 (SLC52A3): role of the predicted glycosylation and substrate-interacting sites.

Science.gov (United States)

Subramanian, Veedamali S; Sabui, Subrata; Teafatiller, Trevor; Bohl, Jennifer A; Said, Hamid M

2017-08-01

The human riboflavin (RF) transporter-3 (hRFVT-3; product of the SLC52A3 gene) plays an essential role in the intestinal RF absorption process and is expressed exclusively at the apical membrane domain of polarized enterocytes. Previous studies have characterized different physiological/biological aspects of this transporter, but nothing is known about the glycosylation status of the hRFVT-3 protein and role of this modification in its physiology/biology. Additionally, little is known about the residues in the hRFVT-3 protein that interact with the ligand, RF. We addressed these issues using appropriate biochemical/molecular approaches, a protein-docking model, and established intestinal/renal epithelial cells. Our results showed that the hRFVT-3 protein is glycosylated and that glycosylation is important for its function. Mutating the predicted N -glycosylation sites at Asn 94 and Asn 168 led to a significant decrease in RF uptake; it also led to a marked intracellular (in the endoplasmic reticulum, ER) retention of the mutated proteins as shown by live-cell confocal imaging studies. The protein-docking model used in this study has identified a number of putative substrate-interacting sites: Ser 16 , Ile 20 , Trp 24 , Phe 142 , Thr 314 , and Asn 315 Mutating these potential interacting sites was indeed found to lead to a significant inhibition in RF uptake and to intracellular (ER) retention of the mutated proteins (except for the Phe 142 mutant). These results demonstrate that the hRFVT-3 protein is glycosylated and this glycosylation is important for its function and cell surface expression. This study also identified a number of residues in the hRFVT-3 polypeptide that are important for its function/cell surface expression.

Dicty_cDB: SLC832 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

Reactions at the Metal Vertex of a Monometal Metallocarborane Cluster. The Chemistry of (closo-3,3-(PPh3)2-3-(HSO4)-3,1,2-RhC2B9H11) and (closo-3-(PPh3)-3,3-(NO3)-3,1,2RhC2B9H11).

Science.gov (United States)

1982-03-09

4) produced by dissociation of PPh 3 from (2) or through an ionic species such as [closo-3,3- (PPh 3)2 -3,1,2-RhC 289 H ] [HSO4 (4a). Secondly, the...acetylene molecule and subsequent insertion into a metal-carbon bond has been observed in the linear oligomerization of acetylere catalyzed by [Ni(CO...monoxide were obtained from Liquid Carbonic and used without further treatment. Phenylacetylene (Aldrich) was distilled under vacuum before use and n

Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

Science.gov (United States)

Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

2016-09-01

The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

PBL3.0

DEFF Research Database (Denmark)

Zotou, Maria; Tambouris, Efthimios; Triantafyllou, Evangelia

This paper presents the PBL3.0 project that aims at enhancing Problem Based Learning (PBL) with Learning Analytics (LA) and Learning Semantics (LS) in order to produce a new educational paradigm and pilot it to produce relevant policy recommendations. To this end, the project will reach the follo......This paper presents the PBL3.0 project that aims at enhancing Problem Based Learning (PBL) with Learning Analytics (LA) and Learning Semantics (LS) in order to produce a new educational paradigm and pilot it to produce relevant policy recommendations. To this end, the project will reach...

Variations in CCR5, but not HFE, ELMO1, or SLC12A3, are associated with susceptibility to kidney disease in north Indian individuals with type 2 diabetes.

Science.gov (United States)

Yadav, Ashok K; Kumar, Vinod; Dutta, Pinaki; Bhansali, Anil; Jha, Vivekanand

2014-11-01

Diabetic nephropathy (DN), the leading cause of end-stage renal disease worldwide, may have a genetic component. In the present study, we investigated variations in a set of genes with susceptibility to DN in a north Indian population. Four genes (HFE, ELMO1, SLC12A3, and CCR5) were selected on the basis of reported association with type 2 diabetes and nephropathy. In all, 417 diabetic subjects (215 without kidney disease [DM] and 202 with DN) and 197 healthy controls (HC) were evaluated for variations in HFE (845 G>A and 187G>C), SLC12A3 (g.34372G>A), CCR5 (59029A>G), and ELMO1 (+9170 G>A). Polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism and Taqman allele discrimination assays. Significant differences were found in genotype and allelic frequency in SLC12A3 (g.34372G>A) between diabetic subjects and HC (P A (AA+GA) genotype between diabetic subjects with and without nephropathy. However, the CCR5 59029AA genotype and A allele were significantly more frequent in diabetics compared with the HC (P = 0.01 and 0.03, respectively) and subjects with DN versus DM (P = 0.002 and 0.01, respectively). For ELMO1 (+9170 G>A), the GG genotype frequency was higher in the diabetic versus HC group. There were no differences in the frequency of HFE-845 G>A and HFE-187G>C among the groups. This study shows that the CCR5 AA genotype is over-represented in subjects with kidney disease due to type 2 diabetes. The CCR5 59029G>A and ELMO1 (+9170 G>A) loci are more frequent, and the SLC12A3 34372 AA genotype is associated with a reduced risk of diabetes. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.

Directory of Open Access Journals (Sweden)

Keijiro Mizukami

Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.

Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome.

Science.gov (United States)

Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger

2012-11-01

Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.

Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

Science.gov (United States)

Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

2014-04-01

Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

Identification of a novel homozygous mutation in MYO3A in a Chinese family with DFNB30 non-syndromic hearing impairment.

Science.gov (United States)

Qu, Ronggui; Sang, Qing; Xu, Yao; Feng, Ruizhi; Jin, Li; He, Lin; Wang, Lei

2016-05-01

Hearing loss is a common sensory impairment. Several genetic loci or genes responsible for non-syndrome hearing loss have been identified, including the well-known deafness genes GJB2, MT-RNR1 and SLC26A4. MYO3A belongs to the myosin superfamily. Previously only three mutations in this gene have been found in an Isreali family with DFNB30, in which patients demonstrated progressive hearing loss. In this study, we characterized a consanguineous Kazakh family with congenital hearing loss. By targeted sequence capture and next-generation sequencing, we identified a homozygous mutation and did bioinformatics analysis to this mutation. A homozygous mutation, MYO3A:c.1841C>T (p.S614F), was identified to be responsible for the disease. Ser614 is located in the motor domain of MYO3A that is highly conserved among different species. Molecular modeling predicts that the conserved Ser614 may play an important role in maintaining the stability of β-sheet and the interaction between neighboring β-strand. This is the second report on MYO3A mutations in deafness and the first report in China. The finding help facilitate establishing a better relationship between MYO3A mutation and hearing phenotypes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Lack of SLC2A1 (glucose transporter 1) mutations in 30 Italian patients with alternating hemiplegia of childhood.

Science.gov (United States)

De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico

2013-07-01

Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.

3D numerical thermal stress analysis of the high power target for the SLC Positron Source

International Nuclear Information System (INIS)

Reuter, E.M.; Hodgson, J.A.

1991-05-01

The volumetrically nonuniform power deposition of the incident 33 GeV electron beam in the SLC Positron Source Target is hypothesized to be the most likely cause target failure. The resultant pulsed temperature distributions are known to generate complicated stress fields with no known closed-form analytical solution. 3D finite element analyses of these temperature distributions and associated thermal stress fields in the new High Power Target are described here. Operational guidelines based on the results of these analyses combined with assumptions made about the fatigue characteristics of the exotic target material are proposed. 6 refs., 4 figs

Meta-Analysis Reveals Significant Association of the 3'-UTR VNTR in SLC6A3 with Alcohol Dependence.

Science.gov (United States)

Ma, Yunlong; Fan, Rongli; Li, Ming D

2016-07-01

Although many studies have analyzed the association of 3'-untranslated region variable-number tandem repeat (VNTR) polymorphism in SLC6A3 with alcohol dependence (AD), the results remain controversial. This study aimed to determine whether this variant indeed has any genetic effect on AD by integrating 17 reported studies with 5,929 participants included. The A9-dominant genetic model that considers A9-repeat and non-A9 repeat as 2 genotypes and compared their frequencies in alcoholics with that in controls was adopted. Considering the potential influence of ethnicity, differences in diagnostic criteria of AD, and alcoholic subgroups, stratified meta-analyses were conducted. There existed no evidence for the presence of heterogeneity among the studied samples, indicating the results under the fixed-effects model are acceptable. We found a significant association of VNTR A9 genotypes with AD in all ethnic populations (pooled odds ratio [OR] 1.12; 95% confidence interval [CI] 1.00, 1.25; p = 0.045) and the Caucasian population (pooled OR 1.15; 95% CI 1.01, 1.31; p = 0.036). We also found VNTR A9 genotypes to be significantly associated with alcoholism as defined by the DSM-IV criteria (pooled OR 1.18; 95% CI 1.03, 1.36; p = 0.02). Further, we found a significant association between VNTR A9 genotypes and alcoholism associated with alcohol withdrawal seizure or delirium tremens (pooled OR 1.55; 95% CI 1.24, 1.92; p = 1.0 × 10(-4) ). In all these meta-analyses, no evidence of publication bias was detected. We concluded that the VNTR polymorphism has an important role in the etiology of AD, and individuals with at least 1 A9 allele are more likely to be dependent on alcohol than persons carrying the non-A9 allele. Copyright © 2016 by the Research Society on Alcoholism.

The ZntA-like NpunR4017 plays a key role in maintaining homeostatic levels of zinc in Nostoc punctiforme.

Science.gov (United States)

Hudek, L; Bräu, L; Michalczyk, A A; Neilan, B A; Meeks, J C; Ackland, M L

2015-12-01

Analysis of cellular response to zinc exposure provides insights into how organisms maintain homeostatic levels of zinc that are essential, while avoiding potentially toxic cytosolic levels. Using the cyanobacterium Nostoc punctiforme as a model, qRT-PCR analyses established a profile of the changes in relative mRNA levels of the ZntA-like zinc efflux transporter NpunR4017 in response to extracellular zinc. In cells treated with 18 μM of zinc for 1 h, NpunR4017 mRNA levels increased by up to 1300 % above basal levels. The accumulation and retention of radiolabelled (65)Zn by NpunR4107-deficient and overexpressing strains were compared to wild-type levels. Disruption of NpunR4017 resulted in a significant increase in zinc accumulation up to 24 % greater than the wild type, while cells overexpressing NpunR4107 accumulated 22 % less than the wild type. Accumulation of (65)Zn in ZntA(-) Escherichia coli overexpressing NpunR4017 was reduced by up to 21 %, indicating the capacity for NpunR4017 to compensate for the loss of ZntA. These findings establish the newly identified NpunR4017 as a zinc efflux transporter and a key transporter for maintaining zinc homeostasis in N. punctiforme.

SLC Final Performance and Lessons

International Nuclear Information System (INIS)

Phinney, Nan

2000-01-01

The Stanford Linear Collider (SLC) was the first prototype of a new type of accelerator, the electron-positron linear collider. Many years of dedicated effort were required to understand the physics of this new technology and to develop the techniques for maximizing performance. Key issues were emittance dilution, stability, final beam optimization and background control. Precision, non-invasive diagnostics were required to measure and monitor the beams throughout the machine. Beam-based feedback systems were needed to stabilize energy, trajectory, intensity and the final beam size at the interaction point. variety of new tuning techniques were developed to correct for residual optical or alignment errors. The final focus system underwent a series of refinements in order to deliver sub-micron size beams. It also took many iterations to understand the sources of backgrounds and develop the methods to control them. The benefit from this accumulated experience was seen in the performance of the SLC during its final run in 1997-98. The luminosity increased by a factor of three to 3*10 30 and the 350,000 Z data sample delivered was nearly double that from all previous runs combined

SLC-2000: A luminosity upgrade for the SLC

International Nuclear Information System (INIS)

Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

1996-01-01

We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

Drift chamber vertex detectors for SLC/LEP

Energy Technology Data Exchange (ETDEWEB)

Hayes, K G

1988-03-01

Factors influencing the design of drift chamber vertex detectors for SLC and LEP are discussed including global strategy, chamber gas, cell design, and signal processing. The designs of the vertex chambers for the L3 and OPAL experiments at LEP and the Mark II experiment at the SLC are described.

Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy

Directory of Open Access Journals (Sweden)

Yangzom D. Bhutia

2017-02-01

Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy

Web 3.0 Emerging

Energy Technology Data Exchange (ETDEWEB)

Hendler, James [Rensselaer Polytechnic Institute

2012-02-22

As more and more data and information becomes available on the Web, new technologies that use explicit semantics for information organization are becoming desirable. New terms such as Linked Data, Semantic Web and Web 3.0 are used more and more, although there is increasing confusion as to what each means. In this talk, I will describe how different sorts of models can be used to link data in different ways. I will particularly explore different kinds of Web applications, from Enterprise Data Integration to Web 3.0 startups, government data release, the different needs of Web 2.0 and 3.0, the growing interest in “semantic search”, and the underlying technologies that power these new approaches.

Association between autoantibodies to the Arginine variant of the Zinc transporter 8 (ZnT8) and stimulated C-peptide levels in Danish children and adolescents with newly diagnosed type 1 diabetes

DEFF Research Database (Denmark)

Andersen, Marie Louise M; Vaziri-Sani, Fariba; Delli, Ahmed

2012-01-01

The zinc transporter 8 (ZnT8) was recently identified as a common autoantigen in type 1 diabetes (T1D) and inclusion of ZnT8 autoantibodies (ZnT8Ab) was found to increase the diagnostic specificity of T1D.......The zinc transporter 8 (ZnT8) was recently identified as a common autoantigen in type 1 diabetes (T1D) and inclusion of ZnT8 autoantibodies (ZnT8Ab) was found to increase the diagnostic specificity of T1D....

Characterization of SLC transporters in human skin

Directory of Open Access Journals (Sweden)

Marion Alriquet

2015-03-01

Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

Integrated Lunar Information Architecture for Decision Support Version 3.0 (ILIADS 3.0)

Science.gov (United States)

Talabac, Stephen; Ames, Troy; Blank, Karin; Hostetter, Carl; Brandt, Matthew

2013-01-01

ILIADS 3.0 provides the data management capabilities to access CxP-vetted lunar data sets from the LMMP-provided Data Portal and the LMMP-provided On-Moon lunar data product server. (LMMP stands for Lunar Mapping and Modeling Project.) It also provides specific quantitative analysis functions to meet the stated LMMP Level 3 functional and performance requirements specifications that were approved by the CxP. The purpose of ILIADS 3.0 is to provide an integrated, rich client lunar GIS software application

46 CFR 54.30-3 - Introduction.

Science.gov (United States)

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false Introduction. 54.30-3 Section 54.30-3 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING PRESSURE VESSELS Mechanical Stress Relief § 54.30-3 Introduction. (a) Large conventional pressure vessels used to transport liquefied...

Different role of zinc transporter 8 between type 1 diabetes mellitus and type 2 diabetes mellitus.

Science.gov (United States)

Yi, Bo; Huang, Gan; Zhou, Zhiguang

2016-07-01

Diabetes can be simply classified into type 1 diabetes mellitus and type 2 diabetes mellitus. Zinc transporter 8 (ZnT8), a novel islet autoantigen, is specifically expressed in insulin-containing secretory granules of β-cells. Genetic studies show that the genotypes of SLC30A8 can determine either protective or diabetogenic response depending on environmental and lifestyle factors. The ZnT8 protein expression, as well as zinc content in β-cells, was decreased in diabetic mice. Thus, ZnT8 might participate in insulin biosynthesis and release, and subsequently involved deteriorated β-cell function through direct or indirect mechanisms in type 1 diabetes mellitus and type 2 diabetes mellitus. From a clinical feature standpoint, the prevalence of ZnT8A is gradiently increased in type 2 diabetes mellitus, latent autoimmune diabetes in adults and type 1 diabetes mellitus. The frequency and epitopes of ZnT8-specific T cells and cytokine release by ZnT8-specific T cells are also different in diabetic patients and healthy controls. Additionally, the response to ZnT8 administration is also different in type 1 diabetes mellitus and type 2 diabetes mellitus. In the present review, we summarize the literature about clinical aspects of ZnT8 in the pathogenesis of diabetes, and suggest that ZnT8 might play a different role between type 1 diabetes mellitus and type 2 diabetes mellitus. © 2015 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

ASPEN Version 3.0

Science.gov (United States)

Rabideau, Gregg; Chien, Steve; Knight, Russell; Schaffer, Steven; Tran, Daniel; Cichy, Benjamin; Sherwood, Robert

2006-01-01

The Automated Scheduling and Planning Environment (ASPEN) computer program has been updated to version 3.0. ASPEN is a modular, reconfigurable, application software framework for solving batch problems that involve reasoning about time, activities, states, and resources. Applications of ASPEN can include planning spacecraft missions, scheduling of personnel, and managing supply chains, inventories, and production lines. ASPEN 3.0 can be customized for a wide range of applications and for a variety of computing environments that include various central processing units and random access memories.

Health informatics 3.0.

Science.gov (United States)

Kalra, Dipak

2011-01-01

Web 3.0 promises us smart computer services that will interact with each other and leverage knowledge about us and our immediate context to deliver prioritised and relevant information to support decisions and actions. Healthcare must take advantage of such new knowledge-integrating services, in particular to support better co-operation between professionals of different disciplines working in different locations, and to enable well-informed co-operation between clinicians and patients. To grasp the potential of Web 3.0 we will need well-harmonised semantic resources that can richly connect virtual teams and link their strategies to real-time and tailored evidence. Facts, decision logic, care pathway steps, alerts, education need to be embedded within components that can interact with multiple EHR systems and services consistently. Using Health Informatics 3.0 a patient's current situation could be compared with the outcomes of very similar patients (from across millions) to deliver personalised care recommendations. The integration of EHRs with biomedical sciences ('omics) research results and predictive models such as the Virtual Physiological Human could help speed up the translation of new knowledge into clinical practice. The mission, and challenge, for Health Informatics 3.0 is to enable healthy citizens, patients and professionals to collaborate within a knowledge-empowered social network in which patient specific information and personalised real-time evidence are seamlessly interwoven.

Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

Science.gov (United States)

Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

2017-07-01

Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

Genetic variants of SLC11A1 are associated with both autoimmune and infectious diseases: systematic review and meta-analysis.

Science.gov (United States)

Archer, N S; Nassif, N T; O'Brien, B A

2015-06-01

A systematic review and meta-analyses were undertaken to investigate the association of SLC11A1 genetic variants with disease occurrence. Literature searching indentified 109 publications to include in the meta-analyses assessing the association of 11 SLC11A1 variants with autoimmune and infectious disease. The (GT)n promoter alleles 2 and 3 (rs534448891), which alter SLC11A1 expression, were significantly associated with tuberculosis (OR=1.47 (1.30-1.66), OR=0.76 (0.65-0.89), respectively) and infectious disease (OR=1.25 (1.10-1.42), OR=0.83 (0.74-0.93), respectively). However, although no association was observed with autoimmune disease, a modest significant association was observed with type 1 diabetes (allele 2 OR=0.94 (0.89-0.98)). On the basis of a stronger association of (GT)n allele 2 with tuberculosis, compared with the protective effect of allele 3, we hypothesise that allele 2 is likely the disease-causing variant influencing disease susceptibility. Significant associations were observed between the 469+14G/C polymorphism (rs3731865) and autoimmune disease (OR=1.30 (1.04-1.64)) and rheumatoid arthritis (OR=1.60 (1.20-2.13)) and between the -237C/T polymorphism (rs7573065) and inflammatory bowel disease (OR=0.60 (0.43-0.84)). Further, significant associations were identified between the 469+14G/C, 1730G/A and 1729+55del4 polymorphisms (rs3731865, rs17235409 and rs17235416, respectively) and both infectious disease per se and tuberculosis. These findings show a clear association between variants in the SLC11A1 locus and autoimmune and infectious disease susceptibility.

Association analysis between a VNTR intron 8 polymorphism of the dopamine transporter gene (SLC6A3 and obsessive- compulsive disorder in a Brazilian sample Análise de associação entre um polimorfismo VNTR no intron 8 do gene do transportador de dopamina (SLC6A3 e transtorno obsessivo-compulsivo em uma amostra brasileira

Directory of Open Access Journals (Sweden)

Karen Miguita

2007-12-01

Full Text Available Family, twin and segregation analysis have provided evidences that genetic factors are implicated in the susceptibility for obsessive-compulsive disorder (OCD. Several lines of research suggest that the dopaminergic system may be involved in the pathophysiology of OCD. Thus, the aim of the present study was to investigate a possible association between a polymorphism located in intron 8 of the dopamine transporter gene (SLC6A3 and OCD in a Brazilian sample composed by 208 patients and 865 healthy controls. No statistically differences were observed in allelic and genotype distributions between cases and controls. No association was also observed when the sample was divided according to specific phenotypic features such as gender, presence of tic disorders co-morbidity and age at onset of obsessive-compulsive symptoms (OCS. Our results suggest that the intron 8 VNTR of the SLC6A3 investigated in this study is not related to the susceptibility for OCD in our Brazilian sample.Estudos de família, gêmeos e de segregação têm demonstrado que fatores genéticos estão envolvidos na susceptibilidade para o desenvolvimento do transtorno obsessivo-compulsivo (TOC. Várias linhas de pesquisa sugerem que o sistema dopaminérgico possa estar envolvido na fisiopatologia do TOC. Assim, o objetivo do presente estudo foi investigar uma possível associação entre o polimorfismo localizado no intron 8 do gene do transportador da dopamina (SLC6A3 e o TOC em uma amostra brasileira composta por 208 pacientes e 865 controles sadios. Nenhuma diferença estatisticamente significante foi observada nas distribuições alélicas e genotípicas entre os grupos de pacientes e controles. Nenhuma associação também foi observada quando as amostras foram divididas de acordo com características fenotípicas específicas, tais como gênero, presença de co-morbidade com tiques e idade de início dos sintomas obsessivo-compulsivo (SOC. Nossos resultados sugerem que o VNTR

ActionScript 3.0 Bible

CERN Document Server

Braunstein, Roger

2010-01-01

The updated edition on all the latest features and capabilities of ActionScript 3.0 and Flash Player 10. ActionScript is a popular programming language used primarily for the development of Web sites and software. This update to the successful previous version introduces you to all the exciting new capabilities of ActionScript 3.0. You'll see how ActionScript 3.0 goes beyond its primary use of scripting Flash animations and is now an object-oriented evolution that runs ten times faster than previous versions and can be used in Adobe's new platforms, including Flex and AIR. Hands-on instruction

Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

Science.gov (United States)

Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

2016-11-01

The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

Zinc-Associated Variant in SLC30A8 Gene Interacts With Gestational Weight Gain on Postpartum Glycemic Changes: A Longitudinal Study in Women With Prior Gestational Diabetes Mellitus.

Science.gov (United States)

Wang, Tiange; Liu, Huikun; Wang, Leishen; Huang, Tao; Li, Weiqin; Zheng, Yan; Heianza, Yoriko; Sun, Dianjianyi; Leng, Junhong; Zhang, Shuang; Li, Nan; Hu, Gang; Qi, Lu

2016-12-01

Zinc transporter 8 genetic variant SLC30A8 has been associated with postpartum risk of type 2 diabetes among women with gestational diabetes mellitus (GDM). Gestational weight gain is one of the strongest risk factors for postpartum hyperglycemia. We assessed the interaction between type 2 diabetes-associated SLC30A8 rs13266634 and gestational weight gain on 1-5 years of postpartum glycemic changes in 1,071 women with prior GDM in a longitudinal study. Compared with gestation of 26-30 weeks, postpartum levels of fasting glucose, oral glucose tolerance test 2-h glucose, and hemoglobin A 1c (HbA 1c ) increased across rs13266634 TT, CT, and CC genotypes in women with excessive gestational weight gain, whereas opposite genetic associations were found in women with inadequate or adequate gestational weight gain. Postpartum changes in fasting glucose per additional copy of the C allele were -0.18, -0.04, and 0.12 mmol/L in women with inadequate, adequate, and excessive gestational weight gain, respectively (P for interaction = 0.002). We also found similar interactions for changes in 2-h glucose and HbA 1c (P for interaction = 0.003 and 0.005, respectively). Our data indicate that gestational weight gain may modify SLC30A8 variant on long-term glycemic changes, highlighting the importance of gestational weight control in the prevention of postpartum hyperglycemia in women with GDM. © 2016 by the American Diabetes Association.

SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

Directory of Open Access Journals (Sweden)

Chi-Jiunn Pan

Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

Influence of DNA-methylation on zinc homeostasis in myeloid cells: Regulation of zinc transporters and zinc binding proteins.

Science.gov (United States)

Kessels, Jana Elena; Wessels, Inga; Haase, Hajo; Rink, Lothar; Uciechowski, Peter

2016-09-01

The distribution of intracellular zinc, predominantly regulated through zinc transporters and zinc binding proteins, is required to support an efficient immune response. Epigenetic mechanisms such as DNA methylation are involved in the expression of these genes. In demethylation experiments using 5-Aza-2'-deoxycytidine (AZA) increased intracellular (after 24 and 48h) and total cellular zinc levels (after 48h) were observed in the myeloid cell line HL-60. To uncover the mechanisms that cause the disturbed zinc homeostasis after DNA demethylation, the expression of human zinc transporters and zinc binding proteins were investigated. Real time PCR analyses of 14 ZIP (solute-linked carrier (SLC) SLC39A; Zrt/IRT-like protein), and 9 ZnT (SLC30A) zinc transporters revealed significantly enhanced mRNA expression of the zinc importer ZIP1 after AZA treatment. Because ZIP1 protein was also enhanced after AZA treatment, ZIP1 up-regulation might be the mediator of enhanced intracellular zinc levels. The mRNA expression of ZIP14 was decreased, whereas zinc exporter ZnT3 mRNA was also significantly increased; which might be a cellular reaction to compensate elevated zinc levels. An enhanced but not significant chromatin accessibility of ZIP1 promoter region I was detected by chromatin accessibility by real-time PCR (CHART) assays after demethylation. Additionally, DNA demethylation resulted in increased mRNA accumulation of zinc binding proteins metallothionein (MT) and S100A8/S100A9 after 48h. MT mRNA was significantly enhanced after 24h of AZA treatment also suggesting a reaction of the cell to restore zinc homeostasis. These data indicate that DNA methylation is an important epigenetic mechanism affecting zinc binding proteins and transporters, and, therefore, regulating zinc homeostasis in myeloid cells. Copyright © 2016 Elsevier GmbH. All rights reserved.

Interaction of organic cation transporter 3 (SLC22A3) and amphetamine.

Science.gov (United States)

Zhu, Hao-Jie; Appel, David I; Gründemann, Dirk; Markowitz, John S

2010-07-01

The organic cation transporter (OCT) 3 is widely expressed in various organs in humans, and involved in the disposition of many exogenous and endogenous compounds. Several lines of evidence have suggested that OCT3 expressed in the brain plays an important role in the regulation of neurotransmission. Relative to wild-type (WT) animals, Oct3 knockout (KO) mice have displayed altered behavioral and neurochemical responses to psychostimulants such as amphetamine (AMPH) and methamphetamine. In the present study, both in vitro and in vivo approaches were utilized to explore potential mechanisms underlying the disparate neuropharmacological effects observed following AMPH exposure in Oct3 KO mice. In vitro uptake studies conducted in OCT3 transfected cells indicated that dextroamphetamine (d-AMPH) is not a substrate of OCT3. However, OCT3 was determined to be a high-capacity and low-affinity transporter for the neurotransmitters dopamine (DA), norepinephrine (NE), and serotonin (5-HT). Inhibition studies demonstrated that d-AMPH exerts relatively weak inhibitory effects on the OCT3-mediated uptake of DA, NE, 5-HT, and the model OCT3 substrate 4-(4-(dimethylamino)styryl)-N-methylpyridinium iodide. The IC(50) values were determined to be 41.5 +/- 7.5 and 24.1 +/- 7.0 microM for inhibiting DA and 5-HT uptake, respectively, while 50% inhibition of NE and 4-(4-(dimethylamino)styryl)-N-methylpyridinium iodide uptake was not achieved by even the highest concentration of d-AMPH applied (100 microM). Furthermore, the disposition of d-AMPH in various tissues including the brain, liver, heart, kidney, muscle, intestine, spleen, testis, uterus, and plasma were determined in both male and female Oct3 KO and WT mice. No significant difference was observed between either genotypes or sex in all tested organs and tissues. Our findings suggest that OCT3 is not a prominent factor influencing the disposition of d-AMPH. Additionally, based upon the inhibitory potency observed in vitro, d

Measurement of electron beam polarization at the SLC

International Nuclear Information System (INIS)

Steiner, H.; California Univ., Berkeley

1988-01-01

One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)

Enterprise 3.0 in Engineering Education

Science.gov (United States)

Ahrens, Andreas; Zascerinska, Jelena

2011-01-01

Enterprise 3.0 offers potential solutions for the quality, maintenance and sustainable development of services. The synergy between Enterprise 3.0 and engineering education advances the development of innovative products, processes and services in the European economy. Aim of the research is to analyze student engineers' use of Enterprise 3.0…

Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

Directory of Open Access Journals (Sweden)

Deborah Cook

2008-09-01

Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

Riboflavin uptake transporter Slc52a2 (RFVT2) is upregulated in the mouse mammary gland during lactation.

Science.gov (United States)

Wu, Alex Man Lai; Dedina, Liana; Dalvi, Pooja; Yang, Mingdong; Leon-Cheon, John; Earl, Brian; Harper, Patricia A; Ito, Shinya

2016-04-01

While it is well recognized that riboflavin accumulates in breast milk as an essential vitamin for neonates, transport mechanisms for its milk excretion are not well characterized. The multidrug efflux transporter ABCG2 in the apical membrane of milk-producing mammary epithelial cells (MECs) is involved with riboflavin excretion. However, it is not clear whether MECs possess other riboflavin transport systems, which may facilitate its basolateral uptake into MECs. We report here that transcripts encoding the second (SLC52A2) and third (SLC52A3) member of the recently discovered family of SLC52A riboflavin uptake transporters are expressed in milk fat globules from human breast milk. Furthermore, Slc52a2 and Slc52a3 mRNA are upregulated in the mouse mammary gland during lactation. Importantly, the induction ofSlc52a2, which was the major Slc52a riboflavin transporter in the lactating mammary gland, was also observed at the protein level. Subcellular localization studies showed that green fluorescent protein-tagged mouse SLC52A2 mainly localized to the cell membrane, with no preferential distribution to the apical or basolateral membrane in polarized kidney MDCK cells. These results strongly implicate a potential role for SLC52A2 in riboflavin uptake by milk-producing MECs, a critical step in the transfer of riboflavin into breast milk. Copyright © 2016 the American Physiological Society.

Reversible peptide oligomerization over nanoscale gold surfaces

Directory of Open Access Journals (Sweden)

Kazushige Yokoyama

2015-11-01

Full Text Available A selective oligomeric formation of amyloid beta 1-40 (Ab1-40 monomers over a nanogold colloidal surface was investigated. An unfolded Ab1-40 monomer is considered to construct a dimer or trimer based oligomeric form with its hydrophobic segment placing outward under an acidic condition. Under a basic condition, a conformation of Ab is expected to take a folded monomeric form with its hydrophilic segment folded inward, avoiding the networking with residual colloidal particles. The most probable oligomeric form constructed over a 20 nm gold colloidal surface within a 25 ℃ to 65 ℃ temperature range is a dimer based unit and that over 30 or 40 nm gold colloidal surface below 15 ℃ is concluded to be a trimer based unit. However, selective oligomerization was not successfully reproduced under the rest of the conditions. A dipole-induced dipole interaction must cause a flexible structural change between folded and unfolded forms.

The rise of patient 3.0

DEFF Research Database (Denmark)

Clemensen, Jane; Danbjørg, Dorthe Boe; Damkjær Syse, Mette

Social media, particularly Facebook (FB), is a new way for patients to find peer patients. By investigating communications within a patient generated FB group over a one year period we looked for evidence of the existence of Patient 3.0 . The indicators for these kinds of activities were where...... in a Facebook group looking for signs of patient 3.0 in the context of health 3.0 (Gagnon, 2012). Qualitative content analysis was conducted on transcripts of postings on the Facebook group site from the period January 2010 to January 2011. These were categorized into themes based on the intentions indicated...... issues they had with both their health care professionals and the health system in general. The material indicates that this group of patients exhibit signs of being what has been described as “Patient 3.0” (Ibid). Their experiences also showcase collisions with the health care system...

The cyanobacterial bicarbonate transporter BicA: its physiological role and the implications of structural similarities with human SLC26 transporters.

Science.gov (United States)

Price, G Dean; Howitt, Susan M

2011-04-01

The cyanobacterial Na+-dependent HCO3- transporter BicA is a member of the ubiquitous and important SulP/SLC26 family of anion transporters found in eukaryotes and prokaryotes. BicA is an important component of the cyanobacterial CO2 concentrating mechanism, an adaptation that contributes to cyanobacteria being able to achieve an estimated 25% of global primary productivity, largely in the oceans. The human SLC26 members are involved in a range of key cellular functions involving a diverse range of anion transport activities including Cl-/HCO3-, I-/HCO3-, and SO42-/HCO3- exchange; mutations in SLC26 members are known to be associated with debilitating diseases such as Pendred syndrome, chondrodysplasias, and congenital chloride diarrhoea. We have recently experimentally determined the membrane topology of BicA using the phoA-lacZ reporter system and here consider some of the extrapolated implications for topology of the human SLC26 family and the Sultr plant sulphate transporters.

Upregulation of the Creatine Transporter Slc6A8 by Klotho

Directory of Open Access Journals (Sweden)

Ahmad Almilaji

2014-11-01

Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

SLC26A4 mutations are associated with a specific inner ear malformation.

Science.gov (United States)

Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa

2007-03-01

Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.

Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

Science.gov (United States)

Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

2017-04-01

The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

30 CFR 282.3 - Definitions.

Science.gov (United States)

2010-07-01

... from such activity. Contingency Plan means a plan for action to be taken in emergency situations. Data... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Definitions. 282.3 Section 282.3 Mineral... CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR General § 282.3 Definitions. When used in this...

Brobygning 3.0

DEFF Research Database (Denmark)

Høgh, Mona Irene; Schlüntz, Ditte Annette; Pedersen, Annette Kastrup

2016-01-01

Denne rapport præsenterer evalueringen af Projektet Brobygning 3.0 – nye koblinger af uddan-nelse og erhvervspraksis for kvalificering og understøttelse af unges uddannelsesvalg. Projektet har delvist været finansieret af Region Sjælland i forbindelse med satsningen Kompetenceparat 2020 og kobler...

Protic Cationic Oligomeric Ionic Liquids of the Urethane Type

DEFF Research Database (Denmark)

Shevchenko, V. V.; Stryutsky, A. V.; Klymenko, N. S.

2014-01-01

Protic oligomeric cationic ionic liquids of the oligo(ether urethane) type are synthesized via the reaction of an isocyanate prepolymer based on oligo(oxy ethylene)glycol with M = 1000 with hexamethylene-diisocyanate followed by blocking of the terminal isocyanate groups with the use of amine...... derivatives of imidazole, pyridine, and 3-methylpyridine and neutralization of heterocycles with ethanesulfonic acid and p-toluenesulfonic acid. The structures and properties of the synthesized oligomeric ionic liquids substantially depend on the structures of the ionic groups. They are amorphous at room...... temperature, but ethanesulfonate imidazolium and pyridinium oligomeric ionic liquids form a low melting crystalline phase. The proton conductivities of the oligomeric ionic liquids are determined by the type of cation in the temperature range 80-120 degrees C under anhydrous conditions and vary within five...

Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

Science.gov (United States)

Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

2011-09-30

Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

Recent SLC developments

International Nuclear Information System (INIS)

Ross, M.

1993-04-01

The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

Regulators of Slc4 bicarbonate transporter activity

Directory of Open Access Journals (Sweden)

Ian M. Thornell

2015-06-01

Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

Cardiac cine MRI: Comparison of 1.5 T, non-enhanced 3.0 T and blood pool enhanced 3.0 T imaging

International Nuclear Information System (INIS)

Gerretsen, S.C.; Versluis, B.; Bekkers, S.C.A.M.; Leiner, T.

2008-01-01

Introduction: Cardiac cine imaging using balanced steady state free precession sequences (bSSFP) suffers from artefacts at 3.0 T. We compared bSSFP cardiac cine imaging at 1.5 T with gradient echo imaging at 3.0 T with and without a blood pool contrast agent. Materials and methods: Eleven patients referred for cardiac cine imaging underwent imaging at 1.5 T and 3.0 T. At 3.0 T images were acquired before and after administration of 0.03 mmol/kg gadofosveset. Blood pool signal-to-noise ratio (SNR), temporal variations in SNR, ejection fraction and myocardial mass were compared. Subjective image quality was scored on a four-point scale. Results: Blood pool SNR increased with more than 75% at 3.0 T compared to 1.5 T (p < 0.001); after contrast administration at 3.0 T SNR increased with 139% (p < 0.001). However, variations in blood pool SNR at 3.0 T were nearly three times as high versus those at 1.5 T in the absence of contrast medium (p < 0.001); after contrast administration this was reduced to approximately a factor 1.4 (p = 0.21). Saturation artefacts led to significant overestimation of ejection fraction in the absence of contrast administration (1.5 T: 44.7 ± 3.1 vs. 3.0 T: 50.7 ± 4.2 [p = 0.04] vs. 3.0 T post contrast: 43.4 ± 2.9 [p = 0.55]). Subjective image quality was highest for 1.5 T (2.8 ± 0.3), and lowest for non-enhanced 3.0 T (1.7 ± 0.6; p = 0.006). Conclusions: GRE cardiac cine imaging at 3.0 T after injection of the blood pool agent gadofosveset leads to improved objective and subjective cardiac cine image quality at 3.0 T and to the same conclusions regarding cardiac ejection fraction compared to bSSFP imaging at 1.5 T

Library 3.0 intelligent libraries and apomediation

CERN Document Server

Kwanya, Tom; Underwood, Peter

2015-01-01

The emerging generation of research and academic library users expect the delivery of user-centered information services. 'Apomediation' refers to the supporting role librarians can give users by stepping in when users need help. Library 3.0 explores the ongoing debates on the "point oh” phenomenon and its impact on service delivery in libraries. This title analyses Library 3.0 and its potential in creating intelligent libraries capable of meeting contemporary needs, and the growing role of librarians as apomediators. Library 3.0 is divided into four chapters. The first chapter introduces and places the topic in context. The second chapter considers "point oh” libraries. The third chapter covers library 3.0 librarianship, while the final chapter explores ways libraries can move towards '3.0'.

Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

Science.gov (United States)

Lean, Choo Bee; Lee, Edmund Jon Deoon

2009-01-01

MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

Estradiol-induced regulation of GLUT4 in 3T3-L1 cells: involvement of ESR1 and AKT activation.

Science.gov (United States)

Campello, Raquel S; Fátima, Luciana A; Barreto-Andrade, João Nilton; Lucas, Thais F; Mori, Rosana C; Porto, Catarina S; Machado, Ubiratan F

2017-10-01

Impaired insulin-stimulated glucose uptake involves reduced expression of the GLUT4 (solute carrier family 2 facilitated glucose transporter member 4, SLC2A4 gene). 17β-estradiol (E 2 ) modulates SLC2A4 /GLUT4 expression, but the involved mechanisms are unclear. Although E 2 exerts biological effects by binding to estrogen receptors 1/2 (ESR1/2), which are nuclear transcriptional factors; extranuclear effects have also been proposed. We hypothesize that E 2 regulates GLUT4 through an extranuclear ESR1 mechanism. Thus, we investigated the effects of E 2 upon (1) subcellular distribution of ESRs and the proto-oncogene tyrosine-protein kinases (SRC) involvement; (2) serine/threonine-protein kinase (AKT) activation; (3) Slc2a4 /GLUT4 expression and (4) GLUT4 subcellular distribution and glucose uptake in 3T3-L1 adipocytes. Differentiated 3T3-L1 adipocytes were cultivated or not with E 2 for 24 h, and additionally treated or not with ESR1-selective agonist (PPT), ESR1-selective antagonist (MPP) or selective SRC inhibitor (PP2). Subcellular distribution of ESR1, ESR2 and GLUT4 was analyzed by immunocytochemistry; Slc2a4 mRNA and GLUT4 were quantified by qPCR and Western blotting, respectively; plasma membrane GLUT4 translocation and glucose uptake were analyzed under insulin stimulus for 20 min or not. E 2 induced (1) translocation of ESR1, but not of ESR2, from nucleus to plasma membrane and AKT phosphorylation, effects mimicked by PPT and blocked by MPP and PP2; (2) increased Slc2a4 /GLUT4 expression and (3) increased insulin-stimulated GLUT4 translocation and glucose uptake. In conclusion, E 2 treatment promoted a SRC-mediated nucleus-plasma membrane shuttle of ESR1, and increased AKT phosphorylation, Slc2a4 /GLUT4 expression and plasma membrane GLUT4 translocation; consequently, improving insulin-stimulated glucose uptake. These results unravel mechanisms through which estrogen improves insulin sensitivity. © 2017 Society for Endocrinology.

Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

Directory of Open Access Journals (Sweden)

Yan Xiaofei

2011-09-01

Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

40 CFR 721.3100 - Oligomeric silicic acid ester compound with a hy-droxyl-al-kyla-mine.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Oligomeric silicic acid ester compound with a hy-droxyl-al-kyla-mine. 721.3100 Section 721.3100 Protection of Environment ENVIRONMENTAL... Significant New Uses for Specific Chemical Substances § 721.3100 Oligomeric silicic acid ester compound with a...

Polymorphism and mesomorphism of oligomeric surfactants: effect of the degree of oligomerization.

Science.gov (United States)

Jurašin, D; Pustak, A; Habuš, I; Šmit, I; Filipović-Vinceković, N

2011-12-06

A series of cationic oligomeric surfactants (quaternary dodecyldimethylammonium ions with two, three, or four chains connected by an ethylene spacer at the headgroup level, abbreviated as dimer, trimer, and tetramer) were synthesized and characterized. The influence of the degree of oligomerization on their polymorphic and mesomorphic properties was investigated by means of X-ray diffraction, polarizing optical microscopy, thermogravimetry, and differential scanning calorimetry. All compounds display layered arrangements with interdigitated dodecyl chains. The increase in the degree of oligomerization increases the interlayer distance and decreases the ordering in the solid phase; whereas the dimer sample is fully crystalline with well-developed 3D ordering and the trimer and tetramer crystallize as highly ordered crystal smectic phases. The number of thermal phase transitions and sequence of phases are markedly affected by the number of dodecyl chains. Anhydrous samples exhibit polymorphism and thermotropic mesomorphism of the smectic type, with the exception of the tetramer that displays only transitions at higher temperature associated with decomposition and melting. All hydrated compounds form lyotropic mesophases showing reversible phase transitions upon heating and cooling. The sequence of liquid-crystalline phases for the dimer, typical of concentrated ionic surfactant systems, comprises a hexagonal phase at lower temperatures and a smectic phase at higher temperatures. In contrast, the trimer and tetramer reveal textures of the hexagonal phase. © 2011 American Chemical Society

SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

Directory of Open Access Journals (Sweden)

Hassen Hadj-Kacem

2010-01-01

Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

E-Learning 3.0 = E-Learning 2.0 + Web 3.0?

Science.gov (United States)

Hussain, Fehmida

2012-01-01

Web 3.0, termed as the semantic web or the web of data is the transformed version of Web 2.0 with technologies and functionalities such as intelligent collaborative filtering, cloud computing, big data, linked data, openness, interoperability and smart mobility. If Web 2.0 is about social networking and mass collaboration between the creator and…

Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas

Directory of Open Access Journals (Sweden)

Alberto Azzalin

2017-04-01

Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.

Lessons from the SLC for future LC control systems

International Nuclear Information System (INIS)

Humphrey, R.

1992-01-01

The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)

Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

Directory of Open Access Journals (Sweden)

Wu Bailin

2008-11-01

Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the

Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

Science.gov (United States)

Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C

2008-01-01

Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to

The SLC polarized electron source

International Nuclear Information System (INIS)

Clendenin, J.E.

1990-10-01

A polarized electron source consisting of a 3-electrode photocathode gun and a flashlamp-pumped dye laser has been designed and built for the SLC and is currently undergoing commissioning. The source is described, and the operating configuration is discussed. The present status of the source and future plans are briefly indicated. 7 refs., 4 figs

DEFINING THE NOTION OF CONCEPT MAPS 3.0

DEFF Research Database (Denmark)

Jensen, Jesper; Johnsen, Lars

The aim of this poster is to present a proposal of how concept maps may be described, annotated and exposed on the Web of Data, also frequently known as the Semantic Web or Web 3.0. In doing so, the poster will first introduce the concept ofconcept maps 3.0 – that is, concept maps which utilize......, and are enriched by, Web 3.0 technologies and resources. While conceptmaps 1.0 and 2.0 may be said to reflect earlier generations of the Web, the web of documents and the social web, the utilization ofWeb 3.0 technologies allows concept maps 3.0 to become machine-interpretable semantic web resources, and perhaps...... even semantic learning resources. This has several implications. One is that concept map discoverability can undoubtedly be improved through metadata annotation and the use of search engine interpretable vocabularies such as hts://schema.org/. Also, a key featureof Web 3.0 is that it supports...

Alterations in expression of senescence marker protein-30 gene by 3,3',5-triiodo-L-thyronine (T3).

Science.gov (United States)

Sar, Pranati; Rath, Bandita; Subudhi, Umakanta; Chainy, Gagan Bihari Nityananda; Supakar, Prakash Chandra

2007-09-01

Thyroid hormone (T3) is essential for normal development, differentiation, and metabolic balance of the body. A toxic dose of T(3) in animals increases the basal metabolic rate and reactive oxygen species production, resulting more oxidative stress through Ca(2+) influx to cytoplasm. Senescence Marker Protein-30 (SMP30) is preferentially expressed in the liver and protects cells against various injuries by enhancement of Ca(2+) efflux to either extra cellular space or intraorganellar spaces through membrane Ca(2+) pump activity. In this paper we report an alteration in the level of SMP30 gene expression using RT-PCR and western blot analysis in T(3) treated female Wistar rats. The results indicate that there is an induction of SMP30 expression during early hours of T(3 )treatment and it declines in severe hyperthyroidism. Therefore, we speculate that SMP30 is regulated by T(3) and might play a protective role in hyperthyroidism.

The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

Science.gov (United States)

Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

2014-01-01

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

The imaging 3.0 informatics scorecard.

Science.gov (United States)

Kohli, Marc; Dreyer, Keith J; Geis, J Raymond

2015-04-01

Imaging 3.0 is a radiology community initiative to empower radiologists to create and demonstrate value for their patients, referring physicians, and health systems. In image-guided health care, radiologists contribute to the entire health care process, well before and after the actual examination, and out to the point at which they guide clinical decisions and affect patient outcome. Because imaging is so pervasive, radiologists who adopt Imaging 3.0 concepts in their practice can help their health care systems provide consistently high-quality care at reduced cost. By doing this, radiologists become more valuable in the new health care setting. The authors describe how informatics is critical to embracing Imaging 3.0 and present a scorecard that can be used to gauge a radiology group's informatics resources and capabilities. Copyright © 2015 American College of Radiology. Published by Elsevier Inc. All rights reserved.

Morphological study on dental caries induced in WBN/KobSlc rats (Rattus norvegicus) fed a standard laboratory diet.

Science.gov (United States)

Fukuzato, Yoko; Matsuura, Tetsuro; Ozaki, Kiyokazu; Matsuura, Masahiro; Sano, Tomoya; Nakahara, Yutaka; Kodama, Yasushi; Nakagawa, Akihito; Okamura, Sumie; Suido, Hirohisa; Torii, Kayo; Makino, Taketoshi; Narama, Isao

2009-10-01

In our previous studies, WBN/KobSlc was characterized as a rat strain in which only males began to develop pancreatitis, and then presented with diabetic symptoms. In the course of studying their pancreatic inflammation, we detected molar caries in prediabetic males feeding on a standard diet (CRF-1) widely used for experimental animals. The purpose of this study is to confirm whether the WBN/KobSlc strain is caries-susceptible to the diet reported to be non-cariogenic, and to examine the effect of a prediabetic condition on their dental caries. For a morphological study, 25 male WBN/KobSlc rats aged 3.2-7.8 months and 24 females of the same strain aged 3.3-6.6 months were used, along with 10 males and 10 females of 8.2-month-old F344 rats. Marked dental caries were detected in the mandibular molars of male and female WBN/KobSlc rats regardless of pancreatitis, although no similar changes were observed in any teeth of the F344 strain fed the same diet. Soft X-ray examination revealed that the caries began in the crown and progressed horizontally and vertically, and that a severe radiolucent lesion extensively expanded to the entire crown, corresponding to a macroscopically deleted molar. The caries had gradually developed mainly in the second mandibular molar from more than 3.5 months of age, while none were seen in any rats before that time. The WBN/KobSlc rats were caries-susceptible even to the standard laboratory diet, and pancreatitis was not directly associated with the onset of dental caries in this strain.

Maternal DRD2, SLC6A3, and OXTR genotypes as potential moderators of the relation between maternal history of care and maternal cortisol secretion in the context of mother-infant separation.

Science.gov (United States)

Ludmer, Jaclyn A; Jamieson, Brittany; Gonzalez, Andrea; Levitan, Robert; Kennedy, James; Villani, Vanessa; Masellis, Mario; Basile, Vincenzo S; Atkinson, Leslie

2017-10-01

A mother's cortisol secretion is importantly associated with her own mental health and her infant's cortisol secretion. This study investigated the influences of maternal history of care and maternal DRD2, SLC6A3, and OXTR genotypes on maternal cortisol in the context of infant stress. A community sample of 296 mother-infant dyads completed a maternal separation at infant age 17 months. Maternal salivary cortisol, buccal cells, and self-reported history of care were collected. Multilevel models revealed that history of care had a greater influence on maternal baseline cortisol (but not cortisol trajectory) for mothers with more plasticity alleles of SLC6A3 (10R) and OXTR (G), relative to mothers with fewer or no plasticity alleles. Findings indicate that a mother's history of care is related to her cortisol secretion in anticipation of infant stress, but that this relation depends on her genetic characteristics. Findings are discussed in relation to the maternal protective system and anticipatory cortisol secretion. Copyright © 2017 Elsevier B.V. All rights reserved.

The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

Science.gov (United States)

Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

2014-11-28

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse

NARCIS (Netherlands)

Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.

2014-01-01

During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate

Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

Science.gov (United States)

Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

2013-01-01

To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

XACML 3.0 in Answer Set Programming

DEFF Research Database (Denmark)

Ramli, Carroline Dewi Puspa Kencana; Nielson, Hanne Riis; Nielson, Flemming

2012-01-01

We present a systematic technique for transforming XACML 3.0 policies in Answer Set Programming (ASP). We show that the resulting logic program has a unique answer set that directly corresponds to our formalisation of the standard semantics of XACML 3.0 from [9]. We demonstrate how our results make...

Significance of downregulation of renal organic cation transporter (SLC47A1 in cisplatin-induced proximal tubular injury

Directory of Open Access Journals (Sweden)

Mizuno T

2015-07-01

Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury

Dicty_cDB: SLC413 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

Dicty_cDB: SLC404 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

Dicty_cDB: SLC402 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

The effects and mechanisms of SLC34A2 on maintaining stem cell-like phenotypes in CD147+ breast cancer stem cells.

Science.gov (United States)

Lv, Yonggang; Wang, Ting; Fan, Jing; Zhang, Zhenzhen; Zhang, Juliang; Xu, Cheng; Li, Yongping; Zhao, Ge; He, Chenyang; Meng, Huimin; Yang, Hua; Wang, Zhen; Liu, Jiayun; Chen, Jianghao; Wang, Ling

2017-04-01

The cancer stem cell (CSC) hypothesis has gained significant recognition in describing tumorigenesis. Identification of the factors critical to development of breast cancer stem cells (BCSCs) may provide insight into the improvement of effective therapies against breast cancer. In this study, we aim to investigate the biological function of SLC34A2 in affecting the stem cell-like phenotypes in BCSCs and its underlying mechanisms. We demonstrated that CD147 + cells from breast cancer tissue samples and cell lines possessed BCSC-like features, including the ability of self-renewal in vitro, differentiation, and tumorigenic potential in vivo. Flow cytometry analysis showed the presence of a variable fraction of CD147 + cells in 9 of 10 tumor samples. Significantly, SLC34A2 expression in CD147 + BCSCs was enhanced compared with that in differentiated adherent progeny of CD147 + BCSCs and adherently cultured cell line cells. In breast cancer patient cohorts, SLC34A2 expression was found increased in 9 of 10 tumor samples. By using lentiviral-based approach, si-SLC34A2-transduced CD147 + BCSCs showed decreased ability of sphere formation, cell viability in vitro, and tumorigenicity in vivo, which suggested the essential role of SLC34A2 in CD147 + BCSCs. Furthermore, PI3K/AKT pathway and SOX2 were found necessary to maintain the stemness of CD147 + BCSCs by using LY294002 or lentiviral-si-SOX2. Finally, we indicated that SLC34A2 could regulate SOX2 to maintain the stem cell-like features in CD147 + BCSCs through PI3K/AKT pathway. Therefore, our report identifies a novel role of SLC34A2 in BCSCs' state regulation and establishes a rationale for targeting the SLC34A2/PI3K/AKT/SOX2 signaling pathway for breast cancer therapy.

Social Values for Ecosystem Services, version 3.0 (SolVES 3.0): documentation and user manual

Science.gov (United States)

Sherrouse, Ben C.; Semmens, Darius J.

2015-01-01

The geographic information system (GIS) tool, Social Values for Ecosystem Services (SolVES), was developed to incorporate quantified and spatially explicit measures of social values into ecosystem service assessments. SolVES 3.0 continues to extend the functionality of SolVES, which was designed to assess, map, and quantify the social values of ecosystem services. Social values—the perceived, nonmarket values the public ascribes to ecosystem services, particularly cultural services, such as aesthetics and recreation—can be evaluated for various stakeholder groups. These groups are distinguishable by their attitudes and preferences regarding public uses, such as motorized recreation and logging. As with previous versions, SolVES 3.0 derives a quantitative 10-point, social-values metric—the value index—from a combination of spatial and nonspatial responses to public value and preference surveys. The tool also calculates metrics characterizing the underlying environment, such as average distance to water and dominant landcover. SolVES 3.0 is integrated with Maxent maximum entropy modeling software to generate more complete social-value maps and offer robust statistical models describing the relationship between the value index and explanatory environmental variables. A model’s goodness of fit to a primary study area and its potential performance in transferring social values to similar areas using value-transfer methodology can be evaluated. SolVES 3.0 provides an improved public-domain tool for decision makers and researchers to evaluate the social values of ecosystem services and to facilitate discussions among diverse stakeholders regarding the tradeoffs among ecosystem services in a variety of physical and social contexts ranging from forest and rangeland to coastal and marine.

40 CFR 30.3 - Effect on other issuances.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Effect on other issuances. 30.3 Section 30.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE..., HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS General § 30.3 Effect on other issuances. For awards subject...

DNA structure modulates the oligomerization properties of the AAV initiator protein Rep68.

Directory of Open Access Journals (Sweden)

Jorge Mansilla-Soto

2009-07-01

Full Text Available Rep68 is a multifunctional protein of the adeno-associated virus (AAV, a parvovirus that is mostly known for its promise as a gene therapy vector. In addition to its role as initiator in viral DNA replication, Rep68 is essential for site-specific integration of the AAV genome into human chromosome 19. Rep68 is a member of the superfamily 3 (SF3 helicases, along with the well-studied initiator proteins simian virus 40 large T antigen (SV40-LTag and bovine papillomavirus (BPV E1. Structurally, SF3 helicases share two domains, a DNA origin interaction domain (OID and an AAA(+ motor domain. The AAA(+ motor domain is also a structural feature of cellular initiators and it functions as a platform for initiator oligomerization. Here, we studied Rep68 oligomerization in vitro in the presence of different DNA substrates using a variety of biophysical techniques and cryo-EM. We found that a dsDNA region of the AAV origin promotes the formation of a complex containing five Rep68 subunits. Interestingly, non-specific ssDNA promotes the formation of a double-ring Rep68, a known structure formed by the LTag and E1 initiator proteins. The Rep68 ring symmetry is 8-fold, thus differing from the hexameric rings formed by the other SF3 helicases. However, similiar to LTag and E1, Rep68 rings are oriented head-to-head, suggesting that DNA unwinding by the complex proceeds bidirectionally. This novel Rep68 quaternary structure requires both the DNA binding and AAA(+ domains, indicating cooperativity between these regions during oligomerization in vitro. Our study clearly demonstrates that Rep68 can oligomerize through two distinct oligomerization pathways, which depend on both the DNA structure and cooperativity of Rep68 domains. These findings provide insight into the dynamics and oligomeric adaptability of Rep68 and serve as a step towards understanding the role of this multifunctional protein during AAV DNA replication and site-specific integration.

Towards health informatics 3.0. Editorial.

Science.gov (United States)

Kulikowski, Casimir A; Geissbuhler, Antoine

2011-01-01

To provide an editorial introduction to the 2011 IMIA Yearbook of Medical Informatics with an overview of its contents and contributors. A brief overview of the main theme, and an outline of the purposes, contents, format, and acknowledgment of contributions for the 2011 IMIA Yearbook. This 2011 issue of the IMIA Yearbook highlights important developments in the development of Web 3.0 capabilities that are increasing in Health Informatics, impacting the activities in research, education and practice in this interdisciplinary field. There has been steady progress towards introducing semantics into informatics systems through more sophisticated representations of knowledge in their underlying information. Health Informatics 3.0 capabilities are identified from the recent literature, illustrated by selected papers published during the past 12 months, and articles reported by IMIA Working Groups. Surveys of the main research sub-fields in biomedical informatics in the Yearbook provide an overview of progress and current challenges across the spectrum of the discipline, focusing on Web 3.0 challenges and opportunities.

Dicty_cDB: SLC481 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

Expression Patterns and Correlations with Metabolic Markers of Zinc Transporters ZIP14 and ZNT1 in Obesity and Polycystic Ovary Syndrome

Science.gov (United States)

Maxel, Trine; Svendsen, Pernille Fog; Smidt, Kamille; Lauridsen, Jesper Krogh; Brock, Birgitte; Pedersen, Steen Bønlykke; Rungby, Jørgen; Larsen, Agnete

2017-01-01

Polycystic ovary syndrome (PCOS) is associated with infertility, increased androgen levels, and insulin resistance. In adipose tissue, zinc facilitates insulin signaling. Circulating zinc levels are altered in obesity, diabetes, and PCOS; and zinc supplementation can ameliorate metabolic disturbances in PCOS. In adipose tissue, expression of zinc influx transporter ZIP14 varies with body mass index (BMI), clinical markers of metabolic syndrome, and peroxisome proliferator-activated receptor gamma (PPARG). In this study, we investigated expression levels of ZIP14 and PPARG in subcutaneous adipose tissue of 36 PCOS women (17 lean and 19 obese women) compared with 23 healthy controls (7 lean and 16 obese women). Further, expression levels of zinc transporter ZIP9, a recently identified androgen receptor, and zinc efflux transporter ZNT1 were investigated, alongside lipid profile and markers of glucose metabolism [insulin degrading enzyme, retinol-binding protein 4 (RBP4), and glucose transporter 4 (GLUT4)]. We find that ZIP14 expression is reduced in obesity and positively correlates with PPARG expression, which is downregulated with increasing BMI. ZNT1 is upregulated in obesity, and both ZIP14 and ZNT1 expression significantly correlates with clinical markers of altered glucose metabolism. In addition, RBP4 and GLUT4 associate with obesity, but an association with PCOS as such was present only for PPARG and RBP4. ZIP14 and ZNT1 does not relate to clinical androgen status and ZIP9 is unaffected by all parameters investigated. In conclusion, our findings support the existence of a zinc dyshomeostasis in adipose tissue in metabolic disturbances including PCOS-related obesity. PMID:28303117

Prolactin receptor attenuation induces zinc pool redistribution through ZnT2 and decreases invasion in MDA-MB-453 breast cancer cells

International Nuclear Information System (INIS)

Bostanci, Zeynep; Alam, Samina; Soybel, David I.; Kelleher, Shannon L.

2014-01-01

Prolactin receptor (PRL-R) activation regulates cell differentiation, proliferation, cell survival and motility of breast cells. Prolactin (PRL) and PRL-R over-expression are strongly implicated in breast cancer, particularly contributing to tumor growth and invasion in the more aggressive estrogen-receptor negative (ER−) disease. PRL-R antagonists have been suggested as potential therapeutic agents; however, mechanisms through which PRL-R antagonists exert their actions are not well-understood. Zinc (Zn) is a regulatory factor for over 10% of the proteome, regulating critical cell processes such as proliferation, cell signaling, transcription, apoptosis and autophagy. PRL-R signaling regulates Zn metabolism in breast cells. Herein we determined effects of PRL-R attenuation on cellular Zn metabolism and cell function in a model of ER-, PRL-R over-expressing breast cancer cells (MDA-MB-453). PRL-R attenuation post-transcriptionally increased ZnT2 abundance and redistributed intracellular Zn pools into lysosomes and mitochondria. ZnT2-mediated lysosomal Zn sequestration was associated with reduced matrix metalloproteinase 2 (MMP-2) activity and decreased invasion. ZnT2-mediated Zn accumulation in mitochondria was associated with increased mitochondrial oxidation. Our results suggest that PRL-R antagonism in PRL-R over-expressing breast cancer cells may reduce invasion through the redistribution of intracellular Zn pools critical for cellular function. - Highlights: • PRL-R attenuation increased ZnT2 expression. • PRL-R attenuation increased lysosomal and mitochondrial Zn accumulation. • PRL-R attenuation decreased MMP-2 and invasion. • PRL-R antagonists may modulate lysosomal and mitochondrial Zn pools

Prolactin receptor attenuation induces zinc pool redistribution through ZnT2 and decreases invasion in MDA-MB-453 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Bostanci, Zeynep, E-mail: zbostanci@hmc.psu.edu [The Pennsylvania State University, Department of Nutritional Sciences, 209 Chandlee Lab, University Park, PA 16802 (United States); The Pennsylvania State University Milton S. Hershey Medical Center, Department of Surgery, 500 University Dr., Hershey, PA 17033 (United States); Alam, Samina, E-mail: sra116@psu.edu [The Pennsylvania State University, Department of Nutritional Sciences, 209 Chandlee Lab, University Park, PA 16802 (United States); The Pennsylvania State University Milton S. Hershey Medical Center, Department of Surgery, 500 University Dr., Hershey, PA 17033 (United States); Soybel, David I., E-mail: dsoybel@hmc.psu.edu [The Pennsylvania State University, Department of Nutritional Sciences, 209 Chandlee Lab, University Park, PA 16802 (United States); The Pennsylvania State University Milton S. Hershey Medical Center, Department of Surgery, 500 University Dr., Hershey, PA 17033 (United States); The Pennsylvania State University College of Medicine, Department of Cell and Molecular Physiology, 500 University Dr., Hershey, PA 17033 (United States); Kelleher, Shannon L., E-mail: slk39@psu.edu [The Pennsylvania State University, Department of Nutritional Sciences, 209 Chandlee Lab, University Park, PA 16802 (United States); The Pennsylvania State University Milton S. Hershey Medical Center, Department of Surgery, 500 University Dr., Hershey, PA 17033 (United States); The Pennsylvania State University College of Medicine, Department of Cell and Molecular Physiology, 500 University Dr., Hershey, PA 17033 (United States)

2014-02-15

Prolactin receptor (PRL-R) activation regulates cell differentiation, proliferation, cell survival and motility of breast cells. Prolactin (PRL) and PRL-R over-expression are strongly implicated in breast cancer, particularly contributing to tumor growth and invasion in the more aggressive estrogen-receptor negative (ER−) disease. PRL-R antagonists have been suggested as potential therapeutic agents; however, mechanisms through which PRL-R antagonists exert their actions are not well-understood. Zinc (Zn) is a regulatory factor for over 10% of the proteome, regulating critical cell processes such as proliferation, cell signaling, transcription, apoptosis and autophagy. PRL-R signaling regulates Zn metabolism in breast cells. Herein we determined effects of PRL-R attenuation on cellular Zn metabolism and cell function in a model of ER-, PRL-R over-expressing breast cancer cells (MDA-MB-453). PRL-R attenuation post-transcriptionally increased ZnT2 abundance and redistributed intracellular Zn pools into lysosomes and mitochondria. ZnT2-mediated lysosomal Zn sequestration was associated with reduced matrix metalloproteinase 2 (MMP-2) activity and decreased invasion. ZnT2-mediated Zn accumulation in mitochondria was associated with increased mitochondrial oxidation. Our results suggest that PRL-R antagonism in PRL-R over-expressing breast cancer cells may reduce invasion through the redistribution of intracellular Zn pools critical for cellular function. - Highlights: • PRL-R attenuation increased ZnT2 expression. • PRL-R attenuation increased lysosomal and mitochondrial Zn accumulation. • PRL-R attenuation decreased MMP-2 and invasion. • PRL-R antagonists may modulate lysosomal and mitochondrial Zn pools.

BOT3P - Bologna Transport Analysis Pre-Post-Processors Version 3.0

International Nuclear Information System (INIS)

Orsi, Roberto

2004-01-01

BOT3P is a set of standard FORTRAN 77 language programs developed at the ENEA-Bologna Nuclear Data Centre. BOT3P Version 1.0 was originally conceived to give the users of the DORT and TORT deterministic transport codes some useful diagnostic tools to prepare and to check their input data files. BOT3P Version 3.0 contains some important additions in the input geometrical model description, such as 'rod' and 'hexagonal' geometrical objects, respecting the exact cross-sectional area value and very suitable to describe a reactor lattice in detail. Moreover, it has extended the possibility to produce the geometrical, material distribution, and fixed neutron source data for the deterministic transport codes TWODANT and THREEDANT of the DANTSYS system and for the PARTISN code too, starting from the same input to BOT3P. When users require X-Y-Z TORT/THREEDANT/PARTISN mesh grids to be generated, BOT3P Version 3.0 produces a geometrical input for the MCNP Monte Carlo transport code also, where the MCNP cells correspond to the X-Y-Z bodies created for TORT.BOT3P Version 3.0 lets users specify areas/volumes of the model where the zone/material distribution can be defined not only by a combinatorial geometry but also by an external source, such as one originated from computerized tomography scan data (only for three-dimensional applications) and from one or more external DORT/TORT input files. BOT3P was developed on a DIGITAL UNIX ALPHA 500/333 workstation and successfully used in some complex neutron shielding and criticality benchmarks. It was also tested on Red Hat Linux 7.1 and is designed to run on most UNIX platforms. All BOT3P versions are publicly available from the Organisation for Economic Co-operation and Development/Nuclear Energy Agency Data Bank (NEA-1627, NEA-1678)

Dicty_cDB: SLC407 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

Dicty_cDB: SLC405 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

Dicty_cDB: SLC415 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

Dicty_cDB: SLC424 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

Dicty_cDB: SLC489 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC435 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

Probiotic Bifidobacterium species stimulate human SLC26A3 gene function and expression in intestinal epithelial cells

Science.gov (United States)

Kumar, Anoop; Hecht, Cameron; Priyamvada, Shubha; Anbazhagan, Arivarasu N.; Alakkam, Anas; Borthakur, Alip; Alrefai, Waddah A.; Gill, Ravinder K.

2014-01-01

SLC26A3, or downregulated in adenoma (DRA), plays a major role in mediating Cl− absorption in the mammalian intestine. Disturbances in DRA function and expression have been implicated in intestinal disorders such as congenital Cl− diarrhea and gut inflammation. We previously showed that an increase in DRA function and expression by Lactobacillus acidophilus and its culture supernatant (CS) might underlie antidiarrheal effects of this probiotic strain. However, the effects of Bifidobacterium species, important inhabitants of the human colon, on intestinal Cl−/HCO3− exchange activity are not known. Our current results demonstrate that CS derived from Bifidobacterium breve, Bifidobacterium infantis, and Bifidobacterium bifidum increased anion exchange activity in Caco-2 cells (∼1.8- to 2.4-fold). Consistent with the increase in DRA function, CS also increased the protein, as well as the mRNA, level of DRA (but not putative anion transporter 1). CS of all three Bifidobacterium sp. increased DRA promoter activity (−1,183/+114 bp) in Caco-2 cells (1.5- to 1.8-fold). Furthermore, the increase in DRA mRNA expression by CS of B. breve and B. infantis was blocked in the presence of the transcription inhibitor actinomycin D (5 μM) and the ERK1/2 MAPK pathway inhibitor U0126 (10 μM). Administration of live B. breve, B. infantis, and B. bifidum by oral gavage to mice for 24 h increased DRA mRNA and protein levels in the colon. These data demonstrate an upregulation of DRA via activation of the ERK1/2 pathway that may underlie potential antidiarrheal effects of Bifidobacterium sp. PMID:25143346

Dicty_cDB: SLC411 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

Catalytic oligomerization of terminal alkynes promoted by organo-f-complexes

International Nuclear Information System (INIS)

Straub, T.; Haskel, A.; Eisen, M.S.

1995-01-01

Organoactinides of the type Cp* 2 AcMe 2 (Cp*=C 5 Me 5 ; Ac=Th, U) are active catalyst precursors for the oligomerization of terminal alkynes HC triple-bond CR (R=alkyl, aryl, SiMe 3 ). The regioselectivity and the extent of oligomerization strongly depend on the alkyne substituent R, whereas the catalytic reactivity is similar for 1 and 2. In the presence of one of these organoactinides, for example, HCCSiMe 3 regioselectively oligomerizes to the head-to-tail dimer 3 (5%) and the trimer 4 (95%). 1 and 2 react with the terminal alkynes, releasing methane, to the corresponding bisacetylide complexes which are active species and in the catalytic reactions. The bisacetylide complex (η 5 -C 5 Me 5 ) 2 U(CCPh) 2 was identified by proton NMR spectroscopy. Subsequent insertion of alkyne molecules in the actinide-carbon σ-bonds leads to the formation of actinide-alkenyl complexes. The turnover limiting step is the release of the organic oligomer from the actinide-organyl complex. A species of the latter has been spectroscopically characterized in the trimerization reaction of HCCSiMe 3 . In this poster, the catalytic reactivity of the actinide alkyls 1 and 2 with various mono-substituted alkynes as well as the spectroscopic characterization of the key organometallic intermediate complexes in the catalytic cycle and a detailed mechanistic discussion are given

Dicty_cDB: SLC420 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

Dicty_cDB: SLC419 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

Dicty_cDB: SLC409 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

Dicty_cDB: SLC485 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

DEFF Research Database (Denmark)

Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

2013-01-01

The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

Science.gov (United States)

Rao, Suryadevara S; Hildebrand, David

2009-10-01

The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

Web 3.0: Implications for Online Learning

Science.gov (United States)

Morris, Robin D.

2010-01-01

The impact of Web 3.0, also known as the Semantic Web, on online learning is yet to be determined as the Semantic Web and its technologies continue to develop. Online instructors must have a rudimentary understanding of Web 3.0 to prepare for the next phase of online learning. This paper provides an understandable definition of the Semantic Web…

Genome-wide association analysis confirms and extends the association of SLC2A9 with serum uric acid levels to Mexican Americans

Directory of Open Access Journals (Sweden)

Venkata Saroja eVoruganti

2013-12-01

Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.

MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

Science.gov (United States)

Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

2016-11-01

A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

IT infrastructure in the era of imaging 3.0.

Science.gov (United States)

McGinty, Geraldine B; Allen, Bibb; Geis, J Raymond; Wald, Christoph

2014-12-01

Imaging 3.0 is a blueprint for the future of radiology modeled after the description of Web 3.0 as "more connected, more open, and more intelligent." Imaging 3.0 involves radiologists' using their expertise to manage all aspects of imaging care to improve patient safety and outcomes and to deliver high-value care. IT tools are critical elements and drivers of success as radiologists embrace the concepts of Imaging 3.0. Organized radiology, specifically the ACR, is the natural convener and resource for the development of this Imaging 3.0 toolkit. The ACR's new Imaging 3.0 Informatics Committee is actively working to develop the informatics tools radiologists need to improve efficiency, deliver more value, and provide quantitative ways to demonstrate their value in new health care delivery and payment systems. This article takes each step of the process of delivering high-value Imaging 3.0 care and outlines the tools available as well as additional resources available to support practicing radiologists. From the moment when imaging is considered through the delivery of a meaningful and actionable report that is communicated to the referring clinician and, when appropriate, to the patient, Imaging 3.0 IT tools will enable radiologists to position themselves as vital constituents in cost-effective, high-value health care. Copyright © 2014 American College of Radiology. Published by Elsevier Inc. All rights reserved.

Effect of SLC34A2 gene mutation on extracellular phosphorus transport in PAM alveolar epithelial cells.

Science.gov (United States)

Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing

2018-01-01

A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .

The gene expression of the neuronal protein, SLC38A9, changes in mouse brain after in vivo starvation and high-fat diet.

Directory of Open Access Journals (Sweden)

Sofie V Hellsten

Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.

Dicty_cDB: SLC495 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

Montage Version 3.0

Science.gov (United States)

Jacob, Joseph; Katz, Daniel; Prince, Thomas; Berriman, Graham; Good, John; Laity, Anastasia

2006-01-01

The final version (3.0) of the Montage software has been released. To recapitulate from previous NASA Tech Briefs articles about Montage: This software generates custom, science-grade mosaics of astronomical images on demand from input files that comply with the Flexible Image Transport System (FITS) standard and contain image data registered on projections that comply with the World Coordinate System (WCS) standards. This software can be executed on single-processor computers, multi-processor computers, and such networks of geographically dispersed computers as the National Science Foundation s TeraGrid or NASA s Information Power Grid. The primary advantage of running Montage in a grid environment is that computations can be done on a remote supercomputer for efficiency. Multiple computers at different sites can be used for different parts of a computation a significant advantage in cases of computations for large mosaics that demand more processor time than is available at any one site. Version 3.0 incorporates several improvements over prior versions. The most significant improvement is that this version is accessible to scientists located anywhere, through operational Web services that provide access to data from several large astronomical surveys and construct mosaics on either local workstations or remote computational grids as needed.

Dicty_cDB: SLC443 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC429 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

Dicty_cDB: SLC428 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

Major involvement of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) in uptake of biotin and pantothenic acid by human brain capillary endothelial cells.

Science.gov (United States)

Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya

2015-07-01

The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015

Dicty_cDB: SLC418 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

Dicty_cDB: SLC458 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

Dicty_cDB: SLC451 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC474 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

Dicty_cDB: SLC425 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

Impedance calculations for the improved SLC damping rings

International Nuclear Information System (INIS)

Bane, K.L.F.; Ng, C.K.

1993-04-01

A longitudinal, single bunch instability is observed in the damping rings of the Stanford Linear Collider (SLC). Beyond a threshold bunch population of 3 x 10 10 particles the bunch energy spread increases and a ''saw-tooth'' variation in bunch length and synchronous phase as functions of time is observed. Although the relative amplitude of the saw-tooth variation is small-only on the order of 10% -- the resulting unpredictability of the beam properties in the rest of the SLC accelerator makes it difficult, if not impossible, to operate the machine above the threshold current. An additional problem at higher currents is that the bunch length is greatly increased. When the bunch is very long in the ring it becomes difficult or impossible to properly compress it after extraction. We want to solve both of these problems so that the SLC can run at higher currents to increase the luminosity. In order to solve these problems the vacuum chambers of both damping rings are being rebuilt with the aim of reducing their impedance. According to previous calculations the impedance the SLC damping rings is dominated by the many small discontinuities that are located in the so-called QD and QF vacuum chamber segments -- elements such as transitions, masks, bellows-that are inductive to the beam, Since these earlier calculations were performed the bellows of the QD segments have been sleeved, yielding a factor of 2 increase in the instability threshold. In this paper we begin by discussing the gains that might be achieved if we can reduce the impedance of the rings even further. Then we estimate the effect on the total impedance of the actual design changes that are being proposed. Three important elements -- the bend-to-quad transitions, the distributed ion pump slots, and the beam position monitor (BPM) electrodes are fully 3-dimensional and will be studied using T3 of the MAFIA computer programs

Dicty_cDB: SLC441 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

MDS 3.0 Frequency Report

Data.gov (United States)

U.S. Department of Health & Human Services — The MDS 3.0 Frequency Report summarizes information for active residents currently in nursing homes. The source of these counts is the residents MDS assessment...

Glycophorin C (Gerbich Antigen Blood Group) and Band 3 Polymorphisms in Two Malaria Holoendemic Regions of Papua New Guinea

Science.gov (United States)

Patel, Sheral S.; King, Christopher L.; Mgone, Charles S.; Kazura, James W.; Zimmerman, Peter A.

2013-01-01

The geographic overlap between the prevalence of erythrocyte polymorphisms and malaria endemicity is thought to be an example of natural selection on human populations. In Papua New Guinea (PNG), the Gerbich-negative phenotype is caused by an exon 3 deletion in the glycophorin C gene (GYPCΔex3) while heterozygosity for a 27-base pair deletion in the SLC4A1 gene (anion exchanger 1 or erythrocyte membrane protein, band 3), SLC4A1Δ27, results in Southeast Asian ovalocytosis. Two geographically and ethnically distinct malaria endemic regions of PNG (the Wosera [East Sepik Province] and Liksul [Madang Province]) were studied to illustrate the distribution of two prominent deletion polymorphisms (GYPCΔex3 and SLC4A1Δ27) and to determine if the genetic load associated with SLC4A1Δ27 would constrain independent assortment of GYPCΔex3 heterozygous and homozygous genotypes. The frequency of the GYPCΔex3 allele was higher in the Wosera (0.463) than Liksul (0.176) (χ2; P < 0.0001). Conversely, the frequency of the SLC4A1Δ27 allele was higher in Liksul (0.0740) than the Wosera (0.0005) (χ2; P < 0.0001). No individuals were homozygous for SLC4A1Δ27. In 355 Liksul residents, independent assortment of these two deletion polymorphisms resulted in 14 SLC4A1Δ27 carriers heterozygous for GYPCΔex3 and one SLC4A1Δ27 carrier homozygous for GYPCΔex3 (Fisher’s exact test; P = 0.8040). While homozygosity for SLC4A1Δ27 appears to be nonviable, the GYPCΔex3 allele is not lethal when combined with SLC4A1Δ27. Neither mutation was associated with altered susceptibility to asymptomatic Plasmodium falciparum or P. vivax infection. While these erythrocyte polymorphisms apparently have no effect on blood-stage malaria infection, their contribution to susceptibility to clinical malaria morbidity requires further study. PMID:14695625

Dicty_cDB: SLC436 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

Dicty_cDB: SLC434 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC450 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

Dicty_cDB: SLC469 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

Dicty_cDB: SLC452 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

Significant Benefits from Libraries in Web 3.0 Environment

African Journals Online (AJOL)

pc

2018-03-05

Mar 5, 2018 ... Keywords- Web 3.0, library 3.0, Web 3.0 Applications, Semantic. Web ... providing virtual information services, and other services cannot be ... web third generation, definition, beginning, and retrieve system. The study ...

What will Web 3.0 bring to education?

Directory of Open Access Journals (Sweden)

Dan Jiang

2014-08-01

Full Text Available Every era of technology has, to some extent, formed education in its own image. It is believed that there is a mutually productive convergence between main technological influences on a culture and the contemporary educational theories and practices. As we are stepping into the era of Web 3.0, it is no surprise that t he network has been one part of our daily life and it becomes one of the most important places for us to learn, work, entertain and socialize, especially for the digital natives. For many people, Web 3.0 still may be a new word in education or a future trend for them, but actually the Web 3.0 technology has been applied and it keeps changing the culture, theory and practice in education subtly. The article aims to discuss about the impacts on Web 3.0 on education and try to view the impacts in terms of culture philosophy and sociology.

Dicty_cDB: SLC486 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC470 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC431 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

Dicty_cDB: SLC465 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

Dicty_cDB: SLC426 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

Dicty_cDB: SLC464 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

Dicty_cDB: SLC477 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

Dicty_cDB: SLC492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

Dicty_cDB: SLC432 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

STANFORD: Highly polarized SLC electron beams

International Nuclear Information System (INIS)

Anon.

1993-01-01

Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium

Dicty_cDB: SLC442 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC478 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

Dicty_cDB: SLC448 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Dicty_cDB: SLC456 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

Dicty_cDB: SLC438 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

Dicty_cDB: SLC440 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

Japanese Language and Culture: 10-3Y, 20-3Y, 30-3Y. 3-Year Program Guide to Implementation

Science.gov (United States)

Alberta Education, 2009

2009-01-01

This guide to implementation is intended to support the Japanese Language and Culture 10-3Y, 20-3Y, 30-3Y Program of Studies. It was developed primarily for teachers, yet it includes information that may be useful for administrators and other stakeholders in their efforts to plan for and implement the new Japanese program of studies. Familiarity…

CIFO 3.0

Science.gov (United States)

Rogers, Pat

1992-01-01

The Ada Runtime Environment Working Group has, since 1985, developed and published the Catalog of Interface Features and Options (CFIO) for Ada runtime environments. These interfaces, expressed in legal Ada, provide 'hooks' into the runtime system to export both functionality and enhanced performance beyond that of 'vanilla' Ada implementations. Such enhancements include high- and low-level scheduling control, asynchronous communications facilities, predictable storage management facilities, and fast interrupt response. CIFO 3.0 represents the latest release, which incorporates the efforts of the European real time community as well as new interfaces and expansions of previous catalog entries. This presentation will give both an overview of the Catalog's contents and an 'insider's' view of the Catalog as a whole.

Modulation of sodium-bicarbonate co-transporter (SLC4A4/NBCe1) protein and mRNA expression in rat's uteri by sex-steroids and at different phases of the oestrous cycle.

Science.gov (United States)

Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib

2014-02-01

Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.

Dicty_cDB: SLC466 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

Dicty_cDB: SLC461 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

Dicty_cDB: SLC437 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

Dicty_cDB: SLC444 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

Dicty_cDB: SLC490 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC484 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Specifications and Prototype of the Knowledge Repository (V.3.0) and the Knowledge Mediator (V.3.0)

Science.gov (United States)

Andreou, Dimitris; Christophides, Vassilis; Flouris, Giorgos; Kotzinos, Dimitris; Pediaditis, Panagiotis; Tsialiamanis, Petros

2009-01-01

This deliverable reports the technical and research development performed until M36 (January 2009) within tasks T5.2 and T5.4 of WP5 in the KP-Lab project, per the latest Description of Work (DoW) 3.2 [DoW3.2]. The described components are included in the KP-Lab Semantic Web Knowledge Middleware (SWKM) Prototype Release 3.0 software that takes…

Dicty_cDB: SLC460 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

Dicty_cDB: SLC496 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

Dicty_cDB: SLC449 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

[Analysis the relationship between SLC26A4 mutation and current diagnosis of inner ear malformation in children with sensorineural hearing loss].

Science.gov (United States)

Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao

2014-11-01

Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.

Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

Science.gov (United States)

Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

2015-01-01

Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

Zn(2+) site engineering at the oligomeric interface of the dopamine transporter.

Science.gov (United States)

Norgaard-Nielsen, Kristine; Norregaard, Lene; Hastrup, Hanne; Javitch, Jonathan A; Gether, Ulrik

2002-07-31

Increasing evidence suggests that Na(+)/Cl(-)-dependent neurotransmitter transporters exist as homo-oligomeric proteins. However, the functional implication of this oligomerization remains unclear. Here we demonstrate the engineering of a Zn(2+) binding site at the predicted dimeric interface of the dopamine transporter (DAT) corresponding to the external end of transmembrane segment 6. Upon binding to this site, which involves a histidine inserted in position 310 (V310H) and the endogenous Cys306 within the same DAT molecule, Zn(2+) potently inhibits [(3)H]dopamine uptake. These data provide indirect evidence that conformational changes critical for the translocation process may occur at the interface between two transporter molecules in the oligomeric structure.

SLC2A9 is a high-capacity urate transporter in humans.

Directory of Open Access Journals (Sweden)

Mark J Caulfield

2008-10-01

Full Text Available Serum uric acid levels in humans are influenced by diet, cellular breakdown, and renal elimination, and correlate with blood pressure, metabolic syndrome, diabetes, gout, and cardiovascular disease. Recent genome-wide association scans have found common genetic variants of SLC2A9 to be associated with increased serum urate level and gout. The SLC2A9 gene encodes a facilitative glucose transporter, and it has two splice variants that are highly expressed in the proximal nephron, a key site for urate handling in the kidney. We investigated whether SLC2A9 is a functional urate transporter that contributes to the longstanding association between urate and blood pressure in man.We expressed both SLC2A9 splice variants in Xenopus laevis oocytes and found both isoforms mediate rapid urate fluxes at concentration ranges similar to physiological serum levels (200-500 microM. Because SLC2A9 is a known facilitative glucose transporter, we also tested whether glucose or fructose influenced urate transport. We found that urate is transported by SLC2A9 at rates 45- to 60-fold faster than glucose, and demonstrated that SLC2A9-mediated urate transport is facilitated by glucose and, to a lesser extent, fructose. In addition, transport is inhibited by the uricosuric benzbromarone in a dose-dependent manner (Ki = 27 microM. Furthermore, we found urate uptake was at least 2-fold greater in human embryonic kidney (HEK cells overexpressing SLC2A9 splice variants than nontransfected kidney cells. To confirm that our findings were due to SLC2A9, and not another urate transporter, we showed that urate transport was diminished by SLC2A9-targeted siRNA in a second mammalian cell line. In a cohort of men we showed that genetic variants of SLC2A9 are associated with reduced urinary urate clearance, which fits with common variation at SLC2A9 leading to increased serum urate. We found no evidence of association with hypertension (odds ratio 0.98, 95% confidence interval [CI

SLC and SLD: Experimental experience with a linear collider

International Nuclear Information System (INIS)

Breidenbach, M.

1993-08-01

The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

8 CFR 3.0 - Executive Office for Immigration Review

Science.gov (United States)

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Executive Office for Immigration Review 3.0 Section 3.0 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY GENERAL PROVISIONS EXECUTIVE OFFICE FOR IMMIGRATION REVIEW § 3.0 Executive Office for Immigration Review Regulations of the Executive Office for...

Triiodothyronine Acutely Stimulates Glucose Transport into L6 Muscle Cells Without Increasing Surface GLUT4, GLUT1, or GLUT3

Science.gov (United States)

Teixeira, Silvania Silva; Tamrakar, Akhilesh K.; Goulart-Silva, Francemilson; Serrano-Nascimento, Caroline; Klip, Amira

2012-01-01

Background Thyroid hormones (THs) act genomically to stimulate glucose transport by elevating glucose transporter (Slc2a) expression and glucose utilization by cells. However, nongenomic effects of THs are now emerging. Here, we assess how triiodothyronine (T3) acutely affects glucose transport and the content of GLUT4, GLUT1, and GLUT3 at the surface of muscle cells, and possible interactions between T3 and insulin action. Methods Differentiated L6 myotubes transfected with myc-tagged Slc2a4 (L6-GLUT4myc) or Slc2a1 (L6-GLUT1myc) and wild-type L6 myotubes were studied in the following conditions: control, hypothyroid (Tx), Tx plus T3, Tx plus insulin, and Tx plus insulin and T3. Results Glucose uptake and GLUT4 content at the cell surface decreased in the Tx group relative to controls. T3 treatment for 30 minutes increased glucose transport into L6-GLUT4myc cells without altering surface GLUT4 content, which increased only thereafter. The total amount of GLUT4 protein remained unchanged among the groups studied. The surface GLUT1 content of L6-GLUT1myc cells also remained unaltered after T3 treatment; however, in these cells glucose transport was not stimulated by T3. In wild-type L6 cells, although T3 treatment increased the total amount of GLUT3, it did not change the surface GLUT3 content. Moreover, within 30 minutes, T3 stimulation of glucose uptake was additive to that of insulin in L6-GLUT4myc cells. As expected, insulin elevated surface GLUT4 content and glucose uptake. However, interestingly, surface GLUT4 content remained unchanged or even dropped with T3 plus insulin. Conclusions These data reveal that T3 rapidly increases glucose uptake in L6-GLUT4myc cells, which, at least for 30 minutes, did not depend on an increment in GLUT4 at the cell surface yet potentiates insulin action. We propose that this rapid T3 effect involves activation of GLUT4 transporters at the cell surface, but cannot discount the involvement of an unknown GLUT. PMID:22663547

Precise system stabilization at SLC using dither techniques

International Nuclear Information System (INIS)

Ross, M.C.; Hendrickson, L.; Himel, T.; Miller, E.

1993-01-01

A data acquisition method has been developed at the SLAC Linear Collider (SLC) that provides accurate beam parameter information using sub-tolerance excitation and synchronized detection. This is being applied to several SLC sub-systems to provide high speed feedback on beam parameters such as linac output energy spread. The method has significantly improved control of the linac energy spread. The linac average phase offset (θ), used to compensate the effects of longitudinal wakefields, is adjusted ±l control bit (about 0.18 degree S-band or 20% of tolerance), in a continuous fashion. Properly coordinated beam energy measurements provide a measure of the derivative of the accelerating voltage (dE/dθ). The position of the beam on the RF wave can thus be determined to ± 0.3 degree in about 5 seconds. The dithering does not contribute significantly to the energy jitter of the SLC and therefore does not adversely affect routine operation. Future applications include control of the interaction region beam size and orientation

A MULTI-WAVELENGTH 3D MODEL OF BD+30°3639

Energy Technology Data Exchange (ETDEWEB)

Freeman, M. J.; Kastner, Joel H. [Chester F. Carlson Center for Imaging Science, School of Physics and Astronomy, and Laboratory for Multiwavelength Astrophysics, Rochester Institute of Technology, 54 Lomb Memorial Drive, Rochester NY 14623 (United States)

2016-10-01

We present a 3D multi-wavelength reconstruction of BD+30°3639, one of the best-studied planetary nebulae in the solar neighborhood. BD+30°3639, which hosts a [WR]-type central star, has been imaged at wavelength regimes that span the electromagnetic spectrum, from radio to X-rays. We have used the astrophysical modeling software SHAPE to construct a 3D morpho-kinematic model of BD+30°3639. This reconstruction represents the most complete 3D model of a PN to date from the standpoint of the incorporation of multi-wavelength data. Based on previously published kinematic data in optical emission lines and in lines of CO (radio) and H{sub 2} (near-IR), we were able to reconstruct BD+30's basic velocity components assuming a set of homologous velocity expansion laws combined with collimated flows along the major axis of the nebula. We confirm that the CO “bullets” in the PN lie along an axis that is slightly misaligned with respect to the major axis of the optical nebula, and that these bullets are likely responsible for the disrupted structures of the ionized and H{sub 2}-emitting shells within BD+30. Given the relative geometries and thus dynamical ages of BD+30's main structural components, it is furthermore possible that the same jets that ejected the CO bullets are responsible for the generation of the X-ray-emitting hot bubble within the PN. Comparison of alternative viewing geometries for our 3D reconstruction of BD+30°3639 with imagery of NGC 40 and NGC 6720 suggests a common evolutionary path for these nebulae.

DiffSLC: A graph centrality method to detect essential proteins of a protein-protein interaction network.

Science.gov (United States)

Mistry, Divya; Wise, Roger P; Dickerson, Julie A

2017-01-01

Identification of central genes and proteins in biomolecular networks provides credible candidates for pathway analysis, functional analysis, and essentiality prediction. The DiffSLC centrality measure predicts central and essential genes and proteins using a protein-protein interaction network. Network centrality measures prioritize nodes and edges based on their importance to the network topology. These measures helped identify critical genes and proteins in biomolecular networks. The proposed centrality measure, DiffSLC, combines the number of interactions of a protein and the gene coexpression values of genes from which those proteins were translated, as a weighting factor to bias the identification of essential proteins in a protein interaction network. Potentially essential proteins with low node degree are promoted through eigenvector centrality. Thus, the gene coexpression values are used in conjunction with the eigenvector of the network's adjacency matrix and edge clustering coefficient to improve essentiality prediction. The outcome of this prediction is shown using three variations: (1) inclusion or exclusion of gene co-expression data, (2) impact of different coexpression measures, and (3) impact of different gene expression data sets. For a total of seven networks, DiffSLC is compared to other centrality measures using Saccharomyces cerevisiae protein interaction networks and gene expression data. Comparisons are also performed for the top ranked proteins against the known essential genes from the Saccharomyces Gene Deletion Project, which show that DiffSLC detects more essential proteins and has a higher area under the ROC curve than other compared methods. This makes DiffSLC a stronger alternative to other centrality methods for detecting essential genes using a protein-protein interaction network that obeys centrality-lethality principle. DiffSLC is implemented using the igraph package in R, and networkx package in Python. The python package can be

RELAP5/Mod3.3 and MARS3.0a Modeling of a Siphon Break Experiment

International Nuclear Information System (INIS)

Park, Su Ki; Kim, Heon Il; Park, Cheol; Yoon, Ju Hyeon

2011-01-01

Pool water plays a very important role as a final heat sink for most pool-type research reactors following postulated events. Therefore, one of design criteria for the reactors is that the water level of reactor pool must not decrease below a predefined elevation even against the most severe accident due to ruptures of coolant boundary of connecting systems to the reactor pool. In order to accomplish the design criterion, all the connecting systems are usually arranged to be above the elevation of reactor core. However, some research reactors with a downward flow in the reactor core have a primary cooling system located below the elevation of reactor core because of meeting an available net positive suction head of pumps in the system. These reactors have a provision consisting of pipes penetrating a reactor pool wall at a higher elevation than that of reactor core and siphon break devices to meet the design criterion. A series of experiments was carried out to figure out thermal hydraulic characteristics during siphon is blocked and establish design requirements for siphon breaker. The experimental study provided a lot of data and observations to the process of siphon break, but it does not provide a sufficient theoretical analysis and present practical design requirements applicable to industry. The experimental range is not also sufficient to cover operating conditions of siphon breakers for research reactors. A series of numerical simulations on the experimental data has been tried by using thermal hydraulic system analysis codes, RELAP5/Mod3.3 and MARS3.0a. This paper includes a part of the numerical simulations. First output from this study shows an importance of an adequate use of thermal hydraulic models in the codes and a big different prediction between the two codes especially in relation to the use of choked flow option. From this study, it seems that RELAP5/Mod3.3 has some problems on the control of a choked flow option-flag or the prediction of a

Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

Science.gov (United States)

Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

2016-08-08

Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

Loss-of-activity-mutation in the cardiac chloride-bicarbonate exchanger AE3 causes short QT syndrome

DEFF Research Database (Denmark)

Thorsen, Kasper; Dam, Vibeke S.; Kjaer-Sorensen, Kasper

2017-01-01

unrelated families with SQTS. The mutation causes reduced surface expression of AE3 and reduced membrane bicarbonate transport. Slc4a3 knockdown in zebrafish causes increased cardiac pHi, short QTc, and reduced systolic duration, which is rescued by wildtype but not mutated SLC4A3. Mechanistic analyses...

SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

Directory of Open Access Journals (Sweden)

Onkar Singh

Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

A cytosolic juxtamembrane interface modulates plexin A3 oligomerization and signal transduction.

Directory of Open Access Journals (Sweden)

Rachael Barton

Full Text Available Plexins (plxns are transmembrane (TM receptors involved in the guidance of vascular, lymphatic vessel, and neuron growth as well as cancer metastasis. Plxn signaling results in cytosolic GTPase-activating protein activity, and previous research implicates dimerization as important for activation of plxn signaling. Purified, soluble plxn extracellular and cytosolic domains exhibit only weak homomeric interactions, suggesting a role for the plxn TM and juxtamembrane regions in homooligomerization. In this study, we consider a heptad repeat in the Danio rerio PlxnA3 cytosolic juxtamembrane domain (JM for its ability to influence PlxnA3 homooligomerization in TM-domain containing constructs. Site-directed mutagenesis in conjunction with the AraTM assay and bioluminescent energy transfer (BRET² suggest an interface involving a JM heptad repeat, in particular residue M1281, regulates PlxnA3 homomeric interactions when examined in constructs containing an ectodomain, TM and JM domain. In the presence of a neuropilin-2a co-receptor and semaphorin 3F ligand, disruption to PlxnA3 homodimerization caused by an M1281F mutation is eliminated, suggesting destabilization of the PlxnA3 homodimer in the JM is not sufficient to disrupt co-receptor complex formation. In contrast, enhanced homodimerization of PlxnA3 caused by mutation M1281L remains even in the presence of ligand semaphorin 3F and co-receptor neuropilin-2a. Consistent with this pattern of PlxnA3 dimerization in the presence of ligand and co-receptor, destabilizing mutations to PlxnA3 homodimerization (M1281F are able to rescue motor patterning defects in sidetracked zebrafish embryos, whereas mutations that enhance PlxnA3 homodimerization (M1281L are not. Collectively, our results indicate the JM heptad repeat, in particular residue M1281, forms a switchable interface that modulates both PlxnA3 homomeric interactions and signal transduction.

Community Land Model Version 3.0 (CLM3.0) Developer's Guide

Energy Technology Data Exchange (ETDEWEB)

Hoffman, FM

2004-12-21

This document describes the guidelines adopted for software development of the Community Land Model (CLM) and serves as a reference to the entire code base of the released version of the model. The version of the code described here is Version 3.0 which was released in the summer of 2004. This document, the Community Land Model Version 3.0 (CLM3.0) User's Guide (Vertenstein et al., 2004), the Technical Description of the Community Land Model (CLM) (Oleson et al., 2004), and the Community Land Model's Dynamic Global Vegetation Model (CLM-DGVM): Technical Description and User's Guide (Levis et al., 2004) provide the developer, user, or researcher with details of implementation, instructions for using the model, a scientific description of the model, and a scientific description of the Dynamic Global Vegetation Model integrated with CLM respectively. The CLM is a single column (snow-soil-vegetation) biogeophysical model of the land surface which can be run serially (on a laptop or personal computer) or in parallel (using distributed or shared memory processors or both) on both vector and scalar computer architectures. Written in Fortran 90, CLM can be run offline (i.e., run in isolation using stored atmospheric forcing data), coupled to an atmospheric model (e.g., the Community Atmosphere Model (CAM)), or coupled to a climate system model (e.g., the Community Climate System Model Version 3 (CCSM3)) through a flux coupler (e.g., Coupler 6 (CPL6)). When coupled, CLM exchanges fluxes of energy, water, and momentum with the atmosphere. The horizontal land surface heterogeneity is represented by a nested subgrid hierarchy composed of gridcells, landunits, columns, and plant functional types (PFTs). This hierarchical representation is reflected in the data structures used by the model code. Biophysical processes are simulated for each subgrid unit (landunit, column, and PFT) independently, and prognostic variables are maintained for each subgrid unit

User information document for WinGridder Version 3.0

International Nuclear Information System (INIS)

Pan, Lehua; Pan, Lehua

2007-01-01

WINGRIDDER V3.0 is a Windows-based software for designing and generating numerical grids for numerical simulators that are based on the 'integral finite difference' or the 'control volume' numerical scheme (e.g., TOUGH2, Pruess et al., 1996). The user can design and generate grid that properly represents the stratigraphic features, inclined faults, and repository. WINGRIDDER V3.0 is an upgrade from WINGRIDDER V2.0. This revision includes testable requirements as listed in the Requirements Document (RD), 10024-RD-3.0-00, Section 2. With new features, WINGRIDDER V3.0 adds the ability to generate a multiple-interactive-continuum (MINC) grid

41 CFR 101-30.101-3 - National stock number.

Science.gov (United States)

2010-07-01

... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true National stock number. 101-30.101-3 Section 101-30.101-3 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30...

Validation Results for LEWICE 3.0

Science.gov (United States)

Wright, William B.

2005-01-01

A research project is underway at NASA Glenn to produce computer software that can accurately predict ice growth under any meteorological conditions for any aircraft surface. This report will present results from version 3.0 of this software, which is called LEWICE. This version differs from previous releases in that it incorporates additional thermal analysis capabilities, a pneumatic boot model, interfaces to computational fluid dynamics (CFD) flow solvers and has an empirical model for the supercooled large droplet (SLD) regime. An extensive comparison of the results in a quantifiable manner against the database of ice shapes and collection efficiency that have been generated in the NASA Glenn Icing Research Tunnel (IRT) has also been performed. The complete set of data used for this comparison will eventually be available in a contractor report. This paper will show the differences in collection efficiency between LEWICE 3.0 and experimental data. Due to the large amount of validation data available, a separate report is planned for ice shape comparison. This report will first describe the LEWICE 3.0 model for water collection. A semi-empirical approach was used to incorporate first order physical effects of large droplet phenomena into icing software. Comparisons are then made to every single element two-dimensional case in the water collection database. Each condition was run using the following five assumptions: 1) potential flow, no splashing; 2) potential flow, no splashing with 21 bin drop size distributions and a lift correction (angle of attack adjustment); 3) potential flow, with splashing; 4) Navier-Stokes, no splashing; and 5) Navier-Stokes, with splashing. Quantitative comparisons are shown for impingement limit, maximum water catch, and total collection efficiency. The results show that the predicted results are within the accuracy limits of the experimental data for the majority of cases.

Impact of genetic polymorphisms of SLC2A2, SLC2A5, and KHK on metabolic phenotypes in hypertensive individuals.

Directory of Open Access Journals (Sweden)

MyPhuong T Le

Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.

Development and Validation of the Nursing Home Minimum Data Set 3.0 Mortality Risk Score (MRS3).

Science.gov (United States)

Thomas, Kali S; Ogarek, Jessica A; Teno, Joan M; Gozalo, Pedro L; Mor, Vincent

2018-03-05

To develop a score to predict mortality using the Minimum Data Set 3.0 (MDS 3.0) that can be readily calculated from items collected during nursing home (NH) residents' admission assessments. We developed a training cohort of Medicare beneficiaries newly admitted to U.S. NHs during 2012 (N=1,426,815) and a testing cohort from 2013 (N=1,160,964). Data came from the MDS 3.0 assessments linked to the Medicare Beneficiary Summary File. Using the training dataset, we developed a composite MDS 3.0 Mortality Risk Score (MRS3) consisting of 17 clinical items and patients' age groups based on their relation to 30-day mortality. We assessed the calibration and discrimination of the MRS3 in predicting 30-day and 60-day mortality and compared its performance to the Charlson Comorbidity Index and the clinician's assessment of 6-month prognosis measured at admission. The 30-day and 60-day mortality rate for the testing population was 2.8% and 5.6%, respectively. Results from logistic regression models suggest that the MRS3 performed well in predicting death within 30 and 60 days (C-Statistics of 0.744 (95%CL = 0.741, 0.747) and 0.709 (95%CL=0.706, 0.711), respectively). The MRS3 was a superior predictor of mortality compared to the Charlson Comorbidity Index (C-statistics of 0.611 (95%CL=0.607, 0.615) and 0.608 (95%CL=0.605, 0.610)) and the clinicians' assessments of patients' 6-month prognoses (C-statistics of 0.543 (95%CL=0.542, 0.545) and 0.528 (95%CL=0.527, 0.529). The MRS3 is a good predictor of mortality and can be useful in guiding decision-making, informing plans of care, and adjusting for patients' risk of mortality.

A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

Directory of Open Access Journals (Sweden)

Beever Jonathan E

2010-05-01

Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

Regularization Tools Version 3.0 for Matlab 5.2

DEFF Research Database (Denmark)

Hansen, Per Christian

1999-01-01

This communication describes Version 3.0 of Regularization Tools, a Matlab package for analysis and solution of discrete ill-posed problems.......This communication describes Version 3.0 of Regularization Tools, a Matlab package for analysis and solution of discrete ill-posed problems....

Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.

Science.gov (United States)

Mackenzie, Bryan; Erickson, Jeffrey D

2004-02-01

The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.

Liraglutide 3.0 mg for Weight Management: A Population Pharmacokinetic Analysis.

Science.gov (United States)

Overgaard, Rune V; Petri, Kristin C; Jacobsen, Lisbeth V; Jensen, Christine B

2016-11-01

This analysis used a population pharmacokinetic approach to identify covariates that influence plasma exposure of liraglutide 3.0 mg, a glucagon-like peptide-1 (GLP-1) receptor agonist approved for weight management in overweight and obese individuals. Samples for pharmacokinetic analysis were drawn at weeks 2, 12 and 28 of the phase IIIa SCALE Obesity and Prediabetes (N = 2339) and SCALE Diabetes (N = 584) trials. Dose proportionality of liraglutide in obese subjects was investigated using data from a phase II dose-finding study (N = 331). Dose-proportional exposure of liraglutide up to and including 3.0 mg was confirmed. Body weight and sex influenced exposure of liraglutide 3.0 mg, while age ≥70 years, race, ethnicity and baseline glycaemic status did not. Compared with a reference subject weighing 100 kg, exposure of liraglutide 3.0 mg was 44 % lower for a subject weighing 234 kg (90 % CI 41-47), 41 % higher for a subject weighing 60 kg (90 % CI 37-46), and 32 % higher (90 % CI 28-35) in females than males with the same body weight. Neither injection site nor renal function significantly influenced exposure of liraglutide 3.0 mg (post hoc analysis). Population pharmacokinetics of liraglutide up to and including 3.0 mg daily in overweight and obese adults demonstrated dose-proportional exposure, and limited effect of covariates other than sex and body weight. These findings were similar to those previously observed with liraglutide up to 1.8 mg in subjects with type 2 diabetes mellitus. Further analysis of exposure-response relationship and its effect on dose requirements is addressed in a separate publication.

Design of an LVDS to USB3.0 adapter and application

Science.gov (United States)

Qiu, Xiaohan; Wang, Yu; Zhao, Xin; Chang, Zhen; Zhang, Quan; Tian, Yuze; Zhang, Yunyi; Lin, Fang; Liu, Wenqing

2016-10-01

USB 3.0 specification was published in 2008. With the development of technology, USB 3.0 is becoming popular. LVDS(Low Voltage Differential Signaling) to USB 3.0 Adapter connects the communication port of spectrometer device and the USB 3.0 port of a computer, and converts the output of an LVDS spectrometer device data to USB. In order to adapt to the changing and developing of technology, LVDS to USB3.0 Adapter was designed and developed based on LVDS to USB2.0 Adapter. The CYUSB3014, a new generation of USB bus interface chip produced by Cypress and conforming to USB3.0 communication protocol, utilizes GPIF-II (GPIF, general programmable interface) to connect the FPGA and increases effective communication speed to 2Gbps. Therefore, the adapter, based on USB3.0 technology, is able to connect more spectrometers to single computer and provides technical basis for the development of the higher speed industrial camera. This article describes the design and development process of the LVDS to USB3.0 adapter.

Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome

OpenAIRE

Haack, Tobias B.; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A.; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M.; Meitinger, Thomas; Yonezawa, Atsushi

2012-01-01

Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin tran...

Hedgehog Buckyball: A High-Symmetry Complete Polyhedral Oligomeric Silsesquioxane (POSS

Directory of Open Access Journals (Sweden)

Yu Hu

2016-08-01

Full Text Available In this study, we report UV-MALDI-TOF MS evidence of a fullerene-like silsesquioxane, a high-symmetry polyhedral oligomeric silsesquioxane (POSS or SSO formulated as R60-Si60O90 or T60 (T = RSiO1.5. The T60 preparation can be performed using a normal hydrolytic condensation of [(3-methacryloxypropyl]trimethoxysilane (MPMS as an example. Theoretically, four 3sp3 hybrid orbitals (each containing an unpaired electron of a Si atom are generated before the bond formation. Then it bonds to another four atom electrons using the four generated hybrid orbitals which produced a stable configuration. This fullerene-like silsesquioxane should exhibit much more functionality, activity and selectivity and is easier to assemble than the double bonds in a fullerene.

Neurotransmitter Transporter-Like: a male germline-specific SLC6 transporter required for Drosophila spermiogenesis.

Directory of Open Access Journals (Sweden)

Nabanita Chatterjee

2011-01-01

Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.

RadCat 3.0 user guide.

Energy Technology Data Exchange (ETDEWEB)

Hinojosa, Daniel; Penisten, Janelle J.; Dennis, Matthew L.; Osborn, Douglas M.; Weiner, Ruth F.; Heames, Terence John; Marincel, Michelle K.

2009-05-01

RADTRAN is an internationally accepted program and code for calculating the risks of transporting radioactive materials. The first versions of the program, RADTRAN I and II, were developed for NUREG-0170 (USNRC, 1977), the first environmental statement on transportation of radioactive materials. RADTRAN and its associated software have undergone a number of improvements and advances consistent with improvements in both available data and computer technology. The version of RADTRAN currently bundled with RadCat is RADTRAN 6.0. This document provides a detailed discussion and a guide for the use of the RadCat 3.0 Graphical User Interface input file generator for the RADTRAN code. RadCat 3.0 integrates the newest analysis capabilities of RADTRAN 6.0 which includes an economic model, updated loss-of-lead shielding model, and unit conversion. As of this writing, the RADTRAN version in use is RADTRAN 6.0.

Phases of variable composition in the system Ba3-xSrxEr(BO3)3 (0≤x≤3.0)

International Nuclear Information System (INIS)

Khamaganova, T.N.

2008-01-01

The possibility of preparing two series of solid solutions in the system Ba 3-x Sr x Er(BO 3 ) 3 (0 ≤ x ≤ 3.0), crystallizing in different structural types, was examined. Samples of the phases of variable composition were synthesized by solid-phase reactions over the temperature range 500-1000 deg C, and their X-ray diffraction characteristics were determined. It is found that the triple phases prepared form two series of substitutional solid solutions in the system studied [ru

M3 User's Manual. Version 3.0

International Nuclear Information System (INIS)

Laaksoharju, Marcus; Skaarman, Erik; Gomez, Javier B.

2009-11-01

This report describes the Multivariate Mixing and Mass balance calculations (M3). This new method and computer code is developed to trace the mixing and reaction processes in the groundwater. The aim of the M3 concept is to decode the often hidden and complex information gathered in the groundwater analytical data. The manual presents shortly the theory and practice behind the M3 method. The M3 computer code is also presented and emphasis is put on the reference manual. This includes detailed reference to the M3 program's abilities and limitations, installation procedures and all functions and operations that the program can perform. It also describes sample cases of how the program is used to analyse a test data set. This guide is part of the Help Files distributed together with M3. Two accompanying reports cover other aspects: - Concepts, Methods, and Mathematical Formulation, gives a complete description of the mathematical framework of M3 and introduces concepts and methods useful for the end user. - M3 version 3.0: Verification and Validation, gathers a collection of validation and verification exercises, designed to test each part of M3 code and to build confidence in its methodology. The M3 method has been tested and modified over several years. The development work has been supported by the Swedish Nuclear Fuel and Waste Management Company (SKB). The main test site for the model was the underground Aespoe Hard Rock Laboratory (HRL). The examples used in this manual are from a Aespoe international groundwater modelling co-operation project where one of the tools used was M3. The M3 concept has been applied on the data from SKB's site investigation programme and in data from Canada, Japan, Jordan, Gabon and Finland. The groundwater composition is a result of mixing processes and water-rock interaction. Standard groundwater models based on thermodynamic laws may not be applicable in a normal temperature groundwater system where equilibrium with many of the

Neuropsychiatric safety with liraglutide 3.0 mg for weight management: Results from randomized controlled phase 2 and 3a trials.

Science.gov (United States)

O'Neil, Patrick M; Aroda, Vanita R; Astrup, Arne; Kushner, Robert; Lau, David C W; Wadden, Thomas A; Brett, Jason; Cancino, Ana-Paula; Wilding, John P H

2017-11-01

Liraglutide, a GLP-1 receptor agonist, regulates appetite via receptors in the brain. Because of concerns regarding the potential of centrally-acting anti-obesity medications to affect mental health, pooled neuropsychiatric safety data from all phase 2 and 3a randomized, double-blind trials with liraglutide 3.0 mg were evaluated post hoc. Data from the liraglutide weight-management programme were pooled. Across trials, individuals with a body mass index ≥30 or ≥27 kg/m 2 with weight-related comorbidities were randomized to once-daily subcutaneous liraglutide 3.0 mg (n = 3384) or placebo (n = 1941), both with a 500 kcal/d deficit diet, plus exercise. Adverse events related to neuropsychiatric safety were collected in all trials. Additionally, in the phase 3a trials, validated mental-health questionnaires were prospectively and systematically administered. In the pooled analysis of 5325 randomized and exposed individuals, rates of depression (2.1 vs 2.1 events/100 person-years) and anxiety (1.9 vs 1.7 events/100 person-years) through adverse event reporting were similarly low in liraglutide and placebo groups. Nine (0.3%) individuals receiving liraglutide and 2 (0.1%) receiving placebo reported adverse events of suicidal ideation or behaviour. In phase 3a trials, mean baseline Patient Health Questionnaire-9 scores of 2.8 ± 3.0 vs 2.9 ± 3.1 for liraglutide vs placebo improved to 1.8 ± 2.7 vs 1.9 ± 2.7, respectively, at treatment end; 34/3291 individuals (1.0%) receiving liraglutide 3.0 mg vs 19/1843 (1.0%) receiving placebo reported suicidal ideation on the Columbia-Suicide Severity Rating Scale. Results of this exploratory pooled analysis provide no cause for concern regarding the neuropsychiatric safety of treatment with liraglutide 3.0 mg in patients similar to those included in the examined trials. Although there was a small numerical imbalance in suicidal ideation with liraglutide through adverse event reporting, no

The orphan transporter v7-3 (slc6a15) is a Na+-dependent neutral amino acid transporter (B0AT2)

DEFF Research Database (Denmark)

Bröer, Angelika; Tietze, Nadine; Kowalczuk, Sonja

2006-01-01

. The transporter is functionally and sequence related to B(0)AT1 (slc6a19) and was hence named B(0)AT2. Leucine, isoleucine, valine, proline and methionine were recognized by the transporter, with values of K(0.5) (half-saturation constant) ranging from 40 to 200 microM. Alanine, glutamine and phenylalanine were...

Python as a federation tool for GENESIS 3.0.

Directory of Open Access Journals (Sweden)

Hugo Cornelis

Full Text Available The GENESIS simulation platform was one of the first broad-scale modeling systems in computational biology to encourage modelers to develop and share model features and components. Supported by a large developer community, it participated in innovative simulator technologies such as benchmarking, parallelization, and declarative model specification and was the first neural simulator to define bindings for the Python scripting language. An important feature of the latest version of GENESIS is that it decomposes into self-contained software components complying with the Computational Biology Initiative federated software architecture. This architecture allows separate scripting bindings to be defined for different necessary components of the simulator, e.g., the mathematical solvers and graphical user interface. Python is a scripting language that provides rich sets of freely available open source libraries. With clean dynamic object-oriented designs, they produce highly readable code and are widely employed in specialized areas of software component integration. We employ a simplified wrapper and interface generator to examine an application programming interface and make it available to a given scripting language. This allows independent software components to be 'glued' together and connected to external libraries and applications from user-defined Python or Perl scripts. We illustrate our approach with three examples of Python scripting. (1 Generate and run a simple single-compartment model neuron connected to a stand-alone mathematical solver. (2 Interface a mathematical solver with GENESIS 3.0 to explore a neuron morphology from either an interactive command-line or graphical user interface. (3 Apply scripting bindings to connect the GENESIS 3.0 simulator to external graphical libraries and an open source three dimensional content creation suite that supports visualization of models based on electron microscopy and their conversion to

Python as a federation tool for GENESIS 3.0.

Science.gov (United States)

Cornelis, Hugo; Rodriguez, Armando L; Coop, Allan D; Bower, James M

2012-01-01

The GENESIS simulation platform was one of the first broad-scale modeling systems in computational biology to encourage modelers to develop and share model features and components. Supported by a large developer community, it participated in innovative simulator technologies such as benchmarking, parallelization, and declarative model specification and was the first neural simulator to define bindings for the Python scripting language. An important feature of the latest version of GENESIS is that it decomposes into self-contained software components complying with the Computational Biology Initiative federated software architecture. This architecture allows separate scripting bindings to be defined for different necessary components of the simulator, e.g., the mathematical solvers and graphical user interface. Python is a scripting language that provides rich sets of freely available open source libraries. With clean dynamic object-oriented designs, they produce highly readable code and are widely employed in specialized areas of software component integration. We employ a simplified wrapper and interface generator to examine an application programming interface and make it available to a given scripting language. This allows independent software components to be 'glued' together and connected to external libraries and applications from user-defined Python or Perl scripts. We illustrate our approach with three examples of Python scripting. (1) Generate and run a simple single-compartment model neuron connected to a stand-alone mathematical solver. (2) Interface a mathematical solver with GENESIS 3.0 to explore a neuron morphology from either an interactive command-line or graphical user interface. (3) Apply scripting bindings to connect the GENESIS 3.0 simulator to external graphical libraries and an open source three dimensional content creation suite that supports visualization of models based on electron microscopy and their conversion to computational models

Foundation ActionScript 3.0 for Flash and Flex

CERN Document Server

Richardson, Darren

2009-01-01

In this book, you'll: *Learn the fundamentals of ActionScript 3.0 using both the Flash IDE and Flex *Use ActionScript 3.0's object-oriented features *Manipulate sound and video to produce exciting modern web applications *Work with XML as your data source ActionScript 3.0, the latest version of the Flash Platform's scripting language, offers many new and powerful features. ActionScript is now a full-fledged programming language, with complete object-oriented capabilities, improved event handling, sound and video support, drawing capabilities, support for regular expressions, and much more. Whe

Wire breakage in SLC wire profile monitors

International Nuclear Information System (INIS)

Field, C.; McCormick, D.; Raimondi, P.; Ross, M.

1998-05-01

Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures

Academic Information System Support in the Era of Education 3.0

Science.gov (United States)

Utomo, HP; Bon, AT; Hendayun, M.

2017-08-01

The emergence of Education 3.0 as a new paradigm in education has been spread widely in many educational institutions, especially in higher education institutions (HEIs). Many of them have been implementing the new paradigm and get benefit from it. But somehow, the implementation caused some problems. The new policy and procedures are causing administrative problems, especially in the academic affair. The implementation also needs to provide external involvement. To overcome the problems, the academic information system (AIS) can be used to support the characteristics of Education 3.0. The purpose of the research is to find the possibility support from the AIS to the characteristics of Education 3.0. The research used Education 3.0 concept and information system (IS) concept to find the possibility. The research used a case study as the method and conducted a qualitative research with an unstructured interview. After comparing the Education 3.0 concept and IS concept with the interview analysis, the research found that all the characteristics of Education 3.0 can possibly support by the AIS. The result can be used as a guideline to develop the new AIS with the capability to support the characteristics of Education 3.0.

Simbrain 3.0: A flexible, visually-oriented neural network simulator.

Science.gov (United States)

Tosi, Zachary; Yoshimi, Jeffrey

2016-11-01

Simbrain 3.0 is a software package for neural network design and analysis, which emphasizes flexibility (arbitrarily complex networks can be built using a suite of basic components) and a visually rich, intuitive interface. These features support both students and professionals. Students can study all of the major classes of neural networks in a familiar graphical setting, and can easily modify simulations, experimenting with networks and immediately seeing the results of their interventions. With the 3.0 release, Simbrain supports models on the order of thousands of neurons and a million synapses. This allows the same features that support education to support research professionals, who can now use the tool to quickly design, run, and analyze the behavior of large, highly customizable simulations. Copyright © 2016 Elsevier Ltd. All rights reserved.

Feedback systems in the SLC

International Nuclear Information System (INIS)

Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

1987-02-01

Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

Directory of Open Access Journals (Sweden)

Lindholm Carlström Eva

2012-05-01

Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

Bartter syndrome type 3 in an elderly complicated with adrenocorticotropin-deficiency.

Science.gov (United States)

Tamagawa, Eri; Inaba, Hidefumi; Ota, Takayuki; Ariyasu, Hiroyuki; Kawashima, Hiromichi; Wakasaki, Hisao; Furuta, Hiroto; Nishi, Masahiro; Nakao, Taisei; Kaito, Hiroshi; Iijima, Kazumoto; Nakanishi, Koichi; Yoshikawa, Norishige; Akamizu, Takashi

2014-01-01

Bartter syndrome (BS) is a disorder with normotensive hypokalemic alkalosis and hyperreninemic hyperaldosteronemia. BS affects infants or early childhood. Patients with BS type 3 harbor mutation in CLCNKB, Cl channel Kb. Gitelman syndrome (GS) is a disorder in childhood, with mutation in SLC12A3. Isolated adrenocorticotropin deficiency (IAD) causes secondary adrenal insufficiency. Neither elderly cases, nor cases with IAD were previously reported in BS. A 72-year-old man was admitted with acute adrenal crisis. He had been treated for IAD for 19 years. He had no trouble during perinatal period, delivery, and growth. After the recovery from adrenal crisis, laboratory tests revealed hypokalemia; 3.0 mEq/L (normal: 3.5-4.5), impaired renal function: eGFR; 37.6 mL/min/1.73 m2, normomagnesemia; 2.1 mg/dL (1.7-2.3), hyperreninemia; 59.4 ng/mL/h (0.2-2.7), hyperaldosteronemia; 23.5 ng/dL (3.0-15.9), and normal urinary ratio of calcium/creatinine. In diuretic tests, he showed a fine response to furosemide, and a mild response to thiazide. In genetic tests, no mutation of SLC12A3 was found and homozygous mutation: c.1830 G > A in CLCNKB was shown. Thus he was diagnosed as BS type 3. Current case presented with unusual features as BS type 3, 1) his late and mild clinical manifestation suggested GS rather than BS, 2) laboratory data and diuretics tests did not show typical features as BS, and 3) IAD and chronic renal failure altered electrolyte metabolism. In conclusion, current case implies that BS type 3 should be considered even in elderly cases with normotensive hypokalemia, and highlights importance of endocrinological and genetic examinations.

Long-range-corrected Rung 3.5 density functional approximations

Science.gov (United States)

Janesko, Benjamin G.; Proynov, Emil; Scalmani, Giovanni; Frisch, Michael J.

2018-03-01

Rung 3.5 functionals are a new class of approximations for density functional theory. They provide a flexible intermediate between exact (Hartree-Fock, HF) exchange and semilocal approximations for exchange. Existing Rung 3.5 functionals inherit semilocal functionals' limitations in atomic cores and density tails. Here we address those limitations using range-separated admixture of HF exchange. We present three new functionals. LRC-ωΠLDA combines long-range HF exchange with short-range Rung 3.5 ΠLDA exchange. SLC-ΠLDA combines short- and long-range HF exchange with middle-range ΠLDA exchange. LRC-ωΠLDA-AC incorporates a combination of HF, semilocal, and Rung 3.5 exchange in the short range, based on an adiabatic connection. We test these in a new Rung 3.5 implementation including up to analytic fourth derivatives. LRC-ωΠLDA and SLC-ΠLDA improve atomization energies and reaction barriers by a factor of 8 compared to the full-range ΠLDA. LRC-ωΠLDA-AC brings further improvement approaching the accuracy of standard long-range corrected schemes LC-ωPBE and SLC-PBE. The new functionals yield highest occupied orbital energies closer to experimental ionization potentials and describe correctly the weak charge-transfer complex of ethylene and dichlorine and the hole-spin distribution created by an Al defect in quartz. This study provides a framework for more flexible range-separated Rung 3.5 approximations.