Natural generalization of Slater determinants to more than one dimension

Science.gov (United States)

Sunko, Denis

The calculation of realistic N-body wave functions for identical fermions is still an open problem in physics, chemistry, and materials science, even for N as small as two. Here a fundamental algebraic structure of many-body Hilbert space is described, enabling theoretically well-founded systematic investigation of wave-function space. The structure allows an arbitrary many-fermion wave function to be written in terms of a finite number of antisymmetric functions called shapes, which cannot be constructed by combining one-dimensional wave functions. Shapes naturally generalize the single-Slater-determinant form for the ground state to more than one dimension. Their number is exactly N! d - 1 in d dimensions. A general algorithm is given to list them all in terms of standard Slater determinants. Conversely, excitations which can be induced from the one-dimensional case are bosonised into a system of distinguishable bosons, called Euler bosons, much like the electromagnetic field is quantized in terms of photons distinguishable by their wave numbers. Their wave functions are given explicitly in terms of elementary symmetric functions, reflecting the fact that the fermion sign problem is trivial in one dimension. The shapes are all possible vacua for the Euler bosons.

Calculation Of Multicenter Electric Field Integrals Over Slater Type Orbitals

International Nuclear Information System (INIS)

Zaim, N.

2010-01-01

Using the properties of complete orthonormal sets of Ψ α -exponential type orbitals (α1,0,-1,-2, ...) and the relations for overlap integrals, the calculations for the multicenter electric field integrals of Slater type orbitals are performed. The results of computer calculations are presented. The convergence of the series is tested by calculating concrete cases for the arbitrary values of quantum numbers, orbital parameters and internuclear distances.

Extremely compact formulas for the Fourier transform of a product of two-centre Slater-type orbitals

International Nuclear Information System (INIS)

Vukovic, T; Dmitrovic, S

2010-01-01

A compact formula for the Fourier transform of a product of Slater-type orbitals on different centres is derived. The integral is reduced to a finite one-dimensional integration over non-oscillatory hypergeometric functions of type 1 F 2 (x;y;z). The formula is valid for all quantum numbers and does not involve the reduced Bessel functions that are usually used to evaluate these integrals. Reduced formulas are calculated for some special directions in the reciprocal space. Also, some useful identities for the Fourier transforms of a product of Slater-type orbitals with correlated sets of parameters are obtained. In order to illustrate simple and efficient use of the presented results, we have applied them to graphene.

Measuring market orientation: further evidence on Narver and Slater's three-component scale.

Science.gov (United States)

Chakrabarty, Subhra; Rogé, Joseph N

2003-12-01

A mail survey of a national random sample of 2,000 marketing managers was conducted. The data provided by 222 respondents were analyzed to assess the dimensionality of Narver and Slater's 15-item measure of market orientation. A confirmatory factor analysis, using LISREL 8.53, provided support for each of the separate dimensions of customer orientation, competitor orientation, and interfunctional coordination. However, a combined 3-factor model of market orientation was not supported. Directions for research are suggested.

78 FR 19299 - Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound...

Science.gov (United States)

2013-03-29

... DEPARTMENT OF THE INTERIOR National Park Service [NPS-WASO-NAGPRA-12395; PPWOCRADN0-PCU00RP14.R50000] Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound... History, University of Puget Sound, has completed an inventory of human remains in consultation with the...

Marketing Ignorance and the Validity of Narver and Slater's MKTOR Scale in High-Tech Russian Firms

NARCIS (Netherlands)

Roersen, Mariska J.; Kraaijenbrink, Jeroen; Groen, Aard J.

A firm's market orientation is an important factor influencing its ability to successfully develop and introduce new products. To measure market orientation, Narver and Slater's MKTOR scale has been accepted in the literature as a valid and reliable scale. In fact, it can be considered state of the

Marketing ignorance and the validity of Narver and Slater's MKTOR scale in high-tech Russian firms

NARCIS (Netherlands)

Roersen, Mariska; Kraaijenbrink, Jeroen; Groen, Arend J.

2013-01-01

A firm's market orientation is an important factor influencing its ability to successfully develop and introduce new products. To measure market orientation, Narver and Slater's MKTOR scale has been accepted in the literature as a valid and reliable scale. In fact, it can be considered state of the

Oscillator strength of partially ionized high-Z atom on Hartree-Fock Slater model

International Nuclear Information System (INIS)

Nakamura, S.; Nishikawa, T.; Takabe, H.; Mima, K.

1991-01-01

The Hartree-Fock Slater (HFS) model has been solved for the partially ionized gold ions generated when an intense laser light is irradiated on a gold foil target. The resultant energy levels are compared with those obtained by a simple screened hydrogenic model with l-splitting effect (SHML). It is shown that the energy levels are poorly model by SHML as the ionization level becomes higher. The resultant wave functions are used to evaluate oscillator strength of important line radiations and compared with those obtained by a simple model using hydrogenic wave functions. Its demonstrated that oscillator strength of the 4p-4d and 4d-4f lines are well modeled by the simple method, while the 4-5 transitions such as 4f-5g, 4d-5f, 4p-5d, and 4f-5p forming the so-called N-band emission are poorly modeled and HFS results less strong line emissions. (author)

Modular relations for the Rogers-Ramanujan-Slater type functions of order fifteen and its applications to partitions

Directory of Open Access Journals (Sweden)

Chandrashekar Adiga

2013-10-01

Full Text Available In a manuscript of Ramanujan, published with his Lost Notebook [20] there are forty identities involving the Rogers-Ramanujan functions. In this paper, we establish several modular relations involving the Rogers-Ramanujan functions and the Rogers-Ramanujan-Slater type functions of order fifteen which are analogues to Ramanujan’s well known forty identities. Furthermore, we give partition theoretic interpretations of two modular relations.

Efficient evaluation of the Fourier transform over products of Slater-type orbitals on different centers

International Nuclear Information System (INIS)

Niehaus, T A; Lopez, R; Rico, J F

2008-01-01

Using the shift-operator technique, a compact formula for the Fourier transform of a product of two Slater-type orbitals located on different atomic centers is derived. The result is valid for arbitrary quantum numbers and was found to be numerically stable for a wide range of geometrical parameters and momenta. Details of the implementation are presented together with benchmark data for representative integrals. We also discuss the assets and drawbacks of alternative algorithms available and analyze the numerical efficiency of the new scheme

On the Least-Squares Fitting of Slater-Type Orbitals with Gaussians: Reproduction of the STO-NG Fits Using Microsoft Excel and Maple

Science.gov (United States)

Pye, Cory C.; Mercer, Colin J.

2012-01-01

The symbolic algebra program Maple and the spreadsheet Microsoft Excel were used in an attempt to reproduce the Gaussian fits to a Slater-type orbital, required to construct the popular STO-NG basis sets. The successes and pitfalls encountered in such an approach are chronicled. (Contains 1 table and 3 figures.)

Unified analytical treatment of multicentre electron attraction, electric field and electric field gradient integrals over Slater orbitals

International Nuclear Information System (INIS)

Guseinov, I I

2004-01-01

The new central and noncentral potential functions (CPFs and NCPFs) of a molecule depending on the coordinates of the nuclei are introduced. Using complete orthonormal sets of Ψ α -exponential-type orbitals (Ψ α -ETOs) introduced by the author, the series expansion formulae for the multicentre electronic attraction (EA), electric field (EF) and electric field gradient (EFG) integrals over Slater-type orbitals (STOs) in terms of CPFs and NCPFs are derived. The relationships obtained are valid for the arbitrary location, quantum numbers and screening constants of STOs

A Slater parameter optimisation interface for the CIV3 atomic structure code and its possible use with the R-matrix close coupling collision code

International Nuclear Information System (INIS)

Fawcett, B.C.; Hibbert, A.

1989-11-01

Details are here provided of amendments to the atomic structure code CIV3 which allow the optional adjustment of Slater parameters and average energies of configurations so that they result in improved energy levels and eigenvectors. It is also indicated how, in principle, the resultant improved eigenvectors can be utilised by the R-matrix collision code, thus providing an optimised target for close coupling collision strength calculations. An analogous computational method was recently reported for distorted wave collision strength calculations and applied to Fe XIII. The general method is suitable for the computation of collision strengths for complex ions and in some cases can then provide a basis for collision strength calculations in ions where ab initio computations break down or result in unnecessarily large errors. (author)

Dirac-Fock-Slater calculations on the geometric and electronic structure of neutral and multiply charged C60 fullerenes

International Nuclear Information System (INIS)

Bastug, T.; Kuerpick, P.; Meyer, J.; Sepp, W.; Fricke, B.; Rosen, A.

1997-01-01

Using a self-consistent relativistic molecular Dirac-Fock-Slater method we have determined the geometric structures and ionization energies of C 60 x t (x=0 endash 7). The lengths of the bonds for the pentagonal edge (single bonds) and the bonds shared by hexagonal rings (double bonds) are found to increase as a function of charge state with an expansion of the cage. The binding energy per atom of C 60 x t (x=0 endash 7) shows a quadratic dependence on the charge state of the C 60 cluster and an extrapolation to higher charge states reveals that C 60 x t should still be bound up to x=13. Charging of the clusters are analyzed using a classical capacitance model and compared with results from other calculations. Calculated ionization potentials are found to increase linearly with the charge while the available experimental data with comparatively big uncertainties indicate a small quadratic dependence. copyright 1997 The American Physical Society

The Analytical Evaluation Of Three-Center Magnetic Multipole Moment Integrals By Using Slater Type Orbitals

International Nuclear Information System (INIS)

Oztekin, E.

2010-01-01

In this study, magnetic multipole moment integrals are calculated by using Slater type orbitals (STOs), Fourier transform and translation formulas. Firstly, multipole moment operators which appear in the three-center magnetic multipole moment integrals are translated to b-center from 0-center. So, three-center magnetic multipole moment integrals have been reduced to the two-center. Then, the obtained analytical expressions have been written in terms of overlap integrals. When the magnetic multipole moment integrals calculated, matrix representations for x-, y- and z-components of multipole moments was composed and every component was separately calculated to analytically. Consequently, magnetic multipole moment integrals are also given in terms of the same and different screening parameters.

Unified treatment of complete orthonormal sets for wave functions, and Slater orbitals of particles with arbitrary spin in coordinate, momentum and four-dimensional spaces

International Nuclear Information System (INIS)

Guseinov, I.I.

2007-01-01

The new analytical relations of complete orthonormal sets for the tensor wave functions and the tensor Slater orbitals of particles with arbitrary spin in coordinate, momentum and four-dimensional spaces are derived using the properties of tensor spherical harmonics and complete orthonormal scalar basis sets of ψ α -exponential type orbitals, φ α -momentum space orbitals and z α -hyperspherical harmonics introduced by the author for particles with spin s=0, where the α=1,0,-1,-2,.... All of the tensor wave functions obtained are complete without the inclusion of the continuum and, therefore, their group of transformations is the four-dimensional rotation group O(4). The analytical formulas in coordinate space are also derived for the overlap integrals over tensor Slater orbitals with the same screening constant. We notice that the new idea presented in this work is the combination of tensor spherical harmonics of rank s with complete orthonormal scalar sets for radial parts of ψ α -, φ α - and z α -orbitals, where s=1/2,1,3/2,2,...

Basis set construction for molecular electronic structure theory: natural orbital and Gauss-Slater basis for smooth pseudopotentials.

Science.gov (United States)

Petruzielo, F R; Toulouse, Julien; Umrigar, C J

2011-02-14

A simple yet general method for constructing basis sets for molecular electronic structure calculations is presented. These basis sets consist of atomic natural orbitals from a multiconfigurational self-consistent field calculation supplemented with primitive functions, chosen such that the asymptotics are appropriate for the potential of the system. Primitives are optimized for the homonuclear diatomic molecule to produce a balanced basis set. Two general features that facilitate this basis construction are demonstrated. First, weak coupling exists between the optimal exponents of primitives with different angular momenta. Second, the optimal primitive exponents for a chosen system depend weakly on the particular level of theory employed for optimization. The explicit case considered here is a basis set appropriate for the Burkatzki-Filippi-Dolg pseudopotentials. Since these pseudopotentials are finite at nuclei and have a Coulomb tail, the recently proposed Gauss-Slater functions are the appropriate primitives. Double- and triple-zeta bases are developed for elements hydrogen through argon. These new bases offer significant gains over the corresponding Burkatzki-Filippi-Dolg bases at various levels of theory. Using a Gaussian expansion of the basis functions, these bases can be employed in any electronic structure method. Quantum Monte Carlo provides an added benefit: expansions are unnecessary since the integrals are evaluated numerically.

Delayed Slater determinant update algorithms for high efficiency quantum Monte Carlo

Science.gov (United States)

McDaniel, T.; D'Azevedo, E. F.; Li, Y. W.; Wong, K.; Kent, P. R. C.

2017-11-01

Within ab initio Quantum Monte Carlo simulations, the leading numerical cost for large systems is the computation of the values of the Slater determinants in the trial wavefunction. Each Monte Carlo step requires finding the determinant of a dense matrix. This is most commonly iteratively evaluated using a rank-1 Sherman-Morrison updating scheme to avoid repeated explicit calculation of the inverse. The overall computational cost is, therefore, formally cubic in the number of electrons or matrix size. To improve the numerical efficiency of this procedure, we propose a novel multiple rank delayed update scheme. This strategy enables probability evaluation with an application of accepted moves to the matrices delayed until after a predetermined number of moves, K. The accepted events are then applied to the matrices en bloc with enhanced arithmetic intensity and computational efficiency via matrix-matrix operations instead of matrix-vector operations. This procedure does not change the underlying Monte Carlo sampling or its statistical efficiency. For calculations on large systems and algorithms such as diffusion Monte Carlo, where the acceptance ratio is high, order of magnitude improvements in the update time can be obtained on both multi-core central processing units and graphical processing units.

Hartree--Slater calculation of the cross section for L-shell ionization of argon by simple heavy charged particles

International Nuclear Information System (INIS)

Choi, B.

1975-01-01

The cross sections for L-shell and subshell ionization by direct Coulomb excitation of argon by incident heavy charged particles are evaluated. Incident particles are described in the plane-wave Born approximation, and nonrelativistic Hartree-Slater (HS) wave functions are used for the atomic electrons. Form factors, energy distributions, and ionization cross sections are compared with those obtained from screened hydrogenic wave functions. At most incident energies, the HS results for the total ionization cross section are only slightly smaller than those obtained with screened hydrogenic wave functions, but considerable discrepancies are found for form factors and energy distributions near the ionization threshold

Optimization of parameters for the extended Hueckel method starting from ab-initio atomic calculations

International Nuclear Information System (INIS)

Branda, M.M.; Ferullo, R.; Castellani, N.J.

1990-01-01

The application of an atomic Hartree-Fock-Slater method is exposed in the present work for the simultaneous obtainment of all parameters used in the extended Hueckel method with charge interaction (IEH): The diagonal elements of the Hamiltonian, the constants of the quadratic relation between. (Author). 16 refs., 3 tabs

Using the Screened Coulomb Potential to Illustrate the Variational Method

Science.gov (United States)

Zuniga, Jose; Bastida, Adolfo; Requena, Alberto

2012-01-01

The screened Coulomb potential, or Yukawa potential, is used to illustrate the application of the single and linear variational methods. The trial variational functions are expressed in terms of Slater-type functions, for which the integrals needed to carry out the variational calculations are easily evaluated in closed form. The variational…

Generalized Hartree-Fock method for electron-atom scattering

International Nuclear Information System (INIS)

Rosenberg, L.

1997-01-01

In the widely used Hartree-Fock procedure for atomic structure calculations, trial functions in the form of linear combinations of Slater determinants are constructed and the Rayleigh-Ritz minimum principle is applied to determine the best in that class. A generalization of this approach, applicable to low-energy electron-atom scattering, is developed here. The method is based on a unique decomposition of the scattering wave function into open- and closed-channel components, so chosen that an approximation to the closed-channel component may be obtained by adopting it as a trial function in a minimum principle, whose rigor can be maintained even when the target wave functions are imprecisely known. Given a closed-channel trial function, the full scattering function may be determined from the solution of an effective one-body Schroedinger equation. Alternatively, in a generalized Hartree-Fock approach, the minimum principle leads to coupled integrodifferential equations to be satisfied by the basis functions appearing in a Slater-determinant representation of the closed-channel wave function; it also provides a procedure for optimizing the choice of nonlinear parameters in a variational determination of these basis functions. Inclusion of additional Slater determinants in the closed-channel trial function allows for systematic improvement of that function, as well as the calculated scattering parameters, with the possibility of spurious singularities avoided. Electron-electron correlations can be important in accounting for long-range forces and resonances. These correlation effects can be included explicitly by suitable choice of one component of the closed-channel wave function; the remaining component may then be determined by the generalized Hartree-Fock procedure. As a simple test, the method is applied to s-wave scattering of positrons by hydrogen. copyright 1997 The American Physical Society

Slater-Koster Tight-Binding parametrization of single and few-layer Black-Phosphorus from first-principles calculations

Science.gov (United States)

Menezes, Marcos; Capaz, Rodrigo

Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.

Novel extrapolation method in the Monte Carlo shell model

International Nuclear Information System (INIS)

Shimizu, Noritaka; Abe, Takashi; Utsuno, Yutaka; Mizusaki, Takahiro; Otsuka, Takaharu; Honma, Michio

2010-01-01

We propose an extrapolation method utilizing energy variance in the Monte Carlo shell model to estimate the energy eigenvalue and observables accurately. We derive a formula for the energy variance with deformed Slater determinants, which enables us to calculate the energy variance efficiently. The feasibility of the method is demonstrated for the full pf-shell calculation of 56 Ni, and the applicability of the method to a system beyond the current limit of exact diagonalization is shown for the pf+g 9/2 -shell calculation of 64 Ge.

Hartree-fock-slater method for materials science the DV-X alpha method for design and characterization of materials

CERN Document Server

Adachi, H; Kawai, J

2006-01-01

Molecular-orbital calculations for materials design such as alloys, ceramics, and coordination compounds are now possible for experimentalists. Molecuar-orbital calculations for the interpretation of chemical effect of spectra are also possible for experimentalists. The most suitable molecular-orbital calculation method for these purpose is the DV-Xa method, which is robust in such a way that the calculation converges to a result even if the structure of the molecule or solid is impossible in the pressure and temperature ranges on earth. This book specially addresses the methods to design novel materials and to predict the spectralline shape of unknown materials using the DV-Xa molecular-orbital method, but is also useful for those who want to calculate electronic structures of materials using any kind of method.

The generalized sturmian method for calculating spectra of atoms and ions

DEFF Research Database (Denmark)

Avery, James Emil; Avery, John Scales

2003-01-01

The properties of generalized Sturmian basis sets are reviewed, and functions of this type are used to perform direct configuration interaction calculations on the spectra of atoms and ions. Singlet excited states calculated in this way show good agreement with experimentally measured spectra. When...... the generalized Sturmian method is applied to atoms, the configurations are constructed from hydrogenlike atomic orbitals with an effective charge which is characteristic of the configuration. Thus, orthonormality between the orbitals of different configurations cannot be assumed, and the generalized Slater...

Status on the heavy elements research using the DV-DFS method

International Nuclear Information System (INIS)

Hirata, Masaru; Bastug, T.; Sekine, Rika; Onoe, Jun; Nakamatsu, Hirohide; Mukoyama, Takeshi

1999-03-01

In this review report, we describe recent progress on the heavy elements research using the discrete-variational Dirac-Fock-Slater (DV-DFS) method which is being improved by Kyoto University, Shizuoka University, RIKEN and JAERI. The DV-DFS is a versatile method for interpreting spectroscopic data and predicting chemical bonding of polyatomic systems including heavy elements. This review is based on the lectures given in 74th spring meeting of chemical Society of Japan (March, 1998) and also at the workshop on the XAFS-relativistic electronic structure calculation for the actinides research which was held at Tokai Research Establishment of JAERI (November, 1998). (author)

Comparison of Methods for Computing the Exchange Energy of quantum helium and hydrogen

International Nuclear Information System (INIS)

Cayao, J. L. C. D.

2009-01-01

I investigate approach methods to find the exchange energy for quantum helium and hydrogen. I focus on Heitler-London, Hund-Mullikan, Molecular Orbital and variational approach methods. I use Fock-Darwin states centered at the potential minima as the single electron wavefunctions. Using these we build Slater determinants as the basis for the two electron problem. I do a comparison of methods for two electron double dot (quantum hydrogen) and for two electron single dot (quantum helium) in zero and finite magnetic field. I show that the variational, Hund-Mullikan and Heitler-London methods are in agreement with the exact solutions. Also I show that the exchange energy calculation by Heitler-London (HL) method is an excellent approximation for large inter dot distances and for single dot in magnetic field is an excellent approximation the Variational method. (author)

Density-functional expansion methods: Grand challenges.

Science.gov (United States)

Giese, Timothy J; York, Darrin M

2012-03-01

We discuss the source of errors in semiempirical density functional expansion (VE) methods. In particular, we show that VE methods are capable of well-reproducing their standard Kohn-Sham density functional method counterparts, but suffer from large errors upon using one or more of these approximations: the limited size of the atomic orbital basis, the Slater monopole auxiliary basis description of the response density, and the one- and two-body treatment of the core-Hamiltonian matrix elements. In the process of discussing these approximations and highlighting their symptoms, we introduce a new model that supplements the second-order density-functional tight-binding model with a self-consistent charge-dependent chemical potential equalization correction; we review our recently reported method for generalizing the auxiliary basis description of the atomic orbital response density; and we decompose the first-order potential into a summation of additive atomic components and many-body corrections, and from this examination, we provide new insights and preliminary results that motivate and inspire new approximate treatments of the core-Hamiltonian.

Mathematical methods in quantum and statistical mechanics

International Nuclear Information System (INIS)

Fishman, L.

1977-01-01

The mathematical structure and closed-form solutions pertaining to several physical problems in quantum and statistical mechanics are examined in some detail. The J-matrix method, introduced previously for s-wave scattering and based upon well-established Hilbert Space theory and related generalized integral transformation techniques, is extended to treat the lth partial wave kinetic energy and Coulomb Hamiltonians within the context of square integrable (L 2 ), Laguerre (Slater), and oscillator (Gaussian) basis sets. The theory of relaxation in statistical mechanics within the context of the theory of linear integro-differential equations of the Master Equation type and their corresponding Markov processes is examined. Several topics of a mathematical nature concerning various computational aspects of the L 2 approach to quantum scattering theory are discussed

Volume and surface photoemission from tungsten. I. Calculation of band structure and emission spectra

DEFF Research Database (Denmark)

Christensen, N. Egede; Feuerbacher, B.

1974-01-01

is obtained from an ad hoc potential based on a Dirac-Slater atomic calculation for the ground-state configuration and with full Slater exchange in the atomic as well as in the crystal potential. The selection of this best potential is justified by comparing the calculated band structure to Fermi...... of states. The present work includes a crude estimate of this surface density of states, which is derived from the bulk band structure by narrowing the d bands according to an effective number of neighbors per surface atom. Estimates of surface relaxation effects are also included.......The electronic energy-band structure of tungsten has been calculated by means of the relativistic-augmented-plane-wave method. A series of mutually related potentials are constructed by varying the electronic configuration and the amount of Slater exchange included. The best band structure...

Calculation of the total electron excitation cross section in the Born approximation using Slater wave functions for the Li (2s yields 2p), Li (2s yields 3p), Na (3s yields 4p), Mg (3p yields 4s), Ca (4s yields 4p) and K (4s yields 4p) excitations. M.S. Thesis

Science.gov (United States)

Simsic, P. L.

1974-01-01

Excitation of neutral atoms by inelastic scattering of incident electrons in gaseous nebulae were investigated using Slater Wave functions to describe the initial and final states of the atom. Total cross sections using the Born Approximation are calculated for: Li(2s yields 2p), Na(3s yields 4p), k(4s yields 4p). The intensity of emitted radiation from gaseous nebulae is also calculated, and Maxwell distribution is employed to average the kinetic energy of electrons.

A Hartree–Fock study of the confined helium atom: Local and global basis set approaches

Energy Technology Data Exchange (ETDEWEB)

Young, Toby D., E-mail: tyoung@ippt.pan.pl [Zakład Metod Komputerowych, Instytut Podstawowych Prolemów Techniki Polskiej Akademia Nauk, ul. Pawińskiego 5b, 02-106 Warszawa (Poland); Vargas, Rubicelia [Universidad Autónoma Metropolitana Iztapalapa, División de Ciencias Básicas e Ingenierías, Departamento de Química, San Rafael Atlixco 186, Col. Vicentina, Iztapalapa, D.F. C.P. 09340, México (Mexico); Garza, Jorge, E-mail: jgo@xanum.uam.mx [Universidad Autónoma Metropolitana Iztapalapa, División de Ciencias Básicas e Ingenierías, Departamento de Química, San Rafael Atlixco 186, Col. Vicentina, Iztapalapa, D.F. C.P. 09340, México (Mexico)

2016-02-15

Two different basis set methods are used to calculate atomic energy within Hartree–Fock theory. The first is a local basis set approach using high-order real-space finite elements and the second is a global basis set approach using modified Slater-type orbitals. These two approaches are applied to the confined helium atom and are compared by calculating one- and two-electron contributions to the total energy. As a measure of the quality of the electron density, the cusp condition is analyzed. - Highlights: • Two different basis set methods for atomic Hartree–Fock theory. • Galerkin finite element method and modified Slater-type orbitals. • Confined atom model (helium) under small-to-extreme confinement radii. • Detailed analysis of the electron wave-function and the cusp condition.

4-center STO interelectron repulsion integrals with Coulomb Sturmians

DEFF Research Database (Denmark)

Avery, James Emil; Avery, John Scales

2018-01-01

Abstract We present a method for evaluating 4-center electron repulsion integrals (ERI) for Slater-type orbitals by way of expansions in terms of Coulomb Sturmians. The ERIs can then be evaluated using our previously published methods for rapid evaluation of Coulomb Sturmians through hyperspherical...

Consideration of relativistic effects in band structure calculations based on the empirical tight-binding method

International Nuclear Information System (INIS)

Hanke, M.; Hennig, D.; Kaschte, A.; Koeppen, M.

1988-01-01

The energy band structure of cadmium telluride and mercury telluride materials is investigated by means of the tight-binding (TB) method considering relativistic effects and the spin-orbit interaction. Taking into account relativistic effects in the method is rather simple though the size of the Hamilton matrix doubles. Such considerations are necessary for the interesting small-interstice semiconductors, and the experimental results are reflected correctly in the band structures. The transformation behaviour of the eigenvectors within the Brillouin zone gets more complicated, but is, nevertheless, theoretically controllable. If, however, the matrix elements of the Green operator are to be calculated, one has to use formula manipulation programmes in particular for non-diagonal elements. For defect calculations by the Koster-Slater theory of scattering it is necessary to know these matrix elements. Knowledge of the transformation behaviour of eigenfunctions saves frequent diagonalization of the Hamilton matrix and thus permits a numerical solution of the problem. Corresponding results for the sp 3 basis are available

Linear-scaling evaluation of the local energy in quantum Monte Carlo

International Nuclear Information System (INIS)

Austin, Brian; Aspuru-Guzik, Alan; Salomon-Ferrer, Romelia; Lester, William A. Jr.

2006-01-01

For atomic and molecular quantum Monte Carlo calculations, most of the computational effort is spent in the evaluation of the local energy. We describe a scheme for reducing the computational cost of the evaluation of the Slater determinants and correlation function for the correlated molecular orbital (CMO) ansatz. A sparse representation of the Slater determinants makes possible efficient evaluation of molecular orbitals. A modification to the scaled distance function facilitates a linear scaling implementation of the Schmidt-Moskowitz-Boys-Handy (SMBH) correlation function that preserves the efficient matrix multiplication structure of the SMBH function. For the evaluation of the local energy, these two methods lead to asymptotic linear scaling with respect to the molecule size

Theoretical study of relativistic effects in the electronic structure and chemical bonding of UF6

International Nuclear Information System (INIS)

Onoe, Jun; Takeuchi, Kazuo; Sekine, Rika; Nakamatsu, Hirohide; Mukoyama, Takeshi; Adachi, Hirohiko.

1992-01-01

We have performed the relativistic molecular orbital calculation for the ground state of UF 6 , using the discrete-variational Dirac-Slater method (DV-DS), in order to elucidate the relativistic effects in the electronic structure and chemical bonding. Compared with the electronic structure calculated by the non-relativistic Hartree-Fock-Slater (DV-X α )MO method, not only the direct relativistic effects (spin-orbit splitting etc), but also the indirect effect due to the change in screening core potential charge are shown to be important in the MO level structure. From the U-F bond overlap population analysis, we found that the U-F bond formation can be explained only by the DV-DS, not by the DV-X α . The calculated electronic structure in valence energy region (-20-OeV) and excitation energies in UV region are in agreement with experiments. (author)

Comparison of the Koster-Slater and the equation-of-motion method for calculation of the electronic structure of defects in compound semiconductors

International Nuclear Information System (INIS)

Tit, N.; Halley, J.W.

1992-01-01

Traditional methods of calculating the electronic structure of defects in semiconductors rely on matrix-diagonalization methods which use the unperturbed crystalline wave functions as a basis. Equation-of-motion (EOM) methods, on the other hand, give excellent results with strong disorder and many defects and make no use of the basis of unperturbed wave functions, but require self-averaging properties of the wave functions which appear superficially to make them unsuitable for study of local properties. We show here that EOM methods are better than traditional methods for calculating the electronic structure of essentially any finite-range impurity potential. The reason is basically that the numerical cost of the traditional Green's-function methods grows approximately as R 7 o/Iper sitet/P, where R is the range of the potential, whereas the cost of the EOM methods per site is independent of the range of the potential. Our detailed calculations on a model of an oxygen vacancy in rutile TiO 2 show that a crossover occurs very soon, so that equation-of-motion methods are better than the traditional ones in the case of potentials of realistic range

Generator coordinate representation of the time independent mean field theory of collisions

International Nuclear Information System (INIS)

Giraud, B.G.; Lemm, J.; Weiguny, A.; Wierling, A.

1991-01-01

We show how matrix elements of the T-matrix can be easily estimated on a basis of Slater determinants, with a mean field approximation. Linear superpositions of these Slater determinants then generate plane waves, or distorted (Coulomb) waves. This provides physical matrix elements of T

Alternative basis for the theory of complex spectra II

International Nuclear Information System (INIS)

Harter, W.G.; Patterson, C.W.

1975-01-01

The atomic angular factor calculation methods are simplified and extended to include a treatment of spin-orbit operators and multiple shell configurations (II'...) sup(n). A tableau formula is given for the matrix between slater states and states of definite total spin

Semiclassical statistical mechanics of fluids

International Nuclear Information System (INIS)

Singh, Y.; Sinha, S.K.

1981-01-01

The problem of calculating the equilibrium properties of fluids in the semiclassical limit when the quantum effects are small is studied. Particle distribution functions and thermodynamic quantities are defined in terms of the Slater sum and methods for evaluating the Slater sum are discussed. It is shown that the expansion method employing the usual Wigner-Kirkwood or Hemmer-Jancovici series is not suitable to treat the properties of the condensed state. Using the grand canonical ensemble and functional differentiation technique we develop cluster expansion series of the Helmholtz free energy and pair correlation functions. Using topological reduction we transform these series to more compact form involving a renormalized potential or a renormalized Mayer function. Then the convergence of the two series is improved by an optimal choice of the renormalized potential or the Mayer function. Integral equation theories are derived and used to devise perturbation methods. An application of these methods to the calculation of the virial coefficients, thermodynamic properties and the pair correlation function for model fluids is discussed. (orig.)

The multifacet graphically contracted function method. I. Formulation and implementation

International Nuclear Information System (INIS)

Shepard, Ron; Brozell, Scott R.; Gidofalvi, Gergely

2014-01-01

The basic formulation for the multifacet generalization of the graphically contracted function (MFGCF) electronic structure method is presented. The analysis includes the discussion of linear dependency and redundancy of the arc factor parameters, the computation of reduced density matrices, Hamiltonian matrix construction, spin-density matrix construction, the computation of optimization gradients for single-state and state-averaged calculations, graphical wave function analysis, and the efficient computation of configuration state function and Slater determinant expansion coefficients. Timings are given for Hamiltonian matrix element and analytic optimization gradient computations for a range of model problems for full-CI Shavitt graphs, and it is observed that both the energy and the gradient computation scale as O(N 2 n 4 ) for N electrons and n orbitals. The important arithmetic operations are within dense matrix-matrix product computational kernels, resulting in a computationally efficient procedure. An initial implementation of the method is used to present applications to several challenging chemical systems, including N 2 dissociation, cubic H 8 dissociation, the symmetric dissociation of H 2 O, and the insertion of Be into H 2 . The results are compared to the exact full-CI values and also to those of the previous single-facet GCF expansion form

The multifacet graphically contracted function method. I. Formulation and implementation

Science.gov (United States)

Shepard, Ron; Gidofalvi, Gergely; Brozell, Scott R.

2014-08-01

The basic formulation for the multifacet generalization of the graphically contracted function (MFGCF) electronic structure method is presented. The analysis includes the discussion of linear dependency and redundancy of the arc factor parameters, the computation of reduced density matrices, Hamiltonian matrix construction, spin-density matrix construction, the computation of optimization gradients for single-state and state-averaged calculations, graphical wave function analysis, and the efficient computation of configuration state function and Slater determinant expansion coefficients. Timings are given for Hamiltonian matrix element and analytic optimization gradient computations for a range of model problems for full-CI Shavitt graphs, and it is observed that both the energy and the gradient computation scale as O(N2n4) for N electrons and n orbitals. The important arithmetic operations are within dense matrix-matrix product computational kernels, resulting in a computationally efficient procedure. An initial implementation of the method is used to present applications to several challenging chemical systems, including N2 dissociation, cubic H8 dissociation, the symmetric dissociation of H2O, and the insertion of Be into H2. The results are compared to the exact full-CI values and also to those of the previous single-facet GCF expansion form.

A unitary correlation operator method

International Nuclear Information System (INIS)

Feldmeier, H.; Neff, T.; Roth, R.; Schnack, J.

1997-09-01

The short range repulsion between nucleons is treated by a unitary correlation operator which shifts the nucleons away from each other whenever their uncorrelated positions are within the repulsive core. By formulating the correlation as a transformation of the relative distance between particle pairs, general analytic expressions for the correlated wave functions and correlated operators are given. The decomposition of correlated operators into irreducible n-body operators is discussed. The one- and two-body-irreducible parts are worked out explicitly and the contribution of three-body correlations is estimated to check convergence. Ground state energies of nuclei up to mass number A=48 are calculated with a spin-isospin-dependent potential and single Slater determinants as uncorrelated states. They show that the deduced energy-and mass-number-independent correlated two-body Hamiltonian reproduces all ''exact'' many-body calculations surprisingly well. (orig.)

Geography and Powerful Knowledge: A Contribution to the Debate

Science.gov (United States)

Maude, Alaric

2018-01-01

This paper is a contribution to the debate on powerful knowledge in geography that began in a 2015 issue of IRGEE and was continued by Frances Slater and Norman Graves in 2016. It addresses some of the questions raised by Slater and Graves. First, it suggests an alternative way of describing and identifying powerful knowledge than the one in their…

Contribution to the projected Hartree-Fock method and microscopic theory of coupling between rotation bands

International Nuclear Information System (INIS)

Brut, F.

1982-01-01

The spectroscopy of odd-A nuclei, in the 1p and 2s-1d shells, is studied in the framework of the projected Hartree-Fock method and by the generator coordinate method. The nuclear effective interactions of Cohen and Kurath, on the one hand, and of Kuo or Preedom-Wildenthal, on the other hand, are used. The binding energies, the nuclear spectra, the static moments and the electromagnetic transitions obtained by these two approaches are compared to the same quantities given by a complete diagonalization in the shell model basis. This study of light nuclei gives some possibilities to put in order the energy levels by coupled rotational bands. In the microscopic approach, thus we find all the elements of the unified model of Bohr and Mottelson. To give evidence of such a relation, the functions of the angle β, in the integrals of the projection method of Peierls and Yoccoz, for a Slater determinant, are developed in the vicinity of the bounds β = O and β = π. The microscopic coefficients are evaluated in the Hartree-Fock approximation, using the particle-hole formalism. Calculations are made for 20 Ne and 21 Ne and the resulting microscopic coefficients are compared with the corresponding terms of the unified model of Bohr and Mottelson [fr

Study of Atoms and Molecules with Auxiliary-Field Quantum Monte Carlo

Science.gov (United States)

Purwanto, Wirawan; Suewattana, Malliga; Krakauer, Henry; Zhang, Shiwei; Walter, Eric J.

2006-03-01

We study the ground-state properties of second-row atoms and molecules using the phaseless auxiliary-field quantum Monte Carlo (AF QMC) method. This method projects the many-body ground state from a trial wave function by means of random walks in the Slater-determinant space. We use a single Slater-determinant trial wave function obtained from density-functional theory (DFT) or Hartree-Fock (HF) calculations. The calculations were done with a plane-wave basis and supercells with periodic boundary condition. We investigate the finite-size effects and the accuracy of pseudopotentials within DFT, HF, and AF QMC frameworks. Pseudopotentials generated from both LDA (OPIUM) and HF are employed. We find that the many-body QMC calculations show a greater sensitivity to the accuracy of the pseudopotentials. With reliable pseudopotentials, the ionization potentials and dissociation energies obtained using AF QMC are in excellent agreement with the experimental results. S. Zhang and H. Krakauer, Phys. Rev. Lett. 90, 136401 (2003) http://opium.sourceforge.net I. Ovcharenko, A. Aspuru-Guzik, and W. A. Lester, J. Chem. Phys. 114, 7790 (2001)

9Be scattering with microscopic wave functions and the continuum-discretized coupled-channel method

Science.gov (United States)

Descouvemont, P.; Itagaki, N.

2018-01-01

We use microscopic 9Be wave functions defined in a α +α +n multicluster model to compute 9Be+target scattering cross sections. The parameter sets describing 9Be are generated in the spirit of the stochastic variational method, and the optimal solution is obtained by superposing Slater determinants and by diagonalizing the Hamiltonian. The 9Be three-body continuum is approximated by square-integral wave functions. The 9Be microscopic wave functions are then used in a continuum-discretized coupled-channel (CDCC) calculation of 9Be+208Pb and of 9Be+27Al elastic scattering. Without any parameter fitting, we obtain a fair agreement with experiment. For a heavy target, the influence of 9Be breakup is important, while it is weaker for light targets. This result confirms previous nonmicroscopic CDCC calculations. One of the main advantages of the microscopic CDCC is that it is based on nucleon-target interactions only; there is no adjustable parameter. The present work represents a first step towards more ambitious calculations involving heavier Be isotopes.

Scaling analysis of the optimized effective potentials for the multiplet states of multivalent 3d ions

International Nuclear Information System (INIS)

Hamamoto, N; Satoko, C

2006-01-01

We apply the optimized effective potential method (OPM) to the multivalent 3d n (n = 2, ..., 8) ions; M ν+ (ν = 2, ..., 8). The total energy functional is approximated by the single-configuration Hartree-Fock. The exchange potential for the average energy configuration is decomposed into the potentials derived from F 2 (3d, 3d) and F 4 (3d, 3d) Slater integrals. To investigate properties of the density-functional potential, we have checked the scaling properties of several physical quantities such as the density, the 3d orbital and these potentials. We find that the potentials of the Slater integrals do not have the scaling property. Instead, the weighted potential V i (r) of an ion i, which is the potential of the Slater integrals times the 3d-orbital density, satisfies the scaling property q 3d i V i (r) ∼ q 3d j λ 4 V j (λr) where q i 3d is the occupation number of the 3d-orbital R 3d (r) for ion i. Furthermore, the weighted potential can be approximated by the ion-independent functional of the 3d-orbital density c k R 8/3 3d (r)/q 3d where c 2 = 0.366 and c 4 0.223. This suggests that the weighted potential can be expressed as a functional of the 3d-orbital density

Matrix elements and few-body calculations within the unitary correlation operator method

International Nuclear Information System (INIS)

Roth, R.; Hergert, H.; Papakonstantinou, P.

2005-01-01

We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges. (orig.)

Matrix elements and few-body calculations within the unitary correlation operator method

International Nuclear Information System (INIS)

Roth, R.; Hergert, H.; Papakonstantinou, P.; Neff, T.; Feldmeier, H.

2005-01-01

We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges

Kritické zhodnocení psychoanalytických přístupů k řeckému náboženství

OpenAIRE

Maľová, Anna

2011-01-01

Two psychoanalytic interpretations are subjected to scrutiny in this thesis. Richard Caldwell, the author of the first interpretation, presents psychoanalytic interpretation of Greek theogonic myths in his book The Origin of the Gods. The Greek family and its influence on Greek myths is subject of the second interpretation presented in the work The Glory of Hera by Philip E. Slater. While Caldwell prefers classical psychoana- lysis Slater is interested in specific schema of the Greek family w...

Geminal embedding scheme for optimal atomic basis set construction in correlated calculations

Energy Technology Data Exchange (ETDEWEB)

Sorella, S., E-mail: sorella@sissa.it [International School for Advanced Studies (SISSA), Via Beirut 2-4, 34014 Trieste, Italy and INFM Democritos National Simulation Center, Trieste (Italy); Devaux, N.; Dagrada, M., E-mail: mario.dagrada@impmc.upmc.fr [Institut de Minéralogie, de Physique des Matériaux et de Cosmochimie, Université Pierre et Marie Curie, Case 115, 4 Place Jussieu, 75252 Paris Cedex 05 (France); Mazzola, G., E-mail: gmazzola@phys.ethz.ch [Theoretische Physik, ETH Zurich, 8093 Zurich (Switzerland); Casula, M., E-mail: michele.casula@impmc.upmc.fr [CNRS and Institut de Minéralogie, de Physique des Matériaux et de Cosmochimie, Université Pierre et Marie Curie, Case 115, 4 Place Jussieu, 75252 Paris Cedex 05 (France)

2015-12-28

We introduce an efficient method to construct optimal and system adaptive basis sets for use in electronic structure and quantum Monte Carlo calculations. The method is based on an embedding scheme in which a reference atom is singled out from its environment, while the entire system (atom and environment) is described by a Slater determinant or its antisymmetrized geminal power (AGP) extension. The embedding procedure described here allows for the systematic and consistent contraction of the primitive basis set into geminal embedded orbitals (GEOs), with a dramatic reduction of the number of variational parameters necessary to represent the many-body wave function, for a chosen target accuracy. Within the variational Monte Carlo method, the Slater or AGP part is determined by a variational minimization of the energy of the whole system in presence of a flexible and accurate Jastrow factor, representing most of the dynamical electronic correlation. The resulting GEO basis set opens the way for a fully controlled optimization of many-body wave functions in electronic structure calculation of bulk materials, namely, containing a large number of electrons and atoms. We present applications on the water molecule, the volume collapse transition in cerium, and the high-pressure liquid hydrogen.

Quantification of entanglement entropies for doubly excited resonance states in two-electron atomic systems

International Nuclear Information System (INIS)

Ho, Yew Kam; Lin, Chien-Hao

2015-01-01

In this work, we study the quantum entanglement for doubly excited resonance states in two-electron atomic systems such as the H - and Ps - ions and the He atom by using highly correlated Hylleraas type functions The resonance states are determined by calculation of density of resonance states with the stabilization method. The spatial (electron-electron orbital) entanglement entropies (linear and von Neumann) for the low-lying doubly excited states are quantified using the Schmidt-Slater decomposition method. (paper)

Photoionization cross-sections of ground and excited valence levels of actinides

Directory of Open Access Journals (Sweden)

Yarzhemsky Victor G.

2012-01-01

Full Text Available The photoionization cross-sections of ground and excited atomic states of actinide atoms were calculated by the Dirac-Fock-Slater method for two excitation energies of X-ray radiation (1253.6 eV and 1486.6 eV. These data are required for calculations of intensities of X-ray photoelectron spectra of actinide compound valence bands and interpretation of experimental spectra.

SCF MS Xα determination of ionization energies and atomic populations of octaedral TiO6-8 cluster

International Nuclear Information System (INIS)

Michel-Calendini, F.M.; Chermette, H.; Pertosa, P.

1979-02-01

The ionization energies of titanium and oxygen states in BaTiO 3 crystal have been investigated through the self-consistent-field-Xα-scattered-wave (SCF MS Xα) method, with the Slater transition state model, applied to a TiO 6 -8 cluster of octaedral symmetry. Ionization energies and electronic charge distribution are compared to XPS data and related to results obtained from tight-binding band computations

Itinerant Ferromagnetism in Ultracold Fermi Gases

DEFF Research Database (Denmark)

Heiselberg, Henning

2012-01-01

Itinerant ferromagnetism in cold Fermi gases with repulsive interactions is studied applying the Jastrow-Slater approximation generalized to finite polarization and temperature. For two components at zero temperature a second order transition is found at akF ≃ 0.90 compatible with QMC. Thermodyna......Itinerant ferromagnetism in cold Fermi gases with repulsive interactions is studied applying the Jastrow-Slater approximation generalized to finite polarization and temperature. For two components at zero temperature a second order transition is found at akF ≃ 0.90 compatible with QMC...

Classic Multi-Configuration-Dirac-Fock and Hartree-Fock-Relativistic methods integrated into a program package for the RAL-IBM mainframe with automatic comparative output

International Nuclear Information System (INIS)

Cowan, R.D.; Grant, I.P.; Fawcett, B.C.; Rose, S.J.

1985-11-01

A Multi-Configuration-Dirac-Fock (MCDF) computer program is adapted to interface with the Hartree-Fock-Relativistic (HFR) program for the RAL IBM mainframe computer. The two codes are integrated into a package which includes the Zeeman Laboratory Slater parameter optimisation routines as well as new RAL routines to further process the HFR and MCDF output. A description of the adaptions to MCDF and new output extensions is included in this report, and details are given regarding HFR FORTRAN subroutines, and lists of Job Control Language (JCL) files for the complete package. (author)

Application of some Hartree-Fock model calculations to the analysis of atomic and free-ion optical spectra

International Nuclear Information System (INIS)

Hayhurst, T.L.

1980-01-01

Techniques for applying ab-initio calculations to the analysis of atomic spectra are investigated, along with the relationship between the semi-empirical and ab-initio forms of Slater-Condon theory. Slater-Condon theory is reviewed with a focus on the essential features that lead to the effective Hamiltonians associated with the semi-empirical form of the theory. Ab-initio spectroscopic parameters are calculated from wavefunctions obtained via self-consistent field methods, while multiconfiguration Hamiltonian matrices are constructed and diagonalized with computer codes written by Robert Cowan of Los Alamos Scientific Laboratory. Group theoretical analysis demonstrates that wavefunctions more general than Slater determinants (i.e. wavefunctions with radical correlations between electrons) lead to essentially the same parameterization of effective Hamiltonians. In the spirit of this analysis, a strategy is developed for adjusting ab-initio values of the spectroscopic parameters, reproducing parameters obtained by fitting the corresponding effective Hamiltonian. Secondary parameters are used to screen the calculated (primary) spectroscopic parameters, their values determined by least squares. Extrapolations of the secondary parameters determined from analyzed spectra are attempted to correct calculations of atoms and ions without experimental levels. The adjustment strategy and extrapolations are tested on the KI sequence from K 0+ through Fe 7+ , fitting to experimental levels for V 4+ , and Cr 5+ ; unobserved levels and spectra are predicted for several members of the sequence. A related problem is also discussed: Energy levels of the Uranium hexahalide complexes, (UX 6 ) 2- for X = F, Cl, Br, and I, are fit to an effective Hamiltonian (the f 2 configuration in O/sub h/ symmetry) with corrections proposed by Brian Judd

Application of some Hartree-Fock model calculations to the analysis of atomic and free-ion optical spectra

International Nuclear Information System (INIS)

Hayhurst, T.L.

1980-05-01

Techniques for applying ab-initio calculations to the analysis of atomic spectra are investigated, along with the relationship between the semi-empirical and ab-initio forms of Slater-Condon theory. Slater-Condon theory is reviewed with a focus on the essential features that lead to the effective Hamiltonians associated with the semi-empirical form of the theory. Ab-initio spectroscopic parameters are calculated from wavefunctions obtained via self-consistent field methods, while multi-configuration Hamiltonian matrices are constructed and diagonalized with computer codes written by Robert Cowan of Los Alamos Scientific Laboratory. Group theoretical analysis demonstrates that wavefunctions more general than Slater determinants (i.e., wavefunctions with radial correlations between electrons) lead to essentially the same parameterization of effective Hamiltonians. In the spirit of this analysis, a strategy is developed for adjusting ab-initio values of the spectroscopic parameters, reproducing parameters obtained by fitting the corresponding effective Hamiltonian. Secondary parameters are used to screen the calculated (primary) spectroscopic parameters, their values determined by least squares. Extrapolations of the secondary parameters determined from analyzed spectra are attempted to correct calculations of atoms and ions without experimental levels. The adjustment strategy and extrapolations are tested on the K I sequence from K 0+ through Fe 7+ , fitting to experimental levels for V 4+ , and Cr 5+ ; unobserved levels and spectra are predicted for several members of the sequence. A related problem is also discussed: energy levels of the uranium hexahalide complexes, (UX 6 ) 2- for X = F, Cl, Br, and I, are fit to an effective Hamiltonian (the f 2 configuration in O/sub h/ symmetry) with corrections proposed by Brian Judd

Angular distribution of Auger electrons due to 3d-shell ionization of krypton

Science.gov (United States)

Omidvar, K.

1977-01-01

Cross sections for electron impact ionization of krypton due to ejection of a 3rd shell electron have been calculated using screened hydrogenic and Hartree-Slater wave functions for target atom. While the total ionization cross sections in the two approximations are within 10% of each other, the Auger electron angular distribution, related to cross sections for specific magnetic quantum numbers of the 3rd electrons, is widely different in the two approximations. The angular distribution due to Hartree-Slater approximation is in excellent agreement with measurement. The physical reason for the discrepancies in the two approximations is explained.

Angular distribution of Auger electrons due to 3d-shell impact ionization of krypton

Science.gov (United States)

Omidvar, K.

1977-01-01

Cross sections for electron impact ionization of krypton due to ejection of a 3d-shell electron have been calculated using screened hydrogenic and Hartree-Slater wavefunctions for the target atom. While the total ionization cross sections in the two approximations are within 10% of each other, the Auger electron angular distribution, related to cross sections for specific magnetic quantum numbers of the 3d electrons, are widely different in the two approximations. The angular distribution due to the Hartree-Slater approximation is in excellent agreement with measurement. The physical reason for the discrepancies in the two approximations is explained.

The configuration-driven table CI method and comparison with integral-driven CI procedures

International Nuclear Information System (INIS)

Buenker, R.J.

1980-01-01

A new configuration-driven CI algorithm is outlined which eliminates the need for explicit comparison of pairs of Slater determinants through the use of a series of compact tables. In this scheme each pair of configurations is either shown to be non-interacting or to fall into one of nine cases, each of which is characterized fully once certain orbital permutations are determined. The program is divided into three parts: a case structure analysis step including integral label generation, a sort of the required electron repulsion integrals, and finally a procedure in which the foregoing information is combined with tabulated directions for the evaluation of the necessary Hamiltonian matrix elements over spin-adapted functions. Timing improvements of up to more than a factor of four have been achieved with the new algorithm

A hybrid configuration interaction treatment based on seniority number and excitation schemes

International Nuclear Information System (INIS)

Alcoba, Diego R.; Capuzzi, Pablo; Torre, Alicia; Lain, Luis; Oña, Ofelia B.; Van Raemdonck, Mario; Bultinck, Patrick; Van Neck, Dimitri

2014-01-01

We present a configuration interaction method in which the Hamiltonian of an N-electron system is projected on Slater determinants selected according to the seniority-number criterion along with the traditional excitation-based procedure. This proposed method is especially useful to describe systems which exhibit dynamic (weak) correlation at determined geometric arrangements (where the excitation-based procedure is more suitable) but show static (strong) correlation at other arrangements (where the seniority-number technique is preferred). The hybrid method amends the shortcomings of both individual determinant selection procedures, yielding correct shapes of potential energy curves with results closer to those provided by the full configuration interaction method

A hybrid configuration interaction treatment based on seniority number and excitation schemes

Energy Technology Data Exchange (ETDEWEB)

Alcoba, Diego R.; Capuzzi, Pablo [Departamento de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and Instituto de Física de Buenos Aires, Consejo Nacional de Investigaciones Científicas y Técnicas, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Torre, Alicia; Lain, Luis, E-mail: qfplapel@lg.ehu.es [Departamento de Química Física, Facultad de Ciencia y Tecnología, Universidad del País Vasco, Apdo. 644 E-48080 Bilbao (Spain); Oña, Ofelia B. [Instituto de Investigaciones Fisicoquímicas Teóricas y Aplicadas, Universidad Nacional de La Plata, CCT La Plata, Consejo Nacional de Investigaciones Científicas y Técnicas, Diag. 113 y 64 (S/N), Sucursal 4, CC 16, 1900 La Plata (Argentina); Van Raemdonck, Mario; Bultinck, Patrick [Department of Inorganic and Physical Chemistry, Ghent University, Krijgslaan 281 (S3), 9000 Gent (Belgium); Van Neck, Dimitri [Center for Molecular Modelling, Ghent University, Technologiepark 903, 9052 Zwijnaarde (Belgium)

2014-12-28

We present a configuration interaction method in which the Hamiltonian of an N-electron system is projected on Slater determinants selected according to the seniority-number criterion along with the traditional excitation-based procedure. This proposed method is especially useful to describe systems which exhibit dynamic (weak) correlation at determined geometric arrangements (where the excitation-based procedure is more suitable) but show static (strong) correlation at other arrangements (where the seniority-number technique is preferred). The hybrid method amends the shortcomings of both individual determinant selection procedures, yielding correct shapes of potential energy curves with results closer to those provided by the full configuration interaction method.

Singly differential electron emission cross sections for ionization of helium by protons

International Nuclear Information System (INIS)

Barna, I.F.; Gagyi-Palffy, A.C.; Gulyas, L.; Tokesi, K.; Burgdoerfer, J.

2005-01-01

Angular differential cross sections are calculated for electrons emitted in proton-helium collisions within the framework of the time-dependent coupled channel-method. The channel wave functions are constructed from Slater functions and Coulomb wave packets. As projectiles we consider protons with energies between 0.3 and 1.5 MeV. We compare our results with experimental data and other theoretical calculations using the first Born approximation, different distorted wave models and classical trajectory Monte Carlo simulations

Component separation in harmonically trapped boson-fermion mixtures

DEFF Research Database (Denmark)

Nygaard, Nicolai; Mølmer, Klaus

1999-01-01

We present a numerical study of mixed boson-fermion systems at zero temperature in isotropic and anise tropic harmonic traps. We investigate the phenomenon of component separation as a function of the strength ut the interparticle interaction. While solving a Gross-Pitaevskii mean-field equation ...... for the boson distribution in the trap, we utilize two different methods to extract the density profile of the fermion component; a semiclassical Thomas-Fermi approximation and a quantum-mechanical Slater determinant Schrodinger equation....

Atomic emission spectroscopy

Science.gov (United States)

Andrew, K. H.

1975-01-01

The relationship between the Slater-Condon theory and the conditions within the atom as revealed by experimental data was investigated. The first spectrum of Si, Rb, Cl, Br, I, Ne, Ar, and Xe-136 and the second spectrum of As, Cu, and P were determined. Methods for assessing the phase stability of fringe counting interferometers and the design of an autoranging scanning system for digitizing the output of an infrared spectrometer and recording it on magnetic tape are described.

Birth order in a contemporary sample of gay men.

Science.gov (United States)

Purcell, D W; Blanchard, R; Zucker, K J

2000-08-01

The birth order of a contemporary North American sample of 97 gay men was quantified using Slater's Index. For the 84 probands with at least one sibling, the results showed a late mean birth order compared with the expected value of .50. Additional birth order indices derived from Slater's Index suggested that the mean later birth order was accounted for more strongly by the proband's number of older brothers than by his number of older sisters. The present findings constitute a replication of a series of recent studies and add to the growing body of evidence that birth order is a reliable correlate of sexual orientation in males.

Electronic absorption spectral studies of Pr(III) chelates with some amino acids

Science.gov (United States)

Kachhawa, Chanchal; Solanki, Kanika; Bhandari, H. S.

2018-05-01

Investigations on Pr(III) systems with 1:1 metal-ligand stoichiometric ratio have been carried out in different solvents. β - Alanine, Taurine and anthranilic acid have been opted as ligands for the investigations. The Study is based on doped crystal phenomenon. The Slater-Condon, spin-orbit, nephelauxetic, bonding, Racah and Judd-Ofelt parameters have been explored during the study. Four bands for Pr(III) have been observed and recorded in the region 350 nm to 900nm. Partial regression method has been used for calculations. Use of computational chemistry has been explored in order to develop better and easier methods of calculations.

Insulating phase in Sr{sub 2}IrO{sub 4}: An investigation using critical analysis and magnetocaloric effect

Energy Technology Data Exchange (ETDEWEB)

Bhatti, Imtiaz Noor; Pramanik, A.K., E-mail: akpramanik@mail.jnu.ac.in

2017-01-15

The nature of insulating phase in 5d based Sr{sub 2}IrO{sub 4} is quite debated as the theoretical as well as experimental investigations have put forward evidences in favor of both magnetically driven Slater-type and interaction driven Mott-type insulator. To understand this insulating behavior, we have investigated the nature of magnetic state in Sr{sub 2}IrO{sub 4} through studying critical exponents, low temperature thermal demagnetization and magnetocaloric effect. The estimated critical exponents do not exactly match with any universality class, however, the values obey the scaling behavior. The exponent values suggest that spin interaction in present material is close to mean-field model. The analysis of low temperature thermal demagnetization data, however, shows dual presence of localized- and itinerant-type of magnetic interaction. Moreover, field dependent change in magnetic entropy indicates magnetic interaction is close to mean-field type. While this material shows an insulating behavior across the magnetic transition, yet a distinct change in slope in resistivity is observed around T{sub c}. We infer that though the insulating phase in Sr{sub 2}IrO{sub 4} is more close to be Slater-type but the simultaneous presence of both Slater- and Mott-type is the likely scenario for this material. - Highlights: • Critical analysis shows Sr{sub 2}IrO{sub 4} has ferromagnetic ordering temperature T{sub c}~225 K. • Obtained critical exponents imply spin interaction is close to mean-field model. • Analysis of magneto-entropy data also supports mean-field type interaction. • However, the presence of both itinerant and localized spin interaction is evident. • Sr{sub 2}IrO{sub 4} has simultaneous presence of both Slater- and Mott-type insulating phase.

Quantum Monte Carlo calculations of van der Waals interactions between aromatic benzene rings

Science.gov (United States)

Azadi, Sam; Kühne, T. D.

2018-05-01

The magnitude of finite-size effects and Coulomb interactions in quantum Monte Carlo simulations of van der Waals interactions between weakly bonded benzene molecules are investigated. To that extent, two trial wave functions of the Slater-Jastrow and Backflow-Slater-Jastrow types are employed to calculate the energy-volume equation of state. We assess the impact of the backflow coordinate transformation on the nonlocal correlation energy. We found that the effect of finite-size errors in quantum Monte Carlo calculations on energy differences is particularly large and may even be more important than the employed trial wave function. In addition to the cohesive energy, the singlet excitonic energy gap and the energy gap renormalization of crystalline benzene at different densities are computed.

Competition of multiplet and spin-orbit splitting in open-shells

Energy Technology Data Exchange (ETDEWEB)

Zhang, Qian; Koch, Erik [Institute for Advanced Simulation, Forschungszentrum Juelich (Germany)

2016-07-01

To study the trends in the spectra of open-shells across the periodic table, we perform density functional calculations for atoms and ions. We collect the Slater-Condon and spin-orbit parameters from the resulting self-consistent radial wave functions and potentials. To make these easily accessible, we provide a simple least squares fitting formula in the spirit of Slater's rules. Given these parameters we calculate the many-body spectra in LS-, intermediate-, and jj-coupling. To assess the relative importance of Coulomb and spin-orbit interactions, we estimate the width of the spectra by calculating the eigen-energy variance of the corresponding Hamiltonian using a simple formula that does not require diagonalizing a complicated many-body Hamiltonian.

Quantum Monte Carlo calculation of the Fermi-liquid parameters in the two-dimensional electron gas

International Nuclear Information System (INIS)

Kwon, Y.; Ceperley, D.M.; Martin, R.M.

1994-01-01

Excitations of the two-dimensional electron gas, including many-body effects, are calculated with a variational Monte Carlo method. Correlated sampling is introduced to calculate small energy differences between different excitations. The usual pair-product (Slater-Jastrow) trial wave function is found to lack certain correlations entirely so that backflow correlation is crucial. From the excitation energies calculated here, we determine Fermi-liquid parameters and related physical quantities such as the effective mass and the Lande g factor of the system. Our results for the effective mass are compared with previous analytic calculations

Environment-dependent crystal-field tight-binding based on density-functional theory

International Nuclear Information System (INIS)

Urban, Alexander

2012-01-01

Electronic structure calculations based on Kohn-Sham density-functional theory (DFT) allow the accurate prediction of chemical bonding and materials properties. Due to the high computational demand DFT calculations are, however, restricted to structures containing at most several hundreds of atoms, i.e., to length scales of a few nanometers. Though, many processes of technological relevance, for example in the field of nanoelectronics, are governed by phenomena that occur on a slightly larger length scale of up to 100 nanometers, which corresponds to tens of thousands of atoms. The semiempirical Slater-Koster tight-binding (TB) method makes it feasible to calculate the electronic structure of such large systems. In contrast to first-principles-based DFT, which is universally applicable to almost all chemical species, the TB method is based on parametrized models that are usually specialized for a particular application or for one certain class of compounds. Usually the model parameters (Slater-Koster tables) are empirically adjusted to reproduce either experimental reference data (e.g., geometries, elastic constants) or data from first-principles methods such as DFT. The construction of a new TB model is therefore connected with a considerable effort that is often contrasted by a low transferability of the parametrization. In this thesis we develop a systematic methodology for the derivation of accurate and transferable TB models from DFT calculations. Our procedure exploits the formal relationship between the two methods, according to which the TB total energy can be understood as a direct approximation of the Kohn--Sham energy functional. The concept of our method is different to previous approaches such as the DFTB method, since it allows to extract TB parameters from converged DFT wave functions and Hamiltonians of arbitrary reference structures. In the following the different subjects of this thesis are briefly summarized. We introduce a new technique for the

Have the Most Relevant and Answerable Research Questions Facing Librarians Changed Between 2001 and 2006?

Directory of Open Access Journals (Sweden)

Suzanne Lewis

2007-03-01

Full Text Available Objective ‐ To examine the similarities and differences between research questions asked by librarians in 2001 to those posed in 2006, and to explore to what extent the published research supports the questions being asked.Methods ‐ Questions collected in 2001 by members of the Evidence‐Based Librarianship Implementation Committee (EBLIC of the MLA Research Section were compared with questions collected in 2006 at a cross‐sectoral seminar introducing evidence based library and information practice to Australian librarians. Questions from each list were categorized using the domains of librarianship proposed by Crumley and Koufogiannakis in 2001, and examined with reference to a content analysis of the library and information studies (LIS research published in 2001 by Koufogiannakis, Slater, and Crumley in 2004.Results ‐ In 2001 and 2006 the most commonly asked questions were in the domain of management (29%, 33%, followed by education (24%, 18.5%. In 2001 questions in the marketing/promotion category ranked lowest (1%, however representation was much greater in 2006 (18.5% ranking an equal second with education. Questions in the lowest ranked domain in 2006 (collections, 6% had been more common in 2001 where collections ranked third, representing 19% of the questions. Koufogiannakis, Slater, and Crumley’s content analysis of LIS research published in 2001 revealed that the most popular domain for research was information access and retrieval (38% followed by collections (24%. Only 1% of published LIS research (seven articles was in the domain of marketing/promotion. In contrast, 36 articles originally assigned to one of the six established domains could more appropriately have been included in a proposed new domain of professional issues.Conclusion ‐ The disparity between questions being asked by practitioners and the evidence being generated by researchers suggests that the research‐practice gap is still an issue. A content

First record of Ligia oceanica (Linnaeus, 1767) (Isopoda: Ligiidae) in the Canary Islands

OpenAIRE

Ramírez, Rubén; Riera, Rodrigo

2013-01-01

This study presents the first record of L. oceanica in the Canary Islands. Additionally, body features between L. oceanica and Ligia italica Fabricius, 1798, the other sea-slater inhabiting the Archipelago, were compared.

Department of Nuclear Methods in the Solid State Physics

International Nuclear Information System (INIS)

2002-01-01

Full text: The activity of the Department of Nuclear Methods in the Solid State Physics is focused on experimental research in condensed matter physics. Thermal neutron scattering and Moessbauer effect are the main techniques mastered in the laboratory. Most of the studies aim at better understanding of properties and processes observed in modern materials. Some applied research and theoretical studies were also performed. Research activities of the Department in 2001 can be summarized as follows: Neutron scattering studies concerned the magnetic ordering in TbB 12 and TmIn 3 and some special features of magnetic excitations in antiferromagnetic γ-Mn-alloys. Some work was devoted to optimization of the neutron single crystal monochromators and polarizers grown in Crystal Growth Laboratory. Small angle scattering studies on the surfactant - water ternary system were performed in cooperation with JINR Dubna. Moessbauer effect investigations of dysprosium intermetallic compounds yielded the new data for Pauling-Slater curves. The same technique applied to perovskites and ferrocene adduct to fullerene helped to resolve their structure. X-ray topographic and diffractometric studies were performed on hydrogen implanted semiconductor surfaces employing the synchrotron radiation sources. The X-ray method was applied also to investigations of plasma spraying process and phase composition of ceramic oxide coatings. Large part of studies concerned the structure of biologically active, pharmacologically important organic complexes, supported by modeling of their electron structure. Crystal growth of large size single-crystals of metals and alloys was used for preparation of specimens with mosaic structure suitable for neutron monochromator and polarizer systems. The construction work of the Neutron and Gamma Radiography Station has been completed. The results of first tests and studies proved the expected abilities of the systems. The possibility to visualize inner structures

Sign Learning Kink-based (SiLK) Quantum Monte Carlo for molecular systems

Energy Technology Data Exchange (ETDEWEB)

Ma, Xiaoyao [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Hall, Randall W. [Department of Natural Sciences and Mathematics, Dominican University of California, San Rafael, California 94901 (United States); Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Löffler, Frank [Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Kowalski, Karol [William R. Wiley Environmental Molecular Sciences Laboratory, Battelle, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States); Bhaskaran-Nair, Kiran; Jarrell, Mark; Moreno, Juana [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803 (United States)

2016-01-07

The Sign Learning Kink (SiLK) based Quantum Monte Carlo (QMC) method is used to calculate the ab initio ground state energies for multiple geometries of the H{sub 2}O, N{sub 2}, and F{sub 2} molecules. The method is based on Feynman’s path integral formulation of quantum mechanics and has two stages. The first stage is called the learning stage and reduces the well-known QMC minus sign problem by optimizing the linear combinations of Slater determinants which are used in the second stage, a conventional QMC simulation. The method is tested using different vector spaces and compared to the results of other quantum chemical methods and to exact diagonalization. Our findings demonstrate that the SiLK method is accurate and reduces or eliminates the minus sign problem.

Sign Learning Kink-based (SiLK) Quantum Monte Carlo for molecular systems

Energy Technology Data Exchange (ETDEWEB)

Ma, Xiaoyao [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Hall, Randall W. [Department of Natural Sciences and Mathematics, Dominican University of California, San Rafael, California 94901, USA; Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Löffler, Frank [Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Kowalski, Karol [William R. Wiley Environmental Molecular Sciences Laboratory, Battelle, Pacific Northwest National Laboratory, Richland, Washington 99352, USA; Bhaskaran-Nair, Kiran [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Jarrell, Mark [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Moreno, Juana [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA

2016-01-07

The Sign Learning Kink (SiLK) based Quantum Monte Carlo (QMC) method is used to calculate the ab initio ground state energies for multiple geometries of the H2O, N2, and F2 molecules. The method is based on Feynman’s path integral formulation of quantum mechanics and has two stages. The first stage is called the learning stage and reduces the well-known QMC minus sign problem by optimizing the linear combinations of Slater determinants which are used in the second stage, a conventional QMC simulation. The method is tested using different vector spaces and compared to the results of other quantum chemical methods and to exact diagonalization. Our findings demonstrate that the SiLK method is accurate and reduces or eliminates the minus sign problem.

Sign Learning Kink-based (SiLK) Quantum Monte Carlo for molecular systems

International Nuclear Information System (INIS)

Ma, Xiaoyao; Hall, Randall W.; Löffler, Frank; Kowalski, Karol; Bhaskaran-Nair, Kiran; Jarrell, Mark; Moreno, Juana

2016-01-01

The Sign Learning Kink (SiLK) based Quantum Monte Carlo (QMC) method is used to calculate the ab initio ground state energies for multiple geometries of the H 2 O, N 2 , and F 2 molecules. The method is based on Feynman’s path integral formulation of quantum mechanics and has two stages. The first stage is called the learning stage and reduces the well-known QMC minus sign problem by optimizing the linear combinations of Slater determinants which are used in the second stage, a conventional QMC simulation. The method is tested using different vector spaces and compared to the results of other quantum chemical methods and to exact diagonalization. Our findings demonstrate that the SiLK method is accurate and reduces or eliminates the minus sign problem

Effects of Ga substitution on the structural and magnetic properties of half metallic Fe{sub 2}MnSi Heusler compound

Energy Technology Data Exchange (ETDEWEB)

Pedro, S. S., E-mail: sandrapedro@uerj.br; Caraballo Vivas, R. J.; Andrade, V. M.; Cruz, C.; Paixão, L. S.; Contreras, C.; Costa-Soares, T.; Rocco, D. L.; Reis, M. S. [Instituto de Física, Universidade Federal Fluminense, Niterói-RJ (Brazil); Caldeira, L. [IF Sudeste MG, Campus Juiz de Fora - Núcleo de Física, Juiz de Fora-MG (Brazil); Coelho, A. A. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas - Unicamp, Campinas-SP (Brazil); Carvalho, A. Magnus G. [Laboratório Nacional de Luz Sincrotron, CNPEM, Campinas-SP (Brazil)

2015-01-07

The so-called half-metallic magnets have been proposed as good candidates for spintronic applications due to the feature of exhibiting a hundred percent spin polarization at the Fermi level. Such materials follow the Slater-Pauling rule, which relates the magnetic moment with the valence electrons in the system. In this paper, we study the bulk polycrystalline half-metallic Fe{sub 2}MnSi Heusler compound replacing Si by Ga to determine how the Ga addition changes the magnetic, the structural, and the half-metal properties of this compound. The material does not follow the Slater-Pauling rule, probably due to a minor structural disorder degree in the system, but a linear dependence on the magnetic transition temperature with the valence electron number points to the half-metallic behavior of this compound.

Structure of the optimized effective Kohn-Sham exchange potential and its gradient approximations

International Nuclear Information System (INIS)

Gritsenko, O.; Van Leeuwen, R.; Baerends, E.J.

1996-01-01

An analysis of the structure of the optimized effective Kohn-Sham exchange potential v, and its gradient approximations is presented. The potential is decomposed into the Slater potential v s and the response of v s to density variations, v resp . The latter exhibits peaks that reflect the atomic shell structure. Kohn-Sham exchange potentials derived from current gradient approaches for the exchange energy are shown to be quite reasonable for the Slater potential, but they fail to approximate the response part, which leads to poor overall potentials. Improved potentials are constructed by a direct fit of v x with a gradient-dependent Pade approximant form. The potentials obtained possess proper asymptotic and scaling properties and reproduce the shell structure of the exact v x . 44 refs., 7 figs., 4 tabs

Electron structure of molecules with very heavy atoms using effective core potentials

International Nuclear Information System (INIS)

Pitzer, K.S.

1982-01-01

Topics covered include effective potential, Hamiltonian for valence-electron motion, molecular calculations, spin-spin coupling, L-S coupling, numerical results of molecular calculations, and results of configuration-interaction Slater-orbital calculations in L-S coupling

How good are the internal conversion coefficients now?

International Nuclear Information System (INIS)

Raman, S.; Nestor, C.W. Jr.; Ichihara, A.; Trzhaskovskaya, M.B.

2002-01-01

To fully utilize experimental internal conversion coefficients, one needs a reliable calculation of theoretical values. We have assembled a set of 100 experimental conversion coefficients, 45 α K and 55 α T values, measured with an accuracy of better than 5%, and generated the corresponding theoretical values using two methods, relativistic Hartree-Fock-Slater (RHFS) and relativistic Dirac-Fock (DF). Extensive comparisons of the experimental values with the two sets of theoretical values show that the DF method is clearly superior to the RHFS method in the overall reproduction of the experimental internal conversion coefficients. We discuss in some detail the differences between various versions of these two theoretical approaches, with a view to understanding which of these differences are most critical to obtaining agreement with experiment

Fixed-Node Diffusion Quantum Monte Carlo Method on Dissociation Energies and Their Trends for R-X Bonds (R = Me, Et, i-Pr, t-Bu).

Science.gov (United States)

Hou, Aiqiang; Zhou, Xiaojun; Wang, Ting; Wang, Fan

2018-05-15

Achieving both bond dissociation energies (BDEs) and their trends for the R-X bonds with R = Me, Et, i-Pr, and t-Bu reliably is nontrivial. Density functional theory (DFT) methods with traditional exchange-correlation functionals usually have large error on both the BDEs and their trends. The M06-2X functional gives rise to reliable BDEs, but the relative BDEs are determined not as accurately. More demanding approaches such as some double-hybrid functionals, for example, G4 and CCSD(T), are generally required to achieve the BDEs and their trends reliably. The fixed-node diffusion quantum Monte Carlo method (FN-DMC) is employed to calculated BDEs of these R-X bonds with X = H, CH 3 , OCH 3 , OH, and F in this work. The single Slater-Jastrow wave function is adopted as trial wave function, and pseudopotentials (PPs) developed for quantum Monte Carlo calculations are chosen. Error of these PPs is modest in wave function methods, while it is more pronounced in DFT calculations. Our results show that accuracy of BDEs with FN-DMC is similar to that of M06-2X and G4, and trends in BDEs are calculated more reliably than M06-2X. Both BDEs and trends in BDEs of these bonds are reproduced reasonably with FN-DMC. FN-DMC using PPs can thus be applied to BDEs and their trends of similar chemical bonds in larger molecules reliably and provide valuable information on properties of these molecules.

Tucker Tensor analysis of Matern functions in spatial statistics

KAUST Repository

Litvinenko, Alexander; Keyes, David E.; Khoromskaia, Venera; Khoromskij, Boris N.; Matthies, Hermann G.

2018-01-01

in a low-rank tensor format. We apply the Tucker and canonical tensor decompositions to a family of Matern- and Slater-type functions with varying parameters and demonstrate numerically that their approximations exhibit exponentially fast convergence

Program package for calculating matrix elements of two-cluster structures in nuclei

International Nuclear Information System (INIS)

Krivec, R.; Mihailovic, M.V.; Kernforschungszentrum Karlsruhe G.m.b.H.

1982-01-01

Matrix elements of operators between Slater determinants of two-cluster structures must be expanded into partial waves for the purpose of angular momentum projection. The expansion coefficients contain integrals over the spherical angles theta and phi. (orig.)

Molecular cluster theory of chemical bonding in actinide oxide

International Nuclear Information System (INIS)

Ellis, D.E.; Gubanov, V.A.; Rosen, A.

1978-01-01

The electronic structure of actinide monoxides AcO and dioxides AcO 2 , where Ac = Th, U, Np, Pu, Am, Cm and Bk has been studied by molecular cluster methods based on the first-principles one-electron local density theory. Molecular orbitals for nearest neighbor clusters AcO 10- 6 and AcO 12- 8 representative of monoxide and dioxide lattices were obtained using non-relativistic spin-restricted and spin-polarized Hartree-Fock-Slater models for the entire series. Fully relativistic Dirac-Slater calculations were performed for ThO, UO and NpO in order to explore magnitude of spin-orbit splittings and level shifts in valence structure. Self-consistent iterations were carried out for NpO, in which the NpO 6 cluster was embedded in the molecular field of the solid. Finally, a ''moment polarized'' model which combines both spin-polarization and relativistic effects in a consistent fashion was applied to the NpO system. Covalent mixing of oxygen 2p and Ac 5f orbitals was found to increase rapidly across the actinide series; metal s,p,d covalency was found to be nearly constant. Mulliken atomic population analysis of cluster eigenvectors shows that free-ion crystal field models are unreliable, except for the light actinides. X-ray photoelectron line shapes have been calculated and are found to compare rather well with experimental data on the dioxides

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Low-energy rate enhancement in recombination processes of electrons into bare uranium ions

International Nuclear Information System (INIS)

Wu Yong; Zeng Siliang; Duan Bin; Yan Jun; Wang Jianguo; Chinese Academy of Sciences, Lanzhou; Dong Chenzhong; Ma Xinwen

2007-01-01

Based on the Dirac-Fork-Slater method combined with the multichannel quantum defect theory, the recombination processes of electrons into bare uranium ions (U 92+ ) are investigated in the relative energy range close to zero, and the x-ray spectrum emitted in the direct radiative recombination and cascades processes are simulated. Compared with the recent measurement, it is found that the rate enhancement comes from the additional populations on high Rydberg states. These additional populations may be produced by other recombination mechanisms, such as the external electric-magnetic effects and the many-body correlation effects, which still remains an open problem. (authors)

Non-orthogonal configuration interaction for the calculation of multielectron excited states

Energy Technology Data Exchange (ETDEWEB)

Sundstrom, Eric J., E-mail: eric.jon.sundstrom@berkeley.edu; Head-Gordon, Martin [Department of Chemistry, University of California Berkeley, Berkeley, California 94720, USA and Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

2014-03-21

We apply Non-orthogonal Configuration Interaction (NOCI) to molecular systems where multielectron excitations, in this case double excitations, play a substantial role: the linear polyenes and β-carotene. We demonstrate that NOCI when applied to systems with extended conjugation, provides a qualitatively correct wavefunction at a fraction of the cost of many other multireference treatments. We also present a new extension to this method allowing for purification of higher-order spin states by utilizing Generalized Hartree-Fock Slater determinants and the details for computing 〈S{sup 2}〉 for the ground and excited states.

The contour deformation method in momentum space and effective interactions for weakly bound nuclei

International Nuclear Information System (INIS)

Hagen, Gaute

2005-01-01

the study of loosely bound and unbound nuclei along the drip lines. The main ingredient in the Gamow Shell Model is the construction of a complete set of many-body Slater determinants built up from a single-particle Berggren basis. It has been shown in this work that a viable starting point in Gamow Shell Model studies is to obtain a single-particle basis by the Contour Deformation Method in momentum space. The results displayed in Paper 2 indicate rapid convergence for many-body resonances using a single-particle basis in momentum space. The challenge for present and future Gamow Shell Model calculations is how to deal with the extreme growth of the number of Slater determinants in the many-body expansion basis. This topic was the main issue of the second part of the thesis. The basic idea was to modify standard effective interaction theory and many-body perturbation theory, so that that their range of applicability encompass the complex interactions and matrices which follow from the generalization of the standard Shell Model to the complex energy plane. Further, the extreme dimension of the Shell Model Hamiltonian matrix requires development of large-scale matrix diagonalization routines which can handle both real and complex matrices. In this thesis it was shown how the Lanczos iteration method may be generalized to complex energy matrices. It was further shown, that by choosing a reasonable initial Lanczos vector for the Oth order multi-particle resonance; the multi- particle resonance may be unambiguously picked out from the set of states obtained from diagonalization at each iteration, by identifying the state which has the largest overlap with the Oth order Lanczos vector. Another important result was the generalization of the Lee-Suzuki similarity transformation to include complex interactions. The emphasis was on the derivation of effective interactions for loosely bound or unbound nuclei which have a strong coupling with the continuum. We demonstrated by a

Inner-shell corrections to the Bethe stopping-power formula evaluated from a realistic atomic model

International Nuclear Information System (INIS)

Inokuti, M.; Manson, S.T.

1985-01-01

Generalized oscillator strengths for K- and L-shell ionization have been calculated using a central potential derived from the Hartree-Slater model. In cases in which an ejected electron carries low kinetic energies, sizable differences with hydrogenic-model calculations are evident

What a Decade of Experiments Reveals about Factors that Influence the Sense of Presence: Latest Findings

Science.gov (United States)

2007-05-01

Paper presented at VII Encontro Portugues de Computacao Grafica, Eurographics, Monte de Caparica, Portugal, February. Slater, M., Usoh, M., and Steed...window? An experimental comparison of immersive and non-immersive walkthroughs. Paper presented at VII Encontro Portugues de Computacao Grafica

Equations-of-motion approach to a quantum theory of large-amplitude collective motion

International Nuclear Information System (INIS)

Klein, A.

1984-01-01

The equations-of-motion approach to large-amplitude collective motion is implemented both for systems of coupled bosons, also studied in a previous paper, and for systems of coupled fermions. For the fermion case, the underlying formulation is that provided by the generalized Hartree-Fock approximation (or generalized density matrix method). To obtain results valid in the semi-classical limit, as in most previous work, we compute the Wigner transform of quantum matrices in the representation in which collective coordinates are diagonal and keep only the leading contributions. Higher-order contributions can be retained, however, and, in any case, there is no ambiguity of requantization. The semi-classical limit is seen to comprise the dynamics of time-dependent Hartree-Fock theory (TDHF) and a classical canonicity condition. By utilizing a well-known parametrization of the manifold of Slater determinants in terms of classical canonical variables, we are able to derive and understand the equations of the adiabatic limit in full parallelism with the boson case. As in the previous paper, we can thus show: (i) to zero and first order in the adiabatic limit the physics is contained in Villar's equations; (ii) to second order there is consistency and no new conditions. The structure of the solution space (discussed thoroughly in the previous paper) is summarized. A discussion of associated variational principles is given. A form of the theory equivalent to self-consistent cranking is described. A method of solution is illustrated by working out several elementary examples. The relationship to previsous work, especially that of Zelevinsky and Marumori and coworkers is discussed briefly. Three appendices deal respectively with the equations-of-motion method, with useful properties of Slater determinants, and with some technical details associated with the fermion equations of motion. (orig.)

Simple formalism for efficient derivatives and multi-determinant expansions in quantum Monte Carlo

NARCIS (Netherlands)

Filippi, Claudia; Assaraf, R.; Moroni, S.

2016-01-01

We present a simple and general formalism to compute efficiently the derivatives of a multi-determinant Jastrow-Slater wave function, the local energy, the interatomic forces, and similar quantities needed in quantum Monte Carlo. Through a straightforward manipulation of matrices evaluated on the

Computation of Ground-State Properties in Molecular Systems: Back-Propagation with Auxiliary-Field Quantum Monte Carlo.

Science.gov (United States)

Motta, Mario; Zhang, Shiwei

2017-11-14

We address the computation of ground-state properties of chemical systems and realistic materials within the auxiliary-field quantum Monte Carlo method. The phase constraint to control the Fermion phase problem requires the random walks in Slater determinant space to be open-ended with branching. This in turn makes it necessary to use back-propagation (BP) to compute averages and correlation functions of operators that do not commute with the Hamiltonian. Several BP schemes are investigated, and their optimization with respect to the phaseless constraint is considered. We propose a modified BP method for the computation of observables in electronic systems, discuss its numerical stability and computational complexity, and assess its performance by computing ground-state properties in several molecular systems, including small organic molecules.

Kinetic-energy matrix elements for atomic Hylleraas-CI wave functions

Energy Technology Data Exchange (ETDEWEB)

Harris, Frank E., E-mail: harris@qtp.ufl.edu [Department of Physics, University of Utah, Salt Lake City, Utah 84112, USA and Quantum Theory Project, University of Florida, P.O. Box 118435, Gainesville, Florida 32611 (United States)

2016-05-28

Hylleraas-CI is a superposition-of-configurations method in which each configuration is constructed from a Slater-type orbital (STO) product to which is appended (linearly) at most one interelectron distance r{sub ij}. Computations of the kinetic energy for atoms by this method have been difficult due to the lack of formulas expressing these matrix elements for general angular momentum in terms of overlap and potential-energy integrals. It is shown here that a strategic application of angular-momentum theory, including the use of vector spherical harmonics, enables the reduction of all atomic kinetic-energy integrals to overlap and potential-energy matrix elements. The new formulas are validated by showing that they yield correct results for a large number of integrals published by other investigators.

Filling of double vacancy in the K atomic shell with emission of one single photon

International Nuclear Information System (INIS)

Jalbert, G.

1978-12-01

A method was developed to calculate the transition rate for two-electron one-photon K(sub αα) transition (2s 2p → 1s 2 ). The method was tested for Ni with two K-shell vacancies in the initial state. The (sub αα) rate is calculated within the framework of a single system formed by the atom and the radiation. The transition is originated in the interactiion between the parts of that system. In the dipole approximation, the transition rate is obtained from the second order term of the time dependente perturbation theory. Hartree-Fock-Slater wave functions were used in the calculations for Ni. The results are compared with the available theoretical and experimental information. (Author) [pt

Calculation of the electronic and magnetic structures of 3d impurities in the Hcp Fe matrix

International Nuclear Information System (INIS)

Franca, Fernando

1995-01-01

In this work we investigate the local magnetic properties and the electronic structure of HCP Fe, as well introducing transition metals atoms 3d (Cs, Ti, Cr, Mn, Co, Ni, Cu, Zn) in HCP iron matrix. We employed the discrete variational method (DVM), which is an orbital molecular method which incorporate the Hartree-Fock-Slater theory and the linear combination of atomic orbitals (LCAO), in the self-consistent charge approximation and the local density approximation of Von Barth and Hedin to the exchange-correlation potential. We used the embedded cluster model to investigate the electronic structure and the local magnetic properties for the central atom of a cluster of 27 atoms immersed in the microcrystal representing the HCP Fe. (author)

Calculation of the electronic and magnetic structures of 3d impurities in the Hcp Fe matrix; Calculo da estrutura eletronica e magnetica de impurezas 3d na matriz do Fe HCP

Energy Technology Data Exchange (ETDEWEB)

Franca, Fernando

1995-12-31

In this work we investigate the local magnetic properties and the electronic structure of HCP Fe, as well introducing transition metals atoms 3d (Cs, Ti, Cr, Mn, Co, Ni, Cu, Zn) in HCP iron matrix. We employed the discrete variational method (DVM), which is an orbital molecular method which incorporate the Hartree-Fock-Slater theory and the linear combination of atomic orbitals (LCAO), in the self-consistent charge approximation and the local density approximation of Von Barth and Hedin to the exchange-correlation potential. We used the embedded cluster model to investigate the electronic structure and the local magnetic properties for the central atom of a cluster of 27 atoms immersed in the microcrystal representing the HCP Fe. (author) 32 refs., 19 figs., 2 tabs.

Magnetic properties and phase stability of half-metal-type Co2Cr1-xFexGa alloys

International Nuclear Information System (INIS)

Kobayashi, K.; Umetsu, R.Y.; Fujita, A.; Oikawa, K.; Kainuma, R.; Fukamichi, K.; Ishida, K.

2005-01-01

The magnetic properties and phase stability of half-metal-type Co 2 Cr 1-x Fe x Ga alloys were investigated by differential scanning calorimetry (DSC), in a superconducting quantum interference device (SQUID) magnetometer and in a vibrating sample magnetometer (VSM), and by transmission electron microscopy (TEM). It was found that the L2 1 -type single-phase is obtainable for the entire concentration of x and that the value of the saturation magnetic moment M s at 4.2K in the lower composition range of x is in agreement with the generalized Slater-Pauling line, while it is rather larger than the generalized Slater-Pauling line above x=0.6. The Curie temperature T c monotonically increases, whereas the transition temperature from the L2 1 - to B2-type phase T t B2/L2 1 is almost constant at 1082+/-13K with increasing x

On the initial conditions of time-dependent mean-field equations of evolution. Pt. 2

International Nuclear Information System (INIS)

Troudet, T.; Paris-11 Univ., 91 - Orsay

1986-01-01

We analyze the problem so far untouched of determining the initial mean-field wavefunction in the context of zero-temperature mean-field descriptions of time-dependent expectation values and quantum fluctuations of nuclear observables. The nucleus, at zero temperature, is taken to be in a low-lying excited many-body eigenstate and is approximated by the corresponding RPA wavefunction as a continuous superposition of coherent states (i.e. Slater determinants). A generating function Gsub(A)(lambda) for time-dependent expectation values and quantum fluctuations is constructed within the formalism of functional integration. By applying the saddle-point method to the functional action of Gsub(A)(lambda) and then taking its lambda-derivatives, we recover the well-known TDHF theory and propose a simple determination of the initial Slater determinant for an appropriate mean-field description of time-dependent expectation values. The analog mean-field description of quadratic-quantum fluctuations proceeds similarly and in addition includes the contribution of the uncorrelated TDHF-RPA phonons coupled to collective excitations of the initial (static) mean-field configuration. When the collective TDHF-RPA excitations are solely taken into account, we obtain an improved version of the Balian-Veneroni dispersion formula by showing how to determine the initial mean-field wavefunction. By first taking the lambda-derivatives of Gsub(A)(lambda) before applying the saddle-point method, the initial mean-field wavefunction is found to be non-linearly coupled to the mean-field dynamics themselves. In return, and in contrast to the first quantization scheme, these both depend non-trivially upon the observable A being measured so that approximations must be proposed to simplify the resulting mean-field equations. (orig.)

Modeling of full-Heusler alloys within tight-binding approximation: Case study of Fe2MnAl

Science.gov (United States)

Azhar, A.; Majidi, M. A.; Nanto, D.

2017-07-01

Heusler alloys have been known for about a century, and predictions of magnetic moment values using Slater-Pauling rule have been successful for many such materials. However, such a simple counting rule has been found not to always work for all Heusler alloys. For instance, Fe2CuAl has been found to have magnetic moment of 3.30 µB per formula unit although the Slater-Pauling rule suggests the value of 2 µB. On the other hand, a recent experiment shows that a non-stoichiometric Heusler compound Fe2Mn0.5Cu0.5Al possesses magnetic moment of 4 µB, closer to the Slater-Pauling prediction for the stoichiometric compound. Such discrepancies signify that the theory to predict the magnetic moment of Heusler alloys in general is still far from being complete. Motivated by this issue, we propose to do a theoretical study on a full-Heusler alloy Fe2MnAl to understand the formation of magnetic moment microscopically. We model the system by constructing a density-functional-theory-based tight-binding Hamiltonian and incorporating Hubbard repulsive as well as spin-spin interactions for the electrons occupying the d-orbitals. Then, we solve the model using Green's function approach, and treat the interaction terms within the mean-field approximation. At this stage, we aim to formulate the computational algorithm for the overall calculation process. Our final goal is to compute the total magnetic moment per unit cell of this system and compare it with the experimental data.

Hierarchy of model Kohn–Sham potentials for orbital-dependent functionals: A practical alternative to the optimized effective potential method

International Nuclear Information System (INIS)

Kohut, Sviataslau V.; Staroverov, Viktor N.; Ryabinkin, Ilya G.

2014-01-01

We describe a method for constructing a hierarchy of model potentials approximating the functional derivative of a given orbital-dependent exchange-correlation functional with respect to electron density. Each model is derived by assuming a particular relationship between the self-consistent solutions of Kohn–Sham (KS) and generalized Kohn–Sham (GKS) equations for the same functional. In the KS scheme, the functional is differentiated with respect to density, in the GKS scheme—with respect to orbitals. The lowest-level approximation is the orbital-averaged effective potential (OAEP) built with the GKS orbitals. The second-level approximation, termed the orbital-consistent effective potential (OCEP), is based on the assumption that the KS and GKS orbitals are the same. It has the form of the OAEP plus a correction term. The highest-level approximation is the density-consistent effective potential (DCEP), derived under the assumption that the KS and GKS electron densities are equal. The analytic expression for a DCEP is the OCEP formula augmented with kinetic-energy-density-dependent terms. In the case of exact-exchange functional, the OAEP is the Slater potential, the OCEP is roughly equivalent to the localized Hartree–Fock approximation and related models, and the DCEP is practically indistinguishable from the true optimized effective potential for exact exchange. All three levels of the proposed hierarchy require solutions of the GKS equations as input and have the same affordable computational cost

Treatment outcome of immediate, early and conventional single-tooth implants in the aesthetic zone : a systematic review to survival, bone level, soft-tissue, aesthetics and patient satisfaction

NARCIS (Netherlands)

den Hartog, Laurens; Huddleston Slater, James J. R.; Vissink, Arjan; Meijer, Henny J. A.; Raghoebar, Gerry M.

2008-01-01

den Hartog L, Huddleston Slater JJR, Vissink A, Meijer HJA, Raghoebar GM. Treatment outcome of immediate, early and conventional single-tooth implants in the aesthetic zone: a systematic review to survival, bone level, soft-tissue, aesthetics and patient satisfaction. J Clin Periodontol 2008; 35:

76 FR 34964 - Stainless Steel Bar From India: Partial Rescission of Antidumping Duty Administrative Review

Science.gov (United States)

2011-06-15

... DEPARTMENT OF COMMERCE International Trade Administration [A-533-810] Stainless Steel Bar From... the antidumping duty order on stainless steel bar from India for the period of review February 1, 2010....; Outokumpu Stainless Bar, Inc.; Universal Stainless & Alloy Products, Inc.; and Valbruna Slater Stainless...

Origins of a Stereotype: Categorization of Facial Attractiveness by 6-Month-Old Infants

Science.gov (United States)

Ramsey, Jennifer L.; Langlois, Judith H.; Hoss, Rebecca A.; Rubenstein, Adam J.; Griffin, Angela M.

2004-01-01

Like adults, young infants prefer attractive to unattractive faces (e.g. Langlois, Roggman, Casey, Ritter, Rieser-Danner & Jenkins, 1987; Slater, von der Schulenburg, Brown, Badenoch, Butterworth, Parsons & Samuels, 1998). Older children and adults stereotype based on facial attractiveness (Eagly, Ashmore, Makhijani & Longo, 1991; Langlois,…

Use of combined Hartree–Fock–Roothaan theory in evaluation of ...

Indian Academy of Sciences (India)

Keywords. Hartree–Fock–Roothaan equations; noninteger -Slater type orbitals; open shell theory; isoelectronic series. ... with those presented in the literature. The results can be useful in the study of various properties of heavy atomic systems when the combined Hartree–Fock–Roothaan approach is employed.

Ab initio calculation atomics ground state wave function for interactions Ion- Atom

International Nuclear Information System (INIS)

Shojaee, F.; Bolori zadeh, M. A.

2007-01-01

Ab initio calculation atomics ground state wave function for interactions Ion- Atom Atomic wave function expressed in a Slater - type basis obtained within Roothaan- Hartree - Fock for the ground state of the atoms He through B. The total energy is given for each atom.

African Journal of Drug & Alcohol Studies, 15(1), 2016 Copyright ...

African Journals Online (AJOL)

Substance use is rising among young people in developing countries, especially in schools and ... verse health problems (Xie, Rehm, Single, ... use such as parental substance use, (Clark ... (Slater, 2003) poor social and emotional ... likely negative consequences of indulging ... early conduct and predisposes an indi-.

Simple formalism for efficient derivatives and multi-determinant expansions in quantum Monte Carlo

Energy Technology Data Exchange (ETDEWEB)

Filippi, Claudia, E-mail: c.filippi@utwente.nl [MESA+ Institute for Nanotechnology, University of Twente, P.O. Box 217, 7500 AE Enschede (Netherlands); Assaraf, Roland, E-mail: assaraf@lct.jussieu.fr [Sorbonne Universités, UPMC Univ Paris 06, CNRS, Laboratoire de Chimie Théorique CC 137-4, place Jussieu F-75252 Paris Cedex 05 (France); Moroni, Saverio, E-mail: moroni@democritos.it [CNR-IOM DEMOCRITOS, Istituto Officina dei Materiali, and SISSA Scuola Internazionale Superiore di Studi Avanzati, Via Bonomea 265, I-34136 Trieste (Italy)

2016-05-21

We present a simple and general formalism to compute efficiently the derivatives of a multi-determinant Jastrow-Slater wave function, the local energy, the interatomic forces, and similar quantities needed in quantum Monte Carlo. Through a straightforward manipulation of matrices evaluated on the occupied and virtual orbitals, we obtain an efficiency equivalent to algorithmic differentiation in the computation of the interatomic forces and the optimization of the orbital parameters. Furthermore, for a large multi-determinant expansion, the significant computational gain afforded by a recently introduced table method is here extended to the local value of any one-body operator and to its derivatives, in both all-electron and pseudopotential calculations.

Tunneling of self-trapped states and formation of a band

International Nuclear Information System (INIS)

Yonemitsu, K.

1993-12-01

Tunneling of a self-trapped kink and formation of a band are studied semi classically in the one-dimensional extended Peierls-Hubbard model near half filling, considering up to Gaussian fluctuations around imaginary-time-dependent periodic motion of electrons and phonons on the stationary phase of the action derived using Slater determinants. In the strong-coupling limit of both the Holstein and attractive Hubbard models, it reproduces analytically-known effective hopping of a single bipolaron because the tunneling involves only one in this limit. The method gives new results in other general cases and is easily applied to excited or more complex systems. 13 refs, 4 figs

Dielectric Relaxation of Water: Theory and Experiment

International Nuclear Information System (INIS)

Adhikari, Narayan Prasad; Paudyal, Harihar; Johri, Manoj

2010-06-01

We have studied the hydrogen bond dynamics and methods for evaluation of probability and relaxation time for hydrogen bond network. Further, dielectric relaxation time has been calculated by using a diagonalization procedure by obtaining eigen values (inverse of relaxation time) of a master equation framed on the basis of Fokker-Planck equations. Microwave cavity spectrometer has been described to make measurements of relaxation time. Slater's perturbation equations are given for the analysis of the data. A comparison of theoretical and experimental data shows that there is a need for improvements in the theoretical model and experimental techniques to provide exact information about structural properties of water. (author)

Pseudo q -Engel expansions and Rogers-Ramanujan type identities ...

African Journals Online (AJOL)

Abstract. Andrews, Knopfmacher and Knopfmacher have used the Schur polynomials to consider the celebrated Rogers-Ramanujan identities in the context of q-Engel expansions. We extend this view using similar polynomials, provided by Sills, in the context of Slater's list of 130 Rogers-Ramanujan type identities.

Engaging bodies and places online

DEFF Research Database (Denmark)

Jordt Jørgensen, Nanna; Rehder, Mads Middelboe

In this paper, we suggest that embodied learning forms the backdrop for young people’s digitally mediated practices. In line with the early studies of Miller & Slater, we approach online engagements as ‘continuous with and embedded in other social spaces’, happening ‘within mundane social...

Lattice Dynamics of Beryllium from a First-Principles Nonlocal Pseudopotential Approach

DEFF Research Database (Denmark)

Walter, F. King; Cutler, P. H.

1970-01-01

dielectric-screening function employing the Kohn-Sham approximation for exchange among the conduction electrons. The energy-wave-number characteristic F(q) is constructed from the Hartree-Fock-Slater (HFS) wave function for Be++; this is used to calculate the phonon dispersion relations in the [0001], [011̅...

Correlations in rare-earth transition-metal permanent magnets

International Nuclear Information System (INIS)

Skomski, R.; Manchanda, P.; Kashyap, A.

2015-01-01

It is investigated how electron-electron correlations affect the intrinsic properties of rare-earth transition-metal magnets. Focusing on orbital moment and anisotropy, we perform model calculations for 3d-4f alloys and density-functional theory (DFT) calculations for NdCo 5 . On an independent-electron level, the use of a single Slater determinant with broken spin symmetry introduces Hund's rule correlations, which govern the behavior of rare-earth ions and of alloys described by the local spin density approximation (LSDA) and LSDA + U approximations to DFT. By contrast, rare-earth ions in intermetallics involve configuration interactions between two or more Slater determinants and lead to phenomena such as spin-charge distribution. Analyzing DFT as a Legendre transformation and using Bethe's crystal-field theory, we show that the corresponding density functionals are very different from familiar LSDA-type expressions and outline the effect of spin-charge separation on the magnetocrystalline anisotropy

Correlations in rare-earth transition-metal permanent magnets

Science.gov (United States)

Skomski, R.; Manchanda, P.; Kashyap, A.

2015-05-01

It is investigated how electron-electron correlations affect the intrinsic properties of rare-earth transition-metal magnets. Focusing on orbital moment and anisotropy, we perform model calculations for 3d-4f alloys and density-functional theory (DFT) calculations for NdCo5. On an independent-electron level, the use of a single Slater determinant with broken spin symmetry introduces Hund's rule correlations, which govern the behavior of rare-earth ions and of alloys described by the local spin density approximation (LSDA) and LSDA + U approximations to DFT. By contrast, rare-earth ions in intermetallics involve configuration interactions between two or more Slater determinants and lead to phenomena such as spin-charge distribution. Analyzing DFT as a Legendre transformation and using Bethe's crystal-field theory, we show that the corresponding density functionals are very different from familiar LSDA-type expressions and outline the effect of spin-charge separation on the magnetocrystalline anisotropy.

Structure and properties of quarternary and tetragonal Heusler compounds for spintronics and spin transver torque applications

Energy Technology Data Exchange (ETDEWEB)

Zamani, Vajiheh Alijani

2012-03-07

This work is divided into two parts: part 1 is focused on the prediction of half-metallicity in quaternary Heusler compounds and their potential for spintronic applications and part 2 on the structural properties of Mn{sub 2}-based Heusler alloys and tuning the magnetism of them from soft to hard-magnetic for spin-transfer torque applications. In part 1, three different series of quaternary Heusler compounds are investigated, XX'MnGa (X=Cu, Ni and X'=Fe,Co), CoFeMnZ (Z=Al,Ga,Si,Ge), and Co{sub 2-x}Rh{sub x}MnZ (Z=Ga,Sn,Sb). All of these quaternary compounds except CuCoMnGa are predicted to be half-metallic ferromagnets by ab-initio electronic structure calculations. In the XX'MnGa class of compounds, NiFeMnGa has a low Curie temperature for technological applications but NiCoMnGa with a high spin polarization, magnetic moment, and Curie temperature is an interesting new material for spintronics applications. All CoFeMnZ compounds exhibit a cubic Heusler structur and their magnetic moments are in fair agreement with the Slater-Pauling rule indicating the halfmetallicity and high spin polarization required for spintronics applications. Their high Curie temperatures make them suitable for utilization at room temperature and above. The structural investigation revealed that the crystal structure of all Co{sub 2-x}Rh{sub x}MnZ compounds aside from CoRhMnSn exhibit different types of anti-site disorder. The magnetic moments of the disordered compounds deviate from the Slater-Pauling rule indicating that 100% spin polarization are not realized in CoRhMnGa, CoRhMnSb, and Co{sub 0.5}Rh{sub 1.5}MnSb. Exchange of one Co in Co{sub 2}MnSn by Rh results in the stable, well-ordered compound CoRhMnSn. This exchange of one of the magnetic Co atoms by a non-magnetic Rh atom keeps the magnetic properties and half-metallicity intact. In part 2, two series of Mn{sub 2}-based Heusler alloys are investigated, Mn{sub 3-x}Co{sub x}Ga and Mn{sub 2-x}Rh{sub 1+x}Sn. It has been

Sampling procedures using optical-data and partial wave cross sections in a Monte Carlo code for simulating kilovolt electron and positron transport in solids

International Nuclear Information System (INIS)

Fernandez-Varea, J.M.; Salvat, F.; Liljequist, D.

1994-09-01

The details of a Monte Carlo code for computing the penetration and energy loss of electrons and positrons in solids are described. The code, intended for electrons and positrons with energies from ∼ 100 eV to ∼ 100 keV, is based on the simulation of individual elastic and inelastic collisions. Elastic collisions are simulated using differential cross sections computed by the relativistic partial wave method applied to a muffin-tin Dirac-Hartree-Fock-Slater potential. Inelastic collisions are simulated by means of a model based on optical and photoelectric data, which are extended to the non-zero momentum transfer region by means of somewhat different algorithms for valence electron excitations and inner-shell excitations. This report focuses on the description of detailed formulae and sampling methods. 10 refs, 3 figs, 8 tabs

Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

Science.gov (United States)

Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

2015-01-13

Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

Self-consistent calculation of atomic structure for mixture

International Nuclear Information System (INIS)

Meng Xujun; Bai Yun; Sun Yongsheng; Zhang Jinglin; Zong Xiaoping

2000-01-01

Based on relativistic Hartree-Fock-Slater self-consistent average atomic model, atomic structure for mixture is studied by summing up component volumes in mixture. Algorithmic procedure for solving both the group of Thomas-Fermi equations and the self-consistent atomic structure is presented in detail, and, some numerical results are discussed

ANALYTIC FITS FOR PARTIAL PHOTOIONIZATION CROSS-SECTIONS

NARCIS (Netherlands)

VERNER, DA; YAKOVLEV, DG

We present a compact, uniform and complete set of analytic fits to the partial Hartree-Dirac-Slater photoionization cross sections for the ground state shells of all atoms and ions of elements from H to Zn (Z less-than-or-equal-to 30). Comparison with experiment and theory demonstrates generally

Come on Higher Ed...Get with the Programme! A Study of Market Orientation in International Student Recruitment

Science.gov (United States)

Ross, Mitchell; Grace, Debra; Shao, Wei

2013-01-01

This paper investigates higher education (HE) student recruitment practices from the standpoint of market orientation. By adopting the well-established market orientation framework of Narver and Slater [1990, The effect of a market orientation on a business profitability. "Journal of Marketing" 54, no. 4: 20-35], we examine the extent to…

DMPD: Signalling pathways mediating type I interferon gene expression. [Dynamic Macrophage Pathway CSML Database

Lifescience Database Archive (English)

Full Text Available 17904888 Signalling pathways mediating type I interferon gene expression. Edwards M...hways mediating type I interferon gene expression. PubmedID 17904888 Title Signalling pathways...R, Slater L, Johnston SL. Microbes Infect. 2007 Sep;9(11):1245-51. Epub 2007 Jul 1. (.png) (.svg) (.html) (.csml) Show Signalling pat

Parallel knock-out schemes in networks

NARCIS (Netherlands)

Broersma, H.J.; Fomin, F.V.; Woeginger, G.J.

2004-01-01

We consider parallel knock-out schemes, a procedure on graphs introduced by Lampert and Slater in 1997 in which each vertex eliminates exactly one of its neighbors in each round. We are considering cases in which after a finite number of rounds, where the minimimum number is called the parallel

Eliminating graphs by means of parallel knock-out schemes

NARCIS (Netherlands)

Broersma, H.J.; Fomin, F.V.; Královic, R.; Woeginger, G.J.

2007-01-01

In 1997 Lampert and Slater introduced parallel knock-out schemes, an iterative process on graphs that goes through several rounds. In each round of this process, every vertex eliminates exactly one of its neighbors. The parallel knock-out number of a graph is the minimum number of rounds after which

Eliminating graphs by means of parallel knock-out schemes

NARCIS (Netherlands)

Broersma, Haitze J.; Fomin, F.V.; Královič, R.; Woeginger, Gerhard

In 1997 Lampert and Slater introduced parallel knock-out schemes, an iterative process on graphs that goes through several rounds. In each round of this process, every vertex eliminates exactly one of its neighbors. The parallel knock-out number of a graph is the minimum number of rounds after which

Threshold Corrosion Fatigue of Welded Shipbuilding Steels.

Science.gov (United States)

1992-01-01

8. J. C. Walter, E. Olbjorn, 0. Allstad and G. Elde, "Safety Against Corrosion Fatigue Offshore," Publication No. 94, Det Norske Ventas , Horik...Offshore. Publication No;. 94;, Det Norske Ventas , Horik, Norway, April 1976. 18. C. E. Jaske, D. Broek, J. E. Slater, W. E. Anderson. Corrosion Fatigue

The time dependent Hartree-Fock-theory for collective nuclear motions

International Nuclear Information System (INIS)

Goeke, K.

1976-11-01

The time-dependent Hartree-Fock theory (TDHF) approximately solves the Schroedinger equation by a variational method in the space of the time-dependent Slater determinants. As the TDHF wave function, similar to the exact solution has the property of being determined completely for all times by the nucleon-nucleon interaction and by assuming initial conditions. TDHF is expected to describe collective motion of nuclei with large amplitudes, too. The subject of this paper is to formulate the TDHF theory and its adiabatic limiting case (ATDHF) suited for setting up a collective Schroedinger equation, to investigate the relations with other theories, and to show the applicability for solving practical problems. (orig./WL) [de

The Mo/Ta (100) interface

International Nuclear Information System (INIS)

Quintanar, C.; Velasco, V.R.; Garcia-Moliner, F.

1990-12-01

We have calculated the interface local density of states (ILDOS) formed by the transition metals Mo/Ta using a tight-binding Slater-Koster description and the Green Function matching method together with quickly converging algorithms to compute the transfer matrices. We obtain the surface LDOS as a byproduct. Our result is a useful tool to analyze experimental results and to check models as a function of the value of the tight-binding parameters either of the bulk or at the interface itself. We consider the (100) direction. We compare the interface to the bulk and to the surface and comment on some recently found experimental results for this interface. (author). 17 refs, 2 figs

On the electron to proton mass ratio and the proton structure

DEFF Research Database (Denmark)

Trinhammer, Ole L.

2013-01-01

We derive an expression for the electron to nucleon mass ratio from a reinterpreted lattice gauge theory Hamiltonian to describe interior baryon dynamics. We use the classical electron radius as our fundamental length scale. Based on expansions on trigonometric Slater determinants for a neutral s...... and d valence quarks of the proton....

Calculation of two-center one-electron molecular integrals with STOs. [BICEN

Energy Technology Data Exchange (ETDEWEB)

Rico, J.F.; Lopez, R.; Paniagua, M.; Ramirez, G. (Universidad Autonoma de Madrid (Spain). Dept. de Quimica Fisica y Quimica Cuantica)

1991-05-01

A program for the calculation of two-center one-electron integrals (overlap, nuclear attraction and kinetic energy) between real Slater-type orbitals (STOs) is reported. The integrals are obtained by recursion over simple auxiliary matrices, whose elements are calculated in terms of further auxiliary functions evaluated in a quick and accurate way. (orig.).

Calculation of two-center one-electron molecular integrals with STOs

International Nuclear Information System (INIS)

Rico, J.F.; Lopez, R.; Paniagua, M.; Ramirez, G.

1991-01-01

A program for the calculation of two-center one-electron integrals (overlap, nuclear attraction and kinetic energy) between real Slater-type orbitals (STOs) is reported. The integrals are obtained by recursion over simple auxiliary matrices, whose elements are calculated in terms of further auxiliary functions evaluated in a quick and accurate way. (orig.)

Renovated Parks Improve Physical Activity

Centers for Disease Control (CDC) Podcasts

We know that children who are physically active every day are less likely to develop chronic diseases as adults, including obesity. Dr. Sandy Slater, a researcher with the University of Illinois, Chicago Prevention Research Center, discusses how a park improvement project in Chicago helped engage communities to improve areas for play and activity.

Covariant density functional theory beyond mean field and applications for nuclei far from stability

International Nuclear Information System (INIS)

Ring, P

2010-01-01

Density functional theory provides a very powerful tool for a unified microscopic description of nuclei all over the periodic table. It is not only successful in reproducing bulk properties of nuclear ground states such as binding energies, radii, or deformation parameters, but it also allows the investigation of collective phenomena, such as giant resonances and rotational excitations. However, it is based on the mean field concept and therefore it has its limits. We discuss here two methods based based on covariant density functional theory going beyond the mean field concept, (i) models with an energy dependent self energy allowing the coupling to complex configurations and a quantitative description of the width of giant resonances and (ii) methods of configuration mixing between Slater determinants with different deformation and orientation providing are very successful description of transitional nuclei and quantum phase transitions.

Basic semiconductor physics

CERN Document Server

Hamaguchi, Chihiro

2017-01-01

This book presents a detailed description of basic semiconductor physics. The text covers a wide range of important phenomena in semiconductors, from the simple to the advanced. Four different methods of energy band calculations in the full band region are explained: local empirical pseudopotential, non-local pseudopotential, KP perturbation and tight-binding methods. The effective mass approximation and electron motion in a periodic potential, Boltzmann transport equation and deformation potentials used for analysis of transport properties are discussed. Further, the book examines experiments and theoretical analyses of cyclotron resonance in detail. Optical and transport properties, magneto-transport, two-dimensional electron gas transport (HEMT and MOSFET) and quantum transport are reviewed, while optical transition, electron-phonon interaction and electron mobility are also addressed. Energy and electronic structure of a quantum dot (artificial atom) are explained with the help of Slater determinants. The...

Benchmark Calculation of Radial Expectation Value for Confined Hydrogen-Like Atoms and Isotropic Harmonic Oscillators

International Nuclear Information System (INIS)

Yu, Rong Mei; Zan, Li Rong; Jiao, Li Guang; Ho, Yew Kam

2017-01-01

Spatially confined atoms have been extensively investigated to model atomic systems in extreme pressures. For the simplest hydrogen-like atoms and isotropic harmonic oscillators, numerous physical quantities have been established with very high accuracy. However, the expectation value of which is of practical importance in many applications has significant discrepancies among calculations by different methods. In this work we employed the basis expansion method with cut-off Slater-type orbitals to investigate these two confined systems. Accurate values for several low-lying bound states were obtained by carefully examining the convergence with respect to the size of basis. A scaling law for was derived and it is used to verify the accuracy of numerical results. Comparison with other calculations show that the present results establish benchmark values for this quantity, which may be useful in future studies. (author)

M sub shell X-ray emission cross section measurements for Pt, Au, Hg, Pb, Th and U at 8 and 10 keV synchrotron photons

International Nuclear Information System (INIS)

Kaur, Gurpreet; Gupta, Sheenu; Tiwari, M.K.; Mittal, Raj

2014-01-01

Highlights: • First time M sub shell fluorescence cross section measurements at 8 and 10 keV photons. • Comparison with theoretical evaluations from different model data for parameters. • Explained the large deviations from the trend of parameters with atomic number Z. • A specific pattern of cross sections with Z is predicted in the region, 78 ⩽ Z ⩽ 92. • Confirmation of prediction requires more experiment in these Z and energy region. -- Abstract: M sub shell X-ray emission cross sections of Pt, Au, Hg, Pb, Th and U at 8 and 10 keV photon energies have been determined with linearly polarized photon beam from Indus-2 synchrotron source. The measured cross sections have been reported for the first time and were used to check the available theoretical Dirac–Hartree–Slater (DHS) and Dirac–Fock (DF) values reported in literature and also the presently derived Non Relativistic Hartree–Slater (NRHS), DF and DHS values for M ξ , M δ , M α , M β , M γ , M m1 and M m2 group of X-rays

Li (i = 1-3) subshell X-ray production cross sections and fluorescence yields for some elements with 56 ≤ Z ≤ 68 at 22.6 keV

International Nuclear Information System (INIS)

Chauhan, Yogeshwar; Tiwari, M.K.; Puri, Sanjiv

2008-01-01

The L k (k = l, α, β 1,4 , β 3,6 , β 2,15,9,10,7 , γ 1,5 and γ 2,3,4 ) X-ray production (XRP) cross sections have been measured for six elements with 56 ≤ Z ≤ 68 at 22.6 keV incident photon energy using the EDXRF spectrometer. The incident photon intensity, detector efficiency and geometrical factors have been determined from the K X-ray yields emitted from elemental targets with 22 ≤ Z ≤ 42 in the same geometrical setup and from knowledge of the K XRP cross sections. The L 1 and L 2 subshell fluorescence yields have been deduced from the present measured L k XRP cross sections using the relativistic Hartree-Fock-Slater (HFS) model based photoionization cross sections. The present deduced ω 1 (exp) values have been found to be, on an average, higher by 15% and 20% than those based on the Dirac-Hartree-Slater (DHS) model and the semi-empirical values compiled by Krause, respectively, for elements with 60 ≤ Z ≤ 68

Jazz Leader Helps a Band Take Giant Steps

Science.gov (United States)

Kelderman, Eric

2008-01-01

This article profiles Neil Slater, the longtime leader of the jazz program at the University of North Texas who encouraged both musical perfection and artistic freedom among his star pupils. Standards are high at North Texas, which has become a Camelot where aspiring jazz musicians have come to hone their skills since 1947, when it offered one of…

A note on neighborhood total domination in graphs

Indian Academy of Sciences (India)

[1] Arumugam S and Sivagnanam C, Neighborhood total domination in graphs, Opuscula. Mathematica 31 (2011) 519–531. [2] Chellali M and Haynes T W, A note on the total domination number of a tree, J. Combin. Math. Combin. Comput. 58 (2006) 189–193. [3] Haynes T W, Hedetniemi S T and Slater P J, Fundamentals ...

Introduction to Density Functional Theory: Calculations by Hand on the Helium Atom

Science.gov (United States)

Baseden, Kyle A.; Tye, Jesse W.

2014-01-01

Density functional theory (DFT) is a type of electronic structure calculation that has rapidly gained popularity. In this article, we provide a step-by-step demonstration of a DFT calculation by hand on the helium atom using Slater's X-Alpha exchange functional on a single Gaussian-type orbital to represent the atomic wave function. This DFT…

A complexity analysis of the Gauss-Bessel quadrature as applied to the evaluation of multi-centre integrals over STFs

International Nuclear Information System (INIS)

Bouferguene, Ahmed; Safouhi, Hassan

2006-01-01

In a previous work (Bouferguene 2005 J. Phys. A: Math. Gen. 38 3923), we have shown that in the framework of the Gaussian integral transform, multi-centre integrals over Slater type functions can be evaluated to an acceptable accuracy using a tailored Gauss quadrature in which the weight function has the form W(σ, τ; z) = z ν exp(-σz - τ/z). To be considered a solution worth implementing within a software for routine use in ab initio molecular simulations, the method must also prove to be at least as efficient as those methods previously published in the literature. Two major results are provided in this paper. Firstly, an improvement of the procedure used to generate the roots and weights of the Gauss-Bessel quadrature is proposed. Secondly, a computational cost analysis of the present method and the SD-bar (Safouhi 2001 J. Phys. A: Math. Gen. 34 2801) based approach are compared, hence proving the equivalence of the two from a complexity point of view

Optimized Enhanced Bioremediation Through 4D Geophysical Monitoring and Autonomous Data Collection, Processing and Analysis

Science.gov (United States)

2014-09-01

organic acids and fluid conductivity. .......................... 62 Figure 5-19 Predicted vs. observed TOA concentrations for August 2010 sampling...including most recently the system developed and demonstrated by the British Geological Survey (BGS) (Ogilvy, Meldrum et al. 2009). However, while the...increase in organic acids . ER has also been used to verify installation of permeable reactive barriers (Slater and Binley 2003).  Induced

A Tribute to Professor Rene H. Miller - A Pioneer in Aeromechanics and Rotary Wing Flight Transportation

Science.gov (United States)

Friedmann, Peretz P.; Johnson, Wayne; Scully, Michael P.

2011-01-01

Rene H. Miller (May 19, 1916 January 28, 2003), Emeritus H. N. Slater Professor of Flight Transportation, was one of the most influential pioneers in rotary wing aeromechanics as well as a visionary whose dream was the development of a tilt-rotor based short haul air transportation system. This paper pays a long overdue tribute to his memory and to his extraordinary contributions.

Browse Title Index

African Journals Online (AJOL)

Items 1 - 50 of 408 ... H. E. Slater, O.C.A. Okoye, O. Okperi, N. Rajora. Vol 15, No 1 (2016), Acute pancreatic pseudocyst in an 18-month old girl in a resource limited centre, Abstract. OE Udefiagbon, C Odion, J Akerele. Vol 7, No 1-2 (2008), Age At Menarche Of School Girls In Urban Benin City, Abstract. MI Momoh, C Okonkwo.

Atomic spectrum of plutonium

International Nuclear Information System (INIS)

Blaise, J.; Fred, M.; Gutmacher, R.G.

1984-08-01

This report contains plutonium wavelengths, energy level classifications, and other spectroscopic data accumulated over the past twenty years at Laboratoire Aime Cotton (LAC) Argonne National Laboratory (ANL), and Lawrence Livermore National Laboratory (LLNL). The primary purpose was term analysis: deriving the energy levels in terms of quantum numbers and electron configurations, and evaluating the Slater-Condon and other parameters from the levels

Quantum statistics of ideal parafermi gases III: The Slater quasi-determinant

International Nuclear Information System (INIS)

Rachidi, M.; Zerouaoui, J.; Saidi, E.H.

1995-09-01

The wave function ψ (1,2,...,N) of a gas of N identical two-dimensional exotic particles of spin 1/M (mod 1), M = 2,3,4,... is constructed. It is shown that ψ (1,2,...,N) obeys a generalized Pauli exclusion principle according to which no more than (M - 1) identical particles of spin 1/M (mod 1) can live in the same quantum state. The Fermi nilpotency and the Bose condensation are recovered as special cases. Examples are given. (author). 9 refs

Quantum statistics of ideal parafermi gases III: The Slater quasi-determinant

Energy Technology Data Exchange (ETDEWEB)

Rachidi, M; Zerouaoui, J [Faculte de Sciences, Rabat (Morocco). Section de Physique de Hautes Energies (LMPHE); Saidi, E H [International Centre for Theoretical Physics, Trieste (Italy)

1995-09-01

The wave function {psi} (1,2,...,N) of a gas of N identical two-dimensional exotic particles of spin 1/M (mod 1), M = 2,3,4,... is constructed. It is shown that {psi} (1,2,...,N) obeys a generalized Pauli exclusion principle according to which no more than (M - 1) identical particles of spin 1/M (mod 1) can live in the same quantum state. The Fermi nilpotency and the Bose condensation are recovered as special cases. Examples are given. (author). 9 refs.

The description of dense hydrogen with Wave Packet Molecular Dynamics (WPMD) simulations; Die Beschreibung von dichtem Wasserstoff mit der Methode der Wellenpaket-Molekulardynamik (WPMD)

Energy Technology Data Exchange (ETDEWEB)

Jakob, B.

2006-10-10

In this work the wave packet molecular dynamics (WPMD) is presented and applied to dense hydrogen. In the WPMD method the electrons are described by a slater determinant of periodic Gaussian wave packets. Each single particle wave function can parametrised through 8 coordinates which can be interpreted as the position and momentum, the width and its conjugate momentum. The equation of motion for these coordinates can be derived from a time depended variational principle. Properties of the equilibrium can be ascertained by a Monte Carlo simulation. With the now completely implemented antisymmetrisation the simulation yields a fundamental different behavior for dense hydrogen compare to earlier simplified models. The results show a phase transition to metallic hydrogen with a higher density than in the molecular phase. This behavior has e.g. a large implication to the physics of giant planets. This work describes the used model and explains in particular the calculation of the energy and forces. The periodicity of the wave function leads to a description in the Fourier space. The antisymmetrisation is done by Matrix operations. Moreover the numerical implementation is described in detail to allow the further development of the code. The results provided in this work show the equation of state in the temperature range 300K - 50000K an density 10{sup 23}-10{sup 24} cm{sup -3}, according a pressure 1 GPa-1000 GPa. In a phase diagram the phase transition to metallic hydrogen can be red off. The electrical conductivity of both phases is destined. (orig.)

Study of the monopole interaction between the nucleus and its electronic environment using the method of the variations in decay rate of a radioactive isotope

International Nuclear Information System (INIS)

Auric, Pierette.

1975-01-01

The electron structure of certain elements was studied by nuclear and chemical techniques. Two main problems were dealt with: one concerning the chemical nature and properties of an impurity M present in very small concentrations in a molecular compound M.R., more precisely the recoil atoms obtained after (n,γ) reaction on copper phthalocyanine (CuPc); the other relating to the electron density at the nucleus present in stoechiometric quantities in various compounds, in this case zirconium in PbZrO 3 and ZrO 2 under variable physico-chemical conditions. In the case of CuPc the reactions of the recoil atom with its surroundings were analyzed by chemical kinetic studies. The recoil atom is considered as an impurity in the semiconductor in the same way as oxygen. An electron transfer process gives it enough energy for an exchange to take place with a CuPc molecule. The method of half-life variations showed that the copper making up the atoms has nuclear electron density lower that that of the copper belonging to a CuPc molecule. Calculations of the Hartree-Fock and Hartree-Fock-Slater type reflect the general change in the electron density between one configuration and another, and a 3d 10 4s 0 type configuration was hence adopted for the recoil atom. In the case of 89 Zr the influence of physico-chemical factors such as temperature, crystal phase and strong electric fields on the nuclear electron density was measured with good precision [fr

Exact exchange potential for slabs: Asymptotic behavior of the Krieger-Li-Iafrate approximation

Science.gov (United States)

Engel, Eberhard

2018-02-01

The Krieger-Li-Iafrate (KLI) approximation for the exact exchange (EXX) potential of density functional theory is investigated far outside the surface of slabs. For large z the Slater component of the EXX/KLI potential falls off as -1 /z , where z is the distance to the surface of a slab parallel to the x y plane. The Slater potential thus reproduces the behavior of the exact EXX potential. Here it is demonstrated that the second component of the EXX/KLI potential, often called the orbital-shift term, is also proportional to 1 /z for large z , at least in general. This result is obtained by an analytical evaluation of the Brillouin zone integrals involved, relying on the exponential decay of the states into the vacuum. Several situations need to be distinguished in the Brillouin zone integration, depending on the band structure of the slab. In all standard situations, including such prominent cases as graphene and Si(111) slabs, however, a 1 /z dependence of the orbital-shift potential is obtained to leading order. The complete EXX/KLI potential therefore does not reproduce the asymptotic behavior of the exact EXX potential.

Effective hypernetted-chain study of even-denominator-filling state of the fractional quantum Hall effect

International Nuclear Information System (INIS)

Ciftja, O.

1999-01-01

The microscopic approach for studying the half-filled state of the fractional quantum Hall effect is based on the idea of proposing a trial Fermi wave function of the Jastrow-Slater form, which is then fully projected onto the lowest Landau level. A simplified starting point is to drop the projection operator and to consider an unprojected wave function. A recent study claims that such a wave function approximated in a Jastrow form may still constitute a good starting point on the study of the half-filled state. In this paper we formalize the effective hypernetted-chain approximation and apply it to the unprojected Fermi wave function, which describes the even-denominator-filling states. We test the above approximation by using the Fermi hypernetted-chain theory, which constitutes the natural choice for the present case. Our results suggest that the approximation of the Slater determinant of plane waves as a Jastrow wave function may not be a very accurate approximation. We conclude that the lowest Landau-level projection operator cannot be neglected if one wants a better quantitative understanding of the phenomena. copyright 1999 The American Physical Society

Atomically resolved spectroscopic study of Sr.sub.2./sub.IrO.sub.4./sub.: Experiment and theory

Czech Academy of Sciences Publication Activity Database

Li, Q.; Cao, G.; Okamoto, S.; Yi, J.; Lin, W.; Sales, B.C.; Yan, J.; Arita, R.; Kuneš, Jan; Kozhevnikov, A.V.; Eguiluz, A.G.; Imada, M.; Gai, Z.; Pan, M.; Mandrus, D.G.

2013-01-01

Roč. 3, OCT (2013), s. 1-7 ISSN 2045-2322 R&D Projects: GA ČR GA13-25251S Institutional support: RVO:68378271 Keywords : Sr 2 IrO 4 * scanning tunneling microscopy * Mott insulator * Slater insulator Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 5.078, year: 2013 http://www.nature.com/srep/2013/131029/srep03073/full/srep03073.html

Dynamics Days US 2013 Conference Held in Denver, Colorado on 3-6 January 2013. Abstracts

Science.gov (United States)

2013-12-17

down before population collapse using replicate laboratory populations of the budding yeast Saccharomyces cerevisiae. We mapped the bifurcation diagram...agreement with the theory. Furthermore, we connected yeast populations spatially to evaluate warning signals based on spatio-temporal fluctuations...Colorado School of Mines $125 ARO 54 Franson, Andrew U Colorado School of Mines $125 ARO 55 Slater, Michael U Colorado School of Mines $125 ARO 56 Brewer

Emergent Leadership and Team Effectiveness on a Team Resource Allocation Task

Science.gov (United States)

1987-10-01

ship rather than socioemotional leadership (Bales & Slater, 1955) and since task- oriented behavior is more likely to occur during the trials (when...Self-attention theory (Mullen, 1983) suggests that sex composition would have other effects on behavior in the group. Mullen argues that self...likely to lead. That firjug is consistent with self-attention theory (Mullen, 1963), which indicates that individuals in a minority are nmore self

Ferromagnetism in the Hubbard-Hirsch model

International Nuclear Information System (INIS)

Ivanov, V.A.; Zhuravlev, M.E.

1991-01-01

In the Hubbard model U=∞ the energy lowering due to exchange interaction of electrons of opposite spin in states with opposite bonding character is taken into account. In the electron concentration range 0< n<1 nonmonotonous dependence m(n) analogous to Slater-Pauling curves has been obtained. The Curle temperature having nonmonotonous dependence on n, saturated magnetization, the temperature dependences of magnetization have been obtained. (orig.)

Stochastic TDHF and the Boltzman-Langevin equation

International Nuclear Information System (INIS)

Suraud, E.; Reinhard, P.G.

1991-01-01

Outgoing from a time-dependent theory of correlations, we present a stochastic differential equation for the propagation of ensembles of Slater determinants, called Stochastic Time-Dependent Hartree-Fock (Stochastic TDHF). These ensembles are allowed to develop large fluctuations in the Hartree-Fock mean fields. An alternative stochastic differential equation, the Boltzmann-Langevin equation, can be derived from Stochastic TDHF by averaging over subensembles with small fluctuations

On the description of electronic final states in the K-shell ionization by protons

International Nuclear Information System (INIS)

Aashamar, O.; Kocbach, L.

1976-06-01

The choice of free electronic wave functions in the description of K-shell ionization by protons is discussed. The previously known discrepancies between PWBA and SCA results are shown to be entirely due to two different choices of electronic wave functions. Calculations in the SCA framework with Hartree-Fock-Slater wave functions are reported. Some general features of the SCA calculations are discussed. (Auth.)

Cirrus Dopant Nano-Composite Coatings

Science.gov (United States)

2014-11-01

coatings without alteration to the existing plating process. Glen Slater, Cirrus Materials | Stephen Flint, Auckland UniServices Ltd Report...ADDRESS(ES) University of Auckland ,Cirrus Materials, Auckland , New Zealand, 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY...JiA/ g THE UNIVERSITY ’-" OF AUCKLAND NEW ZEALAND Te Whare Wanan a o Thmaki Makaurau ~"""’ • ........,." ... Southwest Pacific Basin . p

Structural, electronic, and magnetic properties of pristine and oxygen-adsorbed graphene nanoribbons

Energy Technology Data Exchange (ETDEWEB)

Miwa, R.H.; Veiga, R.G.A. [Instituto de Fisica, Universidade Federal de Uberlandia, Caixa Postal 593, CEP 38400-902, Uberlandia, MG (Brazil); Srivastava, G.P., E-mail: gps@excc.ex.ac.uk [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)

2010-07-15

The structural, electronic and magnetic properties of pristine and oxygen-adsorbed (3,0) zigzag and (6,1) armchair graphene nanoribbons have been investigated theoretically, by employing the ab initio pseudopotential method within the density functional scheme. The zigzag nanoribbon is more stable with antiferromagnetically coupled edges, and is semiconducting. The armchair nanoribbon does not show any preference for magnetic ordering and is semiconducting. The oxygen molecule in its triplet state is adsorbed most stably at the edge of the zigzag nanoribbon. The Stoner metallic behaviour of the ferromagnetic nanoribbons and the Slater insulating (ground state) behaviour of the antiferromagnetic nanoribbons remain intact upon oxygen adsorption. However, the local magnetic moment of the edge carbon atom of the ferromagnetic zigzag ribbon is drastically reduced, due to the formation of a spin-paired C-O bond.

Hartree and Exchange in Ensemble Density Functional Theory: Avoiding the Nonuniqueness Disaster.

Science.gov (United States)

Gould, Tim; Pittalis, Stefano

2017-12-15

Ensemble density functional theory is a promising method for the efficient and accurate calculation of excitations of quantum systems, at least if useful functionals can be developed to broaden its domain of practical applicability. Here, we introduce a guaranteed single-valued "Hartree-exchange" ensemble density functional, E_{Hx}[n], in terms of the right derivative of the universal ensemble density functional with respect to the coupling constant at vanishing interaction. We show that E_{Hx}[n] is straightforwardly expressible using block eigenvalues of a simple matrix [Eq. (14)]. Specialized expressions for E_{Hx}[n] from the literature, including those involving superpositions of Slater determinants, can now be regarded as originating from the unifying picture presented here. We thus establish a clear and practical description for Hartree and exchange in ensemble systems.

Orientação para Aprendizagem, Orientação para Mercado e Desempenho Organizacional: Evidências Empíricas

Directory of Open Access Journals (Sweden)

Eduardo Botti Abbade

2012-01-01

Full Text Available This study aims to identify how learning orientation (LO and market orientation (MO influence theperformance of enterprises in the central region of the state of Rio Grande do Sul (RS, Brazil. The method usedinvolved a survey of 123 companies in central RS. The instrument for data collection was developed using theLO scale (Sinkula, Baker, & Noordewier, 1997, the MARKOR scale (Kohli, Jaworski, & Kumar, 1993 anditems for evaluation of organizational performance proposed by Narver and Slater (1990 and Baker and Sinkula(1999. The results suggest that MO has a significant positive influence on the organizational performance of thecompanies surveyed. It was also noted that the MO significantly influences organizational performance whenmediated by the LO, just as the LO has a significant influence on organizational performance when mediated byMO.

Quantum Chemistry on Quantum Computers: A Polynomial-Time Quantum Algorithm for Constructing the Wave Functions of Open-Shell Molecules.

Science.gov (United States)

Sugisaki, Kenji; Yamamoto, Satoru; Nakazawa, Shigeaki; Toyota, Kazuo; Sato, Kazunobu; Shiomi, Daisuke; Takui, Takeji

2016-08-18

Quantum computers are capable to efficiently perform full configuration interaction (FCI) calculations of atoms and molecules by using the quantum phase estimation (QPE) algorithm. Because the success probability of the QPE depends on the overlap between approximate and exact wave functions, efficient methods to prepare accurate initial guess wave functions enough to have sufficiently large overlap with the exact ones are highly desired. Here, we propose a quantum algorithm to construct the wave function consisting of one configuration state function, which is suitable for the initial guess wave function in QPE-based FCI calculations of open-shell molecules, based on the addition theorem of angular momentum. The proposed quantum algorithm enables us to prepare the wave function consisting of an exponential number of Slater determinants only by a polynomial number of quantum operations.

Comparative studies of atomic independent-particle potentials

International Nuclear Information System (INIS)

Talman, J.D.; Ganas, P.S.; Green, A.E.S.

1979-01-01

A number of atomic properties are compared in various independent-particle models for atoms. The models studied are the Hartree-Fock method, a variationally optimized potential model, a parametrized analytic form of the same model, parametrized analytic models constructed to fit atomic energy levels, the so-called Hartree-Fock-Slater model, and the Xα model. The physical properties compared are single-particle energy levels, total energies, and dipole polarizabilities. The extent to which the virial theorem is satisfied in the different models is also considered. The atoms Be, Ne, Ar, Kr, and Xe and ions O v and Al iv hav been compared. The results show that the experimental properties can be well represented by several of the independent-particle models. Since it has been shown that the optimized potential models yield wavefunctions that are almost the same as Hartree-Fock wavefunctions, they provide a natural solution to the problem of extending the Hartree-Fock method to excited states

Nano-colloid electrophoretic transport: Fully explicit modelling via dissipative particle dynamics

Science.gov (United States)

Hassanzadeh Afrouzi, Hamid; Farhadi, Mousa; Sedighi, Kurosh; Moshfegh, Abouzar

2018-02-01

In present study, a novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced for modelling electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Moreover, capability of different thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field in nano scale application (0.072 600 in DPD units regardless of electric field intensity. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0.145 [ v / nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the radial distribution function with available electrolyte structure modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.

Dissipative particle dynamics: Effects of thermostating schemes on nano-colloid electrophoresis

Science.gov (United States)

Hassanzadeh Afrouzi, Hamid; Moshfegh, Abouzar; Farhadi, Mousa; Sedighi, Kurosh

2018-05-01

A novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced in the present study to model the electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Performance of various thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field (0 . 072 relationships respectively with electric field and colloidal repulsion; although they each respectively behave direct and inverse trends with salt concentration under various thermostats. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0 . 145[v/nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the system radial distribution function with available EW3D modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.

Transport coefficients for carbon, hydrogen, and the organic mixture C2H3

International Nuclear Information System (INIS)

Rinker, G.

1986-02-01

Electrical and thermal transport coefficients are calculated for amorphous elemental carbon and hydrogen, using the best available systematic theoretical methods. The density range considered is 10 -3 g/cm 3 less than or equal to rho less than or equal to 10 6 g/cm 3 for carbon, and 10 -4 g/cm 3 less than or equal to rho less than or equal to 10 5 g/cm 3 for hydrogen. The temperature range considered is 10 -2 eV less than or equal to kT less than or equal to 10 4 eV. Calculational methods include relativistic partial-wave analysis of the extended Ziman theory, and nonrelativistic plane-wave analysis (Born approximation) of the original Ziman theory. Physical models include relativistic Dirac-Fock-Slater and nonrelativistic Thomas-Fermi-Dirac electron-ion potentials, and one-component-plasma ion-ion structure factors. A mixing algorithm is used to obtain approximate transport coefficients for the atomic ratio C 2 H 3 . 10 refs., 31 figs

Self-consistent embedded-cluster calculations of the electronic structure of alkaline earth fluorides in the Hartree-Fock-Slater approximation

International Nuclear Information System (INIS)

Amaral, N.C.; Maffeo, B.; Guenzburger, D.J.R.

1982-01-01

Molecular orbitals calculations were performed for clusters representing the CaF 2 , SrF 2 and BaF 2 ionic crystals. The discrete variational method was employed, with the Xα approximation for the exchange interaction; a detailed investigation of different models for embedding the clusters in the solids led to a realistic description of the effect of neighbour ions in the infinite crystal. The results obtained were used to interpret optical and photoelectron data reported in the literature. In the case of CaF 2 , comparisons were made with existing band structure calculations. (Author) [pt

Electronic structure of lanthanide scandates

Science.gov (United States)

Mizzi, Christopher A.; Koirala, Pratik; Marks, Laurence D.

2018-02-01

X-ray photoelectron spectroscopy, ultraviolet photoelectron spectroscopy, and density functional theory calculations were used to study the electronic structure of three lanthanide scandates: GdSc O3,TbSc O3 , and DySc O3 . X-ray photoelectron spectra simulated from first-principles calculations using a combination of on-site hybrid and GGA +U methods were found to be in good agreement with experimental x-ray photoelectron spectra. The hybrid method was used to model the ground state electronic structure and the GGA +U method accounted for the shift of valence state energies due to photoelectron emission via a Slater-Janak transition state approach. From these results, the lanthanide scandate valence bands were determined to be composed of Ln 4 f ,O 2 p , and Sc 3 d states, in agreement with previous work. However, contrary to previous work the minority Ln 4 f states were found to be located closer to, and in some cases at, the valence band maximum. This suggests that minority Ln 4 f electrons may play a larger role in lanthanide scandate properties than previously thought.

Accurate donor electron wave functions from a multivalley effective mass theory.

Science.gov (United States)

Pendo, Luke; Hu, Xuedong

Multivalley effective mass (MEM) theories combine physical intuition with a marginal need for computational resources, but they tend to be insensitive to variations in the wavefunction. However, recent papers suggest full Bloch functions and suitable central cell donor potential corrections are essential to replicating qualitative and quantitative features of the wavefunction. In this talk, we consider a variational MEM method that can accurately predict both spectrum and wavefunction of isolated phosphorus donors. As per Gamble et. al, we employ a truncated series representation of the Bloch function with a tetrahedrally symmetric central cell correction. We use a dynamic dielectric constant, a feature commonly seen in tight-binding methods. Uniquely, we use a freely extensible basis of either all Slater- or all Gaussian-type functions. With a large basis able to capture the influence of higher energy eigenstates, this method is well positioned to consider the influence of external perturbations, such as electric field or applied strain, on the charge density. This work is supported by the US Army Research Office (W911NF1210609).

Scalar Relativistic Study of the Structure of Rhodium Acetate

Directory of Open Access Journals (Sweden)

Emily E. Edwards

2004-01-01

Full Text Available Abstract: Rhodium acetate, related rhodium carboxylates, and rhodium amide complexes are powerful catalysts for carbene chemistry. They readily promote the decomposition of diazo compounds and transfer the resulting carbene to a variety of substrates. There have been several quantum chemistry studies of these compounds, particularly of the acetate. These have all used non-relativistic methods, and all have shown optimized Rh-Rh bond lengths significantly longer than the experimental value. In this study we have surveyed several scalar relativistic DFT methods using Gaussian, Slater, and numerical basis functions (in DGAUSS, ADF, and DMOL3. Several combinations of exchange-correlation functionals with relativistic and non-relativistic effective core potentials (ECP were investigated, as were non-relativistic and all electron scalar relativistic methods. The combination of the PW91 exchange and PW91 correlation functional with the Christiansen-Ermler ECP gave the best results: 2.3918 Å compared to the experimental value of 2.3855±0.0005 Å.

Coupled state analysis of electron excitations in asymmetric collision systems

International Nuclear Information System (INIS)

Mehler, G.; Reus, T. de; Mueller, U.; Reinhardt, J.; Mueller, B.; Greiner, W.; Soff, G.

1985-01-01

A coupled channel formalism is presented, using relativistic basis states of the target atom. Screening effects are incorporated by means of an effective potential of Hartree-Fock-Slater type. Relativistic wave packets are employed for the description of the continuum. The impact parameter dependence of the K-hole production in p-Ag collisions is calculated, including quadrupole contributions of the projectile Coulomb potential. The results are compared with experimental data. (orig.)

Final Report: Identification and Manipulation of Novel Topological Phases

Science.gov (United States)

2016-02-09

Massachusetts Institute of Technology ( MIT ) 77 Massachusetts Ave. NE18-901 Cambridge, MA 02139 -4307 9-Aug-2015 ABSTRACT Number of Papers published in peer...Professorship (2012-2015) Plenary Speaker, 3rd. International Conference in Superconductivity and Magnetism (ICSM2012) Alfred P. Sloan Fellowship (2012...transition ( MIT ) is discontinuous and occurs at temperatures greater or equal to TN , a Slater-type MIT is continuous and occurs exactly atTN .15 Therefore

Relativistic Calculations and Measurements of Energies, Auger Rates, and Lifetimes.

Science.gov (United States)

1982-12-01

Research and Industry, Denton, Texas, 8-10 November 1982. 7. B. Crasemann: "Efectos Relativ’sticos y de QED Sobre las Transiciones Rayos - X y Auger Entre...INNER-SHELL IONIZATION BY PROTONS X -RAY EMISSION BREIT INTERACTION AUGER TRANSITIONS DIRAC-HARTREE-SLATER COMPUTATIONS SYNCHROTRON RADIATION RESONANT...computations, including relativistic and quantum- electrodynamic effects, of atomic energy levels and of x -ray and Auger transitions in atoms with one or

Contribution to the theoretical study of metallic systems containing rare earths: hyperfine interactions and exchange coupling

International Nuclear Information System (INIS)

Troper, A.

1978-01-01

A theoretical study involving rare earth impurities, which were embedded in transition metals (s-p or noble), from the point of view of the hyperfine interactions is presented. A model was created to describe a d-resonance (Anderson-Moriya) acting on a s-p conduction band which was strongly perturbed by a slater-koster potential, used to describe the rare earths which were diluted in matrices of transition elements. (author)

Change in the Magnitude of River Flooding in the United States, 1965-2015

Science.gov (United States)

This figure shows changes in the size and frequency of flooding events in rivers and streams in the United States between 1965 and 2015. Blue upward-pointing symbols show locations where floods have become larger; brown downward-pointing symbols show locations where floods have become smaller. Data were analyzed by Louise Slater and Gabriele Villarini at the University of Iowa. For more information: www.epa.gov/climatechange/science/indicators

Joint Program on Molecular Biology of Marine Organisms

Science.gov (United States)

1992-08-20

and lateral flagella formation in a marine vibrio (Belas and Colwell, 1982). Upon contact with a surface, the polar flagella of Vibrio ... parahemolyticus ceased to function. Shortl’ thereafter, lateral flagella formed around the cells, apparently mediating the "irreversible" attachment process. Pilus...Colwell. 1982. Adsorption kinetics of 18 Slaterally and polarly flagellated Vibrio . J. Bacteriol. 151:1568-1580. S-- Brown, C.M., D.C. Ellwood, and

State-specific transport properties of electronically excited Ar and C

Science.gov (United States)

Istomin, V. A.; Kustova, E. V.

2018-05-01

In the present study, a theoretical model of state-resolved transport properties in electronically excited atomic species developed earlier is applied to argon and carbon atomic species. It is shown that for Ar and C, similarly to the case of atomic nitrogen and oxygen, the Slater-like models can be applied to calculate diameters of electronically excited atoms. Using the Slater-like model it is shown that for half-filled N (2 px1py1pz1) and full-filled Ar (3 px2py2pz2) electronic shells the growth of atomic radius goes slowly compared to C (2 px1py1) and O (2 px2py1pz1). The effect of collision diameters on the transport properties of Ar and C is evaluated. The influence of accounted number of electronic levels on the transport coefficients is examined for the case of Boltzmann distributions over electronic energy levels. It is emphasized that in the temperature range 1000-14000 K, for Boltzmann-like distributions over electronic states the number of accounted electronic levels do not influence the transport coefficients. Contrary to this, for higher temperatures T > 14000 K this effect becomes of importance, especially for argon.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Charge-density-shear-moduli relationships in aluminum-lithium alloys.

Science.gov (United States)

Eberhart, M

2001-11-12

Using the first principles full-potential linear-augmented-Slater-type orbital technique, the energies and charge densities of aluminum and aluminum-lithium supercells have been computed. The experimentally observed increase in aluminum's shear moduli upon alloying with lithium is argued to be the result of predictable changes to aluminum's total charge density, suggesting that simple rules may allow the alloy designer to predict the effects of dilute substitutional elements on alloy elastic response.

Consistent microscopic theory of collective motion in the framework of an ATDHF approach

International Nuclear Information System (INIS)

Goeke, K.; Reinhard, P.

1978-01-01

Based on merely two assumptions, namely the existence of a collective Hamiltonian and that the collective motion evolves along Slater determinants, we first derive a set of adiabatic time-dependent Hartree-Fock equations (ATDHF) which determine the collective path, the mass and the potential, second give a unique procedure for quantizing the resulting classical collective Hamiltonian, and third explain how to use the collective wavefunctions, which are eigenstates of the quantized Hamiltonian

Market Orientation Capabilities: A Study of Learning Processes in Market-Oriented Companies

OpenAIRE

Silkoset, Ragnhild

2009-01-01

The literature operates with three perspectives on market orientation. These include market orientation as behavior (Kohli and Jaworski 1990; Narver and Slater 1990), market orientation as a unique resource (Hunt and Morgan 1995) and market orientation as a dynamic learning capability (Sinkula 1994; Day 1994b). A company's level of market orientation will vary with regard to the perspectives, including factors affecting a company’s degree of market orientation and the effect...

Master Lovas-Andai and equivalent formulas verifying the 8/33 two-qubit Hilbert-Schmidt separability probability and companion rational-valued conjectures

Science.gov (United States)

Slater, Paul B.

2018-04-01

We begin by investigating relationships between two forms of Hilbert-Schmidt two-rebit and two-qubit "separability functions"—those recently advanced by Lovas and Andai (J Phys A Math Theor 50(29):295303, 2017), and those earlier presented by Slater (J Phys A 40(47):14279, 2007). In the Lovas-Andai framework, the independent variable ɛ \\in [0,1] is the ratio σ (V) of the singular values of the 2 × 2 matrix V=D_2^{1/2} D_1^{-1/2} formed from the two 2 × 2 diagonal blocks (D_1, D_2) of a 4 × 4 density matrix D= ||ρ _{ij}||. In the Slater setting, the independent variable μ is the diagonal-entry ratio √{ρ _{11} ρ _ {44}/ρ _ {22 ρ _ {33}}}—with, of central importance, μ =ɛ or μ =1/ɛ when both D_1 and D_2 are themselves diagonal. Lovas and Andai established that their two-rebit "separability function" \\tilde{χ }_1 (ɛ ) (≈ ɛ ) yields the previously conjectured Hilbert-Schmidt separability probability of 29/64. We are able, in the Slater framework (using cylindrical algebraic decompositions [CAD] to enforce positivity constraints), to reproduce this result. Further, we newly find its two-qubit, two-quater[nionic]-bit and "two-octo[nionic]-bit" counterparts, \\tilde{χ _2}(ɛ ) =1/3 ɛ ^2 ( 4-ɛ ^2) , \\tilde{χ _4}(ɛ ) =1/35 ɛ ^4 ( 15 ɛ ^4-64 ɛ ^2+84) and \\tilde{χ _8} (ɛ )= 1/1287ɛ ^8 ( 1155 ɛ ^8-7680 ɛ ^6+20160 ɛ ^4-25088 ɛ ^2+12740) . These immediately lead to predictions of Hilbert-Schmidt separability/PPT-probabilities of 8/33, 26/323 and 44482/4091349, in full agreement with those of the "concise formula" (Slater in J Phys A 46:445302, 2013), and, additionally, of a "specialized induced measure" formula. Then, we find a Lovas-Andai "master formula," \\tilde{χ _d}(ɛ )= ɛ ^d Γ (d+1)^3 _3\\tilde{F}_2( -{d/2,d/2,d;d/2+1,3 d/2+1;ɛ ^2) }/{Γ ( d/2+1) ^2}, encompassing both even and odd values of d. Remarkably, we are able to obtain the \\tilde{χ _d}(ɛ ) formulas, d=1,2,4, applicable to full (9-, 15-, 27-) dimensional sets of

The Impact of Alternative Market Orientation Strategies on Firm Performance: Customer versus Competitor Orientation

OpenAIRE

Micheels, Eric T.; Gow, Hamish R.

2010-01-01

Research studies have differed over the importance of the relative emphasis of a customer versus competitor orientation in the development of a market orientation (Slater and Narver, 1994; Tajeddini, 2010). In this study, we assess whether the emphasis of one component over another of a market orientation is an important determinant of firm performance within the Illinois beef industry, specifically the cow-calf sector. Using a series of OLS regressions, we examine the importance of a market ...

Ultraviolet photoelectron spectroscopy of transient species

International Nuclear Information System (INIS)

Leeuw, D.M. de.

1979-01-01

Transient species are studied in the isolation of the gas phase using ultraviolet photoelectron spectroscopy (PES). A description of the equipment used and a discussion of some theoretical topics, which play a role in the interpretation of PE spectra, are given. Koopmans' theorem, Hartree-Fock-Slater (HFS) calculations and the sum rule are discussed. A versatile ultraviolet PE spectrometer, designed specifically for this purpose, has been built and the construction and performance of this instrument are described. (Auth.)

Prevention Research Matters-Communities Working to Improve Physical Activity

Centers for Disease Control (CDC) Podcasts

2018-02-15

We know that children who are physically active every day are less likely to develop chronic diseases as adults, including obesity. Dr. Sandy Slater, a researcher with the University of Illinois, Chicago Prevention Research Center, discusses how a park improvement project in Chicago helped engage communities to improve areas for play and activity.  Created: 2/15/2018 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 2/15/2018.

Personalisation of power, neoliberalism and the production of corruption

OpenAIRE

Ahmad Khair, Amal Hayati; Haniffa, Roszaini; Hudaib, Mohammad; Abd. Karim, Mohamad Nazri

2015-01-01

This paper utilises a political lens in considering the cause for the production of corruption and the role of political leadership. Specifically, the notion of personalisation of power as advocated by Slater (2003) is adopted to portray how the adoption of neoliberalism ideology by an aspiring autocratic leader results in the weakening of the infrastructural power through three strategies: packing, rigging and circumventing. We use Perwaja Steel as a case study to demonstrate the modus opera...

Ab initio nuclear structure - the large sparse matrix eigenvalue problem

Energy Technology Data Exchange (ETDEWEB)

Vary, James P; Maris, Pieter [Department of Physics, Iowa State University, Ames, IA, 50011 (United States); Ng, Esmond; Yang, Chao [Computational Research Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Sosonkina, Masha, E-mail: jvary@iastate.ed [Scalable Computing Laboratory, Ames Laboratory, Iowa State University, Ames, IA, 50011 (United States)

2009-07-01

The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 10{sup 10} and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

Ab initio nuclear structure - the large sparse matrix eigenvalue problem

International Nuclear Information System (INIS)

Vary, James P; Maris, Pieter; Ng, Esmond; Yang, Chao; Sosonkina, Masha

2009-01-01

The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 10 10 and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

Studies in the electronic structure of matter

International Nuclear Information System (INIS)

Swarts, C.A.

1979-01-01

The results of various theories for the angular distribution of electrons photoemitted from the outermost p-shell of rare gas atoms are compared. The theories compared are the local density theories of Slater (X/sub α/) and of Hohenberg, Kohn and Sham, the pseudopotential method, Hartree-Fock theory as evaluated by Kennedy and Manson, and Amusia's random phase approximation with exchange (RPAE). Extended Huekel theory is applied to GaAs, GaP, and to the nitrogen isoelectronic trap in GaAs and GaP. The computer perfect crystal band structures are found to be in reasonable agreement with those computed with empirical pseudopotentials. Nitrogen impurity levels in GaAs and GaP are calculated using a cluster model. By means of model calculations for an independent electron metal, exact lineshapes are obtained for the photon absorption, emission and photoemission spectra of deep core states. 97 references

Auxiliary-field quantum Monte Carlo calculations of molecular systems with a Gaussian basis

International Nuclear Information System (INIS)

Al-Saidi, W.A.; Zhang Shiwei; Krakauer, Henry

2006-01-01

We extend the recently introduced phaseless auxiliary-field quantum Monte Carlo (QMC) approach to any single-particle basis and apply it to molecular systems with Gaussian basis sets. QMC methods in general scale favorably with the system size as a low power. A QMC approach with auxiliary fields, in principle, allows an exact solution of the Schroedinger equation in the chosen basis. However, the well-known sign/phase problem causes the statistical noise to increase exponentially. The phaseless method controls this problem by constraining the paths in the auxiliary-field path integrals with an approximate phase condition that depends on a trial wave function. In the present calculations, the trial wave function is a single Slater determinant from a Hartree-Fock calculation. The calculated all-electron total energies show typical systematic errors of no more than a few millihartrees compared to exact results. At equilibrium geometries in the molecules we studied, this accuracy is roughly comparable to that of coupled cluster with single and double excitations and with noniterative triples [CCSD(T)]. For stretched bonds in H 2 O, our method exhibits a better overall accuracy and a more uniform behavior than CCSD(T)

Constraint, Intelligence, and Control Hierarchy in Virtual Environments. Chapter 1

Science.gov (United States)

Sheridan, Thomas B.

2007-01-01

This paper seeks to deal directly with the question of what makes virtual actors and objects that are experienced in virtual environments seem real. (The term virtual reality, while more common in public usage, is an oxymoron; therefore virtual environment is the preferred term in this paper). Reality is difficult topic, treated for centuries in those sub-fields of philosophy called ontology- "of or relating to being or existence" and epistemology- "the study of the method and grounds of knowledge, especially with reference to its limits and validity" (both from Webster s, 1965). Advances in recent decades in the technologies of computers, sensors and graphics software have permitted human users to feel present or experience immersion in computer-generated virtual environments. This has motivated a keen interest in probing this phenomenon of presence and immersion not only philosophically but also psychologically and physiologically in terms of the parameters of the senses and sensory stimulation that correlate with the experience (Ellis, 1991). The pages of the journal Presence: Teleoperators and Virtual Environments have seen much discussion of what makes virtual environments seem real (see, e.g., Slater, 1999; Slater et al. 1994; Sheridan, 1992, 2000). Stephen Ellis, when organizing the meeting that motivated this paper, suggested to invited authors that "We may adopt as an organizing principle for the meeting that the genesis of apparently intelligent interaction arises from an upwelling of constraints determined by a hierarchy of lower levels of behavioral interaction. "My first reaction was "huh?" and my second was "yeah, that seems to make sense." Accordingly the paper seeks to explain from the author s viewpoint, why Ellis s hypothesis makes sense. What is the connection of "presence" or "immersion" of an observer in a virtual environment, to "constraints" and what types of constraints. What of "intelligent interaction," and is it the intelligence of the

Unified description of pf-shell nuclei by the Monte Carlo shell model calculations

Energy Technology Data Exchange (ETDEWEB)

Mizusaki, Takahiro; Otsuka, Takaharu [Tokyo Univ. (Japan). Dept. of Physics; Honma, Michio

1998-03-01

The attempts to solve shell model by new methods are briefed. The shell model calculation by quantum Monte Carlo diagonalization which was proposed by the authors is a more practical method, and it became to be known that it can solve the problem with sufficiently good accuracy. As to the treatment of angular momentum, in the method of the authors, deformed Slater determinant is used as the basis, therefore, for making angular momentum into the peculiar state, projected operator is used. The space determined dynamically is treated mainly stochastically, and the energy of the multibody by the basis formed as the result is evaluated and selectively adopted. The symmetry is discussed, and the method of decomposing shell model space into dynamically determined space and the product of spin and isospin spaces was devised. The calculation processes are shown with the example of {sup 50}Mn nuclei. The calculation of the level structure of {sup 48}Cr with known exact energy can be done with the accuracy of peculiar absolute energy value within 200 keV. {sup 56}Ni nuclei are the self-conjugate nuclei of Z=N=28. The results of the shell model calculation of {sup 56}Ni nucleus structure by using the interactions of nuclear models are reported. (K.I.)

Characterization of some electronic spectral parameters for doped Nd (III) ion in saturated aqueous solution of some pharmaceutical compounds

International Nuclear Information System (INIS)

Naulakha, Neelam; Soni, K.P.; Bhati, P.R.

2000-01-01

The stereo-environment of doped Nd(III) ion in various saturated solutions of some medicinal compounds has been studied for various electronic spectral parameters. The various electronic parameters, viz., Slater Condon (F k ), Lande (ζ 4f ) intensity of hypersensitive band ( 4 G 5/2 ), bonding parameter (b 1/2 ), Judd-Ofelt parameter (Tλ) and Racah parameter (E k ) for Nd(III) ion doped in saturated solution of diphenylhydramine, tripelennamine, chlorophenaramine, promethazine, terfinadine, naproxen, fenoprofen, flurbiprofen, oxaprozine, ketoprofen and ibuprofen have been studied. (author)

A theoretical survey of 4s-4p and 4p-4d transitions in nickel-like ions through Sn XXIII

International Nuclear Information System (INIS)

Wyart, J.F.

1987-01-01

The predictions of 4s-4p and 4p-4d transitions derived from Slater-Condon type calculations of 3d 9 4s, -4p and -4d configurations in the sequence Zn III-Se VII have been recently confirmed experimentally through Mo XV. These new data are used here to refine the predictions in the sequence Mo XV-Sn XXIII. The radial parameters involved in the three configurations are determined in generalized least-squares fits using all known levels in the sequence. (orig.)

La aproximación topológica en el cálculo de orbitales moleculares localizados.

OpenAIRE

Paniagua, Juan Carlos

1983-01-01

[spa] Es bien sabido que cualquier función de onda que se exprese como determinante de Slater construido a partir de orbitales moleculares doblemente ocupados es invariante frente a transformaciones unitarias de dichos orbitales. Aunque las posibilidades de elección son ilimitadas, en la práctica sólo se utilizan dos tipos de orbitales: los canónicos y los localizados. Los primeros se caracterizan por ser funciones propias de algún hamiltoniano monoelectrónico efectivo y entre sus propieda...

Coupled channel calculations of K-shell ionization in asymmetric collision systems

International Nuclear Information System (INIS)

Mehler, G.; Greiner, W.; Soff, G.

1986-07-01

We report theoretical results on K-shell ionization for a variety of asymmetric collision systems. The calculated ionization rates are compared with experimental data. The coupled channel formalism underlying these calculations is presented. It is based on a set of relativistic target centred states, taking a screened potential of Dirac-Fock-Slater type into account. We discuss the effects of different matrix elements, e.g. continuum-continuum couplings. The binding effect is inherently contained in our approach and described in a dynamical way. (orig.)

On the anisotropy energies for YCo5, RCo5, Y2Co17, and R2Co17

International Nuclear Information System (INIS)

Takahashi, H.; Hikosaka, K.; Ohtsuka, S.; Seo, A.; Ukai, T.; Mori, N.

1988-01-01

The approximate d bands for YCo 5 , RCo 5 , Y 2 Co 17 , and R 2 Co 17 (Th 2 Zn 17 and Th 2 Ni 17 type) are formulated by Deegan's prescription and the formulas of Slater and Koster. The experimental results of YCo 5 and Y 2 Co 17 are discussed by using these approximate d bands. For RCo 5 and R 2 Co 17 the discussions are made by adopting the localized model and the band model for 4f electrons

Microscopic theories for collective motions of large amplitude

International Nuclear Information System (INIS)

Souza Cruz, F.F. de.

1986-01-01

The many proposals of ''Collective Paths'' that have appeared in literature, were derived through a local analysis of the Time Dependent Hartree Fock dynamics. Those proposals were compared and validity conditions obtained for Semiclassical Hamiltonians which have only quadratic terms in momenta. A careful analysis of the parametrization of Slater Determinants allowed us to exploit the geometrical features of the Time Dependent Hartree Fock Theory and construct the Paths in a covariant way. The analysis was applied to a three level model (Su(3)). (author) [pt

Theoretical analysis of the structural phase transformation from B3 to B1 in BeO under high pressure

Science.gov (United States)

Jain, Arvind; Verma, Saligram; Nagarch, R. K.; Shah, S.; Kaurav, Netram

2018-05-01

We have performed the phase transformation and elastic properties of BeO at high pressure by formulating effective interionic interaction potential. The elastic constants, including the long-range Coulomb and van der Waals (vdW) interactions and the short-range repulsive interaction of up to second-neighbor ions within the Hafemeister and Flygare approach, are derived. Assuming that both the ions are polarizable, we employed the Slater-Kirkwood variational method to estimate the vdW coefficients, a structural phase transition (Pt) from ZnS structure (B3) to NaCl structure (B1) at 108 GPa has been predicted for BeO. The estimated value of the phase transition pressure (Pt) and the magnitude of the discontinuity in volume at the transition pressure are consistent as compared to the theoretical data. The variations of elastic constants with pressure follow a systematic trend identical to that observed in others compounds of ZnS type structure family.

Configuration interaction wave functions: A seniority number approach

International Nuclear Information System (INIS)

Alcoba, Diego R.; Torre, Alicia; Lain, Luis; Massaccesi, Gustavo E.; Oña, Ofelia B.

2014-01-01

This work deals with the configuration interaction method when an N-electron Hamiltonian is projected on Slater determinants which are classified according to their seniority number values. We study the spin features of the wave functions and the size of the matrices required to formulate states of any spin symmetry within this treatment. Correlation energies associated with the wave functions arising from the seniority-based configuration interaction procedure are determined for three types of molecular orbital basis: canonical molecular orbitals, natural orbitals, and the orbitals resulting from minimizing the expectation value of the N-electron seniority number operator. The performance of these bases is analyzed by means of numerical results obtained from selected N-electron systems of several spin symmetries. The comparison of the results highlights the efficiency of the molecular orbital basis which minimizes the mean value of the seniority number for a state, yielding energy values closer to those provided by the full configuration interaction procedure

Interesting Features of Ionization Potentials for Elements (Z ≤ 119) along the Periodic Table

International Nuclear Information System (INIS)

Gu Chun; Zeng De-Ling; Li Jia-Ming; Jin Rui; Yue Xian-Fang; Gao Xiang

2016-01-01

The ionization potential (IP) is a basic property of an atom, which has many applications such as in element analysis. With the Dirac–Slater methods (i.e., mean field theory), IPs of all occupied orbitals for elements with atomic number (Z ≤ 119) are calculated conveniently and systematically. Compared with available experimental measurements, the theoretical accuracies of IPs for various occupied orbitals are ascertained. The map of the inner orbital IPs with good accuracies should be useful to select x-ray energies for element analysis. Based on systematic variations of the first IPs for the outermost orbitals in good agreement with experimental values as well as other IPs, mechanisms of electronic configurations of all atomic elements (Z ≤ 119) along the periodic table are elucidated. It is interesting to note that there exist some deficiencies of the intermediate orbital IPs, which are due to electron correlations and should be treated beyond the mean field theory. (paper)

Band structure of the quaternary Heusler alloys ScMnFeSn and ScFeCoAl

Science.gov (United States)

Shanthi, N.; Teja, Y. N.; Shaji, Shephine M.; Hosamani, Shashikala; Divya, H. S.

2018-04-01

In our quest for materials with specific applications, a theoretical study plays an important role in predicting the properties of compounds. Heusler alloys or compounds are the most studied in this context. More recently, a lot of quaternary Heusler compounds are investigated for potential applications in fields like Spintronics. We report here our preliminary study of the alloys ScMnFeSn and ScFeCoAl, using the ab-initio linear muffin-tin orbital method within the atomic sphere approximation (LMTO-ASA). The alloy ScMnFeSn shows perfect half-metallicity, namely, one of the spins shows a metallic behaviour and the other spin shows semi-conducting behaviour. Such materials find application in devices such as the spin-transfer torque random access memory (STT-MRAM). In addition, the alloy ScMnFeSn is found to have an integral magnetic moment of 4 µB, as predicted by the Slater-Pauling rule. The alloy ScFeCoAl does not show half-metallicity.

Clinical application and observation of curative effect in the near future of iodine-131 therapy in juvenile patients with hyperthyroidism

International Nuclear Information System (INIS)

Chen Huilin; Liang Jun; Liang Fengyun

2004-01-01

Objective: To assess clinical application of 131 I therapy and observation of curative effect in the near future after treatment in juvenile patients with hyperthyroidism Methods: 44 juvenile patients with hyperthyroidism were divided two subgroups of that children and early youths .The dosage of 131 I were respectively 135.1±34.0(3.65±0.92), 200.2±64.0 MBq(5.41±1.73 mCi). The curative effect belonged in four kinds being to fully recovered, quite a lot, fail to respond to medical and hypothyroidism at six month slater or from then. Results: 46 times treatment were gave and therapy effect was same in every subgroups. The effective rate of total was 89.1% and rater on clinical hypothyroidism was 4.3%. Conclusions: It had an obvious effect that 131 I therapy for juvenile patients with hyperthyroidism. 131 I therapy was also a firmly good select because a well ratio effect/cost. (authors)

Configuration interaction wave functions: A seniority number approach

Energy Technology Data Exchange (ETDEWEB)

Alcoba, Diego R. [Departamento de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and Instituto de Física de Buenos Aires, Consejo Nacional de Investigaciones Científicas y Técnicas, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Torre, Alicia; Lain, Luis, E-mail: qfplapel@lg.ehu.es [Departamento de Química Física, Facultad de Ciencia y Tecnología, Universidad del País Vasco, Apdo. 644, E-48080 Bilbao (Spain); Massaccesi, Gustavo E. [Departamento de Ciencias Exactas, Ciclo Básico Común, Universidad de Buenos Aires, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Oña, Ofelia B. [Instituto de Investigaciones Fisicoquímicas Teóricas y Aplicadas, Universidad Nacional de La Plata, CCT La Plata, Consejo Nacional de Investigaciones Científicas y Técnicas, Diag. 113 y 64 (S/N), Sucursal 4, CC 16, 1900 La Plata (Argentina)

2014-06-21

This work deals with the configuration interaction method when an N-electron Hamiltonian is projected on Slater determinants which are classified according to their seniority number values. We study the spin features of the wave functions and the size of the matrices required to formulate states of any spin symmetry within this treatment. Correlation energies associated with the wave functions arising from the seniority-based configuration interaction procedure are determined for three types of molecular orbital basis: canonical molecular orbitals, natural orbitals, and the orbitals resulting from minimizing the expectation value of the N-electron seniority number operator. The performance of these bases is analyzed by means of numerical results obtained from selected N-electron systems of several spin symmetries. The comparison of the results highlights the efficiency of the molecular orbital basis which minimizes the mean value of the seniority number for a state, yielding energy values closer to those provided by the full configuration interaction procedure.

Preparation of metastable CoFeNi alloys with ultra-high magnetic saturation (Bs = 2.4-2.59 T) by reverse pulse electrodeposition

Science.gov (United States)

Tabakovic, Ibro; Venkatasamy, Venkatram

2018-04-01

The results of reverse pulse electrodeposition of CoFeNi films with ultra-high magnetic saturation, i.e. Bs values between 2.4 and 2.59 T, are presented in this work. Based on valence-bond theory (Hund's rule) it was assumed that the electronic configuration of MOH obtained by one electron reduction of electroactive intermediate (MOH+ads + e → MOHads) or oxidation of metal (M - e + HOH → MOH + H+) would result with larger number of spins per atom for each of transition metals in MOH-precipitated in CoFeNi deposit- with one more spin than their respective neutral metal in the order: Fe > Co > Ni. The experimental results showed that the increase of Bs value above Slater-Pauling curve was not observed for CoFe alloys, thus FeOH and CoOH compounds were not present in deposit. However, the increase of the Bs values above the Slater-Pauling curve (Bs = 2.4-2.59 T) was observed, for CoFeNi films obtained by reverse pulse electrodeposition. Therefore, NiOH as a stable compound is probably formed in a one-electron oxidation step during anodic pulse oxidation reaction precipitated presumably at the grain boundaries, giving rise to the ultra-high magnetic saturation of CoFeNi films. The effects of experimental conditions on elemental composition, magnetic properties, crystal structure, and thermal stability of CoFeNi films were studied.

Relativistic multiple scattering X-alpha calculations

International Nuclear Information System (INIS)

Chermette, H.; Goursot, A.

1986-01-01

The necessity to include self-consistent relativistic corrections in molecular calculations has been pointed out for all compounds involving heavy atoms. Most of the changes in the electronic properties are due to the mass-velocity and the so-called Darwin terms so that the use of Wood and Boring's Hamiltonian is very convenient for this purpose as it can be easily included in MSXalpha programs. Although the spin orbit operator effects are only obtained by perturbation theory, the results compare fairly well with experiment and with other relativistic calculations, namely Hartree-Fock-Slater calculations

Atomic structure calculation of energy levels and oscillator strengths in Ti ion, 2

International Nuclear Information System (INIS)

Ishii, Keishi

1983-10-01

Energy levels and oscillator strengths are calculated for 3s-3p and 3p-3d transition arrays in Ti X, isoelectronic to Al I. The energy levels are obtained by the Slater-Condon theory of atomic structure, including explicitly the strong configuration interactions. The results are presented both in numerical tables and in diagrams. In the tables, the observed data are included for comparison, where available. The calculated weighted oscillator strengths (gf-value) are also displayed in figures, where the weighted oscillator strengths are plotted as a function of wavelength. (author)

Determination of calibration constants for perturbing objects of cavity resonators

International Nuclear Information System (INIS)

Franco, M.A.R.; Serrao, V.A.; Fuhrmann, C.

1989-05-01

Using the Slater theorem, the calibrating constants for objects utilized in the tecnique of perturbing measurements of cavities electric and magnetic fields have been determined. Such perturbing objects are utilized in the measurements of the shunt impedance and electric field relative intensity ocurring in linac accelerating structures. To determine the calibrating constants of the perturbing objects, a cylindrical cavity of well know field pattern has been utilized. The cavity was excited in two differente modes of oscillation and the experimental results are in good aggrement with the theoretical values. (author) [pt

A perceção dos pais sobre a sua responsabilidade nas práticas alimentares dos filhos: relação com a obesidade infantil

OpenAIRE

Santos, Ana Luísa Couto de Almeida dos

2015-01-01

Dissertação de Mestrado em Enfermagem Comunitária Introdução: O excesso de peso e a obesidade em geral, bem como a obesidade infantil em particular, têm sido considerados um problema emergente de saúde pública a nível mundial. Esta patologia foi considerada pela Organização Mundial de Saúde (WHO, 2000) como uma doença multifatorial podendo ter como etiologia fatores biológicos, comportamentais e ambientais, que para Enes e Slater (2010) se inter-relacionam e se potencializam entre si. Segu...

Aproximación topológica en el cálculo de orbitales moleculares localizados, La

OpenAIRE

Paniagua Valle, Juan Carlos

1983-01-01

Es bien sabido que cualquier función de onda que se exprese como determinante de Slater construido a partir de orbitales moleculares doblemente ocupados es invariante frente a transformaciones unitarias de dichos orbitales.Aunque las posibilidades de elección son ilimitadas, en la práctica sólo se utilizan dos tipos de orbitales: los canónicos y los localizados. Los primeros se caracterizan por ser funciones propias de algún hamiltoniano monoelectrónico efectivo y entre sus propiedades más in...

Características de la práctica físico-deportiva del alumnado con discapacidad de la Universitat de València

OpenAIRE

Úbeda Colomer, Joan; Campos Granell, José; Llopis Goig, Ramón; Torregrosa Cabrera, Miguel Ángel

2015-01-01

En la actualidad, la actividad físico-deportiva es fundamental para las personas con discapacidad debido a los múltiples beneficios físicos, psicológicos y sociales que aporta (Patel y Greydanus, 2010; Slater y Meade, 2004). Estudiar las características de la práctica físico-deportiva de este colectivo puede ser útil para poder desarrollar estrategias y programas que mejoren y aumenten dicha práctica (Bragaru,van Wilgen, Geertzen, Ruijs, Dijsktra y Dekker, 2013). Pese a ello, apenas existen e...

CARACTERÍSTICAS DE LA PRÁCTICA FÍSICO-DEPORTIVA DEL ALUMNADO CON DISCAPACIDAD DE LA UNIVERSITAT DE VALÈNCIA

OpenAIRE

Joan Úbeda Colomer; José Campos Granell; Ramón Llopis Goig; Miguel Ángel Torregrosa Cabrera

2015-01-01

En la actualidad, la actividad físico-deportiva es fundamental para las personas con discapacidad debido a los múltiples beneficios físicos, psicológicos y sociales que aporta (Patel y Greydanus, 2010; Slater y Meade, 2004). Estudiar las características de la práctica físico-deportiva de este colectivo puede ser útil para poder desarrollar estrategias y programas que mejoren y aumenten dicha práctica (Bragaru, van Wilgen, Geertzen, Ruijs, Dijsktra y Dekker, 2013). Pese a ello, apenas existen ...

Handbook of Gaussian basis sets

International Nuclear Information System (INIS)

Poirier, R.; Kari, R.; Csizmadia, I.G.

1985-01-01

A collection of a large body of information is presented useful for chemists involved in molecular Gaussian computations. Every effort has been made by the authors to collect all available data for cartesian Gaussian as found in the literature up to July of 1984. The data in this text includes a large collection of polarization function exponents but in this case the collection is not complete. Exponents for Slater type orbitals (STO) were included for completeness. This text offers a collection of Gaussian exponents primarily without criticism. (Auth.)

L1 and L2 sub-shell fluorescence yields for elements with 64 ≤ Z ≤ 70

International Nuclear Information System (INIS)

Kumar, Anil; Puri, Sanjiv

2010-01-01

The L 1 and L 2 sub-shell fluorescence yields have been deduced for elements with 64 ≤ Z ≤ 70 from the L k (k = l, α, β 1,4 , β 3,6 , β 2,15,9,10,7 , γ 1,5 and γ 2,3,4 ) X-ray production cross sections measured at 22.6 keV incident photon energy using a spectrometer involving a disc type radioisotope of Cd 109 as a photon source and a Peltier cooled X-ray detector. The incident photon intensity, detector efficiency and geometrical factor have been determined from the K X-ray yields emitted from elemental targets with 20 ≤ Z ≤ 42 in the same geometrical setup and from knowledge of the K shell cross sections. The present deduced ω 1 (exp) values, for elements with 64 ≤ Z ≤ 70, are found to be in good agreement with those tabulated by Campbell (J.L. Campbell, Atom. Data Nucl. Data Tables 95 (2009) 115), where as these are, on an average, higher by 19% and 24% than those based on the Dirac-Hartree-Slater model (S. Puri et al., X-ray Spectrometry 22 (1993) 358) and the semi-empirical values compiled by Krause (M.O. Krause, J. Phys. Chem. Ref. Data 8 (1979) 307), respectively. The present deduced ω 2 (exp) values are found to be in good agreement with those based on the Dirac-Hartree-Slater model and are higher by up to ∼13% than the semi-empirical values for the elements under investigation.

Literacy, imagination and autonomy in A House for Mr. Biswas = Letramento, autonomia e imaginação em A House for Mr. Biswas

Directory of Open Access Journals (Sweden)

Mariana Bolfarine

2012-01-01

Full Text Available The present article tackles the concepts of literacy, imagination and autonomy in A House for Mr. Biswas (1961 by V. S. Naipaul. The novel reveals that the spread of the English language and Englishness became inevitable during British Imperialism since one of the instruments for its propagation was the imposition of the colonizer’s set of values. It will be shown that although limited and detached from the learners’ reality depicted in the narrative, the missionary school education engendered the imagination as a driving force upon which the protagonist, Mr. Biswas, relies in order to achieve his dreams of autonomy. Theory is mostly foregrounded on works by David Slater, Boaventura dos Santos and Diana Brydon.O presente artigo versa sobre os conceitos de letramento (literacy, imaginação e autonomia em A House for Mr. Biswas (1961, de V. S. Naipaul. O romance revela que a difusão da língua inglesa e da inglesidade (englishness tornou-se inevitável durante o imperialismo britânico, na medida em que estes eram instrumentos de propagação dos valores do colonizador. Demonstraremos que, apesar de limitada e desvinculada da realidade retratada na obra, era a educação proporcionada pelas escolas de missionários que engendrava a imaginação, força motriz que permite ao protagonista, Sr. Biswas, alcançar o seu desejo de autonomia. O campo teórico é constituído principalmente pelos estudos de David Slater, Boaventura dos Santos e Diana Brydon.

L 1 and L 2 sub-shell fluorescence yields for elements with 64 ⩽ Z ⩽ 70

Science.gov (United States)

Kumar, Anil; Puri, Sanjiv

2010-05-01

The L 1 and L 2 sub-shell fluorescence yields have been deduced for elements with 64 ⩽ Z ⩽ 70 from the L k( k = l, α, β1,4, β3,6, β2,15,9,10,7, γ1,5 and γ2,3,4) X-ray production cross sections measured at 22.6 keV incident photon energy using a spectrometer involving a disc type radioisotope of Cd 109 as a photon source and a Peltier cooled X-ray detector. The incident photon intensity, detector efficiency and geometrical factor have been determined from the K X-ray yields emitted from elemental targets with 20 ⩽ Z ⩽ 42 in the same geometrical setup and from knowledge of the K shell cross sections. The present deduced ω1(exp) values, for elements with 64 ⩽ Z ⩽ 70, are found to be in good agreement with those tabulated by Campbell (J.L. Campbell, Atom. Data Nucl. Data Tables 95 (2009) 115), where as these are, on an average, higher by 19% and 24% than those based on the Dirac-Hartree-Slater model (S. Puri et al., X-ray Spectrometry 22 (1993) 358) and the semi-empirical values compiled by Krause (M.O. Krause, J. Phys. Chem. Ref. Data 8 (1979) 307), respectively. The present deduced ω2(exp) values are found to be in good agreement with those based on the Dirac-Hartree-Slater model and are higher by up to ˜13% than the semi-empirical values for the elements under investigation.

Photoelectron angular distribution parameters for elements Z=55 to Z=100 in the photoelectron energy range 100-5000 eV

CERN Document Server

Trzhaskovskaya, M B; Yarzhemsky, V G

2002-01-01

Presented here are parameters of the angular distribution of photoelectrons along with the subshell photoionization cross sections for all atoms with 55<=Z<=100 and for atomic shells with binding energies lower than 2000 eV. The parameters are given for nine photoelectron energies in the range 100-5000 eV. Relativistic calculations have been carried out within the quadrupole approximation by the use of the central Dirac-Fock-Slater potential. The effect of the hole resulting in the atomic subshell after photoionization has been taken into account in the framework of the frozen orbital approximation.

Further microscopic studies of the fission barriers of heavy nuclei

International Nuclear Information System (INIS)

Nhan Hao, T.V.; Le Bloas, J.; Bonneau, L.; Quentin, P.; Koh, Meng-Hock

2012-01-01

Two systematic sources of error in most current microscopic evaluations of fission-barrier heights are studied. They are concerned with an approximate treatment of the Coulomb exchange terms (known as the Slater approximation) in the self-consistent mean-fields and the projection on good parity states (e.g., of positive parity for the spontaneous fission of an even–even nucleus) of left–right reflection asymmetric intrinsic solutions (e.g., around the second barrier). Approximate or unprojected solutions are shown to lead each to an underestimation of the barrier heights by a few hundred keV. (author)

Solving conic optimization problems via self-dual embedding and facial reduction: A unified approach

DEFF Research Database (Denmark)

Permenter, Frank; Friberg, Henrik A.; Andersen, Erling D.

2017-01-01

it fails to return a primal-dual optimal solution or a certificate of infeasibility. Using this observation, we give an algorithm based on facial reduction for solving the primal problem that, in principle, always succeeds. (An analogous algorithm is easily stated for the dual problem.) This algorithm has...... the appealing property that it only performs facial reduction when it is required, not when it is possible; e.g., if a primal-dual optimal solution exists, it will be found in lieu of a facial reduction certificate even if Slater's condition fails. For the case of linear, second-order, and semidefinite...

CONDOR simulation of an 11.4-GHz traveling wave output cavity

International Nuclear Information System (INIS)

Goren, Y.; Yu, D.

1991-01-01

The CONDOR code is used to simulate the cold test and the beam-induced microwave amplification of an 11.4-GHz, six-cell, disk-loaded, traveling wave cavity. Cold test simulation results are in agreement with a modified Slater's theory. Power extraction at the output port is calculated by launching a train of Gaussian electron bunches through the structure. Results are consistent with recent relativistic klystron experiments using a similar TW output cavity. It is further shown that, depending on operating beam parameters, the power extraction efficiency can be maximized by modification of various cells in the TW structure

On the imaginary part of the S-wave pion-nucleus optical potential

International Nuclear Information System (INIS)

Germond, J.F.; Lombard, R.J.

1991-01-01

The contribution of pion absorption to the imaginary part of the S-wave pion-nucleus optical potential is calculated with Slater determinantal antisymmetrized nuclear wave funtions, taking fully into accout the spin and isospin degrees of freedom. The potential obtained has an explicit dependence on the proton and neutron nuclear densities whose coefficients are directly related to the two-nucleon absorption coupling constants. The values of these coefficients extracted from mesic atoms data are in good agreement with those deduced from exclusive pion absorption experiments in 3 He, but larger than the predictions of the pion rescattering model. (orig.)

Validating a mathematical model for inverse osmosis in an experimental flat membrane plant; Validacion de un modelo matematico para osmosis inversa con una planta piloto de membranas planas

Energy Technology Data Exchange (ETDEWEB)

Gomez Gotor, A.; Salama, B.; Argudo, C.

1999-05-01

The different theories regarding inverse osmosis have given rise to mathematical models. This article describes an experiment using the model developed by Slater et al. based on the solution-diffusion theory. A DOW DANMARK SEPARATION SYSTEMS OI LAB-UNIT M 20 was employed together with a pair of type HR 98 PP flat membranes also from DOW DANMARK A/S SEPARATION SYSTEMS. The solution used to study the operational variables was KCI. The findings in regard to volumetric flows and permeate concentrations conformed to the expected trends. The model`s constants were also determined and their predictive value verified. (Author) 9 refs.

A Hartree-Fock program for atomic structure calculations

International Nuclear Information System (INIS)

Mitroy, J.

1999-01-01

The Hartree-Fock equations for a general open shell atom are described. The matrix equations that result when the single particle orbitals are written in terms of a linear combination of analytic basis functions are derived. Attention is paid to the complexities that occur when open shells are present. The specifics of a working FORTRAN program which is available for public use are described. The program has the flexibility to handle either Slater-type orbitals or Gaussian-type orbitals. It can be obtained over the internet at http://lacebark.ntu.edu.au/j_mitroy/research/atomic.htm Copyright (1999) CSIRO Australia

Auger Spectra and Different Ionic Charges Following 3s, 3p and 3d Sub-Shells Photoionization of Kr Atoms

Directory of Open Access Journals (Sweden)

Yehia A. Lotfy

2006-01-01

Full Text Available The decay of inner-shell vacancy in an atom through radiative and non-radiative transitions leads to final charged ions. The de-excitation decay of 3s, 3p and 3d vacancies in Kr atoms are calculated using Monte-Carlo simulation method. The vacancy cascade pathway resulted from the de-excitation decay of deep core hole in 3s subshell in Kr atoms is discussed. The generation of spectator vacancies during the vacancy cascade development gives rise to Auger satellite spectra. The last transitions of the de-excitation decay of 3s, 3p and 3d holes lead to specific charged ions. Dirac-Fock-Slater wave functions are adapted to calculate radiative and non-radiative transition probabilities. The intensity of Kr^{4+} ions are high for 3s hole state, whereas Kr^{3+} and Kr^{2+} ions have highest intensities for 3p and 3d hole states, respectively. The present results of ion charge state distributions agree well with the experimental data.

Some experimental and theoretical aspects of the surface impedance in bulk high-temperature superconductors at 10 GHz

Energy Technology Data Exchange (ETDEWEB)

Deville, A.; Fawaz, H.; Gaillard, B. (Lab. d' Electronique des Milieux Condenses, Univ. de Provence, Centre Saint-Jerome, 13 - Marseille (France)); Noel, H.; Potel, M. (Lab. de Chimie Minerale, Univ. de Rennes, 35 (France)); Monnereau, O. (Lab. de Chimie des Materiaux, Univ. de Provence, Centre Saint-Charles, 13 - Marseille (France))

1992-07-15

After a presentation of the theoretical framework, and a short review of existing r.f. results in high-temperature superconductors, we present our own 10 GHz measurements on YBa[sub 2]Cu[sub 3]O[sub 7] single crystals and sintered samples. We use an electron spin resonance (ESR) heterodyne spectrometer and measurements of the reflection coefficient and resonant frequency of a cavity to get information not only on the surface resistance, R[sub S], as generally done, but also on the surface reactance, X[sub S]. The theoretical analysis of the frequency shift is made by adapting Slater's perturbation method to the present problem. In order to explain both the R[sub s] and X[sub S] results, and previous ESR observations, while keeping theoretical simplicity, we are led to suggest that in the normal state these materials show an unconventional skin effect, where the phenomenon is governed not by the d.c. conductivity, but by an effective (lower) conductivity, the other characteristics being unchanged. We briefly discuss the superconductor results and the validity of the two-fluid model. (orig.).

Solution chemistry of element 105. Pt. III. Hydrolysis and complex formation of Nb, Ta, Db and Pa in HF and HBr solutions

International Nuclear Information System (INIS)

Pershina, V.; Bastug, T.

1999-01-01

Calculations of the electronic structure of MF 6 - and MBr 6 - complexes of Nb, Ta, Pa and element 105, Db, formed in HF and HBr solutions have been performed using the Dirac-Slater Discrete Variational method. On the basis of results of these calculations, relative values of the free energy change of reactions of complex formation have been determined. The order of the complex formation for both acids is shown to be Pa >> Nb > Db > Ta. Such a sequence is defined by a predominant electrostatic energy of the metal-ligand interaction. The hydrolysis of compounds, as a reverse process, proved to change as Ta > Db > Nb >> Pa. Using the theory of metal extraction by anion exchange, the following trend in the extraction of the anionic species from both the HF and HBr aqueous solutions has been predicted: Pa >> Nb ≥ Db > Ta. The strength of the ML 6 - complexes is shown to decrease from MF 6 , to MCl 6 and further to MBr 6 - which is reflected by shifting the complex formation process to the area of higher acid concentrations. (orig.)

A Jeziorski-Monkhorst fully uncontracted multi-reference perturbative treatment. I. Principles, second-order versions, and tests on ground state potential energy curves

Science.gov (United States)

Giner, Emmanuel; Angeli, Celestino; Garniron, Yann; Scemama, Anthony; Malrieu, Jean-Paul

2017-06-01

The present paper introduces a new multi-reference perturbation approach developed at second order, based on a Jeziorski-Mokhorst expansion using individual Slater determinants as perturbers. Thanks to this choice of perturbers, an effective Hamiltonian may be built, allowing for the dressing of the Hamiltonian matrix within the reference space, assumed here to be a CAS-CI. Such a formulation accounts then for the coupling between the static and dynamic correlation effects. With our new definition of zeroth-order energies, these two approaches are strictly size-extensive provided that local orbitals are used, as numerically illustrated here and formally demonstrated in the Appendix. Also, the present formalism allows for the factorization of all double excitation operators, just as in internally contracted approaches, strongly reducing the computational cost of these two approaches with respect to other determinant-based perturbation theories. The accuracy of these methods has been investigated on ground-state potential curves up to full dissociation limits for a set of six molecules involving single, double, and triple bond breaking together with an excited state calculation. The spectroscopic constants obtained with the present methods are found to be in very good agreement with the full configuration interaction results. As the present formalism does not use any parameter or numerically unstable operation, the curves obtained with the two methods are smooth all along the dissociation path.

Statistical approach for calculating opacities of high-Z plasmas

International Nuclear Information System (INIS)

Nishikawa, Takeshi; Nakamura, Shinji; Takabe, Hideaki; Mima, Kunioki

1992-01-01

For simulating the X-ray radiation from laser produced high-Z plasma, an appropriate atomic modeling is necessary. Based on the average ion model, we have used a rather simple atomic model for opacity calculation in a hydrodynamic code and obtained a fairly good agreement with the experiment on the X-ray spectra from the laser-produced plasmas. We have investigated the accuracy of the atomic model used in the hydrodynamic code. It is found that transition energies of 4p-4d, 4d-4f, 4p-5d, 4d-5f and 4f-5g, which are important in laser produced high-Z plasma, can be given within an error of 15 % compared to the values by the Hartree-Fock-Slater (HFS) calculation and their oscillator strengths obtained by HFS calculation vary by a factor two according to the difference of charge state. We also propose a statistical method to carry out detail configuration accounting for electronic state by use of the population of bound electrons calculated with the average ion model. The statistical method is relatively simple and provides much improvement in calculating spectral opacities of line radiation, when we use the average ion model to determine electronic state. (author)

Structural stability, electronic and magnetic behaviour of spin-polarized YCoVZ (Z = Si, Ge) and YCoTiZ (Z = Si, Ge) Heusler alloys

Energy Technology Data Exchange (ETDEWEB)

Rasool, Muhammad Nasir, E-mail: nasir4iub@gmail.com [Department of Physics, The Islamia University of Bahawalpur, Bahawalpur, 63100 (Pakistan); Hussain, Altaf, E-mail: altafiub@yahoo.com [Department of Physics, The Islamia University of Bahawalpur, Bahawalpur, 63100 (Pakistan); Javed, Athar [Department of Physics, University of the Punjab, Lahore, 54590 (Pakistan); Khan, Muhammad Azhar; Iqbal, F. [Department of Physics, The Islamia University of Bahawalpur, Bahawalpur, 63100 (Pakistan)

2016-11-01

The structural stability, electronic and magnetic behaviour of YCoVZ (Z = Si, Ge) and YCoTiZ (Z = Si, Ge) Heusler alloys have been studied by first principle approach. Generalized gradient approximation (GGA) based on density functional theory (DFT) has been applied to investigate the properties of quaternary Heusler alloys. The YCoVSi, YCoVGe, YCoTiSi and YCoTiGe Heusler alloys of Type-3 structure are found to be stable in spin-polarized/magnetic phase. The YCoVSi and YCoVGe alloys exhibit nearly spin gapless semiconductor (SGS) behaviour while YCoTiSi and YCoTiGe alloys show half-metallic ferromagnetic (HMF) behaviour. For YCoVSi, YCoVGe, YCoTiSi and YCoTiGe alloys, the calculated energy band gaps in spin down (↓) channel are 0.60, 0.54, 0.68 and 0.44 eV, respectively. The YCoVZ and YCoTiZ alloys are found to have integral value of total magnetic moment (M{sub T}), thus obeying the Slater-Pauling rule, M{sub T} = (N{sub v}–18)μ{sub B}. - Highlights: • Four Heusler alloys i.e. YCoVZ (Z = Si, Ge) and YCoTiZ (Z = Si, Ge) are studied. • Type-3 crystal structure of all four alloys is stable in magnetic phase. • The compressibility (S) follows the order: S{sub YCoVSi} > S{sub YCoTiSi} > S{sub YCoVGe} > S{sub YCoTiGe}. • Half metallic ferromagnetic behaviour is observed in all four alloys. • All four alloys obey the Slater-Pauling rule, M{sub T} = (N{sub v} – 18)μ{sub B}.

Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model

Science.gov (United States)

Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad

2018-02-01

In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.

Ressituando a gentrificação: a classe popular, a ciência e o estado na pesquisa urbana recente

OpenAIRE

Wacquant,Loïc

2010-01-01

Este artigo amplia o diagnóstico de Tom Slater sobre as causas da gentrificação da pesquisa recente sobre gentrificação. Ele argumenta que o deslocamento de denúncia para celebração da gentrificação, a elisão do deslocamento dos residentes estabelecidos e o foco eufemístico em "mesclagem social" participam de um padrão de invisibilidade da classe operária na esfera pública e na investigação social. Essa obliteração do proletariado na cidade é reforçada pela heteronomia crescente da pesquisa u...

DFTB{sup +} and lanthanides

Energy Technology Data Exchange (ETDEWEB)

Hourahine, B [Department of Physics, SUPA, University of Strathclyde, John Anderson Building, 107 Rottenrow, Glasgow G4 0NG (United Kingdom); Aradi, B; Frauenheim, T, E-mail: benjamin.hourahine@strath.ac.u [BCCMS, Universitaet Bremen, Am Fallturm 1, 28359 Bremen (Germany)

2010-07-01

DFTB{sup +} is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.

Classical dynamics of triatomic system: energized harmonic molecules

International Nuclear Information System (INIS)

Parr, C.A.; Kuppermann, A.; Porter, R.N.

1976-01-01

The dynamical assumptions underlying the Slater and RRK classical-mechanical theories of unimolecular reaction rates are investigated. The predictions of these theories for several nonlinear, triatomic, harmonically-bonded molecular models are compared with the results obtained from the integration of the classical equations of motion. The accuracy of the small-vibration and weak-coupling assumptions are found to break down at energies above about one quarter of a bond dissociation energy. Nonetheless, the small-vibration approximation predicts reaction frequencies in good agreement with the exact results for the models. The effects of rotation on intramolecular energy exchange are examined and found to be significant

Exact pairing correlations in one-dimensional trapped fermions with stochastic mean-field wave-functions

Energy Technology Data Exchange (ETDEWEB)

Juillet, O.; Gulminelli, F. [Caen Univ., Lab. de Physique Corpusculaire (LPC/ENSICAEN), 14 (France); Chomaz, Ph. [Grand Accelerateur National d' Ions Lourds (GANIL), 14 - Caen (France)

2003-11-01

The canonical thermodynamic properties of a one-dimensional system of interacting spin-1/2 fermions with an attractive zero-range pseudo-potential are investigated within an exact approach. The density operator is evaluated as the statistical average of dyadics formed from a stochastic mean-field propagation of independent Slater determinants. For an harmonically trapped Fermi gas and for fermions confined in a 1D-like torus, we observe the transition to a quasi-BCS state with Cooper-like momentum correlations and an algebraic long-range order. For few trapped fermions in a rotating torus, a dominant superfluid component with quantized circulation can be isolated. (author)

Experimental and theoretical Compton profiles of Be, C and Al

Energy Technology Data Exchange (ETDEWEB)

Aguiar, Julio C., E-mail: jaguiar@arn.gob.a [Autoridad Regulatoria Nuclear, Av. Del Libertador 8250, C1429BNP, Buenos Aires (Argentina); Instituto de Fisica ' Arroyo Seco' , Facultad de Ciencias Exactas, U.N.C.P.B.A., Pinto 399, 7000 Tandil (Argentina); Di Rocco, Hector O. [Instituto de Fisica ' Arroyo Seco' , Facultad de Ciencias Exactas, U.N.C.P.B.A., Pinto 399, 7000 Tandil (Argentina); Arazi, Andres [Laboratorio TANDAR, Comision Nacional de Energia Atomica, Av. General Paz 1499, 1650 San Martin, Buenos Aires (Argentina)

2011-02-01

The results of Compton profile measurements, Fermi momentum determinations, and theoretical values obtained from a linear combination of Slater-type orbital (STO) for core electrons in beryllium; carbon and aluminium are presented. In addition, a Thomas-Fermi model is used to estimate the contribution of valence electrons to the Compton profile. Measurements were performed using monoenergetic photons of 59.54 keV provided by a low-intensity Am-241 {gamma}-ray source. Scattered photons were detected at 90{sup o} from the beam direction using a p-type coaxial high-purity germanium detector (HPGe). The experimental results are in good agreement with theoretical calculations.

Vacancy induced half-metallicity in half-Heusler semiconductors

KAUST Repository

Zhu, Zhiyong

2011-09-28

First-principles calculations are performed to investigate the effect of vacancies on the electronic structure and magnetic properties of the two prototypical half-Heusler semiconductors NiTiSn and CoTiSb. The spin degeneracy of the host materials is broken for all types of isolated vacancies under consideration, except for Ni-deficient NiTiSn. A half-metallic character is identified in Sn-deficient NiTiSn and Co/Ti/Sb-deficient CoTiSb. We can explain our findings by introducing an extending Slater-Pauling rule for systems with defects. A ferromagnetic ordering of the local moments due to double exchange appears to be likely.

Systematic analysis of spectroscopic characteristics of the lanthanide and actinide ions with the 4f{sup N−1}5d and 5f{sup N−1}6d electronic configurations in a free state

Energy Technology Data Exchange (ETDEWEB)

Ma, C.-G. [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Brik, M.G., E-mail: brik@fi.tartu.ee [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Institute of Physics, University of Tartu, Riia 142, Tartu 51014 (Estonia); Institute of Physics, Jan Dlugosz University, Armii Krajowej 13/15, PL-42200 Czestochowa (Poland); Tian, Y.; Li, Q.-X. [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China)

2014-08-01

Highlights: • Calculated spectroscopic parameters of f{sup N−1}d configurations of the 4f and 5f ions. • Relations between the Slater parameters, spin–orbit constant, atomic number were found. • Barycenters of the electronic configuration energies were calculated. • Obtained relations reduce the number of independent terms in a free ion Hamiltonian. - Abstract: Systematic consideration of the spectroscopic properties of the f{sup N−1}d excited electronic configurations of the di-, tri- and tetravalent lanthanide and actinide ions in a free state is presented. Variations of the Hartree–Fock calculated Slater parameters for the f{sup N−1}d electron configurations, spin–orbit (SO) interaction constant ζ for the f and d electrons, and averaged values of the second, fourth and sixth powers of the 4f, 5f, 5d, 6d electrons’ radial coordinate across both series were considered; functional dependencies between the mentioned quantities were obtained. It has been shown that the Coulomb interaction parameters F{sup 2}(ff), F{sup 4}(ff), and F{sup 6}(ff) for the f{sup N−1} core increase linearly with the atomic number Z, whereas the direct and exchange Coulomb parameters F{sup 2}(fd), F{sup 4}(fd), G{sup 1}(fd), G{sup 3}(fd), G{sup 5}(fd) for the f{sup N−1}d configuration decrease linearly with Z. Since the SO interaction constant ζ{sup 1/4} is also proportional to Z, it was possible to find linear relationships between the Coulomb interaction parameters and SO constants for the f and d electrons, which effectively reduce the number of independent parameters in the free ion Hamiltonian. The constraining relations between the free ion Hamiltonian’s parameters obtained in the present paper can be used for simulations of the f–d transition spectra of these ions in various crystals.

The Development of the Planet Formation Concept Inventory: A Preliminary Analysis of Version 1

Science.gov (United States)

Simon, Molly; Impey, Chris David; Buxner, Sanlyn

2018-01-01

The topic of planet formation is poorly represented in the educational literature, especially at the college level. As recently as 2014, when developing the Test of Astronomy Standards (TOAST), Slater (2014) noted that for two topics (formation of the Solar System and cosmology), “high quality test items that reflect our current understanding of students’ conceptions were not available [in the literature]” (Slater,2014, p. 8). Furthermore, nearly half of ASTR 101 enrollments are at 2 year/community colleges where both instructors and students have little access to current research and models of planet formation. In response, we administered six student replied response (SSR) short answer questions on the topic of planet formation to n = 1,050 students enrolled in introductory astronomy and planetary science courses at The University of Arizona in the Fall 2016 and Spring 2017 semesters. After analyzing and coding the data from the SSR questions, we developed a preliminary version of the Planet Formation Concept Inventory (PFCI). The PFCI is a multiple-choice instrument with 20 planet formation-related questions, and 4 demographic-related questions. We administered version 1 of the PFCI to six introductory astronomy and planetary science courses (n ~ 700 students) during the Fall 2017 semester. We provided students with 7-8 multiple-choice with explanation of reasoning (MCER) questions from the PFCI. Students selected an answer (similar to a traditional multiple-choice test), and then briefly explained why they chose the answer they did. We also conducted interviews with ~15 students to receive feedback on the quality of the questions and clarity of the instrument. We will present an analysis of the MCER responses and student interviews, and discuss any modifications that will be made to the instrument as a result.

On the accuracy of van der Waals inclusive density-functional theory exchange-correlation functionals for ice at ambient and high pressures.

Science.gov (United States)

Santra, Biswajit; Klimes, Jirí; Tkatchenko, Alexandre; Alfè, Dario; Slater, Ben; Michaelides, Angelos; Car, Roberto; Scheffler, Matthias

2013-10-21

Density-functional theory (DFT) has been widely used to study water and ice for at least 20 years. However, the reliability of different DFT exchange-correlation (xc) functionals for water remains a matter of considerable debate. This is particularly true in light of the recent development of DFT based methods that account for van der Waals (vdW) dispersion forces. Here, we report a detailed study with several xc functionals (semi-local, hybrid, and vdW inclusive approaches) on ice Ih and six proton ordered phases of ice. Consistent with our previous study [B. Santra, J. Klimeš, D. Alfè, A. Tkatchenko, B. Slater, A. Michaelides, R. Car, and M. Scheffler, Phys. Rev. Lett. 107, 185701 (2011)] which showed that vdW forces become increasingly important at high pressures, we find here that all vdW inclusive methods considered improve the relative energies and transition pressures of the high-pressure ice phases compared to those obtained with semi-local or hybrid xc functionals. However, we also find that significant discrepancies between experiment and the vdW inclusive approaches remain in the cohesive properties of the various phases, causing certain phases to be absent from the phase diagram. Therefore, room for improvement in the description of water at ambient and high pressures remains and we suggest that because of the stern test the high pressure ice phases pose they should be used in future benchmark studies of simulation methods for water.

Ultrafast absorption of intense x rays by nitrogen molecules

Energy Technology Data Exchange (ETDEWEB)

Buth, Christian [Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, 69117 Heidelberg (Germany); PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Argonne National Laboratory, Argonne, Illinois 60439 (United States); Liu Jicai [Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, 69117 Heidelberg (Germany); Department of Mathematics and Physics, North China Electric Power University, 102206 Beijing (China); Chen, Mau Hsiung [Physics Division, Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Cryan, James P. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Physics, Stanford University, Stanford, California 94305 (United States); Fang Li; Hoener, Matthias; Berrah, Nora [Department of Physics, Western Michigan University, Kalamazoo, Michigan 49008 (United States); Glownia, James M. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Applied Physics, Stanford University, Stanford, California 94305 (United States); Coffee, Ryan N. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Linac Coherent Light Source, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

2012-06-07

We devise a theoretical description for the response of nitrogen molecules (N{sub 2}) to ultrashort and intense x rays from the free electron laser Linac Coherent Light Source (LCLS). We set out from a rate-equation description for the x-ray absorption by a nitrogen atom. The equations are formulated using all one-x-ray-photon absorption cross sections and the Auger and radiative decay widths of multiply-ionized nitrogen atoms. Cross sections are obtained with a one-electron theory and decay widths are determined from ab initio computations using the Dirac-Hartree-Slater (DHS) method. We also calculate all binding and transition energies of nitrogen atoms in all charge states with the DHS method as the difference of two self-consistent field (SCF) calculations ({Delta}SCF method). To describe the interaction with N{sub 2}, a detailed investigation of intense x-ray-induced ionization and molecular fragmentation are carried out. As a figure of merit, we calculate ion yields and the average charge state measured in recent experiments at the LCLS. We use a series of phenomenological models of increasing sophistication to unravel the mechanisms of the interaction of x rays with N{sub 2}: a single atom, a symmetric-sharing model, and a fragmentation-matrix model are developed. The role of the formation and decay of single and double core holes, the metastable states of N{sub 2}{sup 2+}, and molecular fragmentation are explained.

Synthesis and characterization of Fe-Ti-Sb intermetallic compounds: Discovery of a new Slater-Pauling phase

Science.gov (United States)

Naghibolashrafi, N.; Keshavarz, S.; Hegde, Vinay I.; Gupta, A.; Butler, W. H.; Romero, J.; Munira, K.; LeClair, P.; Mazumdar, D.; Ma, J.; Ghosh, A. W.; Wolverton, C.

2016-03-01

Compounds of Fe, Ti, and Sb were prepared using arc melting and vacuum annealing. Fe2TiSb , expected to be a full Heusler compound crystallizing in the L 21 structure, was shown by XRD and SEM analyses to be composed of weakly magnetic grains of nominal composition Fe1.5TiSb with iron-rich precipitates in the grain boundaries. FeTiSb, a composition consistent with the formation of a half-Heusler compound, also decomposed into Fe1.5TiSb grains with Ti-Sb rich precipitates and was weakly magnetic. The dominant Fe1.5TiSb phase appears to crystallize in a defective L 21 -like structure with iron vacancies. Based on this finding, a first-principles DFT-based binary cluster expansion of Fe and vacancies on the Fe sublattice of the L 21 structure was performed. Using the cluster expansion, we computationally scanned >103 configurations and predict a novel, stable, nonmagnetic semiconductor phase to be the zero-temperature ground state. This new structure is an ordered arrangement of Fe and vacancies, belonging to the space group R 3 m , with composition Fe1.5TiSb , i.e., between the full- and half-Heusler compositions. This phase can be visualized as alternate layers of L 21 phase Fe2TiSb and C 1b phase FeTiSb, with layering along the [111] direction of the original cubic phases. Our experimental results on annealed samples support this predicted ground-state composition, but further work is required to confirm that the R 3 m structure is the ground state.

76 FR 43710 - Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound...

Science.gov (United States)

2011-07-21

... Washington; Port Gamble Indian Community of the Port Gamble Reservation, Washington; Puyallup Tribe of the... Port Madison Reservation, Washington; Swinomish Indians of the Swinomish Reservation, Washington... alternating dry and wet conditions. Based on 14 morphological characteristics, a physical anthropologist...

Stark shifts and widths of a hydrogen atom in Debye plasmas

International Nuclear Information System (INIS)

Yu, A.C.H.; Ho, Y.K.

2005-01-01

A computational scheme has been developed and used to investigate the influence of the plasma environments on modified atomic autoionization for isolated atoms/ions by using the complex coordinate rotation method which is proved to be a very simple and powerful tool to analyze the position and the width of a resonance. The Debye screening potential is employed to describe the effects of the plasma environments. Stark shifts and widths on the ground state of hydrogen are reported for field strength up to F=0.12 a.u. Slater-type basis wave functions are used to describe the system and angular-momentum states up to L=11 are included when the external electric field is turned on. Converged results are obtained by using different maximum angular-momentum states. The modified autoionization for various Debye lengths ranging from infinite to a small value of 0.86 are reported. It has been observed that for a given temperature and under the influence of a given external electric field, the resonance energy and the autoionization width increase for increasing electron density in the plasma. A discussion on the physical implication of our results is made

Generalized Pauli constraints in small atoms

Science.gov (United States)

Schilling, Christian; Altunbulak, Murat; Knecht, Stefan; Lopes, Alexandre; Whitfield, James D.; Christandl, Matthias; Gross, David; Reiher, Markus

2018-05-01

The natural occupation numbers of fermionic systems are subject to nontrivial constraints, which include and extend the original Pauli principle. A recent mathematical breakthrough has clarified their mathematical structure and has opened up the possibility of a systematic analysis. Early investigations have found evidence that these constraints are exactly saturated in several physically relevant systems, e.g., in a certain electronic state of the beryllium atom. It has been suggested that, in such cases, the constraints, rather than the details of the Hamiltonian, dictate the system's qualitative behavior. Here, we revisit this question with state-of-the-art numerical methods for small atoms. We find that the constraints are, in fact, not exactly saturated, but that they lie much closer to the surface defined by the constraints than the geometry of the problem would suggest. While the results seem incompatible with the statement that the generalized Pauli constraints drive the behavior of these systems, they suggest that the qualitatively correct wave-function expansions can in some systems already be obtained on the basis of a limited number of Slater determinants, which is in line with numerical evidence from quantum chemistry.

Quadrupole and monopole generalized oscillator strength for 2p-3p, 2p-4p transition of neon atomic in the velocity formulation

International Nuclear Information System (INIS)

Gomis, L; Diedhiou, I; Tall, M S; Diallo, S; Diatta, C S; Niassy, B

2007-01-01

The quadrupole and monopole generalized oscillator strengths (GOS) as a function of momentum transfer are calculated for the 2p-3p and 2p-4p transitions of the neon atom using the analytical Hartree-Fock (HF) wavefunctions for the ground-state and the wavefunctions for the excited states which are obtained numerically from the modified HF Slater equation. Calculations are carried out by using the HF method and random phase approximation with exchange in the velocity formulation. The positions and the number of the extrema in the GOS have received particular attention in the evaluation. Our calculated monopole GOS of 2p-3p transition in velocity form reveals one maximum located between the experimental and theoretical results of other authors. The disagreement between our first maximum of the quadrupole GOS 2p-3p transition with the experimental and other theoretical ones is unimportant. The extrema of the monopole and quadrupole GOS of 2p-4p transition are given in this paper. The results of velocity form study also show that the electron correlation effects are important around the maxima and are found to influence the positions of the extrema insignificantly

Effect of Coulomb interactions and Hartree-Fock exchange on structural, elastic, optoelectronic and magnetic properties of Co{sub 2}MnSi Heusler: A comparative study

Energy Technology Data Exchange (ETDEWEB)

Lantri, T. [Laboratory of Technology and Solid’s Properties, Faculty of Sciences and Technology, Abdelhamid Ibn Badis University, BP 227, Mostaganem 27000 (Algeria); Bentata, S., E-mail: sam_bentata@yahoo.com [Laboratory of Technology and Solid’s Properties, Faculty of Sciences and Technology, Abdelhamid Ibn Badis University, BP 227, Mostaganem 27000 (Algeria); Bouadjemi, B.; Benstaali, W. [Laboratory of Technology and Solid’s Properties, Faculty of Sciences and Technology, Abdelhamid Ibn Badis University, BP 227, Mostaganem 27000 (Algeria); Bouhafs, B. [Modelling and Simulation in Materials Science Laboratory, Djillali Liabès University of Sidi Bel-Abbès, 22000 Sidi Bel-Abbes (Algeria); Abbad, A. [Laboratory of Technology and Solid’s Properties, Faculty of Sciences and Technology, Abdelhamid Ibn Badis University, BP 227, Mostaganem 27000 (Algeria); Modelling and Simulation in Materials Science Laboratory, Djillali Liabès University of Sidi Bel-Abbès, 22000 Sidi Bel-Abbes (Algeria); Zitouni, A. [Laboratory of Technology and Solid’s Properties, Faculty of Sciences and Technology, Abdelhamid Ibn Badis University, BP 227, Mostaganem 27000 (Algeria)

2016-12-01

Using the first-principle calculations, we have investigated the structural, elastic, optoelectronic and magnetic properties of Co{sub 2}MnSi Heusler alloy. Based on the density functional theory (DFT) and hiring the full-potential linearized augmented plane wave (FP-LAPW) method, we have used five approaches: the Hybrid on-site exact exchange, the Local Spin Density Approximation (LSDA), the LSDA+U, the Generalized Gradient Approximation GGA and GGA+U; where the Hubbard on-site Coulomb interaction correction U is calculated by constraint local density approximation for Co and Mn atoms. Our results show that the highly-ordered Co{sub 2}MnSi alloy is a ductile, stiff and anisotropic material. It has a half-metallic ferromagnetic character with an integer magnetic moment of 5 µB which is in good agreement with the Slater-Pauling rule. - Highlights: • Each approach gives a half magnetic compound. • EECE gives the largest gap. • Elastic properties show a stiff, ductile and anisotropic material. • Electronic properties are similar for the five approaches. • Total magnetic moment is the same for the five approaches (5 µB).

Exact results for the spectra of bosons and fermions with contact interaction

Energy Technology Data Exchange (ETDEWEB)

Mashkevich, Stefan [Schroedinger, 120 West 45th St., New York, NY 10036 (United States)]. E-mail: mash@mashke.org; Matveenko, Sergey [Landau Institute for Theoretical Physics, Kosygina Str. 2, 119334 Moscow (Russian Federation)]. E-mail: matveen@landau.ac.ru; Ouvry, Stephane [Laboratoire de Physique Theorique et Modeles Statistiques, Unite de Recherche de l' Universite Paris 11 associee au CNRS, UMR 8626., Bat. 100, Universite Paris-Sud, 91405 Orsay (France)]. E-mail: ouvry@lptms.u-psud.fr

2007-02-19

An N-body bosonic model with delta-contact interactions projected on the lowest Landau level is considered. For a given number of particles in a given angular momentum sector, any energy level can be obtained exactly by means of diagonalizing a finite matrix: they are roots of algebraic equations. A complete solution of the three-body problem is presented, some general properties of the N-body spectrum are pointed out, and a number of novel exact analytic eigenstates are obtained. The FQHE N-fermion model with Laplacian-delta interactions is also considered along the same lines of analysis. New exact eigenstates are proposed, along with the Slater determinant, whose eigenvalues are shown to be related to Catalan numbers.

Spherical harmonic expansion of short-range screened Coulomb interactions

Energy Technology Data Exchange (ETDEWEB)

Angyan, Janos G [Laboratoire de Cristallographie et de Modelisation des Materiaux Mineraux et Biologiques, UMR 7036, CNRS-Universite Henri Poincare, BP 239, F-54506 Vandoeuvre-les-Nancy (France); Gerber, Iann [Laboratoire de Cristallographie et de Modelisation des Materiaux Mineraux et Biologiques, UMR 7036, CNRS-Universite Henri Poincare, BP 239, F-54506 Vandoeuvre-les-Nancy (France); Marsman, Martijn [Institut fuer Materialphysik and Center for Computational Materials Science, Universitaet Wien, Sensengasse 8, A-1090, Vienna (Austria)

2006-07-07

Spherical harmonic expansions of the screened Coulomb interaction kernel involving the complementary error function are required in various problems in atomic, molecular and solid state physics, like for the evaluation of Ewald-type lattice sums or for range-separated hybrid density functionals. A general analytical expression is derived for the kernel, which is non-separable in the radial variables. With the help of series expansions a separable approximate form is proposed, which is in close analogy with the conventional multipole expansion of the Coulomb kernel in spherical harmonics. The convergence behaviour of these expansions is studied and illustrated by the electrostatic potential of an elementary charge distribution formed by products of Slater-type atomic orbitals.

The eugenic legacy in psychology and psychiatry.

Science.gov (United States)

Pilgrim, David

2008-05-01

Assumptions about genetic differences in human mental characteristics can be traced in large part to the eugenic movement, ascendant at the turn of the 20th century. This paper offers historical case studies, of 'innate general cognitive ability' and 'psychiatric genetics', in order to appraise the eugenic legacy in current psychology and psychiatry. Reviewing the work of representatives, Cyril Burt, Franz Kallmann and Eliot Slater, along with their research networks, it is argued that eugenics remains a quiet but powerful background influence in modern-day psychology and psychiatry. At the turn of the 21st century, eugenics remains an important area of inquiry, reflection and education for those in the inter-disciplinary field of social psychiatry.

199Hg Moessbauer measurements on mercury, alloys and Hg-fluorides

International Nuclear Information System (INIS)

Wurtinger, W.; Kankeleit, E.

1979-01-01

The Moessbauer effect on the 158 keV 5/2 - -1/2 - transition in 199 Hg, of the order of 10 ppm, has been studied using the current integration technique. The isomer shift between the Hg(I)- and Hg(II)-fluorides as well as the quadrupole splitting in Hg 2 Pt and Hg 2 F 2 are interpreted in terms of relativistic Hartree-Fock-Slater and Molecular Orbital calculations. The following nuclear parameters could be derived: Δ[r 2 ] = (3.2+-1.1) 10 -3 fm 2 and Q(5/2 - ) = (-0.8+-0.4)b. Evidence for an oblate triaxially deformed 199 Hg nucleus is derived from particle plus rotor calculations. (orig.)

Fragmentation properties of 6Li

International Nuclear Information System (INIS)

Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

1987-01-01

The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

Quanty4RIXS: a program for crystal field multiplet calculations of RIXS and RIXS-MCD spectra using Quanty.

Science.gov (United States)

Zimmermann, Patric; Green, Robert J; Haverkort, Maurits W; de Groot, Frank M F

2018-05-01

Some initial instructions for the Quanty4RIXS program written in MATLAB ® are provided. The program assists in the calculation of 1s 2p RIXS and 1s 2p RIXS-MCD spectra using Quanty. Furthermore, 1s XAS and 2p 3d RIXS calculations in different symmetries can also be performed. It includes the Hartree-Fock values for the Slater integrals and spin-orbit interactions for several 3d transition metal ions that are required to create the .lua scripts containing all necessary parameters and quantum mechanical definitions for the calculations. The program can be used free of charge and is designed to allow for further adjustments of the scripts. open access.

X-ray attenuation cross sections for energies 100 eV to 100 keV and elements Z = 1 to Z = 92

International Nuclear Information System (INIS)

Saloman, E.B.; Hubbell, J.H.; Scofield, J.H.

1988-01-01

This work presents for the energy range 0.1--100 keV the National Bureau of Standards (NBS) database of experimental x-ray attenuation coefficients (total absorption cross sections) and cross sections calculated using a relativistic Hartree--Slater model for the photoelectric cross section for all elements of atomic number Z = 1--92. The information is displayed in both tabular and graphical form. Also shown on the graphs are cross sections obtained using the semiempirical set of recommended values of B. L. Henke and co-workers (Atomic Data and Nuclear Data Tables 27, 1 (1982)). A bibliography of the NBS database for this energy range is included. copyright 1988 Academic Press, Inc

Extended analysis of Br VIII and predicted trends for the n=4, Δn=0 transistions of nickel-like ions (Kr IX-Mo XV)

International Nuclear Information System (INIS)

Wyart, J.F.; Ryabtsev, A.N.

1986-01-01

More than one hundred lines of Br VIII have been classified in the spectral region 416-824 A, from which all levels of 3d 9 4d (except 1 S 0 ) have been found. The energy levels of the configurations 3d 9 4s, 3d 9 4p and 3d 9 4d have been interpreted from Zn III to Mo XV by means of the Slater-Condon theory and of generalized least squares techniques and the root mean square deviations are 8, 51 and 40 cm -1 respectively. The strongest lines of the 4s-4p and 4p-4d transitions are predicted from Kr IX to Mo XV. (orig.)

Shapes of nuclear configurations in a cranked harmonic oscillator model

International Nuclear Information System (INIS)

Troudet, T.; Arvieu, R.

1980-05-01

The shapes of nuclear configurations are calculated using Slater determinants built with cranked harmonic oscillator single particle states. The nuclear forces role is played by a volume conservation condition (of the potential or of the density) in a first part. In a second part, we have used the finite range, density dependent interaction of Cogny. A very simple classification of configurations emerges in the first part, the relevant parameter being the equatorial eccentricity of the nuclear density. A critical equatorial eccentricity is obtained which governs the accession to the case for which the nucleus is oblate and symmetric around its axis of rotation. Nuclear configurations calculated in the second part observe remarkably well these behaviors

Magnetic ordering induced giant optical property change in tetragonal BiFeO3

Science.gov (United States)

Tong, Wen-Yi; Ding, Hang-Chen; Gong, Shi Jing; Wan, Xiangang; Duan, Chun-Gang

2015-12-01

Magnetic ordering could have significant influence on band structures, spin-dependent transport, and other important properties of materials. Its measurement, especially for the case of antiferromagnetic (AFM) ordering, however, is generally difficult to be achieved. Here we demonstrate the feasibility of magnetic ordering detection using a noncontact and nondestructive optical method. Taking the tetragonal BiFeO3 (BFO) as an example and combining density functional theory calculations with tight-binding models, we find that when BFO changes from C1-type to G-type AFM phase, the top of valance band shifts from the Z point to Γ point, which makes the original direct band gap become indirect. This can be explained by Slater-Koster parameters using the Harrison approach. The impact of magnetic ordering on band dispersion dramatically changes the optical properties. For the linear ones, the energy shift of the optical band gap could be as large as 0.4 eV. As for the nonlinear ones, the change is even larger. The second-harmonic generation coefficient d33 of G-AFM becomes more than 13 times smaller than that of C1-AFM case. Finally, we propose a practical way to distinguish the two AFM phases of BFO using the optical method, which is of great importance in next-generation information storage technologies.

Condensed phase QM/MM simulations utilizing the exchange core functions to describe exchange repulsions at the QM boundary region

International Nuclear Information System (INIS)

Umino, Satoru; Takahashi, Hideaki; Morita, Akihiro

2016-01-01

In a recent work, we developed a method [H. Takahashi et al., J. Chem. Phys. 143, 084104 (2015)] referred to as exchange-core function (ECF) approach, to compute exchange repulsion E ex between solute and solvent in the framework of the quantum mechanical (QM)/molecular mechanical (MM) method. The ECF, represented with a Slater function, plays an essential role in determining E ex on the basis of the overlap model. In the work of Takahashi et al. [J. Chem. Phys. 143, 084104 (2015)], it was demonstrated that our approach is successful in computing the hydrogen bond energies of minimal QM/MM systems including a cationic QM solute. We provide in this paper the extension of the ECF approach to the free energy calculation in condensed phase QM/MM systems by combining the ECF and the QM/MM-ER approach [H. Takahashi et al., J. Chem. Phys. 121, 3989 (2004)]. By virtue of the theory of solutions in energy representation, the free energy contribution δμ ex from the exchange repulsion was naturally formulated. We found that the ECF approach in combination with QM/MM-ER gives a substantial improvement on the calculation of the hydration free energy of a hydronium ion. This can be attributed to the fact that the ECF reasonably realizes the contraction of the electron density of the cation due to the deficit of an electron.

A pair density functional theory utilizing the correlated wave function

International Nuclear Information System (INIS)

Higuchi, M; Higuchi, K

2009-01-01

We propose a practical scheme for calculating the ground-state pair density (PD) by utilizing the correlated wave function. As the correlated wave function, we adopt a linear combination of the single Slater determinants that are constructed from the solutions of the initial scheme [Higuchi M and Higuchi K 2007 Physica B 387, 117]. The single-particle equation is derived by performing the variational principle within the set of PDs that are constructed from such correlated wave functions. Since the search region of the PD is substantially extended as compared with the initial scheme, it is expected that the present scheme can cover more correlation effects. The single-particle equation is practical, and may be easily applied to actual calculations.

Inner-shell couplings in transiently formed superheavy quasimolecules

Energy Technology Data Exchange (ETDEWEB)

Verma, P [Kalindi College, University of Delhi, New Delhi 110008 (India); Mokler, P H [Max-Planck-Institut fuer Kernphysik, 69117 Heidelberg (Germany); Braeuning-Demian, A; Kozhuharov, C; Braeuning, H; Bosch, F; Hagmann, S; Liesen, D [GSI Helmholzzentrum fuer Schwerionenforschung, 64291 Darmstadt (Germany); Anton, J; Fricke, B [Universitaet Kassel, 34109 Kassel (Germany); Stachura, Z [Institute for Nuclear Physics, Cracow PL 31342 (Poland); Wahab, M A, E-mail: p.verma.du@gmail.com [Jamia Millia Islamia, Jamia Nagar, New Delhi 110025 (India)

2011-06-15

The inner-shell couplings for U{sup q+}-ions (73{<=}q{<=}91) moving moderately slow at {approx}69 MeV u{sup -1} and bombarding thin Au targets have been investigated. Having established the definite survival probability of incoming projectile K vacancies in these targets in an earlier publication, the transfer of these vacancies to the target K-shell due to inner-shell couplings has been studied. As the system is in the quasiadiabatic collision regime for the K-shell of collision partners, advanced SCF-DFS (self-consistent field-Dirac-Fock-Slater) multielectron level diagrams have been used for interpretation. Using a simple model, the L-K shell coupling interaction distance has been estimated and compared with level diagram calculations.

On the treatment of light-ion electronic stopping in dense matter

Energy Technology Data Exchange (ETDEWEB)

Schiwietz, G. (Hahn-Meitner-Inst. Berlin GmbH, Div., FD (Germany)); Grande, P.L. (Hahn-Meitner-Inst. Berlin GmbH, Div., FD (Germany))

1994-05-01

A review is given on single-electron mechanisms and the corresponding theoretical approaches describing the electronic energy-transfer processes of light ions in gases and solids. Special emphasis is given to a discussion on the connection between exact Bloch-wave treatments and free-atom approximations. In the case of solids, perturbation theory is applied to the stopping of low-energy ions in the alkaline metals Li and Na. These calculations include Bloch wavefunctions of the Wigner-Seitz type obtained from a Hartree-Fock-Slater calculation and allow for a prediction of the mean energy loss under channeling conditions. Results of the most widely used local-density approximation are compared to data of our more complete perturbative treatment. Comparison is also made with recent LCAO calculations. (orig.)

Bonding and energy parameters for Pr and Nd complexes of benzimidazoles

Energy Technology Data Exchange (ETDEWEB)

Mittal, S; Vyas, P C; Oza, C K [Rajasthan Univ., Jaipur (India). Dept. of Chemistry

1991-01-01

Complexes of praseodymium(III) and neodymium(III) with benzimidazoles have been synthesized and characterized by their conductance and infrared spectral studies. The values of interelectronic repulsion, i.e. Slater-Condon (F{sub 2}, F{sub 4}, F{sub 6}), Racah (E{sup 1}, E{sup 2}, E{sup 3}) parameters and spin-orbit interaction referred as Lande' ({zeta}4f) parameters have been calculated from their electronic spectral data. A comparison of these parameters for the complexes with Pr{sup 3+} and Nd{sup 3+} free ion parameters is discussed. Using F{sub 2} values, the nephelauxetic ratio({Beta}) and bonding parameter(b{sup 1/2}) have beeen calculated. The relative variation of covalent bonding in the complexes has been reported. (author). 11 refs., 1 tab.

A supply chain management strategy for the non-ferrous foundry industry in South Africa / by Arland Slater

OpenAIRE

Slater, Arland

2004-01-01

In today's global knowledge economy, progressive companies must be equipped with a good balance of internal knowledge, both in scope and depth, and must adapt to the rapidly changing business environment. The ability of an organisation to manage knowledge as a corporate strategy is becoming a key competitive advantage. The essence of building an organisation's strength or capability in strategic knowledge management is to deepen the understanding of the exploitation and explora...

Studies in the electronic structure of matter

International Nuclear Information System (INIS)

Swarts, C.A.

1979-01-01

Chapter I: Here the results of various theories for the angular distribution of electrons photoemitted from the outermost p-shell of rare gas atoms are compared. The theories compared are (I) the local density theories of Slater (X/sub α/) and of Hohenberg, Kohn and Sham, (II) the pseudopotential method, (III) Hartree-Fock theory as evaluated by Kennedy and Manson, and (IV) Amusia's Random Phase Approximation with Exchange (RPAE). It is shown that the local density theories, although simple, generally fail to produce reliable cross section; the more complicated Hartree-Fock method is no more reliable; the a priori RPAE method is most reliable, but tedious; and the phenomenological pseudopotential method offers a good combination of reliability and simplicity. The muffin-tin approximation, widely used in molecular and condensed matter physics, is examined and found to be adequate. Chapter II: Extended Hueckel theory is applied to GaAs, GaP and to the nitrogen isoelectronic trap in GaAs and GaP. The computed perfect crystal band structures are found to be in reasonable agreement with those computed with empirical pseudopotentials. Nitrogen impurity levels in GaAs and GaP are calculated using a cluster model. Chapter III: By means of model calculations for an independent electron metal, we obtain exact lineshapes for the photon absorption, emission and photoemission spectra of deep core states. We find in each case an X-ray edge anomaly as pedicted by Nozieres and De Dominicis. Sumrules are used as a general check on the calculations and to explain the deviations of the exact theory from the exciton theory away from threshold

Condensed phase QM/MM simulations utilizing the exchange core functions to describe exchange repulsions at the QM boundary region

Energy Technology Data Exchange (ETDEWEB)

Umino, Satoru; Takahashi, Hideaki, E-mail: hideaki@m.tohoku.ac.jp; Morita, Akihiro [Department of Chemistry, Graduate School of Science, Tohoku University, Sendai, Miyagi 980-8578 (Japan)

2016-08-28

In a recent work, we developed a method [H. Takahashi et al., J. Chem. Phys. 143, 084104 (2015)] referred to as exchange-core function (ECF) approach, to compute exchange repulsion E{sub ex} between solute and solvent in the framework of the quantum mechanical (QM)/molecular mechanical (MM) method. The ECF, represented with a Slater function, plays an essential role in determining E{sub ex} on the basis of the overlap model. In the work of Takahashi et al. [J. Chem. Phys. 143, 084104 (2015)], it was demonstrated that our approach is successful in computing the hydrogen bond energies of minimal QM/MM systems including a cationic QM solute. We provide in this paper the extension of the ECF approach to the free energy calculation in condensed phase QM/MM systems by combining the ECF and the QM/MM-ER approach [H. Takahashi et al., J. Chem. Phys. 121, 3989 (2004)]. By virtue of the theory of solutions in energy representation, the free energy contribution δμ{sub ex} from the exchange repulsion was naturally formulated. We found that the ECF approach in combination with QM/MM-ER gives a substantial improvement on the calculation of the hydration free energy of a hydronium ion. This can be attributed to the fact that the ECF reasonably realizes the contraction of the electron density of the cation due to the deficit of an electron.

Lattice constant changes leading to significant changes of the spin-gapless features and physical nature in a inverse Heusler compound Zr2MnGa

Science.gov (United States)

Wang, Xiaotian; Cheng, Zhenxiang; Khenata, Rabah; Wu, Yang; Wang, Liying; Liu, Guodong

2017-12-01

The spin-gapless semiconductors with parabolic energy dispersions [1-3] have been recently proposed as a new class of materials for potential applications in spintronic devices. In this work, according to the Slater-Pauling rule, we report the fully-compensated ferrimagnetic (FCF) behavior and spin-gapless semiconducting (SGS) properties for a new inverse Heusler compound Zr2MnGa by means of the plane-wave pseudo-potential method based on density functional theory. With the help of GGA-PBE, the electronic structures and the magnetism of Zr2MnGa compound at its equilibrium and strained lattice constants are systematically studied. The calculated results show that the Zr2MnGa is a new SGS at its equilibrium lattice constant: there is an energy gap between the conduction and valence bands for both the majority and minority electrons, while there is no gap between the majority electrons in the valence band and the minority electrons in the conduction band. Remarkably, not only a diverse physical nature transition, but also different types of spin-gapless features can be observed with the change of the lattice constants. Our calculated results of Zr2MnGa compound indicate that this material has great application potential in spintronic devices.

Rare earth point defects in GaN

Energy Technology Data Exchange (ETDEWEB)

Sanna, S.

2007-12-14

In this work we investigate rare earth doped GaN, by means of theoretical simulations. The huge unit cells necessary to model the experimental system, where dilute amount of rare earth ions are used, are handled with the charge self consistent density-functional based-tight binding (SCC-DFTB) calculational scheme. The method has been extended to include LDA+U and simplified self interaction corrected (SIC)-like potentials for the simulation of systems with localised and strongly correlated electrons. A set of tight-binding parameters has been created to model the interaction of GaN with some dopants, including a selection of lanthanide ions interesting due to their optical or magnetic properties (Pr, Eu, Gd, Er and Tm). The f-electrons were treated as valence electrons. A qualitatively correct description of the band gap is crucial for the simulation of rare earth doped GaN, because the luminescence intensity of the implanted samples depends on the size of the host band gap and because the rare earths could introduce charge transition levels near the conduction band. In this work these levels are calculated with the Slater-Janak (SJ) transition state model, which allows an approximate calculation of the charge transition levels by analysing the Kohn-Sham eigenvalues of the DFT. (orig.)

Abstracts from Dietetic Research Event: June 09-11, 2016.

Science.gov (United States)

2016-09-01

Winnipeg, Manitoba was the host city of the 2016 Dietitians of Canada Annual Conference. Through the support of Dietitians of Canada and CFDR, the 2016 event was both an exciting and informative exchange of research and experience-sharing efforts that inspired attendees. The submissions for this year's Canadian Foundation for Dietetic Research (CFDR) event represented the diversity of dietetic research conducted within Canada. The topics highlighted from this year's abstracts include Community Based Nutritional Care, Wellness & Public Health, Determinants of Food Choice, Dietary Intake, Nutrition Health & Education, Dietetic Practice & Education, Clinical Research & Patient Service, and Nutrition Social Media & the Web. Each presenter provided an 11-minute oral presentation (8 minutes for presenting and 3 minutes for questions). This allowed for meaningful interaction between the presenters and those attending the sessions. This year there were professional and student oral research presentations on each day of the conference. These presentations offered the newest insights into important research findings that apply to dietetic practice. This research event would not be possible without the commitment and dedication of many people. On behalf of Dietitians of Canada and CFDR, I would like to extend a special thank you to the 2016 Abstract Review Committee who represented research, clinical nutrition, community nutrition, and education: Masha Jessri (Ph.D Candidate, University of Toronto), Joyce Slater (Associate Professor, University of Manitoba) and Miyoung Suh (Associate Professor, University of Manitoba). We would also like to thank all of our moderators who assisted during the conference to keep our research presentation sessions on time: Marcia Cooper, Miyoung Suh, Andrea Buchholz, Dawna Royall, Paul Fieldhouse, Joyce Slater, Isabelle Giroux, and Bethany Hopkins. Finally, a special thank you to Michelle Naraine and Greg Sarney at CFDR for their assistance and

Malaria-specific metabolite hemozoin mediates the release of several potent endogenous pyrogens (TNF, MIP-1 alpha, and MIP-1 beta) in vitro, and altered thermoregulation in vivo.

Science.gov (United States)

Sherry, B A; Alava, G; Tracey, K J; Martiney, J; Cerami, A; Slater, A F

1995-01-01

A characteristic feature of malaria infection is the occurrence of periodic bouts of fever. Experimental and clinical studies have strongly implicated inflammatory cytokines, like tumour necrosis factor (TNF), in the induction of these intermittent fevers [Clark et al., Infect Immunol 32:1058-1066, 1981; Clark et al., Am J Pathol 129:192-199, 1987; Karunaweera et al., Proc Natl Acad Sci USA 89:3200-3203, 1992], but the malaria-specific metabolite(s) which induce the production of such endogenous pyrogens have not yet been fully characterized. It is well known that during the course of malaria infection, a unique schizont component, alternatively referred to as "malaria pigment" or hemozoin, is released along with merozoites as the host erythrocyte bursts [Urquhart, Clin Infect Dis 19:117-131, 1994]. We have recently determined that the core structure of hemozoin comprises a novel insoluble polymer of heme units linked by iron-carboxylate bonds [Slater et al., Proc Natl Acad Sci USA 88:325-329, 1991; Slater et al., Nature 355:167-169, 1992]. We now report that purified native, as well as chemically synthesized, hemozoin crystals potently induce the release of several pyrogenic cytokines, including TNF, MIP-1 alpha, and MIP-1 beta, from murine macrophages and human peripheral blood monocytes in vitro. Also, intravenous administration of chemically synthesized preparations of hemozoin to anaesthetized rats results in a marked drop in body temperature. A similar drop in body temperature is observed following the intravenous injection of other well-characterized pyrogenic cytokines (e.g., TNF) which are known to induce a fever response in awake animals, and is thought to reflect the inability of rats to appropriately regulate their body temperature while anaesthetized. As a consequence of its ability to induce pyrogenic cytokines in vitro, and thermal dysregulation in vivo, we propose that this unique parasite metabolite is an important pyrogen released by malaria

Anisotropic p-f mixing mechanism explaining anomalous magnetic properties in Ce monopnictides

International Nuclear Information System (INIS)

Takahashi, H.; Kasuya, T.

1985-01-01

The crystal-field splittings in CeP, PrP and NdP are calculated by considering the point-charge Coulomb interaction, the intra-atomic d-f Coulomb interaction, and the p-f and d-f mixings. The p-f mixing mechanisms, not only between the occupied 4f states and the conduction bands, but also between the unoccupied 4f states and the valence bands make an important contribution to the crystal-field splitting. The fact that the crystal-field potential in CeP is smaller than those in PrP and NdP is due to the occupied 4f level in CeP being shallower. The values of the Slater-Koster integrals, (pfσ) and (pfπ), are determined uniquely from the crystal-field fitting for PrP and NdP. (author)

Alcohol advertising and youth.

Science.gov (United States)

Martin, Susan E; Snyder, Leslie B; Hamilton, Mark; Fleming-Milici, Fran; Slater, Michael D; Stacy, Alan; Chen, Meng-Jinn; Grube, Joel W

2002-06-01

This article presents the proceedings of a symposium at the 2001 Research Society on Alcoholism meeting in Montreal, Canada. The symposium was organized and chaired by Joel W. Grube. The presentations and presenters were (1) Introduction and background, by Susan E. Martin; (2) The effect of alcohol ads on youth 15-26 years old, by Leslie Snyder, Mark Hamilton, Fran Fleming-Milici, and Michael D. Slater; (3) A comparison of exposure to alcohol advertising and drinking behavior in elementary versus middle school children, by Phyllis L. Ellickson and Rebecca L. Collins; (4) USC health and advertising project: assessment study on alcohol advertisement memory and exposure, by Alan Stacy; and (5) TV beer and soft drink advertising: what young people like and what effects? by Meng-Jinn Chen and Joel W. Grube.

Curvature of the Lanthanide Contraction: An Explanation

Energy Technology Data Exchange (ETDEWEB)

Raymond, Kenneth; Wellman, Daniel; Sgarlata, Carmelo; Hill, Aru

2009-12-21

A number of studies have shown that for isostructural series of the lanthanides (elements La through Lu), a plot of equivalent metal-ligand bond lengths versus atomic number differs significantly from linearity and can be better fit as a quadratic equation. However, for hydrogen type wave functions, it is the inverse of the average distance of the electron from the nucleus (an estimate of size) that varies linearly with effective nuclear charge. This generates an apparent quadratic dependence of radius with atomic number. Plotting the inverse of lanthanide ion radii (the observed distance minus the ligand size) as a function of effective nuclear charge gives very good linear fits for a variety of lanthanide complexes and materials. Parameters obtained from this fit are in excellent agreement with the calculated Slater shielding constant, k.

Large-scale ab initio configuration interaction calculations for light nuclei

International Nuclear Information System (INIS)

Maris, Pieter; Potter, Hugh; Vary, James P; Aktulga, H Metin; Ng, Esmond G; Yang Chao; Caprio, Mark A; Çatalyürek, Ümit V; Saule, Erik; Oryspayev, Dossay; Sosonkina, Masha; Zhou Zheng

2012-01-01

In ab-initio Configuration Interaction calculations, the nuclear wavefunction is expanded in Slater determinants of single-nucleon wavefunctions and the many-body Schrodinger equation becomes a large sparse matrix problem. The challenge is to reach numerical convergence to within quantified numerical uncertainties for physical observables using finite truncations of the infinite-dimensional basis space. We discuss strategies for constructing and solving the resulting large sparse matrix eigenvalue problems on current multicore computer architectures. Several of these strategies have been implemented in the code MFDn, a hybrid MPI/OpenMP Fortran code for ab-initio nuclear structure calculations that can scale to 100,000 cores and more. Finally, we will conclude with some recent results for 12 C including emerging collective phenomena such as rotational band structures using SRG evolved chiral N3LO interactions.

Modified potentials in many-body perturbation theory

International Nuclear Information System (INIS)

Silver, D.M.; Bartlett, R.J.

1976-01-01

Many-body perturbation-theory calculations of the pair-correlation energy within the regime of various finite expansions in two-center Slater-type basis sets are performed using a wide variety of modified potentials for the determination of unoccupied orbitals. To achieve meaningful convergence, it appears that the perturbation series must be carried through third order, using shifted denominators to include contributions from various higher-order diagrams. Moreover, certain denominator shifts are found necessary to ensure that a negative-definite resolvent accompanies the perturbation scheme when an arbitrary modified potential is employed. Through third order with denominator shifts, well-behaved modified potentials are found to give results that are equivalent, within 1 kcal/mole, to those obtained for pair-correlation energies with the standard self-consistent-field-V/sup N/ potential

Analysis of the spectrum six times ionized zinc (Zn VII): the 3d6-3d54p transition array

International Nuclear Information System (INIS)

Hof, G.H. van het; Joshi, Y.N.; Raassen, A.J.J.; Ryabtsev, A.N.

1993-01-01

The spectrum of zinc was photographed in the 100-300 A region on a 10.7 m grazing incidence spectrograph using a triggered spark light source. 335 lines were classified in the Zn VII 3d 6 -3d 5 4p transition array, resulting in the establishment of 30 of the 34 levels of the 3d 6 configuration and 103 of the 214 levels of the 3d 5 4p. The ground configuration 3d 6 was described by a generalized least-squares fit (GLSF) involving orthogonal operators to a set of 3d N configurations. This yielded a mean error of 3 cm -1 for its level values. The excited configruation was described by the conventional Slater Condon parameter set, giving a mean error of 105 cm -1 . (orig.)

Studies in the theory of solids

Energy Technology Data Exchange (ETDEWEB)

Hjalmarson, H. P.

1979-01-01

The surface arrangement of atoms in a solid controls the energetically slowly varying features of a LEED spectrum. Because of inelastic collisions within the solid, the LEED electrons mainly sample a surface sandwich of atoms. Thus, the surface sandwich reflectivity, computed by using a method which considers only single reflections of the electron by sheets of atoms in the solid, can be directly compared with the slowly varying, surface dependent features in the data. The method was used to determine that the surface of TiS/sub 2/ is ideal whereas the surface sandwich of TiSe/sub 2/ expands outward slightly. For the final determinations, the smoothing method was used on both the data and a theory which includes multiple scattering to confine the comparison to just the slowly varying surface dependent features. Energies of deep traps associated with impurities in semiconductors are shown to be controlled by the S and P orbital energies of the impurity atoms. First, the qualitative physics of a deep trap is worked out using a defect molecule model. The quantitative theory is worked out using a tight binding Koster-Slater calculation. Predictions of energies of deep traps caused by impurities are made for fourteen different semiconductors. The theory is compared with the data for GaP and the alloy GaAs/sub 1-x/P/sub x/ before developing a phenomenological model which depends mainly on the energy centers of the valence and conduction band density of states as well as atomic energies of impurities. This phenomenological model is used to make predictions of deep trap energies in Si.

Studies in the theory of solids

International Nuclear Information System (INIS)

Hjalmarson, H.P.

1979-01-01

The surface arrangement of atoms in a solid controls the energetically slowly varying features of a LEED spectrum. Because of inelastic collisions within the solid, the LEED electrons mainly sample a surface sandwich of atoms. Thus, the surface sandwich reflectivity, computed by using a method which considers only single reflections of the electron by sheets of atoms in the solid, can be directly compared with the slowly varying, surface dependent features in the data. The method was used to determine that the surface of TiS 2 is ideal whereas the surface sandwich of TiSe 2 expands outward slightly. For the final determinations, the smoothing method was used on both the data and a theory which includes multiple scattering to confine the comparison to just the slowly varying surface dependent features. Energies of deep traps associated with impurities in semiconductors are shown to be controlled by the S and P orbital energies of the impurity atoms. First, the qualitative physics of a deep trap is worked out using a defect molecule model. The quantitative theory is worked out using a tight binding Koster-Slater calculation. Predictions of energies of deep traps caused by impurities are made for fourteen different semiconductors. The theory is compared with the data for GaP and the alloy GaAs/sub 1-x/P/sub x/ before developing a phenomenological model which depends mainly on the energy centers of the valence and conduction band density of states as well as atomic energies of impurities. This phenomenological model is used to make predictions of deep trap energies in Si

Accurate measurement of absolute experimental inelastic mean free paths and EELS differential cross-sections

Energy Technology Data Exchange (ETDEWEB)

Craven, Alan J.; Bobynko, Joanna; Sala, Bianca; MacLaren, Ian, E-mail: ian.maclaren@glasgow.ac.uk

2016-11-15

Methods are described for measuring accurate absolute experimental inelastic mean free paths and differential cross-sections using DualEELS. The methods remove the effects of surface layers and give the results for the bulk materials. The materials used are VC{sub 0.83}, TiC{sub 0.98}, VN{sub 0.97} and TiN{sub 0.88} but the method should be applicable to a wide range of materials. The data was taken at 200 keV using a probe half angle of 29 mrad and a collection angle of 36 mrad. The background can be subtracted from under the ionisation edges, which can then be separated from each other. This is achieved by scaling Hartree-Slater calculated cross-sections to the edges in the atomic regions well above the threshold. The average scaling factors required are 1.00 for the non-metal K-edges and 1.01 for the metal L-edges (with uncertainties of a few percent). If preliminary measurements of the chromatic effects in the post-specimen lenses are correct, both drop to 0.99. The inelastic mean free path for TiC{sub 0.98} was measured as 103.6±0.5 nm compared to the prediction of 126.9 nm based on the widely used Iakoubovskii parameterisation. - Highlights: • We show how to extract absolute cross sections for EELS edges using DualEELS. • The method removes the effects of any surface layers on standards. • We use a needle specimen to determining the mean free path for inelastic scattering. • Constrained background fitting is essential to correct background subtraction. • Absolute cross sections are determined for TiC, TiN, VC and VN.

Spectra of Nb XII-XVII from a low-inductance vacuum spark

International Nuclear Information System (INIS)

Burkhalter, P.G.; Cohen, L.; Cowan, R.D.; Sweeney, B.V.

1982-01-01

The XUV spectrum of niobium was obtained by using a low-inductance vaccum spark and grazing-incidence, high-resolution spectrograph. Identification of wavelengths and lines were made in the 2060-A region for complex arrays involving 3d--p and 3d--4f transitions. Atomic structure calculations using relativistically corrected Hartree-Fock wave functions provided the theoretical basis for line classifications. The 3d 9 --3d 8 4p,4f and 3p 5 3d 10 -3p 5 3d 9 4p,4f transitions in Nb XV and satellites to the Ni-like 3d 10 --3d 9 4p,4f lines were classified. Energy levels for the 3d 8 4p and 3d 8 4f configurations in Nb XV were determined by using Slater integrals scaled by least-squares fitting

Evaluation of intensity and energy interaction parameters for the complexation of Pr(III) with selected nucleoside and nucleotide through absorption spectral studies

Science.gov (United States)

Bendangsenla, N.; Moaienla, T.; David Singh, Th.; Sumitra, Ch.; Rajmuhon Singh, N.; Indira Devi, M.

2013-02-01

The interactions of Pr(III) with nucleosides and nucleotides have been studied in different organic solvents employing absorption difference and comparative absorption spectrophotometry. The magnitudes of the variations in both energy and intensity interaction parameters were used to explore the degree of outer and inner sphere co-ordination, incidence of covalency and the extent of metal 4f-orbital involvement in chemical bonding. Various electronic spectral parameters like Slater-Condon (Fk), Racah (Ek), Lande parameter (ξ4f), Nephelauxatic ratio (β), bonding (b1/2), percentage covalency (δ) and intensity parameters like oscillator strength (P) and Judd Ofelt electronic dipole intensity parameter (Tλ, λ = 2, 4, 6) have been evaluated. The variation of these evaluated parameters were employed to interpret the nature of binding of Pr(III) with different ligands i.e. Adenosine/ATP in presence and absence of Ca2+.

Comment on atomic independent-particle models

International Nuclear Information System (INIS)

Doda, D.D.; Gravey, R.H.; Green, A.E.S.

1975-01-01

The Hartree-Fock-Slater (HFS) independent-particle model in the form developed by Hermann and Skillman (HS) and the Green, Sellin, and Zachor (GSZ) analytic independent-particle model are being used for many types of applications of atomic theory to avoid cumbersome, albeit more rigorous, many-body calculations. The single-electron eigenvalues obtained with these models are examined and it is found that the GSZ model is capable of yielding energy eigenvalues for valence electrons which are substantially closer to experimental values than are the results of HS-HFS calculations. With the aid of an analytic representation of the equivalent HS-HFS screening function, the difficulty with this model is identified as a weakness of the potential in the neighborhood of the valence shell. Accurate representations of valence states are important in most atomic applications of the independent-particle model

Characterization of some Pr(III) complexes in terms of electronic spectral parameters

International Nuclear Information System (INIS)

Bhati, P.R.; Soni, K.P.; Joshi, G.K.; Swami, S.N.

1992-01-01

Pr(III) complexes from the ligands derived from methyl acetoacetate, ethyl acetoacetate, veratraldehyde, ethyl vanillin and 2,5 dimethoxy benzaldehyde forming Schiff-bases with ortho, meta and para phenylene diamines have been synthesized. The complexes have been characterized in terms of various Slater-Condon Lande and Judd-Ofelt parameters. The various trends in the parametric values have also been described. The involvement of 4f-orbital in the Pr(III) complexes including deviation in the symmetry have been discussed on the basis of electronic spectral parameters. The validity of the theories used has been established while comparing observed and calculated energies and intensities of the various bands in the present complexes on the basis of r.m.s deviation. The trends of the curves observed in the solution spectra have also been discussed. (author). 21 refs., 5 tabs., 2 figs

Change in the conversion rate for the E3-isomer sup(235m)U (76,8 eV; 1/2+ → 7/2-) at variation of configurations of the valence band of the atomic shell

International Nuclear Information System (INIS)

Grechukhin, D.P.; Soldatov, A.A.

1983-01-01

In the framework of the relativistic Hartree-Fock-Slater method, a change of the conversion rate lambda for the E3 isomer (at the transition energy of h/2πω=77 eV) with respect to the rate lambda for the normal configuration of uranium atom, (7ssup(1/2)sup(2)(6dsup(3/2))sup(1)(5fsup(5/2))sup(3), is calcUlated for 14 configurations of the valence band of the atomic shell, including considerable variations of the occupation numbers in 6d, 7s, and 5f orbits. A very strong change Δlambda/lambda 1 is found to be due to variation of the occupation number for the 5f orbit (ΔN(5f) not equal to 0); the change amounts to about 8% per ΔN(5f)=+-1, that is an order of magnitude higher than Δlambda/lambda 1 due to variations of the occupation numbers for other orbits in the cases where N(5f)=const. Though the direct contribution from the 5f electrons to the conversion is very small ( 1 for ΔN(5f) not equal to 0. A rigid correlation between the partial conversion rate and the r. m. s. radius of the orbit is obtained for 6p orbits

Improving Web-Based Student Learning Through Online Video Demonstrations

Science.gov (United States)

Miller, Scott; Redman, S.

2010-01-01

Students in online courses continue to lag their peers in comparable face-to-face (F2F) courses (Ury 2004, Slater & Jones 2004). A meta-study of web-based vs. classroom instruction by Sitzmann et al (2006) discovered that the degree of learner control positively influences the effectiveness of instruction: students do better when they are in control of their own learning. In particular, web-based courses are more effective when they incorporate a larger variety of instructional methods. To address this need, we developed a series of online videos to demonstrate various astronomical concepts and provided them to students enrolled in an online introductory astronomy course at Penn State University. We found that the online students performed worse than the F2F students on questions unrelated to the videos (t = -2.84), but that the online students who watched the videos performed better than the F2F students on related examination questions (t = 2.11). We also found that the online students who watched the videos performed significantly better than those who did not (t = 3.43). While the videos in general proved helpful, some videos were more helpful than others. We will discuss our thoughts on why this might be, and future plans to improve upon this study. These videos are freely available on iTunesU, YouTube, and Google Video.

A new Gauss quadrature for multicentre integrals over STOs in the Gaussian integral transform approach

International Nuclear Information System (INIS)

Bouferguene, Ahmed

2005-01-01

When computing multicentre integrals over Slater-type orbitals (STOs) by means of the Shavitt and Karplus Gaussian integral transforms (Shavitt and Karplus 1962 J. Chem. Phys. 36 550), one usually ends up with a multiple integral of the form ∫ 0 1 du ∫ 0 1 dv ...∫ 0 ∞ dz F(u, v, ..., z) (Shavitt and Karplus 1965 J. Chem. Phys. 43 398) in which all the integrals are inter-related. The most widely used approach for computing such an integral is to apply a product of Gauss-Legendre quadratures for the integrals over [0, 1] while the semi-infinite term is evaluated by a special procedure. Although numerous approaches have been developed to accurately perform the integration over [0, ∞) efficiently, it is the aim of this work to add a new tool that could be of some benefit in carrying out the hard task of multicentre integrals over STOs. The new approach relies on a special Gauss quadrature referred to as Gauss-Bessel to accurately evaluate the semi-infinite integral of interest. In this work, emphasis is put on accuracy rather than efficiency since its aim is essentially to bring a proof of concept showing that Gauss-Bessel quadrature can successfully be applied in the context of multicentre integrals over STOs. The obtained accuracy is comparable to that obtained with other methods available in the literature

Theoretical Calculation of Absolute Radii of Atoms and Ions. Part 1. The Atomic Radii

Directory of Open Access Journals (Sweden)

Raka Biswas

2002-02-01

Full Text Available Abstract. A set of theoretical atomic radii corresponding to the principal maximum in the radial distribution function, 4πr2R2 for the outermost orbital has been calculated for the ground state of 103 elements of the periodic table using Slater orbitals. The set of theoretical radii are found to reproduce the periodic law and the Lother Meyer’s atomic volume curve and reproduce the expected vertical and horizontal trend of variation in atomic size in the periodic table. The d-block and f-block contractions are distinct in the calculated sizes. The computed sizes qualitatively correlate with the absolute size dependent properties like ionization potentials and electronegativity of elements. The radii are used to calculate a number of size dependent periodic physical properties of isolated atoms viz., the diamagnetic part of the atomic susceptibility, atomic polarizability and the chemical hardness. The calculated global hardness and atomic polarizability of a number of atoms are found to be close to the available experimental values and the profiles of the physical properties computed in terms of the theoretical atomic radii exhibit their inherent periodicity. A simple method of computing the absolute size of atoms has been explored and a large body of known material has been brought together to reveal how many different properties correlate with atomic size.

Extended screened exchange functional derived from transcorrelated density functional theory.

Science.gov (United States)

Umezawa, Naoto

2017-09-14

We propose a new formulation of the correlation energy functional derived from the transcorrelated method in use in density functional theory (TC-DFT). An effective Hamiltonian, H TC , is introduced by a similarity transformation of a many-body Hamiltonian, H, with respect to a complex function F: H TC =1FHF. It is proved that an expectation value of H TC for a normalized single Slater determinant, D n , corresponds to the total energy: E[n] = ⟨Ψ n |H|Ψ n ⟩/⟨Ψ n |Ψ n ⟩ = ⟨D n |H TC |D n ⟩ under the two assumptions: (1) The electron density nr associated with a trial wave function Ψ n = D n F is v-representable and (2) Ψ n and D n give rise to the same electron density nr. This formulation, therefore, provides an alternative expression of the total energy that is useful for the development of novel correlation energy functionals. By substituting a specific function for F, we successfully derived a model correlation energy functional, which resembles the functional form of the screened exchange method. The proposed functional, named the extended screened exchange (ESX) functional, is described within two-body integrals and is parametrized for a numerically exact correlation energy of the homogeneous electron gas. The ESX functional does not contain any ingredients of (semi-)local functionals and thus is totally free from self-interactions. The computational cost for solving the self-consistent-field equation is comparable to that of the Hartree-Fock method. We apply the ESX functional to electronic structure calculations for a solid silicon, H - ion, and small atoms. The results demonstrate that the TC-DFT formulation is promising for the systematic improvement of the correlation energy functional.

A Teoria da Resposta ao Item: possíveis contribuições aos estudos em marketing The Item Response Theory: possible contributions to marketing studies

Directory of Open Access Journals (Sweden)

Danielle Ramos de Miranda Pereira

2011-01-01

Full Text Available A constatação da ampla utilização de escalas multidimensionais por parte dos pesquisadores da área de marketing motivou a elaboração de um artigo com o propósito de discutir a aplicação da Teoria da Resposta ao Item (TRI, bem como apresentar a essa área um método que tem se mostrado bastante eficaz na estimação de construtos comportamentais. Sendo assim, o artigo apresenta uma discussão sobre a TRI, ressaltando seus avanços em relação à Teoria Clássica do Teste (TCT e suas aplicações tradicionais no campo da psicometria e da avaliação educacional. Para verificar sua aplicabilidade nos estudos de marketing, julgou-se adequado conduzir uma aplicação prática da TRI em um estudo envolvendo uma escala já bastante utilizada pelos pesquisadores - a de orientação de mercado (Escala MkTor proposta por Narver e Slater (1990. Os resultados da aplicação demonstraram que, embora o modelo da TRI proposto possa ser considerado satisfatório para a aplicação no contexto da Orientação para o Mercado, existem muitos desafios a serem enfrentados por novos estudos como a construção de uma escala com interpretação prática, indicando o que significa para uma empresa possuir um nível de maturidade associado a um determinado construto. As considerações finais ressaltam que a grande contribuição do artigo aos estudos em marketing é a apresentação de um método alternativo para estimar de forma mais apurada os construtos e avaliar a qualidade dos itens das escalas.The widespread utilization of multidimensional scales by researchers in field of marketing have motivated the conduction of a study to discuss the application of the Item Response Theory (IRT as well as presenting a method that has proved very effective in the estimation of behavioral constructs. Therefore, this article presents a discussion about IRT highlighting its advances regarding the Classical Theory of Tests (CTT and its traditional applications in the

THE EFFECT OF LEARNING ORIENTATION IN THE ORGANIZATIONAL PERFORMANCE OF ENTERPRISES IN RS EL EFECTO DE LA ORIENTACIÓN PARA EL APRENDIZAJE EN EL DESEMPEÑO ORGANIZATIVO DE LAS EMPRESAS DE LA REGIÓN CENTRAL DE RS O EFEITO DA ORIENTAÇÃO PARA A APRENDIZAGEM NO DESEMPENHO ORGANIZACIONAL DAS EMPRESAS DA REGIÃO CENTRAL DO RIO GRANDE DO SUL

Directory of Open Access Journals (Sweden)

Eduardo Botti Abbade

2013-01-01

Full Text Available This study aims to identify the influence of learning orientation on organizational performance ofenterprises in the central region of Rio Grande do Sul. The method employed was a survey of 123 of these enterprises which were mostly classified as small and medium. The data collection instrument was developed using the scale of Learning Orientation developed by Sinkula, Baker and Noordewier (1997, adapted byBaker and Sinkula (1999 and items of organizational performance evaluation proposed by Narver and Slater (1990 and Baker and Sinkula (1999. Correlation Analysis, multiple regression and factor analysis aswell as elaboration of a structural equation model were made. It was found that these enterprises present amoderately high level of learning orientation and organizational performance. It was also noted thatLearning Orientation, in general, presents a positive and significant influence on organizationalperformance. However, more specifically, only the dimension Open Mind of the scale presented astatistically positive significance. The other two dimensions (Commitment to Learning and Shared Visionhad a positive, however not significant, impact.El presente estudio tiene como objetivo identificar la influencia de la orientación para el aprendizaje enel desempeño organizativo de las empresas de la región central de Rio Grande do Sul. El método empleadofue una investigación  de levantamiento con 123 empresas de la región central de RS. El instrumento decolecta de datos fue elaborado utilizándose la escala de Orientación para el Aprendizaje de Sinkula, Baker yNoordewier (1997, adaptada por Baker y Sinkula (1999, e ítems de evaluación del desempeño organizativopropuestos por Narver y Slater (1990 y Baker y Sinkula (1999. Fueron realizados análisis de correlación,regresión linear múltipla y análisis factorial, además de la ecuación estructural del modelo de estudio. Lasempresas investigadas fueron, en su mayoría, clasificadas

Analytic formulae for the Hartree-Fock order parameter at arbitrary p/q filling factors for the 2DEG in a magnetic field

International Nuclear Information System (INIS)

Cabo Monte Oca, A. de.

1994-07-01

Analytic expressions for order parameters are given for the previously introduced general class of Hartree Fock states at arbitrary filling factors ν=p/q for odd q values. The order parameters are expressed as sums of magnetic translations eigenvalues over the filled single electron states. Simple summation formulae for the band spectra in terms of the same eigenvalues are also presented. The energy per particle at ν=1/3 is calculated for various states differing in the way of filling of the 1/3 of the orbitals. The calculated energies are not competing with the usual CDW results. However the high degree of electron overlapping allows for the next corrections to modify this situation. The discussion suggests these Hartree-Fock Slater determinants as interesting alternatives for the Tao-Thouless parent states which may correct their anomalous symmetry and correlation functions properties. (author). 28 refs

Effect of the business environment on market orientation and performance in an emerging country

Directory of Open Access Journals (Sweden)

József Berács

2010-11-01

Full Text Available In the paper the relationship between market orientation and performance, and the effect of the business environment on these two factors in an emerging economy, in Hungary, was investigated. In a research conducted at 572 firms we found that both market orientation and the business environment have an effect on business performance, albeit in a different manner. The three components of the market orientation construct (customer orientation, competitor orientation, interfunctional coordination have a positive effect on performance. Contrary to that, environmental variables (technological turbulence, market turbulence, competitive intensity, buyer power etc. proved to have a signficant impact only on the finance-based performance measures. The results provide unambiguous evidence that the environment has a strong effect on market orientation, indicating that the market orientation scale developed by Narver and Slater is a proper tool to describe the transitional processes in an emerging economy characterized by high turbulence

The spectrum and term system of S VIII

International Nuclear Information System (INIS)

Bengtsson, P.; Jupen, C.; Engstroem, L.; Redfors, A.; Westerlind, M.

1993-01-01

The spectrum of seven times ionized sulfur, S VIII, has been observed in the wavelength range 50-1200 A. Both beam-foil and laser-produced plasma light sources have been used. 71 new lines representing the transitions 2p 5 -2p 4 3d, 2p 4 3s-3p, 3p-3d, 3d-4f, 4f-5g and 5g-6h have been identified and 100 energy levels, of which 46 are new, are now accurately established. The spectral analysis is supported by isoelectronic comparisons along the F I-sequence and by parametric least-squares fits of Slater integrals to the observed levels. The ionization potential in S VIII is determined to 2 651 899 ± 60 cm -1 and estimated ionization energies are derived for the isoelectronic elements between F I and Ar X. (orig.)

Differential and total cross sections for the ionization of water molecule by electron impact

International Nuclear Information System (INIS)

Houamer, S.; Dal Cappello, C.; Mansouri, A.

2007-01-01

A theoretical approach is presented to calculate multiply differential and total cross sections of the ionization of H 2 O molecule in the vapour phase. The wave function of the target is described by molecular orbitals consisting of a linear combination of slater type atomic orbitals centered on the heaviest atom which is the oxygen atom in this case. The calculations are carried out in the first Born approximation where the projectile is described by a plane wave while the ejected electron is described by a coulomb wave taking into account its interaction with the residual ion. The spherical average over the Euler solid angle due to the randomly oriented gaseous target molecule is carried out analytically using the rotation matrix properties. The differential and total cross sections are thus evaluated without any special difficulty and compared with experiments and distorted wave calculations. Fair agreements are observed

A Moessbauer effect study of the bonding in several organoiron carbonyl clusters

International Nuclear Information System (INIS)

Long, G.J.; O'Brien, J.F.

1988-01-01

After a brief review of the applications of the Moessbauer effect to cyclopentadienyl containing compounds, the chemistry and spectral properties of the various iron carbonyl complexes are described. The electronic properties of a series of trinuclear and tetranuclear organoiron clusters have been investigated through Fenske-Hall self-consistent field molecular orbital calculations, and the results are compared with the Moessbauer effect isomer shifts. A linear correlation is found between the Slater effective nuclear charge, as calculated from the Fenske-Hall partial orbital occupancy factors, and the isomer shift. In these compounds the 4s orbital populations are rather constant. However, the cis and trans isomers of [CpFe(CO) 2 ] 2 have a significantly lower 4s orbital populations. In this case, the reduced 4s population must be accounted for by adding it to the effective nuclear charge to obtain a good correlation with the isomer shift. (orig.)

International Conference eXtended Discretization MethodS

CERN Document Server

Benvenuti, Elena

2016-01-01

This book gathers selected contributions on emerging research work presented at the International Conference eXtended Discretization MethodS (X-DMS), held in Ferrara in September 2015. It highlights the most relevant advances made at the international level in the context of expanding classical discretization methods, like finite elements, to the numerical analysis of a variety of physical problems. The improvements are intended to achieve higher computational efficiency and to account for special features of the solution directly in the approximation space and/or in the discretization procedure. The methods described include, among others, partition of unity methods (meshfree, XFEM, GFEM), virtual element methods, fictitious domain methods, and special techniques for static and evolving interfaces. The uniting feature of all contributions is the direct link between computational methodologies and their application to different engineering areas.

Structural and magnetic characterization of Fe2CrSi Heusler alloy nanoparticles as spin injectors and spin based sensors

Science.gov (United States)

Saravanan, G.; Asvini, V.; Kalaiezhily, R. K.; Parveen, I. Mubeena; Ravichandran, K.

2018-05-01

Half-metallic ferromagnetic [HMF] nanoparticles are of considerable interest in spintronics applications due to their potential use as a highly spin polarized current source. HMF exhibits a semiconductor in one spin band at the Fermi level Ef and at the other spin band they poses strong metallic nature which shows 100 % spin polarization at Ef. Fe based full Heusler alloys are primary interest due to high Curie temperature. Fe2CrSi Heusler alloys are synthesized using metallic powders of Fe, Cr and Si by mechanical alloying method. X-Ray diffractions studies were performed to analyze the structural details of Fe2CrSi nanoparticles with High resolution scanning electron microscope (HRSEM) studies for the morphological details of nanoparticles and magnetic properties were studied using Vibrating sample magnetometer (VSM). XRD Data analysis conforms the Heusler alloy phase showing the existence of L21 structure. Magnetic properties are measured for synthesized samples exhibiting a soft magnetic property possessing low coercivity (HC = 60.5 Oe) and saturation magnetic moment of Fe2CrSi is 3.16 µB, which is significantly higher than the ideal value of 2 µB from the Slater-Pauling rule due to room temperature measurement. The change in magnetic properties are half-metallic nature of Fe2CrSi is due to the shift of the Fermi level with respect to the gap were can be used as spin sensors and spin injectors in magnetic random access memories and other spin dependent devices.

Method

Directory of Open Access Journals (Sweden)

Ling Fiona W.M.

2017-01-01

Full Text Available Rapid prototyping of microchannel gain lots of attention from researchers along with the rapid development of microfluidic technology. The conventional methods carried few disadvantages such as high cost, time consuming, required high operating pressure and temperature and involve expertise in operating the equipment. In this work, new method adapting xurography method is introduced to replace the conventional method of fabrication of microchannels. The novelty in this study is replacing the adhesion film with clear plastic film which was used to cut the design of the microchannel as the material is more suitable for fabricating more complex microchannel design. The microchannel was then mold using polymethyldisiloxane (PDMS and bonded with a clean glass to produce a close microchannel. The microchannel produced had a clean edge indicating good master mold was produced using the cutting plotter and the bonding between the PDMS and glass was good where no leakage was observed. The materials used in this method is cheap and the total time consumed is less than 5 hours where this method is suitable for rapid prototyping of microchannel.

Method Points: towards a metric for method complexity

Directory of Open Access Journals (Sweden)

Graham McLeod

1998-11-01

Full Text Available A metric for method complexity is proposed as an aid to choosing between competing methods, as well as in validating the effects of method integration or the products of method engineering work. It is based upon a generic method representation model previously developed by the author and adaptation of concepts used in the popular Function Point metric for system size. The proposed technique is illustrated by comparing two popular I.E. deliverables with counterparts in the object oriented Unified Modeling Language (UML. The paper recommends ways to improve the practical adoption of new methods.

Distorted wave models applied to electron emission study in ion-atom collisions at intermediate and high energies

International Nuclear Information System (INIS)

Fainstein, P.D.

1989-01-01

The electron emission from different atoms induced by impact of multicharged bare ions at intermediate and high energies is studied. To perform these studies, the continuum distorted wave-eikonal initial state model is used. With this distorted wave model, analytical expressions are obtained for the transition amplitudes as a function of the transverse momentum transfer for hydrogen targets in an arbitrary initial state and for every any orbital of a multielectronic target represented as a linear combination of Slater type orbitals. With these expressions, the different cross sections which are compared with the experimental data available are numerically calculated. The results obtained for different targets and projectiles and the comparison with other theoretical models and experimental data allows to explain the electron emission spectra and to predict new effects which have not been measured so far. The results of the present work permit to view the ionization process as the evolution of the active electron in the combined field of the target and projectile nuclei. (Author) [es

Temperature and pressure dependent structural and thermo-physical properties of quaternary CoVTiAl alloy

Science.gov (United States)

Yousuf, Saleem; Gupta, Dinesh C.

2017-09-01

Investigation of band structure and thermo-physical response of new quaternary CoVTiAl Heusler alloy within the frame work of density functional theory has been analyzed. 100% spin polarization with ferromagnetic stable ground state at the optimized lattice parameter of 6.01 Å is predicted for the compound. Slater-Pauling rule for the total magnetic moment of 3 μB and an indirect semiconducting behavior is also seen for the compound. In order to perfectly analyze the thermo-physical response, the lattice thermal conductivity and thermodynamic properties have been calculated. Thermal effects on some macroscopic properties of CoVTiAl are predicted using the quasi-harmonic Debye model, in which the lattice vibrations are taken into account. The variations of the lattice constant, volume expansion coefficient, heat capacities, and Debye temperature with pressure and temperature in the ranges of 0 GPa to 15 GPa and 0 K to 800 K have been obtained.

Exact exchange-correlation potential and approximate exchange potential in terms of density matrices

International Nuclear Information System (INIS)

Holas, A.; March, N.H.

1995-01-01

An exact expression in terms of density matrices (DM) is derived for δF[n]/δn(r), the functional derivative of the Hohenberg-Kohn functional. The derivation starts from the differential form of the virial theorem, obtained here for an electron system with arbitrary interactions, and leads to an expression taking the form of an integral over a path that can be chosen arbitrarily. After applying this approach to the equivalent system of noninteracting electrons (Slater-Kohn-Sham scheme) and combining the corresponding result with the previous one, an exact expression for the exchange-correlation potential v xc (r) is obtained which is analogous in character to that for δF[n]/δn(r), but involving, besides the interacting-system DMs, also the noninteracitng DMs. Equating the former DMs to the latter ones, we reduce the result for the exact v xc (r) to that for an approximate exchange-only potential v x (r). This leads naturally to the Harbola-Sahni exchange-only potential

Experimental and theoretical studies of the energy level structure of multiply charged many-electron ions

International Nuclear Information System (INIS)

Redfors, A.

1991-01-01

Magnesiumlike and aluminumlike spectra of the elements calcium - germanium have been obtained through the use of laser-produced plasmas (LPP) and a 3 m normal incidence vacuum spectrograph. The spectral analyses were mainly based on isoelectronic regularities. Intermediate ionization stages of cerium (Ce V) and silicon (SI VI) have also been studied. The light sources in these cases were a sliding spark and a modified version of the LPP. The Eagle spectrograph at the National Institute of Standards and Technology, Gaitherburg, Maryland was used to record the cerium spectrum. Ab initio calculations and least-squares fits of the Slater energy parameters to the experimental energy levels are reported for all investigated spectra. Theoretical predictions of oscillator strengths for Y III and Zr III in the region 1150-3200 AA are presented. The oscillator strengths are needed for abundance determinations of Y 2+ and Zr 2+ in chemically peculiar stars, Cp stars. (65 refs.)

Orientación al mercado que utilizan las Instituciones Prestadoras de Servicios de Salud (IPS en Florencia, Caquetá, Colombia

Directory of Open Access Journals (Sweden)

Fernando Penagos Guzmán

2017-06-01

Full Text Available esumen Este artículo pretende caracterizar los componentes de la orientación al mercado que utilizan las Instituciones Prestadoras de Servicios de Salud (IPS en Florencia. Como instrumentos de medida se aplicó el enfoque de Test de escalas con ítems Markor de Kohli y Jaworski, y el de Narver y Slater; permitiendo el análisis de la información empresarial y del sector. La propuesta se enmarcó en una forma de investigación cualitativa y cuantitativa, empleando técnicas e instrumentos como entrevista, encuesta, observación directa y fuentes documentales; sometida a la investigación exploratoria-descriptiva. Se concluye que la implementación del modelo y los componentes de orientación al mercado requieren de un gran conocimiento de la empresa, del entorno y sobre todo reconocerlo como generador de una cultura organizacional global, que permita alcanzar los resultados y beneficios con enfoque de largo plazo.

Fast-electron-impact study on excitations of 4p, 4s, and 3d electrons of krypton

International Nuclear Information System (INIS)

Yuan Zhensheng; Zhu Linfan; Liu Xiaojing; Li Wenbin; Cheng Huadong; Xu Kezun; Zhong Zhiping

2002-01-01

Absolute optical oscillator strength densities for the excitations of the electrons 4p, 4s, and 3d have been measured. Their absolute optical oscillator strengths have also been obtained. An enhancement above the 4p ionization threshold in the photoabsorption spectrum was assigned as a delayed maximum which arises from the photoionization process of 4p→εd according to present Dirac-Slater calculation. In the energy region of 4s autoionization, we have observed several features that are absent in previous fast-electron-impact work, but exist in optical measurements. We clarify this discrepancy here. Two Rydberg series of optically forbidden transitions, i.e., 4s -1 ns( 1 S) (n=5,6,7) and 4s -1 nd( 1 D) (n=4,5,6,7) have been observed when the spectrometer worked at conditions with larger momentum transfers, namely, K 2 =0.23 a.u. and 0.67 a.u. Furthermore, the absolute optical oscillator strengths for the 3d excitation have been obtained

Morphologic, magnetic, and Moessbauer spectral properties of Fe75Co25 nanoparticles prepared by ultrasound-assisted electrochemistry

International Nuclear Information System (INIS)

Mancier, Valerie; Delplancke, J.-L.; Delwiche, Jacques; Hubin-Franskin, M.-J.; Piquer, Cristina; Rebbouh, Leila; Grandjean, Fernande

2004-01-01

Nanopowders of Fe 75 Co 25 alloys have been prepared by ultrasound-assisted electrochemistry. Their composition, crystallographic structure, morphology, have been studied by X-ray diffraction, transmission electron microscopy, X-ray fluorescence, and high-energy electron diffraction. The nanopowders are found to present a composition well determined by the electrolyte bath composition, they show a bcc structure. The iron and cobalt atoms exhibit a very homogeneous distribution in the particles. The magnetic properties of the nanopowders have been measured between 5 and 295 K with a vibrating sample magnetometer and their Moessbauer spectra have been obtained at 295 K. The saturation magnetization is characteristic of FeCo alloys. The magnetic behavior and transmission electron microscopy observations of the particles indicate strongly interacting particles with a radius of ca. 2-4 nm, particles which may form agglomerates of larger size. The measured average hyperfine field is situated at the maximum of the Slater-Pauling curve for the FeCo alloys

The SU(r){sub 2} string functions as q-diagrams

Energy Technology Data Exchange (ETDEWEB)

Genish, Arel, E-mail: Arel.genish@weizmann.ac.il; Gepner, Doron, E-mail: Doron.gepner@weizmann.ac.il

2016-06-15

A generalized Roger Ramanujan (GRR) type expression for the characters of A-type parafermions has been a long standing puzzle dating back to conjectures made regarding some of the characters in the 90s. Not long ago we have put forward such GRR type identities describing any of the level two ADE-type generalized parafermions characters at any rank. These characters are the string functions of simply laced Lie algebras at level two, as such, they are also of mathematical interest. In our last joint paper we presented the complete derivation for the D-type generalized parafermions characters identities. Here we generalize our previous discussion and prove the GRR type expressions for the characters of A-type generalized parafermions. To prove the A-type GRR conjecture we study further the q-diagrams, introduced in our last joint paper, and examine the diagrammatic interpretations of known identities among them Slater identities for the characters of the first minimal model, which is the Ising model, and the Bailey lemma.

Modified Moliere's screening parameter and its impact on multiple coulomb scattering

International Nuclear Information System (INIS)

Striganov, Sergei

2015-01-01

The Moliere approximation of elastic Coulomb scattering cross-sections plays an important role in accurate description of multiple scattering, non-ionisation energy, DPA radiation damage etc. The cross-section depends only on a single parameter that describes the atomic screening. Moliere calculated the screening angle for the Tomas-Fermi distribution of electrons in atoms. In this paper, the screening parameter was recalculated using a more accurate atomic form-factor obtained from the self-consistent Dirac-Hartree-Fock-Slater computations. For relativistic particles, the new screening angle can differ from the Moliere approximation by up to 50%. At the same time, it is rather close to other independent calculations. At low energies, the new screening angle is different for positrons and electrons. The positron screening parameter is much larger than the electron one for heavy nuclei at energies of ∼Z keV. The impact of the screening angle on particle transport and calculated quantities is discussed. (authors)

NOSTALGIA, ANTICONSUMO SIMBÓLICO E BEM-ESTAR: A AGRICULTURA URBANA

Directory of Open Access Journals (Sweden)

Bruno Henrique Comasseto

2013-07-01

Full Text Available The establishment of a global consumption culture had as a consequence a growing concern with the impact of consumption practices on the environment, as well as on the general and personal well-being. In this context emerges the urban agriculture (UA associated to environmental, social and health benefits (SLATER, 2001. The objective of this study is to understand the meaning of the UA phenomenon as a consumption practice, identifying which theories are related to it. In order to reach that goal, a qualitative research used as data collection in-depth interviews. The subjects were experts and practitioners in UA living in 9 neighborhoods in urban areas of a Brazilian city with a population bigger than 1 million inhabitants. Results showed double motivation for the UA practice, extrinsic (example and intrinsic (well-being, linking the UA to environmental concerns, to health and well-being, and the respect and pride for a nostalgic cultural heritage.

Stiffness-constant variation in nickel-based alloys: Experiment and theory

International Nuclear Information System (INIS)

Hennion, M.; Hennion, B.

1979-01-01

Recent measurements of the spin-wave stiffness constant in several nickel alloys at various concentrations are interpreted within a random-phase approximation, coherent-potential approximation (RPA-CPA) band model which uses the Hartree-Fock approximation to treat the intraatomic correlations. We give a theoretical description of the possible impurity states in the Hartree-Fock approximation. This allows the determination of the Hartree-Fock solutions which can account for the stiffness-constant behavior and the magnetic moment on the impurity for all the investigated alloys. For alloys such as NiCr, NiV, NiMo, and NiRu, the magnetizations of which deviate from the Slater-Pauling curve, our determination does not correspond to previous works and is consequently discussed. The limits of the model appear mainly due to local-environment effects; in the case of NiMn, it is found that a ternary-alloy model with some Mn atoms in the antiferromagnetic state can account for both stiffness-constant and magnetization behaviors

Energy levels of 4f3 in the Nd3+ free ion from emission spectra

International Nuclear Information System (INIS)

Wyart, Jean-Francois; Meftah, Ali; Bachelier, Annik; Sinzelle, Jocelyne; Tchang-Brillet, Wan-Ue Lydia; Champion, Norbert; Spector, Nissan; Sugar, Jack

2006-01-01

The emission spectrum of neodymium produced by vacuum spark sources was observed in the vacuum ultraviolet on two normal-incidence spectrographs. In an initial result, more than 550 lines have been identified as transitions from 85 4f 2 5d levels to 37 levels of the 4f 3 ground configuration in the free ion Nd 3+ . The levels 4f 34 F 3/2 and 4 I 11/2 , responsible for the well-known 1064 nm laser line, have respective positions of 11 698.57 ±0.1 cm -1 and 1897.07 ±0.1 cm -1 above the ground level 4 I 9/2 . The newly found levels of 4f 3 constitute the first isolated 4f N configuration (N > 2) and therefore enable checks of effective parameters that represent far configuration interaction. Slater parameters F k (4f, 4f) derived from Nd 3+ :LaCl 3 are 3% to 5% smaller than in the free ion. (letter to the editor)

CARACTERÍSTICAS DE LA PRÁCTICA FÍSICO-DEPORTIVA DEL ALUMNADO CON DISCAPACIDAD DE LA UNIVERSITAT DE VALÈNCIA

Directory of Open Access Journals (Sweden)

Joan Úbeda Colomer

2015-04-01

Full Text Available En la actualidad, la actividad físico-deportiva es fundamental para las personas con discapacidad debido a los múltiples beneficios físicos, psicológicos y sociales que aporta (Patel y Greydanus, 2010; Slater y Meade, 2004. Estudiar las características de la práctica físico-deportiva de este colectivo puede ser útil para poder desarrollar estrategias y programas que mejoren y aumenten dicha práctica (Bragaru, van Wilgen, Geertzen, Ruijs, Dijsktra y Dekker, 2013. Pese a ello, apenas existen estudios de carácter cuantitativo sobre el tema. Objetivo: De acuerdo con las carencias señaladas, el objetivo de este trabajo es identificar la cuantía de la práctica físico-deportiva del alumnado con discapacidad de la Universitat de València (UV, así como algunas características y pautas relacionadas con la misma.

The SU(r)_2 string functions as q-diagrams

International Nuclear Information System (INIS)

Genish, Arel; Gepner, Doron

2016-01-01

A generalized Roger Ramanujan (GRR) type expression for the characters of A-type parafermions has been a long standing puzzle dating back to conjectures made regarding some of the characters in the 90s. Not long ago we have put forward such GRR type identities describing any of the level two ADE-type generalized parafermions characters at any rank. These characters are the string functions of simply laced Lie algebras at level two, as such, they are also of mathematical interest. In our last joint paper we presented the complete derivation for the D-type generalized parafermions characters identities. Here we generalize our previous discussion and prove the GRR type expressions for the characters of A-type generalized parafermions. To prove the A-type GRR conjecture we study further the q-diagrams, introduced in our last joint paper, and examine the diagrammatic interpretations of known identities among them Slater identities for the characters of the first minimal model, which is the Ising model, and the Bailey lemma.

Calculation of self-consistent potentials for substitutionally disordered systems with application to the Ag/sub x/-Pd/sub 1-x/ alloy series

International Nuclear Information System (INIS)

Winter, H.; Stocks, G.M.

1983-01-01

Previous Korringa-Kohn-Rostoker coherent-potential-approximation electronic-structure calculations for substitutionally random alloys have been based on ad hoc potentials. The lack of procedures suitable to provide self-consistent, parameter-free potentials prevented computations for systems consisting of dissimilar atoms and is also the reason why quantities like, for example, cohesive energies or lattice constants, have not so far been evaluated for systems of similar constituents. We present in full detail a generally applicable scheme devised for calculating the self-consistent electronic structures of substitutionally disordered systems. Its feasibility is demonstrated by presenting the results obtained for the Ag/sub x/Pd/sub 1-x/ alloy series. They are compared with those of former non-self-consistent calculations which use Mattheiss prescription potentials and the α = 1 Slater exchange, whereas the von Barth--Hedin expression is employed in our work. The differences are perceptible and have to be understood as combined self-consistency and exchange-correlation effects. .ID BW2039 .PG 905 909

Bioenergetics molecular biology, biochemistry, and pathology

CERN Document Server

Ozawa, Takayuki

1990-01-01

The emergence of the Biochemical Sciences is underlined by the FAOB symposium in Seoul and highlighted by this Satellite meeting on the "New Bioenergetics. " Classical mitochondrial electron transfer and energy coupling is now complemented by the emerging molecular biology of the respiratory chain which is studied hand in hand with the recognition of mitochondrial disease as a major and emerging study in the basic and clinical medical sciences. Thus, this symposium has achieved an important balance of the fundamental and applied aspects of bioenergetics in the modern setting of molecular biology and mitochondrial disease. At the same time, the symposium takes note not only of the emerging excellence of Biochemical Studies in the Orient and indeed in Korea itself, but also retrospectively enjoys the history of electron transport and energy conservation as represented by the triumvirate ofYagi, King and Slater. Many thanks are due Drs. Kim and Ozawa for their elegant organization of this meeting and its juxtapo...

Efficient construction of exchange and correlation potentials by inverting the Kohn-Sham equations.

Science.gov (United States)

Kananenka, Alexei A; Kohut, Sviataslau V; Gaiduk, Alex P; Ryabinkin, Ilya G; Staroverov, Viktor N

2013-08-21

Given a set of canonical Kohn-Sham orbitals, orbital energies, and an external potential for a many-electron system, one can invert the Kohn-Sham equations in a single step to obtain the corresponding exchange-correlation potential, vXC(r). For orbitals and orbital energies that are solutions of the Kohn-Sham equations with a multiplicative vXC(r) this procedure recovers vXC(r) (in the basis set limit), but for eigenfunctions of a non-multiplicative one-electron operator it produces an orbital-averaged potential. In particular, substitution of Hartree-Fock orbitals and eigenvalues into the Kohn-Sham inversion formula is a fast way to compute the Slater potential. In the same way, we efficiently construct orbital-averaged exchange and correlation potentials for hybrid and kinetic-energy-density-dependent functionals. We also show how the Kohn-Sham inversion approach can be used to compute functional derivatives of explicit density functionals and to approximate functional derivatives of orbital-dependent functionals.

FEAST fundamental framework for electronic structure calculations: Reformulation and solution of the muffin-tin problem

Science.gov (United States)

Levin, Alan R.; Zhang, Deyin; Polizzi, Eric

2012-11-01

In a recent article Polizzi (2009) [15], the FEAST algorithm has been presented as a general purpose eigenvalue solver which is ideally suited for addressing the numerical challenges in electronic structure calculations. Here, FEAST is presented beyond the “black-box” solver as a fundamental modeling framework which can naturally address the original numerical complexity of the electronic structure problem as formulated by Slater in 1937 [3]. The non-linear eigenvalue problem arising from the muffin-tin decomposition of the real-space domain is first derived and then reformulated to be solved exactly within the FEAST framework. This new framework is presented as a fundamental and practical solution for performing both accurate and scalable electronic structure calculations, bypassing the various issues of using traditional approaches such as linearization and pseudopotential techniques. A finite element implementation of this FEAST framework along with simulation results for various molecular systems is also presented and discussed.

Handbook of the band structure of elemental solids from Z = 1 to Z = 112

CERN Document Server

Papaconstantopoulos, Dimitris A

2015-01-01

This handbook presents electronic structure data and tabulations of Slater-Koster parameters for the whole periodic table. This second edition presents data sets for all elements up to Z = 112, Copernicium, whereas the first edition contained only 53 elements. In this new edition, results are given for the equation of state of the elements together with the parameters of a Birch fit, so that the reader can regenerate the results and derive additional information, such as Pressure-Volume relations and variation of Bulk Modulus with Pressure. For each element, in addition to the equation of state, the energy bands, densities of states, and a set of tight-binding parameters is provided. For a majority of elements, the tight-binding parameters are presented for both a two- and three-center approximation. For the hcp structure, new three-center tight-binding results are given. Other new material in this edition include: energy bands and densities of states of all rare-earth metals, a discussion of the McMillan-Gas...

BDF-methods

DEFF Research Database (Denmark)

Hostrup, Astrid Kuijers

1999-01-01

An introduction to BDF-methods is given. The use of these methods on differential algebraic equations (DAE's) with different indexes with respect to order, stability and convergens of the BDF-methods is presented.......An introduction to BDF-methods is given. The use of these methods on differential algebraic equations (DAE's) with different indexes with respect to order, stability and convergens of the BDF-methods is presented....

Methods for evaluating imaging methods of limited reproducibility

International Nuclear Information System (INIS)

Krummenauer, F.

2005-01-01

Just like new drugs, new or modified imaging methods must be subjected to objective clinical tests, including tests on humans. In this, it must be ensured that the principle of Good Clinical Practice (GCP) are followed with regard to medical, administrative and methodical quality. Innovative methods fo clinical epidemiology and medical biometry should be applied from the planning stage to the final statistical evaluation. The author presents established and new methods for planning, evaluation and reporting of clinical tests of diagnostic methods, and especially imaging methods, in clinical medicine and illustrates these by means of current research projects in the various medical disciplines. The strategies presented are summarized in a recommendation based on the concept of phases I - IV of clinical drug testing in order to enable standardisation of the clinical evaluation of imaging methods. (orig.)

Distillation methods

International Nuclear Information System (INIS)

Konecny, C.

1975-01-01

Two main methods of separation using the distillation method are given and evaluated, namely evaporation and distillation in carrier gas flow. Two basic apparatus are described for illustrating the methods used. The use of the distillation method in radiochemistry is documented by a number of examples of the separation of elements in elemental state, volatile halogenides and oxides. Tables give a survey of distillation methods used for the separation of the individual elements and give conditions under which this separation takes place. The suitability of the use of distillation methods in radiochemistry is discussed with regard to other separation methods. (L.K.)

Mining Method

Energy Technology Data Exchange (ETDEWEB)

Kim, Young Shik; Lee, Kyung Woon; Kim, Oak Hwan; Kim, Dae Kyung [Korea Institute of Geology Mining and Materials, Taejon (Korea, Republic of)

1996-12-01

The reducing coal market has been enforcing the coal industry to make exceptional rationalization and restructuring efforts since the end of the eighties. To the competition from crude oil and natural gas has been added the growing pressure from rising wages and rising production cost as the workings get deeper. To improve the competitive position of the coal mines against oil and gas through cost reduction, studies to improve mining system have been carried out. To find fields requiring improvements most, the technologies using in Tae Bak Colliery which was selected one of long running mines were investigated and analyzed. The mining method appeared the field needing improvements most to reduce the production cost. The present method, so-called inseam roadway caving method presently is using to extract the steep and thick seam. However, this method has several drawbacks. To solve the problems, two mining methods are suggested for a long term and short term method respectively. Inseam roadway caving method with long-hole blasting method is a variety of the present inseam roadway caving method modified by replacing timber sets with steel arch sets and the shovel loaders with chain conveyors. And long hole blasting is introduced to promote caving. And pillar caving method with chock supports method uses chock supports setting in the cross-cut from the hanging wall to the footwall. Two single chain conveyors are needed. One is installed in front of chock supports to clear coal from the cutting face. The other is installed behind the supports to transport caved coal from behind. This method is superior to the previous one in terms of safety from water-inrushes, production rate and productivity. The only drawback is that it needs more investment. (author). 14 tabs., 34 figs.

Perturbation methods

CERN Document Server

Nayfeh, Ali H

2008-01-01

1. Introduction 1 2. Straightforward Expansions and Sources of Nonuniformity 23 3. The Method of Strained Coordinates 56 4. The Methods of Matched and Composite Asymptotic Expansions 110 5. Variation of Parameters and Methods of Averaging 159 6. The Method of Multiple Scales 228 7. Asymptotic Solutions of Linear Equations 308 References and Author Index 387 Subject Index 417

A Novel Polygonal Finite Element Method: Virtual Node Method

Science.gov (United States)

Tang, X. H.; Zheng, C.; Zhang, J. H.

2010-05-01

Polygonal finite element method (PFEM), which can construct shape functions on polygonal elements, provides greater flexibility in mesh generation. However, the non-polynomial form of traditional PFEM, such as Wachspress method and Mean Value method, leads to inexact numerical integration. Since the integration technique for non-polynomial functions is immature. To overcome this shortcoming, a great number of integration points have to be used to obtain sufficiently exact results, which increases computational cost. In this paper, a novel polygonal finite element method is proposed and called as virtual node method (VNM). The features of present method can be list as: (1) It is a PFEM with polynomial form. Thereby, Hammer integral and Gauss integral can be naturally used to obtain exact numerical integration; (2) Shape functions of VNM satisfy all the requirements of finite element method. To test the performance of VNM, intensive numerical tests are carried out. It found that, in standard patch test, VNM can achieve significantly better results than Wachspress method and Mean Value method. Moreover, it is observed that VNM can achieve better results than triangular 3-node elements in the accuracy test.

Extension of the Kohn-Sham formulation of density functional theory to finite temperature

Science.gov (United States)

Gonis, A.; Däne, M.

2018-05-01

Based on Mermin's extension of the Hohenberg and Kohn theorems to non-zero temperature, the Kohn-Sham formulation of density functional theory (KS-DFT) is generalized to finite temperature. We show that present formulations are inconsistent with Mermin's functional containing expressions, in particular describing the Coulomb energy, that defy derivation and are even in violation of rules of logical inference. More; current methodology is in violation of fundamental laws of both quantum and classical mechanics. Based on this feature, we demonstrate the impossibility of extending the KS formalism to finite temperature through the self-consistent solutions of the single-particle Schrödinger equation of T > 0. Guided by the form of Mermin's functional that depends on the eigenstates of a Hamiltonian, determined at T = 0, we base our extension of KS-DFT on the determination of the excited states of a non-interacting system at the zero of temperature. The resulting formulation is consistent with that of Mermin constructing the free energy at T > 0 in terms of the excited states of a non-interacting Hamiltonian (system) that, within the KS formalism, are described by Slater determinants. To determine the excited states at T = 0 use is made of the extension of the Hohenberg and Kohn theorems to excited states presented in previous work applied here to a non-interacting collection of replicas of a non-interacting N-particle system, whose ground state density is taken to match that of K non-interacting replicas of an interacting N-particle system at T = 0 . The formalism allows for an ever denser population of the excitation spectrum of a Hamiltonian, within the KS approximation. The form of the auxiliary potential, (Kohn-Sham potential), is formally identical to that in the ground state formalism with the contribution of the Coulomb energy provided by the derivative of the Coulomb energy in all excited states taken into account. Once the excited states are determined, the

Method Engineering: Engineering of Information Systems Development Methods and Tools

NARCIS (Netherlands)

Brinkkemper, J.N.; Brinkkemper, Sjaak

1996-01-01

This paper proposes the term method engineering for the research field of the construction of information systems development methods and tools. Some research issues in method engineering are identified. One major research topic in method engineering is discussed in depth: situational methods, i.e.

Enhancing the (MSLDIP) image steganographic method (ESLDIP method)

Science.gov (United States)

Seddik Saad, Al-hussien

2011-10-01

Message transmissions over the Internet still have data security problem. Therefore, secure and secret communication methods are needed for transmitting messages over the Internet. Cryptography scrambles the message so that it cannot be understood. However, it makes the message suspicious enough to attract eavesdropper's attention. Steganography hides the secret message within other innocuous-looking cover files (i.e. images, music and video files) so that it cannot be observed [1].The term steganography originates from the Greek root words "steganos'' and "graphein'' which literally mean "covered writing''. It is defined as the science that involves communicating secret data in an appropriate multimedia carrier, e.g., image, audio text and video files [3].Steganographic techniques allow one party to communicate information to another without a third party even knowing that the communication is occurring. The ways to deliver these "secret messages" vary greatly [3].Our proposed method called Enhanced SLDIP (ESLDIP). In which the maximmum hiding capacity (MHC) of proposed ESLDIP method is higher than the previously proposed MSLDIP methods and the PSNR of the ESLDIP method is higher than the MSLDIP PSNR values', which means that the image quality of the ESLDIP method will be better than MSLDIP method and the maximmum hiding capacity (MHC) also improved. The rest of this paper is organized as follows. In section 2, steganography has been discussed; lingo, carriers and types. In section 3, related works are introduced. In section 4, the proposed method will be discussed in details. In section 5, the simulation results are given and Section 6 concludes the paper.

Method Engineering: Engineering of Information Systems Development Methods and Tools

OpenAIRE

Brinkkemper, J.N.; Brinkkemper, Sjaak

1996-01-01

This paper proposes the term method engineering for the research field of the construction of information systems development methods and tools. Some research issues in method engineering are identified. One major research topic in method engineering is discussed in depth: situational methods, i.e. the configuration of a project approach that is tuned to the project at hand. A language and support tool for the engineering of situational methods are discussed.

Numerical Methods for Stochastic Computations A Spectral Method Approach

CERN Document Server

Xiu, Dongbin

2010-01-01

The first graduate-level textbook to focus on fundamental aspects of numerical methods for stochastic computations, this book describes the class of numerical methods based on generalized polynomial chaos (gPC). These fast, efficient, and accurate methods are an extension of the classical spectral methods of high-dimensional random spaces. Designed to simulate complex systems subject to random inputs, these methods are widely used in many areas of computer science and engineering. The book introduces polynomial approximation theory and probability theory; describes the basic theory of gPC meth

Mining method selection by integrated AHP and PROMETHEE method.

Science.gov (United States)

Bogdanovic, Dejan; Nikolic, Djordje; Ilic, Ivana

2012-03-01

Selecting the best mining method among many alternatives is a multicriteria decision making problem. The aim of this paper is to demonstrate the implementation of an integrated approach that employs AHP and PROMETHEE together for selecting the most suitable mining method for the "Coka Marin" underground mine in Serbia. The related problem includes five possible mining methods and eleven criteria to evaluate them. Criteria are accurately chosen in order to cover the most important parameters that impact on the mining method selection, such as geological and geotechnical properties, economic parameters and geographical factors. The AHP is used to analyze the structure of the mining method selection problem and to determine weights of the criteria, and PROMETHEE method is used to obtain the final ranking and to make a sensitivity analysis by changing the weights. The results have shown that the proposed integrated method can be successfully used in solving mining engineering problems.

Observation of a Slater-type metal-to-insulator transition in Sr$_2$IrO$_4$ from time-resolved photo-carrier dynamics

OpenAIRE

Hsieh, D.; Mahmood, F.; Torchinsky, D. H.; Cao, G.; Gedik, N.

2012-01-01

We perform a time-resolved optical study of Sr$_2$IrO$_4$ to understand the influence of magnetic ordering on the low energy electronic structure of a strongly spin-orbit coupled $J_{eff}$=1/2 Mott insulator. By studying the recovery dynamics of photo-carriers excited across the Mott gap, we find that upon cooling through the N\\'{e}el temperature $T_N$ the system evolves continuously from a metal-like phase with fast ($\\sim$50 fs) and excitation density independent relaxation dynamics to a ga...

A Pattern-Oriented Approach to a Methodical Evaluation of Modeling Methods

Directory of Open Access Journals (Sweden)

Michael Amberg

1996-11-01

Full Text Available The paper describes a pattern-oriented approach to evaluate modeling methods and to compare various methods with each other from a methodical viewpoint. A specific set of principles (the patterns is defined by investigating the notations and the documentation of comparable modeling methods. Each principle helps to examine some parts of the methods from a specific point of view. All principles together lead to an overall picture of the method under examination. First the core ("method neutral" meaning of each principle is described. Then the methods are examined regarding the principle. Afterwards the method specific interpretations are compared with each other and with the core meaning of the principle. By this procedure, the strengths and weaknesses of modeling methods regarding methodical aspects are identified. The principles are described uniformly using a principle description template according to descriptions of object oriented design patterns. The approach is demonstrated by evaluating a business process modeling method.

Maintenance methods

International Nuclear Information System (INIS)

Sanchis, H.; Aucher, P.

1990-01-01

The maintenance method applied at the Hague is summarized. The method was developed in order to solve problems relating to: the different specialist fields, the need for homogeneity in the maintenance work, the equipment diversity, the increase of the materials used at the Hague's new facilities. The aim of the method is to create a knowhow formalism, to facilitate maintenance, to ensure the running of the operations and to improve the estimation of the maintenance cost. One of the method's difficulties is the demonstration of the profitability of the maintenance operations [fr

BASIC METHODS OF CLASSIFICATION AND CHARACTERISTICS OF METHODS OF PRICING IN UKRAINE

Directory of Open Access Journals (Sweden)

A. Boguslavskiy

2014-12-01

Full Text Available The article provided definitions and shows the need to use different methods of pricing of enterprises. Exposed the reasons of the absence of a universal classification of pricing methods. The approaches of different authors to classify groups of pricing methods: 1 the cost method; 2 methods with a focus on competition; 3 methods for pricing based on demand, 4 pricing with a focus on maximum profit, 5 parametric methods, 6 pricing under risk and uncertainty, etc. An improved classification pricing methods with the release of the following groups: 1 the methods of cost pricing; 2 methods based on demand; 3 methods, based on competition; 4 microeconomic methods; 5 methods which are based on product life cycles; 6 methods, depending on economic conditions; 7 econometric and statistical techniques 8 Methods of transfer pricing; 9 methods in accordance with the terms of agreements; 10 Methods of assortment pricing; 11 combined methods of pricing and so on. The basic directions of use of combined methods of pricing and analysis of their possible use in Ukraine are shown.

Comparative law as method and the method of comparative law

NARCIS (Netherlands)

Hage, J.C.; Adams, M.; Heirbaut, D.

2014-01-01

This article addresses both the justificatory role of comparative law within legal research (comparative law as method) and the method of comparative law itself. In this connection two questions will be answered: 1. Is comparative law a method, or a set of methods, for legal research? 2. Does

Safety training for working youth: Methods used versus methods wanted.

Science.gov (United States)

Zierold, Kristina M

2016-04-07

Safety training is promoted as a tool to prevent workplace injury; however, little is known about the safety training experiences young workers get on-the-job. Furthermore, nothing is known about what methods they think would be the most helpful for learning about safe work practices. To compare safety training methods teens get on the job to those safety training methods teens think would be the best for learning workplace safety, focusing on age differences. A cross-sectional survey was administered to students in two large high schools in spring 2011. Seventy percent of working youth received safety training. The top training methods that youth reported getting at work were safety videos (42%), safety lectures (25%), and safety posters/signs (22%). In comparison to the safety training methods used, the top methods youth wanted included videos (54%), hands-on (47%), and on-the-job demonstrations (34%). This study demonstrated that there were differences in training methods that youth wanted by age; with older youth seemingly wanting more independent methods of training and younger teens wanting more involvement. Results indicate that youth want methods of safety training that are different from what they are getting on the job. The differences in methods wanted by age may aid in developing training programs appropriate for the developmental level of working youth.

Hearing shapes of few electrons quantum drums: A configuration–interaction study

International Nuclear Information System (INIS)

Ţolea, F.; Ţolea, M.

2015-01-01

The – highly remarkable – existence of non-congruent yet vibrationally isospectral shapes has been first proved theoretically and then also tested experimentally – by using electromagnetic waves in cavities, vibrating smectic films or electrons in nanostructures. In this context, we address the question whether isospectrality holds if two or more electrons interact electrostatically, using the accurate configuration–interaction method, in a discrete representation of the Bilby and Hawk shapes. Isospectral pairs offer an unique possibility to test how identical sets of single-particle energies may combine differently in the few-electrons eigenmodes, due to different wave functions spatial distributions. Our results point towards the break down of isospectrality in the presence of interactions. Thus one should be able to ”hear” the shapes of few electrons quantum drums. Interestingly however, for the analyzed two and three electrons cases, there exists an interaction strength (which can be tuned by changing the size of the shapes), for which the ground states energies of Bilby and Hawk coincide, but not the excited states as well. Wigner localization is studied and shown to occur at about the same size for both Bilby and Hawk shapes. Next, an exercise is proposed to use the two-electrons charge density of the Bilby and Hawk ground states in the phase extraction scheme as proposed by Moon et al. (2008). Results show that out-of-phase regions appear if the linear size of the shapes exceeds the Bohr radius as occupation of higher Slater determinants becomes significant

Hearing shapes of few electrons quantum drums: A configuration–interaction study

Energy Technology Data Exchange (ETDEWEB)

Ţolea, F.; Ţolea, M., E-mail: tzolea@infim.ro

2015-02-01

The – highly remarkable – existence of non-congruent yet vibrationally isospectral shapes has been first proved theoretically and then also tested experimentally – by using electromagnetic waves in cavities, vibrating smectic films or electrons in nanostructures. In this context, we address the question whether isospectrality holds if two or more electrons interact electrostatically, using the accurate configuration–interaction method, in a discrete representation of the Bilby and Hawk shapes. Isospectral pairs offer an unique possibility to test how identical sets of single-particle energies may combine differently in the few-electrons eigenmodes, due to different wave functions spatial distributions. Our results point towards the break down of isospectrality in the presence of interactions. Thus one should be able to ”hear” the shapes of few electrons quantum drums. Interestingly however, for the analyzed two and three electrons cases, there exists an interaction strength (which can be tuned by changing the size of the shapes), for which the ground states energies of Bilby and Hawk coincide, but not the excited states as well. Wigner localization is studied and shown to occur at about the same size for both Bilby and Hawk shapes. Next, an exercise is proposed to use the two-electrons charge density of the Bilby and Hawk ground states in the phase extraction scheme as proposed by Moon et al. (2008). Results show that out-of-phase regions appear if the linear size of the shapes exceeds the Bohr radius as occupation of higher Slater determinants becomes significant.

The Monte Carlo method the method of statistical trials

CERN Document Server

Shreider, YuA

1966-01-01

The Monte Carlo Method: The Method of Statistical Trials is a systematic account of the fundamental concepts and techniques of the Monte Carlo method, together with its range of applications. Some of these applications include the computation of definite integrals, neutron physics, and in the investigation of servicing processes. This volume is comprised of seven chapters and begins with an overview of the basic features of the Monte Carlo method and typical examples of its application to simple problems in computational mathematics. The next chapter examines the computation of multi-dimensio

Catalysts, methods of making catalysts, and methods of use

KAUST Repository

Renard, Laetitia; El Eter, Mohamad; Caps, Valerie; Basset, Jean-Marie

2014-01-01

Embodiments of the present disclosure provide for catalysts, methods of making catalysts, methods of using catalysts, and the like. In an embodiment, the method of making the catalysts can be performed in a single step with a metal nanoparticle precursor and a metal oxide precursor, where a separate stabilizing agent is not needed.

Catalysts, methods of making catalysts, and methods of use

KAUST Repository

Renard, Laetitia

2014-03-06

Embodiments of the present disclosure provide for catalysts, methods of making catalysts, methods of using catalysts, and the like. In an embodiment, the method of making the catalysts can be performed in a single step with a metal nanoparticle precursor and a metal oxide precursor, where a separate stabilizing agent is not needed.

A comparison of Ki-67 counting methods in luminal Breast Cancer: The Average Method vs. the Hot Spot Method.

Science.gov (United States)

Jang, Min Hye; Kim, Hyun Jung; Chung, Yul Ri; Lee, Yangkyu; Park, So Yeon

2017-01-01

In spite of the usefulness of the Ki-67 labeling index (LI) as a prognostic and predictive marker in breast cancer, its clinical application remains limited due to variability in its measurement and the absence of a standard method of interpretation. This study was designed to compare the two methods of assessing Ki-67 LI: the average method vs. the hot spot method and thus to determine which method is more appropriate in predicting prognosis of luminal/HER2-negative breast cancers. Ki-67 LIs were calculated by direct counting of three representative areas of 493 luminal/HER2-negative breast cancers using the two methods. We calculated the differences in the Ki-67 LIs (ΔKi-67) between the two methods and the ratio of the Ki-67 LIs (H/A ratio) of the two methods. In addition, we compared the performance of the Ki-67 LIs obtained by the two methods as prognostic markers. ΔKi-67 ranged from 0.01% to 33.3% and the H/A ratio ranged from 1.0 to 2.6. Based on the receiver operating characteristic curve method, the predictive powers of the KI-67 LI measured by the two methods were similar (Area under curve: hot spot method, 0.711; average method, 0.700). In multivariate analysis, high Ki-67 LI based on either method was an independent poor prognostic factor, along with high T stage and node metastasis. However, in repeated counts, the hot spot method did not consistently classify tumors into high vs. low Ki-67 LI groups. In conclusion, both the average and hot spot method of evaluating Ki-67 LI have good predictive performances for tumor recurrence in luminal/HER2-negative breast cancers. However, we recommend using the average method for the present because of its greater reproducibility.

A comparison of Ki-67 counting methods in luminal Breast Cancer: The Average Method vs. the Hot Spot Method.

Directory of Open Access Journals (Sweden)

Min Hye Jang

Full Text Available In spite of the usefulness of the Ki-67 labeling index (LI as a prognostic and predictive marker in breast cancer, its clinical application remains limited due to variability in its measurement and the absence of a standard method of interpretation. This study was designed to compare the two methods of assessing Ki-67 LI: the average method vs. the hot spot method and thus to determine which method is more appropriate in predicting prognosis of luminal/HER2-negative breast cancers. Ki-67 LIs were calculated by direct counting of three representative areas of 493 luminal/HER2-negative breast cancers using the two methods. We calculated the differences in the Ki-67 LIs (ΔKi-67 between the two methods and the ratio of the Ki-67 LIs (H/A ratio of the two methods. In addition, we compared the performance of the Ki-67 LIs obtained by the two methods as prognostic markers. ΔKi-67 ranged from 0.01% to 33.3% and the H/A ratio ranged from 1.0 to 2.6. Based on the receiver operating characteristic curve method, the predictive powers of the KI-67 LI measured by the two methods were similar (Area under curve: hot spot method, 0.711; average method, 0.700. In multivariate analysis, high Ki-67 LI based on either method was an independent poor prognostic factor, along with high T stage and node metastasis. However, in repeated counts, the hot spot method did not consistently classify tumors into high vs. low Ki-67 LI groups. In conclusion, both the average and hot spot method of evaluating Ki-67 LI have good predictive performances for tumor recurrence in luminal/HER2-negative breast cancers. However, we recommend using the average method for the present because of its greater reproducibility.

Radiochemistry methods in DOE methods for evaluating environmental and waste management samples

International Nuclear Information System (INIS)

Fadeff, S.K.; Goheen, S.C.

1994-08-01

Current standard sources of radiochemistry methods are often inappropriate for use in evaluating US Department of Energy environmental and waste management (DOE/EW) samples. Examples of current sources include EPA, ASTM, Standard Methods for the Examination of Water and Wastewater and HASL-300. Applicability of these methods is limited to specific matrices (usually water), radiation levels (usually environmental levels), and analytes (limited number). Radiochemistry methods in DOE Methods for Evaluating Environmental and Waste Management Samples (DOE Methods) attempt to fill the applicability gap that exists between standard methods and those needed for DOE/EM activities. The Radiochemistry chapter in DOE Methods includes an ''analysis and reporting'' guidance section as well as radiochemistry methods. A basis for identifying the DOE/EM radiochemistry needs is discussed. Within this needs framework, the applicability of standard methods and targeted new methods is identified. Sources of new methods (consolidated methods from DOE laboratories and submissions from individuals) and the methods review process will be discussed. The processes involved in generating consolidated methods add editing individually submitted methods will be compared. DOE Methods is a living document and continues to expand by adding various kinds of methods. Radiochemistry methods are highlighted in this paper. DOE Methods is intended to be a resource for methods applicable to DOE/EM problems. Although it is intended to support DOE, the guidance and methods are not necessarily exclusive to DOE. The document is available at no cost through the Laboratory Management Division of DOE, Office of Technology Development

METHODS IN THE POST-METHODS ERA. REPORT ON AN INTERNATIONAL SURVEY ON LANGUAGE TEACHING METHODS'

Directory of Open Access Journals (Sweden)

Jun Liu

2004-06-01

Full Text Available Do methods still have a place in 21" century language teaching? To answer this question, an international survey was conducted in the surnmer of 1999. A sample of 800 language teachers world-wide randomly drawn from 17,800 TESOLers were each given a 2-page survey. The return rate was 58.5% with the actual usable data set of448, which was analyzed by using both descriptive and inferential statistics. Among the ten commonly recognized teaching methods surveyed, both the Communicative Language Teaching Approach and an eclectic method seem to have the highest rate in familiarity, preference, and use. But when multiple factors, such as teaching contexts, instructional settings, learners' proficiency levels, class size, teaching experience and educational backgrounds of the teachers, and the status of being a native or nonnative English speaking professional were taken into consideration, various patterns and themes emerged. One interesting finding is that Grammar Translation is still used in EFL contexts, in larger classes, and with learners at low proficiency levels, though the ratio between the actual use of this method and teachers' preference does not match. Based on the results of the survey, a new theoretical framework is proposed to conceptualize language teaching methods in the post-methods era.

A nodal method based on matrix-response method

International Nuclear Information System (INIS)

Rocamora Junior, F.D.; Menezes, A.

1982-01-01

A nodal method based in the matrix-response method, is presented, and its application to spatial gradient problems, such as those that exist in fast reactors, near the core - blanket interface, is investigated. (E.G.) [pt

A Monte Carlo method and finite volume method coupled optical simulation method for parabolic trough solar collectors

International Nuclear Information System (INIS)

Liang, Hongbo; Fan, Man; You, Shijun; Zheng, Wandong; Zhang, Huan; Ye, Tianzhen; Zheng, Xuejing

2017-01-01

Highlights: •Four optical models for parabolic trough solar collectors were compared in detail. •Characteristics of Monte Carlo Method and Finite Volume Method were discussed. •A novel method was presented combining advantages of different models. •The method was suited to optical analysis of collectors with different geometries. •A new kind of cavity receiver was simulated depending on the novel method. -- Abstract: The PTC (parabolic trough solar collector) is widely used for space heating, heat-driven refrigeration, solar power, etc. The concentrated solar radiation is the only energy source for a PTC, thus its optical performance significantly affects the collector efficiency. In this study, four different optical models were constructed, validated and compared in detail. On this basis, a novel coupled method was presented by combining advantages of these models, which was suited to carry out a mass of optical simulations of collectors with different geometrical parameters rapidly and accurately. Based on these simulation results, the optimal configuration of a collector with highest efficiency can be determined. Thus, this method was useful for collector optimization and design. In the four models, MCM (Monte Carlo Method) and FVM (Finite Volume Method) were used to initialize photons distribution, as well as CPEM (Change Photon Energy Method) and MCM were adopted to describe the process of reflecting, transmitting and absorbing. For simulating reflection, transmission and absorption, CPEM was more efficient than MCM, so it was utilized in the coupled method. For photons distribution initialization, FVM saved running time and computation effort, whereas it needed suitable grid configuration. MCM only required a total number of rays for simulation, whereas it needed higher computing cost and its results fluctuated in multiple runs. In the novel coupled method, the grid configuration for FVM was optimized according to the “true values” from MCM of

Projection Methods

DEFF Research Database (Denmark)

Wagner, Falko Jens; Poulsen, Mikael Zebbelin

1999-01-01

When trying to solve a DAE problem of high index with more traditional methods, it often causes instability in some of the variables, and finally leads to breakdown of convergence and integration of the solution. This is nicely shown in [ESF98, p. 152 ff.].This chapter will introduce projection...... methods as a way of handling these special problems. It is assumed that we have methods for solving normal ODE systems and index-1 systems....

Study of chemical bonding in the interhalogen complexes based on density functional theory

Energy Technology Data Exchange (ETDEWEB)

Poleshchuk, O. Kh., E-mail: poleshch@tspu.edu.ru [National Research Tomsk Polytechnic University (Russian Federation); Fateev, A. V.; Yarkova, A. G. [Tomsk State Pedagogical University (Russian Federation); Ermakhanov, M. N.; Saidakhmetov, P. A. [M. Auezov South Kazakhstan State University (Kazakhstan)

2016-12-15

The density functional theory analysis was used for a number XYL complexes (XY is a dihalogen molecule and L is a Lewis base), formed between molecules I{sub 2}, ICl, IBr and pyridine. The calculated geometrical parameters, IR spectra and nuclear quadrupole interaction constants of iodine are consistent with the data of microwave spectroscopy and nuclear quadrupole resonance. The good correlation between the experimental and calculated binding energies of the inner electrons of iodine, chlorine and nitrogen atoms were found with the calculation using both Gaussian and Slater functions. The comparison of experimental and calculated changes in the electron density on the atoms upon complex formation suggested the choice of scheme for calculating the effective charge on the atoms, which allow us to interpret the experimental spectra. It is shown that the use of both calculated schemes allows us to predict the enthalpy of complex formation in close agreement with the experimental values. The energy analysis shows that in the complexes the electrostatic binding energy dominates that of covalent binding.

First-principles study of half-metallic properties in RbCaNZ (Z = O, S, and Se) quaternary Heusler compounds

Science.gov (United States)

Rezaei, S.; Ahmadian, F.

2018-06-01

On the basis of first principles calculations, the electronic structures and magnetic properties of quaternary Heusler alloys RbCaNZ (Z = O, S, and Se) were studied. The negative formation energies indicated that all these compounds were thermodynamically stable and thus may be experimentally synthesized at appropriate conditions in the future. The results showed that YI structure was the most favorable configuration among the three possible structures. All compounds were found to be half-metallic ferromagnets. The characteristic of energy bands and origin of half-metallicity were also verified. The total magnetic moments of RbCaNZ (Z = O, S, and Se) compounds were obtained 2μB per formula unit, which were in an agreement with Slater-Pauling rule (Mtot = 12 - Ztot). Half-metallicity was preserved at ranges of 5.06-8.36 Å, 5.96-8.81 Å, and 6.13-8.73 Å for RbCaNO, RbCaNS, and RbCaNSe compounds, respectively, which show that these quaternary Heusler compounds may be potential candidates in spintronic applications.

Magnetic states, correlation effects and metal-insulator transition in FCC lattice

Science.gov (United States)

Timirgazin, M. A.; Igoshev, P. A.; Arzhnikov, A. K.; Irkhin, V. Yu

2016-12-01

The ground-state magnetic phase diagram (including collinear and spiral states) of the single-band Hubbard model for the face-centered cubic lattice and related metal-insulator transition (MIT) are investigated within the slave-boson approach by Kotliar and Ruckenstein. The correlation-induced electron spectrum narrowing and a comparison with a generalized Hartree-Fock approximation allow one to estimate the strength of correlation effects. This, as well as the MIT scenario, depends dramatically on the ratio of the next-nearest and nearest electron hopping integrals {{t}\\prime}/t . In contrast with metallic state, possessing substantial band narrowing, insulator one is only weakly correlated. The magnetic (Slater) scenario of MIT is found to be superior over the Mott one. Unlike simple and body-centered cubic lattices, MIT is the first order transition (discontinuous) for most {{t}\\prime}/t . The insulator state is type-II or type-III antiferromagnet, and the metallic state is spin-spiral, collinear antiferromagnet or paramagnet depending on {{t}\\prime}/t . The picture of magnetic ordering is compared with that in the standard localized-electron (Heisenberg) model.

Effect of oxygen vacancies on magnetic and transport properties of Sr2IrO4

Science.gov (United States)

Dwivedi, Vinod Kumar; Mukhopadhyay, Soumik

2018-05-01

Iridates have recently attracted growing interest because of their potential for realizing various interesting phases like interaction driven Mott-type insulator and magnetically driven Slater-type. In this paper, we present the magnetic and electrical transport properties of polycrystalline Sr2IrO4 synthesized by solid state reaction route. We find a ferromagnetic transition at 240 K. The Curie-Weiss law behavior hold good above the magnetic transition temperature TMag = 240 K with a small effective paramagnetic magnetic moment μeff = 0.25 µB/f.u. and a Curie-Weiss temperature, θCW = +100 K. Zero field cooled (ZFC) magnetization shows a gradual dcrease below 150 K, while same for field cooled (FC) below 50 K. Interestingly, below temperatures, ⁓ 10 K, a sharp increase in ZFC and FC magnetization can be seen. A temperature dependent resistivity reveals insulating behavior followed by power law mechanism. The sintering of sample in air leads to the very low value of resistivity is likely related to Sr or oxygen vacancies.

Structure of the first order reduced density matrix in three electron systems: A generalized Pauli constraints assisted study.

Science.gov (United States)

Theophilou, Iris; Lathiotakis, Nektarios N; Helbig, Nicole

2018-03-21

We investigate the structure of the one-body reduced density matrix of three electron systems, i.e., doublet and quadruplet spin configurations, corresponding to the smallest interacting system with an open-shell ground state. To this end, we use configuration interaction (CI) expansions of the exact wave function in Slater determinants built from natural orbitals in a finite dimensional Hilbert space. With the exception of maximally polarized systems, the natural orbitals of spin eigenstates are generally spin dependent, i.e., the spatial parts of the up and down natural orbitals form two different sets. A measure to quantify this spin dependence is introduced and it is shown that it varies by several orders of magnitude depending on the system. We also study the ordering issue of the spin-dependent occupation numbers which has practical implications in reduced density matrix functional theory minimization schemes, when generalized Pauli constraints (GPCs) are imposed and in the form of the CI expansion in terms of the natural orbitals. Finally, we discuss the aforementioned CI expansion when there are GPCs that are almost "pinned."

Structure of the first order reduced density matrix in three electron systems: A generalized Pauli constraints assisted study

Science.gov (United States)

Theophilou, Iris; Lathiotakis, Nektarios N.; Helbig, Nicole

2018-03-01

We investigate the structure of the one-body reduced density matrix of three electron systems, i.e., doublet and quadruplet spin configurations, corresponding to the smallest interacting system with an open-shell ground state. To this end, we use configuration interaction (CI) expansions of the exact wave function in Slater determinants built from natural orbitals in a finite dimensional Hilbert space. With the exception of maximally polarized systems, the natural orbitals of spin eigenstates are generally spin dependent, i.e., the spatial parts of the up and down natural orbitals form two different sets. A measure to quantify this spin dependence is introduced and it is shown that it varies by several orders of magnitude depending on the system. We also study the ordering issue of the spin-dependent occupation numbers which has practical implications in reduced density matrix functional theory minimization schemes, when generalized Pauli constraints (GPCs) are imposed and in the form of the CI expansion in terms of the natural orbitals. Finally, we discuss the aforementioned CI expansion when there are GPCs that are almost "pinned."

Optical absorption and fluorescence studies of praseodymium ion in chloroborophosphate glasses

International Nuclear Information System (INIS)

Sharma, Y.K.; Tandon, S.P.

1998-01-01

Full text: The interest in optical absorption and fluorescence studies of rare earth ions in glassy materials is increasing continuously in connection with laser research and related application. The absorption and fluorescence spectra of praseodymium ion in chloroborophosphate glasses have been recorded at room temperature. The chloroborophosphate glass specimens having composition in mob.% Na 2 0 (26.08), B 2 0 3 (14.57), P 2 0 5 (44.85), ZnCl 2 (14.50), Pr 6 0 11 (R) [R= 0.0,0.1 and 0.2 moi.%] have been prepared by melt quenching technique. The spectra consists of seven absorption bands and three fluorescence bands. The observed optical spectra are discussed in terms of energy state and the intensity of the transitions. The various energy interaction parameters like Slater-Condon, Lande', Racah and bonding parameters have been computed. Judd-Ofeit intensity parameters and laser parameters have also been computed. These results shows that praseodymium doped chloroborophosphate glass specimen can be considered as good hosts for laser applications

Comprehensive calculations of 4p and 4d lifetimes for the Cu sequence

International Nuclear Information System (INIS)

Curtis, L.J.; Theodosiou, C.E.

1989-01-01

Computed lifetimes for the 4p 2 P/sub 1/2/, 4p 2 P/sub 3/2/, 4d 2 D/sub 3/2/, and 4d 2 D/sub 5/2/ levels in the copper isoelectronic sequence are presented for atomic numbers Z = 29--92. These calculations agree well with recent high-precision lifetime measurements, conflict with the isoelectronic trend of single-configuration Dirac-Fock calculations, and agree at lower Z with the multiplet values of multiconfiguration Hartree-Fock calculations using experimental transition energies. Our calculations involve the inclusion of experimental energy-level data and the use of a Hartree-Slater potential to represent the ionic core. It is found that the core-polarization effects are significant and must be included to obtain agreement with experiment, at least for the lower members of the isoelectronic sequence. As part of the study, we have combined semiempirical parametrizations of the existing database with Dirac-Fock calculations to produce a set of values for the ionization potentials and the 4p and 4d excitation energies for all stable ions in this sequence

Las capacidades de mercadotecnia como un factor de incide en la competitividad de los productores de flores en México

Directory of Open Access Journals (Sweden)

Ana Lilia Coria Páez

2016-03-01

Full Text Available En México existe un enorme potencial del sector floricultor que desafortunadamente no se ha aprovechado: la privilegiada posición geográfica de México, su cercanía con Estados Unidos y Canadá, la variedad de climas y suelos propicios para la actividad; sin embargo, la oportunidad la han aprovechado otros países. El presente estudio empírico tiene como objetivo determinar en qué medida la calidad, la innovación, las capacidades gerenciales y de mercadotecnia inciden en la competitividad de los productores del sector floricultor del pueblo de San Andrés Totoltepec, Tlalpan. Para tal efecto se realizaron entrevistas y se aplicó un cuestionario. Dentro de los hallazgos se encontró que las capacidades de mercadotecnia y la competitividad presentan una correlación apreciable y más bien alta de 0.653, lo cual aporta evidencia empírica relacionada con la mercadotecnia como uno de los factores internos con mayor capacidad para generar competitividad (Ketchen, Hult y Slater, 2007; Kloter, 1994.

Widths of the atomic K-N7 levels

International Nuclear Information System (INIS)

Campbell, J.L.; Papp, Tibor

2001-01-01

Atomic level widths obtained from experimental measurements are collected in Table I, along with the corresponding theoretical widths derived from the Evaluated Atomic Data Library (EADL) of Lawrence Livermore National Laboratory; these EADL values are based upon the Dirac-Hartree-Slater version of the independent-particle model. In a minority of cases, many-body theory predictions are also provided. A brief discussion of the manner in which the experimental widths were deduced from spectroscopic data is included. The bulk of the data are for elements in the solid state, but a few data for gases and simple compounds are included. For the K, L2, L3, and M5 levels, where Coster-Kronig contributions do not contribute or contribute only to a small extent to the overall widths, the EADL predictions appear satisfactory for elements in the solid state. For other levels, where Coster-Kronig and super-Coster-Kronig transitions have large probabilities within the independent-particle model, this model is not satisfactory. Table II provides a complete set of recommended elemental values based upon consideration of the available experimental data

Magneto-electronic, thermal, and thermoelectric properties of some Co-based quaternary alloys

Science.gov (United States)

Bhat, Tahir Mohiuddin; Gupta, Dinesh C.

2018-01-01

In this study, quaternary Heusler alloys CoFeCrZ (Z = Si, As, Sb) were investigated based on the modified Becke-Johnson exchange potential. The electronic structures demonstrated that CoFeCrZ (Z = Si, As, Sb) alloys are completely spin polarized with indirect bandgap and has an integer magnetic moment according to the Slater-Pauling rule. Pugh's and Poisson's ratios showed that these materials are highly ductile with high melting temperatures. The thermal properties comprising the thermal expansion coefficient, heat capacity, and Grüneisen parameter were evaluated at various pressures from 0 to 20 GPa. The Grüneisen parameter values indicated the strong anharmonicity of the lattice vibrations that predominated in these compounds. We also studied the dependency of the thermoelectric transport properties on the temperature, i.e., the thermal conductivity and Seebeck coefficient. These alloys exhibited low lattice thermal conductivity and good Seebeck coefficients at room temperature. The half-metallic structures of these compounds with large band gaps and adequate Seebeck coefficients mean that they are suitable for use in spintronic and thermoelectric device applications.

Extended analysis and the ionization potential of the Ni III spectrum

International Nuclear Information System (INIS)

Garcia-Riquelme, O.; Rico, F.R.

1992-01-01

The Ni III spectrum emitted from a sliding spark in He, has been recorded in the UV 1300-1800A, on the 10.7m normal incidence vacuum spectrograph (plate factor 0.77A/mm), at the NIST in Washington. The low lying configurations 3d 7 4s, 3d 7 4p have been revised, new lines classified and the transitions 4p-4d, 4p-5s analyzed. The analysis has been extended to the spectral region up to 9000A and new terms from the electronic configurations 3d 7 5d, 6s, 5p, 4f and 5g have been identified. Theoretical Slater parametric calculations for these configurations and least square fits to the experimental levels have been performed. The ionization potential has been determined to 283 800±150cm -1 or 35.19±0.02eV. Table of new levels, the list of classified lines in the analyzed ranges 1300-1800, 2200-9000A, and the (LSF) parameters for the calculated configurations, are given. (orig.)

Method Mixins

DEFF Research Database (Denmark)

Ernst, Erik

2005-01-01

The world of programming has been conquered by the procedure call mechanism, including object-oriented method invocation which is a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior, ...... the call stack, e.g., to a callee's callee. The mechanism has been implemented in the programming language gbeta. Variants of the mechanism could be added to almost any imperative programming language.......The world of programming has been conquered by the procedure call mechanism, including object-oriented method invocation which is a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior...

Mimetic discretization methods

CERN Document Server

Castillo, Jose E

2013-01-01

To help solve physical and engineering problems, mimetic or compatible algebraic discretization methods employ discrete constructs to mimic the continuous identities and theorems found in vector calculus. Mimetic Discretization Methods focuses on the recent mimetic discretization method co-developed by the first author. Based on the Castillo-Grone operators, this simple mimetic discretization method is invariably valid for spatial dimensions no greater than three. The book also presents a numerical method for obtaining corresponding discrete operators that mimic the continuum differential and

Discipline methods

OpenAIRE

Maria Kikila; Ioannis Koutelekos

2012-01-01

Child discipline is one of the most important elements of successful parenting. As discipline is defined the process that help children to learn appropriate behaviors and make good choices. Aim: The aim of the present study was to review the literature about the discipline methods. The method οf this study included bibliography research from both the review and the research literature, mainly in the pubmed data base which referred to the discipline methods. Results: In the literature it is ci...

Method Mixins

DEFF Research Database (Denmark)

Ernst, Erik

2002-01-01

invocation is optimized for as-is reuse of existing behavior. Tight coupling reduces flexibility, and traditional invocation tightly couples transfer of information and transfer of control. Method mixins decouple these two kinds of transfer, thereby opening the doors for new kinds of abstraction and reuse......The procedure call mechanism has conquered the world of programming, with object-oriented method invocation being a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior, where traditional....... Method mixins use shared name spaces to transfer information between caller and callee, as opposed to traditional invocation which uses parameters and returned results. This relieves a caller from dependencies on the callee, and it allows direct transfer of information further down the call stack, e...

BASIC METHODS OF CLASSIFICATION AND CHARACTERISTICS OF METHODS OF PRICING IN UKRAINE

OpenAIRE

A. Boguslavskiy

2014-01-01

The article provided definitions and shows the need to use different methods of pricing of enterprises. Exposed the reasons of the absence of a universal classification of pricing methods. The approaches of different authors to classify groups of pricing methods: 1) the cost method; 2) methods with a focus on competition; 3) methods for pricing based on demand, 4) pricing with a focus on maximum profit, 5) parametric methods, 6) pricing under risk and uncertainty, etc. An improved classificat...

Compositions, antibodies, asthma diagnosis methods, and methods for preparing antibodies

Energy Technology Data Exchange (ETDEWEB)

Jin, Hongjun; Zangar, Richard C.

2017-01-17

Methods for preparing an antibody are provided with the method including incorporating 3-bromo-4-hydroxy-benzoic acid into a protein to form an antigen, immunizing a mammalian host with the antigen, and recovering an antibody having an affinity for the antigen from the host. Antibodies having a binding affinity for a monohalotyrosine are provided as well as composition comprising an antibody bound with monohalotyrosine. Compositions comprising a protein having a 3-bromo-4-hydroxy-benzoic acid moiety are also provided. Methods for evaluating the severity of asthma are provide with the methods including analyzing sputum of a patient using an antibody having a binding affinity for monohalotyrosine, and measuring the amount of antibody bound to protein. Methods for determining eosinophil activity in bodily fluid are also provided with the methods including exposing bodily fluid to an antibody having a binding affinity for monohalotyrosine, and measuring the amount of bound antibody to determine the eosinophil activity.

User interface inspection methods a user-centered design method

CERN Document Server

Wilson, Chauncey

2014-01-01

User Interface Inspection Methods succinctly covers five inspection methods: heuristic evaluation, perspective-based user interface inspection, cognitive walkthrough, pluralistic walkthrough, and formal usability inspections. Heuristic evaluation is perhaps the best-known inspection method, requiring a group of evaluators to review a product against a set of general principles. The perspective-based user interface inspection is based on the principle that different perspectives will find different problems in a user interface. In the related persona-based inspection, colleagues assume the

galerkin's methods

African Journals Online (AJOL)

user

The assumed deflection shapes used in the approximate methods such as in the Galerkin's method were normally ... to direct compressive forces Nx, was derived by Navier. [3]. ..... tend to give higher frequency and stiffness, as well as.

Radiometric dating methods

International Nuclear Information System (INIS)

Bourdon, B.

2003-01-01

The general principle of isotope dating methods is based on the presence of radioactive isotopes in the geologic or archaeological object to be dated. The decay with time of these isotopes is used to determine the 'zero' time corresponding to the event to be dated. This paper recalls the general principle of isotope dating methods (bases, analytical methods, validation of results and uncertainties) and presents the methods based on natural radioactivity (Rb-Sr, Sm-Nd, U-Pb, Re-Os, K-Ar (Ar-Ar), U-Th-Ra- 210 Pb, U-Pa, 14 C, 36 Cl, 10 Be) and the methods based on artificial radioactivity with their applications. Finally, the methods based on irradiation damages (thermoluminescence, fission tracks, electron spin resonance) are briefly evoked. (J.S.)

Method Mixins

DEFF Research Database (Denmark)

Ernst, Erik

2002-01-01

. Method mixins use shared name spaces to transfer information between caller and callee, as opposed to traditional invocation which uses parameters and returned results. This relieves a caller from dependencies on the callee, and it allows direct transfer of information further down the call stack, e......The procedure call mechanism has conquered the world of programming, with object-oriented method invocation being a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior, where traditional...

The Value of Mixed Methods Research: A Mixed Methods Study

Science.gov (United States)

McKim, Courtney A.

2017-01-01

The purpose of this explanatory mixed methods study was to examine the perceived value of mixed methods research for graduate students. The quantitative phase was an experiment examining the effect of a passage's methodology on students' perceived value. Results indicated students scored the mixed methods passage as more valuable than those who…

Nondestructive testing method

International Nuclear Information System (INIS)

Porter, J.F.

1996-01-01

Nondestructive testing (NDT) is the use of physical and chemical methods for evaluating material integrity without impairing its intended usefulness or continuing service. Nondestructive tests are used by manufaturer's for the following reasons: 1) to ensure product reliability; 2) to prevent accidents and save human lives; 3) to aid in better product design; 4) to control manufacturing processes; and 5) to maintain a uniform quality level. Nondestructive testing is used extensively on power plants, oil and chemical refineries, offshore oil rigs and pipeline (NDT can even be conducted underwater), welds on tanks, boilers, pressure vessels and heat exchengers. NDT is now being used for testing concrete and composite materials. Because of the criticality of its application, NDT should be performed and the results evaluated by qualified personnel. There are five basic nondestructive examination methods: 1) liquid penetrant testing - method used for detecting surface flaws in materials. This method can be used for metallic and nonmetallic materials, portable and relatively inexpensive. 2) magnetic particle testing - method used to detect surface and subsurface flaws in ferromagnetic materials; 3) radiographic testing - method used to detect internal flaws and significant variation in material composition and thickness; 4) ultrasonic testing - method used to detect internal and external flaws in materials. This method uses ultrasonics to measure thickness of a material or to examine the internal structure for discontinuities. 5) eddy current testing - method used to detect surface and subsurface flaws in conductive materials. Not one nondestructive examination method can find all discontinuities in all of the materials capable of being tested. The most important consideration is for the specifier of the test to be familiar with the test method and its applicability to the type and geometry of the material and the flaws to be detected

Mapping Mixed Methods Research: Methods, Measures, and Meaning

Science.gov (United States)

Wheeldon, J.

2010-01-01

This article explores how concept maps and mind maps can be used as data collection tools in mixed methods research to combine the clarity of quantitative counts with the nuance of qualitative reflections. Based on more traditional mixed methods approaches, this article details how the use of pre/post concept maps can be used to design qualitative…

DOE methods compendium

International Nuclear Information System (INIS)

Leasure, C.S.

1992-01-01

The Department of Energy (DOE) has established an analytical methods compendium development program to integrate its environmental analytical methods. This program is administered through DOE's Laboratory Management Division (EM-563). The primary objective of this program is to assemble a compendium of analytical chemistry methods of known performance for use by all DOE Environmental Restoration and Waste Management program. This compendium will include methods for sampling, field screening, fixed analytical laboratory and mobile analytical laboratory analyses. It will also include specific guidance on the proper selection of appropriate sampling and analytical methods in using specific analytical requirements

The preconditioned Gauss-Seidel method faster than the SOR method

Science.gov (United States)

Niki, Hiroshi; Kohno, Toshiyuki; Morimoto, Munenori

2008-09-01

In recent years, a number of preconditioners have been applied to linear systems [A.D. Gunawardena, S.K. Jain, L. Snyder, Modified iterative methods for consistent linear systems, Linear Algebra Appl. 154-156 (1991) 123-143; T. Kohno, H. Kotakemori, H. Niki, M. Usui, Improving modified Gauss-Seidel method for Z-matrices, Linear Algebra Appl. 267 (1997) 113-123; H. Kotakemori, K. Harada, M. Morimoto, H. Niki, A comparison theorem for the iterative method with the preconditioner (I+Smax), J. Comput. Appl. Math. 145 (2002) 373-378; H. Kotakemori, H. Niki, N. Okamoto, Accelerated iteration method for Z-matrices, J. Comput. Appl. Math. 75 (1996) 87-97; M. Usui, H. Niki, T.Kohno, Adaptive Gauss-Seidel method for linear systems, Internat. J. Comput. Math. 51(1994)119-125 [10

Methods of evaluating SPECT images. The usefulness of the Matsuda`s method by the Patlak plot method in children

Energy Technology Data Exchange (ETDEWEB)

Takaishi, Yasuko [Nippon Medical School, Tokyo (Japan); Hashimoto, Kiyoshi; Fujino, Osamu [and others

1998-11-01

Single photon emission computed tomography (SPECT) is a tool to study cerebral blood flow (CBF) kinetics. There are three methods of evaluating SPECT images: visual, semi-quantitative (evaluation of the radioactivity ratio of the cerebral region to the cerebellum (R/CE) or to the thalamus (R/TH)) and quantitative (Matsuda`s method by Patlak plot method using {sup 99m}Tc-hexamethylpropylene amine oxime radionuclide angiography). We evaluated SPECT images by the quantitative method in 14 patients with neurological disorders and examined the correlation of the results to those obtained by the semi-quantitative method. There was no significant correlation between the R/CE or R/TH ratio and regional CBF except two regions. The evaluation by the semi-quantitative method may have been inappropriate, probably because the cerebellar or thalamic blood flow was not constant in each case. Evaluation by the quantitative method, on the other hand, seemed to be useful not only for the comparison of CBF among normal subjects, but also in the demonstration of progressive changes of CBF in the same case. The Matsuda`s method by the Patlak plot method is suitable for examination of children, since it dose not require aortic blood sampling. (author)

Blowout heroes : while his crew mate risked fire and falling rock to save him, Curly Slater fought right to the last breath

Energy Technology Data Exchange (ETDEWEB)

Louie, J.

2008-11-15

This article discussed a blow-out that resulted in a fatality at a drilling rig near Helmut, British Columbia (BC). The blowout caused a column of fire, drilling mud, and rock to explode from the floor of the rig. As the rig's derrickman was trapped when drilling mud caked onto his easy rider cable and froze the escape sliding mechanism. The derrickman fell and was left dangling by his harness. Crew members spotted him from a distance and returned to the site in order to unhook the easy rider cable from the manifold shack and move the steel line to a location that would allow him to descend more easily. The derrickman was unable to un-jam his fall arrestor. He freed himself using his own strength, seized a cable, but lost his grip while still 75 feet in the air and fell to his death. The tragedy was caused by the presence of a very large gas pocket encountered at an unusually shallow depth. Several of the crew members have been unable to continue working in the oil and gas industry, due to the psychological trauma of witnessing the man's death. The Canadian Association of Oilwell Drilling Contractors (CAODC) has issued awards of merit for the crew men who attempted to save the derrickman, and the entire crew will receive medals of bravery from the Governor General of Canada. 2 figs.

Transport equation solving methods

International Nuclear Information System (INIS)

Granjean, P.M.

1984-06-01

This work is mainly devoted to Csub(N) and Fsub(N) methods. CN method: starting from a lemma stated by Placzek, an equivalence is established between two problems: the first one is defined in a finite medium bounded by a surface S, the second one is defined in the whole space. In the first problem the angular flux on the surface S is shown to be the solution of an integral equation. This equation is solved by Galerkin's method. The Csub(N) method is applied here to one-velocity problems: in plane geometry, slab albedo and transmission with Rayleigh scattering, calculation of the extrapolation length; in cylindrical geometry, albedo and extrapolation length calculation with linear scattering. Fsub(N) method: the basic integral transport equation of the Csub(N) method is integrated on Case's elementary distributions; another integral transport equation is obtained: this equation is solved by a collocation method. The plane problems solved by the Csub(N) method are also solved by the Fsub(N) method. The Fsub(N) method is extended to any polynomial scattering law. Some simple spherical problems are also studied. Chandrasekhar's method, collision probability method, Case's method are presented for comparison with Csub(N) and Fsub(N) methods. This comparison shows the respective advantages of the two methods: a) fast convergence and possible extension to various geometries for Csub(N) method; b) easy calculations and easy extension to polynomial scattering for Fsub(N) method [fr

Ensemble Methods

Science.gov (United States)

Re, Matteo; Valentini, Giorgio

2012-03-01

Ensemble methods are statistical and computational learning procedures reminiscent of the human social learning behavior of seeking several opinions before making any crucial decision. The idea of combining the opinions of different "experts" to obtain an overall “ensemble” decision is rooted in our culture at least from the classical age of ancient Greece, and it has been formalized during the Enlightenment with the Condorcet Jury Theorem[45]), which proved that the judgment of a committee is superior to those of individuals, provided the individuals have reasonable competence. Ensembles are sets of learning machines that combine in some way their decisions, or their learning algorithms, or different views of data, or other specific characteristics to obtain more reliable and more accurate predictions in supervised and unsupervised learning problems [48,116]. A simple example is represented by the majority vote ensemble, by which the decisions of different learning machines are combined, and the class that receives the majority of “votes” (i.e., the class predicted by the majority of the learning machines) is the class predicted by the overall ensemble [158]. In the literature, a plethora of terms other than ensembles has been used, such as fusion, combination, aggregation, and committee, to indicate sets of learning machines that work together to solve a machine learning problem [19,40,56,66,99,108,123], but in this chapter we maintain the term ensemble in its widest meaning, in order to include the whole range of combination methods. Nowadays, ensemble methods represent one of the main current research lines in machine learning [48,116], and the interest of the research community on ensemble methods is witnessed by conferences and workshops specifically devoted to ensembles, first of all the multiple classifier systems (MCS) conference organized by Roli, Kittler, Windeatt, and other researchers of this area [14,62,85,149,173]. Several theories have been

Performative Schizoid Method

DEFF Research Database (Denmark)

Svabo, Connie

2016-01-01

is presented and an example is provided of a first exploratory engagement with it. The method is used in a specific project Becoming Iris, making inquiry into arts-based knowledge creation during a three month visiting scholarship at a small, independent visual art academy. Using the performative schizoid......A performative schizoid method is developed as a method contribution to performance as research. The method is inspired by contemporary research in the human and social sciences urging experimentation and researcher engagement with creative and artistic practice. In the article, the method...... method in Becoming Iris results in four audio-visual and performance-based productions, centered on an emergent theme of the scholartist as a bird in borrowed feathers. Interestingly, the moral lesson of the fable about the vain jackdaw, who dresses in borrowed peacock feathers and becomes a castout...

Spectral Induced Polarization (SIP) monitoring during Microbial Enhanced Oil Recovery (MEOR)

Science.gov (United States)

Heenan, J. W.; Ntarlagiannis, D.; Slater, L. D.

2010-12-01

Jeffrey Heenan, Dimitrios Ntarlagiannis, Lee Slater Department of Earth and Environmental Sciences, Rutgers University, Newark NJ Microbial Enhanced Oil Recovery (MEOR) is an established, cost effective, method for enhancing tertiary oil recovery. Although not commonly used for shallow heavy oils, it could be a viable alternative since it can offer sustainable economic recovery and minimal environmental impact. A critical component of successful MEOR treatments is accurate, real time monitoring of the biodegradation processes resulting from the injection of microbial communities into the formation; results of recent biogeophysical research suggest that minimally-invasive geophysical methods could significantly contribute to such monitoring efforts. Here we present results of laboratory experiments, to assess the sensitivity of the spectral induced polarization method (SIP) to MEOR treatments. We used heavy oil, obtained from a shallow oilfield in SW Missouri, to saturate three sand columns. We then followed common industry procedures,and used a commercially available microbial consortia, to treat the oil columns. The active MEOR experiments were performed in duplicate while a control column maintained similar conditions, without promoting microbial activity and oil degradation. We monitored the SIP signatures, between 0.001 Hz and 1000 Hz, for a period of six months. To support the geophysical measurements we also monitored common geochemical parameters, including pH, Eh and fluid conductivity, and collected weekly fluid samples from the outflow and inflow for further analysis; fluid samples were analyzed to confirm that microbes actively degraded the heavy oils in the column while destructive analysis of the solid materials was performed upon termination of the experiment. Preliminary analysis of the results suggests that SIP is sensitive to MEOR processes. In both inoculated columns we recorded an increase in the low frequency polarization with time; measureable

Dimensionality Reduction Methods: Comparative Analysis of methods PCA, PPCA and KPCA

Directory of Open Access Journals (Sweden)

Jorge Arroyo-Hernández

2016-01-01

Full Text Available The dimensionality reduction methods are algorithms mapping the set of data in subspaces derived from the original space, of fewer dimensions, that allow a description of the data at a lower cost. Due to their importance, they are widely used in processes associated with learning machine. This article presents a comparative analysis of PCA, PPCA and KPCA dimensionality reduction methods. A reconstruction experiment of worm-shape data was performed through structures of landmarks located in the body contour, with methods having different number of main components. The results showed that all methods can be seen as alternative processes. Nevertheless, thanks to the potential for analysis in the features space and the method for calculation of its preimage presented, KPCA offers a better method for recognition process and pattern extraction

Development of nondestructive hybrid measuring method for three-dimensional residual stress distribution of thick welded joint. Hybrid measuring method of inherent strain method and neutron diffraction method

International Nuclear Information System (INIS)

Nakacho, Keiji; Kasahara, Norifumi; Tamura, Ryota

2012-01-01

The measuring methods of the residual stress are classified into destructive one and nondestructive one. The inherent strain method (ISM) is destructive one. The neutron diffraction method (NDM) is nondestructive one. But the measurable depth is limited within about 20 mm and the method cannot measure the weld zone, without destruction of the object. So, in this study, the hybrid measuring method has been developed, by combining the ISM and the NDM. The theory of the hybrid method is the same as the ISM. In the analysis, the strains measured by the NDM without destruction are used. This hybrid measuring method is a true nondestructive measuring method for a thick welded joint. The applicability of the hybrid method has been verified by simulation, using a butt welded joint of thick pipes. In the simulation, the reliable order of the strains measured by the present NDM is very important, and was considered as 10 micro. The measurable regions by the present NDM were assumed. Under the above conditions, the data (the residual elastic strains assumed to be measured by the NDM) were made, and used in the ISM. As a result of such simulation, it has been cleared that the estimated residual stress has very high accuracy, if enough data are used. The required number of data is less than the ISM. (author)

The surface analysis methods; Les methodes d`analyse des surfaces

Energy Technology Data Exchange (ETDEWEB)

Deville, J.P. [Institut de Physique et Chimie, 67 - Strasbourg (France)

1998-11-01

Nowadays, there are a lot of surfaces analysis methods, each having its specificity, its qualities, its constraints (for instance vacuum) and its limits. Expensive in time and in investment, these methods have to be used deliberately. This article appeals to non specialists. It gives some elements of choice according to the studied information, the sensitivity, the use constraints or the answer to a precise question. After having recalled the fundamental principles which govern these analysis methods, based on the interaction between radiations (ultraviolet, X) or particles (ions, electrons) with matter, two methods will be more particularly described: the Auger electron spectroscopy (AES) and x-rays photoemission spectroscopy (ESCA or XPS). Indeed, they are the most widespread methods in laboratories, the easier for use and probably the most productive for the analysis of surface of industrial materials or samples submitted to treatments in aggressive media. (O.M.) 11 refs.

Unstructured characteristic method embedded with variational nodal method using domain decomposition techniques

Energy Technology Data Exchange (ETDEWEB)

Girardi, E.; Ruggieri, J.M. [CEA Cadarache (DER/SPRC/LEPH), 13 - Saint-Paul-lez-Durance (France). Dept. d' Etudes des Reacteurs; Santandrea, S. [CEA Saclay, Dept. Modelisation de Systemes et Structures DM2S/SERMA/LENR, 91 - Gif sur Yvette (France)

2005-07-01

This paper describes a recently-developed extension of our 'Multi-methods,multi-domains' (MM-MD) method for the solution of the multigroup transport equation. Based on a domain decomposition technique, our approach allows us to treat the one-group equation by cooperatively employing several numerical methods together. In this work, we describe the coupling between the Method of Characteristics (integro-differential equation, unstructured meshes) with the Variational Nodal Method (even parity equation, cartesian meshes). Then, the coupling method is applied to the benchmark model of the Phebus experimental facility (Cea Cadarache). Our domain decomposition method give us the capability to employ a very fine mesh in describing a particular fuel bundle with an appropriate numerical method (MOC), while using a much large mesh size in the rest of the core, in conjunction with a coarse-mesh method (VNM). This application shows the benefits of our MM-MD approach, in terms of accuracy and computing time: the domain decomposition method allows us to reduce the Cpu time, while preserving a good accuracy of the neutronic indicators: reactivity, core-to-bundle power coupling coefficient and flux error. (authors)

Unstructured characteristic method embedded with variational nodal method using domain decomposition techniques

International Nuclear Information System (INIS)

Girardi, E.; Ruggieri, J.M.

2005-01-01

This paper describes a recently-developed extension of our 'Multi-methods,multi-domains' (MM-MD) method for the solution of the multigroup transport equation. Based on a domain decomposition technique, our approach allows us to treat the one-group equation by cooperatively employing several numerical methods together. In this work, we describe the coupling between the Method of Characteristics (integro-differential equation, unstructured meshes) with the Variational Nodal Method (even parity equation, cartesian meshes). Then, the coupling method is applied to the benchmark model of the Phebus experimental facility (Cea Cadarache). Our domain decomposition method give us the capability to employ a very fine mesh in describing a particular fuel bundle with an appropriate numerical method (MOC), while using a much large mesh size in the rest of the core, in conjunction with a coarse-mesh method (VNM). This application shows the benefits of our MM-MD approach, in terms of accuracy and computing time: the domain decomposition method allows us to reduce the Cpu time, while preserving a good accuracy of the neutronic indicators: reactivity, core-to-bundle power coupling coefficient and flux error. (authors)

Color image definition evaluation method based on deep learning method

Science.gov (United States)

Liu, Di; Li, YingChun

2018-01-01

In order to evaluate different blurring levels of color image and improve the method of image definition evaluation, this paper proposed a method based on the depth learning framework and BP neural network classification model, and presents a non-reference color image clarity evaluation method. Firstly, using VGG16 net as the feature extractor to extract 4,096 dimensions features of the images, then the extracted features and labeled images are employed in BP neural network to train. And finally achieve the color image definition evaluation. The method in this paper are experimented by using images from the CSIQ database. The images are blurred at different levels. There are 4,000 images after the processing. Dividing the 4,000 images into three categories, each category represents a blur level. 300 out of 400 high-dimensional features are trained in VGG16 net and BP neural network, and the rest of 100 samples are tested. The experimental results show that the method can take full advantage of the learning and characterization capability of deep learning. Referring to the current shortcomings of the major existing image clarity evaluation methods, which manually design and extract features. The method in this paper can extract the images features automatically, and has got excellent image quality classification accuracy for the test data set. The accuracy rate is 96%. Moreover, the predicted quality levels of original color images are similar to the perception of the human visual system.

Cooperative method development

DEFF Research Database (Denmark)

Dittrich, Yvonne; Rönkkö, Kari; Eriksson, Jeanette

2008-01-01

The development of methods tools and process improvements is best to be based on the understanding of the development practice to be supported. Qualitative research has been proposed as a method for understanding the social and cooperative aspects of software development. However, qualitative...... research is not easily combined with the improvement orientation of an engineering discipline. During the last 6 years, we have applied an approach we call `cooperative method development', which combines qualitative social science fieldwork, with problem-oriented method, technique and process improvement....... The action research based approach focusing on shop floor software development practices allows an understanding of how contextual contingencies influence the deployment and applicability of methods, processes and techniques. This article summarizes the experiences and discusses the further development...

Conjugated polymer nanoparticles, methods of using, and methods of making

KAUST Repository

Habuchi, Satoshi; Piwonski, Hubert Marek; Michinobu, Tsuyoshi

2017-01-01

Embodiments of the present disclosure provide for conjugated polymer nanoparticle, method of making conjugated polymer nanoparticles, method of using conjugated polymer nanoparticle, polymers, and the like.

Conjugated polymer nanoparticles, methods of using, and methods of making

KAUST Repository

Habuchi, Satoshi

2017-03-16

Embodiments of the present disclosure provide for conjugated polymer nanoparticle, method of making conjugated polymer nanoparticles, method of using conjugated polymer nanoparticle, polymers, and the like.

Numerical method for time-dependent localized corrosion analysis with moving boundaries by combining the finite volume method and voxel method

International Nuclear Information System (INIS)

Onishi, Yuki; Takiyasu, Jumpei; Amaya, Kenji; Yakuwa, Hiroshi; Hayabusa, Keisuke

2012-01-01

Highlights: ► A novel numerical method to analyze time dependent localized corrosion is developed. ► It takes electromigration, mass diffusion, chemical reactions, and moving boundaries. ► Our method perfectly satisfies the conservation of mass and electroneutrality. ► The behavior of typical crevice corrosion is successfully simulated. ► Both verification and validation of our method are carried out. - Abstract: A novel numerical method for time-dependent localized corrosion analysis is presented. Electromigration, mass diffusion, chemical reactions, and moving boundaries are considered in the numerical simulation of localized corrosion of engineering alloys in an underwater environment. Our method combines the finite volume method (FVM) and the voxel method. The FVM is adopted in the corrosion rate calculation so that the conservation of mass is satisfied. A newly developed decoupled algorithm with a projection method is introduced in the FVM to decouple the multiphysics problem into the electrostatic, mass transport, and chemical reaction analyses with electroneutrality maintained. The polarization curves for the corroding metal are used as boundary conditions for the metal surfaces to calculate the corrosion rates. The voxel method is adopted in updating the moving boundaries of cavities without remeshing and mesh-to-mesh solution mapping. Some modifications of the standard voxel method, which represents the boundaries as zigzag-shaped surfaces, are introduced to generate smooth surfaces. Our method successfully reproduces the numerical and experimental results of a capillary electrophoresis problem. Furthermore, the numerical results are qualitatively consistent with the experimental results for several examples of crevice corrosion.

76 FR 21673 - Alternative Efficiency Determination Methods and Alternate Rating Methods

Science.gov (United States)

2011-04-18

... EERE-2011-BP-TP-00024] RIN 1904-AC46 Alternative Efficiency Determination Methods and Alternate Rating Methods AGENCY: Office of Energy Efficiency and Renewable Energy, Department of Energy. ACTION: Notice of... and data related to the use of computer simulations, mathematical methods, and other alternative...

Scalable fast multipole methods for vortex element methods

KAUST Repository

Hu, Qi

2012-11-01

We use a particle-based method to simulate incompressible flows, where the Fast Multipole Method (FMM) is used to accelerate the calculation of particle interactions. The most time-consuming kernelsâ\\'the Biot-Savart equation and stretching term of the vorticity equationâ\\'are mathematically reformulated so that only two Laplace scalar potentials are used instead of six, while automatically ensuring divergence-free far-field computation. Based on this formulation, and on our previous work for a scalar heterogeneous FMM algorithm, we develop a new FMM-based vortex method capable of simulating general flows including turbulence on heterogeneous architectures, which distributes the work between multi-core CPUs and GPUs to best utilize the hardware resources and achieve excellent scalability. The algorithm also uses new data structures which can dynamically manage inter-node communication and load balance efficiently but with only a small parallel construction overhead. This algorithm can scale to large-sized clusters showing both strong and weak scalability. Careful error and timing trade-off analysis are also performed for the cutoff functions induced by the vortex particle method. Our implementation can perform one time step of the velocity+stretching for one billion particles on 32 nodes in 55.9 seconds, which yields 49.12 Tflop/s. © 2012 IEEE.

method

Directory of Open Access Journals (Sweden)

L. M. Kimball

2002-01-01

Full Text Available This paper presents an interior point algorithm to solve the multiperiod hydrothermal economic dispatch (HTED. The multiperiod HTED is a large scale nonlinear programming problem. Various optimization methods have been applied to the multiperiod HTED, but most neglect important network characteristics or require decomposition into thermal and hydro subproblems. The algorithm described here exploits the special bordered block diagonal structure and sparsity of the Newton system for the first order necessary conditions to result in a fast efficient algorithm that can account for all network aspects. Applying this new algorithm challenges a conventional method for the use of available hydro resources known as the peak shaving heuristic.

Development of modelling method selection tool for health services management: from problem structuring methods to modelling and simulation methods.

Science.gov (United States)

Jun, Gyuchan T; Morris, Zoe; Eldabi, Tillal; Harper, Paul; Naseer, Aisha; Patel, Brijesh; Clarkson, John P

2011-05-19

There is an increasing recognition that modelling and simulation can assist in the process of designing health care policies, strategies and operations. However, the current use is limited and answers to questions such as what methods to use and when remain somewhat underdeveloped. The aim of this study is to provide a mechanism for decision makers in health services planning and management to compare a broad range of modelling and simulation methods so that they can better select and use them or better commission relevant modelling and simulation work. This paper proposes a modelling and simulation method comparison and selection tool developed from a comprehensive literature review, the research team's extensive expertise and inputs from potential users. Twenty-eight different methods were identified, characterised by their relevance to different application areas, project life cycle stages, types of output and levels of insight, and four input resources required (time, money, knowledge and data). The characterisation is presented in matrix forms to allow quick comparison and selection. This paper also highlights significant knowledge gaps in the existing literature when assessing the applicability of particular approaches to health services management, where modelling and simulation skills are scarce let alone money and time. A modelling and simulation method comparison and selection tool is developed to assist with the selection of methods appropriate to supporting specific decision making processes. In particular it addresses the issue of which method is most appropriate to which specific health services management problem, what the user might expect to be obtained from the method, and what is required to use the method. In summary, we believe the tool adds value to the scarce existing literature on methods comparison and selection.

Comparison of nuclear analytical methods with competitive methods

International Nuclear Information System (INIS)

1987-10-01

The use of nuclear analytical techniques, especially neutron activation analysis, already have a 50 year old history. Today several sensitive and accurate, non-nuclear trace element analytical techniques are available and new methods are continuously developed. The IAEA is supporting the development of nuclear analytical laboratories in its Member States. In order to be able to advise the developing countries which methods to use in different applications, it is important to know the present status and development trends of nuclear analytical methods, what are their benefits, drawbacks and recommended fields of application, compared with other, non-nuclear techniques. In order to get an answer to these questions the IAEA convened this Advisory Group Meeting. This volume is the outcome of the presentations and discussions of the meeting. A separate abstract was prepared for each of the 21 papers. Refs, figs, tabs

Spectroscopic methods

International Nuclear Information System (INIS)

Ivanovich, M.; Murray, A.

1992-01-01

The principles involved in the interaction of nuclear radiation with matter are described, as are the principles behind methods of radiation detection. Different types of radiation detectors are described and methods of detection such as alpha, beta and gamma spectroscopy, neutron activation analysis are presented. Details are given of measurements of uranium-series disequilibria. (UK)

Statistical and numerical methods to improve the transient divided bar method

DEFF Research Database (Denmark)

Bording, Thue Sylvester; Nielsen, S.B.; Balling, N.

The divided bar method is a commonly used method to measure thermal conductivity of rock samples in laboratory. We present improvements to this method that allows for simultaneous measurements of both thermal conductivity and thermal diffusivity. The divided bar setup is run in a transient mode...

A European legal method? On European private law and scientific method

NARCIS (Netherlands)

Hesselink, M.

2009-01-01

This article examines the relationship between European private law and scientific method. It argues that a European legal method is a good idea. Not primarily because it will make European private law scholarship look more scientific, but because a debate on the method of a normative science

Uranium price forecasting methods

International Nuclear Information System (INIS)

Fuller, D.M.

1994-01-01

This article reviews a number of forecasting methods that have been applied to uranium prices and compares their relative strengths and weaknesses. The methods reviewed are: (1) judgemental methods, (2) technical analysis, (3) time-series methods, (4) fundamental analysis, and (5) econometric methods. Historically, none of these methods has performed very well, but a well-thought-out model is still useful as a basis from which to adjust to new circumstances and try again

Approaches to Mixed Methods Dissemination and Implementation Research: Methods, Strengths, Caveats, and Opportunities.

Science.gov (United States)

Green, Carla A; Duan, Naihua; Gibbons, Robert D; Hoagwood, Kimberly E; Palinkas, Lawrence A; Wisdom, Jennifer P

2015-09-01

Limited translation of research into practice has prompted study of diffusion and implementation, and development of effective methods of encouraging adoption, dissemination and implementation. Mixed methods techniques offer approaches for assessing and addressing processes affecting implementation of evidence-based interventions. We describe common mixed methods approaches used in dissemination and implementation research, discuss strengths and limitations of mixed methods approaches to data collection, and suggest promising methods not yet widely used in implementation research. We review qualitative, quantitative, and hybrid approaches to mixed methods dissemination and implementation studies, and describe methods for integrating multiple methods to increase depth of understanding while improving reliability and validity of findings.

Comparison of Rice Direct Seeding Methods (Mechanical and Manual with Transplanting Method

Directory of Open Access Journals (Sweden)

A Eyvani

2014-04-01

Full Text Available The main method of rice planting in Iran is transplanting. Due to poor mechanization of rice production, this method is laborious and costly. The other method is direct seeding in wet lands which is performed in the one third of rice cultivation area of the world. The most important problem in this method is high labor requirement of weed control. In order to compare the different rice planting methods (direct drilling, transplanting, and seed broadcasting a manually operated rice direct seeder (drum seeder was designed and fabricated. The research was conducted using a randomized complete block design with three treatments and three replications. Required draft force, field efficiency, effective field capacity, yield, and yield components were measured and the treatments were compared economically. Results showed that there were significant differences among the treatments from the view point of rice yield at the confidence level of 95% i.e. the transplanting method had the maximum yield. A higher rice yield was obtained from the direct seeder compared to the manual broadcasting method but, the difference between these two methods for crop yield was not significant even at the confidence level of the 95%. The coefficient of variation of seed distribution with direct seeding was more than 20%. The labor and time requirements per hectare reduced to 7 and 20 times, respectively when comparing the newly designed direct seeder with the transplanting method. The direct seeding method had the highest benefit to cost ratio in spite of its lower yield. Therefore, this method could be recommended in the rice growing regions.

Advanced differential quadrature methods

CERN Document Server

Zong, Zhi

2009-01-01

Modern Tools to Perform Numerical DifferentiationThe original direct differential quadrature (DQ) method has been known to fail for problems with strong nonlinearity and material discontinuity as well as for problems involving singularity, irregularity, and multiple scales. But now researchers in applied mathematics, computational mechanics, and engineering have developed a range of innovative DQ-based methods to overcome these shortcomings. Advanced Differential Quadrature Methods explores new DQ methods and uses these methods to solve problems beyond the capabilities of the direct DQ method.After a basic introduction to the direct DQ method, the book presents a number of DQ methods, including complex DQ, triangular DQ, multi-scale DQ, variable order DQ, multi-domain DQ, and localized DQ. It also provides a mathematical compendium that summarizes Gauss elimination, the Runge-Kutta method, complex analysis, and more. The final chapter contains three codes written in the FORTRAN language, enabling readers to q...

Inflow Turbulence Generation Methods

Science.gov (United States)

Wu, Xiaohua

2017-01-01

Research activities on inflow turbulence generation methods have been vigorous over the past quarter century, accompanying advances in eddy-resolving computations of spatially developing turbulent flows with direct numerical simulation, large-eddy simulation (LES), and hybrid Reynolds-averaged Navier-Stokes-LES. The weak recycling method, rooted in scaling arguments on the canonical incompressible boundary layer, has been applied to supersonic boundary layer, rough surface boundary layer, and microscale urban canopy LES coupled with mesoscale numerical weather forecasting. Synthetic methods, originating from analytical approximation to homogeneous isotropic turbulence, have branched out into several robust methods, including the synthetic random Fourier method, synthetic digital filtering method, synthetic coherent eddy method, and synthetic volume forcing method. This article reviews major progress in inflow turbulence generation methods with an emphasis on fundamental ideas, key milestones, representative applications, and critical issues. Directions for future research in the field are also highlighted.

Improved radioanalytical methods

International Nuclear Information System (INIS)

Erickson, M.D.; Aldstadt, J.H.; Alvarado, J.S.; Crain, J.S.; Orlandini, K.A.; Smith, L.L.

1995-01-01

Methods for the chemical characterization of the environment are being developed under a multitask project for the Analytical Services Division (EM-263) within the US Department of Energy (DOE) Office of Environmental Management. This project focuses on improvement of radioanalytical methods with an emphasis on faster and cheaper routine methods. We have developed improved methods, for separation of environmental levels of technetium-99 and strontium-89/90, radium, and actinides from soil and water; and for separation of actinides from soil and water matrix interferences. Among the novel separation techniques being used are element- and class-specific resins and membranes. (The 3M Corporation is commercializing Empore trademark membranes under a cooperative research and development agreement [CRADA] initiated under this project). We have also developed methods for simultaneous detection of multiple isotopes using inductively coupled plasma-mass spectrometry (ICP-MS). The ICP-MS method requires less rigorous chemical separations than traditional radiochemical analyses because of its mass-selective mode of detection. Actinides and their progeny have been isolated and concentrated from a variety of natural water matrices by using automated batch separation incorporating selective resins prior to ICP-MS analyses. In addition, improvements in detection limits, sample volume, and time of analysis were obtained by using other sample introduction techniques, such as ultrasonic nebulization and electrothermal vaporization. Integration and automation of the separation methods with the ICP-MS methodology by using flow injection analysis is underway, with an objective of automating methods to achieve more reproducible results, reduce labor costs, cut analysis time, and minimize secondary waste generation through miniaturization of the process

Project Method, as One of the Basic Methods of Environmental Education

Science.gov (United States)

Szállassy, Noémi

2008-01-01

Our aim was to present in this paper the one of the most important methods of environmental education, the project method. We present here the steps and phases of project method and we give an example of how to use these elements in planning an activity for celebrating the World Day for Water.

Methods of nonlinear analysis

CERN Document Server

Bellman, Richard Ernest

1970-01-01

In this book, we study theoretical and practical aspects of computing methods for mathematical modelling of nonlinear systems. A number of computing techniques are considered, such as methods of operator approximation with any given accuracy; operator interpolation techniques including a non-Lagrange interpolation; methods of system representation subject to constraints associated with concepts of causality, memory and stationarity; methods of system representation with an accuracy that is the best within a given class of models; methods of covariance matrix estimation;methods for low-rank mat

Transport methods: general. 1. The Analytical Monte Carlo Method for Radiation Transport Calculations

International Nuclear Information System (INIS)

Martin, William R.; Brown, Forrest B.

2001-01-01

We present an alternative Monte Carlo method for solving the coupled equations of radiation transport and material energy. This method is based on incorporating the analytical solution to the material energy equation directly into the Monte Carlo simulation for the radiation intensity. This method, which we call the Analytical Monte Carlo (AMC) method, differs from the well known Implicit Monte Carlo (IMC) method of Fleck and Cummings because there is no discretization of the material energy equation since it is solved as a by-product of the Monte Carlo simulation of the transport equation. Our method also differs from the method recently proposed by Ahrens and Larsen since they use Monte Carlo to solve both equations, while we are solving only the radiation transport equation with Monte Carlo, albeit with effective sources and cross sections to represent the emission sources. Our method bears some similarity to a method developed and implemented by Carter and Forest nearly three decades ago, but there are substantive differences. We have implemented our method in a simple zero-dimensional Monte Carlo code to test the feasibility of the method, and the preliminary results are very promising, justifying further extension to more realistic geometries. (authors)

Two different hematocrit detection methods: Different methods, different results?

Directory of Open Access Journals (Sweden)

Schuepbach Reto A

2010-03-01

Full Text Available Abstract Background Less is known about the influence of hematocrit detection methodology on transfusion triggers. Therefore, the aim of the present study was to compare two different hematocrit-assessing methods. In a total of 50 critically ill patients hematocrit was analyzed using (1 blood gas analyzer (ABLflex 800 and (2 the central laboratory method (ADVIA® 2120 and compared. Findings Bland-Altman analysis for repeated measurements showed a good correlation with a bias of +1.39% and 2 SD of ± 3.12%. The 24%-hematocrit-group showed a correlation of r2 = 0.87. With a kappa of 0.56, 22.7% of the cases would have been transfused differently. In the-28%-hematocrit group with a similar correlation (r2 = 0.8 and a kappa of 0.58, 21% of the cases would have been transfused differently. Conclusions Despite a good agreement between the two methods used to determine hematocrit in clinical routine, the calculated difference of 1.4% might substantially influence transfusion triggers depending on the employed method.

Method Mixins

DEFF Research Database (Denmark)

Ernst, Erik

2005-01-01

The world of programming has been conquered by the procedure call mechanism, including object-oriented method invocation which is a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior...... of abstraction and reuse. Method mixins use shared name spaces to transfer information between caller and callee, as opposed to traditional invocation which uses parameters and returned results. This relieves the caller from dependencies on the callee, and it allows direct transfer of information further down...... the call stack, e.g., to a callee's callee. The mechanism has been implemented in the programming language gbeta. Variants of the mechanism could be added to almost any imperative programming language....

Dianhydrides, polyimides, methods of making each, and methods of use

KAUST Repository

Ma, Xiaohua; Pinnau, Ingo; Ghanem, Bader

2015-01-01

Embodiments of the present disclosure provide for an aromatic dianhydride, a method of making an aromatic dianhydride, an aromatic dianhydride-based polyimide, a method of making an aromatic dianhydride-based polyimide, and the like.

Dianhydrides, polyimides, methods of making each, and methods of use

KAUST Repository

Ma, Xiaohua

2015-01-08

Embodiments of the present disclosure provide for an aromatic dianhydride, a method of making an aromatic dianhydride, an aromatic dianhydride-based polyimide, a method of making an aromatic dianhydride-based polyimide, and the like.

The Method of Manufactured Universes for validating uncertainty quantification methods

KAUST Repository

Stripling, H.F.; Adams, M.L.; McClarren, R.G.; Mallick, B.K.

2011-01-01

The Method of Manufactured Universes is presented as a validation framework for uncertainty quantification (UQ) methodologies and as a tool for exploring the effects of statistical and modeling assumptions embedded in these methods. The framework

Design Methods in Practice

DEFF Research Database (Denmark)

Jensen, Torben Elgaard; Andreasen, Mogens Myrup

2010-01-01

The paper challenges the dominant and widespread view that a good design method will guarantee a systematic approach as well as certain results. First, it explores the substantial differences between on the one hand the conception of methods implied in Pahl & Beitz’s widely recognized text book...... on engineering design, and on the other hand the understanding of method use, which has emerged from micro-sociological studies of practice (ethnomethodology). Second, it reviews a number of case studies conducted by engineering students, who were instructed to investigate the actual use of design methods...... in Danish companies. The paper concludes that design methods in practice deviate substantially from Pahl & Beitz’s description of method use: The object and problems, which are the starting points for method use, are more contested and less given than generally assumed; The steps of methods are often...

FPGA Implementation of the Coupled Filtering Method and the Affine Warping Method.

Science.gov (United States)

Zhang, Chen; Liang, Tianzhu; Mok, Philip K T; Yu, Weichuan

2017-07-01

In ultrasound image analysis, the speckle tracking methods are widely applied to study the elasticity of body tissue. However, "feature-motion decorrelation" still remains as a challenge for the speckle tracking methods. Recently, a coupled filtering method and an affine warping method were proposed to accurately estimate strain values, when the tissue deformation is large. The major drawback of these methods is the high computational complexity. Even the graphics processing unit (GPU)-based program requires a long time to finish the analysis. In this paper, we propose field-programmable gate array (FPGA)-based implementations of both methods for further acceleration. The capability of FPGAs on handling different image processing components in these methods is discussed. A fast and memory-saving image warping approach is proposed. The algorithms are reformulated to build a highly efficient pipeline on FPGA. The final implementations on a Xilinx Virtex-7 FPGA are at least 13 times faster than the GPU implementation on the NVIDIA graphic card (GeForce GTX 580).

Methods for assessing geodiversity

Science.gov (United States)

Zwoliński, Zbigniew; Najwer, Alicja; Giardino, Marco

2017-04-01

The accepted systematics of geodiversity assessment methods will be presented in three categories: qualitative, quantitative and qualitative-quantitative. Qualitative methods are usually descriptive methods that are suited to nominal and ordinal data. Quantitative methods use a different set of parameters and indicators to determine the characteristics of geodiversity in the area being researched. Qualitative-quantitative methods are a good combination of the collection of quantitative data (i.e. digital) and cause-effect data (i.e. relational and explanatory). It seems that at the current stage of the development of geodiversity research methods, qualitative-quantitative methods are the most advanced and best assess the geodiversity of the study area. Their particular advantage is the integration of data from different sources and with different substantive content. Among the distinguishing features of the quantitative and qualitative-quantitative methods for assessing geodiversity are their wide use within geographic information systems, both at the stage of data collection and data integration, as well as numerical processing and their presentation. The unresolved problem for these methods, however, is the possibility of their validation. It seems that currently the best method of validation is direct filed confrontation. Looking to the next few years, the development of qualitative-quantitative methods connected with cognitive issues should be expected, oriented towards ontology and the Semantic Web.

Mixed methods research.

Science.gov (United States)

Halcomb, Elizabeth; Hickman, Louise

2015-04-08

Mixed methods research involves the use of qualitative and quantitative data in a single research project. It represents an alternative methodological approach, combining qualitative and quantitative research approaches, which enables nurse researchers to explore complex phenomena in detail. This article provides a practical overview of mixed methods research and its application in nursing, to guide the novice researcher considering a mixed methods research project.

Exchange and polarization effects in the elementary excitation spectrum of a hydrogen atom immersed in a hot plasma

International Nuclear Information System (INIS)

Dharma-wardana, M.W.C.; Grimaldi, F.; Lecourt, A.; Pellissier, J.

1980-01-01

The one-particle hydrogenic Green's function has been calculated for a partially ionized plasma consisting of hydrogen atoms, electrons, and protons at high temperatures. The theoretical method extends a previous publication and involves an evaluation of the mass operator in the Dyson equation to include proper self-energy parts to ''all orders'' in the screened interaction. This mass operator characterizes the effective micropotential felt by the atom in the plasma and determines all of the one-particle properties and some two-particle properties associated with the atomic subsystem. The first-order mass operator is nonzero only for exchange scattering, which leads to a frequency-independent exchange shift. This temperature- and density-dependent theory of the exchange shift replaces the usual semiphenomenological schemes based on the Slater-Kohn-Sham type of theory. The exchange-shifted Green's functions are used in evaluating the higher-order contributions. Computer calculations and the resolution of the poles of the Green's function lead to level shifts, widths, and spectral functions. These are calculated within both the second-order and the all-order theory. The second-order theory, which may be valid at sufficiently high densities and in turbulent plasmas, overemphasises the atom-plasmon coupling and shows new structures. The inclusion of contributions beyond second order removes these structures and produces a more ''conventional'' spectral-intensity function. The effects of center-of-mass motion on the level shifts and level profiles are investigated and the onset of plasma instabilities touched upon. These calculations make contact with the work on ''plasma-polarization shifts'' and provide an approach to q,ω-dependent plasma microfields

Charge transfer excitations from excited state Hartree-Fock subsequent minimization scheme

International Nuclear Information System (INIS)

Theophilou, Iris; Tassi, M.; Thanos, S.

2014-01-01

Photoinduced charge-transfer processes play a key role for novel photovoltaic phenomena and devices. Thus, the development of ab initio methods that allow for an accurate and computationally inexpensive treatment of charge-transfer excitations is a topic that nowadays attracts a lot of scientific attention. In this paper we extend an approach recently introduced for the description of single and double excitations [M. Tassi, I. Theophilou, and S. Thanos, Int. J. Quantum Chem. 113, 690 (2013); M. Tassi, I. Theophilou, and S. Thanos, J. Chem. Phys. 138, 124107 (2013)] to allow for the description of intermolecular charge-transfer excitations. We describe an excitation where an electron is transferred from a donor system to an acceptor one, keeping the excited state orthogonal to the ground state and avoiding variational collapse. These conditions are achieved by decomposing the space spanned by the Hartree-Fock (HF) ground state orbitals into four subspaces: The subspace spanned by the occupied orbitals that are localized in the region of the donor molecule, the corresponding for the acceptor ones and two more subspaces containing the virtual orbitals that are localized in the neighborhood of the donor and the acceptor, respectively. Next, we create a Slater determinant with a hole in the subspace of occupied orbitals of the donor and a particle in the virtual subspace of the acceptor. Subsequently we optimize both the hole and the particle by minimizing the HF energy functional in the corresponding subspaces. Finally, we test our approach by calculating the lowest charge-transfer excitation energies for a set of tetracyanoethylene-hydrocarbon complexes that have been used earlier as a test set for such kind of excitations

Recent Advances in the Method of Forces: Integrated Force Method of Structural Analysis

Science.gov (United States)

Patnaik, Surya N.; Coroneos, Rula M.; Hopkins, Dale A.

1998-01-01

Stress that can be induced in an elastic continuum can be determined directly through the simultaneous application of the equilibrium equations and the compatibility conditions. In the literature, this direct stress formulation is referred to as the integrated force method. This method, which uses forces as the primary unknowns, complements the popular equilibrium-based stiffness method, which considers displacements as the unknowns. The integrated force method produces accurate stress, displacement, and frequency results even for modest finite element models. This version of the force method should be developed as an alternative to the stiffness method because the latter method, which has been researched for the past several decades, may have entered its developmental plateau. Stress plays a primary role in the development of aerospace and other products, and its analysis is difficult. Therefore, it is advisable to use both methods to calculate stress and eliminate errors through comparison. This paper examines the role of the integrated force method in analysis, animation and design.

Test Methods for Evaluating Solid Waste, Physical/Chemical Methods. First Update. (3rd edition)

International Nuclear Information System (INIS)

Friedman; Sellers.

1988-01-01

The proposed Update is for Test Methods for Evaluating Solid Waste, Physical/Chemical Methods, SW-846, Third Edition. Attached to the report is a list of methods included in the proposed update indicating whether the method is a new method, a partially revised method, or a totally revised method. Do not discard or replace any of the current pages in the SW-846 manual until the proposed update I package is promulgated. Until promulgation of the update package, the methods in the update package are not officially part of the SW-846 manual and thus do not carry the status of EPA-approved methods. In addition to the proposed Update, six finalized methods are included for immediate inclusion into the Third Edition of SW-846. Four methods, originally proposed October 1, 1984, will be finalized in a soon to be released rulemaking. They are, however, being submitted to subscribers for the first time in the update. These methods are 7211, 7381, 7461, and 7951. Two other methods were finalized in the 2nd Edition of SW-846. They were inadvertantly omitted from the 3rd Edition and are not being proposed as new. These methods are 7081 and 7761

Consumer Behavior Research Methods

DEFF Research Database (Denmark)

Chrysochou, Polymeros

2017-01-01

This chapter starts by distinguishing consumer behavior research methods based on the type of data used, being either secondary or primary. Most consumer behavior research studies phenomena that require researchers to enter the field and collect data on their own, and therefore the chapter...... emphasizes the discussion of primary research methods. Based on the nature of the data primary research methods are further distinguished into qualitative and quantitative. The chapter describes the most important and popular qualitative and quantitative methods. It concludes with an overall evaluation...... of the methods and how to improve quality in consumer behavior research methods....

Comparative study of the geostatistical ore reserve estimation method over the conventional methods

International Nuclear Information System (INIS)

Kim, Y.C.; Knudsen, H.P.

1975-01-01

Part I contains a comprehensive treatment of the comparative study of the geostatistical ore reserve estimation method over the conventional methods. The conventional methods chosen for comparison were: (a) the polygon method, (b) the inverse of the distance squared method, and (c) a method similar to (b) but allowing different weights in different directions. Briefly, the overall result from this comparative study is in favor of the use of geostatistics in most cases because the method has lived up to its theoretical claims. A good exposition on the theory of geostatistics, the adopted study procedures, conclusions and recommended future research are given in Part I. Part II of this report contains the results of the second and the third study objectives, which are to assess the potential benefits that can be derived by the introduction of the geostatistical method to the current state-of-the-art in uranium reserve estimation method and to be instrumental in generating the acceptance of the new method by practitioners through illustrative examples, assuming its superiority and practicality. These are given in the form of illustrative examples on the use of geostatistics and the accompanying computer program user's guide

Qualitative methods textbooks

OpenAIRE

Barndt, William

2003-01-01

Over the past few years, the number of political science departments offering qualitative methods courses has grown substantially. The number of qualitative methods textbooks has kept pace, providing instructors with an overwhelming array of choices. But how to decide which text to choose from this exhortatory smorgasbord? The scholarship desperately needs evaluated. Yet the task is not entirely straightforward: qualitative methods textbooks reflect the diversity inherent in qualitative metho...

Statistical error estimation of the Feynman-α method using the bootstrap method

International Nuclear Information System (INIS)

Endo, Tomohiro; Yamamoto, Akio; Yagi, Takahiro; Pyeon, Cheol Ho

2016-01-01

Applicability of the bootstrap method is investigated to estimate the statistical error of the Feynman-α method, which is one of the subcritical measurement techniques on the basis of reactor noise analysis. In the Feynman-α method, the statistical error can be simply estimated from multiple measurements of reactor noise, however it requires additional measurement time to repeat the multiple times of measurements. Using a resampling technique called 'bootstrap method' standard deviation and confidence interval of measurement results obtained by the Feynman-α method can be estimated as the statistical error, using only a single measurement of reactor noise. In order to validate our proposed technique, we carried out a passive measurement of reactor noise without any external source, i.e. with only inherent neutron source by spontaneous fission and (α,n) reactions in nuclear fuels at the Kyoto University Criticality Assembly. Through the actual measurement, it is confirmed that the bootstrap method is applicable to approximately estimate the statistical error of measurement results obtained by the Feynman-α method. (author)

The use of the spectral method within the fast adaptive composite grid method

Energy Technology Data Exchange (ETDEWEB)

McKay, S.M.

1994-12-31

The use of efficient algorithms for the solution of partial differential equations has been sought for many years. The fast adaptive composite grid (FAC) method combines an efficient algorithm with high accuracy to obtain low cost solutions to partial differential equations. The FAC method achieves fast solution by combining solutions on different grids with varying discretizations and using multigrid like techniques to find fast solution. Recently, the continuous FAC (CFAC) method has been developed which utilizes an analytic solution within a subdomain to iterate to a solution of the problem. This has been shown to achieve excellent results when the analytic solution can be found. The CFAC method will be extended to allow solvers which construct a function for the solution, e.g., spectral and finite element methods. In this discussion, the spectral methods will be used to provide a fast, accurate solution to the partial differential equation. As spectral methods are more accurate than finite difference methods, the ensuing accuracy from this hybrid method outside of the subdomain will be investigated.

Methods for measurement of electron emission yield under low energy electron-irradiation by collector method and Kelvin probe method

Energy Technology Data Exchange (ETDEWEB)

Tondu, Thomas; Belhaj, Mohamed; Inguimbert, Virginie [Onera, DESP, 2 Avenue Edouard Belin, 31400 Toulouse (France); Onera, DESP, 2 Avenue Edouard Belin, 31400 Toulouse, France and Fondation STAE, 4 allee Emile Monso, BP 84234-31432, Toulouse Cedex 4 (France); Onera, DESP, 2 Avenue Edouard Belin, 31400 Toulouse (France)

2010-09-15

Secondary electron emission yield of gold under electron impact at normal incidence below 50 eV was investigated by the classical collector method and by the Kelvin probe method. The authors show that biasing a collector to ensure secondary electron collection while keeping the target grounded can lead to primary electron beam perturbations. Thus reliable secondary electron emission yield at low primary electron energy cannot be obtained with a biased collector. The authors present two collector-free methods based on current measurement and on electron pulse surface potential buildup (Kelvin probe method). These methods are consistent, but at very low energy, measurements become sensitive to the earth magnetic field (below 10 eV). For gold, the authors can extrapolate total emission yield at 0 eV to 0.5, while a total electron emission yield of 1 is obtained at 40{+-}1 eV.

Methods for measurement of electron emission yield under low energy electron-irradiation by collector method and Kelvin probe method

International Nuclear Information System (INIS)

Tondu, Thomas; Belhaj, Mohamed; Inguimbert, Virginie

2010-01-01

Secondary electron emission yield of gold under electron impact at normal incidence below 50 eV was investigated by the classical collector method and by the Kelvin probe method. The authors show that biasing a collector to ensure secondary electron collection while keeping the target grounded can lead to primary electron beam perturbations. Thus reliable secondary electron emission yield at low primary electron energy cannot be obtained with a biased collector. The authors present two collector-free methods based on current measurement and on electron pulse surface potential buildup (Kelvin probe method). These methods are consistent, but at very low energy, measurements become sensitive to the earth magnetic field (below 10 eV). For gold, the authors can extrapolate total emission yield at 0 eV to 0.5, while a total electron emission yield of 1 is obtained at 40±1 eV.

Rossi Alpha Method

International Nuclear Information System (INIS)

Hansen, G.E.

1985-01-01

The Rossi Alpha Method has proved to be valuable for the determination of prompt neutron lifetimes in fissile assemblies having known reproduction numbers at or near delayed critical. This workshop report emphasizes the pioneering applications of the method by Dr. John D. Orndoff to fast-neutron critical assemblies at Los Alamos. The value of the method appears to disappear for subcritical systems where the Rossi-α is no longer an α-eigenvalue

Semi top-down method combined with earth-bank, an effective method for basement construction.

Science.gov (United States)

Tuan, B. Q.; Tam, Ng M.

2018-04-01

Choosing an appropriate method of deep excavation not only plays a decisive role in technical success, but also in economics of the construction project. Presently, we mainly base on to key methods: “Bottom-up” and “Top-down” construction method. Right now, this paper presents an another method of construction that is “Semi Top-down method combining with earth-bank” in order to take the advantages and limit the weakness of the above methods. The Bottom-up method was improved by using the earth-bank to stabilize retaining walls instead of the bracing steel struts. The Top-down method was improved by using the open cut method for the half of the earthwork quantities.

Stochastic optimization methods

CERN Document Server

Marti, Kurt

2005-01-01

Optimization problems arising in practice involve random parameters. For the computation of robust optimal solutions, i.e., optimal solutions being insensitive with respect to random parameter variations, deterministic substitute problems are needed. Based on the distribution of the random data, and using decision theoretical concepts, optimization problems under stochastic uncertainty are converted into deterministic substitute problems. Due to the occurring probabilities and expectations, approximative solution techniques must be applied. Deterministic and stochastic approximation methods and their analytical properties are provided: Taylor expansion, regression and response surface methods, probability inequalities, First Order Reliability Methods, convex approximation/deterministic descent directions/efficient points, stochastic approximation methods, differentiation of probability and mean value functions. Convergence results of the resulting iterative solution procedures are given.

Methods of Software Verification

Directory of Open Access Journals (Sweden)

R. E. Gurin

2015-01-01

Full Text Available This article is devoted to the problem of software verification (SW. Methods of software verification designed to check the software for compliance with the stated requirements such as correctness, system security and system adaptability to small changes in the environment, portability and compatibility, etc. These are various methods both by the operation process and by the way of achieving result. The article describes the static and dynamic methods of software verification and paid attention to the method of symbolic execution. In its review of static analysis are discussed and described the deductive method, and methods for testing the model. A relevant issue of the pros and cons of a particular method is emphasized. The article considers classification of test techniques for each method. In this paper we present and analyze the characteristics and mechanisms of the static analysis of dependencies, as well as their views, which can reduce the number of false positives in situations where the current state of the program combines two or more states obtained both in different paths of execution and in working with multiple object values. Dependences connect various types of software objects: single variables, the elements of composite variables (structure fields, array elements, the size of the heap areas, the length of lines, the number of initialized array elements in the verification code using static methods. The article pays attention to the identification of dependencies within the framework of the abstract interpretation, as well as gives an overview and analysis of the inference tools.Methods of dynamic analysis such as testing, monitoring and profiling are presented and analyzed. Also some kinds of tools are considered which can be applied to the software when using the methods of dynamic analysis. Based on the work a conclusion is drawn, which describes the most relevant problems of analysis techniques, methods of their solutions and

Winter Holts Oscillatory Method: A New Method of Resampling in Time Series.

Directory of Open Access Journals (Sweden)

Muhammad Imtiaz Subhani

2016-12-01

Full Text Available The core proposition behind this research is to create innovative methods of bootstrapping that can be applied in time series data. In order to find new methods of bootstrapping, various methods were reviewed; The data of automotive Sales, Market Shares and Net Exports of the top 10 countries, which includes China, Europe, United States of America (USA, Japan, Germany, South Korea, India, Mexico, Brazil, Spain and, Canada from 2002 to 2014 were collected through various sources which includes UN Comtrade, Index Mundi and World Bank. The findings of this paper confirmed that Bootstrapping for resampling through winter forecasting by Oscillation and Average methods give more robust results than the winter forecasting by any general methods.

The discrete ordinate method in association with the finite-volume method in non-structured mesh; Methode des ordonnees discretes associee a la methode des volumes finis en maillage non structure

Energy Technology Data Exchange (ETDEWEB)

Le Dez, V; Lallemand, M [Ecole Nationale Superieure de Mecanique et d` Aerotechnique (ENSMA), 86 - Poitiers (France); Sakami, M; Charette, A [Quebec Univ., Chicoutimi, PQ (Canada). Dept. des Sciences Appliquees

1997-12-31

The description of an efficient method of radiant heat transfer field determination in a grey semi-transparent environment included in a 2-D polygonal cavity with surface boundaries that reflect the radiation in a purely diffusive manner is proposed, at the equilibrium and in radiation-conduction coupling situation. The technique uses simultaneously the finite-volume method in non-structured triangular mesh, the discrete ordinate method and the ray shooting method. The main mathematical developments and comparative results with the discrete ordinate method in orthogonal curvilinear coordinates are included. (J.S.) 10 refs.

The discrete ordinate method in association with the finite-volume method in non-structured mesh; Methode des ordonnees discretes associee a la methode des volumes finis en maillage non structure

Energy Technology Data Exchange (ETDEWEB)

Le Dez, V.; Lallemand, M. [Ecole Nationale Superieure de Mecanique et d`Aerotechnique (ENSMA), 86 - Poitiers (France); Sakami, M.; Charette, A. [Quebec Univ., Chicoutimi, PQ (Canada). Dept. des Sciences Appliquees

1996-12-31

The description of an efficient method of radiant heat transfer field determination in a grey semi-transparent environment included in a 2-D polygonal cavity with surface boundaries that reflect the radiation in a purely diffusive manner is proposed, at the equilibrium and in radiation-conduction coupling situation. The technique uses simultaneously the finite-volume method in non-structured triangular mesh, the discrete ordinate method and the ray shooting method. The main mathematical developments and comparative results with the discrete ordinate method in orthogonal curvilinear coordinates are included. (J.S.) 10 refs.

Development of 3-D FBR heterogeneous core calculation method based on characteristics method

International Nuclear Information System (INIS)

Takeda, Toshikazu; Maruyama, Manabu; Hamada, Yuzuru; Nishi, Hiroshi; Ishibashi, Junichi; Kitano, Akihiro

2002-01-01

A new 3-D transport calculation method taking into account the heterogeneity of fuel assemblies has been developed by combining the characteristics method and the nodal transport method. In the axial direction the nodal transport method is applied, and the characteristics method is applied to take into account the radial heterogeneity of fuel assemblies. The numerical calculations have been performed to verify 2-D radial calculations of FBR assemblies and partial core calculations. Results are compared with the reference Monte-Carlo calculations. A good agreement has been achieved. It is shown that the present method has an advantage in calculating reaction rates in a small region

Comparison of Monte Carlo method and deterministic method for neutron transport calculation

International Nuclear Information System (INIS)

Mori, Takamasa; Nakagawa, Masayuki

1987-01-01

The report outlines major features of the Monte Carlo method by citing various applications of the method and techniques used for Monte Carlo codes. Major areas of its application include analysis of measurements on fast critical assemblies, nuclear fusion reactor neutronics analysis, criticality safety analysis, evaluation by VIM code, and calculation for shielding. Major techniques used for Monte Carlo codes include the random walk method, geometric expression method (combinatorial geometry, 1, 2, 4-th degree surface and lattice geometry), nuclear data expression, evaluation method (track length, collision, analog (absorption), surface crossing, point), and dispersion reduction (Russian roulette, splitting, exponential transform, importance sampling, corrected sampling). Major features of the Monte Carlo method are as follows: 1) neutron source distribution and systems of complex geometry can be simulated accurately, 2) physical quantities such as neutron flux in a place, on a surface or at a point can be evaluated, and 3) calculation requires less time. (Nogami, K.)

Angular correlation methods

International Nuclear Information System (INIS)

Ferguson, A.J.

1974-01-01

An outline of the theory of angular correlations is presented, and the difference between the modern density matrix method and the traditional wave function method is stressed. Comments are offered on particular angular correlation theoretical techniques. A brief discussion is given of recent studies of gamma ray angular correlations of reaction products recoiling with high velocity into vacuum. Two methods for optimization to obtain the most accurate expansion coefficients of the correlation are discussed. (1 figure, 53 references) (U.S.)

The Box Method

DEFF Research Database (Denmark)

Nielsen, Peter Vilhelm

The velocity level in a room ventilated by jet ventilation is strongly influenced by the supply conditions. The momentum flow in the supply jets controls the air movement in the room and, therefore, it is very important that the inlet conditions and the numerical method can generate a satisfactor...... description of this momentum flow. The Box Method is a practical method for the description of an Air Terminal Device which will save grid points and ensure the right level of the momentum flow....

Decentralized Quasi-Newton Methods

Science.gov (United States)

Eisen, Mark; Mokhtari, Aryan; Ribeiro, Alejandro

2017-05-01

We introduce the decentralized Broyden-Fletcher-Goldfarb-Shanno (D-BFGS) method as a variation of the BFGS quasi-Newton method for solving decentralized optimization problems. The D-BFGS method is of interest in problems that are not well conditioned, making first order decentralized methods ineffective, and in which second order information is not readily available, making second order decentralized methods impossible. D-BFGS is a fully distributed algorithm in which nodes approximate curvature information of themselves and their neighbors through the satisfaction of a secant condition. We additionally provide a formulation of the algorithm in asynchronous settings. Convergence of D-BFGS is established formally in both the synchronous and asynchronous settings and strong performance advantages relative to first order methods are shown numerically.

Dissolution Methods Database

Data.gov (United States)

U.S. Department of Health & Human Services — For a drug product that does not have a dissolution test method in the United States Pharmacopeia (USP), the FDA Dissolution Methods Database provides information on...

The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda bears a novel gene order and unusual control region features

Directory of Open Access Journals (Sweden)

Podsiadlowski Lars

2006-09-01

Full Text Available Abstract Background Sequence data and other characters from mitochondrial genomes (gene translocations, secondary structure of RNA molecules are useful in phylogenetic studies among metazoan animals from population to phylum level. Moreover, the comparison of complete mitochondrial sequences gives valuable information about the evolution of small genomes, e.g. about different mechanisms of gene translocation, gene duplication and gene loss, or concerning nucleotide frequency biases. The Peracarida (gammarids, isopods, etc. comprise about 21,000 species of crustaceans, living in many environments from deep sea floor to arid terrestrial habitats. Ligia oceanica is a terrestrial isopod living at rocky seashores of the european North Sea and Atlantic coastlines. Results The study reveals the first complete mitochondrial DNA sequence from a peracarid crustacean. The mitochondrial genome of Ligia oceanica is a circular double-stranded DNA molecule, with a size of 15,289 bp. It shows several changes in mitochondrial gene order compared to other crustacean species. An overview about mitochondrial gene order of all crustacean taxa yet sequenced is also presented. The largest non-coding part (the putative mitochondrial control region of the mitochondrial genome of Ligia oceanica is unexpectedly not AT-rich compared to the remainder of the genome. It bears two repeat regions (4× 10 bp and 3× 64 bp, and a GC-rich hairpin-like secondary structure. Some of the transfer RNAs show secondary structures which derive from the usual cloverleaf pattern. While some tRNA genes are putative targets for RNA editing, trnR could not be localized at all. Conclusion Gene order is not conserved among Peracarida, not even among isopods. The two isopod species Ligia oceanica and Idotea baltica show a similarly derived gene order, compared to the arthropod ground pattern and to the amphipod Parhyale hawaiiensis, suggesting that most of the translocation events were already present the last common ancestor of these isopods. Beyond that, the positions of three tRNA genes differ in the two isopod species. Strand bias in nucleotide frequency is reversed in both isopod species compared to other Malacostraca. This is probably due to a reversal of the replication origin, which is further supported by the fact that the hairpin structure typically found in the control region shows a reversed orientation in the isopod species, compared to other crustaceans.

The ICARE Method

Science.gov (United States)

Henke, Luke

2010-01-01

The ICARE method is a flexible, widely applicable method for systems engineers to solve problems and resolve issues in a complete and comprehensive manner. The method can be tailored by diverse users for direct application to their function (e.g. system integrators, design engineers, technical discipline leads, analysts, etc.). The clever acronym, ICARE, instills the attitude of accountability, safety, technical rigor and engagement in the problem resolution: Identify, Communicate, Assess, Report, Execute (ICARE). This method was developed through observation of Space Shuttle Propulsion Systems Engineering and Integration (PSE&I) office personnel approach in an attempt to succinctly describe the actions of an effective systems engineer. Additionally it evolved from an effort to make a broadly-defined checklist for a PSE&I worker to perform their responsibilities in an iterative and recursive manner. The National Aeronautics and Space Administration (NASA) Systems Engineering Handbook states, engineering of NASA systems requires a systematic and disciplined set of processes that are applied recursively and iteratively for the design, development, operation, maintenance, and closeout of systems throughout the life cycle of the programs and projects. ICARE is a method that can be applied within the boundaries and requirements of NASA s systems engineering set of processes to provide an elevated sense of duty and responsibility to crew and vehicle safety. The importance of a disciplined set of processes and a safety-conscious mindset increases with the complexity of the system. Moreover, the larger the system and the larger the workforce, the more important it is to encourage the usage of the ICARE method as widely as possible. According to the NASA Systems Engineering Handbook, elements of a system can include people, hardware, software, facilities, policies and documents; all things required to produce system-level results, qualities, properties, characteristics

Ensemble Data Mining Methods

Data.gov (United States)

National Aeronautics and Space Administration — Ensemble Data Mining Methods, also known as Committee Methods or Model Combiners, are machine learning methods that leverage the power of multiple models to achieve...

Simulation of Rossi-α method with analog Monte-Carlo method

International Nuclear Information System (INIS)

Lu Yuzhao; Xie Qilin; Song Lingli; Liu Hangang

2012-01-01

The analog Monte-Carlo code for simulating Rossi-α method based on Geant4 was developed. The prompt neutron decay constant α of six metal uranium configurations in Oak Ridge National Laboratory were calculated. α was also calculated by Burst-Neutron method and the result was consistent with the result of Rossi-α method. There is the difference between results of analog Monte-Carlo simulation and experiment, and the reasons for the difference is the gaps between uranium layers. The influence of gaps decrease as the sub-criticality deepens. The relative difference between results of analog Monte-Carlo simulation and experiment changes from 19% to 0.19%. (authors)

Method Usage in Design : How methods function as mental tools for designers

NARCIS (Netherlands)

Daalhuizen, J.J.

2014-01-01

Methods are means to help designers achieve desired change as efficiently and effectively as possible. Methods can be used to do so in the context of learning - to help teach students how to design on a professional level. Methods can also be used in the context of performance - to help designers

A highly accurate method for determination of dissolved oxygen: Gravimetric Winkler method

International Nuclear Information System (INIS)

Helm, Irja; Jalukse, Lauri; Leito, Ivo

2012-01-01

Highlights: ► Probably the most accurate method available for dissolved oxygen concentration measurement was developed. ► Careful analysis of uncertainty sources was carried out and the method was optimized for minimizing all uncertainty sources as far as practical. ► This development enables more accurate calibration of dissolved oxygen sensors for routine analysis than has been possible before. - Abstract: A high-accuracy Winkler titration method has been developed for determination of dissolved oxygen concentration. Careful analysis of uncertainty sources relevant to the Winkler method was carried out and the method was optimized for minimizing all uncertainty sources as far as practical. The most important improvements were: gravimetric measurement of all solutions, pre-titration to minimize the effect of iodine volatilization, accurate amperometric end point detection and careful accounting for dissolved oxygen in the reagents. As a result, the developed method is possibly the most accurate method of determination of dissolved oxygen available. Depending on measurement conditions and on the dissolved oxygen concentration the combined standard uncertainties of the method are in the range of 0.012–0.018 mg dm −3 corresponding to the k = 2 expanded uncertainty in the range of 0.023–0.035 mg dm −3 (0.27–0.38%, relative). This development enables more accurate calibration of electrochemical and optical dissolved oxygen sensors for routine analysis than has been possible before.

Rubidium-strontium method

International Nuclear Information System (INIS)

Dubansky, A.

1980-01-01

The rubidium-strontium geological dating method is based on the determination of the Rb and Sr isotope ratio in rocks, mainly using mass spectrometry. The method is only practical for silicate minerals and rocks, potassium feldspars and slates. Also described is the rubidium-strontium isochrone method. This, however, requires a significant amount of experimental data and an analysis of large quantities of samples, often of the order of tons. The results are tabulated of rubidium-strontium dating of geological formations in the Czech Socialist Republic. (M.S.)

An improved method for calculation of interface pressure force in PLIC-VOF methods

International Nuclear Information System (INIS)

Sefollahi, M.; Shirani, E.

2004-08-01

Conventional methods for the modeling of surface tension force in Piecewise Linear Interface Calculation-Volume of Fluid (PLIC-VOF) methods, such as Continuum Surface Force (CSF), Continuum Surface Stress (CSS) and also Meier's method, convert the surface tension force into a body force. Not only do they include the force in the interfacial cells but also in the neighboring cells. Thus they produce spurious currents. Also the pressure jump, due to the surface tension, is not calculated accurately in these methods. In this paper a more accurate method for the application of interface force in the computational modeling of free surfaces and interfaces which use PLIC-VOF methods is developed. This method is based on the evaluation of the surface tension force only in the interfacial cells and not the neighboring cells. Also the normal and the interface surface area needed for the calculation of the surface tension force is calculated more accurately. The present method is applied to a two-dimensional motionless drop of liquid and a bubble of gas as well as a non-circular two-dimensional drop, which oscillates due to the surface tension force, in an initially stagnant fluid with no gravity force. The results are compared with the results of the cases when CSF, CSS and Meier's methods are used. It is shown that the present method calculates pressure jump at the interface more accurately and produces less spurious currents comparing to CSS an CSF models. (author)

Methods That Matter: Integrating Mixed Methods for More Effective Social Science Research

Science.gov (United States)

Hay, M. Cameron, Ed.

2016-01-01

To do research that really makes a difference--the authors of this book argue--social scientists need questions and methods that reflect the complexity of the world. Bringing together a consortium of voices across a variety of fields, "Methods that Matter" offers compelling and successful examples of mixed methods research that do just…

Wielandt method applied to the diffusion equations discretized by finite element nodal methods

International Nuclear Information System (INIS)

Mugica R, A.; Valle G, E. del

2003-01-01

Nowadays the numerical methods of solution to the diffusion equation by means of algorithms and computer programs result so extensive due to the great number of routines and calculations that should carry out, this rebounds directly in the execution times of this programs, being obtained results in relatively long times. This work shows the application of an acceleration method of the convergence of the classic method of those powers that it reduces notably the number of necessary iterations for to obtain reliable results, what means that the compute times they see reduced in great measure. This method is known in the literature like Wielandt method and it has incorporated to a computer program that is based on the discretization of the neutron diffusion equations in plate geometry and stationary state by polynomial nodal methods. In this work the neutron diffusion equations are described for several energy groups and their discretization by means of those called physical nodal methods, being illustrated in particular the quadratic case. It is described a model problem widely described in the literature which is solved for the physical nodal grade schemes 1, 2, 3 and 4 in three different ways: to) with the classic method of the powers, b) method of the powers with the Wielandt acceleration and c) method of the powers with the Wielandt modified acceleration. The results for the model problem as well as for two additional problems known as benchmark problems are reported. Such acceleration method can also be implemented to problems of different geometry to the proposal in this work, besides being possible to extend their application to problems in 2 or 3 dimensions. (Author)

New models for intermolecular repulsion and their application to Van Der Waals complexes and crystals of organic molecules

International Nuclear Information System (INIS)

Tsui, H.H.Y.

2001-01-01

Model intermolecular potentials are required for simulations of molecules in the gas, liquid, or solid phase. The widely used isotropic atom-atom model potentials are empirically fitted and based on the assumptions of transferability, combining rules and that atoms in molecules are spherical. This thesis develops a non-empirical method of modelling repulsion by applying the overlap model, which we show as a general non-empirical method of deriving repulsion potentials for a specific molecule. In this thesis, the repulsion parameters for an exponential atom-atom model potential are obtained from the ab initio charge density of a small organic molecule by making the assumption that the repulsion is proportional to the overlap of a pair of molecules. The proportionality constant is fixed by a limited number of intermolecular perturbation theory (IMPT) calculations. To complete the model potential, the electrostatic interaction is represented by a distributed multipole analysis, and the Slater-Kirkwood formula is used for the dispersion. These non-empirical potentials can reproduce experimental crystal structure when applied to crystal structure prediction of an oxyboryl derivative. A detailed study on further improving the overlap model was carried out for phenol-water, by including other minor intermolecular contributions of charge-transfer and penetration. High quality ab initio calculations on the complex were performed for use in comparison. To compare with experimental data, diffusion Monte Carlo simulations were performed with the potential, so that the effects of anharmonic zero-point motion on structure and energy of the system are included. When the system is too large for an IMPT calculation, the proportionality constant can be determined empirically by fitting the cell volume as shown in our study of crystal structures of chlorothalonil. This is used with an anisotropic repulsion model that has been derived for Cl and N atoms in chlorothalonil. This model

Gamow-Teller response in the configuration space of a density-functional-theory-rooted no-core configuration-interaction model

Science.gov (United States)

Konieczka, M.; Kortelainen, M.; Satuła, W.

2018-03-01

Background: The atomic nucleus is a unique laboratory in which to study fundamental aspects of the electroweak interaction. This includes a question concerning in medium renormalization of the axial-vector current, which still lacks satisfactory explanation. Study of spin-isospin or Gamow-Teller (GT) response may provide valuable information on both the quenching of the axial-vector coupling constant as well as on nuclear structure and nuclear astrophysics. Purpose: We have performed a seminal calculation of the GT response by using the no-core configuration-interaction approach rooted in multireference density functional theory (DFT-NCCI). The model treats properly isospin and rotational symmetries and can be applied to calculate both the nuclear spectra and transition rates in atomic nuclei, irrespectively of their mass and particle-number parity. Methods: The DFT-NCCI calculation proceeds as follows: First, one builds a configuration space by computing relevant, for a given physical problem, (multi)particle-(multi)hole Slater determinants. Next, one applies the isospin and angular-momentum projections and performs the isospin and K mixing in order to construct a model space composed of linearly dependent states of good angular momentum. Eventually, one mixes the projected states by solving the Hill-Wheeler-Griffin equation. Results: The method is applied to compute the GT strength distribution in selected N ≈Z nuclei including the p -shell 8Li and 8Be nuclei and the s d -shell well-deformed nucleus 24Mg. In order to demonstrate a flexibility of the approach we present also a calculation of the superallowed GT β decay in doubly-magic spherical 100Sn and the low-spin spectrum in 100In. Conclusions: It is demonstrated that the DFT-NCCI model is capable of capturing the GT response satisfactorily well by using a relatively small configuration space, exhausting simultaneously the GT sum rule. The model, due to its flexibility and broad range of applicability, may

Nanotube structures, methods of making nanotube structures, and methods of accessing intracellular space

Science.gov (United States)

VanDersarl, Jules J.; Xu, Alexander M.; Melosh, Nicholas A.; Tayebi, Noureddine

2016-02-23

In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure, in one aspect, relate to methods of making a structure including nanotubes, a structure including nanotubes, methods of delivering a fluid to a cell, methods of removing a fluid to a cell, methods of accessing intracellular space, and the like.

Catalytic reforming methods

Science.gov (United States)

Tadd, Andrew R; Schwank, Johannes

2013-05-14

A catalytic reforming method is disclosed herein. The method includes sequentially supplying a plurality of feedstocks of variable compositions to a reformer. The method further includes adding a respective predetermined co-reactant to each of the plurality of feedstocks to obtain a substantially constant output from the reformer for the plurality of feedstocks. The respective predetermined co-reactant is based on a C/H/O atomic composition for a respective one of the plurality of feedstocks and a predetermined C/H/O atomic composition for the substantially constant output.

FREEZING AND THAWING TIME PREDICTION METHODS OF FOODS II: NUMARICAL METHODS

Directory of Open Access Journals (Sweden)

Yahya TÜLEK

1999-03-01

Full Text Available Freezing is one of the excellent methods for the preservation of foods. If freezing and thawing processes and frozen storage method are carried out correctly, the original characteristics of the foods can remain almost unchanged over an extended periods of time. It is very important to determine the freezing and thawing time period of the foods, as they strongly influence the both quality of food material and process productivity and the economy. For developing a simple and effectively usable mathematical model, less amount of process parameters and physical properties should be enrolled in calculations. But it is a difficult to have all of these in one prediction method. For this reason, various freezing and thawing time prediction methods were proposed in literature and research studies have been going on.

Divergence-Conforming Discontinuous Galerkin Methods and $C^0$ Interior Penalty Methods

KAUST Repository

Kanschat, Guido

2014-01-01

© 2014 Society for Industrial and Applied Mathematics. In this paper, we show that recently developed divergence-conforming methods for the Stokes problem have discrete stream functions. These stream functions in turn solve a continuous interior penalty problem for biharmonic equations. The equivalence is established for the most common methods in two dimensions based on interior penalty terms. Then, extensions of the concept to discontinuous Galerkin methods defined through lifting operators, for different weak formulations of the Stokes problem, and to three dimensions are discussed. Application of the equivalence result yields an optimal error estimate for the Stokes velocity without involving the pressure. Conversely, combined with a recent multigrid method for Stokes flow, we obtain a simple and uniform preconditioner for harmonic problems with simply supported and clamped boundary.

Earthquake prediction by Kina Method

International Nuclear Information System (INIS)

Kianoosh, H.; Keypour, H.; Naderzadeh, A.; Motlagh, H.F.

2005-01-01

Earthquake prediction has been one of the earliest desires of the man. Scientists have worked hard to predict earthquakes for a long time. The results of these efforts can generally be divided into two methods of prediction: 1) Statistical Method, and 2) Empirical Method. In the first method, earthquakes are predicted using statistics and probabilities, while the second method utilizes variety of precursors for earthquake prediction. The latter method is time consuming and more costly. However, the result of neither method has fully satisfied the man up to now. In this paper a new method entitled 'Kiana Method' is introduced for earthquake prediction. This method offers more accurate results yet lower cost comparing to other conventional methods. In Kiana method the electrical and magnetic precursors are measured in an area. Then, the time and the magnitude of an earthquake in the future is calculated using electrical, and in particular, electrical capacitors formulas. In this method, by daily measurement of electrical resistance in an area we make clear that the area is capable of earthquake occurrence in the future or not. If the result shows a positive sign, then the occurrence time and the magnitude can be estimated by the measured quantities. This paper explains the procedure and details of this prediction method. (authors)

Isotope methods in hydrology

International Nuclear Information System (INIS)

Moser, H.; Rauert, W.

1980-01-01

Of the investigation methods used in hydrology, tracer methods hold a special place as they are the only ones which give direct insight into the movement and distribution processes taking place in surface and ground waters. Besides the labelling of water with salts and dyes, as in the past, in recent years the use of isotopes in hydrology, in water research and use, in ground-water protection and in hydraulic engineering has increased. This by no means replaces proven methods of hydrological investigation but tends rather to complement and expand them through inter-disciplinary cooperation. The book offers a general introduction to the application of various isotope methods to specific hydrogeological and hydrological problems. The idea is to place the hydrogeologist and the hydrologist in the position to recognize which isotope method will help him solve his particular problem or indeed, make a solution possible at all. He should also be able to recognize what the prerequisites are and what work and expenditure the use of such methods involves. May the book contribute to promoting cooperation between hydrogeologists, hydrologists, hydraulic engineers and isotope specialists, and thus supplement proven methods of investigation in hydrological research and water utilization and protection wherever the use of isotope methods proves to be of advantage. (orig./HP) [de

Single-Case Designs and Qualitative Methods: Applying a Mixed Methods Research Perspective

Science.gov (United States)

Hitchcock, John H.; Nastasi, Bonnie K.; Summerville, Meredith

2010-01-01

The purpose of this conceptual paper is to describe a design that mixes single-case (sometimes referred to as single-subject) and qualitative methods, hereafter referred to as a single-case mixed methods design (SCD-MM). Minimal attention has been given to the topic of applying qualitative methods to SCD work in the literature. These two…

Radiochemistry methods in DOE Methods for Evaluating Environmental and Waste Management Samples: Addressing new challenges

International Nuclear Information System (INIS)

Fadeff, S.K.; Goheen, S.C.; Riley, R.G.

1994-01-01

Radiochemistry methods in Department of Energy Methods for Evaluating Environmental and Waste Management Samples (DOE Methods) add to the repertoire of other standard methods in support of U.S. Department of Energy environmental restoration and waste management (DOE/EM) radiochemical characterization activities. Current standard sources of radiochemistry methods are not always applicable for evaluating DOE/EM samples. Examples of current sources include those provided by the US Environmental Protection Agency, the American Society for Testing and Materials, Standard Methods for the Examination of Water and Wastewater, and Environmental Measurements Laboratory Procedures Manual (HASL-300). The applicability of these methods is generally limited to specific matrices (usually water), low-level radioactive samples, and a limited number of analytes. DOE Methods complements these current standard methods by addressing the complexities of EM characterization needs. The process for determining DOE/EM radiochemistry characterization needs is discussed. In this context of DOE/EM needs, the applicability of other sources of standard radiochemistry methods is defined, and gaps in methodology are identified. Current methods in DOE Methods and the EM characterization needs they address are discussed. Sources of new methods and the methods incorporation process are discussed. The means for individuals to participate in (1) identification of DOE/EM needs, (2) the methods incorporation process, and (3) submission of new methods are identified

The Generalized Sturmian Method

DEFF Research Database (Denmark)

Avery, James Emil

2011-01-01

these ideas clearly so that they become more accessible. By bringing together these non-standard methods, the book intends to inspire graduate students, postdoctoral researchers and academics to think of novel approaches. Is there a method out there that we have not thought of yet? Can we design a new method...... generations of researchers were left to work out how to achieve this ambitious goal for molecular systems of ever-increasing size. This book focuses on non-mainstream methods to solve the molecular electronic Schrödinger equation. Each method is based on a set of core ideas and this volume aims to explain...

Conformable variational iteration method

Directory of Open Access Journals (Sweden)

Omer Acan

2017-02-01

Full Text Available In this study, we introduce the conformable variational iteration method based on new defined fractional derivative called conformable fractional derivative. This new method is applied two fractional order ordinary differential equations. To see how the solutions of this method, linear homogeneous and non-linear non-homogeneous fractional ordinary differential equations are selected. Obtained results are compared the exact solutions and their graphics are plotted to demonstrate efficiency and accuracy of the method.

A rapid method for soil cement design : Louisiana slope value method.

Science.gov (United States)

1964-03-01

The current procedure used by the Louisiana Department of Highways for laboratory design of cement stabilized soil base and subbase courses is taken from standard AASHO test methods, patterned after Portland Cement Association criteria. These methods...

Inventory of LCIA selection methods for assessing toxic releases. Methods and typology report part B

DEFF Research Database (Denmark)

Larsen, Henrik Fred; Birkved, Morten; Hauschild, Michael Zwicky

method(s) in Work package 8 (WP8) of the OMNIITOX project. The selection methods and the other CRS methods are described in detail, a set of evaluation criteria are developed and the methods are evaluated against these criteria. This report (Deliverable 11B (D11B)) gives the results from task 7.1d, 7.1e......This report describes an inventory of Life Cycle Impact Assessment (LCIA) selection methods for assessing toxic releases. It consists of an inventory of current selection methods and other Chemical Ranking and Scoring (CRS) methods assessed to be relevant for the development of (a) new selection...... and 7.1f of WP 7 for selection methods. The other part of D11 (D11A) is reported in another report and deals with characterisation methods. A selection method is a method for prioritising chemical emissions to be included in an LCIA characterisation of toxic releases, i.e. calculating indicator scores...

New mixed finite-element methods

International Nuclear Information System (INIS)

Franca, L.P.

1987-01-01

New finite-element methods are proposed for mixed variational formulations. The methods are constructed by adding to the classical Galerkin method various least-squares like terms. The additional terms involve integrals over element interiors, and include mesh-parameter dependent coefficients. The methods are designed to enhance stability. Consistency is achieved in the sense that exact solutions identically satisfy the variational equations.Applied to several problems, simple finite-element interpolations are rendered convergent, including convenient equal-order interpolations generally unstable within the Galerkin approach. The methods are subdivided into two classes according to the manner in which stability is attained: (1) circumventing Babuska-Brezzi condition methods; (2) satisfying Babuska-Brezzi condition methods. Convergence is established for each class of methods. Applications of the first class of methods to Stokes flow and compressible linear elasticity are presented. The second class of methods is applied to the Poisson, Timoshenko beam and incompressible elasticity problems. Numerical results demonstrate the good stability and accuracy of the methods, and confirm the error estimates

Extension of the analysis of the 3d4-3d34p transition array in Ni VII

International Nuclear Information System (INIS)

Hof, G.J. van het; Raassen, A.J.J.; Uylings, P.H.M.; Podobedova, L.I.; Ryabtsev, A.N.

1989-01-01

The spectrum of Ni VII has been photographed in the 190-265 A region using grazing incidence vacuum spectrographs. More than 400 lines have been classified. In the 3d 4 -configuration 32 of the 34 possible levels and in the 3d 3 4p-configuration 93 of the 110 levels are established. The lines and levels which have already been published are confirmed. The configurations are described both with the conventional Slater-Condon parameters and the recently developed orthogonal parameter set. The conventional set yields a standard deviation for the levels in the 3d 4 configuration of 46 cm -1 and of 163 cm -1 for the levels in the 3d 3 4p configuration. With the orthogonal set this decreases to 3.5 cm -1 and 130 cm -1 respectively. As a consequence of the perturbation by the inner shell excited 3p 5 3d 5 configuration the levels of the 3d 3 ( 2 F) 4p 3 F term show an average deviation of approx. -1400 cm -1 from their calculated values. The other levels can be described very well without taking this perturbation into account. (orig.)

High-efficiency wavefunction updates for large scale Quantum Monte Carlo

Science.gov (United States)

Kent, Paul; McDaniel, Tyler; Li, Ying Wai; D'Azevedo, Ed

Within ab intio Quantum Monte Carlo (QMC) simulations, the leading numerical cost for large systems is the computation of the values of the Slater determinants in the trial wavefunctions. The evaluation of each Monte Carlo move requires finding the determinant of a dense matrix, which is traditionally iteratively evaluated using a rank-1 Sherman-Morrison updating scheme to avoid repeated explicit calculation of the inverse. For calculations with thousands of electrons, this operation dominates the execution profile. We propose a novel rank- k delayed update scheme. This strategy enables probability evaluation for multiple successive Monte Carlo moves, with application of accepted moves to the matrices delayed until after a predetermined number of moves, k. Accepted events grouped in this manner are then applied to the matrices en bloc with enhanced arithmetic intensity and computational efficiency. This procedure does not change the underlying Monte Carlo sampling or the sampling efficiency. For large systems and algorithms such as diffusion Monte Carlo where the acceptance ratio is high, order of magnitude speedups can be obtained on both multi-core CPU and on GPUs, making this algorithm highly advantageous for current petascale and future exascale computations.

Calculations of thermophysical properties of cubic carbides and nitrides using the Debye-Grueneisen model

International Nuclear Information System (INIS)

Lu Xiaogang; Selleby, Malin; Sundman, Bo

2007-01-01

The thermal expansivities and heat capacities of MX (M = Ti, Zr, Hf, V, Nb, Ta; X = C, N) carbides and nitrides with NaCl structure were calculated using the Debye-Grueneisen model combined with ab initio calculations. Two different approximations for the Grueneisen parameter γ were used in the Debye-Grueneisen model, i.e. the expressions proposed by Slater and by Dugdale and MacDonald. The thermal electronic contribution was evaluated from ab initio calculations of the electronic density of states. The calculated results were compared with CALPHAD assessments and experimental data. It was found that the calculations using the Dugdale-MacDonald γ can account for most of the experimental data. By fitting experimental heat capacity and thermal expansivity data below the Debye temperatures, an estimation of Poisson's ratio was obtained and Young's and shear moduli were evaluated. In order to reach a reasonable agreement with experimental data, it was necessary to use the logarithmic averaged mass of the constituent atoms. The agreements between the calculated and the experimental values for the bulk and Young's moduli are generally better than the agreement for shear modulus

Higher-Order Statistical Correlations and Mutual Information Among Particles in a Quantum Well

Science.gov (United States)

Yépez, V. S.; Sagar, R. P.; Laguna, H. G.

2017-12-01

The influence of wave function symmetry on statistical correlation is studied for the case of three non-interacting spin-free quantum particles in a unidimensional box, in position and in momentum space. Higher-order statistical correlations occurring among the three particles in this quantum system is quantified via higher-order mutual information and compared to the correlation between pairs of variables in this model, and to the correlation in the two-particle system. The results for the higher-order mutual information show that there are states where the symmetric wave functions are more correlated than the antisymmetric ones with same quantum numbers. This holds in position as well as in momentum space. This behavior is opposite to that observed for the correlation between pairs of variables in this model, and the two-particle system, where the antisymmetric wave functions are in general more correlated. These results are also consistent with those observed in a system of three uncoupled oscillators. The use of higher-order mutual information as a correlation measure, is monitored and examined by considering a superposition of states or systems with two Slater determinants.

Higher-Order Statistical Correlations and Mutual Information Among Particles in a Quantum Well

International Nuclear Information System (INIS)

Yépez, V. S.; Sagar, R. P.; Laguna, H. G.

2017-01-01

The influence of wave function symmetry on statistical correlation is studied for the case of three non-interacting spin-free quantum particles in a unidimensional box, in position and in momentum space. Higher-order statistical correlations occurring among the three particles in this quantum system is quantified via higher-order mutual information and compared to the correlation between pairs of variables in this model, and to the correlation in the two-particle system. The results for the higher-order mutual information show that there are states where the symmetric wave functions are more correlated than the antisymmetric ones with same quantum numbers. This holds in position as well as in momentum space. This behavior is opposite to that observed for the correlation between pairs of variables in this model, and the two-particle system, where the antisymmetric wave functions are in general more correlated. These results are also consistent with those observed in a system of three uncoupled oscillators. The use of higher-order mutual information as a correlation measure, is monitored and examined by considering a superposition of states or systems with two Slater determinants. (author)

The determination of the Dirac density matrix of the d-dimensional harmonic oscillator for an arbitrary number of closed shells

International Nuclear Information System (INIS)

Howard, I.A.; March, N.H.; Nieto, L.M.

2002-01-01

In 1959, March and Young (Nucl. Phys. 12 237) rewrote the equation of motion for the Dirac density matrix γ(x, x 0 ) in terms of sum and difference variables. Here, γ(r-bar, r-bar 0 ) for the d-dimensional isotropic harmonic oscillator for an arbitrary number of closed shells is shown to satisfy, using the variables vertical bar r-bar + r-bar 0 vertical bar/2 and vertical bar r-bar - r-bar 0 vertical bar/2, a generalized partial differential equation embracing the March-Young equation for d=1. As applications, we take in turn the cases d=1, 2, 3 and 4, and obtain both the density matrix γ (r-bar, r-bar 0 ) and the diagonal density ρ(r)=γ(r-bar, r-bar 0 ) vertical bar r-bar 0 =r-bar, this diagonal element already being known to satisfy a third-order linear homogeneous differential equation for d=1 through 3. Some comments are finally made on the d-dimensional kinetic energy density, which is important for first-principles density functional theory in allowing one to bypass one-particle Schroedinger equations (the so-called Slater-Kohn-Sham equations). (author)

The paired-domination and the upper paired-domination numbers of graphs

Directory of Open Access Journals (Sweden)

Włodzimierz Ulatowski

2015-01-01

Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

Corrective results for the even-parity-quartet P states of lithium isoelectronic sequence

International Nuclear Information System (INIS)

Holoien, E.

1982-01-01

In order to secure a proper p-type behavior of the radial Slater orbitals r/sup n/exp(-etar/2) for the two p electrons near origin in the 1s2p2p configuration, the fixed n power must always be chosen greater than or equal to unity. Unfortunately, this restriction has not been applied to both p electrons in all 30 basic products of the 1967 trial wave function for the even-parity 4 p states, only correct for the one p electron in the case of 4p 0 states. According to this restriction only 14 basic products used are allowed. The remaining 16 basic products are not allowed and therefore have been omitted in the present investigation. This error has made the 1967 calculated total energies too low. Corrective results of the total energy using the allowed correlated 14-term wave function are given in this Communication. The present result for He - 1s2p 2 4 p indicates a position 148 meV in the continuum above the He 2 3 P threshold, in good agreement with recent theoretical calculations

Lesson learned - CGID based on the Method 1 and Method 2 for digital equipment

International Nuclear Information System (INIS)

Hwang, Wonil; Sohn, Kwang Young; Cho, Chang Hwan; Kim, Sung Jong

2015-01-01

The acceptance methods associated with commercial-grade dedication are the following: 1) Special tests and inspection (Method 1) 2) Commercial-grade surveys (Method 2) 3) Source verification (Method 3) 4) An acceptable item and supplier performance record (Method 4) Special tests and inspections, often referred to as Method 1, are performed by the dedicating entity after the item is received to verify selected critical characteristics. Conducting a commercial-grade survey of a supplier is often referred to as Method 2. Supplier audits to verify compliance with a nuclear QA program do not meet the intent of a commercial-grade survey. Source verification, often referred to as Method 3, entails verification of critical characteristics during manufacture and testing of the item being procured. The performance history (good or bad) of the item and supplier is a consideration when determining the use of the other acceptance methods and the rigor with which they are used on a case-by-case basis. Some digital equipment system has the delivery reference and its operating history for Nuclear Power Plant as far as surveyed. However it was found that there is difficulty in collecting this of supporting data sheet, so that supplier usually decide to conduct the CGID based on the Method-1 and Method-2 based on the initial qualification likely. It is conceived that the Method-4 might be a better approach for CGID(Commercial Grade Item Dedication) even if there are some difficulties in data package for justifying CGID from the vendor and operating organization. This paper present the lesson learned from the consulting for Method-1 and 2 for digital equipment dedication. Considering all the information above, there are a couple of issues to remind in order to perform the CGID for Method-2. In doing commercial grade survey based on Method 2, quality personnel as well as technical engineer shall be involved for integral dedication. Other than this, the review of critical

Statistical methods

CERN Document Server

Szulc, Stefan

1965-01-01

Statistical Methods provides a discussion of the principles of the organization and technique of research, with emphasis on its application to the problems in social statistics. This book discusses branch statistics, which aims to develop practical ways of collecting and processing numerical data and to adapt general statistical methods to the objectives in a given field.Organized into five parts encompassing 22 chapters, this book begins with an overview of how to organize the collection of such information on individual units, primarily as accomplished by government agencies. This text then

Sieve methods

CERN Document Server

Halberstam, Heine

2011-01-01

Derived from the techniques of analytic number theory, sieve theory employs methods from mathematical analysis to solve number-theoretical problems. This text by a noted pair of experts is regarded as the definitive work on the subject. It formulates the general sieve problem, explores the theoretical background, and illustrates significant applications.""For years to come, Sieve Methods will be vital to those seeking to work in the subject, and also to those seeking to make applications,"" noted prominent mathematician Hugh Montgomery in his review of this volume for the Bulletin of the Ameri