Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome
O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.
2016-01-01
Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter
Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia
2015-01-01
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neu...
Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans
2015-01-01
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. PMID:25704603
Iqbal, Zafar; Willemsen, Marjolein H; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; de Brouwer, Arjan P M; Marouillat, Sylviane; Wienker, Thomas F; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans
2015-03-05
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.
Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David
2014-04-01
Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.
The renal urate transporter SLC17A1 locus: confirmation of association with gout.
Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R
2012-04-27
Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.
Upregulation of the Creatine Transporter Slc6A8 by Klotho
Directory of Open Access Journals (Sweden)
Ahmad Almilaji
2014-11-01
Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.
Moriyama, Yoshinori; Hiasa, Miki; Sakamoto, Shohei; Omote, Hiroshi; Nomura, Masatoshi
2017-09-01
Vesicular storage of ATP is one of the processes initiating purinergic chemical transmission. Although an active transport mechanism was postulated to be involved in the processes, a transporter(s) responsible for the vesicular storage of ATP remained unidentified for some time. In 2008, SLC17A9, the last identified member of the solute carrier 17 type I inorganic phosphate transporter family, was found to encode the vesicular nucleotide transporter (VNUT) that is responsible for the vesicular storage of ATP. VNUT transports various nucleotides in a membrane potential-dependent fashion and is expressed in the various ATP-secreting cells. Mice with knockout of the VNUT gene lose vesicular storage and release of ATP from neurons and neuroendocrine cells, resulting in blockage of the initiation of purinergic chemical transmission. Thus, VNUT plays an essential role in the vesicular storage and release of ATP. The VNUT knockout mice exhibit resistance for neuropathic pain and a therapeutic effect against diabetes by way of increased insulin sensitivity. Thus, VNUT inhibitors and suppression of VNUT gene expression may be used for therapeutic purposes through suppression of purinergic chemical transmission. This review summarizes the studies to date on VNUT and discusses what we have learned about the relevance of vesicular ATP release as a potential drug target.
Tarailo-Graovac, M. (Maja); Drögemöller, B.I. (Britt I.); Wasserman, W.W. (Wyeth W.); C.J. Ross; A.M.W. van den Ouweland (Ans); N. Darin (Niklas); Kollberg, G. (Gittan); Van Karnebeek, C.D.M. (Clara D. M.); Blomqvist, M. (Maria)
2017-01-01
textabstractBackground: Sialic acid storage diseases are neurodegenerative disorders characterized by accumulation of sialic acid in the lysosome. These disorders are caused by mutations in SLC17A5, the gene encoding sialin, a sialic acid transporter located in the lysosomal membrane. The most
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081
Zhong, Xi Zoë; Cao, Qi; Sun, Xue
2016-01-01
Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-11-28
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Polymorphism Study on SLC30A8 and Its Association with Type 2 Diabetes
Directory of Open Access Journals (Sweden)
M. Vignesh
2016-11-01
Full Text Available Type 2 diabetes mellitus (T2DM is one of the threatening disorders in the world. It affects people of all ages. Type 2 diabetes mellitus is a condition in which the glucose level in the blood is elevated due to improper function of the secretion of insulin from beta cells of the pancreas. It is a multifactorial disease because it is caused by both environmental and hereditary factors. One of the genes which play an important role in type 2 diabetes mellitus is SLC30A8 which encodes for zinc transporter ZnT8. The common polymorphic site for SLC30A8 is rs13266634. This single-nucleotide polymorphism leads to type 2 diabetes mellitus by replacing the arginine residue with tryptophan residue. This review mainly focuses on the polymorphic studies in the gene SLC30A8 and its association with type 2 diabetes mellitus.
Directory of Open Access Journals (Sweden)
Naoya Murao
Full Text Available Incretins (GLP-1 and GIP potentiate insulin secretion through cAMP signaling in pancreatic β-cells in a glucose-dependent manner. We recently proposed a mechanistic model of incretin-induced insulin secretion (IIIS that requires two critical processes: 1 generation of cytosolic glutamate through the malate-aspartate (MA shuttle in glucose metabolism and 2 glutamate transport into insulin granules by cAMP signaling to promote insulin granule exocytosis. To directly prove the model, we have established and characterized CRISPR/Cas9-engineered clonal mouse β-cell lines deficient for the genes critical in these two processes: aspartate aminotransferase 1 (AST1, gene symbol Got1, a key enzyme in the MA shuttle, which generates cytosolic glutamate, and the vesicular glutamate transporters (VGLUT1, VGLUT2, and VGLUT3, gene symbol Slc17a7, Slc17a6, and Slc17a8, respectively, which participate in glutamate transport into secretory vesicles. Got1 knockout (KO β-cell lines were defective in cytosolic glutamate production from glucose and showed impaired IIIS. Unexpectedly, different from the previous finding that global Slc17a7 KO mice exhibited impaired IIIS from pancreatic islets, β-cell specific Slc17a7 KO mice showed no significant impairment in IIIS, as assessed by pancreas perfusion experiment. Single Slc17a7 KO β-cell lines also retained IIIS, probably due to compensatory upregulation of Slc17a6. Interestingly, triple KO of Slc17a7, Slc17a6, and Slc17a8 diminished IIIS, which was rescued by exogenously introduced wild-type Slc17a7 or Slc17a6 genes. The present study provides direct evidence for the essential roles of AST1 and VGLUTs in β-cell glutamate signaling for IIIS and also shows the usefulness of the CRISPR/Cas9 system for studying β-cells by simultaneous disruption of multiple genes.
Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families
Directory of Open Access Journals (Sweden)
Hemant Kulkarni
2016-01-01
Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-05-09
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.
SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.
Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten
2015-12-03
SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.
Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S
2017-04-01
A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through
Recessive mutations in SLC38A8 cause foveal hypoplasia and optic nerve misrouting without albinism.
Poulter, James A; Al-Araimi, Musallam; Conte, Ivan; van Genderen, Maria M; Sheridan, Eamonn; Carr, Ian M; Parry, David A; Shires, Mike; Carrella, Sabrina; Bradbury, John; Khan, Kamron; Lakeman, Phillis; Sergouniotis, Panagiotis I; Webster, Andrew R; Moore, Anthony T; Pal, Bishwanath; Mohamed, Moin D; Venkataramana, Anandula; Ramprasad, Vedam; Shetty, Rohit; Saktivel, Murugan; Kumaramanickavel, Govindasamy; Tan, Alex; Mackey, David A; Hewitt, Alex W; Banfi, Sandro; Ali, Manir; Inglehearn, Chris F; Toomes, Carmel
2013-12-05
Foveal hypoplasia and optic nerve misrouting are developmental defects of the visual pathway and only co-occur in connection with albinism; to date, they have only been associated with defects in the melanin-biosynthesis pathway. Here, we report that these defects can occur independently of albinism in people with recessive mutations in the putative glutamine transporter gene SLC38A8. Nine different mutations were identified in seven Asian and European families. Using morpholino-mediated ablation of Slc38a8 in medaka fish, we confirmed that pigmentation is unaffected by loss of SLC38A8. Furthermore, by undertaking an association study with SNPs at the SLC38A8 locus, we showed that common variants within this gene modestly affect foveal thickness in the general population. This study reveals a melanin-independent component underpinning the development of the visual pathway that requires a functional role for SLC38A8. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G
2011-02-01
We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.
Jensen, Lars R; Chen, Wei; Moser, Bettina; Lipkowitz, Bettina; Schroeder, Christopher; Musante, Luciana; Tzschach, Andreas; Kalscheuer, Vera M; Meloni, Ilaria; Raynaud, Martine; van Esch, Hilde; Chelly, Jamel; de Brouwer, Arjan P M; Hackett, Anna; van der Haar, Sigrun; Henn, Wolfram; Gecz, Jozef; Riess, Olaf; Bonin, Michael; Reinhardt, Richard; Ropers, Hans-Hilger; Kuss, Andreas W
2011-01-01
X-linked intellectual disability (XLID), also known as X-linked mental retardation, is a highly genetically heterogeneous condition for which mutations in >90 different genes have been identified. In this study, we used a custom-made sequencing array based on the Affymetrix 50k platform for mutation screening in 17 known XLID genes in patients from 135 families and found eight single-nucleotide changes that were absent in controls. For four mutations affecting ATRX (p.1761M>T), PQBP1 (p.155R>X) and SLC6A8 (p.390P>L and p.477S>L), we provide evidence for a functional involvement of these changes in the aetiology of intellectual disability. PMID:21267006
DEFF Research Database (Denmark)
Boesgaard, T W; Zilinskaite, J; Vänttinen, M
2008-01-01
AIMS/HYPOTHESIS: A recent genome-wide association study identified the SLC30A8 rs13266634 polymorphism encoding an Arg325Trp polymorphism in the zinc transporter protein member 8 (ZnT-8) to be associated with type 2 diabetes. Here, we investigate whether the polymorphism is related to altered ins...
Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A
2016-11-01
The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.
DEFF Research Database (Denmark)
Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath
2007-01-01
Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...
Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran
2014-01-01
Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...
Treatment of intractable epilepsy in a female with SLC6A8 deficiency
Mercimek-Mahmutoglu, S.; Connolly, M.B.; Poskitt, K.J.; Horvath, G.A.; Lowry, N.; Salomons, G.S.; Casey, B.; Sinclair, G.; Davis, C.; Jakobs, C.; Stockler-Ipsiroglu, S.
2010-01-01
A female heterozygous for a novel, disease causing, missense mutation in the X-linked cerebral creatine transporter (SLC6A8) gene (c.1067G > T, p.Gly356Val) presented with intractable epilepsy, mild intellectual disability and moderately reduced cerebral creatine levels. Treatment with creatine
Directory of Open Access Journals (Sweden)
Hassan Brim
Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.
Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi
2017-01-01
The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.
The role of SLC2A1 in early onset and childhood absence epilepsies
DEFF Research Database (Denmark)
Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg
2013-01-01
Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...
Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice
Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo
2016-01-01
Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...
Expression and Its Clinical Significance of SLC22A18 in Non-small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Ming LEI
2012-01-01
Full Text Available Background and objective It has been proven that multidrug resistance (MDR is the main cause of chemotherapy failure in lung cancer. Research on emergence mechanisms of MDR has great clinical significance in improving the curative efficiency of lung cancer chemotherapy. Proteins encoded by the SLC22A18 gene, which is similar to the transmembrane transporter, may influence the sensitivity of chemotherapeutics as well as the metabolism and growth of cells. In addition, these proteins probably have some effect on the development of lung cancer MDR. The aim of the present study is to investigate the expression of SLC22A18 protein in non-small cell lung cancer (NSCLC as well as in corresponding normal lung tissue. Furthermore, the relationship between SLC22A18 expression and pathological grade and TNM stage is analyzed. Methods The expression of SLC22A18 was detected by EnVinsion in 96 cases with NSCLC and in corresponding normal lung tissue. Statistical analysis was performed using SPSS 17.0 statistical software. Results SLC22A18 was mainly located in cell membrane and cytoplasm. The expression level of SLC22A18 in NSCLC was significantly higher than that in normal tissue (P<0.01. The positive rates in squamous cell lung cancer and lung adenocarcinoma were 68% and 78.2%, respectively (P<0.05. Moreover, the higher expression of SLC22A18 was associated with lower histological grade and later TNM stage (P<0.05. Conclusion SLC22A18 protein is overexpressed in NSCLC, and its expression is correlated with pathological grade and TNM stage. These findings provide the experimental basis for investigating the role of tumor and chemoresistance.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki
2010-01-01
The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4
Nishida, Kentaro; Nomura, Yuka; Kawamori, Kanako; Moriyama, Yoshinori; Nagasawa, Kazuki
2014-09-05
ATP plays an important role in the signal transduction between sensory neurons and satellite cells in dorsal root ganglia (DRGs). In primary cultured DRG neurons, ATP is known to be stored in lysosomes via a vesicular nucleotide transporter (VNUT), and to be released into the intercellular space through exocytosis. DRGs consist of large-, medium- and small-sized neurons, which play different roles in sensory transmission, but there is no information on the expression profiles of VNUT in DRG subpopulations. Here, we obtained detailed expression profiles of VNUT in isolated rat DRG tissues. On immunohistochemical analysis, VNUT was found in DRG neurons, and was predominantly expressed by the small- and medium-sized DRG ones, as judged upon visual inspection, and this was compatible with the finding that the number of VNUT-positive DRG neurons in IB4-positive cells was greater than that in NF200-positive ones. These results suggest that VNUT play a role in ATP accumulation in DRG neurons, especially in small- and medium-sized ones, and might be involved in ATP-mediated nociceptive signaling in DRGs. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures
DEFF Research Database (Denmark)
Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy
2015-01-01
GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...
DEFF Research Database (Denmark)
Nielsen, Lotte B; Vaziri-Sani, Fariba; Pörksen, Sven
2011-01-01
Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact...
Directory of Open Access Journals (Sweden)
Julia Preobraschenski
2018-04-01
Full Text Available Summary: Vesicular glutamate transporters (VGLUTs fill synaptic vesicles with glutamate and are thus essential for glutamatergic neurotransmission. However, VGLUTs were originally discovered as members of a transporter subfamily specific for inorganic phosphate (Pi. It is still unclear how VGLUTs accommodate glutamate transport coupled to an electrochemical proton gradient ΔμH+ with inversely directed Pi transport coupled to the Na+ gradient and the membrane potential. Using both functional reconstitution and heterologous expression, we show that VGLUT transports glutamate and Pi using a single substrate binding site but different coupling to cation gradients. When facing the cytoplasm, both ions are transported into synaptic vesicles in a ΔμH+-dependent fashion, with glutamate preferred over Pi. When facing the extracellular space, Pi is transported in a Na+-coupled manner, with glutamate competing for binding but at lower affinity. We conclude that VGLUTs have dual functions in both vesicle transmitter loading and Pi homeostasis within glutamatergic neurons. : Preobraschenski et al. show that the vesicular glutamate transporter functions as a bi-directional phosphate transporter that is coupled with different cations in each direction and hence may play a key role in neuronal phosphate homeostasis. Keywords: VGLUT, SLC17 family, type I Na+-dependent inorganic phosphate transporter, ATPase, proteoliposomes, hybrid vesicles, anti-VGLUT1 nanobody
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS
Directory of Open Access Journals (Sweden)
Bianca Maria Rotoli
2018-03-01
Full Text Available Lysinuric protein intolerance (LPI is a recessively inherited aminoaciduria caused by mutations of SLC7A7, the gene encoding y+LAT1 light chain of system y+L for cationic amino acid transport. The pathogenesis of LPI is still unknown. In this study, we have utilized a gene silencing approach in macrophages and airway epithelial cells to investigate whether complications affecting lung and immune system are directly ascribable to the lack of SLC7A7 or, rather, mediated by an abnormal accumulation of arginine in mutated cells. When SLC7A7/y+LAT1 was silenced in human THP-1 macrophages and A549 airway epithelial cells by means of short interference RNA (siRNA, a significant induction of the expression and release of the inflammatory mediators IL1β and TNFα was observed, no matter the intracellular arginine availability. This effect was mainly regulated at transcriptional level through the activation of NFκB signaling pathway. Moreover, since respiratory epithelial cells are the important sources of chemokines in response to pro-inflammatory stimuli, the effect of IL1β has been addressed on SLC7A7 silenced A549 cells. Results obtained indicated that the downregulation of SLC7A7/y+LAT1 markedly strengthened the stimulatory effect of the cytokine on CCL5/RANTES expression and release without affecting the levels of CXCL8/IL8. Consistently, also the conditioned medium of silenced THP-1 macrophages activated airway epithelial cells in terms of CCL5/RANTES expression due to the presence of elevated amount of proinflammatory cytokines. In conclusion, our results point to a novel thus far unknown function of SLC7A7/y+LAT1, that, under physiological conditions, besides transporting arginine, may act as a brake to restrain inflammation.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4
Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin
2016-09-01
The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul
Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.
Lean, Choo Bee; Lee, Edmund Jon Deoon
2009-01-01
MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq
Gagnon, Kenneth B; Delpire, Eric
2013-04-15
Among the over 300 members of the solute carrier (SLC) group of integral plasma membrane transport proteins are the nine electroneutral cation-chloride cotransporters belonging to the SLC12 gene family. Seven of these transporters have been functionally described as coupling the electrically silent movement of chloride with sodium and/or potassium. Although in silico analysis has identified two additional SLC12 family members, no physiological role has been ascribed to the proteins encoded by either the SLC12A8 or the SLC12A9 genes. Evolutionary conservation of this gene family from protists to humans confirms their importance. A wealth of physiological, immunohistochemical, and biochemical studies have revealed a great deal of information regarding the importance of this gene family to human health and disease. The sequencing of the human genome has provided investigators with the capability to link several human diseases with mutations in the genes encoding these plasma membrane proteins. The availability of bacterial artificial chromosomes, recombination engineering techniques, and the mouse genome sequence has simplified the creation of targeting constructs to manipulate the expression/function of these cation-chloride cotransporters in the mouse in an attempt to recapitulate some of these human pathologies. This review will summarize the three human disorders that have been linked to the mutation/dysfunction of the Na-Cl, Na-K-2Cl, and K-Cl cotransporters (i.e., Bartter's, Gitleman's, and Andermann's syndromes), examine some additional pathologies arising from genetically modified mouse models of these cotransporters including deafness, blood pressure, hyperexcitability, and epithelial transport deficit phenotypes.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4
Directory of Open Access Journals (Sweden)
Pereira Fred A
2005-08-01
Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in
SLC2A9 is a high-capacity urate transporter in humans.
Directory of Open Access Journals (Sweden)
Mark J Caulfield
2008-10-01
Full Text Available Serum uric acid levels in humans are influenced by diet, cellular breakdown, and renal elimination, and correlate with blood pressure, metabolic syndrome, diabetes, gout, and cardiovascular disease. Recent genome-wide association scans have found common genetic variants of SLC2A9 to be associated with increased serum urate level and gout. The SLC2A9 gene encodes a facilitative glucose transporter, and it has two splice variants that are highly expressed in the proximal nephron, a key site for urate handling in the kidney. We investigated whether SLC2A9 is a functional urate transporter that contributes to the longstanding association between urate and blood pressure in man.We expressed both SLC2A9 splice variants in Xenopus laevis oocytes and found both isoforms mediate rapid urate fluxes at concentration ranges similar to physiological serum levels (200-500 microM. Because SLC2A9 is a known facilitative glucose transporter, we also tested whether glucose or fructose influenced urate transport. We found that urate is transported by SLC2A9 at rates 45- to 60-fold faster than glucose, and demonstrated that SLC2A9-mediated urate transport is facilitated by glucose and, to a lesser extent, fructose. In addition, transport is inhibited by the uricosuric benzbromarone in a dose-dependent manner (Ki = 27 microM. Furthermore, we found urate uptake was at least 2-fold greater in human embryonic kidney (HEK cells overexpressing SLC2A9 splice variants than nontransfected kidney cells. To confirm that our findings were due to SLC2A9, and not another urate transporter, we showed that urate transport was diminished by SLC2A9-targeted siRNA in a second mammalian cell line. In a cohort of men we showed that genetic variants of SLC2A9 are associated with reduced urinary urate clearance, which fits with common variation at SLC2A9 leading to increased serum urate. We found no evidence of association with hypertension (odds ratio 0.98, 95% confidence interval [CI
Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel
2009-01-01
Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353
Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode
2017-10-26
Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice
Directory of Open Access Journals (Sweden)
Kaifeng Yin
2017-05-01
Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.
Chromosomal localization of the human vesicular amine transporter genes
Energy Technology Data Exchange (ETDEWEB)
Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. (UCLA School of Medicine, Los Angeles, CA (United States))
1993-12-01
The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.
Positive selection in the SLC11A1 gene in the family Equidae
DEFF Research Database (Denmark)
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan
2016-01-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...
DEFF Research Database (Denmark)
Nielsen, L. B.; Vaziri-Sani, F.; Porksen, S.
2011-01-01
Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact......8 gene is associated with preserved beta-cell function in type 1 diabetes patients. The genetic determination of the rs13266634 variant on the ZnT8Ab specificity is sustained the first 12 months after the diagnosis of type 1 diabetes in a pediatric cohort....
Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel
2009-10-15
3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.
SLC-2000: A luminosity upgrade for the SLC
International Nuclear Information System (INIS)
Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.
1996-01-01
We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)
Zhang, Xiao-Lei; McGlothan, Jennifer L; Miry, Omid; Stansfield, Kirstie H; Loth, Meredith K; Stanton, Patric K; Guilarte, Tomás R
2018-01-01
Childhood lead (Pb2+) intoxication is a public health problem of global proportion. Lead exposure during development produces multiple effects on the central nervous system including impaired synapse formation, altered synaptic plasticity, and learning deficits. In primary hippocampal neurons in culture and hippocampal slices, Pb2+ exposure inhibits vesicular release and reduces the number of fast-releasing sites, an effect associated with Pb2+ inhibition of NMDA receptor-mediated trans-synaptic Brain-Derived Neurotrophic Factor (BDNF) signaling. The objective of this study was to determine if activation of TrkB, the cognate receptor for BDNF, would rescue Pb2+-induced impairments of vesicular release. Rats were chronically exposed to Pb2+ prenatally and postnatally until 50 days of age. This chronic Pb2+ exposure paradigm enhanced paired-pulse facilitation of synaptic potentials in Schaffer collateral-CA1 synapses in the hippocampus, a phenomenon indicative of reduced vesicular release probability. Decreased vesicular release probability was confirmed by both mean-variance analysis and direct 2-photon imaging of vesicular release from hippocampal slices of rats exposed to Pb2+in vivo. We also found a Pb2+-induced impairment of calcium influx in Schaffer collateral-CA1 synaptic terminals. Intraperitoneal injections of Pb2+ rats with the TrkB receptor agonist 7,8-dihydroxyflavone (5 mg/kg) for 14-15 days starting at postnatal day 35, reversed all Pb2+-induced impairments of presynaptic transmitter release at Schaffer collateral-CA1 synapses. This study demonstrates for the first time that in vivo pharmacological activation of TrkB receptors by small molecules such as 7,8-dihydroxyflavone can reverse long-term effects of chronic Pb2+ exposure on presynaptic terminals, pointing to TrkB receptor activation as a promising therapeutic intervention in Pb2+-intoxicated children. © The Author 2017. Published by Oxford University Press on behalf of the Society of
Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem
2016-11-01
Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.
Boycott, Kym M.; Beaulieu, Chandree L.; Kernohan, Kristin D.; Gebril, Ola H.; Mhanni, Aziz; Chudley, Albert E.; Redl, David; Qin, Wen; Hampson, Sarah; Küry, Sébastien; Tetreault, Martine; Puffenberger, Erik G.; Scott, James N.; Bezieau, Stéphane; Reis, André; Uebe, Steffen; Schumacher, Johannes; Hegele, Robert A.; McLeod, D. Ross; Gálvez-Peralta, Marina; Majewski, Jacek; Ramaekers, Vincent T.; Nebert, Daniel W.; Innes, A. Micheil; Parboosingh, Jillian S.; Abou Jamra, Rami
2015-01-01
Manganese (Mn) and zinc (Zn) are essential divalent cations used by cells as protein cofactors; various human studies and animal models have demonstrated the importance of Mn and Zn for development. Here we describe an autosomal-recessive disorder in six individuals from the Hutterite community and in an unrelated Egyptian sibpair; the disorder is characterized by intellectual disability, developmental delay, hypotonia, strabismus, cerebellar atrophy, and variable short stature. Exome sequencing in one affected Hutterite individual and the Egyptian family identified the same homozygous variant, c.112G>C (p.Gly38Arg), affecting a conserved residue of SLC39A8. The affected Hutterite and Egyptian individuals did not share an extended common haplotype, suggesting that the mutation arose independently. SLC39A8 is a member of the solute carrier gene family known to import Mn, Zn, and other divalent cations across the plasma membrane. Evaluation of these two metal ions in the affected individuals revealed variably low levels of Mn and Zn in blood and elevated levels in urine, indicating renal wasting. Our findings identify a human Mn and Zn transporter deficiency syndrome linked to SLC39A8, providing insight into the roles of Mn and Zn homeostasis in human health and development. PMID:26637978
Directory of Open Access Journals (Sweden)
Marina Gálvez-Peralta
Full Text Available Previously this laboratory characterized Slc39a8-encoded ZIP8 as a Zn(2+/(HCO(3(-(2 symporter; yet, the overall physiological importance of ZIP8 at the whole-organism level remains unclear. Herein we describe the phenotype of the hypomorphic Slc39a8(neo/neo mouse which has retained the neomycin-resistance gene in intron 3, hence causing significantly decreased ZIP8 mRNA and protein levels in embryo, fetus, placenta, yolk sac, and several tissues of neonates. The Slc39a8(neo allele is associated with diminished zinc and iron uptake in mouse fetal fibroblast and liver-derived cultures; consequently, Slc39a8(neo/neo newborns exhibit diminished zinc and iron levels in several tissues. Slc39a8(neo/neo homozygotes from gestational day(GD-11.5 onward are pale, growth-stunted, and die between GD18.5 and 48 h postnatally. Defects include: severely hypoplastic spleen; hypoplasia of liver, kidney, lung, and lower limbs. Histologically, Slc39a8(neo/neo neonates show decreased numbers of hematopoietic islands in yolk sac and liver. Low hemoglobin, hematocrit, red cell count, serum iron, and total iron-binding capacity confirmed severe anemia. Flow cytometry of fetal liver cells revealed the erythroid series strikingly affected in the hypomorph. Zinc-dependent 5-aminolevulinic acid dehydratase, required for heme synthesis, was not different between Slc39a8(+/+ and Slc39a8(neo/neo offspring. To demonstrate further that the mouse phenotype is due to ZIP8 deficiency, we bred Slc39a8(+/neo with BAC-transgenic BTZIP8-3 line (carrying three extra copies of the Slc39a8 allele; this cross generated viable Slc39a8(neo/neo_BTZIP8-3(+/+ pups showing none of the above-mentioned congenital defects-proving Slc39a8(neo/neo causes the described phenotype. Our study demonstrates that ZIP8-mediated zinc transport plays an unappreciated critical role during in utero and neonatal growth, organ morphogenesis, and hematopoiesis.
Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.
Wu, Alex Man Lai; Dedina, Liana; Dalvi, Pooja; Yang, Mingdong; Leon-Cheon, John; Earl, Brian; Harper, Patricia A; Ito, Shinya
2016-04-01
While it is well recognized that riboflavin accumulates in breast milk as an essential vitamin for neonates, transport mechanisms for its milk excretion are not well characterized. The multidrug efflux transporter ABCG2 in the apical membrane of milk-producing mammary epithelial cells (MECs) is involved with riboflavin excretion. However, it is not clear whether MECs possess other riboflavin transport systems, which may facilitate its basolateral uptake into MECs. We report here that transcripts encoding the second (SLC52A2) and third (SLC52A3) member of the recently discovered family of SLC52A riboflavin uptake transporters are expressed in milk fat globules from human breast milk. Furthermore, Slc52a2 and Slc52a3 mRNA are upregulated in the mouse mammary gland during lactation. Importantly, the induction ofSlc52a2, which was the major Slc52a riboflavin transporter in the lactating mammary gland, was also observed at the protein level. Subcellular localization studies showed that green fluorescent protein-tagged mouse SLC52A2 mainly localized to the cell membrane, with no preferential distribution to the apical or basolateral membrane in polarized kidney MDCK cells. These results strongly implicate a potential role for SLC52A2 in riboflavin uptake by milk-producing MECs, a critical step in the transfer of riboflavin into breast milk. Copyright © 2016 the American Physiological Society.
SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.
Directory of Open Access Journals (Sweden)
Chi-Jiunn Pan
Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.
Mutations in SLC12A5 in epilepsy of infancy with migrating focal seizures
Stödberg, Tommy; McTague, Amy; Ruiz, Arnaud J.; Hirata, Hiromi; Zhen, Juan; Long, Philip; Farabella, Irene; Meyer, Esther; Kawahara, Atsuo; Vassallo, Grace; Stivaros, Stavros M.; Bjursell, Magnus K.; Stranneheim, Henrik; Tigerschiöld, Stephanie; Persson, Bengt; Bangash, Iftikhar; Das, Krishna; Hughes, Deborah; Lesko, Nicole; Lundeberg, Joakim; Scott, Rod C.; Poduri, Annapurna; Scheffer, Ingrid E.; Smith, Holly; Gissen, Paul; Schorge, Stephanie; Reith, Maarten E. A.; Topf, Maya; Kullmann, Dimitri M.; Harvey, Robert J.; Wedell, Anna; Kurian, Manju A.
2015-01-01
The potassium-chloride co-transporter KCC2, encoded by SLC12A5, plays a fundamental role in fast synaptic inhibition by maintaining a hyperpolarizing gradient for chloride ions. KCC2 dysfunction has been implicated in human epilepsy, but to date, no monogenic KCC2-related epilepsy disorders have been described. Here we show recessive loss-of-function SLC12A5 mutations in patients with a severe infantile-onset pharmacoresistant epilepsy syndrome, epilepsy of infancy with migrating focal seizures (EIMFS). Decreased KCC2 surface expression, reduced protein glycosylation and impaired chloride extrusion contribute to loss of KCC2 activity, thereby impairing normal synaptic inhibition and promoting neuronal excitability in this early-onset epileptic encephalopathy. PMID:26333769
2011-06-01
provokes lung metastasis. (5) Both STAT3 and SLC5A8 knockout showed the similar phenotype, like mammary gland involution delay, mastitis and...100 ng/ml cholera toxin, 0.01mg/ml bovine insulin and 500 ng/ml hydrocortisone. HBL100 cells was grown in McCoy 5A with 10% FBS. MCF7 and BT20
Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J
2001-09-01
Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.
SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.
Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A
2016-11-01
Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.
Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A
2017-07-01
Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.
Jacobsen, Jessie C; Wilson, Callum; Cunningham, Vicki; Glamuzina, Emma; Prosser, Debra O; Love, Donald R; Burgess, Trent; Taylor, Juliet; Swan, Brendan; Hill, Rosamund; Robertson, Stephen P; Snell, Russell G; Lehnert, Klaus
2016-03-01
Two male siblings from a consanguineous union presented in early infancy with marked truncal hypotonia, a general paucity of movement, extrapyramidal signs and cognitive delay. By mid-childhood they had made little developmental progress and remained severely hypotonic and bradykinetic. They developed epilepsy and had problems with autonomic dysfunction and oculogyric crises. They had a number of orthopaedic problems secondary to their hypotonia. Cerebrospinal fluid (CSF) neurotransmitters were initially normal, apart from mildly elevated 5-hydroxyindolacetic acid, and the children did not respond favourably to a trial of levodopa-carbidopa. The youngest died from respiratory complications at 10 years of age. Repeat CSF neurotransmitters in the older sibling at eight years of age showed slightly low homovanillic acid and 5-hydroxyindoleacetic acid levels. Whole-exome sequencing revealed a novel mutation homozygous in both children in the monoamine transporter gene SLC18A2 (p.Pro237His), resulting in brain dopamine-serotonin vesicular transport disease. This is the second family to be described with a mutation in this gene. Treatment with the dopamine agonist pramipexole in the surviving child resulted in mild improvements in alertness, communication, and eye movements. This case supports the identification of the causal mutation in the original case, expands the clinical phenotype of brain dopamine-serotonin vesicular transport disease and confirms that pramipexole treatment may lead to symptomatic improvement in affected individuals.
Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.
Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay
2017-07-05
reduction of Slc6a15 occurs selectively in the NAc D2-neurons. Genetic reduction of Slc6a15 induces susceptibility to a subthreshold stress, while genetic overexpression in D2-neurons prevents social avoidance after chronic social defeat stress. Copyright © 2017 the authors 0270-6474/17/376527-12$15.00/0.
A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.
Caduff, M; Bauer, A; Jagannathan, V; Leeb, T
2017-10-01
Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.
DEFF Research Database (Denmark)
Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob
2015-01-01
The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...
Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel
2015-07-15
Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.
DEFF Research Database (Denmark)
Kniazeff, Julie; Loland, Claus Juul; Goldberg, Naomi
2005-01-01
The extracellular concentration of the neurotransmitters dopamine, serotonin, norepinephrine, GABA and glycine is tightly controlled by plasma membrane transporters belonging to the SLC6 gene family. A very large number of putative transport proteins with a remarkable homology to the SLC6...... proximity between TM 7 and 8 in the tertiary structure of TnaT as previously suggested for the mammalian counterparts. Furthermore, the inhibition of uptake upon cross-linking the two cysteines provides indirect support for a conserved conformational role of these transmembrane domains in the transport...
Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.
Directory of Open Access Journals (Sweden)
Jing Yuan
Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.
Kato, Hidekazu; Miyake, Fuyu; Shimbo, Hiroko; Ohya, Makoto; Sugawara, Hidenori; Aida, Noriko; Anzai, Rie; Takagi, Mariko; Okuda, Mitsuko; Takano, Kyoko; Wada, Takahito; Iai, Mizue; Yamashita, Sumimasa; Osaka, Hitoshi
2014-08-01
Creatine transporter deficiency (CTD) is an example of X-linked intellectual disability syndromes, caused by mutations in SLC6A8 on Xq28. Although this is the second most frequent genetic cause of intellectual disabilities in Europe or America after Fragile X syndrome, information on the morbidity of this disease is limited in Japan. Using the HPLC screening method we have established recently, we examined samples of urine of 105 patients (73 males and 32 females) with developmental disabilities at our medical center. And we have found a family with three ID boys with a novel missense mutation in SLC6A8. This is the second report of a Japanese family case of CTD. A systematic diagnostic system of this syndrome should be established in Japan to enable us to estimate its frequency and treatment. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Cohen, Rony; Basel-Vanagaite, Lina; Goldberg-Stern, Hadassah; Halevy, Ayelet; Shuper, Avinoam; Feingold-Zadok, Michal; Behar, Doron M; Straussberg, Rachel
2014-11-01
To characterize a new subset of early myoclonic encephalopathy usually associated with metabolic etiologies with a new genetic entity. We describe two siblings with early myoclonic encephalopathy born to consanguineous parents of Arab Muslim origin from Israel. We used homozygosity mapping and candidate gene sequencing to reveal the genetic basis of the myoclonic syndrome. We found a rare missense mutation in the gene encoding one of the two mitochondrial glutamate/H symporters, SLC25A22. The phenotype of early myoclonic encephalopathy was first linked to the same mutation in 2005 in patients of the same ethnicity as our family. Owing to the devastating nature of this encephalopathy, we focus attention on its clinical history, epileptic semiology, distinct electroencephalography features, and genetic basis. We provide the evidence that an integrated diagnostic strategy combining homozygosity mapping with candidate gene sequencing is efficient in consanguineous families with highly heterogeneous autosomal recessive diseases. Copyright © 2014 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Nancy D Merner
2015-10-01
Full Text Available Many encoded gene products responsible for neurodevelopmental disorders (NDs like autism spectrum disorders (ASD, schizophrenia (SCZ, intellectual disability (ID, and idiopathic generalized epilepsy (IGE converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5 Cl- transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS, functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD in human ASD (R952H and R1049C and SCZ (R952H previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs.
A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle
Directory of Open Access Journals (Sweden)
Beever Jonathan E
2010-05-01
Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and
A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.
Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane
2017-01-01
Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.
Wang, Tiange; Liu, Huikun; Wang, Leishen; Huang, Tao; Li, Weiqin; Zheng, Yan; Heianza, Yoriko; Sun, Dianjianyi; Leng, Junhong; Zhang, Shuang; Li, Nan; Hu, Gang; Qi, Lu
2016-12-01
Zinc transporter 8 genetic variant SLC30A8 has been associated with postpartum risk of type 2 diabetes among women with gestational diabetes mellitus (GDM). Gestational weight gain is one of the strongest risk factors for postpartum hyperglycemia. We assessed the interaction between type 2 diabetes-associated SLC30A8 rs13266634 and gestational weight gain on 1-5 years of postpartum glycemic changes in 1,071 women with prior GDM in a longitudinal study. Compared with gestation of 26-30 weeks, postpartum levels of fasting glucose, oral glucose tolerance test 2-h glucose, and hemoglobin A 1c (HbA 1c ) increased across rs13266634 TT, CT, and CC genotypes in women with excessive gestational weight gain, whereas opposite genetic associations were found in women with inadequate or adequate gestational weight gain. Postpartum changes in fasting glucose per additional copy of the C allele were -0.18, -0.04, and 0.12 mmol/L in women with inadequate, adequate, and excessive gestational weight gain, respectively (P for interaction = 0.002). We also found similar interactions for changes in 2-h glucose and HbA 1c (P for interaction = 0.003 and 0.005, respectively). Our data indicate that gestational weight gain may modify SLC30A8 variant on long-term glycemic changes, highlighting the importance of gestational weight control in the prevention of postpartum hyperglycemia in women with GDM. © 2016 by the American Diabetes Association.
Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong
2016-04-01
Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Jensen, N.; Schroder, H. D.; Hejbol, E. K.
2013-01-01
Familial idiopathic basal ganglia calcification (FIBGC) is a neurodegenerative disorder with neuropsychiatric and motor symptoms. Deleterious mutations in SLC20A2, encoding the type III sodium-dependent phosphate transporter 2 (PiT2), were recently linked to FIBGC in almost 50% of the families...... reported worldwide. Here, we show that knockout of Slc20a2 in mice causes calcifications in the thalamus, basal ganglia, and cortex, demonstrating that reduced PiT2 expression alone can cause brain calcifications....
OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.
Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy
2017-05-30
Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.
Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya
2018-03-05
Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.
Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying
2017-04-01
The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.
Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U
2013-01-01
Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.
Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures
Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.
2015-01-01
GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL
Directory of Open Access Journals (Sweden)
Ann Sluder
Full Text Available The efficacy of all major insecticide classes continues to be eroded by the development of resistance mediated, in part, by selection of alleles encoding insecticide insensitive target proteins. The discovery of new insecticide classes acting at novel protein binding sites is therefore important for the continued protection of the food supply from insect predators, and of human and animal health from insect borne disease. Here we describe a novel class of insecticides (Spiroindolines encompassing molecules that combine excellent activity against major agricultural pest species with low mammalian toxicity. We confidently assign the vesicular acetylcholine transporter as the molecular target of Spiroindolines through the combination of molecular genetics in model organisms with a pharmacological approach in insect tissues. The vesicular acetylcholine transporter can now be added to the list of validated insecticide targets in the acetylcholine signalling pathway and we anticipate that this will lead to the discovery of novel molecules useful in sustaining agriculture. In addition to their potential as insecticides and nematocides, Spiroindolines represent the only other class of chemical ligands for the vesicular acetylcholine transporter since those based on the discovery of vesamicol over 40 years ago, and as such, have potential to provide more selective tools for PET imaging in the diagnosis of neurodegenerative disease. They also provide novel biochemical tools for studies of the function of this protein family.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4
Ehmke, Nadja; Graul-Neumann, Luitgard; Smorag, Lukasz; Koenig, Rainer; Segebrecht, Lara; Magoulas, Pilar; Scaglia, Fernando; Kilic, Esra; Hennig, Anna F; Adolphs, Nicolai; Saha, Namrata; Fauler, Beatrix; Kalscheuer, Vera M; Hennig, Friederike; Altmüller, Janine; Netzer, Christian; Thiele, Holger; Nürnberg, Peter; Yigit, Gökhan; Jäger, Marten; Hecht, Jochen; Krüger, Ulrike; Mielke, Thorsten; Krawitz, Peter M; Horn, Denise; Schuelke, Markus; Mundlos, Stefan; Bacino, Carlos A; Bonnen, Penelope E; Wollnik, Bernd; Fischer-Zirnsak, Björn; Kornak, Uwe
2017-11-02
Gorlin-Chaudhry-Moss syndrome (GCMS) is a dysmorphic syndrome characterized by coronal craniosynostosis and severe midface hypoplasia, body and facial hypertrichosis, microphthalmia, short stature, and short distal phalanges. Variable lipoatrophy and cutis laxa are the basis for a progeroid appearance. Using exome and genome sequencing, we identified the recurrent de novo mutations c.650G>A (p.Arg217His) and c.649C>T (p.Arg217Cys) in SLC25A24 in five unrelated girls diagnosed with GCMS. Two of the girls had pronounced neonatal progeroid features and were initially diagnosed with Wiedemann-Rautenstrauch syndrome. SLC25A24 encodes a mitochondrial inner membrane ATP-Mg/P i carrier. In fibroblasts from affected individuals, the mutated SLC25A24 showed normal stability. In contrast to control cells, the probands' cells showed mitochondrial swelling, which was exacerbated upon treatment with hydrogen peroxide (H 2 O 2 ). The same effect was observed after overexpression of the mutant cDNA. Under normal culture conditions, the mitochondrial membrane potential of the probands' fibroblasts was intact, whereas ATP content in the mitochondrial matrix was lower than that in control cells. However, upon H 2 O 2 exposure, the membrane potential was significantly elevated in cells harboring the mutated SLC25A24. No reduction of mitochondrial DNA copy number was observed. These findings demonstrate that mitochondrial dysfunction with increased sensitivity to oxidative stress is due to the SLC25A24 mutations. Our results suggest that the SLC25A24 mutations induce a gain of pathological function and link mitochondrial ATP-Mg/P i transport to the development of skeletal and connective tissue. Copyright © 2017 American Society of Human Genetics. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e
DEFF Research Database (Denmark)
Huppke, Peter; Brendel, Cornelia; Kalscheuer, Vera
2012-01-01
or compound heterozygous mutations for all affected subjects in SLC33A1 encoding a highly conserved acetylCoA transporter (AT-1) required for acetylation of multiple gangliosides and glycoproteins. The mutations were found to cause reduced or absent AT-1 expression and abnormal intracellular localization...
Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction
Directory of Open Access Journals (Sweden)
Yun-Fang Jia
2017-07-01
Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4
DEFF Research Database (Denmark)
Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D
2013-01-01
The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...
Directory of Open Access Journals (Sweden)
Wu Bailin
2008-11-01
Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the
Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C
2008-01-01
Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to
Directory of Open Access Journals (Sweden)
Agné Kulyté
Full Text Available Although the mechanisms linking obesity to insulin resistance (IR and type 2 diabetes (T2D are not entirely understood, it is likely that alterations of adipose tissue function are involved. The aim of this study was to identify new genes controlling insulin sensitivity in adipocytes from obese women with either insulin resistant (OIR or sensitive (OIS adipocytes. Insulin sensitivity was first determined by measuring lipogenesis in isolated adipocytes from abdominal subcutaneous white adipose tissue (WAT in a large observational study. Lipogenesis was measured under conditions where glucose transport was the rate limiting step and reflects in vivo insulin sensitivity. We then performed microarray-based transcriptome profiling on subcutaneous WAT specimen from a subgroup of 9 lean, 21 OIS and 18 obese OIR women. We could identify 432 genes that were differentially expressed between the OIR and OIS group (FDR ≤5%. These genes are enriched in pathways related to glucose and amino acid metabolism, cellular respiration, and insulin signaling, and include genes such as SLC2A4, AKT2, as well as genes coding for enzymes in the mitochondria respiratory chain. Two IR-associated genes, KLF15 encoding a transcription factor and SLC25A10 encoding a dicarboxylate carrier, were selected for functional evaluation in adipocytes differentiated in vitro. Knockdown of KLF15 and SLC25A10 using siRNA inhibited insulin-stimulated lipogenesis in adipocytes. Transcriptome profiling of siRNA-treated cells suggested that KLF15 might control insulin sensitivity by influencing expression of PPARG, PXMP2, AQP7, LPL and genes in the mitochondrial respiratory chain. Knockdown of SLC25A10 had only modest impact on the transcriptome, suggesting that it might directly influence insulin sensitivity in adipocytes independently of transcription due to its important role in fatty acid synthesis. In summary, this study identifies novel genes associated with insulin sensitivity in
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C
Directory of Open Access Journals (Sweden)
Hsin-Chou Yang
Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA
Energy Technology Data Exchange (ETDEWEB)
Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others
1995-12-10
The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT
SLC and SLD: Experimental experience with a linear collider
International Nuclear Information System (INIS)
Breidenbach, M.
1993-08-01
The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described
17 CFR 270.17a-8 - Mergers of affiliated companies.
2010-04-01
... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Mergers of affiliated... (CONTINUED) RULES AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.17a-8 Mergers of affiliated companies. (a) Exemption of affiliated mergers. A Merger of a registered investment company (or a series thereof...
Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd
2018-04-01
The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.
Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.
Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B
2016-08-08
Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Karen M Vernau
Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.
Directory of Open Access Journals (Sweden)
Karen Miguita
2007-12-01
Full Text Available Family, twin and segregation analysis have provided evidences that genetic factors are implicated in the susceptibility for obsessive-compulsive disorder (OCD. Several lines of research suggest that the dopaminergic system may be involved in the pathophysiology of OCD. Thus, the aim of the present study was to investigate a possible association between a polymorphism located in intron 8 of the dopamine transporter gene (SLC6A3 and OCD in a Brazilian sample composed by 208 patients and 865 healthy controls. No statistically differences were observed in allelic and genotype distributions between cases and controls. No association was also observed when the sample was divided according to specific phenotypic features such as gender, presence of tic disorders co-morbidity and age at onset of obsessive-compulsive symptoms (OCS. Our results suggest that the intron 8 VNTR of the SLC6A3 investigated in this study is not related to the susceptibility for OCD in our Brazilian sample.Estudos de família, gêmeos e de segregação têm demonstrado que fatores genéticos estão envolvidos na susceptibilidade para o desenvolvimento do transtorno obsessivo-compulsivo (TOC. Várias linhas de pesquisa sugerem que o sistema dopaminérgico possa estar envolvido na fisiopatologia do TOC. Assim, o objetivo do presente estudo foi investigar uma possível associação entre o polimorfismo localizado no intron 8 do gene do transportador da dopamina (SLC6A3 e o TOC em uma amostra brasileira composta por 208 pacientes e 865 controles sadios. Nenhuma diferença estatisticamente significante foi observada nas distribuições alélicas e genotípicas entre os grupos de pacientes e controles. Nenhuma associação também foi observada quando as amostras foram divididas de acordo com características fenotípicas específicas, tais como gênero, presença de co-morbidade com tiques e idade de início dos sintomas obsessivo-compulsivo (SOC. Nossos resultados sugerem que o VNTR
Rosenthal, Elisabeth A; Ranchalis, Jane; Crosslin, David R; Burt, Amber; Brunzell, John D; Motulsky, Arno G; Nickerson, Deborah A; Wijsman, Ellen M; Jarvik, Gail P
2013-12-05
Hypertriglyceridemia (HTG) is a heritable risk factor for cardiovascular disease. Investigating the genetics of HTG may identify new drug targets. There are ~35 known single-nucleotide variants (SNVs) that explain only ~10% of variation in triglyceride (TG) level. Because of the genetic heterogeneity of HTG, a family study design is optimal for identification of rare genetic variants with large effect size because the same mutation can be observed in many relatives and cosegregation with TG can be tested. We considered HTG in a five-generation family of European American descent (n = 121), ascertained for familial combined hyperlipidemia. By using Bayesian Markov chain Monte Carlo joint oligogenic linkage and association analysis, we detected linkage to chromosomes 7 and 17. Whole-exome sequence data revealed shared, highly conserved, private missense SNVs in both SLC25A40 on chr7 and PLD2 on chr17. Jointly, these SNVs explained 49% of the genetic variance in TG; however, only the SLC25A40 SNV was significantly associated with TG (p = 0.0001). This SNV, c.374A>G, causes a highly disruptive p.Tyr125Cys substitution just outside the second helical transmembrane region of the SLC25A40 inner mitochondrial membrane transport protein. Whole-gene testing in subjects from the Exome Sequencing Project confirmed the association between TG and SLC25A40 rare, highly conserved, coding variants (p = 0.03). These results suggest a previously undescribed pathway for HTG and illustrate the power of large pedigrees in the search for rare, causal variants. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
MyPhuong T Le
Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.
An Integrated Enterprise Accelerator Database for the SLC Control System
International Nuclear Information System (INIS)
2002-01-01
Since its inception in the early 1980's, the SLC Control System has been driven by a highly structured memory-resident real-time database. While efficient, its rigid structure and file-based sources makes it difficult to maintain and extract relevant information. The goal of transforming the sources for this database into a relational form is to enable it to be part of a Control System Enterprise Database that is an integrated central repository for SLC accelerator device and Control System data with links to other associated databases. We have taken the concepts developed for the NLC Enterprise Database and used them to create and load a relational model of the online SLC Control System database. This database contains data and structure to allow querying and reporting on beamline devices, their associations and parameters. In the future this will be extended to allow generation of EPICS and SLC database files, setup of applications and links to other databases such as accelerator maintenance, archive data, financial and personnel records, cabling information, documentation etc. The database is implemented using Oracle 8i. In the short term it will be updated daily in batch from the online SLC database. In the longer term, it will serve as the primary source for Control System static data, an R and D platform for the NLC, and contribute to SLC Control System operations
Positive selection in the SLC11A1 gene in the family Equidae.
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr
2016-05-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.
Sialin (SLC17A5) functions as a nitrate transporter in the plasma membrane
Qin, Lizheng; Liu, Xibao; Sun, Qifei; Fan, Zhipeng; Xia, Dengsheng; Ding, Gang; Ong, Hwei Ling; Adams, David; Gahl, William A.; Zheng, Changyu; Qi, Senrong; Jin, Luyuan; Zhang, Chunmei; Gu, Liankun; He, Junqi; Deng, Dajun; Ambudkar, Indu S.; Wang, Songlin
2012-01-01
In vivo recycling of nitrate (NO3−) and nitrite (NO2−) is an important alternative pathway for the generation of nitric oxide (NO) and maintenance of systemic nitrate–nitrite–NO balance. More than 25% of the circulating NO3− is actively removed and secreted by salivary glands. Oral commensal bacteria convert salivary NO3− to NO2−, which enters circulation and leads to NO generation. The transporters for NO3− in salivary glands have not yet been identified. Here we report that sialin (SLC17A5), mutations in which cause Salla disease and infantile sialic acid storage disorder (ISSD), functions as an electrogenic 2NO3−/H+ cotransporter in the plasma membrane of salivary gland acinar cells. We have identified an extracellular pH-dependent anion current that is carried by NO3− or sialic acid (SA), but not by Br−, and is accompanied by intracellular acidification. Both responses were reduced by knockdown of sialin expression and increased by the plasma membrane-targeted sialin mutant (L22A-L23A). Fibroblasts from patients with ISSD displayed reduced SA- and NO3−-induced currents compared with healthy controls. Furthermore, expression of disease-associated sialin mutants in fibroblasts and salivary gland cells suppressed the H+-dependent NO3− conductance. Importantly, adenovirus-dependent expression of the sialinH183R mutant in vivo in pig salivary glands decreased NO3− secretion in saliva after intake of a NO3−-rich diet. Taken together, these data demonstrate that sialin mediates nitrate influx into salivary gland and other cell types. We suggest that the 2NO3−/H+ transport function of sialin in salivary glands can contribute significantly to clearance of serum nitrate, as well as nitrate recycling and physiological nitrite-NO homeostasis. PMID:22778404
Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta
2017-03-15
Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.
Jaggumantri, Sravan; Dunbar, Mary; Edgar, Vanessa; Mignone, Cristina; Newlove, Theresa; Elango, Rajavel; Collet, Jean Paul; Sargent, Michael; Stockler-Ipsiroglu, Sylvia; van Karnebeek, Clara D M
2015-10-01
Creatine transporter (SLC6A8) deficiency is an X-linked inborn error of metabolism characterized by cerebral creatine deficiency, behavioral problems, seizures, hypotonia, and intellectual developmental disability. A third of patients are amenable to treatment with high-dose oral creatine, glycine, and L-arginine supplementation. Given the limited treatment response, we initiated an open-label observational study to evaluate the effect of adjunct S-adenosyl methionine to further enhance intracerebral creatine synthesis. Significant and reproducible issues with sleep and behavior were noted in both male patients on a dose of 50/mg/kg. One of the two patients stopped S-adenosyl methionine and did not come for any follow-up. A safe and tolerable dose (17 mg/kg/day) was identified in the other patient. On magnetic resonance spectroscopy, this 8-year-old male did not show an increase in intracerebral creatine. However, significant improvement in speech/language skills, muscle mass were observed as well as in personal outcomes as defined by the family in activities related to communication and decision making. Further research is needed to assess the potential of S-adenosyl methionine as an adjunctive therapy for creatine transporter deficiency patients and to define the optimal dose. Our study also illustrates the importance of pathophysiology-based treatment, individualized outcome assessment, and patient/family participation in rare diseases research. Copyright © 2015 Elsevier Inc. All rights reserved.
Investigation of SLC6A4 gene expression in autism spectrum disorders
Directory of Open Access Journals (Sweden)
Elif Funda Şener
2015-06-01
Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169
Ito, T; Nishio, A; Wangemann, P; Griffith, A J
2015-12-03
Hearing loss of patients with enlargement of the vestibular aqueduct (EVA) can fluctuate or progress, with overall downward progression. The most common detectable cause of EVA is mutations of SLC26A4. We previously described a transgenic Slc26a4-insufficient mouse model of EVA in which Slc26a4 expression is controlled by doxycycline administration. Mice that received doxycycline from conception until embryonic day 17.5 (DE17.5; doxycycline discontinued at embryonic day 17.5) had fluctuating hearing loss between 1 and 6 months of age with an overall downward progression after 6 months of age. In this study, we characterized the cochlear functional and structural changes underlying irreversible hearing loss in DE17.5 mice at 12 months of age. The endocochlear potential was decreased and inversely correlated with auditory brainstem response thresholds. The stria vascularis was thickened and edematous in ears with less severe hearing loss, and thinned and atrophic in ears with more severe hearing loss. There were pathologic changes in marginal cell morphology and gene expression that were not observed at 3 months. We conclude that strial dysfunction and degeneration are the primary causes of irreversible progressive hearing loss in our Slc26a4-insufficient mouse model of EVA. This model of primary strial atrophy may be used to explore the mechanisms of progressive hearing loss due to strial dysfunction. Published by Elsevier Ltd.
Report on the SLC control system
International Nuclear Information System (INIS)
Phinney, N.
1985-05-01
The SLC control system is based on a VAX 11/780 Host computer with approximately 50 microprocessor clusters which provide distributed intelligence and control of all CAMAC interface modules. This paper will present an overview of the system including current status and a description of the software architecture and communication protocols. 8 refs
Characterization of SLC transporters in human skin
Directory of Open Access Journals (Sweden)
Marion Alriquet
2015-03-01
Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.
Buonocore, Linda; Blight, Keril J.; Rice, Charles M.; Rose, John K.
2002-01-01
We generated recombinant vesicular stomatitis viruses (VSV) expressing genes encoding hybrid proteins consisting of the extracellular domains of hepatitis C virus (HCV) glycoproteins fused at different positions to the transmembrane and cytoplasmic domains of the VSV G glycoprotein (E1G and E2G). We show that these chimeric proteins are transported to the cell surface and incorporated into VSV virions efficiently. We also generated VSV recombinants in which the gene encoding the VSV G protein...
Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi
2018-01-01
The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.
Conditional expression of the vesicular stomatitis virus glycoprotein gene in Escherichia coli.
Rose, J K; Shafferman, A
1981-01-01
Bacterial plasmids that directed expression of the vesicular stomatitis virus glycoprotein (G-protein) gene under control of the tryptophan operon regulatory region were constructed. A plasmid directing the synthesis of a G-protein-like protein (containing the NH2-terminal segment of seven amino acids encoded by the trpE gene fused to the complete G-protein sequence lacking only its NH2-terminal methionine) could be transformed into trpR+ (repressed) but not into trpR- (derepressed) cells. Th...
Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru
2018-05-15
Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.
2010-04-01
... Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION EXCHANGE PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.17 Hearing. (a) The following minimum... conducted before members of the disciplinary committee. The hearing may be conducted before all of the...
Computed tomography of the vesicular glands: anatomical animal model (Oryctolagus cuniculus)
International Nuclear Information System (INIS)
Dimitrov, R.; Stamatova-Yovcheva, K.; Hamza, S.; Toneva, Y.
2014-01-01
Spiral CT is a non-invasive imaging method of choice for animal anatomical studies. The aim of the study was to establish the imaging anatomical features of the vesicular glands in the rabbit. Eight sexually mature healthy clinically male New Zealand rabbits of 18 months of age with body weight from 2.8 kg to 3.2 kg were used. The animals were anesthetized. As contrast medium Opti-ray350 was administrated. The computed tomography scan was complied with certain bone and soft tissue markers. For this purpose, a whole body multi-slice spiral computed tomography scanner was used. The both soft tissue glands were heterogeneous and relatively hyperdense structures, and defined in detail from the adjacent soft tissues. The urinary bladder neck was ventrally to the glands. Both vesicular glands were better differentiated each other when the rabbit is examined in abdominal recumbence. In dorsal recumbence the shape of the transversal image of the glandular finding was oval. In abdominal recumbence both the left and right soft tissue vesicular gland were defined. Transversal anatomical computed tomographic investigation of the rabbit vesicular gland is a detailed and definitive method, to study the normal morphology of these glands. Key words: Vesicular Gland. Helical Computed Tomography. Anatomy. Rabbit
Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter
2017-07-01
Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.
International Nuclear Information System (INIS)
Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.
1987-02-01
Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed
Mask locations in the SLC final focus region
International Nuclear Information System (INIS)
Cence, R.J.
1983-01-01
The location of four sets of masks needed to shield against background in the final focus region of the SLC is shown. The main point of this note is to update the results of Miller and Sens taking into account the recent changes that have been made in the optics of the SLC beams. For the latest beam design we use the TRANSPORT output dated 5-13-83. This design assumes that the final bends will form an S about the interaction point and that the final quadrupoles will be superconducting and will be placed about 8 feet from the interaction point
Directory of Open Access Journals (Sweden)
Alexandre Bolze
Full Text Available We investigated two siblings with granulomatous histiocytosis prominent in the nasal area, mimicking rhinoscleroma and Rosai-Dorfman syndrome. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous frameshift deletion in SLC29A3, which encodes human equilibrative nucleoside transporter-3 (hENT3. Germline mutations in SLC29A3 have been reported in rare patients with a wide range of overlapping clinical features and inherited disorders including H syndrome, pigmented hypertrichosis with insulin-dependent diabetes, and Faisalabad histiocytosis. With the exception of insulin-dependent diabetes and mild finger and toe contractures in one sibling, the two patients with nasal granulomatous histiocytosis studied here displayed none of the many SLC29A3-associated phenotypes. This mild clinical phenotype probably results from a remarkable genetic mechanism. The SLC29A3 frameshift deletion prevents the expression of the normally coding transcripts. It instead leads to the translation, expression, and function of an otherwise noncoding, out-of-frame mRNA splice variant lacking exon 3 that is eliminated by nonsense-mediated mRNA decay (NMD in healthy individuals. The mutated isoform differs from the wild-type hENT3 by the modification of 20 residues in exon 2 and the removal of another 28 amino acids in exon 3, which include the second transmembrane domain. As a result, this new isoform displays some functional activity. This mechanism probably accounts for the narrow and mild clinical phenotype of the patients. This study highlights the 'rescue' role played by a normally noncoding mRNA splice variant of SLC29A3, uncovering a new mechanism by which frameshift mutations can be hypomorphic.
SLC beam line error analysis using a model-based expert system
International Nuclear Information System (INIS)
Lee, M.; Kleban, S.
1988-02-01
Commissioning particle beam line is usually a very time-consuming and labor-intensive task for accelerator physicists. To aid in commissioning, we developed a model-based expert system that identifies error-free regions, as well as localizing beam line errors. This paper will give examples of the use of our system for the SLC commissioning. 8 refs., 5 figs
Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.
2013-01-01
Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine cal...
Directory of Open Access Journals (Sweden)
Monica eJenstad
2013-12-01
Full Text Available Intercellular communication is pivotal in optimising and synchronising cellular responses to keep internal homeostasis and to respond adequately to external stimuli. In the central nervous system (CNS, glutamatergic and GABAergic signals are postulated to be dependent on the glutamate/GABA-glutamine (GGG cycle for vesicular loading of neurotransmitters, for inactivating the signal and for the replenishment of the neurotransmitters. Islets of Langerhans release the hormones insulin and glucagon, but share similarities with CNS cells in for example transcriptional control of development and differentiation, and chromatin methylation. Interestingly, proteins involved in the CNS in secretion of the neurotransmitters and emitting their responses as well as the regulation of these processes, are also found in islet cells. Moreover, high levels of glutamate, GABA and glutamine and their respective vesicular and plasma membrane transporters have been shown in the islet cells and there is emerging support for these amino acids and their transporters playing important roles in the maturation and secretion of insulin and glucagon. In this review, we will discuss the feasibility of recent data in the field in relation to the biophysical properties of the transporters (Slc1, Slc17, Slc32 and Slc38 and physiology of hormone secretion in islets of Langerhans.
Directory of Open Access Journals (Sweden)
Mark W Neff
Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.
Regulation of vesicular trafficking by Parkinson's disease-associated genes
Directory of Open Access Journals (Sweden)
Tsuyoshi Inoshita
2015-10-01
Full Text Available The regulatory mechanisms that control intracellular vesicular trafficking play important roles in cellular function and viability. Neurons have specific vesicular trafficking systems for synaptic vesicle formation, release and recycling. Synaptic vesicular trafficking impairments induce neuronal dysfunction and physiological and behavioral disorders. Parkinson's disease (PD is an age-dependent neurodegenerative disorder characterized by dopamine depletion and loss of dopamine neurons in the midbrain. The molecular mechanism responsible for the neurodegeneration that occurs during PD is still not understood; however, recent functional analyses of familial PD causative genes suggest that a number of PD causative genes regulate intracellular vesicular trafficking, including synaptic vesicular dynamics. This review focuses on recent insights regarding the functions of PD causative genes, their relationship with vesicular trafficking and how mutations associated with PD affect vesicular dynamics and neuronal survival.
Limitations of interaction-point spot-size tuning at the SLC
International Nuclear Information System (INIS)
Emma, P.; Hendrickson, L.J.; Zimmermann, F.; Raimondi, P.
1997-05-01
At the Stanford Linear Collider (SLC), the interaction-point spot size is minimized by repeatedly correcting, for both beams, various low-order optical aberrations, such as dispersion, waist position or coupling. These corrections are performed about every 8 hours, by minimizing the IP spot size while exciting different orthogonal combinations of final-focus magnets. The spot size itself is determined by measuring the beam deflection angle as a function of the beam-beam separation. Additional information is derived from the energy loss due to beamstrahlung and from luminosity-related signals. In the 1996 SLC run, the typical corrections were so large as to imply a 20-40% average luminosity loss due to residual uncompensated or fluctuating tunable aberrations. In this paper, the authors explore the origin of these large tuning corrections and study possible mitigations for the next SLC run
Directory of Open Access Journals (Sweden)
Yuan-Zong Song
Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.
Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.
Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang
2017-07-01
Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.
Directory of Open Access Journals (Sweden)
Weijers Rob NM
2010-06-01
Full Text Available Abstract Background We examined the effects of the R325W mutation on the three-dimensional (3D structure of the β-cell-specific Zn2+ (zinc transporter ZnT-8. Methods A model of the C-terminal domain of the human ZnT-8 protein was generated by homology modeling based on the known crystal structure of the Escherichia coli (E. coli zinc transporter YiiP at 3.8 Å resolution. Results The homodimer ZnT-8 protein structure exists as a Y-shaped architecture with Arg325 located at the ultimate bottom of this motif at approximately 13.5 Å from the transmembrane domain juncture. The C-terminal domain sequences of the human ZnT-8 protein and the E. coli zinc transporter YiiP share 12.3% identical and 39.5% homologous residues resulting in an overall homology of 51.8%. Validation statistics of the homology model showed a reasonable quality of the model. The C-terminal domain exhibited an αββαβ fold with Arg325 as the penultimate N-terminal residue of the α2-helix. The side chains of both Arg325 and Trp325 point away from the interface with the other monomer, whereas the ε-NH3+ group of Arg325 is predicted to form an ionic interaction with the β-COO- group of Asp326 as well as Asp295. An amino acid alignment of the β2-α2 C-terminal loop domain revealed a variety of neutral amino acids at position 325 of different ZnT-8 proteins. Conclusions Our validated homology models predict that both Arg325 and Trp325, amino acids with a helix-forming behavior, and penultimate N-terminal residues in the α2-helix of the C-terminal domain, are shielded by the planar surface of the three cytoplasmic β-strands and hence unable to affect the sensing capacity of the C-terminal domain. Moreover, the amino acid residue at position 325 is too far removed from the docking and transporter parts of ZnT-8 to affect their local protein conformations. These data indicate that the inherited R325W abnormality in SLC30A8 may be tolerated and results in adequate zinc transfer
Bassi, Maria R; Larsen, Mads A B; Kongsgaard, Michael; Rasmussen, Michael; Buus, Søren; Stryhn, Anette; Thomsen, Allan R; Christensen, Jan P
2016-02-01
The live attenuated yellow fever vaccine (YF-17D) has been successfully used for more than 70 years. It is generally considered a safe vaccine, however, recent reports of serious adverse events following vaccination have raised concerns and led to suggestions that even safer YF vaccines should be developed. Replication deficient adenoviruses (Ad) have been widely evaluated as recombinant vectors, particularly in the context of prophylactic vaccination against viral infections in which induction of CD8+ T-cell mediated immunity is crucial, but potent antibody responses may also be elicited using these vectors. In this study, we present two adenobased vectors targeting non-structural and structural YF antigens and characterize their immunological properties. We report that a single immunization with an Ad-vector encoding the non-structural protein 3 from YF-17D could elicit a strong CD8+ T-cell response, which afforded a high degree of protection from subsequent intracranial challenge of vaccinated mice. However, full protection was only observed using a vector encoding the structural proteins from YF-17D. This vector elicited virus-specific CD8+ T cells as well as neutralizing antibodies, and both components were shown to be important for protection thus mimicking the situation recently uncovered in YF-17D vaccinated mice. Considering that Ad-vectors are very safe, easy to produce and highly immunogenic in humans, our data indicate that a replication deficient adenovector-based YF vaccine may represent a safe and efficient alternative to the classical live attenuated YF vaccine and should be further tested.
Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying
2015-01-01
Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.
Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N
2013-01-01
To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.
Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.
Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun
2018-06-15
Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.
Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.
Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong
2017-10-01
Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.
Directory of Open Access Journals (Sweden)
Marlena M. Westcott
2018-03-01
Full Text Available Recombinant vesicular stomatitis virus (VSV is a promising platform for vaccine development. M51R VSV, an attenuated, M protein mutant strain, is an effective inducer of Type I interferon and dendritic cell (DC maturation, which are desirable properties to exploit for vaccine design. We have previously evaluated M51R VSV (M51R and M51R VSV that produces flagellin (M51R-F as vaccine vectors using murine models, and found that flagellin enhanced DC activation and VSV-specific antibody production after low-dose vaccination. In this report, the immunogenicity of M51R vectors and the adjuvant effect of virus-produced flagellin were evaluated in nonhuman primates following high-dose (108 pfu and low-dose (105 pfu vaccination. A single intramuscular vaccination of African green monkeys with M51R or M51R-F induced VSV-specific, dose-dependent humoral immune responses. Flagellin induced a significant increase in antibody production (IgM, IgG and neutralizing antibody at the low vaccination dose. A VSV-specific cellular response was detected at 6 weeks post-vaccination, but was neither dose-dependent nor enhanced by flagellin; similar numbers of VSV-specific, IFNγ-producing cells were detected in lymph node and spleen of all animals. These results indicate that virus-directed, intracellular flagellin production may improve VSV-based vaccines encoding heterologous antigens by lowering the dose required to achieve humoral immunity.
Adding PCs to SLC Control System
International Nuclear Information System (INIS)
Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.
1993-05-01
The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code
A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.
Directory of Open Access Journals (Sweden)
Paige A Winkler
Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.
Renal epithelial cells can release ATP by vesicular fusion
Directory of Open Access Journals (Sweden)
Randi G Bjaelde
2013-09-01
Full Text Available Renal epithelial cells have the ability to release nucleotides as paracrine factors. In the intercalated cells of the collecting duct, ATP is released by connexin30 (cx30, which is selectively expressed in this cell type. However, ATP is released by virtually all renal epithelia and the aim of the present study was to identify possible alternative nucleotide release pathways in a renal epithelial cell model. We used MDCK (type1 cells to screen for various potential ATP release pathways. In these cells, inhibition of the vesicular H+-ATPases (bafilomycin reduced both the spontaneous and hypotonically (80%-induced nucleotide release. Interference with vesicular fusion using N-ethylamide markedly reduced the spontaneous nucleotide release, as did interference with trafficking from the endoplasmic reticulum to the Golgi apparatus (brefeldin A1 and vesicular transport (nocodazole. These findings were substantiated using a siRNA directed against SNAP-23, which significantly reduced spontaneous ATP release. Inhibition of pannexin and connexins did not affect the spontaneous ATP release in this cell type, which consists of ∼90% principal cells. TIRF-microscopy of either fluorescently-labeled ATP (MANT-ATP or quinacrine-loaded vesicles, revealed that spontaneous release of single vesicles could be promoted by either hypoosmolality (50% or ionomycin. This vesicular release decreased the overall cellular fluorescence by 5.8% and 7.6% respectively. In summary, this study supports the notion that spontaneous and induced ATP release can occur via exocytosis in renal epithelial cells.
Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.
Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W
2014-04-01
Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.
DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet
2015-07-10
Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.
7Li(18O, 17N8Be reaction and the 17N + 8Be-potential
Directory of Open Access Journals (Sweden)
A. T. Rudchik
2010-12-01
Full Text Available Angular distributions of the 7Li(18O, 17N8Be reaction were measured for the transitions to the ground states of 8Be and 17N and excited states of 17N at the energy Elab(18O = 114 MeV. The data were analyzed with coupled-reaction-channels method for one- and two-step transfers of nucleons and clusters. In the analysis, the 7Li + 18O potential de-duced in the analysis of the elastic 7Li + 18O-scattering data as well as shell-model spectroscopic amplitudes of trans-ferred nucleons and clusters were used. Parameters of the 8Be + 17N potential were deduced using the reaction data. Contributions of different one- and two-step transfers in the 7Li(18O, 17N8Be reaction cross-section was studied.
Directory of Open Access Journals (Sweden)
Xin Wen
Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.
Fukuzato, Yoko; Matsuura, Tetsuro; Ozaki, Kiyokazu; Matsuura, Masahiro; Sano, Tomoya; Nakahara, Yutaka; Kodama, Yasushi; Nakagawa, Akihito; Okamura, Sumie; Suido, Hirohisa; Torii, Kayo; Makino, Taketoshi; Narama, Isao
2009-10-01
In our previous studies, WBN/KobSlc was characterized as a rat strain in which only males began to develop pancreatitis, and then presented with diabetic symptoms. In the course of studying their pancreatic inflammation, we detected molar caries in prediabetic males feeding on a standard diet (CRF-1) widely used for experimental animals. The purpose of this study is to confirm whether the WBN/KobSlc strain is caries-susceptible to the diet reported to be non-cariogenic, and to examine the effect of a prediabetic condition on their dental caries. For a morphological study, 25 male WBN/KobSlc rats aged 3.2-7.8 months and 24 females of the same strain aged 3.3-6.6 months were used, along with 10 males and 10 females of 8.2-month-old F344 rats. Marked dental caries were detected in the mandibular molars of male and female WBN/KobSlc rats regardless of pancreatitis, although no similar changes were observed in any teeth of the F344 strain fed the same diet. Soft X-ray examination revealed that the caries began in the crown and progressed horizontally and vertically, and that a severe radiolucent lesion extensively expanded to the entire crown, corresponding to a macroscopically deleted molar. The caries had gradually developed mainly in the second mandibular molar from more than 3.5 months of age, while none were seen in any rats before that time. The WBN/KobSlc rats were caries-susceptible even to the standard laboratory diet, and pancreatitis was not directly associated with the onset of dental caries in this strain.
Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth
Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela
2012-01-01
Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245
Directory of Open Access Journals (Sweden)
Venkata Saroja eVoruganti
2013-12-01
Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.
Truncating SLC5A7 mutations underlie a spectrum of dominant hereditary motor neuropathies.
Salter, Claire G; Beijer, Danique; Hardy, Holly; Barwick, Katy E S; Bower, Matthew; Mademan, Ines; De Jonghe, Peter; Deconinck, Tine; Russell, Mark A; McEntagart, Meriel M; Chioza, Barry A; Blakely, Randy D; Chilton, John K; De Bleecker, Jan; Baets, Jonathan; Baple, Emma L; Walk, David; Crosby, Andrew H
2018-04-01
To identify the genetic cause of disease in 2 previously unreported families with forms of distal hereditary motor neuropathies (dHMNs). The first family comprises individuals affected by dHMN type V, which lacks the cardinal clinical feature of vocal cord paralysis characteristic of dHMN-VII observed in the second family. Next-generation sequencing was performed on the proband of each family. Variants were annotated and filtered, initially focusing on genes associated with neuropathy. Candidate variants were further investigated and confirmed by dideoxy sequence analysis and cosegregation studies. Thorough patient phenotyping was completed, comprising clinical history, examination, and neurologic investigation. dHMNs are a heterogeneous group of peripheral motor neuron disorders characterized by length-dependent neuropathy and progressive distal limb muscle weakness and wasting. We previously reported a dominant-negative frameshift mutation located in the concluding exon of the SLC5A7 gene encoding the choline transporter (CHT), leading to protein truncation, as the likely cause of dominantly-inherited dHMN-VII in an extended UK family. In this study, our genetic studies identified distinct heterozygous frameshift mutations located in the last coding exon of SLC5A7 , predicted to result in the truncation of the CHT C-terminus, as the likely cause of the condition in each family. This study corroborates C-terminal CHT truncation as a cause of autosomal dominant dHMN, confirming upper limb predominating over lower limb involvement, and broadening the clinical spectrum arising from CHT malfunction.
DEFF Research Database (Denmark)
Elizondo, Elisa; Larsen, Jannik; Hatzakis, Nikos
2012-01-01
A confocal fluorescence microscopy-based assay was used for studying the influence of the preparation route on the supramolecular organization of lipids in a vesicular system. In this work, vesicles composed of cholesterol and CTAB (1/1 mol %) or cholesterol and DOPC (2/8 mol %) and incorporating...
International Nuclear Information System (INIS)
Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.
1991-01-01
The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance
Filling Landsat ETM+ SLC-off gaps using a segmentation model approach
Maxwell, Susan
2004-01-01
The purpose of this article is to present a methodology for filling Landsat Scan Line Corrector (SLC)-off gaps with same-scene spectral data guided by a segmentation model. Failure of the SLC on the Landsat 7 Enhanced Thematic Mapper Plus (ETM+) instrument resulted in a loss of approximately 25 percent of the spectral data. The missing data span across most of the image with scan gaps varying in size from two pixels near the center of the image to 14 pixels along the east and west edges. Even with the scan gaps, the radiometric and geometric qualities of the remaining portions of the image still meet design specifications and therefore contain useful information (see http:// landsat7.usgs.gov for additional information). The U.S. Geological Survey EROS Data Center (EDC) is evaluating several techniques to fill the gaps in SLC-off data to enhance the usability of the imagery (Howard and Lacasse 2004) (PE&RS, August 2004). The method presented here uses a segmentation model approach that allows for same-scene spectral data to be used to fill the gaps. The segment model is generated from a complete satellite image with no missing spectral data (e.g., Landsat 5, Landsat 7 SLCon, SPOT). The model is overlaid on the Landsat SLC-off image, and the missing data within the gaps are then estimated using SLC-off spectral data that intersect the segment boundary. A major advantage of this approach is that the gaps are filled using spectral data derived from the same SLC-off satellite image.
Transmission and pathogenesis of vesicular stomatitis viruses
Vesicular Stomatitis (VS) is caused by the Vesicular Stomatitis Virus (VSV), a negative single stranded RNA arthropod-borne virus member of the Family Rhabdoviridae. The virion is composed of the host derived plasma membrane, the envelope, and an internal ribonucleoprotein core. The envelope contain...
DEFF Research Database (Denmark)
Lüttichau, H R; Lewis, I C; Gerstoft, J
2001-01-01
The viral chemokine antagonist vMIP-II encoded by human herpesvirus 8 (HHV8) and MC148 encoded by the poxvirus - Molluscum contagiosum - were tested against the newly identified chemokine receptor CCR10. As the CCR10 ligand ESkine / CCL27 had the highest identity to MC148 and because both...
The role of the serotonergic system in suicidal behavior
Sadkowski, Marta; Dennis, Brittany; Clayden, Robert C; ElSheikh, Wala; Rangarajan, Sumathy; DeJesus, Jane; Samaan, Zainab
2013-01-01
Serotonin is a widely investigated neurotransmitter in several psychopathologies, including suicidal behavior (SB); however, its role extends to several physiological functions involving the nervous system, as well as the gastrointestinal and cardiovascular systems. This review summarizes recent research into ten serotonergic genes related to SB. These genes – TPH1, TPH2, SLC6A4, SLC18A2, HTR1A, HTR1B, HTR2A, DDC, MAOA, and MAOB – encode proteins that are vital to serotonergic function: tryptophan hydroxylase; the serotonin transporter 5-HTT; the vesicular transporter VMAT2; the HTR1A, HTR1B, and HTR2A receptors; the L-amino acid decarboxylase; and the monoamine oxidases. This review employed a systematic search strategy and a narrative research methodology to disseminate the current literature investigating the link between SB and serotonin. PMID:24235834
Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy
Directory of Open Access Journals (Sweden)
Yangzom D. Bhutia
2017-02-01
Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy
SLC26A4 mutations are associated with a specific inner ear malformation.
Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa
2007-03-01
Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.
International Nuclear Information System (INIS)
Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.
1993-01-01
The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC
De novo duplication of 17p13.1-p13.2 in a patient with intellectual disability and obesity.
Kuroda, Yukiko; Ohashi, Ikuko; Tominaga, Makiko; Saito, Toshiyuki; Nagai, Jun-Ichi; Ida, Kazumi; Naruto, Takuya; Masuno, Mitsuo; Kurosawa, Kenji
2014-06-01
17p13.1 Deletion encompassing TP53 has been described as a syndrome characterized by intellectual disability and dysmorphic features. Only one case with a 17p13.1 duplication encompassing TP53 has been reported in a patient with intellectual disability, seizures, obesity, and diabetes mellitus. Here, we present a patient with a 17p13.1 duplication who exhibited obesity and intellectual disability, similar to the previous report. The 9-year-old proposita was referred for the evaluation of intellectual disability and obesity. She also exhibited insulin resistance and liver dysfunction. She had wide palpebral fissures, upturned nostrils, a long mandible, short and slender fingers, and skin hyperpigmentation. Array comparative genomic hybridization (array CGH) detected a 3.2 Mb duplication of 17p13.1-p13.2 encompassing TP53, FXR2, NLGN2, and SLC2A4, which encodes the insulin-responsive glucose transporter 4 (GLUT4) associated with insulin-stimulated glucose uptake in adipocytes and muscle. We suggest that 17p13.1 duplication may represent a clinically recognizable condition characterized partially by a characteristic facial phenotype, developmental delay, and obesity. © 2014 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Sofie V Hellsten
Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.
Operational experience with optical matching in the SLC Final Focus System
International Nuclear Information System (INIS)
Bambade, P.; Burchat, P.; Burke, D.
1989-01-01
In the SLC Final Focus System, all components of transverse phase-space and the couplings between them must be controlled to minimize the beam size at the interaction point. After summarizing the experimental algorithm and the on-line tuning programs, we present a consistent set of measurements and describe our present understanding of the various contributions to this beam size. 17 refs., 9 figs
Physics at the SLC [SLAC Linear Collider
International Nuclear Information System (INIS)
Swartz, M.L.
1990-11-01
The SLAC Linear Collider (SLC) was constructed in the years 1983--1987 for two principal reasons: to develop the accelerator physics and technology that are necessary for the construction of future linear electron-positron colliders; and to produce electron-positron collisions at the Z 0 pole and to study the physics of the weak neutral current. To date, the SLC program has been quite successful at achieving the first goal. The machine has produced and collided high energy electron and positron beams of three-micron transverse size. The problems of operating an open geometry detector in an environment that is more akin to those found in fixed-target experiments than in storage rings have largely been solved. As a physics producing venture, the SLC has been less successful than was originally hoped but more successful than is commonly believed. Some of the results that have been produced by the Mark II experiment with a very modest data sample are competitive with those that have been produced with much larger samples by the four LEP collaborations. At the current, time, SLAC is engaged in an ambitious program to upgrade the SLC luminosity and to exploit one of its unique features, a spin polarized electron beam. These lectures are therefore organized into three sections: a brief description of the SLC; a review of the physics results that have been achieved with the Mark II detector; a description of the SLC's future: the realization and use of a polarized electron beam
International Nuclear Information System (INIS)
Ross, M.
1993-04-01
The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines
Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.
Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J
2017-07-01
To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.
Polarized source performance in 1992 for SLC--SLD
International Nuclear Information System (INIS)
Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.
1993-02-01
In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met
2010-04-01
... Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION EXCHANGE PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.18 Decision. Promptly following a hearing conducted in accordance with § 8.17, the disciplinary committee shall render a written decision...
Schnetkamp, Paul P M
2013-01-01
Members of the SLC24 gene family encode K(+)-dependent Na(+)/Ca(2+) exchangers (NCKX) that utilize both the inward Na(+) and outward K(+) gradients to extrude Ca(2+) from cells. There are five human SLC24 genes that play a role in biological process as diverse as vision in retinal rod and cone photoreceptors, olfaction, skin pigmentation and at least three of the five genes are also widely expressed in the brain. Here I review the functional, physiological and structural features of NCKX proteins that have emerged in the past few years. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Angela M Devlin
2010-08-01
Full Text Available Prenatal and early postnatal exposure to maternal depression may "program" childhood behavior via epigenetic processes such as DNA methylation. Methylenetetrahydro-folate reductase (MTHFR is an important enzyme in the generation of methyl groups for DNA methylation. The common MTHFR C677T variant is associated with depression in men and non-pregnant women, and with global changes in DNA methylation. This study investigated the effect of maternal MTHFR C677T genotype on antenatal maternal mood, and their impact on the gene-specific methylation in pregnant women and their newborn infants. The methylation status of SLC6A4, which encodes the transmembrane serotonin transporter, and BDNF, which encodes brain derived neurotrophic factor, were assessed because of their potential role in behaviour.Depressed mood was assessed by the Edinburgh Postnatal Depression Scale (EPDS and the Hamilton Rating Scale for Depression (HAM-D in women (n = 82, all taking folate during the 2(nd and 3(rd trimesters of pregnancy. The methylation status of SLC6A4 and BDNF were assessed in 3rd trimester maternal peripheral leukocytes and in umbilical cord leukocytes collected from their infants at birth. Women with the MTHFR 677TT genotype had greater 2(nd trimester depressed mood (p<0.05. Increased 2(nd trimester maternal depressed mood (EPDS scores was associated with decreased maternal and infant SLC6A4 promoter methylation (p<0.05, but had no effect on BDNF promoter methylation.These findings show that the MTHFR C677T variant is associated with greater depressed mood during pregnancy. We further showed that prenatal exposure to maternal depressed mood affects gene-specific DNA methylation patterns. These findings support the concept that alterations in epigenetic processes may contribute to developmental programming of behaviour by maternal depression.
Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.
2013-01-01
Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905
SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*
Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas
2010-01-01
Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830
Directory of Open Access Journals (Sweden)
Fabrice Le Boeuf
2017-09-01
Full Text Available The reovirus fusion-associated small transmembrane (FAST proteins are the smallest known viral fusogens (∼100–150 amino acids and efficiently induce cell-cell fusion and syncytium formation in multiple cell types. Syncytium formation enhances cell-cell virus transmission and may also induce immunogenic cell death, a form of apoptosis that stimulates immune recognition of tumor cells. These properties suggest that FAST proteins might serve to enhance oncolytic virotherapy. The oncolytic activity of recombinant VSVΔM51 (an interferon-sensitive vesicular stomatitis virus [VSV] mutant encoding the p14 FAST protein (VSV-p14 was compared with a similar construct encoding GFP (VSV-GFP in cell culture and syngeneic BALB/c tumor models. Compared with VSV-GFP, VSV-p14 exhibited increased oncolytic activity against MCF-7 and 4T1 breast cancer spheroids in culture and reduced primary 4T1 breast tumor growth in vivo. VSV-p14 prolonged survival in both primary and metastatic 4T1 breast cancer models, and in a CT26 metastatic colon cancer model. As with VSV-GFP, VSV-p14 preferentially replicated in vivo in tumors and was cleared rapidly from other sites. Furthermore, VSV-p14 increased the numbers of activated splenic CD4, CD8, natural killer (NK, and natural killer T (NKT cells, and increased the number of activated CD4 and CD8 cells in tumors. FAST proteins may therefore provide a multi-pronged approach to improving oncolytic virotherapy via syncytium formation and enhanced immune stimulation.
Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun
2017-04-01
Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Directory of Open Access Journals (Sweden)
Anna Rita Cappello
2018-04-01
Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza
2018-04-01
The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
International Nuclear Information System (INIS)
Moffeit, K.C.
1987-01-01
The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model
International Nuclear Information System (INIS)
Phinney, N.
1992-08-01
The SLAC Linear Collider (SLC) has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper will discuss the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high-current, low-emittance beams and focusing the beams to the micron scale for collisions
Energy Technology Data Exchange (ETDEWEB)
Phinney, N. [Stanford Univ., CA (United States). Stanford Linear Accelerator Center
1998-07-01
The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider.
International Nuclear Information System (INIS)
Phinney, N.
1998-01-01
The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider
Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas
Directory of Open Access Journals (Sweden)
Alberto Azzalin
2017-04-01
Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.
DEFF Research Database (Denmark)
Bassi, Maria R; Larsen, Mads Andreas Bay; Kongsgaard, Michael
2016-01-01
The live attenuated yellow fever vaccine (YF-17D) has been successfully used for more than 70 years. It is generally considered a safe vaccine, however, recent reports of serious adverse events following vaccination have raised concerns and led to suggestions that even safer YF vaccines should...... be developed. Replication deficient adenoviruses (Ad) have been widely evaluated as recombinant vectors, particularly in the context of prophylactic vaccination against viral infections in which induction of CD8+ T-cell mediated immunity is crucial, but potent antibody responses may also be elicited using......, which afforded a high degree of protection from subsequent intracranial challenge of vaccinated mice. However, full protection was only observed using a vector encoding the structural proteins from YF-17D. This vector elicited virus-specific CD8+ T cells as well as neutralizing antibodies, and both...
STANFORD: Highly polarized SLC electron beams
International Nuclear Information System (INIS)
Anon.
1993-01-01
Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium
Matsui, T; Nakayama, H; Yoshida, K; Shinmyo, A
2003-10-01
Peroxidases (PRX, EC 1.11.1.7) are widely distributed across microorganisms, plants, and animals; and, in plants, they have been implicated in a variety of secondary metabolic reactions. In particular, horseradish (Armoracia rusticana) root represents the main source of commercial PRX production. The prxC1a gene, which encodes horseradish PRX (HRP) C, is expressed mainly in the roots and stems of the horseradish plant. HRP C1a protein is shown to be synthesized as a preprotein with both a N-terminal (NTPP) and a C-terminal propeptide (CTPP). These propeptides, which might be responsible for intracellular localization or secretion, are removed before or concomitant with production of the mature protein. We investigated the functional role of HRP C1a NTPP and CTPP in the determination of the vesicular transport route, using an analytical system of transgenically cultured tobacco cells (Nicotiana tabacum, BY2). Here, we report that NTPP and CTPP are necessary and sufficient for accurate localization of mature HRP C1a protein to vacuoles of the vesicular transport system. We also demonstrate that HRP C1a derived from a preprotein lacking CTPP is shunted into the secretory pathway.
S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model
Directory of Open Access Journals (Sweden)
Pingting Liu
2017-01-01
Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.
Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J
2015-06-11
ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.
Chen, Wen-Lian; Wang, Yue-Ying; Zhao, Aihua; Xia, Li; Xie, Guoxiang; Su, Mingming; Zhao, Linjing; Liu, Jiajian; Qu, Chun; Wei, Runmin; Rajani, Cynthia; Ni, Yan; Cheng, Zhen; Chen, Zhu; Chen, Sai-Juan; Jia, Wei
2016-11-14
Rapidly proliferating leukemic progenitor cells consume substantial glucose, which may lead to glucose insufficiency in bone marrow. We show that acute myeloid leukemia (AML) cells are prone to fructose utilization with an upregulated fructose transporter GLUT5, which compensates for glucose deficiency. Notably, AML patients with upregulated transcription of the GLUT5-encoding gene SLC2A5 or increased fructose utilization have poor outcomes. Pharmacological blockage of fructose uptake ameliorates leukemic phenotypes and potentiates the cytotoxicity of the antileukemic agent, Ara-C. In conclusion, this study highlights enhanced fructose utilization as a metabolic feature of AML and a potential therapeutic target. Copyright © 2016 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Anon.
1990-05-15
During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)
Microstructure and Tensile Behavior of Al8Co17Cr17Cu8Fe17Ni33 (at.%) High-Entropy Alloy
Daoud, H. M.; Manzoni, A.; Völkl, R.; Wanderka, N.; Glatzel, U.
2013-12-01
Microstructure evolution and tensile behavior of the high-entropy alloy Al8Co17Cr17Cu8Fe17Ni33 (at.%) are investigated at room temperature and at 500°C in the as-cast state and under different heat-treatment conditions. Detailed microstructural characterizations are carried out using optical microscopy, scanning electron microscopy, and transmission electron microscopy. The equilibrium phase evolution as a function of temperature was calculated using the Thermo-Calc software (Thermo-Calc Software, Stockholm, Sweden) integrated with TTNi-7 database. The observed majority phase is a face-centered cubic solid solution for all tested specimens. Tensile ductility at room temperature and at elevated temperature is enhanced by heat treatment at 1150°C. An embrittlement phenomenon has been observed after a heat treatment at 700°C resulting in significant degradation in tensile properties.
Are vesicular neurotransmitter transporters potential treatment targets for temporal lobe epilepsy?
Directory of Open Access Journals (Sweden)
Joeri eVan Liefferinge
2013-08-01
Full Text Available The vesicular neurotransmitter transporters (VNTs are small proteins responsible for packing synaptic vesicles with neurotransmitters thereby determining the amount of neurotransmitter released per vesicle through fusion in both neurons and glial cells. Each transporter subtype was classically seen as a specific neuronal marker of the respective nerve cells containing that particular neurotransmitter or structurally related neurotransmitters. More recently, however, it has become apparent that common neurotransmitters can also act as co-transmitters, adding complexity to neurotransmitter release and suggesting intriguing roles for VNTs therein. We will first describe the current knowledge on vesicular glutamate transporters (VGLUT1/2/3, the vesicular excitatory amino acid transporter (VEAT, the vesicular nucleotide transporter (VNUT, vesicular monoamine transporters (VMAT1/2, the vesicular acetylcholine transporter (VAChT and the vesicular γ-aminobutyric acid (GABA transporter (VGAT in the brain. We will focus on evidence regarding transgenic mice with disruptions in VNTs in different models of seizures and epilepsy. We will also describe the known alterations and reorganizations in the expression levels of these VNTs in rodent models for temporal lobe epilepsy (TLE and in human tissue resected for epilepsy surgery. Finally, we will discuss perspectives on opportunities and challenges for VNTs as targets for possible future epilepsy therapies.
International Nuclear Information System (INIS)
Anon.
1990-01-01
During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)
Performance of the SLC polarized electron source with high polarization
International Nuclear Information System (INIS)
Clendenin, J.E.; Alley, R.K.; Aoyagi, H.
1993-04-01
For the 1992 operating cycle of the SLAC Linear Collider (SLC), the polarized electron source (PES) during its maiden run successfully met the pulse intensity and overall efficiency requirements of the SLC. However, the polarization of the bulk GaAs cathode was low (∼27%) and the pulse-to-pulse stability was marginal. We have shown that adequate charge for the SLC can be extracted from a strained layer cathode having P e ∼80% even though the quantum efficiency (QE) is - beam stability. The performance of the PES during the 1993 SLC operating cycle with these and other improvements is discussed
Abplanalp, Jeannette; Laczko, Endre; Philp, Nancy J.; Neidhardt, John; Zuercher, Jurian; Braun, Philipp; Schorderet, Daniel F.; Munier, Francis L.; Verrey, François; Berger, Wolfgang; Camargo, Simone M.R.; Kloeckener-Gruissem, Barbara
2013-01-01
Creatine transport has been assigned to creatine transporter 1 (CRT1), encoded by mental retardation associated SLC6A8. Here, we identified a second creatine transporter (CRT2) known as monocarboxylate transporter 12 (MCT12), encoded by the cataract and glucosuria associated gene SLC16A12. A non-synonymous alteration in MCT12 (p.G407S) found in a patient with age-related cataract (ARC) leads to a significant reduction of creatine transport. Furthermore, Slc16a12 knockout (KO) rats have elevated creatine levels in urine. Transport activity and expression characteristics of the two creatine transporters are distinct. CRT2 (MCT12)-mediated uptake of creatine was not sensitive to sodium and chloride ions or creatine biosynthesis precursors, breakdown product creatinine or creatine phosphate. Increasing pH correlated with increased creatine uptake. Michaelis–Menten kinetics yielded a Vmax of 838.8 pmol/h/oocyte and a Km of 567.4 µm. Relative expression in various human tissues supports the distinct mutation-associated phenotypes of the two transporters. SLC6A8 was predominantly found in brain, heart and muscle, while SLC16A12 was more abundant in kidney and retina. In the lens, the two transcripts were found at comparable levels. We discuss the distinct, but possibly synergistic functions of the two creatine transporters. Our findings infer potential preventive power of creatine supplementation against the most prominent age-related vision impaired condition. PMID:23578822
Measurement of electron beam polarization at the SLC
International Nuclear Information System (INIS)
Steiner, H.; California Univ., Berkeley
1988-01-01
One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)
SLAC-Linac-Collider (SLC) Project
International Nuclear Information System (INIS)
Wiedemann, H.
1981-02-01
The proposed SLAC Linear Collider Project (SLC) and its features are described in this paper. In times of ever increasing costs for energy the electron storage ring principle is about to reach its practical limit. A new class of colliding beam beam facilities, the Linear Colliders, are getting more and more attractive and affordable at very high center-of-mass energies. The SLC is designed to be a poineer of this new class of colliding beam facilities and at the same time will serve as a valuable tool to explore the high energy physics at the level of 100 GeV in the center-of-mass system
Drift chamber vertex detectors for SLC/LEP
Energy Technology Data Exchange (ETDEWEB)
Hayes, K G
1988-03-01
Factors influencing the design of drift chamber vertex detectors for SLC and LEP are discussed including global strategy, chamber gas, cell design, and signal processing. The designs of the vertex chambers for the L3 and OPAL experiments at LEP and the Mark II experiment at the SLC are described.
17 CFR 210.8-01 - Preliminary Notes to Article 8.
2010-04-01
... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Preliminary Notes to Article 8... ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Article 8 Financial Statements of Smaller Reporting Companies § 210.8-01 Preliminary Notes to Article 8. Sections 210.8-01 to 210.8-08 shall...
Superconducting quadrupoles for the SLC final focus
International Nuclear Information System (INIS)
Erickson, R.; Fieguth, T.; Murray, J.J.
1987-01-01
The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient superconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance
Making electron beams for the SLC linac
International Nuclear Information System (INIS)
Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.
1984-01-01
A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table
Superconducting quadrupoles for the SLC final focus
International Nuclear Information System (INIS)
Erickson, R.; Fieguth, T.; Murray, J.J.
1987-01-01
The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient supperconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance
Directory of Open Access Journals (Sweden)
Clifford Jacobs
2014-06-01
Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.
Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib
2014-02-01
Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.
17 CFR 8.08 - Disciplinary committee.
2010-04-01
... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Disciplinary committee. 8.08 Section 8.08 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION EXCHANGE PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.08 Disciplinary...
Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko
2014-09-18
SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.
2010-04-01
... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Final decision. 8.20 Section 8.20 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION EXCHANGE PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.20 Final decision. Each...
Directory of Open Access Journals (Sweden)
Sofia Blazevic
Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.
Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis
Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.
2010-01-01
Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853
Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters
Directory of Open Access Journals (Sweden)
Markus Grube
2018-04-01
Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.
ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production
Directory of Open Access Journals (Sweden)
Etienne Masle-Farquhar
2017-05-01
Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.
The polarized electron gun for the SLC
International Nuclear Information System (INIS)
Schultz, D.C.; Clendenin, J.; Frisch, J.; Hoyt, E.; Klaisner, L.; Woods, M.; Wright, D.; Zolotorev, M.
1992-03-01
A new polarized electron gun for use on the SLC at SLAC has been built and tested. It is a diode gun with a laser driven GaAs photocathode. It is designed to provide short (2ns) pulses of 10 A at 160 kV at 120 Hz. The design features of the gun and results from a testing program on a new and dedicated beam line are presented. Early results from operation on the SLC will also be shown
Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells
Directory of Open Access Journals (Sweden)
Kayo Ikeda
2017-11-01
Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter
Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas
1997-01-01
The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306
Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela
2011-12-01
Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.
Regulators of Slc4 bicarbonate transporter activity
Directory of Open Access Journals (Sweden)
Ian M. Thornell
2015-06-01
Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.
Survey of beam instrumentation used in SLC
International Nuclear Information System (INIS)
Ecklund, S.D.
1991-03-01
A survey of beam instruments used at SLAC in the SLC machine is presented. The basic utility and operation of each device is briefly described. The various beam instruments used at the Stanford Linear Collider (SLC), can be classified by the function they perform. Beam intensity, position and size are typical of the parameters of beam which are measured. Each type of parameter is important for adjusting or tuning the machine in order to achieve optimum performance. 39 refs
International Nuclear Information System (INIS)
Sanchez-Chopitea, L.; Emma, P.; Van Olst, D.
1991-05-01
Beam orbits in the SLC are monitored in real time and the data is stored for future trend and correlation analysis. A background process acquires Beam Position Monitor (BPM) and Toroid data on a periodic basis and saves the general quantities such as orbit RMS and beam intensity in addition to the individual readings. Some of this data is archived by the SLC History Buffer facility and the rest is saved in files for later analysis. This has permitted the tracing of interaction point instabilities to specific devices as far away as the damping rings. In addition, the data is displayed for the operators both in summary and in full form. The different displays can be configured from the control consoles. 2 refs., 5 figs
Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G
2015-04-01
Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. We conducted a genomewide association study with 1.1 million genetic markers in 815 children. We found serum uric acid to be significantly heritable [h(2) ± SD = 0.45 ± 0.08, P = 5.8 × 10(-11)] and associated with SLC2A9 variants (P values between 10(-16) and 10(-7)). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. © 2015 American Society for Nutrition.
Lessons from the SLC for future LC control systems
International Nuclear Information System (INIS)
Humphrey, R.
1991-12-01
The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: Repetition rate; Sensitivity to orbit distortion; Stability/Automation; and Accelerator Development
Analyses of SLC13A5-epilepsy patients reveal perturbations of TCA cycle.
Bainbridge, Matthew N; Cooney, Erin; Miller, Marcus; Kennedy, Adam D; Wulff, Jacob E; Donti, Taraka; Jhangiani, Shalini N; Gibbs, Richard A; Elsea, Sarah H; Porter, Brenda E; Graham, Brett H
2017-08-01
To interrogate the metabolic profile of five subjects from three families with rare, nonsense and missense mutations in SLC13A5 and Early Infantile Epileptic Encephalopathies (EIEE) characterized by severe, neonatal onset seizures, psychomotor retardation and global developmental delay. Mass spectrometry of plasma, CSF and urine was used to identify consistently dysregulated analytes in our subjects. Distinctive elevations of citrate and dysregulation of citric acid cycle intermediates, supporting the hypothesis that loss of SLC13A5 function alters tricarboxylic acid cycle (TCA) metabolism and may disrupt metabolic compartmentation in the brain. Our results indicate that analysis of plasma citrate and other TCA analytes in SLC13A5 deficient patients define a diagnostic metabolic signature that can aid in diagnosing children with this disease. Copyright © 2017 Elsevier Inc. All rights reserved.
A calorimeter software trigger for the Mark II detector at SLC [Stanford Linear Collider
International Nuclear Information System (INIS)
Briggs, D.; Glanzman, T.; Grosse-Wiesmann, P.; Tinsman, J.; Holmgren, S.; Schaad, M.W.
1989-04-01
A new FASTBUS-based calorimeter software trigger for the upgraded Mark II at the Stanford Linear Collider (SLC) is presented. The trigger requirements for SLC and a short description of the hardware used for this purpose are given, followed by a detailed description of the software. Some preliminary results are presented. 9 refs., 4 figs
Mistry, Divya; Wise, Roger P; Dickerson, Julie A
2017-01-01
Identification of central genes and proteins in biomolecular networks provides credible candidates for pathway analysis, functional analysis, and essentiality prediction. The DiffSLC centrality measure predicts central and essential genes and proteins using a protein-protein interaction network. Network centrality measures prioritize nodes and edges based on their importance to the network topology. These measures helped identify critical genes and proteins in biomolecular networks. The proposed centrality measure, DiffSLC, combines the number of interactions of a protein and the gene coexpression values of genes from which those proteins were translated, as a weighting factor to bias the identification of essential proteins in a protein interaction network. Potentially essential proteins with low node degree are promoted through eigenvector centrality. Thus, the gene coexpression values are used in conjunction with the eigenvector of the network's adjacency matrix and edge clustering coefficient to improve essentiality prediction. The outcome of this prediction is shown using three variations: (1) inclusion or exclusion of gene co-expression data, (2) impact of different coexpression measures, and (3) impact of different gene expression data sets. For a total of seven networks, DiffSLC is compared to other centrality measures using Saccharomyces cerevisiae protein interaction networks and gene expression data. Comparisons are also performed for the top ranked proteins against the known essential genes from the Saccharomyces Gene Deletion Project, which show that DiffSLC detects more essential proteins and has a higher area under the ROC curve than other compared methods. This makes DiffSLC a stronger alternative to other centrality methods for detecting essential genes using a protein-protein interaction network that obeys centrality-lethality principle. DiffSLC is implemented using the igraph package in R, and networkx package in Python. The python package can be
Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio
2016-01-01
To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.
Zhong, Sheng; Navaratnam, Dhasakumar; Santos-Sacchi, Joseph
2014-01-01
Chloride is the major anion in cells, with many diseases arising from disordered Cl- regulation. For the non-invasive investigation of Cl- flux, YFP-H148Q and its derivatives chameleon and Cl-Sensor previously were introduced as genetically encoded chloride indicators. Neither the Cl- sensitivity nor the pH-susceptibility of these modifications to YFP is optimal for precise measurements of Cl- under physiological conditions. Furthermore, the relatively poor photostability of YFP derivatives hinders their application for dynamic and quantitative Cl- measurements. Dynamic and accurate measurement of physiological concentrations of chloride would significantly affect our ability to study effects of chloride on cellular events. In this study, we developed a series of YFP derivatives to remove pH interference, increase photostability and enhance chloride sensitivity. The final product, EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP), has a chloride Kd of 14 mM and pKa of 5.9. The bleach time constant of 175 seconds is over 15-fold greater than wild-type EYFP. We have used the sensor fused to the transmembrane protein prestin (gerbil prestin, SLC26a5), and shown for the first time physiological (mM) chloride flux in HEK cells expressing this protein. This modified fluorescent protein will facilitate investigations of dynamics of chloride ions and their mediation of cell function. Modifications to YFP (EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP) results in a photostable fluorescent protein that allows measurement of physiological changes in chloride concentration while remaining minimally affected by changes in pH.
Directory of Open Access Journals (Sweden)
Sheng Zhong
Full Text Available Chloride is the major anion in cells, with many diseases arising from disordered Cl- regulation. For the non-invasive investigation of Cl- flux, YFP-H148Q and its derivatives chameleon and Cl-Sensor previously were introduced as genetically encoded chloride indicators. Neither the Cl- sensitivity nor the pH-susceptibility of these modifications to YFP is optimal for precise measurements of Cl- under physiological conditions. Furthermore, the relatively poor photostability of YFP derivatives hinders their application for dynamic and quantitative Cl- measurements. Dynamic and accurate measurement of physiological concentrations of chloride would significantly affect our ability to study effects of chloride on cellular events.In this study, we developed a series of YFP derivatives to remove pH interference, increase photostability and enhance chloride sensitivity. The final product, EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP, has a chloride Kd of 14 mM and pKa of 5.9. The bleach time constant of 175 seconds is over 15-fold greater than wild-type EYFP. We have used the sensor fused to the transmembrane protein prestin (gerbil prestin, SLC26a5, and shown for the first time physiological (mM chloride flux in HEK cells expressing this protein. This modified fluorescent protein will facilitate investigations of dynamics of chloride ions and their mediation of cell function.Modifications to YFP (EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP results in a photostable fluorescent protein that allows measurement of physiological changes in chloride concentration while remaining minimally affected by changes in pH.
Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka
2014-01-01
Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Directory of Open Access Journals (Sweden)
Zhao Jiandong
2012-05-01
Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.
Mutations in SLC20A2 are a major cause of familial idiopathic basal ganglia calcification
Hsu, Sandy Chan; Sears, Renee L.; Lemos, Roberta R.; Quintáns, Beatriz; Huang, Alden; Spiteri, Elizabeth; Nevarez, Lisette; Mamah, Catherine; Zatz, Mayana; Pierce, Kerrie D.; Fullerton, Janice M.; Adair, John C.; Berner, Jon E.; Bower, Matthew; Brodaty, Henry; Carmona, Olga; Dobricić, Valerija; Fogel, Brent L.; García-Estevez, Daniel; Goldman, Jill; Goudreau, John L.; Hopfer, Suellen; Janković, Milena; Jaumà, Serge; Jen, Joanna C.; Kirdlarp, Suppachok; Klepper, Joerg; Kostić, Vladimir; Lang, Anthony E.; Linglart, Agnès; Maisenbacher, Melissa K.; Manyam, Bala V.; Mazzoni, Pietro; Miedzybrodzka, Zofia; Mitarnun, Witoon; Mitchell, Philip B.; Mueller, Jennifer; Novaković, Ivana; Paucar, Martin; Paulson, Henry; Simpson, Sheila A.; Svenningsson, Per; Tuite, Paul; Vitek, Jerrold; Wetchaphanphesat, Suppachok; Williams, Charles; Yang, Michele; Schofield, Peter R.; de Oliveira, João R. M.; Sobrido, María-Jesús
2014-01-01
Familial idiopathic basal ganglia calcification (IBGC) or Fahr’s disease is a rare neurodegenerative disorder characterized by calcium deposits in the basal ganglia and other brain regions, which is associated with neuropsychiatric and motor symptoms. Familial IBGC is genetically heterogeneous and typically transmitted in an autosomal dominant fashion. We performed a mutational analysis of SLC20A2, the first gene found to cause IBGC, to assess its genetic contribution to familial IBGC. We recruited 218 subjects from 29 IBGC-affected families of varied ancestry and collected medical history, neurological exam, and head CT scans to characterize each patient’s disease status. We screened our patient cohort for mutations in SLC20A2. Twelve novel (nonsense, deletions, missense, and splice site) potentially pathogenic variants, one synonymous variant, and one previously reported mutation were identified in 13 families. Variants predicted to be deleterious cosegregated with disease in five families. Three families showed nonsegregation with clinical disease of such variants, but retrospective review of clinical and neuroimaging data strongly suggested previous misclassification. Overall, mutations in SLC20A2 account for as many as 41 % of our familial IBGC cases. Our screen in a large series expands the catalog of SLC20A2 mutations identified to date and demonstrates that mutations in SLC20A2 are a major cause of familial IBGC. Non-perfect segregation patterns of predicted deleterious variants highlight the challenges of phenotypic assessment in this condition with highly variable clinical presentation. PMID:23334463
Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu
2011-09-30
Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and
Directory of Open Access Journals (Sweden)
Yan Xiaofei
2011-09-01
Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was
Gonçalves, A C; Santos, R; O'Neill, A; Escada, P; Fialho, G; Caria, H
2016-06-01
Pendred syndrome (PS) is the second most common type of autosomal recessive syndromic hearing loss (HL). It is characterised by sensorineural HL and goiter with occasional hypothyroidism. These features are generally accompanied by malformations of the inner ear, as enlarged vestibular aqueduct (EVA). In about 50% of probands, mutations in the SLC26A4 gene are the cause of the disease. Here we report the case of a Portuguese female, aged 47, presenting with severe to profound HL and hypothyroidism. Her mother and sister, both deceased, had suffered from HL and goiter. By MRI and CT, an enlarged vestibular aqueduct and endolymphatic sac were observed. Molecular study of the patient included screening for GJB2 coding mutations and GJB6 common deletions followed by screening of all SLC26A4 exons, as well as intronic regions 8 and 14. Mutation c.918+2T>C was found for the first time in homozygosity in the intronic region 7 of the SLC26A4 gene. Whilst sequencing the control samples, a novel mutation c.821C>G was found in heterozygosity in the exon 7 of SLC26A4 gene and was predicted to be damaging. This study thus led to the finding of two novel SLC26A4 genotypes and provides new insight on the phenotypic features associated with PS. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.
Fowler, Veronica L; Ransburgh, Russell H; Poulsen, Elizabeth G; Wadsworth, Jemma; King, Donald P; Mioulet, Valerie; Knowles, Nick J; Williamson, Susanna; Liu, Xuming; Anderson, Gary A; Fang, Ying; Bai, Jianfa
2017-01-01
Seneca Valley virus 1 (SVV-1) can cause vesicular disease that is clinically indistinguishable from foot-and-mouth disease, vesicular stomatitis and swine vesicular disease. SVV-1-associated disease has been identified in pigs in several countries, namely USA, Canada, Brazil and China. Diagnostic tests are required to reliably detect this emerging virus, and this report describes the development and evaluation of a novel real-time (r) reverse-transcription (RT) PCR assay (rRT-PCR), targeting the viral polymerase gene (3D) of SVV-1. This new assay detected all historical and contemporary SVV-1 isolates examined (n=8), while no cross-reactivity was observed with nucleic acid templates prepared from other vesicular disease viruses or common swine pathogens. The analytical sensitivity of the rRT-PCR was 0.79 TCID 50 /ml and the limit of detection was equivalent using two different rRT-PCR master-mixes. The performance of the test was further evaluated using pig nasal (n=25) and rectal swab samples (n=25), where concordant results compared to virus sequencing were generated for 43/50 samples. The availability of this assay, will enable laboratories to rapidly detect SVV-1 in cases of vesicular disease in pigs, negated for notifiable diseases, and could enable existing knowledge gaps to be investigated surrounding the natural epidemiology of SVV-1. Copyright © 2016 Elsevier B.V. All rights reserved.
Decreased miR-106a inhibits glioma cell glucose uptake and proliferation by targeting SLC2A3 in GBM.
Dai, Dong-Wei; Lu, Qiong; Wang, Lai-Xing; Zhao, Wen-Yuan; Cao, Yi-Qun; Li, Ya-Nan; Han, Guo-Sheng; Liu, Jian-Min; Yue, Zhi-Jian
2013-10-14
MiR-106a is frequently down-regulated in various types of human cancer. However the underlying mechanism of miR-106a involved in glioma remains elusive. The association of miR-106a with glioma grade and patient survival was analyzed. The biological function and target of miR-106a were determined by bioinformatic analysis and cell experiments (Western blot, luciferase reporter, cell cycle, ntracellular ATP production and glucose uptake assay). Finally, rescue expression of its target SLC2A3 was used to test the role of SLC2A3 in miR-106a-mediated cell glycolysis and proliferation. Here we showed that miR-106a was a tumor suppressor miRNA was involved in GBM cell glucose uptake and proliferation. Decreased miR-106a in GBM tissues and conferred a poor survival of GBM patients. SLC2A3 was identified as a core target of miR-106a in GBM cells. Inhibition of SLC2A3 by miR-106a attenuated cell proliferation and inhibited glucose uptake. In addition, for each biological process we identified ontology-associated transcripts that significantly correlated with SLC2A3 expression. Finally, the expression of SLC2A3 largely abrogated miR-106a-mediated cell proliferation and glucose uptake in GBM cells. Taken together, miR-106a and SLC2A3 could be potential therapeutic approaches for GBM.
Lessons from the SLC for future LC control systems
International Nuclear Information System (INIS)
Humphrey, R.
1992-01-01
The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)
Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A
2018-02-09
Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Chen, Pei; Tang, Qin; Wang, Chunfang
2016-02-01
A sodium-dependent phosphate cotransporter gene, NaPi-IIb (slc34a2), was isolated from yellow catfish (Pelteobagrus fulvidraco) intestine through homology cloning and the rapid amplification of cDNA ends. The full-length cDNA of slc34a2 consisted of 2326 bp with an open reading frame encoding 621 amino acids, a 160-bp 5' untranslated region, and a 300-bp 3' untranslated region. The deduced amino acid sequence showed 79.0 and 70.9% sequence identity to Astyanax mexicanus and Pundamilia nyererei, respectively. The membrane-spanning domains based on the hydrophilic and hydrophobic properties of the deduced amino acids were predicted, and results showed that the putative protein had eight transmembrane domains, with the intracellular NH2 and COOH termini. Two functional regions including first intracellular loop and third extracellular loop as well as the six N-glycosylation sites in second extracellular loop were found. The slc34a2 mRNA in the tested tissues was examined through semiquantitative reverse transcription polymerase chain reaction and quantitative real-time PCR, with the highest level found in the anterior intestine, followed by the posterior and middle intestines. The slc34a2 mRNA expression in the whole intestine under different dietary phosphorus (P) treatments was detected using qPCR. The results showed that the slc34a2 expression levels in the low-P groups (0.33 and 0.56%) were significantly higher (p < 0.05) than levels in the sufficient-P (0.81%) and high-P (1.15, 1.31, and 1.57%) groups. High expression of slc34a2 mRNA in low-P groups stimulated P utilization efficiency, indicating the close relationship between genotype and phenotype in yellow catfish. In contrast with conventional strategies (formula and feeding strategies), this study provided another possible approach by using molecular techniques to increase the P utilization in yellow catfish.
Directory of Open Access Journals (Sweden)
Onkar Singh
Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.
SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland
Directory of Open Access Journals (Sweden)
Hassen Hadj-Kacem
2010-01-01
Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.
International Nuclear Information System (INIS)
Keller, L.P.
1982-01-01
Work on a one interaction-region, push-pull conceptual design for the SLC is described. The concept which has received the most attention is described. It is a below-ground hall - a 15 m deep rectangular pit covered by a surface building which houses counting rooms, power supplies, cryogenics and other auxiliary equipment
Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G
2015-01-01
Background: Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. Objective: The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. Design: We conducted a genomewide association study with 1.1 million genetic markers in 815 children. Results: We found serum uric acid to be significantly heritable [h2 ± SD = 0.45 ± 0.08, P = 5.8 × 10−11] and associated with SLC2A9 variants (P values between 10−16 and 10−7). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Conclusions: Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. PMID:25833971
Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia
2018-01-01
The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412
SLC energy spectrum monitor using synchrotron radiation
International Nuclear Information System (INIS)
Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.
1986-01-01
The SLAC linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. The energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08 %. The design considerations of this monitor are presented. A pair of these monitors is under construction with an installation data set for late summer 1986
SLC energy spectrum monitor using synchrotron radiation
International Nuclear Information System (INIS)
Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.
1986-04-01
The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs
Pancreatitis aguda grave asociada a gangrena vesicular
Arroyo-Sánchez, Abel S; Aguirre-Mejía, Rosa Y; Echenique-Martínez, Sergio E
2014-01-01
Se presenta el caso un paciente diabético que desarrolló un cuadro de pancreatitis aguda grave asociada a gangrena vesicular, en el que se evaluó la aplicabilidad de los criterios de clasificación y manejo de la hoja de ruta para pancreatitis aguda, así mismo se proponen algunos tópicos que pudieran ser investigados a futuro We present a diabetic patient who developed severe acute pancreatitis associated to gallbladder gangrene, in this case we assessed the applicability of classification ...
Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.
Directory of Open Access Journals (Sweden)
Deborah Cook
2008-09-01
Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.
Directory of Open Access Journals (Sweden)
Fabian R. Reimold
2015-06-01
Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.
Directory of Open Access Journals (Sweden)
Olha Hurba
Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Zhong, Sheng; Navaratnam, Dhasakumar; Santos-Sacchi, Joseph
2014-01-01
Background Chloride is the major anion in cells, with many diseases arising from disordered Cl− regulation. For the non-invasive investigation of Cl− flux, YFP-H148Q and its derivatives chameleon and Cl-Sensor previously were introduced as genetically encoded chloride indicators. Neither the Cl− sensitivity nor the pH-susceptibility of these modifications to YFP is optimal for precise measurements of Cl− under physiological conditions. Furthermore, the relatively poor photostability of YFP derivatives hinders their application for dynamic and quantitative Cl− measurements. Dynamic and accurate measurement of physiological concentrations of chloride would significantly affect our ability to study effects of chloride on cellular events. Methodology/Principal Findings In this study, we developed a series of YFP derivatives to remove pH interference, increase photostability and enhance chloride sensitivity. The final product, EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP), has a chloride Kd of 14 mM and pKa of 5.9. The bleach time constant of 175 seconds is over 15-fold greater than wild-type EYFP. We have used the sensor fused to the transmembrane protein prestin (gerbil prestin, SLC26a5), and shown for the first time physiological (mM) chloride flux in HEK cells expressing this protein. This modified fluorescent protein will facilitate investigations of dynamics of chloride ions and their mediation of cell function. Conclusions Modifications to YFP (EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP) results in a photostable fluorescent protein that allows measurement of physiological changes in chloride concentration while remaining minimally affected by changes in pH. PMID:24901231
17 CFR 8.13 - Answer to charges.
2010-04-01
... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Answer to charges. 8.13 Section 8.13 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION EXCHANGE PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.13 Answer to...
17 CFR 8.11 - Notice of charges.
2010-04-01
... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Notice of charges. 8.11 Section 8.11 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION EXCHANGE PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.11 Notice of...
Directory of Open Access Journals (Sweden)
Vinícius Leobet Lunkes
2016-08-01
Full Text Available ABSTRACT: Vesicular stomatitis virus (VSV is the agent of a vesicular disease that affects many animal species and may be clinically confounded with foot-and-mouth disease in ruminant and swine. Horses are especially susceptible to VSV and may serve as sentinels for virus circulation. The present study investigated the presence of neutralizing antibodies against VSV Indiana III (VSIV-3 in serum samples of 3,626 horses from six states in three Brazilian regions: Southern (RS, n = 1,011, Midwest (GO/DF, n = 1,767 and Northeast (PB, PE, RN and CE, n = 848 collected between 2013 and 2014. Neutralizing antibodies against VSIV-3 (titers ≥40 were detected in 641 samples (positivity of 17.7%; CI95%:16.5-19.0%, being 317 samples from CE (87.3%; CI95%: 83.4-90.5 %; 109 from RN (65.7%; CI95%: 57.8 -72.7%; 124 from PB (45.4%; CI95%: 39.4-51.5%; 78 from GO/DF (4.4%; CI95%: 3.5-5.5% and nine samples of RS (0.9%; CI95%: 0.4-1.7%. Several samples from the Northeast and Midwest harbored high neutralizing titers, indicating a recent exposure to the virus. In contrast, samples from RS had low titers, possibly due to a past remote exposure. Several positive samples presented neutralizing activity against other VSV serotypes (Indiana I and New Jersey, yet in lower titers, indicating the specificity of the response to VSIV-3. These results demonstrated a relatively recent circulation of VSIV-3 in northeastern Brazilian States, confirming clinical findings and demonstrating the sanitary importance of this infection.
Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R
2017-06-07
The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.
Directory of Open Access Journals (Sweden)
J. Noelia Dufay
2017-06-01
Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.
Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger
2012-11-01
Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.
Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M
2017-10-19
The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Eduardo Tarazona-Santos
Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.
17 CFR 210.8-07 - Limited partnerships.
2010-04-01
..., PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF... Reporting Companies § 210.8-07 Limited partnerships. (a) Smaller reporting companies that are limited... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Limited partnerships. 210.8-07...
The pulsed amplitude unit for the SLC
International Nuclear Information System (INIS)
Rolfe, J.; Browne, M.J.; Jobe, R.K.
1987-02-01
There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital Converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU is a part of the system that controls the output of Klystrons in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed
The calculated longitudinal impedance of the SLC [Stanford Linear Collider] damping rings
International Nuclear Information System (INIS)
Bane, K.L.F.
1988-05-01
A high level of current dependent bunch lengthening has been observed in the north damping ring of the Stanford Linear Collider (SLC), indicating that the ring's impedance is very inductive. This level of bunch lengthening will limit the performance of the SLC. In order to study the problem of bunch lengthening in the damping ring and the possibility of reducing their inductance we compute, in this report, the longitudinal impedance of the damping ring vacuum chamber. More specifically we find the response function of the ring to a short gaussian bunch. This function will later be used as a driving term in the longitudinal equation of motion. We also identify the important inductive elements of the vacuum chamber and estimate their contribution to the total ring inductance. This information will be useful in assessing the effect of vacuum chamber modifications. 7 refs. , 8 figs., 1 tab
The pulsed amplitude unit for the SLC
International Nuclear Information System (INIS)
Rolfe, J.; Browne, M.J.; Jobe, R.K.
1987-01-01
There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU at is as part of the system that controls the output of Klystorns in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed
Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao
2014-11-01
Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.
Vesicular storage and release of acetylcholine in Torpedo electroplaque synapses
Energy Technology Data Exchange (ETDEWEB)
Suszkiw, J B; Zimmermann, H; Whittaker, V P [Max-Planck-Institut fuer Biophysikalische Chemie (Karl-Friedrich-Bonhoefer-Inst.), Goettingen (Germany, F.R.)
1978-06-01
The disposition of newly synthesized ACh subsequent to depletion of vesicular endogenous ACh by stimulation was studied in the electromotor nerve terminals of Torpedo marmorata using (/sup 3/H) acetate as a precursor of ACh. Little vesicular (/sup 3/H) ACh could be isolated from tissue immediately after stimulation at 1 Hz. After 3 h post-stimulation recovery the newly-synthesized (/sup 3/H) ACh is found predominantly in a subpopulation of vesicles distinct from the vesicles containing most of the endogenous poorly labelled ACh. Restimulation of the tissue causes release of highly labelled ACh with a specific radioactivity (SRA) comparable to that of the newly synthesized (/sup 3/H) ACh in the highly labelled subpopulation of vesicles and significantly greater than the SRA of ACh in the main vesicular pool of the total tissue.
DEFF Research Database (Denmark)
Jensen, Kristian K; Manfra, Denise J; Grisotto, Marcos G
2005-01-01
Kaposi's sarcoma (KS)-associated herpesvirus or human herpes virus 8 is considered the etiological agent of KS, a highly vascularized neoplasm that is the most common tumor affecting HIV/AIDS patients. The KS-associated herpesvirus/human herpes virus 8 open reading frame 74 encodes a constitutively...
The SLC control system - status and development
International Nuclear Information System (INIS)
Phinney, N.; Shoaee, H.
1987-03-01
The SLC control system is installed and operational in the full SLC through the Linac, Damping Rings, Positron Source, Arcs and Final Focus. The system now includes a host VAX 11/785, a development VAX 11/780, 4 VAX workstations, a distributed network of 70 microprocessors, and about 270 Camac crates with more than 4000 modules. The micros are used for control and monitoring of the hardware, for pulse-to-pulse feedback, and for consoles (COWs). High level model-driven host software provides a variety of tools for beam setup, optimization, diagnosis, and stabilization. This paper will summarize the current status and projects under development
Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong
2016-10-01
The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese
17 CFR 270.8b-2 - Definitions.
2010-04-01
... such document is filed with such exchange. (j) Share. The term “share” means a share of stock in a... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Definitions. 270.8b-2 Section 270.8b-2 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES AND...
Generalized fast feedback system in the SLC
International Nuclear Information System (INIS)
Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.
1991-11-01
A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine
Association of SLC11A1 gene polymorphism with caprine ...
Indian Academy of Sciences (India)
Navya
2017-01-16
Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...
MC148 encoded by human molluscum contagiosum poxvirus is an antagonist for human but not murine CCR8
DEFF Research Database (Denmark)
Lüttichau, H R; Gerstoft, J; Schwartz, T W
2001-01-01
The viral CC chemokines MC148, encoded by the poxvirus molluscum contagiosum, and viral macrophage inflammatory protein (vMIP)-I and vMIP-II, encoded by human herpesvirus 8, were probed on the murine CC receptor (CCR) 8 in parallel with human CCR8. In calcium mobilization assays, vMIP-I acted...... as a high-affinity agonist, whereas vMIP-II acted as a low-affinity antagonist on the murine CCR8 as well as the human CCR8. MC148 was found to bind and block responses through the human CCR8 with high affinity, but surprisingly MC148 was unable to bind and block responses through the murine CCR8. Because...
Structural modifications of vesicular aggregates following gamma-irradiation
International Nuclear Information System (INIS)
Mantaka-Marketou, A.E.; Domasou, A.S.
1991-01-01
The structural changes of the didodecyldimethylammonium bromide (DDAB) vesicular bilayers after γ-irradiation and under conditions where mainly OH radicals are present are reported. Alterations of the vesicular structure, such as polarity and fluidity, were detected after a dose of 0.65 kGy. A higher dose of ∼14kGy cause important damage to the well organized molecular structure and this is manifested by an important augmentation of the fluidity and polarity of the Stern region of the aggregates. Increased water penetration into the bilayer of the vesicle is probably the reason for these changes and electron micrographs support this hypothesis. (author)
Vesicular trafficking of immune mediators in human eosinophils revealed by immunoelectron microscopy
Energy Technology Data Exchange (ETDEWEB)
Melo, Rossana C.N., E-mail: rossana.melo@ufjf.edu.br [Laboratory of Cellular Biology, Department of Biology, ICB, Federal University of Juiz de Fora, UFJF, Rua José Lourenço Kelmer, Juiz de Fora, MG 36036-900 (Brazil); Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, 330 Brookline Avenue, CLS 943, Boston, MA 02215 (United States); Weller, Peter F. [Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, 330 Brookline Avenue, CLS 943, Boston, MA 02215 (United States)
2016-10-01
Electron microscopy (EM)-based techniques are mostly responsible for our current view of cell morphology at the subcellular level and continue to play an essential role in biological research. In cells from the immune system, such as eosinophils, EM has helped to understand how cells package and release mediators involved in immune responses. Ultrastructural investigations of human eosinophils enabled visualization of secretory processes in detail and identification of a robust, vesicular trafficking essential for the secretion of immune mediators via a non-classical secretory pathway associated with secretory (specific) granules. This vesicular system is mainly organized as large tubular-vesicular carriers (Eosinophil Sombrero Vesicles – EoSVs) actively formed in response to cell activation and provides a sophisticated structural mechanism for delivery of granule-stored mediators. In this review, we highlight the application of EM techniques to recognize pools of immune mediators at vesicular compartments and to understand the complex secretory pathway within human eosinophils involved in inflammatory and allergic responses. - Highlights: • Application of EM to understand the complex secretory pathway in human eosinophils. • EM techniques reveal an active vesicular system associated with secretory granules. • Tubular vesicles are involved in the transport of granule-derived immune mediators.
Vesicular trafficking of immune mediators in human eosinophils revealed by immunoelectron microscopy
International Nuclear Information System (INIS)
Melo, Rossana C.N.; Weller, Peter F.
2016-01-01
Electron microscopy (EM)-based techniques are mostly responsible for our current view of cell morphology at the subcellular level and continue to play an essential role in biological research. In cells from the immune system, such as eosinophils, EM has helped to understand how cells package and release mediators involved in immune responses. Ultrastructural investigations of human eosinophils enabled visualization of secretory processes in detail and identification of a robust, vesicular trafficking essential for the secretion of immune mediators via a non-classical secretory pathway associated with secretory (specific) granules. This vesicular system is mainly organized as large tubular-vesicular carriers (Eosinophil Sombrero Vesicles – EoSVs) actively formed in response to cell activation and provides a sophisticated structural mechanism for delivery of granule-stored mediators. In this review, we highlight the application of EM techniques to recognize pools of immune mediators at vesicular compartments and to understand the complex secretory pathway within human eosinophils involved in inflammatory and allergic responses. - Highlights: • Application of EM to understand the complex secretory pathway in human eosinophils. • EM techniques reveal an active vesicular system associated with secretory granules. • Tubular vesicles are involved in the transport of granule-derived immune mediators.
Vesicular stomatitis forecasting based on Google Trends.
Wang, JianYing; Zhang, Tong; Lu, Yi; Zhou, GuangYa; Chen, Qin; Niu, Bing
2018-01-01
Vesicular stomatitis (VS) is an important viral disease of livestock. The main feature of VS is irregular blisters that occur on the lips, tongue, oral mucosa, hoof crown and nipple. Humans can also be infected with vesicular stomatitis and develop meningitis. This study analyses 2014 American VS outbreaks in order to accurately predict vesicular stomatitis outbreak trends. American VS outbreaks data were collected from OIE. The data for VS keywords were obtained by inputting 24 disease-related keywords into Google Trends. After calculating the Pearson and Spearman correlation coefficients, it was found that there was a relationship between outbreaks and keywords derived from Google Trends. Finally, the predicted model was constructed based on qualitative classification and quantitative regression. For the regression model, the Pearson correlation coefficients between the predicted outbreaks and actual outbreaks are 0.953 and 0.948, respectively. For the qualitative classification model, we constructed five classification predictive models and chose the best classification predictive model as the result. The results showed, SN (sensitivity), SP (specificity) and ACC (prediction accuracy) values of the best classification predictive model are 78.52%,72.5% and 77.14%, respectively. This study applied Google search data to construct a qualitative classification model and a quantitative regression model. The results show that the method is effective and that these two models obtain more accurate forecast.
Vesicular stomatitis forecasting based on Google Trends
Lu, Yi; Zhou, GuangYa; Chen, Qin
2018-01-01
Background Vesicular stomatitis (VS) is an important viral disease of livestock. The main feature of VS is irregular blisters that occur on the lips, tongue, oral mucosa, hoof crown and nipple. Humans can also be infected with vesicular stomatitis and develop meningitis. This study analyses 2014 American VS outbreaks in order to accurately predict vesicular stomatitis outbreak trends. Methods American VS outbreaks data were collected from OIE. The data for VS keywords were obtained by inputting 24 disease-related keywords into Google Trends. After calculating the Pearson and Spearman correlation coefficients, it was found that there was a relationship between outbreaks and keywords derived from Google Trends. Finally, the predicted model was constructed based on qualitative classification and quantitative regression. Results For the regression model, the Pearson correlation coefficients between the predicted outbreaks and actual outbreaks are 0.953 and 0.948, respectively. For the qualitative classification model, we constructed five classification predictive models and chose the best classification predictive model as the result. The results showed, SN (sensitivity), SP (specificity) and ACC (prediction accuracy) values of the best classification predictive model are 78.52%,72.5% and 77.14%, respectively. Conclusion This study applied Google search data to construct a qualitative classification model and a quantitative regression model. The results show that the method is effective and that these two models obtain more accurate forecast. PMID:29385198
Vesicular stomatitis forecasting based on Google Trends.
Directory of Open Access Journals (Sweden)
JianYing Wang
Full Text Available Vesicular stomatitis (VS is an important viral disease of livestock. The main feature of VS is irregular blisters that occur on the lips, tongue, oral mucosa, hoof crown and nipple. Humans can also be infected with vesicular stomatitis and develop meningitis. This study analyses 2014 American VS outbreaks in order to accurately predict vesicular stomatitis outbreak trends.American VS outbreaks data were collected from OIE. The data for VS keywords were obtained by inputting 24 disease-related keywords into Google Trends. After calculating the Pearson and Spearman correlation coefficients, it was found that there was a relationship between outbreaks and keywords derived from Google Trends. Finally, the predicted model was constructed based on qualitative classification and quantitative regression.For the regression model, the Pearson correlation coefficients between the predicted outbreaks and actual outbreaks are 0.953 and 0.948, respectively. For the qualitative classification model, we constructed five classification predictive models and chose the best classification predictive model as the result. The results showed, SN (sensitivity, SP (specificity and ACC (prediction accuracy values of the best classification predictive model are 78.52%,72.5% and 77.14%, respectively.This study applied Google search data to construct a qualitative classification model and a quantitative regression model. The results show that the method is effective and that these two models obtain more accurate forecast.
17 CFR 141.8 - Procedures for salary offset.
2010-04-01
... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Procedures for salary offset. 141.8 Section 141.8 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION SALARY OFFSET § 141.8 Procedures for salary offset. (a) Deductions to liquidate an employee's debt will be by...
International Nuclear Information System (INIS)
Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi
2009-01-01
Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.
Dispersive effects of transverse displacements of SLC Arc magnets
International Nuclear Information System (INIS)
Murray, J.J.; Fieguth, T.; Kheifets, S.
1986-01-01
The SLC Arc magnets are subject to random displacements and field errors resulting in unpredictable transverse displacement of the central trajectory from that of the design. The chosen method of correcting this perturbed trajectory in the SLC Arcs utilizes mechanical movement of the combined function magnets which compose the Arc transport lines. Here we present the results of a recent investigation substantiating the earlier results which led to the adoption of this method
Directory of Open Access Journals (Sweden)
Nabanita Chatterjee
2011-01-01
Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.
17 CFR 8.05 - Enforcement staff.
2010-04-01
... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Enforcement staff. 8.05... staff. (a) Each exchange shall establish an adequate enforcement staff which shall be authorized by the... staff shall consist of employees of the exchange and/or persons hired on a contract basis. It may not...
Precise system stabilization at SLC using dither techniques
International Nuclear Information System (INIS)
Ross, M.C.; Hendrickson, L.; Himel, T.; Miller, E.
1993-01-01
A data acquisition method has been developed at the SLAC Linear Collider (SLC) that provides accurate beam parameter information using sub-tolerance excitation and synchronized detection. This is being applied to several SLC sub-systems to provide high speed feedback on beam parameters such as linac output energy spread. The method has significantly improved control of the linac energy spread. The linac average phase offset (θ), used to compensate the effects of longitudinal wakefields, is adjusted ±l control bit (about 0.18 degree S-band or 20% of tolerance), in a continuous fashion. Properly coordinated beam energy measurements provide a measure of the derivative of the accelerating voltage (dE/dθ). The position of the beam on the RF wave can thus be determined to ± 0.3 degree in about 5 seconds. The dithering does not contribute significantly to the energy jitter of the SLC and therefore does not adversely affect routine operation. Future applications include control of the interaction region beam size and orientation
Generalized fast feedback system in the SLC
International Nuclear Information System (INIS)
Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.
1992-01-01
A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine. (author)
A status report on the SLC program
International Nuclear Information System (INIS)
Prescott, C.Y.
1985-09-01
The SLC program is an accelerator experiment and a physics experiment. The progress in the accelerator experiment has been rapid, with injector and damping ring components working, conventional construction on schedule, and technical components in production. Accelerator studies will investigate beam-linac and beam-beam interactions, with application to the design of future linear colliders. The physics experiments start in 1987 to study Z 0 properties and to look for new physics effects. Detectors to fully exploit the potential physics are under construction
Nakata, T; Matsui, T; Kobayashi, K; Kobayashi, Y; Anzai, N
2013-11-12
Organic cation transporters (OCTs) are expressed mainly in the kidney and liver. OCTs transport intrinsic organic cations, including monoamine, dopamine, serotonine and choline, across the plasma membrane. Here, we demonstrate that OCT2 (SLC22A2) is expressed in cholinergic neurons, motoneurons in the anterior horn of the spinal cord, and is implicated in acetylcholine (Ach) recycling in presynaptic terminals. Application of rabbit anti-peptide antibody revealed that OCT2 was expressed in the anterior horn of the spinal cord. Double immunostaining of muscle sections with anti-OCT2 and alpha-bungarotoxin (BTX) revealed that OCT2 was localized in the neuromuscular junctions (NMJs). Immunoelectron microscopy revealed that OCT2 was localized both in synaptic vesicles (SVs) in presynaptic terminals around the motoneurons (C-terminals) and in SVs in nerve terminals in NMJs. The similarity in the distribution of OCT2 in cholinergic neurons and that of vesicular acetyl choline transporter (VAchT), and the fact that OCT2 can transport choline suggest that OCT2 could work as a low-affinity and high-capacity choline transporter at presynaptic terminals in cholinergic neurons in a firing-dependent manner. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.
Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae
2014-04-01
Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.
Wright, S F; Morton, J B; Sworobuk, J E
1987-09-01
Spore morphology is currently used to identify species of vesicular-arbuscular mycorrhizal fungi. We report the first use of a highly specific immunological method for identification of a vesicular-arbuscular mycorrhizal fungus. Two monoclonal antibodies were produced against Glomus occultum. Monoclonal antibodies reacted strongly with both spores and hyphae in an indirect enzyme-linked immunosorbent assay. All other mycorrhizal (29 species) and nonmycorrhizal (5 species) fungi tested were nonreactive with the monoclonal antibodies. A single spore of G. occultum was detectable in the presence of high numbers of spores of other vesicular-arbuscular mycorrhizal fungi. Variation in the reaction of G. occultum isolates from West Virginia, Florida, and Colombia suggests that monoclonal antibodies may differentiate strains.
Model of reversible vesicular transport with exclusion
International Nuclear Information System (INIS)
Bressloff, Paul C; Karamched, Bhargav R
2016-01-01
A major question in neurobiology concerns the mechanics behind the motor-driven transport and delivery of vesicles to synaptic targets along the axon of a neuron. Experimental evidence suggests that the distribution of vesicles along the axon is relatively uniform and that vesicular delivery to synapses is reversible. A recent modeling study has made explicit the crucial role that reversibility in vesicular delivery to synapses plays in achieving uniformity in vesicle distribution, so called synaptic democracy (Bressloff et al 2015 Phys. Rev. Lett. 114 168101). In this paper we generalize the previous model by accounting for exclusion effects (hard-core repulsion) that may occur between molecular motor-cargo complexes (particles) moving along the same microtubule track. The resulting model takes the form of an exclusion process with four internal states, which distinguish between motile and stationary particles, and whether or not a particle is carrying vesicles. By applying a mean field approximation and an adiabatic approximation we reduce the system of ODEs describing the evolution of occupation numbers of the sites on a 1D lattice to a system of hydrodynamic equations in the continuum limit. We find that reversibility in vesicular delivery allows for synaptic democracy even in the presence of exclusion effects, although exclusion does exacerbate nonuniform distributions of vesicles in an axon when compared with a model without exclusion. We also uncover the relationship between our model and other models of exclusion processes with internal states. (paper)
Energy Technology Data Exchange (ETDEWEB)
Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2009-11-20
Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.
Vesicular thick-walled swollen hyphae in pulmonary zygomycosis.
Kimura, Masatomo; Ito, Hiroyuki
2009-03-01
An autopsy case of pulmonary zygomycosis in a patient with rheumatoid arthritis on immunosuppressive therapy is presented herein. There was a pulmonary cavitated infarct caused by mycotic thrombosis. Thin-walled narrow hyphae and vesicular thick-walled swollen hyphae were found on the pleural surface and in the necrotic tissue at the periphery of the cavity. Findings of such shaped fungal elements may cause erroneous histopathological diagnosis because pauciseptate broad thin-walled hyphae are usually the only detectable fungal elements in zygomycosis tissue. Although immunohistochemistry confirmed these unusual elements to be zygomycetous in the present case, it is important for the differential diagnosis to be aware that zygomycetes can form thin narrow hyphae and vesicular thick-walled swollen hyphae.
Bunch length measurements in the SLC damping ring
International Nuclear Information System (INIS)
Decker, F.J.; Limberg, T.; Minty, M.; Ross, M.
1993-05-01
The synchrotron light of the SLC damping ring was used to measure the bunch length with a streak camera at different times in the damping cycle. There are bunch length oscillations after injection, different equilibrium length during the cycle due to rf manipulations to avoid microwave instability oscillations, and just before extraction there is a longitudinal phase space rotation (bunch muncher) to shorten the bunch length. Measurements under these different conditions are presented and compared with BPM pulse height signals. Calibration and adjustment issues and the connection of the streak camera to the SLC control system are also discussed
Beam-based alignment technique for the SLC [Stanford Linear Collider] linac
International Nuclear Information System (INIS)
Adolphsen, C.E.; Lavine, T.L.; Atwood, W.B.
1989-03-01
Misalignment of quadrupole magnets and beam position monitors (BPMs) in the linac of the SLAC Linear Collider (SLC) cause the electron and positron beams to be steered off-center in the disk-loaded waveguide accelerator structures. Off-center beams produce wakefields which limit the SLC performance at high beam intensities by causing emittance growth. Here, we present a general method for simultaneously determining quadrupole magnet and BPM offsets using beam trajectory measurements. Results from the application of the method to the SLC linac are described. The alignment precision achieved is approximately 100 μm, which is significantly better than that obtained using optical surveying techniques. 2 refs., 4 figs
Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus
2008-01-01
Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801
Distribution and expression of SLC45A2 in the skin of sheep with different coat colors.
Wang, Haidong; Xue, Linli; Li, Yanan; Zhao, Bingling; Chen, Tianzhi; Liu, Ying; Chang, Lucheng; Wang, Juan
2016-01-01
To investigate whether the membrane-associated transporter protein SLC45A2 is differentially expressed in the skin of sheep with different coat colors and to determine its correlation with coat color establishment in sheep. The expression of SLC45A2 in sheep skin samples with different coat colors was qualitatively and quantitatively analyzed by PCR amplification, RT-PCR, immunohistochemical staining and Western blotting. A 193-bp SLC45A2 CDS sequence was successfully amplified from sheep skin samples with diverse coat colors. RT-PCR analysis revealed that SLC45A2 mRNA was expressed in all sheep skin samples tested, with relative expression levels of 512.74 ± 121.51 in black skin, 143.38 ± 119.31 and 1.36 ± 0.09 in black dots and white dots of piebald skin, respectively, and 1.02 ± 0.23 in white skin (p coat colors. These patterns were quantified by optical density (OD) analysis, which yielded relative expression levels of 0.23 ± 0.11 in black skin, 0.19 ± 0.09 and 0.10 ± 0.03 in black dots and white dots of piebald skin, respectively, and 0.08 ± 0.01 in white skin (p coat colors, though at significantly different levels. SLC45A2 may participate in the establishment of coat color by regulating the synthesis and trafficking of melanin.
Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K
2016-10-01
Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue
First case report of vesicular stomatitis in the State of Paraíba, Brazil
Directory of Open Access Journals (Sweden)
Inácio José Clementino
2014-10-01
Full Text Available The present report describes the first case of vesicular stomatitis in the State of Paraíba, Brazil. Records from the Official Veterinary Services of the State of Paraíba were analyzed while responding to a suspected case of vesicular disease at a property (property I in the municipality of Pombal in which the cattle showed clinical signs and lesions of vesicular disease. Surveillance in the surrounding area revealed similar lesions in cattle at two other properties (II and III. Based on these events, the suspicion was considered well founded, and samples were collected for evaluation at the National Agricultural Laboratory of the State of Pará. The property was interdicted, and those located within a 3 km radius (perifocal from the focus were inspected. At property I, 42.86% (6/14 of the cattle showed vesicular disease lesions characterized by intense sialorrhea, ruptured oral vesicles, epithelial detachment of the tongue and muzzle, and vesicular lesions in the udder and interdigital space. Similar lesions were detected in cattle at properties II and III, affecting 80.95% (34/42 and 11.54% (3/26 of the animals, respectively. Tissue samples collected from the three properties were positive for the vesicular stomatitis virus (Indiana 3 subtype. The properties were monitored for 21 days after the last infected animal was cured, and afterwards, the three properties were released.
SLC status and SLAC future plans
International Nuclear Information System (INIS)
Richter, B.
1990-01-01
In this presentation, I shall discuss the linear collider program at the Stanford Linear Accelerator Center as it is now, and as we hope to see it evolve over the next few years. Of greatest interest to the high-energy accelerator physics community gathered here is the development of the linear collider concept, and so I shall concentrate most of this paper on a discussion of the present status and future evolution of the SLC. I will also briefly discuss the research and development program that we are carrying out aimed at the realization of the next generation of higher-energy linear colliders. SLAC has a major colliding-beam storage-ring program as well, including present rings and design studies on future high luminosity projects, but time constraints preclude a discussion of them. (author) 8 figs., 3 tabs
The SLC polarized electron source
International Nuclear Information System (INIS)
Clendenin, J.E.
1990-10-01
A polarized electron source consisting of a 3-electrode photocathode gun and a flashlamp-pumped dye laser has been designed and built for the SLC and is currently undergoing commissioning. The source is described, and the operating configuration is discussed. The present status of the source and future plans are briefly indicated. 7 refs., 4 figs
A Novel Missense Mutation in SLC5A5 Gene in a Sudanese Family with Congenital Hypothyroidism.
Watanabe, Yui; Ebrhim, Reham Shareef; Abdullah, Mohamed A; Weiss, Roy E
2018-05-15
Thyroid hormone synthesis requires the presence of iodide. The sodium iodide symporter (NIS) is a glycoprotein which mediates the active uptake of iodide from the blood stream into the thyroid grand. NIS defects due to SLC5A5 gene mutations are known to cause congenital hypothyroidism (CH). The proposita is a 28-year-old female whose origin is the North Sudan where neonatal screening for CH is not available. She presented with severe constipation and a goiter at the age of 40 days. Laboratory testing confirmed CH and she was started on levothyroxine (L-T4). Presumably due to the delayed treatment the patient developed mental retardation. Her younger sister presented with a goiter, tongue protrusion and umbilical hernia and the youngest brother was also diagnosed with CH based on the TSH >100 µIU/mL at the age of 22 days and 8 days, respectively. Two siblings were treated with L-T4 and had normal development. Their consanguineous parents had no history of thyroid disorders. We performed whole exome sequencing (WES) on the proposita. WES identified a novel homozygous missense mutation in the SLC5A5 gene: c.1042T>G, p.Tyr348Asp, which was subsequently confirmed by Sanger sequencing. All affected children were homozygous for the same mutation and their unaffected mother was heterozygous. The NIS protein is composed of 13 transmembrane segments (TMS), an extracellular amino-terminus and an intracellular carboxyl terminus. The mutation is located in the TMS IX which has the most β-OH group-containing amino acids (serine and threonine) which is implicated in Na+ binding and translocation. In conclusion, a novel homozygous missense mutation in the SLC5A5 gene was identified in the Sudanese family with CH. The mutation is located in the TMS IX of the NIS protein which is essential for NIS function. Low iodine intake in Sudan is considered to affect severity of hypothyroidism in the patients.
Current treatment of vesicular lithiasis
International Nuclear Information System (INIS)
Garcia Rodriguez, Oscar
2010-01-01
Surgical treatment of vesicular lithiasis has changed in past years. The addition of the new techniques in daily medical practice not always is immediate. Reasons relative to when to operate a patient presenting with gall bladder calculi are argued and documenting how this procedure is mainly reserved for symptomatic patients where pain is considered as a symptom par excellence. Also, it is exposed how this change has been faced. (author)
X-Linked Creatine Transporter Deficiency Presenting as a Mitochondrial Disorder
Hathaway, S.C.; Friez, M.; Limbo, K.; Parker, C.; Salomons, G.S.; Vockley, J.; Wood, T.; Abdul-Rahman, O.A.
2010-01-01
X-linked creatine transporter defect is caused by mutations in SLC6A8 at Xq28, which encodes the sodium-dependent creatine transporter. Reduction in creatine uptake results in elevated urine creatine and CSF creatine deficiency, which can be detected on magnetic resonance spectroscopy. We report a
Mammen, Cherry; Rupps, Rosemarie; Trnka, Peter; Boerkoel, Cornelius F
2012-02-01
We report a 5-year-old boy with thiazide-resistant Bartter syndrome. This is highly unusual since thiazide hypersensitivity is a common diagnostic finding in Bartter syndrome patients. Subsequent molecular testing identified compound heterozygosity for two novel mutations in KCNJ1, (c.556A > G and c.683G > A) which is associated with Bartter syndrome, and a paternally inherited polymorphism in SLC12A3 (c.791G > C). Mutations in SLC12A3 cause the thiazide-resistant tubulopathy Gitelman syndrome. Based on published studies of this polymorphism in SLC12A3 and the features of the proband's father, we postulate that this polymorphism modifies the phenotype of Bartter syndrome in the proband to thiazide resistance. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Beam determination of quadrupole misalignments and beam position monitor biases in the SLC linac
International Nuclear Information System (INIS)
Lavine, T.L.; Seeman, J.T.; Atwood, W.B.; Himel, T.M.; Petersen, A.; Adolphsen, C.E.
1988-09-01
Misalignments of magnetic quadrupoles and biases in beam position monitors (BPMs) in the Stanford Linear Collider (SLC) linac can lead to a situation in which the beam is off-center in the disk-loaded waveguide accelerator structure. The off-center beam produces wakefields which can limit SLC performance by causing unacceptably large emittance growth. We present a general method for determining quadrupole misalignments and BPM biases in the SLC linac by using beam trajectory measurements. The method utilizes both electron and positron beams on opposite rf cycles in the same linac lattice to determine simultaneously magnetic quadrupole misalignments and BPM biases. The two-beam trajectory data may be acquired without interrupting SLC colliding beam operations. 2 refs., 5 figs
DEFF Research Database (Denmark)
Rosenkilde, M M; Kledal, T N; Bräuner-Osborne, Hans
1999-01-01
A number of CXC chemokines competed with similar, nanomolar affinity against 125I-interleukin-8 (IL-8) binding to ORF-74, a constitutively active seven-transmembrane receptor encoded by human herpesvirus 8. However, in competition against 125I-labeled growth-related oncogene (GRO)-alpha, the ORF-74...
Measuring micron size beams in the SLC final focus
International Nuclear Information System (INIS)
McCormick, D.; Ross, M.; DeBarger, S.
1994-10-01
A pair of high resolution wire scanners have been built and installed in the SLC final focus. The final focus optics uses a set of de-magnifying telescopes, and an ideal location for a beam size monitor is at one of the magnified image points of the interaction point. The image point chosen for these scanners is in the middle of a large bend magnet. The design beam spots here are about 2 microns in the vertical and 20 microns in the horizontal plane. The scanners presented a number of design challenges. In this paper we discuss the mechanical design of the scanner, and fabrication techniques of its ceramic wire support card which holds many 4 and 7 um carbon wires. Accurate motion of the wire during a scan is critical. In this paper we describe tests of stepper motors, gear combinations, and radiation hardened encoders needed to produce the required motion with a step resolution of 80 nanometers. Also presented here are the results of scattered radiation detector placement studies carried out to optimize the signal from the 4 micron wires. Finally, we present measurements from the scanner
2011-02-04
... launch satellites into polar orbit: Delta II; Taurus; Atlas V; Delta IV; Falcon; and Minotaur. Also a... HTV-2A 22-Apr-10 SLC-8 VAFB. Atlas V NRO L-41 17-Sept-10 SLC-3E No. Minotaur IV 25-Sept-10 SLC-8 No... observed to be ``torn open.'' This was an unusually high number of pup mortalities, as previous counts...
Directory of Open Access Journals (Sweden)
Lindholm Carlström Eva
2012-05-01
Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.
Effect of vesicular arbuscular mycorrhizal fungus on the ...
African Journals Online (AJOL)
STORAGESEVER
2008-10-06
Oct 6, 2008 ... ... association between certain plants and microorganisms plays an important role in soil ..... an Agrostis capillaris population on a copper contaminated soil. Plant ... vesicular-arbuscular mycorrhizal fungi in Amazonian Peru.
Directory of Open Access Journals (Sweden)
Thomas Lundåsen
Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.
Ganaha, Akira; Kaname, Tadashi; Yanagi, Kumiko; Naritomi, Kenji; Tono, Tetsuya; Usami, Shin-ichi; Suzuki, Mikio
2013-05-24
Pendred syndrome (PS) and nonsyndromic hearing loss associated with enlarged vestibular aqueduct (EVA) are caused by SLC26A4 mutations. The Okinawa Islands are the southwestern-most islands of the Japanese archipelago. And ancestral differences have been reported between people from Okinawa Island and those from the main islands of Japan. To confirm the ethnic variation of the spectrum of SLC26A4 mutations, we investigated the frequencies of SLC26A4 mutations and clinical manifestations of patients with EVA or PS living in the Okinawa Islands. We examined 22 patients with EVA or PS from 21 unrelated families in Okinawa Islands. The patient's clinical history, findings of physical and otoscopic examinations, hearing test, and computed tomography (CT) scan of the temporal bones were recorded. To detect mutations, all 21 exons and the exon-intron junctions of SLC26A4 were sequenced for all subjects. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for SLC26A4 and calculations using the comparative CT (2(-ΔΔCT)) method were used to determine the pathogenicity associated with gene substitutions. SLC26A4 mutations were identified in 21 of the 22 patients. We found a compound heterozygous mutation for IVS15 + 5G > A/H723R in nine patients (41%), a homozygous substitution of IVS15 + 5G > A in six patients (27%), and homozygous mutation for H723R in five patients (23%). The most prevalent types of SLC26A4 alleles were IVS15 + 5G > A and H723R, which both accounted for 15/22 (68%) of the patients. There were no significant correlations between the types of SLC26A4 mutation and clinical manifestations. Based on qRT-PCR results, expression of SLC26A4 was not identified in patients with the homozygous substitution of IVS15 + 5G > A. The substitution of IVS15 + 5G > A in SLC26A4 was the most common mutation in uniquely found in patients with PS and EVA in Okinawa Islands. This suggested that the spectrum of SLC26A4 mutation differed
Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.
Mackenzie, Bryan; Erickson, Jeffrey D
2004-02-01
The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.
International Nuclear Information System (INIS)
Swartz, M.L.
1988-07-01
The SLAC Linear Collider has been designed to readily accommodate polarized electron beams. Considerable effort has been made to implement a polarized source, a spin rotation system, and a system to monitor the beam polarization. Nearly all major components have been fabricated. At the current time, several source and polarimeter components have been installed. The installation and commissioning of the entire system will take place during available machine shutdown periods as the commissioning of SLC progresses. It is expected that a beam polarization of 45% will be achieved with no loss in luminosity. 13 refs., 15 figs
The emerging physiological roles of the SLC14A family of urea transporters
Stewart, Gavin
2011-01-01
In mammals, urea is the main nitrogenous breakdown product of protein catabolism and is produced in the liver. In certain tissues, the movement of urea across cell membranes is specifically mediated by a group of proteins known as the SLC14A family of facilitative urea transporters. These proteins are derived from two distinct genes, UT-A (SLC14A2) and UT-B (SLC14A1). Facilitative urea transporters play an important role in two major physiological processes – urinary concentration and urea nitrogen salvaging. Although UT-A and UT-B transporters both have a similar basic structure and mediate the transport of urea in a facilitative manner, there are a number of significant differences between them. UT-A transporters are mainly found in the kidney, are highly specific for urea, have relatively lower transport rates and are highly regulated at both gene expression and cellular localization levels. In contrast, UT-B transporters are more widespread in their tissue location, transport both urea and water, have a relatively high transport rate, are inhibited by mercurial compounds and currently appear to be less acutely regulated. This review details the fundamental research that has so far been performed to investigate the function and physiological significance of these two types of urea transporters. PMID:21449978
Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu
2011-01-01
Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged ...
LENUS (Irish Health Repository)
Murphy, Therese M
2012-02-01
BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.
Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao
2015-12-01
To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Kicker thyratron experience from SLC
International Nuclear Information System (INIS)
Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.
1991-05-01
The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs
Directory of Open Access Journals (Sweden)
Toshiyuki Fukada
Full Text Available BACKGROUND: Zinc (Zn is an essential trace element and it is abundant in connective tissues, however biological roles of Zn and its transporters in those tissues and cells remain unknown. METHODOLOGY/PRINCIPAL FINDINGS: Here we report that mice deficient in Zn transporter Slc39a13/Zip13 show changes in bone, teeth and connective tissue reminiscent of the clinical spectrum of human Ehlers-Danlos syndrome (EDS. The Slc39a13 knockout (Slc39a13-KO mice show defects in the maturation of osteoblasts, chondrocytes, odontoblasts, and fibroblasts. In the corresponding tissues and cells, impairment in bone morphogenic protein (BMP and TGF-beta signaling were observed. Homozygosity for a SLC39A13 loss of function mutation was detected in sibs affected by a unique variant of EDS that recapitulates the phenotype observed in Slc39a13-KO mice. CONCLUSIONS/SIGNIFICANCE: Hence, our results reveal a crucial role of SLC39A13/ZIP13 in connective tissue development at least in part due to its involvement in the BMP/TGF-beta signaling pathways. The Slc39a13-KO mouse represents a novel animal model linking zinc metabolism, BMP/TGF-beta signaling and connective tissue dysfunction.
SLC Final Performance and Lessons
International Nuclear Information System (INIS)
Phinney, Nan
2000-01-01
The Stanford Linear Collider (SLC) was the first prototype of a new type of accelerator, the electron-positron linear collider. Many years of dedicated effort were required to understand the physics of this new technology and to develop the techniques for maximizing performance. Key issues were emittance dilution, stability, final beam optimization and background control. Precision, non-invasive diagnostics were required to measure and monitor the beams throughout the machine. Beam-based feedback systems were needed to stabilize energy, trajectory, intensity and the final beam size at the interaction point. variety of new tuning techniques were developed to correct for residual optical or alignment errors. The final focus system underwent a series of refinements in order to deliver sub-micron size beams. It also took many iterations to understand the sources of backgrounds and develop the methods to control them. The benefit from this accumulated experience was seen in the performance of the SLC during its final run in 1997-98. The luminosity increased by a factor of three to 3*10 30 and the 350,000 Z data sample delivered was nearly double that from all previous runs combined
Directory of Open Access Journals (Sweden)
Mizuno T
2015-07-01
Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury
International Nuclear Information System (INIS)
Martin-Acebes, Miguel A.; Gonzalez-Magaldi, Monica; Rosas, Maria F.; Borrego, Belen; Brocchi, Emiliana; Armas-Portela, Rosario; Sobrino, Francisco
2008-01-01
The intracellular distribution of swine vesicular disease virus (SVDV) proteins and the induced reorganization of endomembranes in IBRS-2 cells were analyzed. Fluorescence to new SVDV capsids appeared first upon infection, concentrated in perinuclear circular structures and colocalized to dsRNA. As in foot-and-mouth disease virus (FMDV)-infected cells, a vesicular pattern was predominantly found in later stages of SVDV capsid morphogenesis that colocalized with those of non-structural proteins 2C, 2BC and 3A. These results suggest that assembly of capsid proteins is associated to the replication complex. Confocal microscopy showed a decreased fluorescence to ER markers (calreticulin and protein disulfide isomerase), and disorganization of cis-Golgi gp74 and trans-Golgi caveolin-1 markers in SVDV- and FMDV-, but not in vesicular stomatitis virus (VSV)-infected cells. Electron microscopy of SVDV-infected cells at an early stage of infection revealed fragmented ER cisternae with expanded lumen and accumulation of large Golgi vesicles, suggesting alterations of vesicle traffic through Golgi compartments. At this early stage, FMDV induced different patterns of ER fragmentation and Golgi alterations. At later stages of SVDV cytopathology, cells showed a completely vacuolated cytoplasm containing vesicles of different sizes. Cell treatment with brefeldin A, which disrupts the Golgi complex, reduced SVDV (∼ 5 log) and VSV (∼ 4 log) titers, but did not affect FMDV growth. Thus, three viruses, which share target tissues and clinical signs in natural hosts, induce different intracellular effects in cultured cells
NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse
Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.
2014-01-01
During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate
Klystron control software in the SLC
International Nuclear Information System (INIS)
Jobe, R.K.; Thompson, K.; Phinney, N.
1985-05-01
Triggering, control, and monitoring of 240 high-power klystrons will be supported by the SLC control system this summer. The control software is distributed among a VAX host computer, a local microprocessor cluster, and a dedicated intelligent CAMAC module. The functions performed by these three components and the algorithms used are discussed
17 CFR 31.8 - Cover of leverage contracts.
2010-04-01
... receipt for two business days: Provided, however, That the amount of physical commodities subject to such... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Cover of leverage contracts. 31.8 Section 31.8 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION LEVERAGE...
Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier
2013-01-01
The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (pHH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle.
Directory of Open Access Journals (Sweden)
Cheng Hu
2009-10-01
Full Text Available Recent advance in genetic studies added the confirmed susceptible loci for type 2 diabetes to eighteen. In this study, we attempt to analyze the independent and joint effect of variants from these loci on type 2 diabetes and clinical phenotypes related to glucose metabolism.Twenty-one single nucleotide polymorphisms (SNPs from fourteen loci were successfully genotyped in 1,849 subjects with type 2 diabetes and 1,785 subjects with normal glucose regulation. We analyzed the allele and genotype distribution between the cases and controls of these SNPs as well as the joint effects of the susceptible loci on type 2 diabetes risk. The associations between SNPs and type 2 diabetes were examined by logistic regression. The associations between SNPs and quantitative traits were examined by linear regression. The discriminative accuracy of the prediction models was assessed by area under the receiver operating characteristic curves. We confirmed the effects of SNPs from PPARG, KCNJ11, CDKAL1, CDKN2A-CDKN2B, IDE-KIF11-HHEX, IGF2BP2 and SLC30A8 on risk for type 2 diabetes, with odds ratios ranging from 1.114 to 1.406 (P value range from 0.0335 to 1.37E-12. But no significant association was detected between SNPs from WFS1, FTO, JAZF1, TSPAN8-LGR5, THADA, ADAMTS9, NOTCH2-ADAM30 and type 2 diabetes. Analyses on the quantitative traits in the control subjects showed that THADA SNP rs7578597 was association with 2-h insulin during oral glucose tolerance tests (P = 0.0005, empirical P = 0.0090. The joint effect analysis of SNPs from eleven loci showed the individual carrying more risk alleles had a significantly higher risk for type 2 diabetes. And the type 2 diabetes patients with more risk allele tended to have earlier diagnostic ages (P = 0.0006.The current study confirmed the association between PPARG, KCNJ11, CDKAL1, CDKN2A-CDKN2B, IDE-KIF11-HHEX, IGF2BP2 and SLC30A8 and type 2 diabetes. These type 2 diabetes risk loci contributed to the disease additively.
Lv, Yonggang; Wang, Ting; Fan, Jing; Zhang, Zhenzhen; Zhang, Juliang; Xu, Cheng; Li, Yongping; Zhao, Ge; He, Chenyang; Meng, Huimin; Yang, Hua; Wang, Zhen; Liu, Jiayun; Chen, Jianghao; Wang, Ling
2017-04-01
The cancer stem cell (CSC) hypothesis has gained significant recognition in describing tumorigenesis. Identification of the factors critical to development of breast cancer stem cells (BCSCs) may provide insight into the improvement of effective therapies against breast cancer. In this study, we aim to investigate the biological function of SLC34A2 in affecting the stem cell-like phenotypes in BCSCs and its underlying mechanisms. We demonstrated that CD147 + cells from breast cancer tissue samples and cell lines possessed BCSC-like features, including the ability of self-renewal in vitro, differentiation, and tumorigenic potential in vivo. Flow cytometry analysis showed the presence of a variable fraction of CD147 + cells in 9 of 10 tumor samples. Significantly, SLC34A2 expression in CD147 + BCSCs was enhanced compared with that in differentiated adherent progeny of CD147 + BCSCs and adherently cultured cell line cells. In breast cancer patient cohorts, SLC34A2 expression was found increased in 9 of 10 tumor samples. By using lentiviral-based approach, si-SLC34A2-transduced CD147 + BCSCs showed decreased ability of sphere formation, cell viability in vitro, and tumorigenicity in vivo, which suggested the essential role of SLC34A2 in CD147 + BCSCs. Furthermore, PI3K/AKT pathway and SOX2 were found necessary to maintain the stemness of CD147 + BCSCs by using LY294002 or lentiviral-si-SOX2. Finally, we indicated that SLC34A2 could regulate SOX2 to maintain the stem cell-like features in CD147 + BCSCs through PI3K/AKT pathway. Therefore, our report identifies a novel role of SLC34A2 in BCSCs' state regulation and establishes a rationale for targeting the SLC34A2/PI3K/AKT/SOX2 signaling pathway for breast cancer therapy.
Directory of Open Access Journals (Sweden)
Fei Liu
Full Text Available Hearing loss is one of the most prevalent human birth defects. Genetic factors contribute to the pathogenesis of deafness. It is estimated that one-third of deafness genes have already been identified. The current work is an attempt to find novel genes relevant to hearing loss using guilt-by-profiling and guilt-by-association bioinformatics analyses of approximately 80 known non-syndromic hereditary hearing loss (NSHL genes. Among the 300 newly identified candidate deafness genes, slc26a2 were selected for functional studies in zebrafish. The slc26a2 gene was knocked down using an antisense morpholino (MO, and significant defects were observed in otolith patterns, semicircular canal morphology, and lateral neuromast distributions in morphants. Loss-of-function defects are caused primarily by apoptosis, and morphants are insensitive to sound stimulation and imbalanced swimming behaviours. Morphant defects were found to be partially rescued by co-injection of human SLC26A2 mRNA. All the results suggest that bioinformatics is capable of predicting new deafness genes and this showed slc26a2 is to be a critical otic gene whose dysfunction may induce hearing impairment.
Use of landsat ETM+ SLC-off segment-based gap-filled imagery for crop type mapping
Maxwell, S.K.; Craig, M.E.
2008-01-01
Failure of the Scan Line Corrector (SLC) on the Landsat ETM+ sensor has had a major impact on many applications that rely on continuous medium resolution imagery to meet their objectives. The United States Department of Agriculture (USDA) Cropland Data Layer (CDL) program uses Landsat imagery as the primary source of data to produce crop-specific maps for 20 states in the USA. A new method has been developed to fill the image gaps resulting from the SLC failure to support the needs of Landsat users who require coincident spectral data, such as for crop type mapping and monitoring. We tested the new gap-filled method for a CDL crop type mapping project in eastern Nebraska. Scan line gaps were simulated on two Landsat 5 images (spring and late summer 2003) and then gap-filled using landscape boundary models, or segment models, that were derived from 1992 and 2002 Landsat images (used in the gap-fill process). Various date combinations of original and gap-filled images were used to derive crop maps using a supervised classification process. Overall kappa values were slightly higher for crop maps derived from SLC-off gap-filled images compared to crop maps derived from the original imagery (0.3–1.3% higher). Although the age of the segment model used to derive the SLC-off gap-filled product did not negatively impact the overall agreement, differences in individual cover type agreement did increase (−0.8%–1.6% using the 2002 segment model to −5.0–5.1% using the 1992 segment model). Classification agreement also decreased for most of the classes as the size of the segment used in the gap-fill process increased.
Luminosity Optimization Feedback in the SLC
International Nuclear Information System (INIS)
1999-01-01
The luminosity optimization at the SLC has been limited by the precision with which one can measure the micron size beams at the Interaction Point. Ten independent tuning parameters must be adjusted. An automated application has been used to scan each parameter over a significant range and set the minimum beam size as measured with a beam-beam deflection scan. Measurement errors limited the accuracy of this procedure and degraded the resulting luminosity. A new luminosity optimization feedback system has been developed using novel dithering techniques to maximize the luminosity with respect to the 10 parameters, which are adjusted one at a time. Control devices are perturbed around nominal setpoints, while the averaged readout of a digitized luminosity monitor measurement is accumulated for each setting. Results are averaged over many pulses to achieve high precision and then fitted to determine the optimal setting. The dithering itself causes a small loss in luminosity, but the improved optimization is expected to significantly enhance the performance of the SLC. Commissioning results are reported
SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation
DEFF Research Database (Denmark)
Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N
2011-01-01
The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...
Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.
2012-01-01
Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097
Kuan, Lisa; Schaffer, Jessica N.; Zouzias, Christos D.
2014-01-01
Proteus mirabilis is a Gram-negative enteric bacterium that causes complicated urinary tract infections, particularly in patients with indwelling catheters. Sequencing of clinical isolate P. mirabilis HI4320 revealed the presence of 17 predicted chaperone-usher fimbrial operons. We classified these fimbriae into three groups by their genetic relationship to other chaperone-usher fimbriae. Sixteen of these fimbriae are encoded by all seven currently sequenced P. mirabilis genomes. The predicted protein sequence of the major structural subunit for 14 of these fimbriae was highly conserved (≥95 % identity), whereas three other structural subunits (Fim3A, UcaA and Fim6A) were variable. Further examination of 58 clinical isolates showed that 14 of the 17 predicted major structural subunit genes of the fimbriae were present in most strains (>85 %). Transcription of the predicted major structural subunit genes for all 17 fimbriae was measured under different culture conditions designed to mimic conditions in the urinary tract. The majority of the fimbrial genes were induced during stationary phase, static culture or colony growth when compared to exponential-phase aerated culture. Major structural subunit proteins for six of these fimbriae were detected using MS of proteins sheared from the surface of broth-cultured P. mirabilis, demonstrating that this organism may produce multiple fimbriae within a single culture. The high degree of conservation of P. mirabilis fimbriae stands in contrast to uropathogenic Escherichia coli and Salmonella enterica, which exhibit greater variability in their fimbrial repertoires. These findings suggest there may be evolutionary pressure for P. mirabilis to maintain a large fimbrial arsenal. PMID:24809384
International Nuclear Information System (INIS)
Schwickerath, Ulrich; Silva, Ricardo
2010-01-01
Most LCG sites are currently running on SL(C)4. However, this operating system is already rather old, and it is becoming difficult to get the required hardware drivers, to get the best out of recent hardware. A possible way out is the migration to SL(C)5 based systems where possible, in combination with virtualization methods. The former is typically possible for nodes where the software to run the services is available and tested, while the latter offers a possibility to make use of the new hardware platforms whilst maintaining operating system compatibility. Since autumn 2008, CERN has offered public interactive and batch worker nodes for evaluation to the experiments. For the Grid environment, access is granted by a dedicated CEs. The status of the evaluation, feedback received from the experiments and the status of the migration will be reviewed, and the status of virtualization of services at CERN will be reported. Beyond this, the migration to a new operating system also offers an excellent opportunity to upgrade the fabric infrastructure used to manage the servers.
Vps35-deficiency impairs SLC4A11 trafficking and promotes corneal dystrophy.
Directory of Open Access Journals (Sweden)
Wei Liu
Full Text Available Vps35 (vacuolar protein sorting 35 is a major component of retromer that selectively promotes endosome-to-Golgi retrieval of transmembrane proteins. Dysfunction of retromer is a risk factor for the pathogenesis of Parkinson's disease (PD and Alzheimer's disease (AD. However, Vps35/retromer's function in the eye or the contribution of Vps35-deficiency to eye degenerative disorders remains to be explored. Here we provide evidence for a critical role of Vps35 in mouse corneal dystrophy. Vps35 is expressed in mouse and human cornea. Mouse cornea from Vps35 heterozygotes (Vps35+/- show features of dystrophy, such as loss of both endothelial and epithelial cell densities, disorganizations of endothelial, stroma, and epithelial cells, excrescences in the Descemet membrane, and corneal edema. Additionally, corneal epithelial cell proliferation was reduced in Vps35-deficient mice. Intriguingly, cell surface targeting of SLC4A11, a membrane transport protein (OH- /H+ /NH3 /H2O of corneal endothelium, whose mutations have been identified in patients with corneal dystrophy, was impaired in Vps35-deficient cells and cornea. Taken together, these results suggest that SLC4A11 appears to be a Vps35/retromer cargo, and Vps35-regulation of SLC4A11 trafficking may underlie Vps35/retromer regulation of corneal dystrophy.
Wright, Sara F.; Morton, Joseph B.; Sworobuk, Janis E.
1987-01-01
Spore morphology is currently used to identify species of vesicular-arbuscular mycorrhizal fungi. We report the first use of a highly specific immunological method for identification of a vesicular-arbuscular mycorrhizal fungus. Two monoclonal antibodies were produced against Glomus occultum. Monoclonal antibodies reacted strongly with both spores and hyphae in an indirect enzyme-linked immunosorbent assay. All other mycorrhizal (29 species) and nonmycorrhizal (5 species) fungi tested were no...
Directory of Open Access Journals (Sweden)
Lin, XG.
1993-01-01
Full Text Available Investigation on the effect of phosphorus on vesicular-arbuscular mycorrhizal infection, and dual inoculation of vesicular-arbuscular mycorrhizae + rhizobium on growth of white clover under field microplots and pot experiments was conducted on fluvo-aquic soils of semi-arid region in north China. The results showed that 60 kg P205 ha in form of superphosphate was the most favorable phosphorus level for vesicular-arbuscular mycorrhizal infection ; mycorrhizal infection, nodulation, dry weight of shoots and roots, total uptake of nitrogen, phosphorus and other elements, the final yields and recovery of phosphorus of white clover were significantly increased by vesicular-arbuscular mycorrhizal inoculation and dual inoculation with vesicular-arbuscular mycorrhizal fungi and rhizobium. The highest response of inoculation was obtained by adding fertilizer phosphorus at the level of 60 kg P205 ha in form of superphosphate.
Wire breakage in SLC wire profile monitors
International Nuclear Information System (INIS)
Field, C.; McCormick, D.; Raimondi, P.; Ross, M.
1998-05-01
Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures
Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura
2018-04-12
Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.
Spin motion of electrons in the SLC linac
International Nuclear Information System (INIS)
Panofsky, W.K.H.
1990-01-01
It is generally expected that the depolarizing effects of the linear accelerator RF fields will be small. Recently Bill Atwood raised the question whether this conclusion is still correct in view of the fact that the particles in the SLC spend a larger fraction of their time at phase angles ''off crest'' due to BNS damping; since radial fields are in quadrature with the accelerating field this might imply that depolarizing effects are larger. On the other hand, because of the smaller emittance of the SLC relative to the earlier linac radial excursions would be smaller. The anticipation is therefore that the depolarizing effect will again be negligible but it might be worthwhile to update the early calculations of SLAC TN-63-97 revised in this paper
Directory of Open Access Journals (Sweden)
Armando R Irizarry
Full Text Available There has been growing recognition of the essential roles of citrate in biomechanical properties of mineralized tissues, including teeth and bone. However, the sources of citrate in these tissues have not been well defined, and the contribution of citrate to the regulation of odontogenesis and osteogenesis has not been examined. Here, tooth and bone phenotypes were examined in sodium-dependent citrate transporter (NaCT Slc13a5 deficient C57BL/6 mice at 13 and 32 weeks of age. Slc13a5 deficiency led to defective tooth development, characterized by absence of mature enamel, formation of aberrant enamel matrix, and dysplasia and hyperplasia of the enamel organ epithelium that progressed with age. These abnormalities were associated with fragile teeth with a possible predisposition to tooth abscesses. The lack of mature enamel was consistent with amelogenesis imperfecta. Furthermore, Slc13a5 deficiency led to decreased bone mineral density and impaired bone formation in 13-week-old mice but not in older mice. The findings revealed the potentially important role of citrate and Slc13a5 in the development and function of teeth and bone.
Mundell, Nathan A; Beier, Kevin T; Pan, Y Albert; Lapan, Sylvain W; Göz Aytürk, Didem; Berezovskii, Vladimir K; Wark, Abigail R; Drokhlyansky, Eugene; Bielecki, Jan; Born, Richard T; Schier, Alexander F; Cepko, Constance L
2015-08-01
Current limitations in technology have prevented an extensive analysis of the connections among neurons, particularly within nonmammalian organisms. We developed a transsynaptic viral tracer originally for use in mice, and then tested its utility in a broader range of organisms. By engineering the vesicular stomatitis virus (VSV) to encode a fluorophore and either the rabies virus glycoprotein (RABV-G) or its own glycoprotein (VSV-G), we created viruses that can transsynaptically label neuronal circuits in either the retrograde or anterograde direction, respectively. The vectors were investigated for their utility as polysynaptic tracers of chicken and zebrafish visual pathways. They showed patterns of connectivity consistent with previously characterized visual system connections, and revealed several potentially novel connections. Further, these vectors were shown to infect neurons in several other vertebrates, including Old and New World monkeys, seahorses, axolotls, and Xenopus. They were also shown to infect two invertebrates, Drosophila melanogaster, and the box jellyfish, Tripedalia cystophora, a species previously intractable for gene transfer, although no clear evidence of transsynaptic spread was observed in these species. These vectors provide a starting point for transsynaptic tracing in most vertebrates, and are also excellent candidates for gene transfer in organisms that have been refractory to other methods. © 2015 Wiley Periodicals, Inc.
Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I
2002-01-01
Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...
Price, G Dean; Howitt, Susan M
2011-04-01
The cyanobacterial Na+-dependent HCO3- transporter BicA is a member of the ubiquitous and important SulP/SLC26 family of anion transporters found in eukaryotes and prokaryotes. BicA is an important component of the cyanobacterial CO2 concentrating mechanism, an adaptation that contributes to cyanobacteria being able to achieve an estimated 25% of global primary productivity, largely in the oceans. The human SLC26 members are involved in a range of key cellular functions involving a diverse range of anion transport activities including Cl-/HCO3-, I-/HCO3-, and SO42-/HCO3- exchange; mutations in SLC26 members are known to be associated with debilitating diseases such as Pendred syndrome, chondrodysplasias, and congenital chloride diarrhoea. We have recently experimentally determined the membrane topology of BicA using the phoA-lacZ reporter system and here consider some of the extrapolated implications for topology of the human SLC26 family and the Sultr plant sulphate transporters.
17 CFR 210.8-05 - Pro forma financial information.
2010-04-01
... information showing the effects of the acquisition shall be furnished if financial statements of a business... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Pro forma financial information. 210.8-05 Section 210.8-05 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION...
Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan
2012-06-01
Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.
Impedance calculations for the improved SLC damping rings
International Nuclear Information System (INIS)
Bane, K.L.F.; Ng, C.K.
1993-04-01
A longitudinal, single bunch instability is observed in the damping rings of the Stanford Linear Collider (SLC). Beyond a threshold bunch population of 3 x 10 10 particles the bunch energy spread increases and a ''saw-tooth'' variation in bunch length and synchronous phase as functions of time is observed. Although the relative amplitude of the saw-tooth variation is small-only on the order of 10% -- the resulting unpredictability of the beam properties in the rest of the SLC accelerator makes it difficult, if not impossible, to operate the machine above the threshold current. An additional problem at higher currents is that the bunch length is greatly increased. When the bunch is very long in the ring it becomes difficult or impossible to properly compress it after extraction. We want to solve both of these problems so that the SLC can run at higher currents to increase the luminosity. In order to solve these problems the vacuum chambers of both damping rings are being rebuilt with the aim of reducing their impedance. According to previous calculations the impedance the SLC damping rings is dominated by the many small discontinuities that are located in the so-called QD and QF vacuum chamber segments -- elements such as transitions, masks, bellows-that are inductive to the beam, Since these earlier calculations were performed the bellows of the QD segments have been sleeved, yielding a factor of 2 increase in the instability threshold. In this paper we begin by discussing the gains that might be achieved if we can reduce the impedance of the rings even further. Then we estimate the effect on the total impedance of the actual design changes that are being proposed. Three important elements -- the bend-to-quad transitions, the distributed ion pump slots, and the beam position monitor (BPM) electrodes are fully 3-dimensional and will be studied using T3 of the MAFIA computer programs
Generation and acceleration of high intensity beams in the SLC injector
International Nuclear Information System (INIS)
Ross, M.C.; Browne, M.J.; Clendenin, J.E.; Jobe, R.K.; Seeman, J.T.; Sheppard, J.C.; Stiening, R.F.
1985-04-01
A new gun pulser and substantially increased focusing have been added to the first 100 m of the SLAC linac in order to provide a pair of intense electron bunches to the SLC damping ring. Each bunch from this injector must have 5 x 10 10 electrons, an invariant emittance γepsilon less than or equal to 1.8 x 10 -3 m-rad and the pair must have an energy spread of less than 2%. Wakefield instabilities present in earlier versions of this injector have been controlled by reducing the transverse beam dimension by a factor of 3
Goldstein, David S; Kopin, Irwin J; Sharabi, Yehonatan; Holmes, Courtney
2015-02-01
Parkinson disease with orthostatic hypotension (PD + OH) and the parkinsonian form of multiple system atrophy (MSA-P) can be difficult to distinguish clinically. Recent studies indicate that PD entails a vesicular storage defect in catecholaminergic neurons. Although cardiac sympathetic neuroimaging by (18)F-dopamine positron emission tomography can identify decreased vesicular storage, this testing is not generally available. We assessed whether plasma biomarkers of a vesicular storage defect can separate PD + OH from MSA-P. We conceptualized that after F-dopamine injection, augmented production of F-dihydroxyphenylacetic acid (F-DOPAC) indicates decreased vesicular storage, and we therefore predicted that arterial plasma F-DOPAC would be elevated in PD + OH but not in MSA-P. We measured arterial plasma F-DOPAC after (18)F-dopamine administration (infused i.v. over 3 min) in patients with PD + OH (N = 12) or MSA-P (N = 21) and in healthy control subjects (N = 26). Peak F-DOPAC:dihydroxyphenylglycol (DHPG) was also calculated to adjust for effects of denervation on F-DOPAC production. Plasma F-DOPAC accumulated rapidly after initiation of (18)F-dopamine infusion. Peak F-DOPAC (5-10 min) in PD + OH averaged three times that in MSA-P (P 300 nCi-kg/cc-mCi, in contrast with 7 of 12 PD + OH patients (χ(2) = 16.6, P < 0.0001). DHPG was lower in PD + OH (3.83 ± 0.36 nmol/L) than in MSA-P (5.20 ± 0.29 nmol/L, P = 0.007). All MSA-P patients had peak F-DOPAC:DHPG < 60, in contrast with 9 of 12 PD + OH patients (χ(2) = 17.5, P < 0.0001). Adjustment of peak F-DOPAC for DHPG increased test sensitivity from 58 to 81% at similar high specificity. After F-dopamine injection, plasma F-DOPAC and F-DOPAC:DHPG distinguish PD + OH from MSA-P.
Anticipation in a family with primary familial brain calcification caused by an SLC20A2 variant.
Konno, Takuya; Blackburn, Patrick R; Rozen, Todd D; van Gerpen, Jay A; Ross, Owen A; Atwal, Paldeep S; Wszolek, Zbigniew K
2018-04-11
To describe a family with primary familial brain calcification (PFBC) due to SLC20A2 variant showing possible genetic anticipation. We conducted historical, genealogical, clinical, and radiologic studies of a family with PFBC. Clinical evaluations including neurological examination and head computed tomography (CT) scans of a proband and her father were performed. They provided additional information regarding other family members. To identify a causative gene variant, we performed whole-exome sequencing for the proband followed by segregation analysis in other affected members using direct sequencing. In this family, nine affected members were identified over four generations. The proband suffered from chronic daily headache including thunderclap headache. We identified an SLC20A2 (c.509delT, p.(Leu170*)) variant in three affected members over three generations. Interestingly, the age of onset became younger as the disease passed through successive generations, suggestive of genetic anticipation. For clinical purpose, it is important to consider thunderclap headache and genetic anticipation in PFBC caused by SLC20A2 variants. Further investigation is required to validate our observation. Copyright © 2018 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
An encoding device and a method of encoding
DEFF Research Database (Denmark)
2012-01-01
The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....
Miller, G W; Wang, Y M; Gainetdinov, R R; Caron, M G
2001-01-01
One of the most valuable methods for understanding the function of a particular protein is the generation of animals that have had the gene encoding for the protein of interest disrupted, commonly known as a "quo;knockout"quo; or null mutant. By incorporating a sequence of DNA (typically encoding antibiotic resistance to aid in the selection of the mutant gene) into embryonic stem cells by homologous recombination, the normal transcription of the gene is effectively blocked (Fig. 1). Since a particular protein is encoded by two copies of a gene, it is necessary to have the gene on both alleles "quo;knocked out."quo; This is performed by cross-breeding animals with one affected allele (heterozygote) to generate offspring that have inherited two mutant alleles (homozygote). This procedure has been used to generate animals lacking either the plasma membrane dopamine transporter (DAT; Fig. 2) or the vesicular monoamine transporter (VMAT2; Fig. 3). Both DAT and VMAT2 are essential for dopamine homeostasis and are thought to participate in the pathogenesis of Parkinson's disease (1-5). Fig. 1. Maps of the targeting vector and the mock construct. The mouse genomic fragment (clone 11) was isolated from a Stratagene 129 SvJ library by standard colony hybridization using a PCR probe from the 5' end of rat cDNA. The restriction site abbreviations are as follows: H, HindIII; N, NotI; Sc, SacI; Sn, SnaI; X, XbaI; and Xh, XhoI. The region between HindIII and SnaI on clone 11 containing the coding sequence from transmembrane domains 3 and 4 of VMAT2 was deleted and replaced with PGK-neo. The 3' fragment of clone 11 was reserved as an external probe for Southern analysis. To facilitate PCR screening of embryonic stem cell clones, a mock construct containing the SnaI/XbaI fragment and part of the Neo cassette was generated as a positive control. pPNT and pGEM4Z were used to construct knockout and mock vectors, respectively. (Reproduced with permission from ref. 1). Fig. 2. DAT and
Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan
2017-01-01
ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822
Mele, Daniela; Dioguardi, Fabio
2018-03-01
Acknowledging the grain size dependency of shape is important in volcanology, in particular when dealing with tephra produced and emplaced during and after explosive volcanic eruptions. A systematic measurement of the tridimensional shape of vesicular pyroclasts of Campi Flegrei fallout deposits (Agnano-Monte Spina, Astroni 6 and Averno 2 eruptions) varying in size from 8.00 to 0.016 mm has been carried out by means of X-Ray Microtomography. Data show that particle shape changes with size, especially for juvenile vesicular clasts, since it is dependent on the distribution and size of vesicles that contour the external clast outline. Two drag laws that include sphericity in the formula were used for estimating the dependency of settling velocity on shape. Results demonstrate that it is not appropriate to assume a size-independent shape for vesicular particles, in contrast with the approach commonly employed when simulating the ash dispersion in the atmosphere.
Status of the SLC: Developments in Linear Collider physics
International Nuclear Information System (INIS)
Krejcik, P.
1994-11-01
This paper reviews the performance of the SLAC Linear Collider, both from the perspective of a machine delivering high luminosity polarized beams for physics, and as a test for future linear colliders. The development of the SLC taken place over a number of years and the steady improvements have been documented in previous review papers. As a review paper, the list references also serves as a bibliography, pointing to the work of the many people contributing to the upgrades and commissioning of the various SLC systems. The major upgrades for this present run have been an improved final focus optics, new low impedance vacuum chambers for the damping rings and improved polarization from the electron source. The performance of the SLC is driven to some extent by its unique 3-beam operation in which the linac accelerates both the electron and positron bunches for collision, as well as the electron bunch to produce the positrons. The special attention required to maintain stable operation in the face of the interactions caused by beam loading from the bunches will (fortunately exclamation point) not be an issue in future linear colliders. They will deal instead with the problems associated with handling long bunch trains
Directory of Open Access Journals (Sweden)
Irene Flønes
Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.
Zhang, X Y; Geng, T T; Liu, L J; Yuan, D Y; Feng, T; Kang, L L; Jin, T B; Chen, C
2015-08-19
Current evidence suggests that heredity and metabolic syndrome contribute to gout progression. SLC2A9 and ZNF518B may play a role in gout progression in different populations, but no studies have focused on the Tibetan Chinese population. In this study, we determined whether variations in these 2 genes were correlated with gout-related indices in Chinese-Tibetan gout patients. We detected 6 single nucleotide polymorphisms in SLC2A9 and ZNF518B in 319 Chinese Tibetan gout patients. One-way analysis of variance was used to evaluate the polymorphisms' effects on gout based on mean serum levels of metabolism indicators. Polymorphisms in SLC2A9 and ZNF518B affected multiple risk factors related to gout development. Significant differences in serum triglyceride levels and high-density lipoprotein-cholesterol level were detected between different genotypic groups with SLC2A9 polymorphisms rs13129697 (P = 0.022), rs4447863 (P = 0.018), and rs1014290 (P = 0.045). Similarly in ZNF518B, rs3217 (P = 0.016) and rs10016022 (P = 0.046) were associated with high creatinine and glucose levels, respectively. This study is the first to investigate and identify positive correlations between SLC2A9 and ZNF518B gene polymorphisms and metabolic indices in Tibetan gout patients. We found significant evidence indicating that genetic polymorphisms affect gout-related factors in Chinese Tibetan populations.
Bovine Vaccinia in dairy cattle and suspicion of vesicular disease on milkers in Brazil
Directory of Open Access Journals (Sweden)
Thaís Garcia da Silva
2018-05-01
Full Text Available ABSTRACT: Bovine vaccinia (BV is a vesicular disease induced by the Vaccinia virus (VACV that affects milk production and is an occupational zoonosis. This research had the following objectives: (i detection of VACV by qPCR in cattle with clinical suspicion of vesicular disease; (ii symptoms characterization in animals and milkers with clinical suspicion of the disease and virus detection in humans; and (iii identification of risk factors for infections of VACV in herds from several Brazilian states. A total of 471 bovine epithelial samples from dairy farms, in 15 Brazilian states, were evaluated between 2007 and 2012. The samples were tested by quantitative PCR (qPCR using SYBR Green® reagents, validated with a lower limit of detection of 100 TCID50/50µL (1.7x100 viral particles, and 45.1% of VACV positive samples were detected. Using official forms for epidemiological investigation (FORM-IN, the risk factors for VACV infections in cattle were determined to be farms with a lack of technological facilities (P=0.029 and the presence of rodents (P=0.001. There was an effect of seasonality in cattle with a higher occurrence of BV during the dry season. A total of 420 epidemiological questionnaires were applied at public health care centers, where 100% of the milkers had vesicular lesions on their hands (98.1% and on their arms (6.9%. The most frequent clinical symptoms in humans were: local swelling (74.2%, headache (20.7%, fever (10.4% and inguinal lymphadenopathy (74.2%. Only 19.98% of milkers aged between 39 and 58 years were seroreactive to VACV and were immunized with the human anti-smallpox vaccine. There was an increase in the frequency of BV in older individuals due to their natural decrease in specific immunity. It has been shown that the implementation of zootechnical management techniques and health planning are important for the prevention of BV in animals and humans.
Kicker for the SLC electron damping ring
International Nuclear Information System (INIS)
Bartelson, L.; Crawford, C.; Dinkel, J.; Kerns, Q.; Howell, J.; Snowdon, S.; Walton, J.
1987-01-01
The SLC electron damping ring requires two kickers each providing a 5 mr kick at 1.2 GEV to pairs of electron bunches spaced 61.63 nsec apart. The exact shape of the kick is unimportant, but the specification applies to the field the bunches see
International Nuclear Information System (INIS)
Novick, P.J.; Goud, B.; Salminen, A.; Walworth, N.C.; Nair, J.; Potenza, M.
1988-01-01
Vesicular transport is an important mechanism for the intracellular traffic of proteins and lipids in eukaryotic cells. Vesicles mediate the passage of proteins between the various organelles of the secretory pathway and the exocytic release of these proteins into the extracellular environment. Vesicles also mediate the uptake of proteins and fluid from the external environment, delivering them to endosomes. Despite the generality of the vesicular transport mechanism, the process is not yet understood at a molecular level. The key questions that are addressed are (1) How are vesicles formed from the membrane of the donor organelle? (2) How are these vesicles transported? (3) How do the vesicles recognize the membrane of the target (acceptor) organelle? (4) How is membrane fusion accomplished? The genetic flexibility of yeast has been exploited to identify components of the cellular machinery required for vesicular transport
The vesicular-arbuscular mycorrhizal symbiosis | Quilambo | African ...
African Journals Online (AJOL)
Vesicular-arbuscular mycorrhiza fungi are associated with the majority ot the terrestrial plants. Their function ranges from stress alleviation to bioremediation in soils polluted with heavy metals. However, our knowledge about this symbiosis is still limited. For the semi-arid tropics, where some african countries are located, ...
Correlation plot facility in the SLC control system
International Nuclear Information System (INIS)
Hendrickson, L.; Phinney, N.; Sanchez-Chopitea, L.
1991-05-01
The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. A generalized interface allows the user to perform a wide variety of machine physics experiments without the need for specialized software. It has been used extensively during SLC commissioning and operation. The user may step one or two independent parameters such as magnet or feedback setpoints while measuring or calculating up to 160 others. Measured variables include all analog signals available to the control system as well as a variety of derived parameters such as beam size or emittance. Various fitting algorithms and display options are provided for data analysis. A software-callable interface is also provided. Applications based on this facility are used to phase klystrons, measure emittance and dispersion, minimize beam size at the interaction point and maintain beam collisions. 4 refs., 3 figs
Machine protection schemes for the SLC
International Nuclear Information System (INIS)
Ross, M.C.
1991-01-01
The beamline components of a linear collider must be protected from high power beams in a way that is both reliable and has a minimum impact on integrated luminosity. When an upstream accelerator component fault occurs, the machine protection system suppresses the appropriate beam pulses and restores them when the fault clears or is compensated for. If an unacceptable localized beam loss is detected, without an accompanying component fault that is a likely cause of the loss, the system must provide identical, lower rate (lower average power), beam pulses to be used for diagnosis. This must not be done at the expense of any upstream beam stabilization system since fault diagnosis and recovery may take some time. Since the SLC beam pulse sequence is a regenerative one, i.e. correct function on a given pulse requires that several preceding pulses have been successfully completed, beam pulse repetition rate limiting is not trivial. Smooth, rapid, recovery from this type of fault is very important and can have a significant impact on luminosity. This paper provides an overview of the beam suppression and repetition rate limiting schemes used at the SLC
VMAT2 and Parkinson’s disease: harnessing the dopamine vesicle
Lohr, Kelly M; Miller, Gary W
2014-01-01
Despite a movement away from dopamine-focused Parkinson’s disease (PD) research, a recent surge of evidence now suggests that altered vesicular storage of dopamine may contribute to the demise of the nigral neurons in this disease. Human studies demonstrate that the vesicular monoamine transporter 2 (VMAT2; SLC18A2) is dysfunctional in PD brain. Moreover, studies with transgenic mice suggest that there is an untapped reserve capacity of the dopamine vesicle that could be unbridled by increasi...
Directory of Open Access Journals (Sweden)
Joseph Andronic
Full Text Available Swelling-activated pathways for myo-inositol, one of the most abundant organic osmolytes in mammalian cells, have not yet been identified. The present study explores the SLC5A3 protein as a possible transporter of myo-inositol in hyponically swollen HEK293 cells. To address this issue, we examined the relationship between the hypotonicity-induced changes in plasma membrane permeability to myo-inositol P ino [m/s] and expression/localization of SLC5A3. P ino values were determined by cell volumetry over a wide tonicity range (100-275 mOsm in myo-inositol-substituted solutions. While being negligible under mild hypotonicity (200-275 mOsm, P ino grew rapidly at osmolalities below 200 mOsm to reach a maximum of ∼ 3 nm/s at 100-125 mOsm, as indicated by fast cell swelling due to myo-inositol influx. The increase in P ino resulted most likely from the hypotonicity-mediated incorporation of cytosolic SLC5A3 into the plasma membrane, as revealed by confocal fluorescence microscopy of cells expressing EGFP-tagged SLC5A3 and super-resolution imaging of immunostained SLC5A3 by direct stochastic optical reconstruction microscopy (dSTORM. dSTORM in hypotonic cells revealed a surface density of membrane-associated SLC5A3 proteins of 200-2000 localizations/μm2. Assuming SLC5A3 to be the major path for myo-inositol, a turnover rate of 80-800 myo-inositol molecules per second for a single transporter protein was estimated from combined volumetric and dSTORM data. Hypotonic stress also caused a significant upregulation of SLC5A3 gene expression as detected by semiquantitative RT-PCR and Western blot analysis. In summary, our data provide first evidence for swelling-mediated activation of SLC5A3 thus suggesting a functional role of this transporter in hypotonic volume regulation of mammalian cells.
An Effective Gap Filtering Method for Landsat ETM+ SLC-Off Data
Directory of Open Access Journals (Sweden)
Seulki Lee
2016-01-01
Full Text Available The Landsat 7 Enhanced Thematic Mapper Plus (ETM+ scan line corrector (SLC failed on 31 May 2003, causing the SLC to turn off. Many gap-filled products were developed and deployed to combat this situation. The majority of these products used a primary image taken by the SLC when functioning properly in an attempt to correct SLC-off images. However, temporal atmospheric elements could not be reliably reflected using a primary image, and therefore the corrected image was not viable for use by monitoring systems. To bypass this limitation, this study has developed the Gap Interpolation and Filtering (GIF method that relies on one-dimensional interpolation filtering to conveniently recover pixels within a single image at a high level of accuracy without borrowing from images acquired at a different time or by another sensor. The GIF method was compared to two other methods—Global Linear Histogram Match (GLHM, and the Local Linear Histogram Match (LLHM—both developed by National Aeronautics and Space Administration (NASA and United States Geological Survey (USGS to determine its accuracy. The GIF method accuracy was found superior in land, sea, and cloud imaging. In particular, its sea and cloud images returned Root Mean Square Error (RMSE values close to or less than 1. We expect the GIF method developed in this research to be of invaluable aid to monitoring systems that depend heavily on Landsat imagery.
Perez de Leon, Adalberto A; Tabachnick, Walter J
2006-03-01
Laboratory-reared Culicoides sonorensis Wirth & Jones were infected with vesicular stomatitis virus serotype New Jersey (family Rhabdoviridae, genus Vesiculovirus, VSNJV) through intrathoracic inoculation. After 10-d incubation at 25 degrees C, these insects were allowed to blood feed on four steers. Two other steers were exposed to VSNJV through intralingual inoculation with 10(8) tissue culture infective dose50 VSNJV. All six steers became seropositive for VSNJV. The results demonstrate the ability of C. sonorensis to transmit VSNJV to livestock. Only the animals intralingually inoculated with VSNJV showed clinical signs in the form of vesicles at the site of inoculation. Uninfected C. sonorensis allowed to feed on the exposed animals did not become infected with VSNJV. Animals infected by C. sonorensis showed a slower antibody response compared with intralingually inoculated animals. This is probably because of different amounts of virus received via insect transmission and syringe inoculation. A significant difference was found in the serum acute-phase protein alpha-1-acid glycoprotein in animals that received VSNJV through C. sonorensis transmission. These animals had previously been exposed to insect attack in the field compared with intralingually inoculated animals and C. sonorensis-infected animals that had been protected from insect attack. The failure to observe clinical signs of vesicular stomatitis through transmission of VSNJV by C. sonorensis may explain widespread subclinical infections during vesicular stomatitis epidemics.
Importance of high order momentum terms in SLC optics
International Nuclear Information System (INIS)
Kozanecki, W.
1985-01-01
The evaluation of background levels at the SLC relies, in several cases, on the proper representation of how low momentum electrons propagate through the Arcs and the Final Focus System (FFS). For example, beam - gas bremsstrahlung in the arcs causes electrons of up to 6% energy loss to be transported through to the IP; secondary showers on edges of masks and collimators yield debris with a very wide momentum spectrum. This note is a naive attempt at checking the validity of TRANSPORT and TURTLE calculations, by evaluating the contributions of the momentum terms to increasingly higher order, and checking the mutual consistency of the results produced by the two methods on a beam of wide momentum spread. 8 refs., 4 figs., 1 tab
Directory of Open Access Journals (Sweden)
Sébastien Fritz
Full Text Available The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1% showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals. Thirty-four candidate haplotypes (p<10(-4 including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total. Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina, SLC35A3 (CVM, APAF1 (HH1 and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle.
Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C.; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier
2013-01-01
The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (p<10−4) including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle. PMID:23762392
Lin, XG.; Hao, WY.; Wu, TH.
1993-01-01
Investigation on the effect of phosphorus on vesicular-arbuscular mycorrhizal infection, and dual inoculation of vesicular-arbuscular mycorrhizae + rhizobium on growth of white clover under field microplots and pot experiments was conducted on fluvo-aquic soils of semi-arid region in north China. The results showed that 60 kg P205 ha in form of superphosphate was the most favorable phosphorus level for vesicular-arbuscular mycorrhizal infection ; mycorrhizal infection, nodulation, dry weight ...
Practical Microform Materials for Libraries: Silver, Diazo, Vesicular.
Veaner, Allen B.
1982-01-01
Remarks on the relative permanence and durability of three types of film in use in library microform reproduction (silver, diazo, and vesicular) and points out some technical and economic facts that govern the choice of microform materials for libraries. A 6-item reference list is included. (Author/JL)
IL-17-Expressing CD4+ and CD8+ T Lymphocytes in Human Toxoplasmosis
Directory of Open Access Journals (Sweden)
Jéssica Líver Alves Silva
2014-01-01
Full Text Available This study aimed to measure the synthesis of Th1 and Th2 cytokines by mononuclear cells after culture with live T. gondii and identified Th17 (CD4+ and Tc17 (CD8+ cells in toxoplasma-seronegative and toxoplasma-seropositive parturient and nonpregnant women. Cytometric bead arrays were used to measure cytokine levels (IL-2, TNF-α, IFN-γ, IL-4, IL-5, and IL-10; immunophenotyping was used to characterize Th17 and Tc17 cells, and the cells were stained with antibodies against CD4+ and CD8+ T cells expressing IL-17. The addition of tachyzoites to cell cultures induced the synthesis of IL-5, IL-10, and TNF-α by cells from seronegative parturient women and of IL-5 and IL-10 by cells from seropositive, nonpregnant women. We observed a lower level of IL-17-expressing CD4+ and CD8+ T lymphocytes in cultures of cells from seronegative and seropositive parturient and nonpregnant women that were stimulated with tachyzoites, whereas analysis of the CD4+ and CD8+ T cell populations showed a higher level of CD4+ T cells compared with CD8+ T cells. These results suggest that the cytokine pattern and IL-17-expressing CD4+ and CD8+ T lymphocytes may have important roles in the inflammatory response to T. gondii, thus contributing to the maintenance of pregnancy and control of parasite invasion and replication.
Energy spread in SLC linac with Landau damping
International Nuclear Information System (INIS)
Seeman, J.
1984-01-01
The possibility of using Landau damping to reduce the growth of the beam size due to transverse wake fields has been known for some time. Recently K. Bane has calculated the effects of Landau damping for the SLC. The energy spread is then slowly removed so that at the end of the linac it has returned to the SLC specification of less than +0.5%. The purpose of the energy spread is to reduce the resonant driving of the tail of the bunch by the head. In this note the expected energy spreads within the beam are tabulated at various positions along the linac for use by those people designing momentum dependent equipment and for those interested in Landau damping
Periodic Sorption of Tungstate Ions on Anionite AV-17-8
Directory of Open Access Journals (Sweden)
D’yachenko Aleksandr
2017-01-01
Full Text Available The multiple sorption of sodium tungstate resulting from the autoclave-soda digestion of a tungsten-bearing concentrate was studied using anion-exchange resin AV-17-8. The choice of ion exchange resin was carried out under static conditions using highly basic anionites. The sorption and desorption plots for tungstate and carbonate ions were demonstrated under dynamic conditions. The total dynamic capacity of the resin was estimated for each species of the ions in three sorption cycles. The applicability of the AV-17-8 resin as a sorbent in the autoclave-soda process flowsheet was determined.
Pérez De León, Adalberto A; O'Toole, Donal; Tabachnick, Walter J
2006-05-01
Intrathoracically inoculated Culicoides sonorensis Wirth & Jones were capable of transmitting vesicular stomatitis New Jersey virus (family Rhabdoviridae, genus Vesiculovirus, VSNJV) during blood feeding on the abdomen of six guinea pigs. None of the guinea pigs infected in this manner developed clinical signs of vesicular stomatitis despite seroconversion for VSNJV. Guinea pigs infected by intradermal inoculations of VSNJV in the abdomen also failed to develop clinical signs of vesicular stomatitis. Three guinea pigs given intradermal inoculations of VSNJV in the foot pad developed lesions typical of vesicular stomatitis. Transmission by the bite of C. sonorensis may have facilitated guinea pig infection with VSNJV because a single infected C. sonorensis caused seroconversion and all guinea pigs infected by insect bite seroconverted compared with 50% of the guinea pigs infected by intradermal inoculation with a higher titer VSNJV inoculum. The role of C. sonorensis in the transmission of VSNJV is discussed.
Mauri, Lucia; Barone, Luca; Al Oum, Muna; Del Longo, Alessandra; Piozzi, Elena; Manfredini, Emanuela; Stanzial, Franco; Benedicenti, Francesco; Penco, Silvana; Patrosso, Maria Cristina
2014-01-01
Oculocutaneous Albinism (OCA) is a heterogeneous group of inherited diseases involving hair, skin and eyes. To date, six forms are recognized on the effects of different melanogenesis genes. OCA4 is caused by mutations in SLC45A2 showing a heterogeneous phenotype ranging from white hair, blue irides and nystagmus to brown/black hair, brown irides and no nystagmus. The high clinic variety often leads to misdiagnosis. Our aim is to contribute to OCA4 diagnosis defining SLC45A2 genetic variants in Italian patients with OCA without any TYR, OCA2 and TYRP1 gene defects. After the clinical diagnosis of OCA, all patients received genetic counseling and genetic test. Automatic sequencing of TYR, OCA2, and TYRP1 genes was performed on DNA of 117 albino patients. Multiplex Ligation-dependent Probe Amplification (MLPA) was carried out on TYR and OCA2 genes to increase the mutation rate. SLC45A2 gene sequencing was then executed in the patients with a single mutation in one of the TYR, OCA2, TYRP1 genes and in the patients, which resulted negative at the screening of these genes. SLC45A2 gene analysis was performed in 41 patients and gene alterations were found in 5 patients. Four previously reported SLC45A2 mutations were found: p.G100S, p.W202C, p.A511E and c.986delC, and three novel variants were identified: p.M265L, p.H94D, and c.1156+1G>A. All the alterations have been detected in the group of patients without mutations in the other OCA genes. Three new variants were identified in OCA4 gene; the analysis allowed the classification of a patient previously misdiagnosed as OA1 because of skin and hair pigmentation presence. The molecular defects in SLC45A2 gene represent the 3.4% in this cohort of Italian patients, similar to other Caucasian populations; our data differ from those previously published by an Italian researcher group, obtained on a smaller cohort of patients. © 2013 Elsevier B.V. All rights reserved.
Low-dose Propofol–induced Amnesia Is Not due to a Failure of Encoding
Veselis, Robert A.; Pryor, Kane O.; Reinsel, Ruth A.; Mehta, Meghana; Pan, Hong; Johnson, Ray
2008-01-01
Background—Propofol may produce amnesia by affecting encoding. The hypothesis that propofol weakens encoding was tested by measuring regional cerebral blood flow during verbal encoding. Methods—17 volunteer participants (12 M, 30.4±6.5 years old) had regional cerebral blood flow measured using H2O15 positron emission tomography during complex and simple encoding tasks (deep vs. shallow level of processing), to identify a region of interest in the left inferior prefrontal cortex...
MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.
Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet
2016-11-01
A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).
Molecular cloning and characterization of duck interleukin-17
Interleukin-17 (IL-17) belonging to the Th17 family is a proinflammatory cytokine produced by activated T cells. A 1034-bp cDNA encoding duck IL-17 (duIL-17) was cloned from ConA-activated splenic lymphocytes of ducks. The encoded protein, predicted to consisted of 169 amino acids, displayed a molec...
Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing
2018-01-01
A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .
Stütz, Adrian M; Teran-Garcia, Margarita; Rao, D C; Rice, Treva; Bouchard, Claude; Rankinen, Tuomo
2009-11-01
The sodium bicarbonate cotransporter gene SLC4A5, associated earlier with cardiovascular phenotypes, was tested for associations in the HERITAGE Family Study, and possible mechanisms were investigated. Twelve tag-single nucleotide polymorphisms (SNPs) covering the SLC4A5 gene were analyzed in 276 Black and 503 White healthy, sedentary subjects. Associations were tested using a variance components-based (QTDT) method with data adjusted for age, sex and body size. In Whites, rs6731545 and rs7571842 were significantly associated with resting and submaximal exercise pulse pressure (PP) (0.0004 HERITAGE Family Study are likely due to neither variation in the promoter nor known coding SNPs of SLC4A5.
Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya
2015-07-01
The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015
A model for visual memory encoding.
Directory of Open Access Journals (Sweden)
Rodolphe Nenert
Full Text Available Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA. All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN. Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.
A model for visual memory encoding.
Nenert, Rodolphe; Allendorfer, Jane B; Szaflarski, Jerzy P
2014-01-01
Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA) with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA). All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions) and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN). Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s) of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.
Nakamura, Yukihiro; Harada, Harumi; Kamasawa, Naomi; Matsui, Ko; Rothman, Jason S; Shigemoto, Ryuichi; Silver, R Angus; DiGregorio, David A; Takahashi, Tomoyuki
2015-01-07
Synaptic efficacy and precision are influenced by the coupling of voltage-gated Ca(2+) channels (VGCCs) to vesicles. But because the topography of VGCCs and their proximity to vesicles is unknown, a quantitative understanding of the determinants of vesicular release at nanometer scale is lacking. To investigate this, we combined freeze-fracture replica immunogold labeling of Cav2.1 channels, local [Ca(2+)] imaging, and patch pipette perfusion of EGTA at the calyx of Held. Between postnatal day 7 and 21, VGCCs formed variable sized clusters and vesicular release became less sensitive to EGTA, whereas fixed Ca(2+) buffer properties remained constant. Experimentally constrained reaction-diffusion simulations suggest that Ca(2+) sensors for vesicular release are located at the perimeter of VGCC clusters (<30 nm) and predict that VGCC number per cluster determines vesicular release probability without altering release time course. This "perimeter release model" provides a unifying framework accounting for developmental changes in both synaptic efficacy and time course. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Tousignant, Steven J P; Bruner, Laura; Schwartz, Jake; Vannucci, Fabio; Rossow, Stephanie; Marthaler, Douglas G
2017-08-31
The study highlights the shedding pattern of Senecavirus A (SVA) during an outbreak of vesicular disease in a sow farm from the South-central Minnesota, USA. In this study, 34 individual, mixed parity sows with clinical signs of vesicular lesions and 30 individual piglets from 15 individual litters from sows with vesicular lesions were conveniently selected for individual, longitudinal sampling. Serum, tonsil, rectal, and vesicular swabs were collected on day1 post outbreak, and then again at 1, 2, 3, 4, 6, and 9 weeks post outbreak. Samples were tested at the University of Minnesota Veterinary Diagnostic Laboratory for SVA via Real Time Polymerase Chain Reaction (RT-PCR) RESULTS: In sows, vesicular lesions had the highest concentration of SVA, but had the shortest duration of detection lasting only 2 weeks. Viremia was detected for 1 week post outbreak, and quickly declined thereafter. SVA was detected at approximately the same frequency for both tonsil and rectal swabs with the highest percentage of SVA positive samples detected in the first 6 weeks post outbreak. In suckling piglets, viremia quickly declined 1 week post outbreak and was prevalent in low levels during the first week after weaning (4 weeks post outbreak) and was also detected in piglets that were co-mingled from a SVA negative sow farm. Similar to sows, SVA detection on rectal and tonsil swabs in piglets lasted approximately 6 weeks post outbreak. The study illustrates the variation of SVA shedding patterns in different sample types over a 9 week period in sows and piglets, and suggests the potential for viral spread between piglets at weaning.
González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A
2015-01-01
Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.
Directory of Open Access Journals (Sweden)
Raymond E. Lai
2018-04-01
Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport
DEFF Research Database (Denmark)
Andersen, Gitte; Rose, Christian Schack; Hamid, Yasmin Hassan
2003-01-01
The SLC2A10 gene encodes the GLUT10 facilitative glucose transporter, which is expressed in high amounts in liver and pancreas. The gene is mapped to chromosome 20q12-q13.1, a region that has been shown to be linked to type 2 diabetes. The gene was examined in 61 Danish type 2 diabetic patients......, and a total of six variants (-27C-->T, Ala206Thr, Ala272Ala, IVS2 + 10G-->A, IVS4 + 18T-->G, and IVS4 + 26G-->A) were identified and investigated in an association study, which included 503 type 2 diabetic patients and 510 glucose-tolerant control subjects. None of the variants were associated with type 2...... substantially to the pathogenesis of type 2 diabetes in the examined study population. However, the codon 206 polymorphism may be related to the interindividual variation in fasting and oral glucose-induced serum insulin levels....
Reconstitution of the fusogenic activity of vesicular stomatitis virus
Metsikkö, K.; van Meer, G.; Simons, K.
1986-01-01
Enveloped virus glycoproteins exhibit membrane fusion activity. We have analysed whether the G protein of vesicular stomatitis virus, reconstituted into liposomes, is able to fuse nucleated cells in a pH-dependent fashion. Proteoliposomes produced by octylglucoside dialysis did not exhibit cell
Action potential-independent and pharmacologically unique vesicular serotonin release from dendrites
Colgan, Lesley A.; Cavolo, Samantha L.; Commons, Kathryn G.; Levitan, Edwin S.
2012-01-01
Serotonin released within the dorsal raphe nucleus (DR) induces feedback inhibition of serotonin neuron activity and consequently regulates mood-controlling serotonin release throughout the forebrain. Serotonin packaged in vesicles is released in response to action potentials by the serotonin neuron soma and terminals, but the potential for release by dendrites is unknown. Here three-photon (3P) microscopy imaging of endogenous serotonin in living rat brain slice, immunofluorescence and immuno-gold electron microscopy detection of VMAT2 (vesicular monoamine transporter 2) establish the presence of vesicular serotonin within DR dendrites. Furthermore, activation of glutamate receptors is shown to induce vesicular serotonin release from dendrites. However, unlike release from the soma and terminals, dendritic serotonin release is independent of action potentials, relies on L-type Ca2+ channels, is induced preferentially by NMDA, and displays distinct sensitivity to the selective serotonin reuptake inhibitor (SSRI) antidepressant fluoxetine. The unique control of dendritic serotonin release has important implications for DR physiology and the antidepressant action of SSRIs, dihydropyridines and NMDA receptor antagonists. PMID:23136413
Beam based alignment of the SLC final focus sextupoles
International Nuclear Information System (INIS)
Emma, P.; Irwin, J.; Phinney, N.; Raimondi, P.; Toge, N.; Walker, N.J.; Ziemann, V.
1993-05-01
The strong demagnification inherent in final focus systems requires local cancellation of the resulting chromaticty. Strong sextupole pair separated by a -I transform are positioned π/2 in the betatron phase away from the Interaction Point (IP) in order to cancel chromatic aberrations primarily due to the final quadrupoles. Sextupole alignment is critical in order to provide orthogonal tuning of the chromaticty and, in the case of the SLC, to limit the third and higher order optical aberrations generated from misaligned and 'nested' horizontal and vertical sextupole pairs. Reported here is a novel technique for aligning the beam centroid to the sextupole centers, which uses measurements of the criticality dependent parameter - the beam size at the IP. Results for the SLC final focus sextupoles are presented, where a resolution of <50 μm is achieved
Haack, Tobias B.; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A.; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M.; Meitinger, Thomas; Yonezawa, Atsushi
2012-01-01
Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin tran...
Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen
2015-04-03
Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.
Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong
2017-03-01
Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Three bunch energy stabilization for the SLC injector
International Nuclear Information System (INIS)
Sheppard, J.C.; Almog, I.; Bambade, P.S.; Clendenin, J.E.; Jobe, R.K.; Phinney, N.; Shoaee, H.; Stiening, R.F.; Thompson, K.A.
1986-09-01
Slow feedback has been developed to control the energy and energy spread of the beams which are injected into the SLC damping rings. Within a single RF pulse, two bunches of electrons and one bunch of positrons are accelerated to an energy of 1.21 GeV in the injector of the SLC. The two electron bunches are deflected into the north damping ring while the positrons are targeted into the south ring. In order to fit into the acceptance of the rings, the composite energy deviation and energy spread of the beams must be less than 2% full width. Control of the beam energy characteristics is accomplished with a set of computer controlled feedback loops which monitor the parameters of the three bunches and make adjustments to the available RF energy, RF phasing, and RF timing. This paper presents an overview of the feedback algorithms and of the special hardware developments, and reports on the operational status of the processes
Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.
Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa
2011-03-01
The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.
50 CFR 17.8 - Import exemption for threatened, CITES Appendix-II wildlife.
2010-10-01
... 50 Wildlife and Fisheries 2 2010-10-01 2010-10-01 false Import exemption for threatened, CITES Appendix-II wildlife. 17.8 Section 17.8 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE..., EXPORTATION, AND IMPORTATION OF WILDLIFE AND PLANTS (CONTINUED) ENDANGERED AND THREATENED WILDLIFE AND PLANTS...
First results from SLD with polarized electron beam at SLC
International Nuclear Information System (INIS)
Fero, M.J.
1992-12-01
The SLAC Linear Collider (SLC) has been modified to collide a longitudinally polarized electron beam with the unpolarized positron beam. We review the beginning of polarized beam running at the SLC, and report on the measurement of the left-right cross section asymmetry (A LR ) made with a sample of 10,224 Z decays collected over the course of the 1992 run. The average beam polarization for this set of Z decays was 22.4 ± 0.6%(syst.). A LR was measured to be 0.100 ± 0.044(stat.) ± 0.004(syst.). From this measurement, the weak mixing angle defined at the Z boson pole is determined to be sin 2 θ eff W = 0.2378 ± 0.0056 ± 0.0005
Wolf, Marlene; Clark-Lewis, Ian; Buri, Caroline; Langen, Hanno; Lis, Maddalena; Mazzucchelli, Luca
2003-01-01
Cathepsin D (Cath-D) expression in human primary breast cancer has been associated with a poor prognosis. In search of a better understanding of the Cath-D substrates possibly involved in cancer invasiveness and metastasis, we investigated the potential interactions between this protease and chemokines. Here we report that purified Cath-D, as well as culture supernatants from the human breast carcinoma cell lines MCF-7 and T47D, selectively degrade macrophage inflammatory protein (MIP)-1α (CCL3), MIP-1β (CCL4), and SLC (CCL21). Proteolysis was totally blocked by the protease inhibitor pepstatin A, and specificity of Cath-D cleavage was demonstrated using a large chemokine panel. Whereas MIP-1α and MIP-1β degradation was rapid and complete, cleavage of SLC was slow and not complete. Mass spectrometry analysis showed that Cath-D cleaves the Leu58 to Trp59 bond of SLC producing two functionally inactive fragments. Analysis of Cath-D proteolysis of a series of monocyte chemoattractant protein-3/MIP-1β hybrids indicated that processing of MIP-1β might start by cleaving off amino acids located in the C-terminal domain. In situ hybridization studies revealed MIP-1α, MIP-1β, and Cath-D gene expression mainly in the stromal compartment of breast cancers whereas SLC transcripts were found in endothelial cells of capillaries and venules within the neoplastic tissues. Cath-D production in the breast carcinoma cell lines MCF-7 and T47D, as assessed by enzyme-linked immunosorbent assay of culture supernatants and cell lysates, was not affected by stimulation with chemokines such as interleukin-8 (CXCL8), SDF-1 (CXCL12), and SLC. These data suggest that inactivation of chemokines by Cath-D possibly influences regulatory mechanisms in the tumoral extracellular microenvironment that in turn may affect the generation of the antitumoral immune response, the migration of cancer cells, or both processes. PMID:12651610
17 CFR 210.8-03 - Interim financial statements.
2010-04-01
... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Interim financial statements... AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES EXCHANGE... ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Article 8 Financial Statements of...
17 CFR 210.8-02 - Annual financial statements.
2010-04-01
... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Annual financial statements... AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES EXCHANGE... ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Article 8 Financial Statements of...
International Nuclear Information System (INIS)
Whitt, M.A.; Chong, L.; Rose, J.K.
1989-01-01
The authors have used transient expression of the wild-type vesicular stomatitis virus (VSV) glycoprotein (G protein) from cloned cDNA to rescue a temperature-sensitive G protein mutant of VSV in cells at the nonpermissive temperature. Using cDNAs encoding G proteins with deletions in the normal 29-amino-acid cytoplasmic domain, they determined that the presence of either the membrane-proximal 9 amino acids or the membrane-distal 12 amino acids was sufficient for rescue of the temperature-sensitive mutant. G proteins with cytoplasmic domains derived from other cellular or viral G proteins did not rescue the mutant, nor did G proteins with one or three amino acids of the normal cytoplasmic domain. Rescue correlated directly with the ability of the G proteins to be incorporated into virus particles. This was shown by analysis of radiolabeled particles separated on sucrose gradients as well as by electron microscopy of rescued virus after immunogold labeling. Quantitation of surface expression showed that all of the mutated G proteins were expressed less efficiently on the cell surface than was wild-type G protein. However, they were able to correct for differences in rescue efficiency resulting from differences in the level of surface expression by reducing wild-type G protein expression to levels equivalent to those observed for the mutated G proteins. The results provide evidence that at least a portion of the cytoplasmic domain is required for efficient assembly of the VSV G protein into virions during virus budding
Solid state high power amplifier for driving the SLC injector klystron
International Nuclear Information System (INIS)
Judkins, J.G.; Clendenin, J.E.; Schwarz, H.D.
1985-03-01
The SLC injector klystron rf drive is now provided by a recently developed solid-state amplifier. The high gain of the amplifier permits the use of a fast low-power electronic phase shifter. Thus the SLC computer control system can be used to shift the phase of the high-power rf rapidly during the fill time of the injector accelerator section. These rapid phase shifts are used to introduce a phase-energy relationship in the accelerated electron pulse in conjunction with the operation of the injector bunch compressor. The amplifier, the method of controlling the rf phase, and the operational characteristics of the system are described. 5 refs., 4 figs
Determination of electroweak parameters at the SLC
International Nuclear Information System (INIS)
Torrence, E.
1996-09-01
We present an improved measurement of the left-right cross section asymmetry (A LR ) for Z 0 boson production by e + e - collisions. The measurement was performed at a center-of-mass energy of 91.28 GeV with the SLD detector at the SLAC Linear Collider (SLC) during the 1994-95 running period. The luminosity-weighted average polarization of the SLC electron beam during this run was measured to be (77.23 ± 0.52)%. Using a sample of 93,644 hadronic Z 0 decays, we measure the pole asymmetry A LR 0 to be 0.1512 ± 0.0042(stat.) ± 0.0011(syst.) which is equivalent to an effective weak mixing angle of sin 2 θ W eff = 0.23100 ± 0.00054(stat.) ± 0.00014(syst.). We also present a preliminary direct measurement of the Z 0 -lepton coupling asymmetries A e , A μ , and A τ extracted from the differential cross section observed in leptonic Z 0 decays. We combine these results with our previous A LR measurement to obtain a combined determination of the weak mixing angle sin 2 θ W eff = 0.23061 ± 0.00047
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Uttenthal, Åse; Fernandez, Jovita
2005-01-01
In order to establish a rapid and reliable system for the detection of vesicular stomatitis virus (VSV), we developed a quantitative reverse transcription-PCR assay for the detection, quantification, and differentiation of the major serotypes, VSV Indiana and VSV New Jersey, using a closed......-tube multiplex format. The detection system is based on the recently invented primer-probe energy transfer (PriProET) system. A region of the gene encoding the RNA-dependent RNA polymerase was amplified by using VSV-specific primers in the presence of two serotype-specific fluorescent probes. By incorporating...... probes. The limits of detection ware found to be less than 10 50% tissue culture infective doses/ml for both serotypes. The diagnostic value of the new method was tested with clinical materials from experimentally infected pigs, and it is concluded that the method is a powerful tool for the rapid...
17 CFR 275.206(4)-8 - Pooled investment vehicles.
2010-04-01
... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Pooled investment vehicles... COMMISSION (CONTINUED) RULES AND REGULATIONS, INVESTMENT ADVISERS ACT OF 1940 § 275.206(4)-8 Pooled investment vehicles. (a) Prohibition. It shall constitute a fraudulent, deceptive, or manipulative act...
Verification of the SLC wake potentials
International Nuclear Information System (INIS)
Bane, K.; Weiland, T.
1983-01-01
The accurate knowledge of the monopole, dipole, and quadrupole wake potentials is essential for SLC. These wake potentials were previously computed by the modal method. The time domain code TBCI allows independent verification of these results. This comparison shows that the two methods agree to within 10% for bunch lengths down to 1 mm. TBCI results also indicate that rounding the irises gives at least a 10% reduction in the wake potentials
Directory of Open Access Journals (Sweden)
Maider Ibarrola-Villava
Full Text Available As the incidence of Malignant Melanoma (MM reflects an interaction between skin colour and UV exposure, variations in genes implicated in pigmentation and tanning response to UV may be associated with susceptibility to MM. In this study, 363 SNPs in 65 gene regions belonging to the pigmentation pathway have been successfully genotyped using a SNP array. Five hundred and ninety MM cases and 507 controls were analyzed in a discovery phase I. Ten candidate SNPs based on a p-value threshold of 0.01 were identified. Two of them, rs35414 (SLC45A2 and rs2069398 (SILV/CKD2, were statistically significant after conservative Bonferroni correction. The best six SNPs were further tested in an independent Spanish series (624 MM cases and 789 controls. A novel SNP located on the SLC45A2 gene (rs35414 was found to be significantly associated with melanoma in both phase I and phase II (P<0.0001. None of the other five SNPs were replicated in this second phase of the study. However, three SNPs in TYR, SILV/CDK2 and ADAMTS20 genes (rs17793678, rs2069398 and rs1510521 respectively had an overall p-value<0.05 when considering the whole DNA collection (1214 MM cases and 1296 controls. Both the SLC45A2 and the SILV/CDK2 variants behave as protective alleles, while the TYR and ADAMTS20 variants seem to function as risk alleles. Cumulative effects were detected when these four variants were considered together. Furthermore, individuals carrying two or more mutations in MC1R, a well-known low penetrance melanoma-predisposing gene, had a decreased MM risk if concurrently bearing the SLC45A2 protective variant. To our knowledge, this is the largest study on Spanish sporadic MM cases to date.
DEFF Research Database (Denmark)
Oskari Kilpeläinen, Tuomas; Lakka, T A; Laaksonen, D E
2007-01-01
. The interaction of the SNPs with the change in PA on the conversion to T2D was assessed using Cox regression with adjustments for the other components of the intervention (dietary changes, weight reduction). The carriers of the common homozygous genotype of rs5393, rs5394, or rs5404 of SLC2A2 and rs3758947...
SLC energy upgrade program at SLAC
International Nuclear Information System (INIS)
Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebacqz, J.V.
1985-01-01
The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators
SLC Energy Upgrade Program at SLAC
International Nuclear Information System (INIS)
Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebacqz, J.V.
1985-03-01
The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators
Bellanger, Anne-Pauline; Mougey, Valentine; Pallandre, Jean-Rene; Gbaguidi-Haore, Houssein; Godet, Yann; Millon, Laurence
2017-08-25
Alveolar echinococcosis is a severe chronic helminthic disease that mimics slow-growing liver cancer. The immune evasion strategy of Echinococcus multilocularis Leuckart, 1863 remains poorly understood. The aim of this study was to investigate in vitro the impact of E. multilocularis vesicular fluid (Em-VF) on peripheral blood mononuclear cells (PBMC) and on natural killer (NK) cells. PBMC and NK cells were exposed to Em-VF (1 µg/ml) during six days. The effect of Em-VF was assessed on CD69, viability and proliferation, and on and transforming growth factor β (TGF-β), interferon γ (IFN-γ), interleukin 17 (IL-17) and interleukin 10, using flow cytometry and ELISA, respectively. Exposure to Em-VF had no bearing on PBMC's viability, proliferation and expression of CD69. In contrast, higher levels of IL-17 at day three and of TGF-β at day six were observed in PBMC supernatant after exposure to Em-VF (p Wilcoxon signed-rank test). Exposure to Em-VF induced a significant decrease of CD69 expression of NK cells at day three and a significant decrease of proliferation of NK cells at day six (p Wilcoxon signed-rank test). In contrast, NK cells viability and levels of cytokines did not vary significantly over Em-VF stimulation. Exposure to Em-VF had a significant bearing on activation and proliferation of NK cells. NK cells may play an important role in the immune response of the host against E. multilocularis.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
1991-01-01
Encoding circuit for transforming a picture signal into blocks of, for example, 8*8 coefficients, in which each block of coefficients is read motion-adaptively. In the case of motion within a sub-picture, the block of coefficients is read in such an order that the obtained series of coefficients
DEFF Research Database (Denmark)
Christensen, H.; Jakobsen, I.
1993-01-01
Cucumber was grown in a partially sterilized sand-soil mixture with the vesicular-arbuscular mycorrhizal (VAM) fungus Glomus fasciculatum or left uninoculated. Fresh soil extract was places in polyvinyl chloride tubes without propagules of mycorrhizal fungi. Root tips and root segments...... and top of tubes, and of cocci with a diameter of 0.55-0.78 mum in the bulk soil in the center of tubes, were significantly reduced by VAM fungi. The extremely high bacterial biomass (1-7 mg C g-1 dry weight soil) was significant reduced by mycorrhizal colonization on root segments and in bulk soil...... biomass, and changed the spatial pattern of bacterial growth compared to non-mycorrhizal cucumbers. The [H-3]-thymidine incorporation was significantly higher on root tips in the top of tubes, and on root segments and bulk soil in the center of tubes on non-mycorrhizal plants compared to mycorrhizal...
CD3+CD8+CD161high Tc17 cells are depleted in HIV-infection
DEFF Research Database (Denmark)
Gaardbo, Julie Christine; Hartling, Hans Jakob; Thorsteinsson, Kristina
2012-01-01
CD8+ Tc17 cells with pro-inflammatory properties have only recently been acknowledged, and Tc17 cells in HIV-infection are undescribed. CD3+CD8+CD161 Tc17 cells and the production of Interleukin-17 were examined in untreated and treated HIV-infected patients, HIV-HCV co-infected patients...... and healthy controls. Depletion of CD3+CD8+CD161 Tc17 cells and diminished production of Interleukin-17 in HIV-infected patients was found. The level of Tc17 cells was associated with the level of the CD4+ count in treated patients....
A Missense Mutation in SLC45A2 Is Associated with Albinism in Several Small Long Haired Dog Breeds.
Wijesena, Hiruni R; Schmutz, Sheila M
2015-01-01
Homozygosity for a large deletion in the solute carrier family 45, member 2 (SLC45A2) gene causes oculocutaneous albinism (OCA) in the Doberman Pinscher breed. An albino Lhasa Apso did not have this g.27141_31223del (CanFam2) deletion in her SLC45A2 sequence. Therefore, SLC45A2 was investigated in this female Lhasa Apso to search for other possible variants that caused her albinism. The albino Lhasa Apso was homozygous for a nonsynonymous substitution in the seventh exon, a c.1478G>A base change that resulted in a glycine to aspartic acid substitution (p.G493D). This mutation was not found in a wolf, a coyote, or any of the 15 other Lhasa Apso dogs or 32 other dogs of breeds related to the Lhasa Apso. However, an albino Pekingese, 2 albino Pomeranians, and an albino mixed breed dog that was small and long haired were also homozygous for the 493D allele. The colored puppies of the albino Lhasa Apso and the colored dam of the 2 albino Pomeranians were heterozygous for this allele. However, an albino Pug was homozygous for the 493G allele and therefore although we suggest the 493D allele causes albinism when homozygous in several small, long haired dog breeds, it does not explain all albinism in dogs. A variant effect prediction for the albino Lhasa Apso confirms that p.G493D is a deleterious substitution, and a topology prediction for SLC45A2 suggests that the 11th transmembrane domain where the 493rd amino acid was located, has an altered structure. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
17 CFR 143.8 - Inflation-adjusted civil monetary penalties.
2010-04-01
... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Inflation-adjusted civil... JURISDICTION General Provisions § 143.8 Inflation-adjusted civil monetary penalties. (a) Unless otherwise amended by an act of Congress, the inflation-adjusted maximum civil monetary penalty for each violation of...
Zheng, Yuxuan; Ritzenthaler, Jeffrey D; Burke, Tom J; Otero, Javier; Roman, Jesse; Watson, Walter H
2018-04-01
Aging is associated with progressive oxidation of the extracellular environment. The redox state of human plasma, defined by the concentrations of cysteine (Cys) and cystine (CySS), becomes more oxidized as we age. Recently, we showed that fibroblasts isolated from the lungs of young and old mice retain this differential phenotype; old cells produce and maintain a more oxidizing extracellular redox potential (E h (Cys/CySS)) than young cells. Microarray analysis identified down-regulation of Slc7a11, the light subunit of the CySS/glutamate transporter, as a potential mediator of age-related oxidation in these cells. The purpose of the present study was to investigate the mechanistic link between Slc7a11 expression and extracellular E h (Cys/CySS). Sulforaphane treatment or overexpression of Slc7a11 was used to increase Slc7a11 in lung fibroblasts from old mice, and sulfasalazine treatment or siRNA-mediated knock down was used to decrease Slc7a11 in young fibroblasts. Slc7a11 mRNA levels were measured by real-time PCR, Slc7a11 activity was determined by measuring the rate of glutamate release, Cys, CySS, glutathione (GSH) and its disulfide (GSSG) were measured by HPLC, and E h (Cys/CySS) was calculated from the Nernst equation. The results showed that both E h (Cys/CySS) and E h (GSH/GSSG) were more oxidized in the conditioned media of old cells than in young cells. Up-regulation of Slc7a11 via overexpression or sulforaphane treatment restored extracellular E h (Cys/CySS) in cultures of old cells, whereas down-regulation reproduced the oxidizing E h (Cys/CySS) in young cells. Only sulforaphane treatment was able to increase total GSH and restore E h (GSH/GSSG), whereas overexpression, knock down and sulfasalazine had no effect on these parameters. In addition, inhibition of GSH synthesis with buthionine sulfoximine had no effect on the ability of cells to restore their extracellular redox potential in response to an oxidative challenge. In conclusion, our study
Directory of Open Access Journals (Sweden)
Quirino Cordeiro
2010-10-01
Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,05
Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.
Rao, Suryadevara S; Hildebrand, David
2009-10-01
The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.
Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).
Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M
2015-12-07
The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.
Inert gas narcosis and the encoding and retrieval of long-term memory.
Kneller, Wendy; Hobbs, Malcolm
2013-12-01
Prior research has indicated that inert gas narcosis (IGN) causes decrements in free recall memory performance and that these result from disruption of either encoding or self-guided search in the retrieval process. In a recent study we provided evidence, using a Levels of Processing approach, for the hypothesis that IGN affects the encoding of new information. The current study sought to replicate these results with an improved methodology. The effect of ambient pressure (111.5-212.8 kPa/1-11 msw vs. 456-516.8 kPa/35-41 msw) and level of processing (shallow vs. deep) on free recall memory performance was measured in 34 divers in the context of an underwater field experiment. Free recall was significantly worse at high ambient pressure compared to low ambient pressure in the deep processing condition (low pressure: M = 5.6; SD = 2.7; high pressure: M = 3.3; SD = 1.4), but not in the shallow processing condition (low pressure: M = 3.9; SD = 1.7; high pressure: M = 3.1; SD = 1.8), indicating IGN impaired memory ability in the deep processing condition. In the shallow water, deep processing improved recall over shallow processing but, significantly, this effect was eliminated in the deep water. In contrast to our earlier study this supported the hypothesis that IGN affects the self-guided search of information and not encoding. It is suggested that IGN may affect both encoding and self-guided search and further research is recommended.
Directory of Open Access Journals (Sweden)
Mignon Laurence
2010-02-01
Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.
Directory of Open Access Journals (Sweden)
André Bordinassi Medina
2017-04-01
Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.
Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich
2013-11-22
Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.
Hoekstra, PJ; Bijzet, J; Limburg, PC; Steenhuis, MP; Troost, PW; Oosterhoff, MD; Korf, J; Kallenberg, CGM; Minderaa, RB
Objective: Elevated D8/17 expression on B lymphocytes is a known susceptibility marker of rheumatic fever. Previous studies have reported higher than usual D8/ 17 expression on B lymphocytes of patients with tic disorders. The purpose of this study was to assess D8/17 expression on B lymphocytes of
Precision electroweak physics with the SLD/SLC: The left-right polarization asymmetry
International Nuclear Information System (INIS)
Rowson, P.C.
1994-12-01
Following a brief review of a commonly used general framework for the analysis of radiative corrections and possible new physics, the recent precision results from the SLD/SLC are discussed and used to test the standard electroweak model. In the 1993 SLD/SLC run, the SLD recorded 50,000 Z events produced by the collision of longitudinally polarized electrons on unpolarized positrons at a center-of-mass energy of 91.26 GeV. The luminosity-weighted average polarization of the SLC electron beam was (63.0 ± 1.1)%. We measure the left-right cross-section asymmetry in Z boson production, A LR , to be 0.1628 ± 0.0071 (stat) ± 0.0028 (syst) which determines the effective weak mixing angle to be sin 2 θ W eff = 0.2292 ± 0.0009 (stat) ± 0.0004 (syst). When averaged with our 1992 result, we obtain sin 2 θ W eff = 0.2294 ± 0. 0010. This result differs from analogous LEP results at the level of about 2.5 σ. The world averages of electroweak data are comfortably in agreement with the standard model
Configuring the SLC linac for injection into PEP
International Nuclear Information System (INIS)
Bane, K.L.F.
1989-01-01
From time to time the normal SLC physics program is to be interrupted so that beam can be delivered to PEP. In order that the switch to PEP injection (and the switch back again) can be accomplished quickly and easily, the gun, the damping rings, the linac phase ramp, the energy profile of the linac klystrons for the scavenger bunch, and the entire positron production system are to be kept the same as in the SLC configuration. What mainly remains to be changed is the linac klystron profile for the leading two bunches - those going to PEP. The new klystron profile must be such that it leaves these two beams (1) with final energies that match that of the storage ring and (2) with final energy spectra that fit within the energy aperture of the PEP transfer line. The conditions that need to be met in order to achieve these two goals are discussed in this note. 1 ref., 2 figs
Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming
2016-08-01
The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.
Directory of Open Access Journals (Sweden)
Amy J Osborne
Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.
Mueller, W. U.; Dingwell, D. B.; Downey, W. S.; Mastin, L. G.
2008-12-01
Recognizing pyroclastic deposits that originate directly from magmatic and phreatomagmatic explosions in a subaqueous setting is based upon sedimentary structures, such as massive, stratified, and graded beds as well as (pyro)clast size. Ideally such deposits form ordered fining-and thinning-upward sequences. Pumice, scoria, glass shards, euhedral and broken crystals, and lithic fragments are constituents that support an explosive heritage. Recent deep-sea ROV and submersible dives have retrieved non-vesicular to vesicle- poor, mm-scale, mafic shards in 5-15 cm-thick massive and/or graded (stratified) deposits, for which a subaqueous explosive origin has been inferred. These sheet hyaloclastites with variable shard shapes were first documented on Seamount 6 as deep-sea Limu O Pele at water depths > 1000 m. We identified in Seamount 6 samples equant to blocky shards with angular to subrounded terminations, but also subordinate hair-like and contorted glassy filaments, warped shards and irregular shards. Shards display internal laminations (flow-banding?) and have local perlitic fractures. Bubble wall shards derived from scoria burst were rare. In combination with all the above and a poor shard vesicularity (tubes and ponded magma in depths > 1000 m. We envision that hydrostatic pressure commensurate with water depth played a significant role. The deposits can be readily explained by a hydroclastic process whereby fragmentation occurred at the milli-second (Limu) to second scale (hyaloclastite). Hence, hyperquenched glass shards or thread-like glass filaments need not require magmatic explosivity. Constant surface interaction between aphyric, low-viscosity, high temperature, magma-lava at depth with seawater causes fragmentation (granulation) that can generate such delicate shards. The transfer of heat to the ambient medium, seawater, favours turbulent convection causing strong water movement that strips glassy rinds and lofts the fine-grained shards and Limu O Pele
Directory of Open Access Journals (Sweden)
Dongsha Wang
Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.
Berninger, Mary Lou; O'Hearn, Emily; Lomkin, Richanne; Newens, Ken; Havas, Karyn A
2018-03-01
Vesicular stomatitis (VS) is a vesicular disease of horses, cattle, and pigs in the Western Hemisphere caused by viruses in the genus Vesiculovirus. Disease manifests as vesicles and erosions on the oral mucosa, teats, prepuce, and coronary band, and is similar in presentation to foot-and-mouth disease. Laboratory confirmation is therefore required. Conventional assays include competitive (c)ELISA and complement fixation (CF). The cELISA provides more accurate herd-level detection of VSV-exposed cattle, but may lack the ability to capture fluctuating antibody levels in individual animals. The CF assay can confirm newly infected animals because of its ability to detect antigen-antibody complexes, thus is considered to be indicative of IgM. We evaluated the immune status of 2 herds affected by VSV in 2014 by testing sera collected in June 2015. Two conventional assays were compared to a novel IgM-IgG ELISA. When sampled in 2015, both herds had detectable VSV-specific antibodies; 18% and 36% of animals tested by cELISA and 2% and 8% of animals tested by CF were positive. The novel IgM-IgG assay exhibited fair agreement (adjusted kappa score of 48) with the conventional assays, and should be evaluated further to assess its ability to replace the 2 separate assays with a single assay system, or for its ability to replace the CF assay as a more sensitive method for defining newly exposed animals.
RF phase distribution systems at the SLC
International Nuclear Information System (INIS)
Jobe, R.K.; Schwarz, H.D.
1989-04-01
Modern large linear accelerators require RF distribution systems with minimal phase drifts and errors. Through the use of existing RF coaxial waveguides, and additional installation of phase reference cables and monitoring equipment, stable RF distribution for the SLC has been achieved. This paper discusses the design and performance of SLAC systems, and some design considerations for future colliders. 6 refs., 4 figs
Review of lattice measurement techniques at the SLC
International Nuclear Information System (INIS)
Barklow, T.; Emma, P.; Krejcik, P.; Walker, N.
1991-11-01
A technique is described for reconstructing the first order transport matrix (R) for a given beam line. Emphasis is placed on the rigorous error analysis of the data, and the use of powerful statistical techniques to estimate unknown systematic errors. The application of the technique to the measurement and subsequent correction of the SLC Arcs is briefly described. 5 refs., 4 figs
Signifiance of Arginine 20 in the 2A protease for swine vesicular disease virus pathogenicity
DEFF Research Database (Denmark)
Inoue, Toru; Zhang, Zhidong; Wang, Leyuan
2007-01-01
Pathogenic and attenuated strains of swine vesicular disease virus (SVDV), an enterovirus, have been characterized previously and, by using chimeric infectious cDNA clones, the key determinants of pathogenicity in pigs have been mapped to the coding region for 1D–2A. Within this region, residue 20...
Directory of Open Access Journals (Sweden)
Mychaleckyj Josyf C
2005-12-01
Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.
Directory of Open Access Journals (Sweden)
Guanghou Shui
Full Text Available BACKGROUND: Phosphatidic acid (PA is a key regulated intermediate and precursor for de novo biosynthesis of all glycerophospholipids. PA can be synthesized through the acylation of lysophosphatidic acid (LPA by 1-acyl-3-phosphate acyltransferase (also called lysophosphatidic acid acyltransferase, LPAAT. Recent findings have substantiated the essential roles of acyltransferases in various biological functions. METHODOLOGIES/PRINCIPAL FINDINGS: We used a flow-injection-based lipidomic approach with approximately 200 multiple reaction monitoring (MRM transitions to pre-screen fatty acyl composition of phospholipids in the yeast Saccharomyces cerevisiae mutants. Dramatic changes were observed in fatty acyl composition in some yeast mutants including Slc1p, a well-characterized LPAAT, and Cst26p, a recently characterized phosphatidylinositol stearoyl incorporating 1 protein and putative LPAAT in S. cerevisiae. A comprehensive high-performance liquid chromatography-based multi-stage MRM approach (more than 500 MRM transitions was developed and further applied to quantify individual phospholipids in both strains to confirm these changes. Our data suggest potential fatty acyl substrates as well as fatty acyls that compensate for defects in both Cst26p and Slc1p mutants. These results were consistent with those from a non-radioactive LPAAT enzymatic assay using C17-LPA and acyl-CoA donors as substrates. CONCLUSIONS: We found that Slc1p utilized fatty acid (FA 18:1 and FA 14:0 as substrates to synthesize corresponding PAs; moreover, it was probably the only acyltransferase responsible for acylation of saturated short-chain fatty acyls (12:0 and 10:0 in S. cerevisiae. We also identified FA 18:0, FA 16:0, FA 14:0 and exogenous FA 17:0 as preferred substrates for Cst26p because transformation with a GFP-tagged CST26 restored the phospholipid profile of a CST26 mutant. Our current findings expand the enzymes and existing scope of acyl-CoA donors for
Directory of Open Access Journals (Sweden)
Daniela Paccagnini
2009-09-01
Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.