WorldWideScience

Sample records for slater ligia oceanica

  1. First record of Ligia oceanica (Linnaeus, 1767) (Isopoda: Ligiidae) in the Canary Islands

    OpenAIRE

    Ramírez, Rubén; Riera, Rodrigo

    2013-01-01

    This study presents the first record of L. oceanica in the Canary Islands. Additionally, body features between L. oceanica and Ligia italica Fabricius, 1798, the other sea-slater inhabiting the Archipelago, were compared.

  2. The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda bears a novel gene order and unusual control region features

    Directory of Open Access Journals (Sweden)

    Podsiadlowski Lars

    2006-09-01

    Full Text Available Abstract Background Sequence data and other characters from mitochondrial genomes (gene translocations, secondary structure of RNA molecules are useful in phylogenetic studies among metazoan animals from population to phylum level. Moreover, the comparison of complete mitochondrial sequences gives valuable information about the evolution of small genomes, e.g. about different mechanisms of gene translocation, gene duplication and gene loss, or concerning nucleotide frequency biases. The Peracarida (gammarids, isopods, etc. comprise about 21,000 species of crustaceans, living in many environments from deep sea floor to arid terrestrial habitats. Ligia oceanica is a terrestrial isopod living at rocky seashores of the european North Sea and Atlantic coastlines. Results The study reveals the first complete mitochondrial DNA sequence from a peracarid crustacean. The mitochondrial genome of Ligia oceanica is a circular double-stranded DNA molecule, with a size of 15,289 bp. It shows several changes in mitochondrial gene order compared to other crustacean species. An overview about mitochondrial gene order of all crustacean taxa yet sequenced is also presented. The largest non-coding part (the putative mitochondrial control region of the mitochondrial genome of Ligia oceanica is unexpectedly not AT-rich compared to the remainder of the genome. It bears two repeat regions (4× 10 bp and 3× 64 bp, and a GC-rich hairpin-like secondary structure. Some of the transfer RNAs show secondary structures which derive from the usual cloverleaf pattern. While some tRNA genes are putative targets for RNA editing, trnR could not be localized at all. Conclusion Gene order is not conserved among Peracarida, not even among isopods. The two isopod species Ligia oceanica and Idotea baltica show a similarly derived gene order, compared to the arthropod ground pattern and to the amphipod Parhyale hawaiiensis, suggesting that most of the translocation events were already

  3. Cryptic biodiversity and phylogeographic patterns of Seychellois Ligia isopods

    Directory of Open Access Journals (Sweden)

    Carlos A. Santamaria

    2017-10-01

    Full Text Available Ligia isopods are conspicuous inhabitants of rocky intertidal habitats exhibiting several biological traits that severely limit their dispersal potential. Their presence in patchy habitats and low vagility may lead to long term isolation, allopatric isolation and possible cryptic speciation. Indeed, various species of Ligia have been suggested to represent instead cryptic species complexes. Past studies; however, have largely focused in Eastern Pacific and Atlantic species of Ligia, leaving in doubt whether cryptic diversity occurs in other highly biodiverse areas. The Seychelles consists of 115 islands of different ages and geological origins spread across the western Indian Ocean. They are well known for their rich biodiversity with recent reports of cryptic species in terrestrial Seychellois organisms. Despite these studies, it is unclear whether coastal invertebrates from the Seychelles harbor any cryptic diversity. In this study, we examined patterns of genetic diversity and isolation within Ligia isopods across the Seychelles archipelago by characterizing individuals from locations across both inner and outer islands of the Seychelles using mitochondrial and nuclear markers. We report the presence of highly divergent lineages of independent origin. At Aldabra Atoll, we uncovered a lineage closely related to the Ligia vitiensis cryptic species complex. Within the inner islands of Cousine, Silhouette, and Mahé we detected the presence of two moderately divergent and geographically disjunct lineages most closely related to Ligia dentipes. Our findings suggest that the Seychelles may harbor at least three novel species of Ligia in need of description and that these species may have originated independently.

  4. Exact Slater integrals

    International Nuclear Information System (INIS)

    Golden, L.B.

    1968-01-01

    In atomic structure calculations, one has to evaluate the Slater integrals. In the present program, the authors evaluate exactly the Slater integral when hydrogenic wave functions are used for the bound-state orbitals. When hydrogenic wave functions are used, the Slater integrals involve integrands which can be written in the form of a product of an exponential, exp(ax) and a known analytic polynomial function, f(x). By repeated partial integration such an integral can be expressed in terms of a finite series involving the exponential, the polynomial function and its derivatives. PL/1-FORMAC has a built-in subroutine that will analytically find the derivatives of any multinomial. Thus, the finite series and hence the Slater integral can be evaluated analytically. (Auth.)

  5. From Slater orbitals to Coulomb Sturmians

    Indian Academy of Sciences (India)

    The simple connection between the Slater orbitals, venerable in quantum chemistry, and ... Thanks to the growth of computing ... of classical mechanics for the motion of planets or pro- ... riments show that a ionized gas of H atom has a con-.

  6. Cardioacceleratory Neurons of the Isopod Crustacean, Ligia exotica : Visualization of Peripheral Projection onto the Heart Muscle

    OpenAIRE

    Akira, Sakurai; Hiroshi, Yamagishi; Institute of Biological Sciences, University of Tsukuba; Institute of Biological Sciences, University of Tsukuba

    1998-01-01

    Innervation of the heart muscle by the cardioacceleratory neurons was morphologically and electrophysiologically examined in the isopod crustacean, Ligia exotica. Intracellular injection of neurobiotin into the first and second cardioacceleratory neurons(CA1 and CA2)revealed their peripheral axonal projections. Inside the heart, the CA1 and CA2 axons ran along the trunk of the cardiac ganglion. Finely arborized branches with many varicosities arose from the axon and projected over the heart m...

  7. Nitrogen-fixing bacteria in Mediterranean seagrass (Posidonia oceanica) roots

    KAUST Repository

    Garcias Bonet, Neus; Arrieta, J M; Duarte, Carlos M.; Marbà , Nú ria

    2016-01-01

    of nitrogen for P. oceanica. The low diversity of nitrogen-fixing bacteria reported here suggests species-specific relationships between diazotrophs and P. oceanica, revealing possible symbiotic interactions that could play a major role in nitrogen acquisition

  8. SUITABLE MORDANTS FOR DYEING POSIDONIA OCEANICA FIBERS

    Directory of Open Access Journals (Sweden)

    ROMÁN Silvia

    2017-05-01

    Full Text Available Posidonia oceanica is the most extended sea grass in the Mediterranean Sea. Important quantities of this alga are accumulated on coasts making necessary the cleaninness of those beaches where it can be found. For this reason, many authors are developmenting new products made by this raw material, like green composites or are studing this material to be used as biomass, for example. The aim of this study is to dye the Posidonia Oceanica fiber using commercial natural dye to change their appearance to get a material more attractive for different areas. To achieve this aim, fibers were scoured and bleached in order to remove the brown colour of the Posidonia Oceanica fibers. Scoured and bleached processes were followed by the treatment done for cellulosic fibers, because some researches indicate that P. Oceanica is composed of high quantity of cellulose. Different types of biomordants were use in the pre-treatment of the fiber to improve the affinity between the fiber and the dye used. To compare the results, we evaluate the colour of each sample using CIELAB parameters and colour differences (ΔE*, which are obtained by reflexion spectrophotometre. The results showed that medium molecular weight chitosan, which was used as biomordant, gets the highest intensity of colour

  9. A complex evolutionary history in a remote archipelago: phylogeography and morphometrics of the Hawaiian endemic Ligia isopods.

    Directory of Open Access Journals (Sweden)

    Carlos A Santamaria

    Full Text Available Compared to the striking diversification and levels of endemism observed in many terrestrial groups within the Hawaiian Archipelago, marine invertebrates exhibit remarkably lower rates of endemism and diversification. Supralittoral invertebrates restricted to specific coastal patchy habitats, however, have the potential for high levels of allopatric diversification. This is the case of Ligia isopods endemic to the Hawaiian Archipelago, which most likely arose from a rocky supralittoral ancestor that colonized the archipelago via rafting, and diversified into rocky supralittoral and inland lineages. A previous study on populations of this isopod from O'ahu and Kaua'i revealed high levels of allopatric differentiation, and suggested inter-island historical dispersal events have been rare. To gain a better understanding on the diversity and evolution of this group, we expanded prior phylogeographic work by incorporating populations from unsampled main Hawaiian Islands (Maui, Moloka'i, Lana'i, and Hawai'i, increasing the number of gene markers (four mitochondrial and two nuclear genes, and conducting Maximum likelihood and Bayesian phylogenetic analyses. Our study revealed new lineages and expanded the distribution range of several lineages. The phylogeographic patterns of Ligia in the study area are complex, with Hawai'i, O'ahu, and the Maui-Nui islands sharing major lineages, implying multiple inter-island historical dispersal events. In contrast, the oldest and most geographically distant of the major islands (Kaua'i shares no lineages with the other islands. Our results did not support the monophyly of all the supralittoral lineages (currently grouped into L. hawaiensis, or the monophyly of the terrestrial lineages (currently grouped into L. perkinsi, implying more than one evolutionary transition between coastal and inland forms. Geometric-morphometric analyses of three supralittoral clades revealed significant body shape differences among them

  10. Molecular integrals for slater type orbitals using coulomb sturmians

    DEFF Research Database (Denmark)

    Avery, James Emil; Avery, John Scales

    2014-01-01

    The use of Slater type orbitals in molecular calculations is hindered by the slowness of integral evaluation. In the present paper, we introduce a method for overcoming this problem by expanding STO's in terms of Coulomb Sturmians, for which the problem of evaluating molecular integrals rapidly has...

  11. Acute kidney injury from Paraquat poisoning: a case report. | Slater ...

    African Journals Online (AJOL)

    Acute kidney injury from Paraquat poisoning: a case report. H. E. Slater, O.C.A. Okoye, O. Okperi, N. Rajora. Abstract. Paraquat is a salt widely used as a herbicide. Although paraquat poisoning is rare in the general population, it may be considered as one of the most toxic poisons frequently used for suicide attempts, and is ...

  12. Constrained body shape among highly genetically divergent allopatric lineages of the supralittoral isopod Ligia occidentalis (Oniscidea).

    Science.gov (United States)

    Santamaria, Carlos A; Mateos, Mariana; DeWitt, Thomas J; Hurtado, Luis A

    2016-03-01

    Multiple highly divergent lineages have been identified within Ligia occidentalis sensu lato, a rocky supralittoral isopod distributed along a ~3000 km latitudinal gradient that encompasses several proposed marine biogeographic provinces and ecoregions in the eastern Pacific. Highly divergent lineages have nonoverlapping geographic distributions, with distributional limits that generally correspond with sharp environmental changes. Crossbreeding experiments suggest postmating reproductive barriers exist among some of them, and surveys of mitochondrial and nuclear gene markers do not show evidence of hybridization. Populations are highly isolated, some of which appear to be very small; thus, the effects of drift are expected to reduce the efficiency of selection. Large genetic divergences among lineages, marked environmental differences in their ranges, reproductive isolation, and/or high isolation of populations may have resulted in morphological differences in L. occidentalis, not detected yet by traditional taxonomy. We used landmark-based geometric morphometric analyses to test for differences in body shape among highly divergent lineages of L. occidentalis, and among populations within these lineages. We analyzed a total of 492 individuals from 53 coastal localities from the southern California Bight to Central Mexico, including the Gulf of California. We conducted discriminant function analyses (DFAs) on body shape morphometrics to assess morphological variation among genetically differentiated lineages and their populations. We also tested for associations between phylogeny and morphological variation, and whether genetic divergence is correlated to multivariate morphological divergence. We detected significant differences in body shape among highly divergent lineages, and among populations within these lineages. Nonetheless, neither lineages nor populations can be discriminated on the basis of body shape, because correct classification rates of cross

  13. Out of Asia: mitochondrial evolutionary history of the globally introduced supralittoral isopod Ligia exotica.

    Science.gov (United States)

    Hurtado, Luis A; Mateos, Mariana; Wang, Chang; Santamaria, Carlos A; Jung, Jongwoo; Khalaji-Pirbalouty, Valiallah; Kim, Won

    2018-01-01

    The native ranges and invasion histories of many marine species remain elusive due to a dynamic dispersal process via marine vessels. Molecular markers can aid in identification of native ranges and elucidation of the introduction and establishment process. The supralittoral isopod Ligia exotica has a wide tropical and subtropical distribution, frequently found in harbors and ports around the globe. This isopod is hypothesized to have an Old World origin, from where it was unintentionally introduced to other regions via wooden ships and solid ballast. Its native range, however, remains uncertain. Recent molecular studies uncovered the presence of two highly divergent lineages of L. exotica in East Asia, and suggest this region is a source of nonindigenous populations. In this study, we conducted phylogenetic analyses (Maximum Likelihood and Bayesian) of a fragment of the mitochondrial 16S ribosomal (r)DNA gene using a dataset of this isopod that greatly expanded previous representation from Asia and putative nonindigenous populations around the world. For a subset of samples, sequences of 12S rDNA and NaK were also obtained and analyzed together with 16S rDNA. Our results show that L. exotica is comprised of several highly divergent genetic lineages, which probably represent different species. Most of the 16S rDNA genetic diversity (48 haplotypes) was detected in East and Southeast Asia. Only seven haplotypes were observed outside this region (in the Americas, Hawai'i, Africa and India), which were identical or closely related to haplotypes found in East and Southeast Asia. Phylogenetic patterns indicate the L. exotica clade originated and diversified in East and Southeast Asia, and only members of one of the divergent lineages have spread out of this region, recently, suggesting the potential to become invasive is phylogenetically constrained.

  14. Calculation Of Multicenter Electric Field Integrals Over Slater Type Orbitals

    International Nuclear Information System (INIS)

    Zaim, N.

    2010-01-01

    Using the properties of complete orthonormal sets of Ψ α -exponential type orbitals (α1,0,-1,-2, ...) and the relations for overlap integrals, the calculations for the multicenter electric field integrals of Slater type orbitals are performed. The results of computer calculations are presented. The convergence of the series is tested by calculating concrete cases for the arbitrary values of quantum numbers, orbital parameters and internuclear distances.

  15. Relativity and pseudopotentials in the Hartree-Fock-Slater method

    International Nuclear Information System (INIS)

    Snijders, J.G.

    1979-01-01

    The methodological problems involved in electronic structure determinations of compounds containing heavy elements by the Hartree-Fock-Slater scheme are investigated. It is shown that the effect of the inner electrons can be simulated by a so called pseudopotential, so that only the valence electrons have to be treated explicitly which constitutes a considerable reduction of computation time. It is further shown that a pseudopotential calculation is able to achieve an accuracy that is comparable to the results of a calculation including the core. (Auth.)

  16. Natural generalization of Slater determinants to more than one dimension

    Science.gov (United States)

    Sunko, Denis

    The calculation of realistic N-body wave functions for identical fermions is still an open problem in physics, chemistry, and materials science, even for N as small as two. Here a fundamental algebraic structure of many-body Hilbert space is described, enabling theoretically well-founded systematic investigation of wave-function space. The structure allows an arbitrary many-fermion wave function to be written in terms of a finite number of antisymmetric functions called shapes, which cannot be constructed by combining one-dimensional wave functions. Shapes naturally generalize the single-Slater-determinant form for the ground state to more than one dimension. Their number is exactly N! d - 1 in d dimensions. A general algorithm is given to list them all in terms of standard Slater determinants. Conversely, excitations which can be induced from the one-dimensional case are bosonised into a system of distinguishable bosons, called Euler bosons, much like the electromagnetic field is quantized in terms of photons distinguishable by their wave numbers. Their wave functions are given explicitly in terms of elementary symmetric functions, reflecting the fact that the fermion sign problem is trivial in one dimension. The shapes are all possible vacua for the Euler bosons.

  17. Nitrogen-fixing bacteria in Mediterranean seagrass (Posidonia oceanica) roots

    KAUST Repository

    Garcias Bonet, Neus

    2016-03-09

    Biological nitrogen fixation by diazotrophic bacteria in seagrass rhizosphere and leaf epiphytic community is an important source of nitrogen required for plant growth. However, the presence of endophytic diazotrophs remains unclear in seagrass tissues. Here, we assess the presence, diversity and taxonomy of nitrogen-fixing bacteria within surface-sterilized roots of Posidonia oceanica. Moreover, we analyze the nitrogen isotopic signature of seagrass tissues in order to notice atmospheric nitrogen fixation. We detected nitrogen-fixing bacteria by nifH gene amplification in 13 out of the 78 roots sampled, corresponding to 9 locations out of 26 meadows. We detected two different types of bacterial nifH sequences associated with P. oceanica roots, which were closely related to sequences previously isolated from the rhizosphere of a salt marsh cord grass and a putative anaerobe. Nitrogen content of seagrass tissues showed low isotopic signatures in all the sampled meadows, pointing out the atmospheric origin of the assimilated nitrogen by seagrasses. However, this was not related with the presence of endophytic nitrogen fixers, suggesting the nitrogen fixation occurring in rhizosphere and in the epiphytic community could be an important source of nitrogen for P. oceanica. The low diversity of nitrogen-fixing bacteria reported here suggests species-specific relationships between diazotrophs and P. oceanica, revealing possible symbiotic interactions that could play a major role in nitrogen acquisition by seagrasses in oligotrophic environments where they form lush meadows.

  18. 76 FR 48179 - Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound...

    Science.gov (United States)

    2011-08-08

    ... Museum of Natural History, University of Puget Sound, Tacoma, WA AGENCY: National Park Service, Interior. ACTION: Notice. SUMMARY: The Slater Museum of Natural History, University of Puget Sound has completed an... contact the Slater Museum of Natural History, University of Puget Sound. Disposition of the human remain...

  19. Approximating a wavefunction as an unconstrained sum of Slater determinants

    International Nuclear Information System (INIS)

    Beylkin, Gregory; Perez, Fernando; Mohlenkamp, Martin J.

    2008-01-01

    The wavefunction for the multiparticle Schroedinger equation is a function of many variables and satisfies an antisymmetry condition, so it is natural to approximate it as a sum of Slater determinants. Many current methods do so, but they impose additional structural constraints on the determinants, such as orthogonality between orbitals or an excitation pattern. We present a method without any such constraints, by which we hope to obtain much more efficient expansions and insight into the inherent structure of the wavefunction. We use an integral formulation of the problem, a Green's function iteration, and a fitting procedure based on the computational paradigm of separated representations. The core procedure is the construction and solution of a matrix-integral system derived from antisymmetric inner products involving the potential operators. We show how to construct and solve this system with computational complexity competitive with current methods

  20. Patch types in Posidonia oceanica meadows around Corsica. How can we use them in seascape ecology?

    OpenAIRE

    Abadie, Arnaud; Bonacorsi, Marina; Gobert, Sylvie; Lejeune, Pierre; Pergent, Gérard; Pergent-Martini, Christine

    2015-01-01

    The meadows formed by the Mediterranean seagrass Posidonia oceanica are subjected to various natural (e.g., water movement, light availability, sedimentation) and anthropogenic (e.g., anchoring, trawling, fish farms, explosives) phenomena that erode them and create diverse types of patches. The assemblage of the P. oceanica matrix and these patches creates particular seascapes. On the basis of this assessment, we aimed to investigate the importance of the patch type in structuring P. oceanica...

  1. 78 FR 19299 - Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound...

    Science.gov (United States)

    2013-03-29

    ... DEPARTMENT OF THE INTERIOR National Park Service [NPS-WASO-NAGPRA-12395; PPWOCRADN0-PCU00RP14.R50000] Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound... History, University of Puget Sound, has completed an inventory of human remains in consultation with the...

  2. Method of renormalization potential for one model of Hartree-Fock-Slater type

    CERN Document Server

    Zasorin, Y V

    2002-01-01

    A new method of the potential renormalization for the quasiclassical model of the Hartree-Fock-Slater real potential is proposed. The method makes it possible to easily construct the wave functions and contrary to the majority od similar methods it does not require the knowledge of the real-type potential

  3. Verification of mutagen function of Zeocin in Nannochloropsis oceanica through transcriptome analysis

    Science.gov (United States)

    Lin, Genmei; Wang, Yamei; Guo, Li; Ding, Haiyan; Hu, Yongmei; Liang, Sijie; Zhang, Zhongyi; Yang, Guanpin

    2017-06-01

    Zeocin can cause double strand breaks of DNA and thus is frequently used as a selective antibiotic of eukaryotic Sh ble transformants. In non-transformation system, Zeocin may function as a mutagen if not totally lethal. To verify such function of Zeocin, we mutated Nannochloropsis oceanica by increasing the concentration of Zeocin in medium gradually, and isolated a N. oceanica strain (single cell culture) which survived Zeocin up to 10.0 μg mL-1. The Zeocin-tolerant strain entered the exponential growth phase later and grew slower than the wild strain. Transcriptome profiling showed that the Zeocin-tolerant N. oceanica strain survived Zeocin mainly by adapting (heritable), rather than acclimating (plastic) to Zeocin. Hence mutating N. oceanica with Zeocin was approved effective. Meanwhile, the physiological characteristics of this Zeocin-tolerant strain were demonstrated. As we proposed, N. oceanica tolerated Zeocin by strengthening its protein degradation and antioxidation. The genes controlling cell division and cellular response to stimuli may also have played important roles in the reduction of growth and the tolerance to Zeocin. Our findings evidenced that Zeocin can serve as an appropriate mutagen of microalgae. Creating variations through mutation with Zeocin may help to study the genetic basis of the traits of this monoploidy and asexual microalga, as well as improve its production.

  4. Measuring market orientation: further evidence on Narver and Slater's three-component scale.

    Science.gov (United States)

    Chakrabarty, Subhra; Rogé, Joseph N

    2003-12-01

    A mail survey of a national random sample of 2,000 marketing managers was conducted. The data provided by 222 respondents were analyzed to assess the dimensionality of Narver and Slater's 15-item measure of market orientation. A confirmatory factor analysis, using LISREL 8.53, provided support for each of the separate dimensions of customer orientation, competitor orientation, and interfunctional coordination. However, a combined 3-factor model of market orientation was not supported. Directions for research are suggested.

  5. Time-dependent density functional theory beyond Kohn-Sham Slater determinants.

    Science.gov (United States)

    Fuks, Johanna I; Nielsen, Søren E B; Ruggenthaler, Michael; Maitra, Neepa T

    2016-08-03

    When running time-dependent density functional theory (TDDFT) calculations for real-time simulations of non-equilibrium dynamics, the user has a choice of initial Kohn-Sham state, and typically a Slater determinant is used. We explore the impact of this choice on the exchange-correlation potential when the physical system begins in a 50 : 50 superposition of the ground and first-excited state of the system. We investigate the possibility of judiciously choosing a Kohn-Sham initial state that minimizes errors when adiabatic functionals are used. We find that if the Kohn-Sham state is chosen to have a configuration matching the one that dominates the interacting state, this can be achieved for a finite time duration for some but not all such choices. When the Kohn-Sham system does not begin in a Slater determinant, we further argue that the conventional splitting of the exchange-correlation potential into exchange and correlation parts has limited value, and instead propose a decomposition into a "single-particle" contribution that we denote v, and a remainder. The single-particle contribution can be readily computed as an explicit orbital-functional, reduces to exchange in the Slater determinant case, and offers an alternative to the adiabatic approximation as a starting point for TDDFT approximations.

  6. Potential adsorption of methylene blue from aqueous solution using green macroalgaePosidonia oceanica.

    Science.gov (United States)

    Allouche, F.-N.; Yassaa, N.

    2018-03-01

    The use of inexpensive biological materials, such as marine algae for removing dyes from contaminated industrial effluents appears as a potential alternative method. The aim of this study is to investigate the aptitude of marine macroalgae Posidonia Oceanica local biomass abundant on the coasts of Algeria for selective sorption of methylene blue (MB) from an aqueous solution in batch experiments at 20 °C. A maximum percentage removal of Posidonia oceanica occurs at pH 5. Equilibrium isotherm data were analyzed using the Langmuir and the Freundlich isotherms. The adsorption equilibrium of methylene blue was best describe by Langmuir model than the Freundlich model. The maximum sorption capacity was 357 mgg-1at pH 5. The sorption data were very well described by the pseudo-second-order model. Keywords: Posidonia oceanica, Methylene blue (MB), Biosorption, Isotherm Equilibrium, Kinetics; Modelling.

  7. Engineering the Chloroplast Genome of Oleaginous Marine Microalga Nannochloropsis oceanica

    Directory of Open Access Journals (Sweden)

    Qinhua Gan

    2018-04-01

    Full Text Available Plastid engineering offers an important tool to fill the gap between the technical and the enormous potential of microalgal photosynthetic cell factory. However, to date, few reports on plastid engineering in industrial microalgae have been documented. This is largely due to the small cell sizes and complex cell-wall structures which make these species intractable to current plastid transformation methods (i.e., biolistic transformation and polyethylene glycol-mediated transformation. Here, employing the industrial oleaginous microalga Nannochloropsis oceanica as a model, an electroporation-mediated chloroplast transformation approach was established. Fluorescent microscopy and laser confocal scanning microscopy confirmed the expression of the green fluorescence protein, driven by the endogenous plastid promoter and terminator. Zeocin-resistance selection led to an acquisition of homoplasmic strains of which a stable and site-specific recombination within the chloroplast genome was revealed by sequencing and DNA gel blotting. This demonstration of electroporation-mediated chloroplast transformation opens many doors for plastid genome editing in industrial microalgae, particularly species of which the chloroplasts are recalcitrant to chemical and microparticle bombardment transformation.

  8. Venezuelan geckos (Gekkonidae, Phyllodactylidae, Sphaerodactylidae) in the collection of the Universidad de Concepción in Chile, with description of the type series of Gonatodes ligiae and Gonatodes petersi (Sphaerodactylidae).

    Science.gov (United States)

    Barrio-Amorós, Cesar L; Ortíz, Juan C

    2016-07-07

    Herein we catalogue all geckos (Gekkonidae, Phyllodactylidae and Sphaerodactylidae) collected by Roberto Donoso-Barros in Venezuela between 1963 and 1964, deposited in the Universidad de Concepción in Chile. Donoso-Barros did not provide detailed descriptions of two species of Gonatodes named by him, despite both being valid species. We take the opportunity to do so and the type series of Gonatodes ligiae and G. petersi are described for the first time. We also present images in life of all species collected by Donoso-Barros in Venezuela.

  9. Genetic indicators of iron limitation in wild populations of Thalassiosira oceanica from the northeast Pacific Ocean.

    Science.gov (United States)

    Chappell, P Dreux; Whitney, LeAnn P; Wallace, Joselynn R; Darer, Adam I; Jean-Charles, Samua; Jenkins, Bethany D

    2015-03-01

    Assessing the iron (Fe) nutritional status of natural diatom populations has proven challenging as physiological and molecular responses can differ in diatoms of the same genus. We evaluated expression of genes encoding flavodoxin (FLDA1) and an Fe-starvation induced protein (ISIP3) as indicators of Fe limitation in the marine diatom Thalassiosira oceanica. The specificity of the response to Fe limitation was tested in cultures grown under Fe- and macronutrient-deficient conditions, as well as throughout the diurnal light cycle. Both genes showed a robust and specific response to Fe limitation in laboratory cultures and were detected in small volume samples collected from the northeast Pacific, demonstrating the sensitivity of this method. Overall, FLDA1 and ISIP3 expression was inversely related to Fe concentrations and offered insight into the Fe nutritional health of T. oceanica in the field. As T. oceanica is a species tolerant to low Fe, indications of Fe limitation in T. oceanica populations may serve as a proxy for severe Fe stress in the overall diatom community. At two shallow coastal locations, FLD1A and ISIP3 expression revealed Fe stress in areas where dissolved Fe concentrations were high, demonstrating that this approach may be powerful for identifying regions where Fe supply may not be biologically available.

  10. Physiological responses of the seagrass Posidonia oceanica as indicators of fish farm impact

    International Nuclear Information System (INIS)

    Perez, Marta; Garcia, Tania; Invers, Olga; Ruiz, Juan Manuel

    2008-01-01

    The development of aquaculture along the Mediterranean coastline degrades the marine environment, in particular Posidonia oceanica meadows, which, in extreme cases, show high mortality. Here we studied the effects of organic matter and nutrient input from the effluents of three fish farms, located along the Mediterranean coast, on P. oceanica physiology. For this purpose, we measured physiological variables such as total nitrogen (N) content, free amino acid (FAA) concentration and composition, N stable isotope ratio (δ 15 N), total phosphorus (P) content and total non-structural carbohydrate (TNC) content in plant tissues and epiphytes affected by organic discharges (highly impacted stations: HI, and less impacted stations: LI) and compared these results with those obtained in references sites (control stations: C). For all the descriptors analyzed in P. oceanica epiphytes, the values recorded in the vicinity of cages were, in general, much higher than those in C. Leaves did not respond consistently in any case. Total N content and δ 15 N in epiphytes together with the total P content in rhizomes and epiphytes were the physiological descriptors that showed the most consistent responses to fish farm effluents. On the basis of these observations, we conclude that fish farm activities strongly affect the physiological parameters of nearby P. oceanica meadows. We propose that changes in these physiological parameters may be useful indicators of marine environmental degradation in studies that monitor the effects of fish farming

  11. Transplantation assessment of degraded Posidonia oceanica habitats: site selection and long-term monitoring

    Directory of Open Access Journals (Sweden)

    M. PIRROTTA

    2014-09-01

    Full Text Available A model developed for Zostera marina was adapted and used to select suitable areas for Posidonia oceanica transplantation in the Gulf of Palermo, where recent rehabilitation programmes have reduced human pressure. This model consists of three steps: (1 habitat selection, by calculation of the Preliminary Transplant Suitability Index (PTSI; (2 field assessments and test-transplanting, to evaluate the site suitability and to estimate the effects of tearing on transplant units (about 50%; (3 identification of suitable restoration sites, by calculation of the Transplant Suitability Index (TSI. A new parameter was added to the literature model: the number of grids detached, which is linked to factors (hydrodynamic regime, anchoring, fishing that have a potentially great effect on the final outcome of the transplant. Only one site (TSI = 16 in the Gulf of Palermo was indicated as potentially suitable for restoration with P. oceanica. In this site, a transplant of 40 m2 was implemented. From 2008 to 2014, transplant effectiveness was evaluated in terms of establishment, detachment and mortality of cuttings and shoot density. The long-term monitoring (6 years allowed us to detect changes in the structural conditions of the transplanted meadow and to identify the possible turning point in P. oceanica recovery (2 years after transplanting. Moreover, 6 years after transplantation the P. oceanica meadow has exceeded the transplant shoot density of about 16%, with a mean and a maximum value of 11.6 and 17 shoots per cutting, respectively.

  12. Magnetically modified Posidonia oceanica biomass as an adsorbent for organic dyes removal

    Czech Academy of Sciences Publication Activity Database

    Šafařík, Ivo; Ashoura, N.; Maděrová, Z.; Pospíšková, K.; Baldíková, E.; Šafaříková, Miroslava

    2016-01-01

    Roč. 17, č. 2 (2016), s. 351-358 ISSN 1108-393X Institutional support: RVO:60077344 Keywords : Posidonia oceanica * Neptune balls * magnetic biomass * organic dyes * adsorbent Subject RIV: DJ - Water Pollution ; Quality Impact factor: 1.683, year: 2016

  13. Physiological responses of the seagrass Posidonia oceanica as indicators of fish farm impact

    Energy Technology Data Exchange (ETDEWEB)

    Perez, Marta [Departament d' Ecologia, Universitat de Barcelona Avda. Diagonal 645, 08028 Barcelona (Spain); Garcia, Tania [Departament d' Ecologia, Universitat de Barcelona Avda. Diagonal 645, 08028 Barcelona (Spain)], E-mail: irulagun@hotmail.com; Invers, Olga [Departament d' Ecologia, Universitat de Barcelona Avda. Diagonal 645, 08028 Barcelona (Spain); Ruiz, Juan Manuel [Instituto Espanol de Oceanografia C/Varadero 1, 30740 San Pedro del Pinatar, Murcia (Spain)

    2008-05-15

    The development of aquaculture along the Mediterranean coastline degrades the marine environment, in particular Posidonia oceanica meadows, which, in extreme cases, show high mortality. Here we studied the effects of organic matter and nutrient input from the effluents of three fish farms, located along the Mediterranean coast, on P. oceanica physiology. For this purpose, we measured physiological variables such as total nitrogen (N) content, free amino acid (FAA) concentration and composition, N stable isotope ratio ({delta}{sup 15}N), total phosphorus (P) content and total non-structural carbohydrate (TNC) content in plant tissues and epiphytes affected by organic discharges (highly impacted stations: HI, and less impacted stations: LI) and compared these results with those obtained in references sites (control stations: C). For all the descriptors analyzed in P. oceanica epiphytes, the values recorded in the vicinity of cages were, in general, much higher than those in C. Leaves did not respond consistently in any case. Total N content and {delta}{sup 15}N in epiphytes together with the total P content in rhizomes and epiphytes were the physiological descriptors that showed the most consistent responses to fish farm effluents. On the basis of these observations, we conclude that fish farm activities strongly affect the physiological parameters of nearby P. oceanica meadows. We propose that changes in these physiological parameters may be useful indicators of marine environmental degradation in studies that monitor the effects of fish farming.

  14. Is Posidonia oceanica regression a general feature in the Mediterranean Sea?

    Directory of Open Access Journals (Sweden)

    M. BONACORSI

    2013-03-01

    Full Text Available Over the last few years, a widespread regression of Posidonia oceanica meadows has been noticed in the Mediterranean Sea. However, the magnitude of this decline is still debated. The objectives of this study are (i to assess the spatio-temporal evolution of Posidonia oceanica around Cap Corse (Corsica over time comparing available ancient maps (from 1960 with a new (2011 detailed map realized combining different techniques (aerial photographs, SSS, ROV, scuba diving; (ii evaluate the reliability of ancient maps; (iii discuss observed regression of the meadows in relation to human pressure along the 110 km of coast. Thus, the comparison with previous data shows that, apart from sites clearly identified with the actual evolution, there is a relative stability of the surfaces occupied by the seagrass Posidonia oceanica. The recorded differences seem more related to changes in mapping techniques. These results confirm that in areas characterized by a moderate anthropogenic impact, the Posidonia oceanica meadow has no significant regression and that the changes due to the evolution of mapping techniques are not negligible. However, others facts should be taken into account before extrapolating to the Mediterranean Sea (e.g. actually mapped surfaces and assessing the amplitude of the actual regression.

  15. A three-dimensional niche comparison of Emiliania huxleyi and Gephyrocapsa oceanica: reconciling observations with projections

    Directory of Open Access Journals (Sweden)

    N. A. Gafar

    2018-06-01

    Full Text Available Coccolithophore responses to changes in carbonate chemistry speciation such as CO2 and H+ are highly modulated by light intensity and temperature. Here, we fit an analytical equation, accounting for simultaneous changes in carbonate chemistry speciation, light and temperature, to published and original data for Emiliania huxleyi, and compare the projections with those for Gephyrocapsa oceanica. Based on our analysis, the two most common bloom-forming species in present-day coccolithophore communities appear to be adapted for a similar fundamental light niche but slightly different ones for temperature and CO2, with E. huxleyi having a tolerance to lower temperatures and higher CO2 levels than G. oceanica. Based on growth rates, a dominance of E. huxleyi over G. oceanica is projected below temperatures of 22 °C at current atmospheric CO2 levels. This is similar to a global surface sediment compilation of E. huxleyi and G. oceanica coccolith abundances suggesting temperature-dependent dominance shifts. For a future Representative Concentration Pathway (RCP 8.5 climate change scenario (1000 µatm fCO2, we project a CO2 driven niche contraction for G. oceanica to regions of even higher temperatures. However, the greater sensitivity of G. oceanica to increasing CO2 is partially mitigated by increasing temperatures. Finally, we compare satellite-derived particulate inorganic carbon estimates in the surface ocean with a recently proposed metric for potential coccolithophore success on the community level, i.e. the temperature-, light- and carbonate-chemistry-dependent CaCO3 production potential (CCPP. Based on E. huxleyi alone, as there was interestingly a better correlation than when in combination with G. oceanica, and excluding the Antarctic province from the analysis, we found a good correlation between CCPP and satellite-derived particulate inorganic carbon (PIC with an R2 of 0.73, p < 0.01 and a slope of 1.03 for austral winter

  16. Efficient evaluation of the Fourier transform over products of Slater-type orbitals on different centers

    International Nuclear Information System (INIS)

    Niehaus, T A; Lopez, R; Rico, J F

    2008-01-01

    Using the shift-operator technique, a compact formula for the Fourier transform of a product of two Slater-type orbitals located on different atomic centers is derived. The result is valid for arbitrary quantum numbers and was found to be numerically stable for a wide range of geometrical parameters and momenta. Details of the implementation are presented together with benchmark data for representative integrals. We also discuss the assets and drawbacks of alternative algorithms available and analyze the numerical efficiency of the new scheme

  17. Energy band structure of Cr by the Slater-Koster interpolation scheme

    International Nuclear Information System (INIS)

    Seifu, D.; Mikusik, P.

    1986-04-01

    The matrix elements of the Hamiltonian between nine localized wave-functions in tight-binding formalism are derived. The symmetry adapted wave-functions and the secular equations are formed by the group theory method for high symmetry points in the Brillouin zone. A set of interaction integrals is chosen on physical ground and fitted via the Slater-Koster interpolation scheme to the abinito band structure of chromium calculated by the Green function method. Then the energy band structure of chromium is interpolated and extrapolated in the Brillouin zone. (author)

  18. Hyperspherical Slater determinant approach to few-body fractional quantum Hall states

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Bin, E-mail: yanbin@purdue.edu; Wooten, Rachel E.; Daily, Kevin M.; Greene, Chris H.

    2017-05-15

    In a recent study (Daily et al., 2015), a hyperspherical approach has been developed to study few-body fractional quantum Hall states. This method has been successfully applied to the exploration of few boson and fermion problems in the quantum Hall region, as well as the study of inter-Landau level collective excitations (Rittenhouse et al., 2016; Wooten et al., 2016). However, the hyperspherical method as it is normally implemented requires a subsidiary (anti-)symmetrization process, which limits its computational effectiveness. The present work overcomes these difficulties and extends the power of this method by implementing a representation of the hyperspherical many-body basis space in terms of Slater determinants of single particle eigenfunctions. A clear connection between the hyperspherical representation and the conventional single particle picture is presented, along with a compact operator representation of the theoretical framework. - Highlights: • A hyperspherical method has been implemented to study the quantum Hall effect. • The hyperspherical many-body basis space is represented with Slater determinants. • Example numerical studies of the 4- and 8-electron systems are presented.

  19. Integration by cell algorithm for Slater integrals in a spline basis

    International Nuclear Information System (INIS)

    Qiu, Y.; Fischer, C.F.

    1999-01-01

    An algorithm for evaluating Slater integrals in a B-spline basis is introduced. Based on the piecewise property of the B-splines, the algorithm divides the two-dimensional (r 1 , r 2 ) region into a number of rectangular cells according to the chosen grid and implements the two-dimensional integration over each individual cell using Gaussian quadrature. Over the off-diagonal cells, the integrands are separable so that each two-dimensional cell-integral is reduced to a product of two one-dimensional integrals. Furthermore, the scaling invariance of the B-splines in the logarithmic region of the chosen grid is fully exploited such that only some of the cell integrations need to be implemented. The values of given Slater integrals are obtained by assembling the cell integrals. This algorithm significantly improves the efficiency and accuracy of the traditional method that relies on the solution of differential equations and renders the B-spline method more effective when applied to multi-electron atomic systems

  20. Interaction between Posidonia oceanica meadows upper limit and hydrodynamics of four Mediterranean beaches

    Science.gov (United States)

    De Muro, Sandro; Ruju, Andrea; Buosi, Carla; Porta, Marco; Passarella, Marinella; Ibba, Angelo

    2017-04-01

    Posidonia oceanica meadow is considered to play an important role in the coastal geomorphology of Mediterranean beach systems. In particular, the importance of the meadow in protecting the coastline from erosion is well-recognized. Waves are attenuated by greater friction across seagrass meadows, which have the capacity to reduce water flow and therefore increase sediment deposition and accumulation as well as beach stability. The P. oceanica meadow upper limit usually occurs within the most dynamic zone of the beach system. Considering the great attention paid in the literature to the connection between the growth of P. oceanica and coastal hydrodynamics (Infantes et al., 2009; Vacchi et al., 2014; De Muro et al., 2016, 2017), this study aims at extending the previous work by investigating the combined influence of hydrodynamic parameters (e.g., wave-induced main currents and wave orbital velocity at the bottom) and different types of sea bottom (e.g., soft sediment, rocky substrates) on the position of the upper limit of the P. oceanica meadow. We applied this approach to 4 Mediterranean beach systems located on the Sardinian coastline (3 on the South and 1 on the North) and characterized by a wide range of orientations and incoming wave conditions. On these beaches, the extension of the P. oceanica meadows and the bathymetry have been obtained through detailed surveying campaigns and aerial photo analysis. In addition, high spatial resolution wave hydrodynamics have been reconstructed by running numerical simulations with Delft 3D. Offshore wave climate has been reconstructed by using measured datasets for those beaches that have a nearby buoy whose dataset is representative of the incoming wave conditions for that particular stretch of coast. Whereas, for those beaches with no availability of a representative measured dataset, wave climate has been analyzed from the NOAA hindcast dataset. From the whole range of incoming wave directions in deep waters, we

  1. A Hartree-Fock-Slater-Boltzmann-Saha method for detailed atomic structure and equation of state of plasmas

    International Nuclear Information System (INIS)

    Jiang Minhao; Meng Xujun

    2005-01-01

    The effect of the free electron background in plasmas is introduced in Hartree-Fock-Slater self-consistent field atomic model to correct the single electron energies for each electron configuration, and to provide accurate atomic data for Boltzmann-Saha equation. In the iteration process chemical potential is adjusted to change the free electron background to satisfy simultaneously the conservation of the free electrons in Saha equation as well as in Hartree-Fock-Slater self-consistent field atomic model. As examples the equations of state of the carbon and aluminum plasmas are calculated to show the applicability of this method. (authors)

  2. Trace metal distributions in Posidonia oceanica and sediments from Taranto Gulf (Ionian Sea, Southern Italy

    Directory of Open Access Journals (Sweden)

    A. DI LEO

    2013-03-01

    Full Text Available Distribution of metals (Hg, Pb, Sn, Cu, Cd and Zn was determined in sediments and in different tissues of Posidonia oceanica collected from San Pietro Island, Taranto Gulf (Ionian Sea, Southern Italy. In seagrass, results, compared with metal concentrations in sediments, showed that the highest concentrations of Hg, Pb, Sn and Cu were found in the roots, while in the green leaves were found the highest levels of Cd and Zn. Instead the lowest metal concentrations were found in the basal part of the leaf. Levels of  metals in the leaves were similar to those found by other authors in uncontaminated areas of the Mediterranean Sea. Mercury levels in roots were correlated to levels in sediments. This could demonstrate the plant memorizes sediments contamination . This study reinforces the usefulness and the relevance of Posidonia oceanica as an indicator of spatial metal contamination and an interesting tool for environmental quality evaluation.

  3. Seasonal grazing and food preference of herbivores in a Posidonia oceanica meadow

    Directory of Open Access Journals (Sweden)

    Andrea Peirano

    2001-12-01

    Full Text Available Seasonal grazing of the fish Sarpa salpa (L., the urchin Paracentrotus lividus Lamarck and the isopods Idotea spp. was compared with the C/N ratio of adult and intermediate leaves and epiphytes of Posidonia oceanica (L. Delile, collected at three different depths. Despite seasonal differences in grazing, herbivores showed preferences throughout the year for adult leaves with more epiphyte and higher N contents. The maximum grazing on adult and intermediate leaves was observed in September and in June for fish and in March for urchins, whereas it was irregular for isopods. Grazing by the three herbivores was not related to their preference for leaves or epiphytes, notwithstanding the seasonal differences in their C and N contents. We concluded that herbivores show no preference for food type throughout the year and that seasonal consumption of P. oceanica is related mainly to herbivore behaviour.

  4. Future heat waves due to climate change threaten the survival of Posidonia oceanica seedlings.

    Science.gov (United States)

    Guerrero-Meseguer, Laura; Marín, Arnaldo; Sanz-Lázaro, Carlos

    2017-11-01

    Extreme weather events are major drivers of ecological change, and their occurrence is likely to increase due to climate change. The transient increases in atmospheric temperatures are leading to a greater occurrence of heat waves, extreme events that can produce a substantial warming of water, especially in enclosed basins such as the Mediterranean Sea. Here, we tested the effects of current and predicted heat waves on the early stages of development of the seagrass Posidonia oceanica. Temperatures above 27 °C limited the growth of the plant by inhibiting its photosynthetic system. It suffered a reduction in leaf growth and faster leaf senescence, and in some cases mortality. This study demonstrates that the greater frequency of heat waves, along with anticipated temperature rises in coming decades, are expected to negatively affect the germination of P. oceanica seedlings. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Marketing Ignorance and the Validity of Narver and Slater's MKTOR Scale in High-Tech Russian Firms

    NARCIS (Netherlands)

    Roersen, Mariska J.; Kraaijenbrink, Jeroen; Groen, Aard J.

    A firm's market orientation is an important factor influencing its ability to successfully develop and introduce new products. To measure market orientation, Narver and Slater's MKTOR scale has been accepted in the literature as a valid and reliable scale. In fact, it can be considered state of the

  6. Marketing ignorance and the validity of Narver and Slater's MKTOR scale in high-tech Russian firms

    NARCIS (Netherlands)

    Roersen, Mariska; Kraaijenbrink, Jeroen; Groen, Arend J.

    2013-01-01

    A firm's market orientation is an important factor influencing its ability to successfully develop and introduce new products. To measure market orientation, Narver and Slater's MKTOR scale has been accepted in the literature as a valid and reliable scale. In fact, it can be considered state of the

  7. Numerical evaluation of two-center integrals over Slater type orbitals

    Energy Technology Data Exchange (ETDEWEB)

    Kurt, S. A., E-mail: slaykurt@gmail.com [Department of Physics, Natural Sciences Institute, Ondokuz Mayıs University, 55139, Samsun (Turkey); Yükçü, N., E-mail: nyukcu@gmail.com [Department of Energy Systems Engineering, Faculty of Technology, Adıyaman University, 02040, Adıyaman (Turkey)

    2016-03-25

    Slater Type Orbitals (STOs) which one of the types of exponential type orbitals (ETOs) are used usually as basis functions in the multicenter molecular integrals to better understand physical and chemical properties of matter. In this work, we develop algorithms for two-center overlap and two-center two-electron hybrid and Coulomb integrals which are calculated with help of translation method for STOs and some auxiliary functions by V. Magnasco’s group. We use Mathematica programming language to produce algorithms for these calculations. Numerical results for some quantum numbers are presented in the tables. Consequently, we compare our obtained numerical results with the other known literature results and other details of evaluation method are discussed.

  8. A direct method to transform between expansions in the configuration state function and Slater determinant bases

    International Nuclear Information System (INIS)

    Olsen, Jeppe

    2014-01-01

    A novel algorithm is introduced for the transformation of wave functions between the bases of Slater determinants (SD) and configuration state functions (CSF) in the genealogical coupling scheme. By modifying the expansion coefficients as each electron is spin-coupled, rather than performing a single many-electron transformation, the large transformation matrix that plagues previous approaches is avoided and the required number of operations is drastically reduced. As an example of the efficiency of the algorithm, the transformation for a configuration with 30 unpaired electrons and singlet spin is discussed. For this case, the 10 × 10 6 coefficients in the CSF basis is obtained from the 150 × 10 6 coefficients in the SD basis in 1 min, which should be compared with the seven years that the previously employed method is estimated to require

  9. Numerical evaluation of two-center integrals over Slater type orbitals

    International Nuclear Information System (INIS)

    Kurt, S. A.; Yükçü, N.

    2016-01-01

    Slater Type Orbitals (STOs) which one of the types of exponential type orbitals (ETOs) are used usually as basis functions in the multicenter molecular integrals to better understand physical and chemical properties of matter. In this work, we develop algorithms for two-center overlap and two-center two-electron hybrid and Coulomb integrals which are calculated with help of translation method for STOs and some auxiliary functions by V. Magnasco’s group. We use Mathematica programming language to produce algorithms for these calculations. Numerical results for some quantum numbers are presented in the tables. Consequently, we compare our obtained numerical results with the other known literature results and other details of evaluation method are discussed.

  10. The Analytical Evaluation Of Three-Center Magnetic Multipole Moment Integrals By Using Slater Type Orbitals

    International Nuclear Information System (INIS)

    Oztekin, E.

    2010-01-01

    In this study, magnetic multipole moment integrals are calculated by using Slater type orbitals (STOs), Fourier transform and translation formulas. Firstly, multipole moment operators which appear in the three-center magnetic multipole moment integrals are translated to b-center from 0-center. So, three-center magnetic multipole moment integrals have been reduced to the two-center. Then, the obtained analytical expressions have been written in terms of overlap integrals. When the magnetic multipole moment integrals calculated, matrix representations for x-, y- and z-components of multipole moments was composed and every component was separately calculated to analytically. Consequently, magnetic multipole moment integrals are also given in terms of the same and different screening parameters.

  11. Recruitment and Patch Establishment by Seed in the Seagrass Posidonia oceanica: Importance and Conservation Implications

    OpenAIRE

    Balestri, Elena; Vallerini, Flavia; Lardicci, Claudio

    2017-01-01

    Seagrasses are declining globally, and deeper understanding is needed on the recruitment potential and distribution of new populations for many threatened species to support conservation planning in the face of climate change. Recruitment of Posidonia oceanica, a threatened seagrass endemic to the Mediterranean, has long been considered rare due to infrequent flowering, but mounting evidence demonstrates that the species is responding to a changing climate through greater reproductive effort....

  12. Genome, Functional Gene Annotation, and Nuclear Transformation of the Heterokont Oleaginous Alga Nannochloropsis oceanica CCMP1779

    Science.gov (United States)

    2012-11-15

    development of such an algal model system for basic discovery, we sequenced the genome and two sets of transcriptomes of N. oceanica CCMP1779, assembled...CCMP1779 has a gene encoding a highly conserved violax- anthin de-epoxidase ( VDE ) protein like that found in plants (Table S9). In Arabidopsis, VDE is...HLA3 or LCI1 were present. This result suggests that CCMP1779 might have a plastid Ci transport system similar to that of Chlamydomonas, but a distinct

  13. Marine space ecology and seagrasses. Does patch type matter in Posidonia oceanica seascapes?

    OpenAIRE

    Abadie, Arnaud; Gobert, Sylvie; Bonacorsi, Marina; Lejeune, Pierre; Pergent, Gérard; Pergent-Martini, Christine

    2015-01-01

    The use of landscape tools in the study of seagrass meadows (seascapes) begins to be widely spreadbut still require the establishment of several basis, i.e. a patch type classification based on numericalcharacteristics. Thanks to the complex seascapes created by the Posidonia oceanica meadows, they appearto be suitable for a study at a patch type level (class), which bring a new insight of their arrangement at thewhole seascape scale. By interpreting side scan sonar images from the Corsican c...

  14. Seascape ecology in Posidonia oceanica seagrass meadows: Linking structure and ecological processes for management

    OpenAIRE

    Abadie, Arnaud; Pace, Matthew; Gobert, Sylvie; Borg, Joseph

    2018-01-01

    Seagrass meadows constitute marine habitats in shallow water temperate and tropical coastal areas worldwide that have a high ecological and economic importance. Amongst the 60 or so seagrass species, the endemic Mediterranean species Posidonia oceanica forms meadows that are arguably the most important shallow water coastal habitat in the region but which are subjected to high anthropogenic pressures. Because of the relatively large size of the plant, the meadows formed by this seagrass have ...

  15. The impact of dredge-fill on Posidonia oceanica seagrass meadows: regression and patterns of recovery.

    Science.gov (United States)

    Badalamenti, Fabio; Alagna, Adriana; D'Anna, Giovanni; Terlizzi, Antonio; Di Carlo, Giuseppe

    2011-03-01

    Posidonia oceanica meadows can be severely damaged by dredge-fill operations. We report on the construction of gas pipelines that occurred between 1981 and 1993 in SW Sicily, Italy. A large portion of the meadow was mechanically removed, and the excavated trench was filled with a mosaic of substrates, ranging from sand to consolidated rock debris. Meadow loss and recovery were quantified over 7 years after the end of operations. We recorded an overall loss of 81.20 ha of meadow. Substrate strongly affected recovery as the percent cover by P. oceanica consistently increased on calcareous rubble, reaching values of 44.37 ± 3.05% in shallow sites after 7 years, whereas no significant increase occurred on other substrates. As in the Mediterranean Sea exploitation of coastal areas continues to grow with consequent impacts on P. oceanica meadows, this case study illustrates how artificial rubble-like materials could be employed to support the restoration of damaged meadows. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. The influence of light on copper-limited growth of an oceanic diatom, Thalassiosira oceanica (Coscinodiscophyceae).

    Science.gov (United States)

    Kim, Jun-Woo; Price, Neil M

    2017-10-01

    Thalassiosira oceanica (CCMP 1005) was grown over a range of copper concentrations at saturating and subsaturating irradiance to test the hypothesis that Cu and light were interacting essential resources. Growth was a hyperbolic function of irradiance in Cu-replete medium (263 fmol Cu' · L -1 ) with maximum rates achieved at 200 μmol photons · m -2  · s -1 . Lowering the Cu concentration at this irradiance to 30.8 fmol Cu' · L -1 decreased cellular Cu quota by 7-fold and reduced growth rate by 50%. Copper-deficient cells had significantly slower (P light, low-Cu concentration was no longer limiting to growth: Cu concentration and light interacted strongly to affect growth rate of T. oceanica (P light-dependent, suggesting that faster growth of T. oceanica under high light and low Cu was a result of light-stimulated Cu uptake. © 2017 Phycological Society of America.

  17. Metal contamination of Posidonia oceanica meadows along the Corsican coastline (Mediterranean)

    Energy Technology Data Exchange (ETDEWEB)

    Lafabrie, C. [University of Corsica, Faculty of Sciences, Equipe Ecosystemes Littoraux, BP 52, 20250 Corte (France)], E-mail: lafabrie@univ-corse.fr; Pergent-Martini, C.; Pergent, G. [University of Corsica, Faculty of Sciences, Equipe Ecosystemes Littoraux, BP 52, 20250 Corte (France)

    2008-01-15

    The aim of this study is to determine metal (Cd, Co, Cr, Hg, Ni, Pb) concentrations in Posidonia oceanica tissues along the Corsican coastline. The results show that except for Cr, all the metals are preferentially accumulated in the blades; this is particularly interesting as it means that future metal analyses may be carried out only on the blades avoiding thus the removal of the shoots. Moreover, they show that metal concentrations may reflect the 'background noise' of the Mediterranean Sea. Station 15 (Canari) can however be distinguished from the others due to its high Co, Cr and Ni concentrations. This result may be related to the presence of a previous asbestos mine, located near this station. Therefore, this study reinforces the usefulness and the relevance of Posidonia oceanica as a tracer of spatial metal contamination and as an interesting tool for water quality evaluation. - The seagrass Posidonia oceanica is a relevant tracer of spatial metal contamination and an interesting tool for water quality evaluation.

  18. Alterations of the structure of Posidonia oceanica beds due to the introduced alga Caulerpa taxifolia

    Directory of Open Access Journals (Sweden)

    Heike Molenaar

    2009-06-01

    Full Text Available The impact of Caulerpa taxifolia on the structure of shallow Posidonia oceanica beds was studied in permanent quadrats from 1995 to 2005 at the invaded site of Cap Martin and the control site of Cap d’Antibes (French Riviera, France. The cover of C. taxifolia, shoot density, number of orthotropic and plagiotropic shoots and proportion of ramifications of P. oceanica were measured yearly. The cover of C. taxifolia in the invaded zone rapidly reached a maximum of infestation in 2000 with 93% of the quadrats covered by the alga. In 2001 an unexplained phenomenon led to a sharp decrease in the infestation and in the following years the colonisation remained low. Within the 10 years of the study, P. oceanica did not disappear from the permanent quadrats, but we observed a drastic change in the structure of the meadow invaded by C. taxifolia. Between 1999 and 2000 a decrease in the shoot density observed at both sites was probably related to the warm temperature event recorded in 1999 (from 636 to 143 shoots m-2 at the invaded site and from 488 to 277 at the control site. At the invaded site, the seagrass never recovered its initial density even after a sharp decrease in C. taxifolia. The orthotropic/plagiotropic shoot ratio was strongly modified at the invaded site, where plagiotropic shoots became dominant because of an increase in their ramification.

  19. Palaeoclimatic conditions in the Mediterranean explain genetic diversity of Posidonia oceanica seagrass meadows

    KAUST Repository

    Chefaoui, Rosa M.

    2017-05-26

    Past environmental conditions in the Mediterranean Sea have been proposed as main drivers of the current patterns of distribution of genetic structure of the seagrass Posidonia oceanica, the foundation species of one of the most important ecosystems in the Mediterranean Sea. Yet, the location of cold climate refugia (persistence regions) for this species during the Last Glacial Maximum (LGM) is not clear, precluding the understanding of its biogeographical history. We used Ecological Niche Modelling together with existing phylogeographic data to locate Pleistocene refugia in the Mediterranean Sea and to develop a hypothetical past biogeographical distribution able to explain the genetic diversity presently found in P. oceanica meadows. To do that, we used an ensemble approach of six predictive algorithms and two Ocean General Circulation Models. The minimum SST in winter and the maximum SST in summer allowed us to hindcast the species range during the LGM. We found separate glacial refugia in each Mediterranean basin and in the Central region. Altogether, the results suggest that the Central region of the Mediterranean Sea was the most relevant cold climate refugium, supporting the hypothesis that long-term persistence there allowed the region to develop and retain its presently high proportion of the global genetic diversity of P. oceanica.

  20. Palaeoclimatic conditions in the Mediterranean explain genetic diversity of Posidonia oceanica seagrass meadows

    KAUST Repository

    Chefaoui, Rosa M.; Duarte, Carlos M.; Serrã o, Ester A.

    2017-01-01

    Past environmental conditions in the Mediterranean Sea have been proposed as main drivers of the current patterns of distribution of genetic structure of the seagrass Posidonia oceanica, the foundation species of one of the most important ecosystems in the Mediterranean Sea. Yet, the location of cold climate refugia (persistence regions) for this species during the Last Glacial Maximum (LGM) is not clear, precluding the understanding of its biogeographical history. We used Ecological Niche Modelling together with existing phylogeographic data to locate Pleistocene refugia in the Mediterranean Sea and to develop a hypothetical past biogeographical distribution able to explain the genetic diversity presently found in P. oceanica meadows. To do that, we used an ensemble approach of six predictive algorithms and two Ocean General Circulation Models. The minimum SST in winter and the maximum SST in summer allowed us to hindcast the species range during the LGM. We found separate glacial refugia in each Mediterranean basin and in the Central region. Altogether, the results suggest that the Central region of the Mediterranean Sea was the most relevant cold climate refugium, supporting the hypothesis that long-term persistence there allowed the region to develop and retain its presently high proportion of the global genetic diversity of P. oceanica.

  1. Recruitment and Patch Establishment by Seed in the Seagrass Posidonia oceanica: Importance and Conservation Implications

    Directory of Open Access Journals (Sweden)

    Elena Balestri

    2017-06-01

    Full Text Available Seagrasses are declining globally, and deeper understanding is needed on the recruitment potential and distribution of new populations for many threatened species to support conservation planning in the face of climate change. Recruitment of Posidonia oceanica, a threatened seagrass endemic to the Mediterranean, has long been considered rare due to infrequent flowering, but mounting evidence demonstrates that the species is responding to a changing climate through greater reproductive effort. Due to the fragmentary information on recruit occurrence and distribution, little is known about reproductive success in the species and its contribution to persistence. We assembled P. oceanica recruitment data from published and unpublished sources, including our own, to examine the frequency and extent of recruitment events (establishment of seedlings in a site, seedling growth potential and habitat characteristics at recruitment sites. Results show that at least one recruitment event has occurred about every 3 years, and 18 localities were colonized at least one time since the first seedling record in 1986. Notably, consistently high seedling inputs were observed in four localities of the Western Mediterranean. Seedlings established mainly on unoccupied substrate areas along the coasts of islands, in sheltered sites and at shallower depths (<3 m than the upper limit of adjacent P. oceanica meadows. Seedling establishment occurred more frequently on rocky than on sandy substrate, and rarely on dead “matte” or meadows of the seagrass Cymodocea nodosa. The chance of colonization success on rock was two times higher than on sand. Our 11 years of observations have allowed for the first time the documentation of the formation and development of patches by P. oceanica seed. These findings contradict the historical assumption that sexual recruitment is rare and usually unsuccessful for P. oceanica, and highlight the potential importance of recruitment for

  2. Effects of fish farm waste on Posidonia oceanica meadows: Synthesis and provision of monitoring and management tools

    Energy Technology Data Exchange (ETDEWEB)

    Holmer, Marianne [Institute of Biology, University of Southern Denmark, Campusvej 55, DK-5230 Odense M (Denmark)], E-mail: holmer@biology.sdu.dk; Argyrou, Marina [Marine Environment Division, Department of Fisheries and Marine Research, Ministry of Agriculture, Natural Resources and Environment, 101 Bethleem Street, 1416 Nicosia (Cyprus); Dalsgaard, Tage [Department of Marine Ecology, National Environmental Research Institute, Aarhus University, Vejlsovej 25, P.O. Box 314, DK-8600 Silkeborg (Denmark); Danovaro, Roberto [Department of Marine Science, Polytechnic University of Marche, Via Brecce Bianche, 60131 Ancona (Italy); Diaz-Almela, Elena; Duarte, Carlos M. [IMEDEA (CSIC-UIB), Miquel Marques 21, 07190 Esporles (Illes Balears) (Spain); Frederiksen, Morten [Institute of Biology, University of Southern Denmark, Campusvej 55, DK-5230 Odense M (Denmark); Grau, Antoni [Direccio General de Pesca, Conselleria d' Agricultura i Pesca, Govern de les Illes Balears, Foners 10, 07006 Palma de Mallorca (Illes Balears) (Spain); Karakassis, Ioannis [Marine Ecology Laboratory, Biology Department, University of Crete, Heraklion, 71409 Crete (Greece); Marba, Nuria [IMEDEA (CSIC-UIB), Miquel Marques 21, 07190 Esporles (Illes Balears) (Spain); Mirto, Simone [Institute for the Marine Coastal Environment, National Council of Research, Spianata S. Raineri, 86, 98122 Messina (Italy); Perez, Marta [Departament d' Ecologia, Universitat de Barcelona, Av. Diagonal 645, 08028 Barcelona (Spain); Pusceddu, Antonio [Department of Marine Science, Polytechnic University of Marche, Via Brecce Bianche, 60131 Ancona (Italy); Tsapakis, Manolis [Institute of Oceanography, Hellenic Center for Marine Research, P.O. Box 2214, GR 71003 Heraklion, Crete (Greece)

    2008-09-15

    This paper provides a synthesis of the EU project MedVeg addressing the fate of nutrients released from fish farming in the Mediterranean with particular focus on the endemic seagrass Posidonia oceanica habitat. The objectives were to identify the main drivers of seagrass decline linked to fish farming and to provide sensitive indicators of environmental change, which can be used for monitoring purposes. The sedimentation of waste particles in the farm vicinities emerges as the main driver of benthic deterioration, such as accumulation of organic matter, sediment anoxia as well as seagrass decline. The effects of fish farming on P. oceanica meadows are diverse and complex and detected through various metrics and indicators. A safety distance of 400 m is suggested for management of P. oceanica near fish farms followed by establishment of permanent seagrass plots revisited annually for monitoring the health of the meadows.

  3. Ictioplancton asociado a praderas de Posidonia oceanica durante la época estival en la reserva marina de Tabarca

    Directory of Open Access Journals (Sweden)

    Del Pilar Ruso, Y.

    2007-01-01

    Full Text Available Ichthyoplankton associated with P. oceanica meadows during the summer season in the Tabarca marine reserveHabitat complexity plays a key role in survival in early stages of fish larvae. We investigated fish larvae assemblage and its relation with P. oceanicaseagrass at the Tabarca Island Marine Reserve. Samples were taken using moored plankton nets at two depths (0 and 2 m from P. oceanica meadow over five consecutive days in July 2000. Three hundred and fifty¿three larvae were captured. The mostabundant families were Clupeidae (31%, Sparidae (27%, Engraulidae (11% and Gobiidae (6%. We observed that small fish larvae were able to select nursery areas. We conclude that the P. oceanica leaf canopy is a major factor in structuring the larval fish assemblages of some demersal species.

  4. Effects of fish farm waste on Posidonia oceanica meadows: Synthesis and provision of monitoring and management tools

    International Nuclear Information System (INIS)

    Holmer, Marianne; Argyrou, Marina; Dalsgaard, Tage; Danovaro, Roberto; Diaz-Almela, Elena; Duarte, Carlos M.; Frederiksen, Morten; Grau, Antoni; Karakassis, Ioannis; Marba, Nuria; Mirto, Simone; Perez, Marta; Pusceddu, Antonio; Tsapakis, Manolis

    2008-01-01

    This paper provides a synthesis of the EU project MedVeg addressing the fate of nutrients released from fish farming in the Mediterranean with particular focus on the endemic seagrass Posidonia oceanica habitat. The objectives were to identify the main drivers of seagrass decline linked to fish farming and to provide sensitive indicators of environmental change, which can be used for monitoring purposes. The sedimentation of waste particles in the farm vicinities emerges as the main driver of benthic deterioration, such as accumulation of organic matter, sediment anoxia as well as seagrass decline. The effects of fish farming on P. oceanica meadows are diverse and complex and detected through various metrics and indicators. A safety distance of 400 m is suggested for management of P. oceanica near fish farms followed by establishment of permanent seagrass plots revisited annually for monitoring the health of the meadows

  5. Extremely compact formulas for the Fourier transform of a product of two-centre Slater-type orbitals

    International Nuclear Information System (INIS)

    Vukovic, T; Dmitrovic, S

    2010-01-01

    A compact formula for the Fourier transform of a product of Slater-type orbitals on different centres is derived. The integral is reduced to a finite one-dimensional integration over non-oscillatory hypergeometric functions of type 1 F 2 (x;y;z). The formula is valid for all quantum numbers and does not involve the reduced Bessel functions that are usually used to evaluate these integrals. Reduced formulas are calculated for some special directions in the reciprocal space. Also, some useful identities for the Fourier transforms of a product of Slater-type orbitals with correlated sets of parameters are obtained. In order to illustrate simple and efficient use of the presented results, we have applied them to graphene.

  6. Modular relations for the Rogers-Ramanujan-Slater type functions of order fifteen and its applications to partitions

    Directory of Open Access Journals (Sweden)

    Chandrashekar Adiga

    2013-10-01

    Full Text Available In a manuscript of Ramanujan, published with his Lost Notebook [20] there are forty identities involving the Rogers-Ramanujan functions. In this paper, we establish several modular relations involving the Rogers-Ramanujan functions and the Rogers-Ramanujan-Slater type functions of order fifteen which are analogues to Ramanujan’s well known forty identities. Furthermore, we give partition theoretic interpretations of two modular relations.

  7. Investigation of the structure change of atomic shells due to uranium ionization by the Dirac-Fock-Slater method

    International Nuclear Information System (INIS)

    Shchornak, G.

    1979-01-01

    The influence of outer vacancies in the atomic shells of uranium on the atomic shell structure is claculated by the Dirac-Fock-Slater method. It is found out that the energy of the X-ray transitions increases due to the detachment of the electrons with the lowest binding energies. The electron detachment from the subshells of the 4f level gives rise to negative energy shifts of the X-ray transitions.(author)

  8. Oscillator strength of partially ionized high-Z atom on Hartree-Fock Slater model

    International Nuclear Information System (INIS)

    Nakamura, S.; Nishikawa, T.; Takabe, H.; Mima, K.

    1991-01-01

    The Hartree-Fock Slater (HFS) model has been solved for the partially ionized gold ions generated when an intense laser light is irradiated on a gold foil target. The resultant energy levels are compared with those obtained by a simple screened hydrogenic model with l-splitting effect (SHML). It is shown that the energy levels are poorly model by SHML as the ionization level becomes higher. The resultant wave functions are used to evaluate oscillator strength of important line radiations and compared with those obtained by a simple model using hydrogenic wave functions. Its demonstrated that oscillator strength of the 4p-4d and 4d-4f lines are well modeled by the simple method, while the 4-5 transitions such as 4f-5g, 4d-5f, 4p-5d, and 4f-5p forming the so-called N-band emission are poorly modeled and HFS results less strong line emissions. (author)

  9. Delayed Slater determinant update algorithms for high efficiency quantum Monte Carlo

    Science.gov (United States)

    McDaniel, T.; D'Azevedo, E. F.; Li, Y. W.; Wong, K.; Kent, P. R. C.

    2017-11-01

    Within ab initio Quantum Monte Carlo simulations, the leading numerical cost for large systems is the computation of the values of the Slater determinants in the trial wavefunction. Each Monte Carlo step requires finding the determinant of a dense matrix. This is most commonly iteratively evaluated using a rank-1 Sherman-Morrison updating scheme to avoid repeated explicit calculation of the inverse. The overall computational cost is, therefore, formally cubic in the number of electrons or matrix size. To improve the numerical efficiency of this procedure, we propose a novel multiple rank delayed update scheme. This strategy enables probability evaluation with an application of accepted moves to the matrices delayed until after a predetermined number of moves, K. The accepted events are then applied to the matrices en bloc with enhanced arithmetic intensity and computational efficiency via matrix-matrix operations instead of matrix-vector operations. This procedure does not change the underlying Monte Carlo sampling or its statistical efficiency. For calculations on large systems and algorithms such as diffusion Monte Carlo, where the acceptance ratio is high, order of magnitude improvements in the update time can be obtained on both multi-core central processing units and graphical processing units.

  10. Chemoreception of the Seagrass Posidonia Oceanica by Benthic Invertebrates is Altered by Seawater Acidification.

    Science.gov (United States)

    Zupo, Valerio; Maibam, Chingoileima; Buia, Maria Cristina; Gambi, Maria Cristina; Patti, Francesco Paolo; Scipione, Maria Beatrice; Lorenti, Maurizio; Fink, Patrick

    2015-08-01

    Several plants and invertebrates interact and communicate by means of volatile organic compounds (VOCs). These compounds may play the role of infochemicals, being able to carry complex information to selected species, thus mediating inter- or intra-specific communications. Volatile organic compounds derived from the wounding of marine diatoms, for example, carry information for several benthic and planktonic invertebrates. Although the ecological importance of VOCs has been demonstrated, both in terrestrial plants and in marine microalgae, their role as infochemicals has not been demonstrated in seagrasses. In addition, benthic communities, even the most complex and resilient, as those associated to seagrass meadows, are affected by ocean acidification at various levels. Therefore, the acidification of oceans could produce interference in the way seagrass-associated invertebrates recognize and choose their specific environments. We simulated the wounding of Posidonia oceanica leaves collected at two sites (a control site at normal pH, and a naturally acidified site) off the Island of Ischia (Gulf of Naples, Italy). We extracted the VOCs and tested a set of 13 species of associated invertebrates for their specific chemotactic responses in order to determine if: a) seagrasses produce VOCs playing the role of infochemicals, and b) their effects can be altered by seawater pH. Our results indicate that several invertebrates recognize the odor of wounded P. oceanica leaves, especially those strictly associated to the leaf stratum of the seagrass. Their chemotactic reactions may be modulated by the seawater pH, thus impairing the chemical communications in seagrass-associated communities in acidified conditions. In fact, 54% of the tested species exhibited a changed behavioral response in acidified waters (pH 7.7). Furthermore, the differences observed in the abundance of invertebrates, in natural vs. acidified field conditions, are in agreement with these behavioral

  11. Responses of the Mediterranean seagrass Posidonia oceanica to hypersaline stress duration and recovery.

    Science.gov (United States)

    Marín-Guirao, Lázaro; Sandoval-Gil, Jose Miguel; Bernardeau-Esteller, Jaime; Ruíz, Juan Manuel; Sánchez-Lizaso, Jose Luis

    2013-03-01

    We studied the hypersaline stress responses of the Mediterranean seagrass Posidonia oceanica to determine if the species was tolerant to salinity increases that occur in coastal waters by the desalination industry. Water relations, amino acids, carbohydrates, ions, photosynthesis, respiration, chlorophyll a fluorescence, leaf growth and morphology, and plant mortality were analysed after exposing the mesocosm P. oceanica to a salinity level of 43 for one and three months followed by a month for recovery. One-month saline-stressed plants exhibited sub-lethal effects, including a leaf cell turgor pressure reduction, loss of ionic equilibrium and decreased leaf growth. There were also changes in photoprotective mechanisms, increased concentrations of organic osmolytes in leaves and reduced leaf ageing. All these dysfunctions recovered after removing the stress. After the longer exposure of three months, stress symptoms were much more acute and plants showed an excessive ionic exclusion capacity, increased leaf cell turgor, reduced plant carbon balance, increased leaf aging and leaf decay and increased plant mortality, which indicated that the plant had entered a stage of severe physiological stress. In addition, the long-term saline-stressed plants were not able to recover, still showing sustained injury after the one-month recovery period as reflected by unbalanced leaf ionic content, persistently impaired photosynthesis, decline in internal carbon resources and decreased leaf growth that resulted in undersized plants. In conclusion, P. oceanica was not able to acclimate to the saline conditions tested since it could not reach a new physiological equilibrium or recover after a chronic exposure of 3 months. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Response of Posidonia oceanica seagrass and its epibiont communities to ocean acidification.

    Directory of Open Access Journals (Sweden)

    Katja Guilini

    Full Text Available The unprecedented rate of CO2 increase in our atmosphere and subsequent ocean acidification (OA threatens coastal ecosystems. To forecast the functioning of coastal seagrass ecosystems in acidified oceans, more knowledge on the long-term adaptive capacities of seagrass species and their epibionts is needed. Therefore we studied morphological characteristics of Posidonia oceanica and the structure of its epibiont communities at a Mediterranean volcanic CO2 vent off Panarea Island (Italy and performed a laboratory experiment to test the effect of OA on P. oceanica photosynthesis and its potential buffering capacity. At the study site east of Basiluzzo Islet, venting of CO2 gas was controlled by tides, resulting in an average pH difference of 0.1 between the vent and reference site. P. oceanica shoot and leaf density was unaffected by these levels of OA, although shorter leaves at the vent site suggest increased susceptibility to erosion, potentially by herbivores. The community of sessile epibionts differed in composition and was characterized by a higher species richness at the vent site, though net epiphytic calcium carbonate concentration was similar. These findings suggest a higher ecosystem complexity at the vent site, which may have facilitated the higher diversity of copepods in the otherwise unaffected motile epibiont community. In the laboratory experiment, P. oceanica photosynthesis increased with decreasing pHT (7.6, 6.6, 5.5, which induced an elevated pH at the leaf surfaces of up to 0.5 units compared to the ambient seawater pHT of 6.6. This suggests a temporary pH buffering in the diffusive boundary layer of leaves, which could be favorable for epibiont organisms. The results of this multispecies study contribute to understanding community-level responses and underlying processes in long-term acidified conditions. Increased replication and monitoring of physico-chemical parameters on an annual scale are, however, recommended to

  13. Response of Posidonia oceanica seagrass and its epibiont communities to ocean acidification.

    Science.gov (United States)

    Guilini, Katja; Weber, Miriam; de Beer, Dirk; Schneider, Matthias; Molari, Massimiliano; Lott, Christian; Bodnar, Wanda; Mascart, Thibaud; De Troch, Marleen; Vanreusel, Ann

    2017-01-01

    The unprecedented rate of CO2 increase in our atmosphere and subsequent ocean acidification (OA) threatens coastal ecosystems. To forecast the functioning of coastal seagrass ecosystems in acidified oceans, more knowledge on the long-term adaptive capacities of seagrass species and their epibionts is needed. Therefore we studied morphological characteristics of Posidonia oceanica and the structure of its epibiont communities at a Mediterranean volcanic CO2 vent off Panarea Island (Italy) and performed a laboratory experiment to test the effect of OA on P. oceanica photosynthesis and its potential buffering capacity. At the study site east of Basiluzzo Islet, venting of CO2 gas was controlled by tides, resulting in an average pH difference of 0.1 between the vent and reference site. P. oceanica shoot and leaf density was unaffected by these levels of OA, although shorter leaves at the vent site suggest increased susceptibility to erosion, potentially by herbivores. The community of sessile epibionts differed in composition and was characterized by a higher species richness at the vent site, though net epiphytic calcium carbonate concentration was similar. These findings suggest a higher ecosystem complexity at the vent site, which may have facilitated the higher diversity of copepods in the otherwise unaffected motile epibiont community. In the laboratory experiment, P. oceanica photosynthesis increased with decreasing pHT (7.6, 6.6, 5.5), which induced an elevated pH at the leaf surfaces of up to 0.5 units compared to the ambient seawater pHT of 6.6. This suggests a temporary pH buffering in the diffusive boundary layer of leaves, which could be favorable for epibiont organisms. The results of this multispecies study contribute to understanding community-level responses and underlying processes in long-term acidified conditions. Increased replication and monitoring of physico-chemical parameters on an annual scale are, however, recommended to assure that the

  14. Fungal root symbionts of the seagrass Posidonia oceanica in the central Adriatic Sea revealed by microscopy, culturing and 454-pyrosequencing

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Borovec, Ondřej; Župan, I.; Kolařík, Miroslav; Sudová, Radka

    2017-01-01

    Roč. 583, November 16 (2017), s. 107-120 ISSN 0171-8630 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : seagrass es * Posidonia oceanica * root mycobionts Subject RIV: EH - Ecology, Behaviour; EE - Microbiology, Virology (MBU-M) OBOR OECD: Ecology; Microbiology (MBU-M) Impact factor: 2.292, year: 2016

  15. Light availability and temperature, not increased CO2, will structure future meadows of Posidonia oceanica

    KAUST Repository

    Hendriks, Iris E.

    2017-02-15

    We evaluated the photosynthetic performance of Posidonia oceanica during short-term laboratory exposures to ambient and elevated temperatures (24–25°C and 29–30°C) warming and pCO2 (380, 750 and 1000ppm pCO2) under normal and low light conditions (200 and 40μmol photons m−2s−1 respectively). Plant growth was measured at the low light regime and showed a negative response to warming. Light was a critical factor for photosynthetic performance, although we found no evidence of compensation of photosynthetic quantum efficiency in high light. Relative Electron Rate Transport (rETRmax) was higher in plants incubated in high light, but not affected by pCO2 or temperature. The saturation irradiance (Ik) was negatively affected by temperature. We conclude that elevated CO2 does not enhance photosynthetic activity and growth, in the short term for P. oceanica, while temperature has a direct negative effect on growth. Low light availability also negatively affected photosynthetic performance during the short experimental period examined here. Therefore increasing concentrations of CO2 may not compensate for predicted future conditions of warmer water and higher turbidity for seagrass meadows.

  16. Posidonia oceanica (L. Delile Ethanolic Extract Modulates Cell Activities with Skin Health Applications

    Directory of Open Access Journals (Sweden)

    Laura Cornara

    2018-01-01

    Full Text Available Seagrasses are high plants sharing adaptive metabolic features with both terrestrial plants and marine algae, resulting in a phytocomplex possibly endowed with interesting biological properties. The aim of this study is to evaluate the in vitro activities on skin cells of an ethanolic extract obtained from the leaves of Posidonia oceanica (L. Delile, family Potamogetonaceae, herein named Posidonia ethanolic extract (PEE. PEE showed high radical scavenging activity, high phenolic content, and resulted rich in chicoric acid, as determined through HPLC-MS analysis. The use of MTT assay on fibroblasts showed a PEE cytotoxicity threshold (IC05 of 50 µg/mL at 48 h, while a sub-toxic dose of 20 µg/mL induced a significant increase of fibroblast growth rate after 10 days. In addition, an ELISA assay revealed that PEE doses of 5 and 10 µg/mL induced collagen production in fibroblasts. PEE induced dose-dependent mushroom tyrosinase inhibition, up to about 45% inhibition at 1000 µg/mL, while 50% reduction of melanin was observed in melanoma cells exposed to 50 µg/mL PEE. Finally, PEE lipolytic activity was assessed by measuring glycerol release from adipocytes following triglyceride degradation. In conclusion, we have collected new data about the biological activities of the phytocomplex of P. oceanica seagrass on skin cells. Our findings indicate that PEE could be profitably used in the development of products for skin aging, undesired hyperpigmentation, and cellulite.

  17. Light availability and temperature, not increased CO2, will structure future meadows of Posidonia oceanica

    KAUST Repository

    Hendriks, Iris E.; Olsen, Ylva S.; Duarte, Carlos M.

    2017-01-01

    We evaluated the photosynthetic performance of Posidonia oceanica during short-term laboratory exposures to ambient and elevated temperatures (24–25°C and 29–30°C) warming and pCO2 (380, 750 and 1000ppm pCO2) under normal and low light conditions (200 and 40μmol photons m−2s−1 respectively). Plant growth was measured at the low light regime and showed a negative response to warming. Light was a critical factor for photosynthetic performance, although we found no evidence of compensation of photosynthetic quantum efficiency in high light. Relative Electron Rate Transport (rETRmax) was higher in plants incubated in high light, but not affected by pCO2 or temperature. The saturation irradiance (Ik) was negatively affected by temperature. We conclude that elevated CO2 does not enhance photosynthetic activity and growth, in the short term for P. oceanica, while temperature has a direct negative effect on growth. Low light availability also negatively affected photosynthetic performance during the short experimental period examined here. Therefore increasing concentrations of CO2 may not compensate for predicted future conditions of warmer water and higher turbidity for seagrass meadows.

  18. Epiphytes modulate Posidonia oceanica photosynthetic production, energetic balance, antioxidant mechanisms and oxidative damage

    Directory of Open Access Journals (Sweden)

    Monya Mendes Costa

    2015-12-01

    Full Text Available Epiphytes impose physical barriers to light penetration into seagrass leaves causing shading, which may decrease the production of oxygen reactive species (ROS, but also constitute a physical aggression that may trigger the production of ROS, leading to oxidative damage. Here we investigate the effects of epiphytes on Posidonia oceanica under both interactive perspectives, light attenuation and oxidative stress. Specifically the role of epiphytes in net photosynthesis, chlorophyll a and b, photoprotection (Violaxanthin+Anteraxanthin+Zeaxanthin cycle, soluble sugar and starch contents, enzymatic (ascorbate peroxidase (APX and dehydroascorbate reductase (DHAR and global (trolox equivalent antioxidant capacity (TEAC and oxygen radical antioxidant capacity (ORAC antioxidant responses, phenolics and oxidative damage (malondialdehyde are tested. Leaves with epiphytes showed higher chlorophyll b and lower content in VAZ cycle carotenoids. Epiphyte shading was the probable reason for the lower VAZ de-epoxidation-ratio of leaves with epiphytes. In spite of being shaded, leaves with epiphytes showed higher antioxidant levels, indicating that epiphytes trigger the production of ROS. Both ORAC and TEAC and also APX and DHAR activities were higher in leaves with epiphytes, indicating that this response was related with its presence. Malondialdehyde concentrations also suggest oxidative damage caused by epiphytes. We conclude that the epiphyte load causes oxidative stress in P. oceanica and the mechanisms to scavenge ROS were not completely effective to avoid cell damage.

  19. Purification of intact chloroplasts from marine plant Posidonia oceanica suitable for organelle proteomics.

    Science.gov (United States)

    Piro, Amalia; Serra, Ilia Anna; Spadafora, Antonia; Cardilio, Monica; Bianco, Linda; Perrotta, Gaetano; Santos, Rui; Mazzuca, Silvia

    2015-12-01

    Posidonia oceanica is a marine angiosperm, or seagrass, adapted to grow to the underwater life from shallow waters to 50 m depth. This raises questions of how their photosynthesis adapted to the attenuation of light through the water column and leads to the assumption that biochemistry and metabolism of the chloroplast are the basis of adaptive capacity. In the present study, we described a protocol that was adapted from those optimized for terrestrial plants, to extract chloroplasts from as minimal tissue as possible. We obtained the best balance between tissue amount/intact chloroplasts yield using one leaf from one plant. After isopynic separations, the chloroplasts purity and integrity were evaluated by biochemical assay and using a proteomic approach. Chloroplast proteins were extracted from highly purified organelles and resolved by 1DE SDS-PAGE. Proteins were sequenced by nLC-ESI-IT-MS/MS of 1DE gel bands and identified against NCBInr green plant databases, Dr. Zompo database for seagrasses in a local customized dataset. The curated localization of proteins in sub-plastidial compartments (i.e. envelope, stroma and thylakoids) was retrieved in the AT_CHLORO database. This purification protocol and the validation of compartment markers may serve as basis for sub-cellular proteomics in P. oceanica and other seagrasses. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Unified analytical treatment of multicentre electron attraction, electric field and electric field gradient integrals over Slater orbitals

    International Nuclear Information System (INIS)

    Guseinov, I I

    2004-01-01

    The new central and noncentral potential functions (CPFs and NCPFs) of a molecule depending on the coordinates of the nuclei are introduced. Using complete orthonormal sets of Ψ α -exponential-type orbitals (Ψ α -ETOs) introduced by the author, the series expansion formulae for the multicentre electronic attraction (EA), electric field (EF) and electric field gradient (EFG) integrals over Slater-type orbitals (STOs) in terms of CPFs and NCPFs are derived. The relationships obtained are valid for the arbitrary location, quantum numbers and screening constants of STOs

  1. A method for the calculation of collision strengths for complex atomic structures based on Slater parameter optimisation

    International Nuclear Information System (INIS)

    Fawcett, B.C.; Mason, H.E.

    1989-02-01

    This report presents details of a new method to enable the computation of collision strengths for complex ions which is adapted from long established optimisation techniques previously applied to the calculation of atomic structures and oscillator strengths. The procedure involves the adjustment of Slater parameters so that they determine improved energy levels and eigenvectors. They provide a basis for collision strength calculations in ions where ab initio computations break down or result in reducible errors. This application is demonstrated through modifications of the DISTORTED WAVE collision code and SUPERSTRUCTURE atomic-structure code which interface via a transformation code JAJOM which processes their output. (author)

  2. Hartree--Slater calculation of the cross section for L-shell ionization of argon by simple heavy charged particles

    International Nuclear Information System (INIS)

    Choi, B.

    1975-01-01

    The cross sections for L-shell and subshell ionization by direct Coulomb excitation of argon by incident heavy charged particles are evaluated. Incident particles are described in the plane-wave Born approximation, and nonrelativistic Hartree-Slater (HS) wave functions are used for the atomic electrons. Form factors, energy distributions, and ionization cross sections are compared with those obtained from screened hydrogenic wave functions. At most incident energies, the HS results for the total ionization cross section are only slightly smaller than those obtained with screened hydrogenic wave functions, but considerable discrepancies are found for form factors and energy distributions near the ionization threshold

  3. Legal protection is not enough: Posidonia oceanica meadows in marine protected areas are not healthier than those in unprotected areas of the northwest Mediterranean Sea.

    Science.gov (United States)

    Montefalcone, Monica; Albertelli, Giancarlo; Morri, Carla; Parravicini, Valeriano; Bianchi, Carlo Nike

    2009-04-01

    Using the Conservation Index, which measures the proportional amount of dead matte relative to live Posidonia oceanica, we assessed the health of 15 P. oceanica meadows at a regional scale along the coast of Liguria (NW Mediterranean). These areas were characterized by different degrees of anthropization, from highly urbanized sites to marine protected areas. Two different scenarios were identified according to depth: in shallow zones, the health of P. oceanica meadows was related to the degree of anthropization along the coastline. In contrast, in deep zones, most meadows exhibited poor health, independent of both the degree of disturbance and the legal measures protecting the area. Working synergistically with the regional impact of increased water turbidity, local impacts from the coast were recognized as the main causes of the severe regression of most Ligurian P. oceanica meadows. We conclude that marine protected areas alone are not sufficient to guarantee the protection of P. oceanica meadows. We emphasize the need for a management network involving the Sites of Community Interest (SCIs) containing P. oceanica meadows.

  4. Towards Visual Navigation of an Autonomous Underwater Vehicle in Areas with Posidonia Oceanica

    Directory of Open Access Journals (Sweden)

    Francisco Bonin-Font

    2017-12-01

    Full Text Available This paper presents an exhaustive, extensive and detailed experimental assessment of different types of visual key-points in terms of robustness, stability and traceability, in images taken in marine areas densely colonized with Posidonia Oceanica (P.O.. This work has been focused mainly in two issues: a evaluating the  capacity of several image color and contrast enhancing preprocessing techniques to increase the image quality and the number of stable features, and b finding the pair feature detector/descriptor, from a wide range of different combinations, that maximizes the number of inlier correspondences in consecutive frames or frames that close a loop (images that overlap, taken at distant time instants, from different viewpoints or even with different environmental conditions. Conclusions extracted from both evaluations will affect directly the quality of visual odometers and/or the image registration processes involved in visual SLAM approaches.

  5. Simulations of dredged sediment spreading on a Posidonia oceanica meadow off the Ligurian coast, Northwestern Mediterranean.

    Science.gov (United States)

    Capello, M; Cutroneo, L; Ferranti, M P; Budillon, G; Bertolotto, R M; Ciappa, A; Cotroneo, Y; Castellano, M; Povero, P; Tucci, S

    2014-02-15

    The sandy deposits from dredging can have negative effects on the environment such as increase in suspended solids in the water column and their consequent transport. An experimental study was conducted to characterize water masses, dynamics, and sedimentation rates on the Ligurian continental shelf (Italy), where both a sand deposit, that could be used for beach nourishment, and a nearby Posidonia oceanica meadow coexist. The environmental plan provides a mathematical simulation of the sediment-dispersion to evaluate the possible impact on the meadow. It has been calculated that the dredging could double the concentration of suspended particles, but its scheduling will preclude a sediment accumulation. All the information obtained from this work will be used to study the environmental feasibility of the sand deposit exploitation and as starting point for drawing up the monitoring plan in case of dredging. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Activated carbon derived from marine Posidonia Oceanica for electric energy storage

    Directory of Open Access Journals (Sweden)

    N. Boukmouche

    2014-07-01

    Full Text Available In this paper, the synthesis and characterization of activated carbon from marine Posidonia Oceanica were studied. The activated carbon was prepared by a simple process namely pyrolysis under inert atmosphere. The activated carbon can be used as electrodes for supercapacitor devices. X-ray diffraction result revealed a polycrystalline graphitic structure. While scanning electron microscope investigation showed a layered structure with micropores. The EDS analysis showed that the activated carbon contains the carbon element in high atomic percentage. Electrochemical impedance spectroscopy revealed a capacitive behavior (electrostatic phenomena. The specific capacity per unit area of the electrochemical double layer of activated carbon electrode in sulfuric acid electrolyte was 3.16 F cm−2. Cyclic voltammetry and galvanostatic chronopotentiometry demonstrated that the electrode has excellent electrochemical reversibility. It has been found that the surface capacitance was strongly related to the specific surface area and pore size.

  7. Reduced carbon sequestration in a Mediterranean seagrass (Posidonia oceanica) ecosystem impacted by fish farming

    DEFF Research Database (Denmark)

    Apostolaki, E; Holmer, Marianne; Marbà, N

    2011-01-01

    We studied the relationship between sediment nutrient enrichment and carbon sequestration, using the ratio of gross primary production to respiration (P/R), in a fish-farming impacted and an unaffected Mediterranean seagrass (Posidonia oceanica) ecosystem in the Aegean Sea, Greece. Carbon (C......), nitrogen (N) and phosphorus (P) sedimentation, nutrient pools in sediment and dissolved nutrients in pore water were significantly and positively intercorrelated, indicating close linkage between sedimentation and sediment nutrient pools in seagrass meadows. C, N and P sediment pools were significantly...... nutrient enrichment. Threshold values are given for C, N and P sedimentation rates and sediment pools, and for N and P concentrations in pore waters, after which P/R ratio in the seagrass meadow decreases below 1, indicating a shift from autotrophy to heterotrophy with sediment nutrient enrichment...

  8. Aeolian transport of seagrass ( Posidonia oceanica ) beach-cast to terrestrial systems

    KAUST Repository

    Jiménez, Maria A.

    2017-06-29

    The annual export of the Mediterranean seagrass (Posidonia oceanica) litter to adjacent beaches and coastal dunes was quantified by examining the fortnight evolution of seagrass beach-cast volume on two beaches in the NW Mediterranean (Son Real and Es Trenc, Mallorca Island, Spain) for two years and analyzing the wind speed and direction obtained from the closest Meteorological Spanish Agency surface weather stations. The decomposition stage of the deposits was examined by analyzing the total hydrolysable amino acids, its percentage distribution and derived degradation indexes. Prevalent winds exceeding 6 m s−1, the coastline morphology and type of terrestrial vegetation determine the annual dynamics of the seagrass beach-cast. In the most protected beach (Son Real) the seagrass beach-cast remained nearly stationary during the two studied years while it exhibited wide annual fluctuations in the less protected one (Es Trenc). The amounts of P. oceanica wrack washed on Son Real and Es Trenc beaches, respectively, were estimated at 309 kg DW m coastline−1 yr−1 and 1359 kg DW m coastline−1 yr−1. They supplied between 20 kg CaCO3 m coastline−1 yr−1 and 47 kg CaCO3 m coastline−1 yr−1. Between 54% (Son Real) and 70% (Es Trenc) of seagrass beach-cast, respectively accounting for 1.5 kg N m coastline−1 yr−1 and 8.6 kg N m coastline−1 yr−1, were annually exported from the beaches to adjacent dune systems. Our results reveal that Mediterranean seagrass meadows might be an important source of materials, including sand and nutrients, for adjacent terrestrial systems, able to support their functioning.

  9. Metabolic Remodeling of Membrane Glycerolipids in the Microalga Nannochloropsis oceanica under Nitrogen Deprivation

    Directory of Open Access Journals (Sweden)

    Danxiang Han

    2017-08-01

    Full Text Available HIGHLIGHTSAn electrospray ionization mass spectrometry-based lipidomics method was developed and integrated with transcriptomics to elucidate metabolic remodeling and turnover of microalgal membrane lipids by using Nannochloropsis oceanica as a model.The lack of lipidome analytical tools has limited our ability to gain new knowledge about lipid metabolism in microalgae, especially for membrane glycerolipids. An electrospray ionization mass spectrometry-based lipidomics method was developed for Nannochloropsis oceanica IMET1, which resolved 41 membrane glycerolipids molecular species belonging to eight classes. Changes in membrane glycerolipids under nitrogen deprivation and high-light (HL conditions were uncovered. The results showed that the amount of plastidial membrane lipids including monogalactosyldiacylglycerol, phosphatidylglycerol, and the extraplastidic lipids diacylglyceryl-O-4′-(N, N, N,-trimethyl homoserine and phosphatidylcholine decreased drastically under HL and nitrogen deprivation stresses. Algal cells accumulated considerably more digalactosyldiacylglycerol and sulfoquinovosyldiacylglycerols under stresses. The genes encoding enzymes responsible for biosynthesis, modification and degradation of glycerolipids were identified by mining a time-course global RNA-seq data set. It suggested that reduction in lipid contents under nitrogen deprivation is not attributable to the retarded biosynthesis processes, at least at the gene expression level, as most genes involved in their biosynthesis were unaffected by nitrogen supply, yet several genes were significantly up-regulated. Additionally, a conceptual eicosapentaenoic acid (EPA biosynthesis network is proposed based on the lipidomic and transcriptomic data, which underlined import of EPA from cytosolic glycerolipids to the plastid for synthesizing EPA-containing chloroplast membrane lipids.

  10. Aeolian transport of seagrass (Posidonia oceanica) beach-cast to terrestrial systems

    Science.gov (United States)

    Jiménez, Maria A.; Beltran, Rafel; Traveset, Anna; Calleja, Maria Ll; Delgado-Huertas, Antonio; Marbà, Núria

    2017-09-01

    The annual export of the Mediterranean seagrass (Posidonia oceanica) litter to adjacent beaches and coastal dunes was quantified by examining the fortnight evolution of seagrass beach-cast volume on two beaches in the NW Mediterranean (Son Real and Es Trenc, Mallorca Island, Spain) for two years and analyzing the wind speed and direction obtained from the closest Meteorological Spanish Agency surface weather stations. The decomposition stage of the deposits was examined by analyzing the total hydrolysable amino acids, its percentage distribution and derived degradation indexes. Prevalent winds exceeding 6 m s-1, the coastline morphology and type of terrestrial vegetation determine the annual dynamics of the seagrass beach-cast. In the most protected beach (Son Real) the seagrass beach-cast remained nearly stationary during the two studied years while it exhibited wide annual fluctuations in the less protected one (Es Trenc). The amounts of P. oceanica wrack washed on Son Real and Es Trenc beaches, respectively, were estimated at 309 kg DW m coastline-1 yr-1 and 1359 kg DW m coastline-1 yr-1. They supplied between 20 kg CaCO3 m coastline-1 yr-1 and 47 kg CaCO3 m coastline-1 yr-1. Between 54% (Son Real) and 70% (Es Trenc) of seagrass beach-cast, respectively accounting for 1.5 kg N m coastline-1 yr-1 and 8.6 kg N m coastline-1 yr-1, were annually exported from the beaches to adjacent dune systems. Our results reveal that Mediterranean seagrass meadows might be an important source of materials, including sand and nutrients, for adjacent terrestrial systems, able to support their functioning.

  11. Acclimation to different depths by the marine angiosperm Posidonia oceanica: transcriptomic and proteomic profiles

    Directory of Open Access Journals (Sweden)

    Emanuela eDattolo

    2013-06-01

    Full Text Available For seagrasses, seasonal and daily variations in light and temperature represent the mains factors driving their distribution along the bathymetric cline. Changes in these environmental factors, due to climatic and anthropogenic effects, can compromise their survival. In a framework of conservation and restoration, it becomes crucial to improve our knowledge about the physiological plasticity of seagrass species along environmental gradients. Here, we aimed to identify differences in transcriptomic and proteomic profiles, involved in the acclimation along the depth gradient in the seagrass Posidonia oceanica, and to improve the available molecular resources in this species, which is an important requisite for the application of eco-genomic approaches. To do that, from plant growing in the shallow (-5m and a deep (-25m portions of a single meadow, (i we generated two reciprocal EST (Expressed Sequences Tags libraries using a Suppressive Subtractive Hybridization (SSH approach, to obtain depth/specific transcriptional profiles, and (ii we identified proteins differentially expressed, using the highly innovative USIS mass spectrometry methodology, coupled with 1D-SDS electrophoresis and labeling free approach. Mass spectra were searched in the open source Global Proteome Machine (GPM engine against plant databases and with the X!Tandem algorithm against a local database. Transcriptional analysis showed both quantitative and qualitative differences between depths. EST libraries had only the 3% of transcripts in common. A total of 315 peptides belonging to 64 proteins were identified by mass spectrometry. ATP synthase subunits were among the most abundant proteins in both conditions. Both approaches identified genes and proteins in pathways related to energy metabolism, transport and genetic information processing, that appear o be the most involved in depth acclimation in P. oceanica. Their putative rules in acclimation to depth were discussed.

  12. Aeolian transport of seagrass ( Posidonia oceanica ) beach-cast to terrestrial systems

    KAUST Repository

    Jimé nez, Maria A.; Beltran, Rafel; Traveset, Anna; Calleja, Maria Ll; Delgado-Huertas, Antonio; Marbà , Nú ria

    2017-01-01

    The annual export of the Mediterranean seagrass (Posidonia oceanica) litter to adjacent beaches and coastal dunes was quantified by examining the fortnight evolution of seagrass beach-cast volume on two beaches in the NW Mediterranean (Son Real and Es Trenc, Mallorca Island, Spain) for two years and analyzing the wind speed and direction obtained from the closest Meteorological Spanish Agency surface weather stations. The decomposition stage of the deposits was examined by analyzing the total hydrolysable amino acids, its percentage distribution and derived degradation indexes. Prevalent winds exceeding 6 m s−1, the coastline morphology and type of terrestrial vegetation determine the annual dynamics of the seagrass beach-cast. In the most protected beach (Son Real) the seagrass beach-cast remained nearly stationary during the two studied years while it exhibited wide annual fluctuations in the less protected one (Es Trenc). The amounts of P. oceanica wrack washed on Son Real and Es Trenc beaches, respectively, were estimated at 309 kg DW m coastline−1 yr−1 and 1359 kg DW m coastline−1 yr−1. They supplied between 20 kg CaCO3 m coastline−1 yr−1 and 47 kg CaCO3 m coastline−1 yr−1. Between 54% (Son Real) and 70% (Es Trenc) of seagrass beach-cast, respectively accounting for 1.5 kg N m coastline−1 yr−1 and 8.6 kg N m coastline−1 yr−1, were annually exported from the beaches to adjacent dune systems. Our results reveal that Mediterranean seagrass meadows might be an important source of materials, including sand and nutrients, for adjacent terrestrial systems, able to support their functioning.

  13. Acclimation to different depths by the marine angiosperm Posidonia oceanica: transcriptomic and proteomic profiles.

    Science.gov (United States)

    Dattolo, Emanuela; Gu, Jenny; Bayer, Philipp E; Mazzuca, Silvia; Serra, Ilia A; Spadafora, Antonia; Bernardo, Letizia; Natali, Lucia; Cavallini, Andrea; Procaccini, Gabriele

    2013-01-01

    For seagrasses, seasonal and daily variations in light and temperature represent the mains factors driving their distribution along the bathymetric cline. Changes in these environmental factors, due to climatic and anthropogenic effects, can compromise their survival. In a framework of conservation and restoration, it becomes crucial to improve our knowledge about the physiological plasticity of seagrass species along environmental gradients. Here, we aimed to identify differences in transcriptomic and proteomic profiles, involved in the acclimation along the depth gradient in the seagrass Posidonia oceanica, and to improve the available molecular resources in this species, which is an important requisite for the application of eco-genomic approaches. To do that, from plant growing in shallow (-5 m) and deep (-25 m) portions of a single meadow, (i) we generated two reciprocal Expressed Sequences Tags (EST) libraries using a Suppressive Subtractive Hybridization (SSH) approach, to obtain depth/specific transcriptional profiles, and (ii) we identified proteins differentially expressed, using the highly innovative USIS mass spectrometry methodology, coupled with 1D-SDS electrophoresis and labeling free approach. Mass spectra were searched in the open source Global Proteome Machine (GPM) engine against plant databases and with the X!Tandem algorithm against a local database. Transcriptional analysis showed both quantitative and qualitative differences between depths. EST libraries had only the 3% of transcripts in common. A total of 315 peptides belonging to 64 proteins were identified by mass spectrometry. ATP synthase subunits were among the most abundant proteins in both conditions. Both approaches identified genes and proteins in pathways related to energy metabolism, transport and genetic information processing, that appear to be the most involved in depth acclimation in P. oceanica. Their putative rules in acclimation to depth were discussed.

  14. Relationship of non-protein thiol pools and accumulated Cd or Hg in the marine macrophyte Posidonia oceanica (L.) Delile

    International Nuclear Information System (INIS)

    Maserti, B.E.; Ferrillo, V.; Avdis, O.; Nesti, U.; Di Garbo, A.; Catsiki, A.; Maestrini, P.L.

    2005-01-01

    The accumulation of cadmium or mercury and the effect of these elements on the levels of non-protein thiols in the blades of the marine macrophyte Posidonia oceanica were investigated. A significant accumulation of cadmium or mercury, dependent on metal concentration supplied, was observed in metal-treated blades. In the blades treated either with cadmium or mercury, a significant increase in the levels of non-protein thiols (other than glutathione) and a marked depletion of the reduced glutathione content as a function of the metal, exposure time and metal concentration supplied were found. This investigation provides first experimental report on the relationship between non-protein thiol pools and accumulated cadmium or mercury in P. oceanica

  15. Effect of environmental factors (wave exposure and depth) and anthropogenic pressure in the C sink capacity of Posidonia oceanica meadows

    KAUST Repository

    Mazarrasa, Iné s; Marbà , Nú ria; Garcia-Orellana, Jordi; Masqué , Pere; Arias-Ortiz, Ariane; Duarte, Carlos M.

    2017-01-01

    Seagrass are among the most important natural carbon sinks on Earth with Posidonia oceanica (Mediterranean Sea) considered as the most relevant species. Yet, the number of direct measurements of organic carbon burial rates in P. oceanica is still scarce and the effect of local environmental factors remains largely unexplored. In addition, P. oceanica meadows are declining due to the increase in anthropogenic pressure in coastal areas during the last century. The aim of this study is to assess the recent carbon sink capacity of P. oceanica and particularly the effect of human pressure and two environmental factors, water depth and exposure to wave energy (based on a fetch index), on the carbon burial rate since 1900. We conducted an extensive survey of sediment cores in meadows distributed across a gradient of depth, fetch, and human pressure around The Balearic Islands. Sediment and carbon accumulation rates were obtained from 210Pb concentrations profiles. Top-30 centimeters carbon stocks (6.1 ± 1.4 kg C m−2) and burial rates (26 ± 6 g C m−2 yr1) varied up to fivefold across meadows. No significant effect of water depth in carbon burial rates was observed. Although fetch was significantly correlated with sediment mean grain size, confirming the effect of wave exposure in the patterns of sedimentation, fetch alone could not explain the differences in carbon burial rates among the meadows examined. Human pressure affected carbon burial rates, leading to increased rates since the onset of the rise in anthropogenic pressure, particularly so in sheltered meadows supporting high human pressure.

  16. Effect of environmental factors (wave exposure and depth) and anthropogenic pressure in the C sink capacity of Posidonia oceanica meadows

    KAUST Repository

    Mazarrasa, Inés

    2017-03-20

    Seagrass are among the most important natural carbon sinks on Earth with Posidonia oceanica (Mediterranean Sea) considered as the most relevant species. Yet, the number of direct measurements of organic carbon burial rates in P. oceanica is still scarce and the effect of local environmental factors remains largely unexplored. In addition, P. oceanica meadows are declining due to the increase in anthropogenic pressure in coastal areas during the last century. The aim of this study is to assess the recent carbon sink capacity of P. oceanica and particularly the effect of human pressure and two environmental factors, water depth and exposure to wave energy (based on a fetch index), on the carbon burial rate since 1900. We conducted an extensive survey of sediment cores in meadows distributed across a gradient of depth, fetch, and human pressure around The Balearic Islands. Sediment and carbon accumulation rates were obtained from 210Pb concentrations profiles. Top-30 centimeters carbon stocks (6.1 ± 1.4 kg C m−2) and burial rates (26 ± 6 g C m−2 yr1) varied up to fivefold across meadows. No significant effect of water depth in carbon burial rates was observed. Although fetch was significantly correlated with sediment mean grain size, confirming the effect of wave exposure in the patterns of sedimentation, fetch alone could not explain the differences in carbon burial rates among the meadows examined. Human pressure affected carbon burial rates, leading to increased rates since the onset of the rise in anthropogenic pressure, particularly so in sheltered meadows supporting high human pressure.

  17. Genetic delineation between and within the widespread coccolithophore morpho-species Emiliania huxleyi and Gephyrocapsa oceanica (Haptophyta).

    Science.gov (United States)

    Bendif, El Mahdi; Probert, Ian; Carmichael, Margaux; Romac, Sarah; Hagino, Kyoko; de Vargas, Colomban

    2014-02-01

    Emiliania huxleyi and Gephyrocapsa oceanica are abundant coccolithophore morpho-species that play key roles in ocean carbon cycling due to their importance as both primary producers and cal-cifiers. Global change processes such as ocean acidification impact these key calcifying species. The physiology of E. huxleyi, a developing model species, has been widely studied, but its genetic delineation from G. oceanica remains unclear due to a lack of resolution in classical genetic markers. Using nuclear (18S rDNA and 28S rDNA), mitochondrial (cox1, cox2, cox3, rpl16, and dam), and plastidial (16S rDNA, rbcL, tufA, and petA) DNA markers from 99 E. huxleyi and 44 G. oceanica strains, we conducted a multigene/multistrain survey to compare the suitability of different markers for resolving phylogenetic patterns within and between these two morpho-species. The nuclear genes tested did not provide sufficient resolution to discriminate between the two morpho-species that diverged only 291Kya. Typical patterns of incomplete lineage sorting were generated in phylogenetic analyses using plastidial genes. In contrast, full morpho-species delineation was achieved with mitochondrial markers and common intra-morpho-species phylogenetic patterns were observed despite differing rates of DNA substitution. Mitochondrial genes are thus promising barcodes for distinguishing these coccolithophore morpho-species, in particular in the context of environmental monitoring. © 2013 Phycological Society of America.

  18. An ecosystem-based approach to assess the status of a Mediterranean ecosystem, the Posidonia oceanica seagrass meadow.

    Directory of Open Access Journals (Sweden)

    Sébastien Personnic

    Full Text Available Biotic indices, which reflect the quality of the environment, are widely used in the marine realm. Sometimes, key species or ecosystem engineers are selected for this purpose. This is the case of the Mediterranean seagrass Posidonia oceanica, widely used as a biological quality element in the context of the European Union Water Framework Directive (WFD. The good quality of a water body and the apparent health of a species, whether or not an ecosystem engineer such as P. oceanica, is not always indicative of the good structure and functioning of the whole ecosystem. A key point of the recent Marine Strategy Framework Directive (MSFD is the ecosystem-based approach. Here, on the basis of a simplified conceptual model of the P. oceanica ecosystem, we have proposed an ecosystem-based index of the quality of its functioning, compliant with the MSFD requirements. This index (EBQI is based upon a set of representative functional compartments, the weighting of these compartments and the assessment of the quality of each compartment by comparison of a supposed baseline. The index well discriminated 17 sites in the north-western Mediterranean (French Riviera, Provence, Corsica, Catalonia and Balearic Islands covering a wide range of human pressure levels. The strong points of the EBQI are that it is easy to implement, non-destructive, relatively robust, according to the selection of the compartments and to their weighting, and associated with confidence indices that indicate possible weakness and biases and therefore the need for further field data acquisition.

  19. An unexplored sedimentary record for the study of environmental change in mediterranean coastal environments: Posidonia oceanica (L.) Delile peats

    International Nuclear Information System (INIS)

    Mateo, M.-A.; Renom, P.; Romero, J.; Julia, R.; Michener, R.

    2002-01-01

    Information on seagrass paleo-ecology is very scarce because detailed seagrass paleorecords are virtually lacking. The endemic Mediterranean seagrass Posidonia oceanica conjugates two unusual features that allow the reconstruction of the past history of the plant at two different time scales. On the one hand, the study of the leaf sheaths that remain attached to the rhizomes after leaf abcision (lepidochronology), allows to differentiate up to 30 yearly cycles. On the other hand, radiocarbon dating of peat-like deposits derived from Posidonia oceanica rhizomes and roots ('mattes'), reveals a chronological organic record of the plant spanning several thousands of years. Changes in the isotopic signature (δ 13 C) of the sheaths along Posidonia rhizomes from a meadow off Medes Islands (NW Mediterranean, Spain), were highly correlated with changes in annual leave production and with water transparency. These relationships and the isotopic analysis of sheath debris from several Posidonia peats along the Spanish Mediterranean coast are used to make some preliminary inferences about long-term meadow history. Several phenomena potentially making difficult the interpretation of the information contained in Posidonia peats are critically discussed. It is concluded that a detailed study of P. oceanica peats will open new vistas in Mediterranean paleo-ecological and paleo-environmental research (author)

  20. The use of banquettes of Posidonia oceanica as a source of fiber and minerals in ruminant nutrition. An observational study.

    Science.gov (United States)

    Castillo, C; Mantecón, A R; Sotillo, J; Benedito, J L; Abuelo, A; Gutiérrez, C; Hernández, J

    2014-10-01

    In the search for new food sources that contribute to the optimization of livestock production this paper discusses the possibility of using waste (called banquettes) of a marine plant commonly found on the Mediterranean coasts: Posidonia oceanica. The idea stems from the use of a waste that in summertime generates large costs because it is considered bothersome on the beaches. Thus, tons and tons of residues are collected each year from the beach, being destined for incineration. However, alternative uses for these residues are suggested, such as forage that is particularly relevant for the Mediterranean coast, where the weather does not support abundant grass growth. With this purpose, samples of banquettes of P. oceanica from six different points of a touristic place located in the Murcia Region (S.E. of Spain) were collected in April 2012 on the same day directly from the beach above the water line, washed with distilled water and sun-dried for 48 h. Approximately 500 g of each sample of plant material was chopped and two subsamples of 200 g each were placed in airtight plastic containers and sent to the laboratory for mineral and chemical analysis. This report provides data on the nutritional composition of P. oceanica such as mineral contents (As, Cd, Co, Cr, Cu, Fe, Mn, Ni, Pb and Zn) and chemical composition (ash, CP, ether extract (EE), NDF and ADF, respectively) and ADL. Finally, the in sacco rumen disappearance of dry matter (DM), organic matter (OM), CP and NDF were studied. Our results showed that minerals, except for Fe, where within the range of values reported for P. oceanica in other parts of the Mediterranean region. Given the high Fe content further studies assessing the antagonic Fe-Cu interaction and its effect on animal health should be addressed. In relation to chemical composition, it is clear that this seagrass is a poor protein source and has levels of DM degradability at 24 h, similar to those obtained for cereal straw. The information

  1. On the Evaluation Overlap Integrals with the Same and Different Screening Parameters Over Slater Type Orbitals via the Fourier-Transform Method

    International Nuclear Information System (INIS)

    Yavuz, M.; Yuekcue, N.; Oeztekin, E.; Yilmaz, H.; Doenduer, S.

    2005-01-01

    In this paper, derivation of analytical expressions for overlap integrals with the same and different screening parameters of Slater type orbitals (STOs) via the Fourier-transform method is presented. Consequently, it is relatively easy to express the Fourier integral representations of the overlap integrals with same and different screening parameters mentioned as finite sums of Gegenbauer, Gaunt, binomial coefficients, and STOs.

  2. On the Least-Squares Fitting of Slater-Type Orbitals with Gaussians: Reproduction of the STO-NG Fits Using Microsoft Excel and Maple

    Science.gov (United States)

    Pye, Cory C.; Mercer, Colin J.

    2012-01-01

    The symbolic algebra program Maple and the spreadsheet Microsoft Excel were used in an attempt to reproduce the Gaussian fits to a Slater-type orbital, required to construct the popular STO-NG basis sets. The successes and pitfalls encountered in such an approach are chronicled. (Contains 1 table and 3 figures.)

  3. Dirac-Fock-Slater calculations on the geometric and electronic structure of neutral and multiply charged C60 fullerenes

    International Nuclear Information System (INIS)

    Bastug, T.; Kuerpick, P.; Meyer, J.; Sepp, W.; Fricke, B.; Rosen, A.

    1997-01-01

    Using a self-consistent relativistic molecular Dirac-Fock-Slater method we have determined the geometric structures and ionization energies of C 60 x t (x=0 endash 7). The lengths of the bonds for the pentagonal edge (single bonds) and the bonds shared by hexagonal rings (double bonds) are found to increase as a function of charge state with an expansion of the cage. The binding energy per atom of C 60 x t (x=0 endash 7) shows a quadratic dependence on the charge state of the C 60 cluster and an extrapolation to higher charge states reveals that C 60 x t should still be bound up to x=13. Charging of the clusters are analyzed using a classical capacitance model and compared with results from other calculations. Calculated ionization potentials are found to increase linearly with the charge while the available experimental data with comparatively big uncertainties indicate a small quadratic dependence. copyright 1997 The American Physical Society

  4. Adsorption and Biocirculation in Oceanic Waters; Adsorcion y Biocirculacion en las Aguas Oceanicas

    Energy Technology Data Exchange (ETDEWEB)

    Zenkevich, L. A.

    1960-07-01

    It is generally known that in recent years oceanographers in all countries have denoted great attention to studying the dispersion routes and speed of movement of radioactive decay products in oceanic waters. At the same time the form, degree and extent of contamination of oceanic waters by fission products has been investigated. It is clear that scientists are becoming more and more interested in living organisms as a factor responsible for the transport and distribution of radioactive substances in water. B. Ketchum and Y. Bowen discuss the concept of 'biological transport' and make an interesting attempt to define it in mathematical terms and to collate it with research on 'physical transport'. The term 'biocirculation' has come into use. It is evident that this factor cannot be left out of account as a means of transport or system of adsorption. The great volume of suspension formed of mineral substances and not containing living organisms is characterized by its relatively low mobility, and the bacterial and phytoplankton bodies constitute a vast adsorption surface (Tables 1 and 2). The ocean water column contains a vast quantity of matter in suspension, including living organisms (bacteria, phytoplankton and zooplankton) and components not containing living organisms (bioseston and abioseston). Quantitative determination of all the seston enables its role as an adsorption surface and as a mechanism of vertical and horizontal biocirculation to be evaluated. The adsorption surface for various seston groups in average density distribution zones, and the index of subsurface biocirculation in a water column less than 1 m{sup 2} in the habitat are given [Spanish] Es bien sabido que en el transcurso de los ultimos anos, los oceanografos del mundo entero han venido prestando gran atencion al estudio de la distribucion y de la velocidad de desplazamiento de los productos de la precipitacion radiactiva en las aguas oceanicas. Al mismo tiempo se esta estudiando la forma

  5. Molecular Characterization of CTR-type Copper Transporters in an Oceanic Diatom, Thalassiosira oceanica 1005

    Science.gov (United States)

    Kong, L.; Price, N. M.

    2016-02-01

    Copper is an essential micronutrient for phytoplankton growth because of its role as a redox cofactor in electron transfer proteins in photosynthesis and respiration, and a potentially limiting resource in parts of the open sea. Thalassiosira oceanica 1005 can grow at inorganic copper concentrations varying from 10 fmol/L to 10 nmol/L by regulating copper uptake across plasma membrane. Four putative CTR-type copper transporter genes (ToCTR1, ToCTR2, ToCTR3.1 and ToCTR3.2) were identified by BLASTP search against the T. oceanica genome. Predicted gene models were revised by assembled mRNA sequencing transcripts and updated gene models contained all conserved features of characterized CTR-type copper transporters. ToCTR3.1 and ToCTR3.2 may arise from one another by gene duplication as they shared a sequence similarity of 97.6% with a peptide insertion of 5 amino acids at N-terminus of ToCTR3.1. The expression of ToCTR1, ToCTR2 and ToCTR3.1/3.2 was upregulated in low copper concentrations, but only ToCTR3.1/3.2 showed a significant increase (2.5 fold) in copper-starved cells. Both ToCTR3.1 and ToCTR3.2 restored growth of a yeast double mutant, Saccharomyces cerevisiae ctr1Δctr3Δ, in copper deficient medium. GFP-fused ToCTR expression showed that some ToCTR3.1 localized to the plasma membrane but a large portion was retained in the endoplasmic reticulum. Inefficient targeting of ToCTR3.1 to the yeast outer membrane may explain poorer growth compared to the Saccharomyces native ScCTR1 transformant. Thus, diatom CTR genes encoding CTR-type copper transporters show high-affinity copper uptake and their regulation may enable diatoms to survive in ocean environments containing a wide range of copper concentrations.

  6. Effects of fish farm loadings on seagrass (Posidonia oceanica) distribution, growth and photosynthesis.

    Science.gov (United States)

    Ruiz, J M; Pérez, M; Romero, J

    2001-09-01

    The spatial extent and timing of the impact of fish farms on the distribution and performance of a Posidonia oceanica meadow were examined in an embayment of the south-eastern coast of Spain (Hornillo Bay, Murcia). Changes in seagrass distribution were determined using available seagrass mapping (from 1988, i.e., before the onset of aquaculture activities and 1998) and by successive sampling in 1994 and 1998. Environmental variables (light attenuation coefficient, water-column dissolved nutrients and organic content of sediments) together with plant performance (shoot biomass, leaf growth rate, photosynthetic activity, carbohydrate reserves, the number of leaves per shoot, epiphyte loads and herbivore pressure) were measured in plants affected by organic discharges, and were compared with those found in reference healthy plants over an annual growth cycle. Since the onset of fish farm activity, 11.29 ha of P. oceanica meadow has been completely lost and 9.86 ha significantly degraded, thus resulting in a total affected area which accounts for about 53% of the former meadow, or 7-fold the fish farming area. Unequal propagation of seagrass die-off or degradation reflects the relevance of local factors such as depth and hydrodynamism on the true extent of fish farm impact. Water transparency decreases and dissolved nutrient and organic content of sediments increases in the vicinity of cages compared to distant reference stations, thus supporting the notion of environmental gradients caused by the organic release from cages, which spreads outwards. Shoot size, leaf growth rate and the number of leaves per shoot in plants close to the fish farm decreased. Moreover, low leaf growth and low rhizome carbohydrate concentration (always relative to that found in an undisturbed area) indicated carbon budget imbalances. Since light reduction in the affected area was only modest (31% of light reaching the sea surface, while at the same depth this figure was 39% at the reference

  7. Variability in patterns of macro-epiphytic leaf community of Posidonia oceanica in the Islands of Kuriate: Western coast of Tunisia

    Directory of Open Access Journals (Sweden)

    Ben Brahim Mounir

    2016-03-01

    Full Text Available Objective: To test the response of the epiphyte community structure and biomass of the Posidonia oceanica (P. oceanica leaves to natural disturbance. Methods: Sampling of P. oceanica was carried in winter and summer on three sites in Kuriate Islands (western coast of Tunisia subject to different environments disturbances. Shoots of P. oceanica were preserved in seawater-formalin (5% solution for macro-epiphytes species identification in the laboratory. The samples were examined for leaf surface per shoot and the coverage (expressed as a percentage of leaf surface of each morphological group, then carefully scraped with a razor blade. Epiphytes and scraped leaves were oven-dried at 60 °C for 48 h. Biomass was expressed as g dry weight/shoot. Results: The biomass and the percentage cover of macro-epiphytic leaves showed seasonal variation. The highest values of epiphytic leaves were detected in summer whereas the lowest values were registered during winter. ANOVA showed that Kuriate Islands functioned as a single ecosystem in terms assemblage of macro-epiphytic leaves since no significant variation was detected for biomass and percentage cover at the scale site. Our study showed that natural disturbance had no effect on the assemblage distribution and the biomass of macro-epiphyte on the leaves of P. oceanica between the scales of site, whereas variability at the smallest scale was detected. ANOVA showed that exposure to wind and current had no effect on the biomass of macro-epiphytes leaves. Conclusions: Biomass and assemblages of macro-epiphytic leaves of P. oceanica were high in summer and homogenous between all sites investigated. Natural disturbances such as exposure to wind have no effect on the distribution and the biomass of epiphytes on the shallow meadow.

  8. Seagrass (Posidonia oceanica) seedlings in a high-CO2 world: from physiology to herbivory

    KAUST Repository

    Hernán, Gema

    2016-12-01

    Under future increased CO2 concentrations, seagrasses are predicted to perform better as a result of increased photosynthesis, but the effects in carbon balance and growth are unclear and remain unexplored for early life stages such as seedlings, which allow plant dispersal and provide the potential for adaptation under changing environmental conditions. Furthermore, the outcome of the concomitant biochemical changes in plant-herbivore interactions has been poorly studied, yet may have important implications in plant communities. In this study we determined the effects of experimental exposure to current and future predicted CO2 concentrations on the physiology, size and defense strategies against herbivory in the earliest life stage of the Mediterranean seagrass Posidonia oceanica. The photosynthetic performance of seedlings, assessed by fluorescence, improved under increased pCO2 conditions after 60 days, although these differences disappeared after 90 days. Furthermore, these plants exhibited bigger seeds and higher carbon storage in belowground tissues, having thus more resources to tolerate and recover from stressors. Of the several herbivory resistance traits measured, plants under high pCO2 conditions had a lower leaf N content but higher sucrose. These seedlings were preferred by herbivorous sea urchins in feeding trials, which could potentially counteract some of the positive effects observed.

  9. n-Nonacosadienes from the marine haptophytes Emiliania huxleyi and Gephyrocapsa oceanica.

    Science.gov (United States)

    Nakamura, Hideto; Sawada, Ken; Araie, Hiroya; Suzuki, Iwane; Shiraiwa, Yoshihiro

    2015-03-01

    The hydrocarbons in cultures of marine haptophytes Emiliania huxleyi NIES837 and Gephyrocapsa oceanica NIES1315 were analyzed, and nonacosadienes and hentriacontadienes were detected as the major compounds in both strains. C29 and C31 monoenes and di-, tri- and tetra-unsaturated C33 alkenes were also detected as minor compounds but not C37 and C38 alkenes. The positions of the double bonds in the C29 and C31 alkenes were determined by mass spectrometry of their dimethyl disulfide (DMDS) adducts. Among the four C29 alkenes identified, the most abundant isomer was 2,20-nonacosadiene, and the other three compounds were 1,20-nonacosadiene, 3,20-nonacosadiene and 9-nonacosene, respectively. Hitherto, 2,20-nonacosadiene and 3,20-nonacosadiene were unknown to be natural products. The double bond at the n-9 (ω9) position in these C29 alkenes is hypothesized to be derived from precursors of unsaturated fatty acids possessing an n-9 double bond, such as (9Z)-9-octadecenoic acid. Nonacosadienes have the potential for being used as distinct haptophyte biomarkers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Removal of phosphorus from aqueous solution by Posidonia oceanica fibers using continuous stirring tank reactor

    Energy Technology Data Exchange (ETDEWEB)

    Wahab, Mohamed Ali, E-mail: waheb_med@yahoo.fr [University of Carthage, Water Research and Technologies Centre (CERTE), Wastewater Treatment and Recycling Laboratory, B.P. 273, 8020 Soliman (Tunisia); Hassine, Rafik Ben [International Environmental Green Technology (IGET) (Tunisia); Jellali, Salah, E-mail: salah.jallali@certe.rnrt.tn [University of Carthage, Water Research and Technologies Centre (CERTE), Wastewater Treatment and Recycling Laboratory, B.P. 273, 8020 Soliman (Tunisia)

    2011-05-15

    The present study aims to develop a new potentially low-cost, sustainable treatment approach to soluble inorganic phosphorus removal from synthetic solutions and secondary wastewater effluents in which a plant waste (Posidonia oceanica fiber: POF) is used for further agronomic benefit. Dynamic flow tests using a continuous stirred tank reactor (CSTR) were carried out to study the effect of initial concentration of phosphorus, amount of adsorbent, feeding flow rate and anions competition. The experimental results showed that the removal efficiency of phosphorus from synthetic solutions is about 80% for 10 g L{sup -1} of POF. In addition, the variation of the initial concentration of phosphorus from 8 to 50 mg L{sup -1} increased the adsorption capacity from 0.99 to 3.03 mg g{sup -1}. The use of secondary treated wastewater showed the presence of competition phenomenon between phosphorus and sulphate which could be overcoming with increasing the sorptive surface area and providing more adsorption sites when increasing the adsorbent dosage of POF. Compared with columns studies, this novel CSTR system showed more advantages for the removal of soluble phosphorus as a tertiary treatment of urban secondary effluents with more adsorption efficiency and capacity, in addition to the prospect use of saturated POF with nutriment as fertilizer and compost.

  11. Removal of phosphorus from aqueous solution by Posidonia oceanica fibers using continuous stirring tank reactor

    International Nuclear Information System (INIS)

    Wahab, Mohamed Ali; Hassine, Rafik Ben; Jellali, Salah

    2011-01-01

    The present study aims to develop a new potentially low-cost, sustainable treatment approach to soluble inorganic phosphorus removal from synthetic solutions and secondary wastewater effluents in which a plant waste (Posidonia oceanica fiber: POF) is used for further agronomic benefit. Dynamic flow tests using a continuous stirred tank reactor (CSTR) were carried out to study the effect of initial concentration of phosphorus, amount of adsorbent, feeding flow rate and anions competition. The experimental results showed that the removal efficiency of phosphorus from synthetic solutions is about 80% for 10 g L -1 of POF. In addition, the variation of the initial concentration of phosphorus from 8 to 50 mg L -1 increased the adsorption capacity from 0.99 to 3.03 mg g -1 . The use of secondary treated wastewater showed the presence of competition phenomenon between phosphorus and sulphate which could be overcoming with increasing the sorptive surface area and providing more adsorption sites when increasing the adsorbent dosage of POF. Compared with columns studies, this novel CSTR system showed more advantages for the removal of soluble phosphorus as a tertiary treatment of urban secondary effluents with more adsorption efficiency and capacity, in addition to the prospect use of saturated POF with nutriment as fertilizer and compost.

  12. Sp. Radicis-Lycopersici Using Mixture of Vegetable and Posidonia oceanica Compost

    Directory of Open Access Journals (Sweden)

    S. Kouki

    2012-01-01

    Full Text Available A compost of vegetable waste and Posidonia oceanica mixture (70 : 30% vol : vol was tested in vitro and in vivo for its efficacy against Fusarium oxysporum f.sp radicis-lycopersici (Forl, the causal agent of Fusarium wilt of Tomato (Lycopersicon esculentum cv. chourouk.The incorporation of non-sterilized VPC in the culture medium showed potent antifungal activity against Forl and complete inhibition of mycelium growth was observed for all the tested compost rates (0.5, 1, 2, 4, 6, 8, 10, 15 and 20%. However, only the highest rates (15 and 20% of a sterilized suspension of VPC were effective in preventing mycelial growth. Nine indigenous bacterial strains isolated from VPC exhibited antagonism against Forl. Based on 16S rDNA sequence analysis, the isolates were assigned to Bacillus sphaericus (B12 and BS2, Pseudomonas putida PPS7 and Burkholderia gladioli BuC16. Under green house condition, seed inoculation by B12, BS2, PP7 and BuC16 strains protected significantly tomato against Fusarium oxysporum f.sp radicis-lycopersici (Forl attacks.

  13. Seagrass (Posidonia oceanica) seedlings in a high-CO2 world: from physiology to herbivory.

    Science.gov (United States)

    Hernán, Gema; Ramajo, Laura; Basso, Lorena; Delgado, Antonio; Terrados, Jorge; Duarte, Carlos M; Tomas, Fiona

    2016-12-01

    Under future increased CO 2 concentrations, seagrasses are predicted to perform better as a result of increased photosynthesis, but the effects in carbon balance and growth are unclear and remain unexplored for early life stages such as seedlings, which allow plant dispersal and provide the potential for adaptation under changing environmental conditions. Furthermore, the outcome of the concomitant biochemical changes in plant-herbivore interactions has been poorly studied, yet may have important implications in plant communities. In this study we determined the effects of experimental exposure to current and future predicted CO 2 concentrations on the physiology, size and defense strategies against herbivory in the earliest life stage of the Mediterranean seagrass Posidonia oceanica. The photosynthetic performance of seedlings, assessed by fluorescence, improved under increased pCO 2 conditions after 60 days, although these differences disappeared after 90 days. Furthermore, these plants exhibited bigger seeds and higher carbon storage in belowground tissues, having thus more resources to tolerate and recover from stressors. Of the several herbivory resistance traits measured, plants under high pCO 2 conditions had a lower leaf N content but higher sucrose. These seedlings were preferred by herbivorous sea urchins in feeding trials, which could potentially counteract some of the positive effects observed.

  14. Effects of in situ CO2 enrichment on structural characteristics, photosynthesis, and growth of the Mediterranean seagrass Posidonia oceanica

    Science.gov (United States)

    Cox, T. Erin; Gazeau, Frédéric; Alliouane, Samir; Hendriks, Iris E.; Mahacek, Paul; Le Fur, Arnaud; Gattuso, Jean-Pierre

    2016-04-01

    Seagrass is expected to benefit from increased carbon availability under future ocean acidification. This hypothesis has been little tested by in situ manipulation. To test for ocean acidification effects on seagrass meadows under controlled CO2/pH conditions, we used a Free Ocean Carbon Dioxide Enrichment (FOCE) system which allows for the manipulation of pH as continuous offset from ambient. It was deployed in a Posidonia oceanica meadow at 11 m depth in the Northwestern Mediterranean Sea. It consisted of two benthic enclosures, an experimental and a control unit both 1.7 m3, and an additional reference plot in the ambient environment (2 m2) to account for structural artifacts. The meadow was monitored from April to November 2014. The pH of the experimental enclosure was lowered by 0.26 pH units for the second half of the 8-month study. The greatest magnitude of change in P. oceanica leaf biometrics, photosynthesis, and leaf growth accompanied seasonal changes recorded in the environment and values were similar between the two enclosures. Leaf thickness may change in response to lower pH but this requires further testing. Results are congruent with other short-term and natural studies that have investigated the response of P. oceanica over a wide range of pH. They suggest any benefit from ocean acidification, over the next century (at a pH of ˜ 7.7 on the total scale), on Posidonia physiology and growth may be minimal and difficult to detect without increased replication or longer experimental duration. The limited stimulation, which did not surpass any enclosure or seasonal effect, casts doubts on speculations that elevated CO2 would confer resistance to thermal stress and increase the buffering capacity of meadows.

  15. Response of the seagrass Posidonia oceanica to different light environments: Insights from a combined molecular and photo-physiological study.

    Science.gov (United States)

    Dattolo, E; Ruocco, M; Brunet, C; Lorenti, M; Lauritano, C; D'Esposito, D; De Luca, P; Sanges, R; Mazzuca, S; Procaccini, G

    2014-10-01

    Here we investigated mechanisms underlying the acclimation to light in the marine angiosperm Posidonia oceanica, along its bathymetric distribution (at -5 m and -25 m), combining molecular and photo-physiological approaches. Analyses were performed during two seasons, summer and autumn, in a meadow located in the Island of Ischia (Gulf of Naples, Italy), where a genetic distinction between plants growing above and below the summer thermocline was previously revealed. At molecular level, analyses carried out using cDNA-microarray and RT-qPCR, revealed the up-regulation of genes involved in photoacclimation (RuBisCO, ferredoxin, chlorophyll binding proteins), and photoprotection (antioxidant enzymes, xanthophyll-cycle related genes, tocopherol biosynthesis) in the upper stand of the meadow, indicating that shallow plants are under stressful light conditions. However, the lack of photo-damage, indicates the successful activation of defense mechanisms. This conclusion is also supported by several responses at physiological level as the lower antenna size, the higher number of reaction centers and the higher xanthophyll cycle pigment pool, which are common plant responses to high-light adaptation/acclimation. Deep plants, despite the lower available light, seem to be not light-limited, thanks to some shade-adaptation strategies (e.g. higher antenna size, lower Ek values). Furthermore, also at the molecular level there were no signs of stress response, indicating that, although the lower energy available, low-light environments are more favorable for P. oceanica growth. Globally, results of whole transcriptome analysis displayed two distinct gene expression signatures related to depth distribution, reflecting the different light-adaptation strategies adopted by P. oceanica along the depth gradient. This observation, also taking into account the genetic disjunction of clones along the bathymetry, might have important implications for micro-evolutionary processes

  16. Trace metal concentrations in Posidonia oceanica of North Corsica (northwestern Mediterranean Sea: use as a biological monitor?

    Directory of Open Access Journals (Sweden)

    Gosselin Marc

    2006-09-01

    Full Text Available Abstract Background Within semi-closed areas like the Mediterranean Sea, anthropic wastes tend to concentrate in the environment. Metals, in particular, are known to persist in the environment and can affect human health due to accumulation in the food chain. The seagrass Posidonia oceanica, widely found in Mediterranean coastal waters, has been chosen as a "sentinel" to quantify the distribution of such pollutants within the marine environment. Using a technique similar to dendrochronology in trees, it can act as an indicator of pollutant levels over a timeframe of several months to years. In the present study, we measured and compared the levels of eight trace metals (Cr, Ni, Cu, Zn, As, Se, Cd, and Pb in sheaths dated by lepidochronology and in leaves of shoots sampled from P. oceanica meadows collected from six offshore sites in northern Corsica between 1988 and 2004; in the aim to determine 1 the spatial and 2 temporal variations of these metals in these areas and 3 to compared these two types of tissues. Results We found low trace metal concentrations with no increase over the last decade, confirming the potential use of Corsican seagrass beds as reference sites for the Mediterranean Sea. Temporal trends of trace metal concentrations in sheaths were not significant for Cr, Ni, Cu, As or Se, but Zn, Cd, and Pb levels decreased, probably due to the reduced anthropic use of these metals. Similar temporal trends between Cu levels in leaves (living tissue and in sheaths (dead tissue demonstrated that lepidochronology linked with Cu monitoring is effective for surveying the temporal variability of this metal. Conclusion Leaves of P. oceanica can give an indication of the metal concentration in the environment over a short time period (months with good accuracy. On the contrary, sheaths, which gave an indication of changes over long time periods (decades, seem to be less sensitive to variations in the metal concentration in the environment

  17. Collaboration between research institutions and Marine Protected Area contributes to Posidonia oceanica conservation: The Egadi Island’s experiment

    International Nuclear Information System (INIS)

    Cocito, Silvia; Lombardi, Chiara; Peirano, Andrea; Donati, Stefano; Patti Genovese, Pietro; Ponzè, Niccolo

    2015-01-01

    Preliminary results on the collaboration between the ENEA’s Marine Environment Research Center and the Egadi Islands’ Marine Protected Area (MPA), aimed to evaluate effectiveness of artificial reefs in limiting the impact of trawling on Posidonia oceanica meadow at Favignana Island, are reported. The methods and parameters chosen for monitoring showed their reliability in training non-experienced personnel for data collection within the MPA. The proposed monitoring approach is of great value to the MPA interested in both gathering basic and long-term data on the health status of protected habitats and acquiring baseline information useful for the evaluation of protection and conservation actions. [it

  18. Basis set construction for molecular electronic structure theory: natural orbital and Gauss-Slater basis for smooth pseudopotentials.

    Science.gov (United States)

    Petruzielo, F R; Toulouse, Julien; Umrigar, C J

    2011-02-14

    A simple yet general method for constructing basis sets for molecular electronic structure calculations is presented. These basis sets consist of atomic natural orbitals from a multiconfigurational self-consistent field calculation supplemented with primitive functions, chosen such that the asymptotics are appropriate for the potential of the system. Primitives are optimized for the homonuclear diatomic molecule to produce a balanced basis set. Two general features that facilitate this basis construction are demonstrated. First, weak coupling exists between the optimal exponents of primitives with different angular momenta. Second, the optimal primitive exponents for a chosen system depend weakly on the particular level of theory employed for optimization. The explicit case considered here is a basis set appropriate for the Burkatzki-Filippi-Dolg pseudopotentials. Since these pseudopotentials are finite at nuclei and have a Coulomb tail, the recently proposed Gauss-Slater functions are the appropriate primitives. Double- and triple-zeta bases are developed for elements hydrogen through argon. These new bases offer significant gains over the corresponding Burkatzki-Filippi-Dolg bases at various levels of theory. Using a Gaussian expansion of the basis functions, these bases can be employed in any electronic structure method. Quantum Monte Carlo provides an added benefit: expansions are unnecessary since the integrals are evaluated numerically.

  19. Implications of extreme life span in clonal organisms: millenary clones in meadows of the threatened seagrass Posidonia oceanica.

    Directory of Open Access Journals (Sweden)

    Sophie Arnaud-Haond

    Full Text Available The maximum size and age that clonal organisms can reach remains poorly known, although we do know that the largest natural clones can extend over hundreds or thousands of metres and potentially live for centuries. We made a review of findings to date, which reveal that the maximum clone age and size estimates reported in the literature are typically limited by the scale of sampling, and may grossly underestimate the maximum age and size of clonal organisms. A case study presented here shows the occurrence of clones of slow-growing marine angiosperm Posidonia oceanica at spatial scales ranging from metres to hundreds of kilometres, using microsatellites on 1544 sampling units from a total of 40 locations across the Mediterranean Sea. This analysis revealed the presence, with a prevalence of 3.5 to 8.9%, of very large clones spreading over one to several (up to 15 kilometres at the different locations. Using estimates from field studies and models of the clonal growth of P. oceanica, we estimated these large clones to be hundreds to thousands of years old, suggesting the evolution of general purpose genotypes with large phenotypic plasticity in this species. These results, obtained combining genetics, demography and model-based calculations, question present knowledge and understanding of the spreading capacity and life span of plant clones. These findings call for further research on these life history traits associated with clonality, considering their possible ecological and evolutionary implications.

  20. Posidonia oceanica as a Renewable Lignocellulosic Biomass for the Synthesis of Cellulose Acetate and Glycidyl Methacrylate Grafted Cellulose

    Directory of Open Access Journals (Sweden)

    Elena Vismara

    2013-05-01

    Full Text Available High-grade cellulose (97% α-cellulose content of 48% crystallinity index was extracted from the renewable marine biomass waste Posidonia oceanica using H2O2 and organic peracids following an environmentally friendly and chlorine-free process. This cellulose appeared as a new high-grade cellulose of waste origin quite similar to the high-grade cellulose extracted from more noble starting materials like wood and cotton linters. The benefits of α-cellulose recovery from P. oceanica were enhanced by its transformation into cellulose acetate CA and cellulose derivative GMA-C. Fully acetylated CA was prepared by conventional acetylation method and easily transformed into a transparent film. GMA-C with a molar substitution (MS of 0.72 was produced by quenching Fenton’s reagent (H2O2/FeSO4 generated cellulose radicals with GMA. GMA grafting endowed high-grade cellulose from Posidonia with adsorption capability. GMA-C removes β-naphthol from water with an efficiency of 47%, as measured by UV-Vis spectroscopy. After hydrolysis of the glycidyl group to glycerol group, the modified GMA-C was able to remove p-nitrophenol from water with an efficiency of 92%, as measured by UV-Vis spectroscopy. α-cellulose and GMA-Cs from Posidonia waste can be considered as new materials of potential industrial and environmental interest.

  1. Effects of recreational fishing on three fish species from the Posidonia oceanica meadows off Minorca (Balearic archipelago, western Mediterranean

    Directory of Open Access Journals (Sweden)

    Luis Cardona

    2007-12-01

    Full Text Available Experimental fishing and visual censuses were conducted at nine Posidonia oceanica sites off Minorca exposed to different levels of fishing intensity to assess the effects of recreational fishing on the species that dominate the catch. Total catch per unit effort (CPUE was highly seasonal and a statistically significant interaction term existed between the season and the level of fishing intensity. CPUE decreased everywhere at the end of the fishing season (autumn, but such a reduction was more intense at those sites exposed to the highest level of fishing. Visual censuses confirmed that there was a lower abundance of vulnerable fish in autumn. Differences vanished in spring probably because fish reshuffled between the considered sites throughout the winter, when the level of fishing intensity was extremely low. Although the average total lengths of Serranus scriba and Diplodus annularis were unaffected by the level of fishing intensity, the average total length of Coris julis was smaller at the most heavily fished sites. In conclusion, recreational fishing has a relevant impact on most of the exploited species and some of the seasonality reported for the Posidonia oceanica fish assemblages might be caused by the seasonality of the fishery.

  2. Highly diverse molluscan assemblages of Posidonia oceanica meadows in northwestern Alboran Sea (W Mediterranean): Seasonal dynamics and environmental drivers

    Science.gov (United States)

    Urra, Javier; Mateo Ramírez, Ángel; Marina, Pablo; Salas, Carmen; Gofas, Serge; Rueda, José L.

    2013-01-01

    The seasonal dynamics of the molluscan fauna associated with the westernmost populations of the Mediterranean seagrass Posidonia oceanica, has been studied throughout an annual cycle in the northwestern coasts of the Alboran Sea. Samples were collected seasonally (5 replicated per season) using a non-destructive sampling technique (airlift sampler) on quadrats of 50 × 50 cm at 2 sites located 7 km apart. Several environmental variables from the water column (temperature, chlorophyll a), the sediment (percentage of organic matter) and the seagrass meadows (shoot density, leaf height and width, number of leaves per shoot) were also measured in order to elucidate their relationships with the dynamics of the molluscan assemblages. In these meadows, a total of 17,416 individuals of molluscs were collected, belonging to 71 families and 171 species, being Rissoidae, Pyramidellidae and Trochidae the best-represented families, and Mytilidae, Nassaridae and Trochidae the dominant ones in terms of abundance. The assemblages were dominated by micro-algal grazers, filter feeders and ectoparasites (including those feeding on sessile preys). The species richness and the abundance displayed significant maximum values in summer, whereas evenness and diversity displayed maximum values in spring, being significant for the evenness. Both abundance and species richness values were positively correlated to seawater temperature and percentage organic matter, only for the latter, and negatively to leaf width. Significant seasonal groupings were obtained with multivariate analyses (MDS, Cluster, ANOSIM) using qualitative and quantitative data that could be mainly related to biological aspects (i.e. recruitment) of single species. The molluscan assemblages are influenced by the biogeographical location of the area (Alboran Sea), reflected in the absence or scarcity of most Mediterranean species strictly associated with P. oceanica (e.g. Tricolia speciosa, Rissoa ventricosa) and by the

  3. Selective enrichment of Eicosapentaenoic acid (20:5n-3) in N. oceanica CASA CC201 by natural auxin supplementation.

    Science.gov (United States)

    Udayan, Aswathy; Arumugam, Muthu

    2017-10-01

    The present study aims to evaluate the effect of different concentration of natural auxin, Indole-3 acetic acid (IAA) on growth, lipid yield, PUFA and EPA accumulation in Nannochloropsis oceanica CASA CC201. It was observed that the, treatment with 10ppm concentration of IAA resulted in high cell number 579.5×10 6 cells/ml than the control (215.5×10 6 cells/ml). Treatment with IAA at a concentration of 40ppm gives the highest cellular lipid accumulation of 60.9% DCW than the control 31.05% DCW). Lipid yield is also found to be increased by the addition of 40ppm IAA (319.5mg/L) compared with the control (121.5mg/L). EPA percentage is increased to 10.76% by the addition of 40ppm IAA compared to the control (1.87%). Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Efficient light-harvesting using non-carbonyl carotenoids: Energy transfer dynamics in the VCP complex from Nannochloropsis oceanica.

    Science.gov (United States)

    Keşan, Gürkan; Litvín, Radek; Bína, David; Durchan, Milan; Šlouf, Václav; Polívka, Tomáš

    2016-04-01

    Violaxanthin-chlorophyll a protein (VCP) from Nannochloropsis oceanica is a Chl a-only member of the LHC family of light-harvesting proteins. VCP binds carotenoids violaxanthin (Vio), vaucheriaxanthin (Vau), and vaucheriaxanthin-ester (Vau-ester). Here we report on energy transfer pathways in the VCP complex. The overall carotenoid-to-Chla energy transfer has efficiency over 90%. Based on their energy transfer properties, the carotenoids in VCP can be divided into two groups; blue carotenoids with the lowest energy absorption band around 480nm and red carotenoids with absorption extended up to 530nm. Both carotenoid groups transfer energy efficiently from their S2 states, reaching efficiencies of ~70% (blue) and ~60% (red). The S1 pathway, however, is efficient only for the red carotenoid pool for which two S1 routes characterized by 0.33 and 2.4ps time constants were identified. For the blue carotenoids the S1-mediated pathway is represented only by a minor route likely involving a hot S1 state. The relaxed S1 state of blue carotenoids decays to the ground state within 21ps. Presence of a fraction of non-transferring red carotenoids with the S1 lifetime of 13ps indicates some specific carotenoid-protein interaction that must shorten the intrinsic S1 lifetime of Vio and/or Vau whose S1 lifetimes in methanol are 26 and 29ps, respectively. The VCP complex from N. oceanica is the first example of a light-harvesting complex binding only non-carbonyl carotenoids with carotenoid-to-chlorophyll energy transfer efficiency over 90%. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Altered epiphyte community and sea urchin diet in Posidonia oceanica meadows in the vicinity of volcanic CO2 vents.

    Science.gov (United States)

    Nogueira, Patricia; Gambi, Maria Cristina; Vizzini, Salvatrice; Califano, Gianmaria; Tavares, Ana Mafalda; Santos, Rui; Martínez-Crego, Begoña

    2017-06-01

    Ocean acidification (OA) predicted for 2100 is expected to shift seagrass epiphyte communities towards the dominance of more tolerant non-calcifying taxa. However, little is known about the indirect effects of such changes on food provision to key seagrass consumers. We found that epiphyte communities of the seagrass Posidonia oceanica in two naturally acidified sites (i.e. north and south sides of a volcanic CO 2 vent) and in a control site away from the vent at the Ischia Island (NW Mediterranean Sea) significantly differed in composition and abundance. Such differences involved a higher abundance of non-calcareous crustose brown algae and a decline of calcifying polychaetes in both acidified sites. A lower epiphytic abundance of crustose coralline algae occurred only in the south side of the vents, thus suggesting that OA may alter epiphyte assemblages in different ways due to interaction with local factors such as differential fish herbivory or hydrodynamics. The OA effects on food items (seagrass, epiphytes, and algae) indirectly propagated into food provision to the sea urchin Paracentrotus lividus, as reflected by a reduced P. oceanica exploitation (i.e. less seagrass and calcareous epiphytes in the diet) in favour of non-calcareous green algae in both vent sites. In contrast, we detected no difference close and outside the vents neither in the composition of sea urchin diet nor in the total abundance of calcareous versus non-calcareous taxa. More research, under realistic scenarios of predicted pH reduction (i.e. ≤ 0.32 units of pH by 2100), is still necessary to better understand cascading effects of this altered urchin exploitation of food resources under acidified conditions on ecosystem diversity and function. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Study of the interaction mechanism in the biosorption of copper(II) ions onto posidonia oceanica and peat

    Energy Technology Data Exchange (ETDEWEB)

    Izquierdo, Marta; Marzal, Paula; Gabaldon, Carmen [Departamento de Ingenieria Quimica, Escuela Tecnica Superior de Ingenieria, Universitat de Valencia, Valencia (Spain); Silvetti, Margherita; Castaldi, Paola [Dipartimento di Scienze Ambientali e Agrarie e Biotecnologie Agro-Alimentari, Sez. Chimica Agraria ed Ambientale, University of Sassari, Sassari (Italy)

    2012-04-15

    A systematic approach was used to characterize the biosorption of copper(II) onto two biosorbents, Posidonia oceanica and peat, focusing on the interaction mechanisms, the copper(II) sorption-desorption process and the thermal behavior of the biosorbents. Sorption isotherms at pH 4-6 were obtained and the experimental data were fitted to the Langmuir model with a maximum uptake (q{sub max}) at pH 6 of 85.78 and 49.69 mg g{sup -1}, for P. oceanica and peat, respectively. A sequential desorption (SD) with water, Ca(NO{sub 3}){sub 2}, and EDTA was applied to copper-saturated biosorbents. Around 65-70% copper(II) were desorbed with EDTA, indicating that this heavy metal was strongly bound. The reversibility of copper(II) sorption was obtained by desorption with HCl and SD. Fourier transform IR spectroscopy (FTIR) analysis detected the presence of peaks associated with OH groups in aromatic and aliphatic structures, CH, CH{sub 2}, and CH{sub 3} in aliphatic structures, COO{sup -} and COOH groups and unsaturated aromatic structures on the surface of both biosorbents, as well as peaks corresponding to Si-O groups on the surface of peat. The results of SEM-EDX and FTIR analysis of copper-saturated samples demonstrated that ion exchange was one of the mechanisms involved in copper(II) retention. Thermal analysis of biosorbent samples showed that copper(II) sorption-desorption processes affected the thermal stability of the biosorbents. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  7. Effects of disturbances caused by coastal constructions on spatial structure, growth dynamics and photosynthesis of the seagrass Posidonia oceanica.

    Science.gov (United States)

    Ruiz, J M; Romero, J

    2003-12-01

    The light-limitation hypothesis was tested to assess whether water turbidity had caused the decline of a Mediterranean Posidonia oceanica (L.) Delile meadow in an area affected by a harbor. The annual growth, photosynthesis and rhizome starch concentrations of seagrass were measured and related to changes in light availability and dissolved nutrient concentration along a gradient of meadow degradation from areas close to the harbor outwards. Environmental and plant variables were measured in three stations placed along this gradient and compared with a reference station at an undisturbed meadow. The light attenuation coefficient (k) increased toward the inner harbor area, mainly due to sediment resuspension. The shoot density and leaf productivity of P. oceanica shoots were much lower in disturbed stations of the inner harbor area than in the outer, less disturbed station and the reference meadow. However, daily leaf carbon gains, calculated from the photosynthetic rates at saturating irradiance (P(max)) and the daily period in which seagrass receives light higher than its saturating irradiance (H(sat)), suggested positive C-balance in all stations. This was partly explained by photo-acclimatization of seagrass to the reduced light availability at the disturbed harbor stations (inner and intermediate), as indicated by the lengthening of H(sat) and the decrease in saturating irradiance (I(sat)) and respiratory demands. Despite photo-acclimatization, disturbed harbor stations showed less positive C-balance, seen not only in their lower leaf growth and biomass but also in a decrease in rhizome carbohydrate reserves (starch). Our results suggest that light reduction account for the reduced seagrass productivity and abundance. However, meadow decline (in terms of shoot mortality) in the harbor area is well above that predicted from similar light environments of nearby meadows or simulated in shading experiments. Thus, there are other factors than light limitation

  8. Depth-acclimation of photosynthesis, morphology and demography of Posidonia oceanica and Cymodocea nodosa in the Spanish Mediterranean Sea

    DEFF Research Database (Denmark)

    Olesen, B.; Enríquez, Susana; Duarte, Carlos M.

    2002-01-01

    and roots at greater depths, thereby promoting the balance between photosynthesis and respiration in the shoots. C. nodosa, being a potentially fast-growing species compared to P. oceanica, had higher maximum photosynthetic and respiration rates as well as light compensation points for photosynthesis....... Photosynthetic efficiency at low light, however, was almost the same for the 2 species as suggested by the relatively small differences in mass-specific light absorption. Only C. nodosa acclimated physiologically to depth as light-use efficiency increased, and light compensation point declined significantly from...... shallow to deep water. P. oceanica, however, possessed low respiration rates and slightly lower light compensation points values than C. nodosa throughout the depth range. Shoot mortality and recruitment rates were unaffected by rooting depth. C. nodosa stand experienced fast shoot turnover compared to P...

  9. Antagonistic roles of abscisic acid and cytokinin during response to nitrogen depletion in oleaginous microalga Nannochloropsis oceanica expand the evolutionary breadth of phytohormone function

    Czech Academy of Sciences Publication Activity Database

    Lu, Y.; Tarkowská, Danuše; Turečková, Veronika; Luo, T.; Xin, Y.; Li, J.; Wang, Q.; Jiao, N.; Strnad, Miroslav; Xu, J.

    2014-01-01

    Roč. 80, č. 1 (2014), s. 52-68 ISSN 0960-7412 R&D Projects: GA ČR GA206/09/1284; GA MŠk LK21306; GA MŠk(CZ) LO1204 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional support: RVO:61389030 Keywords : Nannochloropsis oceanica * antagonistic synergy * abscisic acid Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.972, year: 2014

  10. Variation along the year of trace metal levels in the compartments of the seagrass Posidonia oceanica in Port El Kantaoui, Tunisia.

    Science.gov (United States)

    Zakhama-Sraieb, Rym; Sghaier, Yassine Ramzi; Hmida, Ahmed Ben; Cappai, Giovanna; Carucci, Alessandra; Charfi-Cheikhrouha, Faouzia

    2016-01-01

    The accumulation of the five trace metals (TMs) cadmium, copper, lead, nickel and zinc was measured in Posidonia oceanica leaves. Shoots were seasonally sampled at 8-10-m depth from four stations located in Port El Kantaoui area, Tunisia, during four campaigns performed in 2012. Levels of the five TMs were analyzed using inductively coupled plasma atomic emission spectrometry (ICP-AES) in three compartments of P. oceanica shoots: blades and sheaths of adult leaves and intermediate leaves. Results showed a preferential accumulation of Cd, Pb, Ni and Zn in adult leaf blades. Therefore, we focus on the study of this compartment. TM levels of blades of adult leaves decreased in the following order: Zn > Ni > Cu > Pb > Cd, irrespective of the season. Levels of the five TMs significantly differed between seasons (p < 0.01). Levels of Cd and Cu showed a seasonal pattern: Cd decreased from spring to winter while Cu increased during that same period of time. A significant correlation (p < 0.01) was found between Cd-Cu and Cd-Pb. A significant correlation (p < 0.05) was also noted between Cd-Ni in the adult leaf blades. A relationship was recorded between the foliar surface of the adult leaf blades and Zn accumulation. This survey allowed to highlight the annual variation of TM accumulation in adult leaf blades of P. oceanica, in relation with ecophysiology of this seagrass. Therefore, this study reinforces the usefulness and the relevance of this compartment of P. oceanica, easy to sample without destruction of whole shoot, as a bioindicator of Zn, Ni, Cd and Pb contamination.

  11. Unified treatment of complete orthonormal sets for wave functions, and Slater orbitals of particles with arbitrary spin in coordinate, momentum and four-dimensional spaces

    International Nuclear Information System (INIS)

    Guseinov, I.I.

    2007-01-01

    The new analytical relations of complete orthonormal sets for the tensor wave functions and the tensor Slater orbitals of particles with arbitrary spin in coordinate, momentum and four-dimensional spaces are derived using the properties of tensor spherical harmonics and complete orthonormal scalar basis sets of ψ α -exponential type orbitals, φ α -momentum space orbitals and z α -hyperspherical harmonics introduced by the author for particles with spin s=0, where the α=1,0,-1,-2,.... All of the tensor wave functions obtained are complete without the inclusion of the continuum and, therefore, their group of transformations is the four-dimensional rotation group O(4). The analytical formulas in coordinate space are also derived for the overlap integrals over tensor Slater orbitals with the same screening constant. We notice that the new idea presented in this work is the combination of tensor spherical harmonics of rank s with complete orthonormal scalar sets for radial parts of ψ α -, φ α - and z α -orbitals, where s=1/2,1,3/2,2,...

  12. The effect of temperature, salinity and growth rate on the stable hydrogen isotopic composition of long chain alkenones produced by Emiliania huxleyi and Gephyrocapsa oceanica

    Directory of Open Access Journals (Sweden)

    S. Schouten

    2006-01-01

    Full Text Available Two haptophyte algae, Emiliania huxleyi and Gephyrocapsa oceanica, were cultured at different temperatures and salinities to investigate the impact of these factors on the hydrogen isotopic composition of long chain alkenones synthesized by these algae. Results showed that alkenones synthesized by G. oceanica were on average depleted in D by 30 compared to those of E. huxleyi when grown under similar temperature and salinity conditions. The fractionation factor, αalkenones-H2O, ranged from 0.760 to 0.815 for E. huxleyi and from 0.741 to 0.788 for G. oceanica. There was no significant correlation of αalkenones-H2O with temperature but a positive linear correlation was observed between αalkenones-H2O and salinity with ~3 change in fractionation per salinity unit and a negative correlation between αalkenones-H2O and growth rate. This suggests that both salinity and growth rate can have a substantial impact on the stable hydrogen isotopic composition of long chain alkenones in natural environments.

  13. Mapping of Posidonia oceanica (L. Delile Meadows Using Geographic Information Systems: A case study in Ufakdere - Kaş (Mediterranean Sea

    Directory of Open Access Journals (Sweden)

    Volkan Demir

    2016-12-01

    Full Text Available Posidonia oceanica (Linnaeus Delile 1813 is an endemic and the most widespread seagrass species of the Mediterranean Sea. Seagrass meadows are one of the most productive ecosystems on Earth, providing habitat to numerous organisms. Therefore, mapping of seagrass meadows is of crucial importance for conservation and coastal management purposes. Here we present an integrated geographic information system approach with SCUBA diving, providing a cost effective method to monitor seagrass beds at shallow coastal habitats. In this case study P. oceanica meadows were mapped in Ufakdere region of Kaş (Antalya coastal area between April – September 2015. A total of 25000 m2 are were screened to create seagrass coverage maps. Results indicate that P. oceanica meadows cover 21200 m2 and we estimated that 520 m2 of this area is highly damaged. This integrated approach provided one of the most detailed small-scale Posidonia mapping in Turkey and this time and cost effective methodology can be applied to any seagrass meadow with great ease to increase our knowledge on this important habitat.

  14. Tissue-specific transcriptomic profiling provides new insights into the reproductive ecology and biology of the iconic seagrass species Posidonia oceanica.

    Science.gov (United States)

    Entrambasaguas, Laura; Jahnke, Marlene; Biffali, Elio; Borra, Marco; Sanges, Remo; Marín-Guirao, Lázaro; Procaccini, Gabriele

    2017-10-01

    Seagrasses form extensive meadows in shallow coastal waters and are among the world's most productive ecosystems. Seagrasses can produce both clonally and sexually, and flowering has long been considered infrequent, but important for maintaining genetically diverse stands. Here we investigate the molecular mechanisms involved in flowering of the seagrass Posidonia oceanica, an iconic species endemic to the Mediterranean. We generated a de novo transcriptome of this non-model species for leaf, male and female flower tissue of three individuals, and present molecular evidence for genes that may be involved in the flowering process and on the reproductive biology of the species. We present evidence that suggests that P. oceanica exhibits a strategy of protogyny, where the female part of the hermaphroditic flower develops before the male part, in order to avoid self-fertilization. We found photosynthetic genes to be up-regulated in the female flower tissues, indicating that this may be capable of photosynthesis. Finally, we detected a number of interesting genes, previously known to be involved in flowering pathways responding to light and temperature cues and in pathways involved in anthocyanin and exine synthesis. This first comparative transcriptomic approach of leaf, male and female tissue provides a basis for functional genomics research on flower development in P. oceanica and other seagrass species. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Performance assessment of density functional methods with Gaussian and Slater basis sets using 7σ orbital momentum distributions of N2O

    Science.gov (United States)

    Wang, Feng; Pang, Wenning; Duffy, Patrick

    2012-12-01

    Performance of a number of commonly used density functional methods in chemistry (B3LYP, Bhandh, BP86, PW91, VWN, LB94, PBe0, SAOP and X3LYP and the Hartree-Fock (HF) method) has been assessed using orbital momentum distributions of the 7σ orbital of nitrous oxide (NNO), which models electron behaviour in a chemically significant region. The density functional methods are combined with a number of Gaussian basis sets (Pople's 6-31G*, 6-311G**, DGauss TZVP and Dunning's aug-cc-pVTZ as well as even-tempered Slater basis sets, namely, et-DZPp, et-QZ3P, et-QZ+5P and et-pVQZ). Orbital momentum distributions of the 7σ orbital in the ground electronic state of NNO, which are obtained from a Fourier transform into momentum space from single point electronic calculations employing the above models, are compared with experimental measurement of the same orbital from electron momentum spectroscopy (EMS). The present study reveals information on performance of (a) the density functional methods, (b) Gaussian and Slater basis sets, (c) combinations of the density functional methods and basis sets, that is, the models, (d) orbital momentum distributions, rather than a group of specific molecular properties and (e) the entire region of chemical significance of the orbital. It is found that discrepancies of this orbital between the measured and the calculated occur in the small momentum region (i.e. large r region). In general, Slater basis sets achieve better overall performance than the Gaussian basis sets. Performance of the Gaussian basis sets varies noticeably when combining with different Vxc functionals, but Dunning's augcc-pVTZ basis set achieves the best performance for the momentum distributions of this orbital. The overall performance of the B3LYP and BP86 models is similar to newer models such as X3LYP and SAOP. The present study also demonstrates that the combinations of the density functional methods and the basis sets indeed make a difference in the quality of the

  16. A Slater parameter optimisation interface for the CIV3 atomic structure code and its possible use with the R-matrix close coupling collision code

    International Nuclear Information System (INIS)

    Fawcett, B.C.; Hibbert, A.

    1989-11-01

    Details are here provided of amendments to the atomic structure code CIV3 which allow the optional adjustment of Slater parameters and average energies of configurations so that they result in improved energy levels and eigenvectors. It is also indicated how, in principle, the resultant improved eigenvectors can be utilised by the R-matrix collision code, thus providing an optimised target for close coupling collision strength calculations. An analogous computational method was recently reported for distorted wave collision strength calculations and applied to Fe XIII. The general method is suitable for the computation of collision strengths for complex ions and in some cases can then provide a basis for collision strength calculations in ions where ab initio computations break down or result in unnecessarily large errors. (author)

  17. Contrasting Physiological and Proteomic Adaptations to Iron and/or Copper Limitation in Two Strains of the Same Open Ocean Diatom Thalassiosira oceanica

    Science.gov (United States)

    Schuback, N.; Hippmann, A.; Maldonado, M. T.; Allen, A. E.; McCrow, J.; Foster, L. J.; Green, B. R.; Alami, M.

    2016-02-01

    Iron plays a significant role in controlling marine primary productivity. Despite that extremely low dissolved iron (Fe) concentrations are found in Fe-limited regions, some phytoplankton are able to survive and thrive. Two strains of the model oceanic diatom Thalassiosira oceanica, TO 1003 and TO 1005, have both been used in previous studies to characterize adaptations to iron limitation. These studies have shown that T. oceanica has lowered its Fe requirements and increased its Fe acquisition efficiency compared to coastal counterparts. Both strategies may impose a higher cellular copper (Cu) demand. However, the underlying biochemical adaptations in these oceanic diatoms remain unknown. Recently, the genome, as well as the first proteomic and transcriptomic analyses of T. oceanica 1005 grown under different Fe levels, were published. To further our understanding of the interplay between Fe- and Cu- physiology in open ocean diatoms, we examined an array of physiological responses to varying degrees of Fe-, Cu- and Fe/Cu co-limitation in both strains. We also determined the differential expression of proteins using stable isotope labeling and LC-MS/MS proteomic analysis. The two strains, TO 1003 and TO 1005, need markedly different metal concentrations in the media. TO1003 requires 30% less Cu to sustain its optimal growth and less than 1/10th of the minimum Cu that is needed by TO 1005 to survive. In contrast, TO 1005 is able to grow with less Fe available in the media. The physiological and proteomic responses of these two strains when acclimated to low Fe and/or Cu concentrations will be presented. The evolutionary implications will be discussed.

  18. Na+-Dependent High-Affinity Nitrate, Phosphate and Amino Acids Transport in Leaf Cells of the Seagrass Posidonia oceanica (L. Delile

    Directory of Open Access Journals (Sweden)

    Lourdes Rubio

    2018-05-01

    Full Text Available Posidonia oceanica (L. Delile is a seagrass, the only group of vascular plants to colonize the marine environment. Seawater is an extreme yet stable environment characterized by high salinity, alkaline pH and low availability of essential nutrients, such as nitrate and phosphate. Classical depletion experiments, membrane potential and cytosolic sodium measurements were used to characterize the high-affinity NO3−, Pi and amino acids uptake mechanisms in this species. Net uptake rates of both NO3− and Pi were reduced by more than 70% in the absence of Na+. Micromolar concentrations of NO3− depolarized mesophyll leaf cells plasma membrane. Depolarizations showed saturation kinetics (Km = 8.7 ± 1 μM NO3−, which were not observed in the absence of Na+. NO3− induced depolarizations at increasing Na+ also showed saturation kinetics (Km = 7.2 ± 2 mM Na+. Cytosolic Na+ measured in P. oceanica leaf cells (17 ± 2 mM Na+ increased by 0.4 ± 0.2 mM Na+ upon the addition of 100 μM NO3−. Na+-dependence was also observed for high-affinity l-ala and l-cys uptake and high-affinity Pi transport. All together, these results strongly suggest that NO3−, amino acids and Pi uptake in P. oceanica leaf cells are mediated by high-affinity Na+-dependent transport systems. This mechanism seems to be a key step in the process of adaptation of seagrasses to the marine environment.

  19. Slater-Koster Tight-Binding parametrization of single and few-layer Black-Phosphorus from first-principles calculations

    Science.gov (United States)

    Menezes, Marcos; Capaz, Rodrigo

    Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.

  20. Ocean Color Products Supporting the Assessment of Good Environmental Status: Development of a Spatial Distribution Model for the Seagrass Posidonia Oceanica (L.) Delille, 1813

    Science.gov (United States)

    Zucchetta, M.; Taji, M. A.; Mangin, A.; Pastres, R.

    2015-12-01

    Posidonia oceanica (L.) Delile, 1813 is a seagrass species endemic to the Mediterranean Sea, which is considered as one of the key habitats of the coastal areas. This species forms large meadows sensitive to several anthropogenic pressures, that can be regarded as indicators of environment quality in coastal environments and its distributional patterns should be take into account when evaluating the Environmental Status following the Ecosystem approach promoted by the Mediterranean Action Plan of UNEP and the EU Marine Strategy Framework Directive (2008/56/EC). The aim of this study was to develop a Species Distribution Model for P. oceanica, to be applied to the whole Mediterranean North African coast, in order to obtain an estimation of the potential distribution of this species in the region to be considered as an indicator for the assessment of good Environmental Status. As the study area is a data-poor zone with regard to seagrass distribution (i.e. only for some areas detailed distribution maps are available), the Species Distribution Model (SDM) was calibrated using high resolution data from 5 Mediterranean sites, located in Italy and Spain and validated using available data from the North African coast. Usually, when developing SDMs species occupancy data is available at coarser resolution than the information of environmental variables, and thus has to be downscaled at the appropriate grain to be coupled to the environmental conditions. Tackling the case of P. oceanica we had to face the opposite problem: the quality (in terms of resolution) of the information on seagrass distribution is generally very high compared to the environmental data available over large scale in marine domains (e.g. global bathymetry data). The high resolution application and the model transfer (from calibration areas to North African coast) was possible taking advantage of Ocean Color products: the probability of presence of the species in a given area was modelled using a

  1. Photosynthesis, growth and survival of the Mediterranean seagrass Posidonia oceanica in response to simulated salinity increases in a laboratory mesocosm system

    Science.gov (United States)

    Marín-Guirao, Lázaro; Sandoval-Gil, José M.; Ruíz, Juan M.; Sánchez-Lizaso, José L.

    2011-04-01

    This study aims to examine the effect of increased salinity on the photosynthetic activity of the Mediterranean seagrass Posidonia oceanica in a laboratory mesocosm system. To do this, large rhizome fragments were transplanted in a mesocosm laboratory system and maintained at 37 (ambient salinity, control treatment), 39, 41 and 43 (hypersaline treatments) for 47 days. Pigment content, light absorption, photosynthetic characteristics (derived from P vs. E curves and fluorescence parameters), and shoot size, growth rates and net shoot change were determined at the end of the experimental period. Both net and gross photosynthetic rates of plants under hypersaline conditions were significantly reduced, with rates some 25-33% and 13-20% lower than in control plants. The pigment content (Chl a, Chl b, Chl b:Chl a molar ratio, total carotenoids and carotenoids:Chl a ratio), leaf absorptance and maximum quantum yield of PSII ( F v/ F m) of control plants showed little or no changes under hypersaline conditions, which suggests that alterations to the capacity of the photosynthetic apparatus to capture and process light were not responsible for the reduced photosynthetic rates. In contrast, dark respiration rates increased substantially, with mean values up to 98% higher than in control leaves. These results suggest that the respiratory demands of the osmoregulatory process are likely to be responsible for the observed decrease in photosynthetic rates, although alterations to photosynthetic carbon assimilation and reduction could also be involved. As a consequence, leaf carbon balance was considerably impaired and leaf growth rates decreased as salinity increased above the ambient (control) salinity. No significant differences were found in the percentage of net shoot change, but mean values were clearly negative at salinity levels of 41 and 43. Results presented here indicate that photosynthesis of P. oceanica is highly sensitive to hypersaline stress and that it likely

  2. El conocimiento de la Posidonia oceanica y sus funciones ecológicas como herramienta de gestión litoral. La realización de encuestas a los usuarios de playas y calas de la isla de Menorca

    Directory of Open Access Journals (Sweden)

    Francesc Xavier Roig i Munar

    2001-01-01

    Full Text Available La Posidonia oceanica juega un papel primordial como producción de sedimento y defensa de las playas y calas de la isla de Menorca. La realización de encuestas de percepción a los usuarios de playa sobre el conocimiento y las funciones ecológicas de esta planta resulta una herramienta de gestión primordial para la conservación y mantenimiento de los espacios litorales insulares.

  3. Enhancement of biofuels production by means of co-pyrolysis of Posidonia oceanica (L.) and frying oil wastes: Experimental study and process modeling.

    Science.gov (United States)

    Zaafouri, Kaouther; Ben Hassen Trabelsi, Aida; Krichah, Samah; Ouerghi, Aymen; Aydi, Abdelkarim; Claumann, Carlos Alberto; André Wüst, Zibetti; Naoui, Silm; Bergaoui, Latifa; Hamdi, Moktar

    2016-05-01

    Energy recovery from lignocellulosic solid marine wastes, Posidonia oceanica wastes (POW) with slow pyrolysis responds to the growing trend of alternative energies as well as waste management. Physicochemical, thermogravimetric (TG/DTG) and spectroscopic (FTIR) characterizations of POW were performed. POW were first converted by pyrolysis at different temperatures (450°C, 500°C, 550°C and 600°C) using a fixed-bed reactor. The obtained products (bio-oil, syngas and bio char) were analyzed. Since the bio-oil yield obtained from POW pyrolysis is low (2wt.%), waste frying oil (WFO) was added as a co-substrate in order to improve of biofuels production. The co-pyrolysis gave a better yield of liquid organic fraction (37wt.%) as well as syngas (CH4,H2…) with a calorific value around 20MJ/kg. The stoichiometric models of both pyrolysis and co-pyrolysis reactions were performed according to the biomass formula: CαHβOγNδSε. The thermal kinetic decomposition of solids was validated through linearized Arrhenius model. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Mapping Spatial Patterns of Posidonia oceanica Meadows by Means of Daedalus ATM Airborne Sensor in the Coastal Area of Civitavecchia (Central Tyrrhenian Sea, Italy

    Directory of Open Access Journals (Sweden)

    Marco Marcelli

    2013-10-01

    Full Text Available The spatial distribution of sea bed covers and seagrass in coastal waters is of key importance in monitoring and managing Mediterranean shallow water environments often subject to both increasing anthropogenic impacts and climate change effects. In this context we present a methodology for effective monitoring and mapping of Posidonia oceanica (PO meadows in turbid waters using remote sensing techniques tested by means of LAI (Leaf Area Index point sea truth measurements. Preliminary results using Daedalus airborne sensor are reported referring to the PO meadows at Civitavecchia site (central Tyrrhenian sea where vessel traffic due to presence of important harbors and huge power plant represent strong impact factors. This coastal area, 100 km far from Rome (Central Italy, is characterized also by significant hydrodynamic variations and other anthropogenic factors that affect the health of seagrass meadows with frequent turbidity and suspended sediments in the water column. During 2011–2012 years point measurements of several parameters related to PO meadows phenology were acquired on various stations distributed along 20 km of coast between the Civitavecchia and S. Marinella sites. The Daedalus airborne sensor multispectral data were preprocessed with the support of satellite (MERIS derived water quality parameters to obtain here improved thematic maps of the local PO distribution. Their thematic accuracy was then evaluated as agreement (R2 with the point sea truth measurements and regressive modeling using an on purpose developd method.

  5. Bioaccumulation of aluminium in the seagrasses Cymodocea nodosa (Ucria) Aschers. and Posidonia oceanica (L.) Delile and macroalgae of the Gulf of Antikyra (Greece)

    Energy Technology Data Exchange (ETDEWEB)

    Malea, P. [Thessaloniki Univ. (Greece). Inst. of Botany

    1993-12-31

    Mean concentrations of Aluminium ({+-}SE) in two seagrasses, four Chlorophytes, three Chromophytes and seven Rhodophyte species from the Gulf of Antikyra (Greece) decreased in the order: Chlorophyta > Chromophyta > Rhodophyta > P. oceanica > C. nodosa. This area is of particular interest because of the bauxite composition of the substrate and of the wate discharge from an aluminium factory in the Gulf. Aluminium concentrations in the two seagrasses were evenly distributed at the Gulf stations. Only the concentrations of Al in C. nodosa displayed significant seasonal variation. The mean concentrations increased from spring to summer, at which point they reached their maxima. This pattern is discussed in relation to the leaf-age of the seagrass. Regarding the amount of Al accumulated by the macroalgae of each division, there were interspecific differences which were attributed to differences in the structure, the ecology and the binding sites offered by the plants. The dependence of Al concentrations in the macrophytes on the concentrations in the sediment and the correlation of Al concentrations with the concentrations of some other metals in the plants were also investigated. (orig.)

  6. Microbiological parameters and maturity degree during composting of Posidonia oceanica residues mixed with vegetable wastes in semi-arid pedo-climatic condition.

    Science.gov (United States)

    Saidi, Neyla; Kouki, Soulwene; M'hiri, Fadhel; Jedidi, Naceur; Mahrouk, Meriam; Hassen, Abdennaceur; Ouzari, Hadda

    2009-01-01

    The aim of this study was to characterize the biological stability and maturity degree of compost during a controlled pile-composting trial of mixed vegetable residues (VR) collected from markets of Tunis City with residues of Posidonia oceanica (PoR), collected from Tunis beaches. The accumulation in beaches (as well as their removal) constitutes a serious environmental problem in all Mediterranean countries particularly in Tunisia. Aerobic-thermophilic composting is the most reasonable way to profit highly-valuable content of organic matter in these wastes for agricultural purposes. The physical, chemical, and biological parameters were monitored during composting over 150 d. The most appropriate parameters were selected to establish the maturity degree. The main result of this research was the deduction of the following maturity criterion: (a) C/N ratio 80%. These five parameters, considered jointly are indicative of a high maturity degree and thus of a high-quality organic amendment which employed in a rational way, may improve soil fertility and soil quality. The mature compost was relatively rich in N (13.0 g/kg), P (4.74 g/kg) and MgO (15.80 g/kg). Thus composting definitively constitutes the most optimal option to exploit these wastes.

  7. Human impact, geomorphological and bio-environmental indicators for mapping and monitoring of a Mediterranean urban-beach with Posidonia oceanica (Gulf of Cagliari-Sardinia)

    Science.gov (United States)

    De Muro, Sandro; Pusceddu, Nicola; Frongia, Paolo; Buosi, Carla; Passarella, Marinella; Ibba, Angelo

    2016-04-01

    This work describes the human conditioned evolution (medium term) and the short term dynamics (mainly sediment transport) in southern Sardinia beach (between Giorgino and Cala d'Orri, about 11km), composed of fine to coarse quartz sand, backed by dune ridges and lagoons. The study was founded by NEPTUNE Project, Tender6 (L n. 7/2007). Geomorphological and bio-environmental indicators as: urbanization and coastal defence expansion, dune and beach changes, biotic indices (benthic foraminifera and Posidonia meadow) have been used. Medium-term evolution, over a period of 60 years, was carried out by ortho-images (1954-2015) for reconstructing coastline changes at this temporal scale. The main modifications were the building of the canal harbor, the consequent loss of 2.5km of beach, and the construction of several coastal defense structures, which caused asymmetric accumulations (lee zones) and erosion areas. Short-term variations have been periodically monitored (2014-2015) during 5 different field surveys (DGPS and Echo-sounder data) obtaining topo-bathymetric digital models. Sedimentary and hydrodynamic characteristics have been studied. Wave propagation, coastal currents and sediment transport, have been simulated through numerical models within Delft3D software. The results obtained allowed to visualize the response of the beach to wave stress, forced from SW, S, SE (Cagliari buoy and weather data). The comparison between data collected, thematic maps and models allowed to identify the main controlling factors and distribution mechanisms of the sedimentary paths on the shoreface. Those human modifications (e.g. building of the canal harbour and jetties, lagoon mouths stabilization, the consequent modified hydrodynamics and bottom trawling) have direct influence on the Posidonia oceanica and on its upper limit. In 2002, the Italian Environment Office reported a wide area (between -4m and -20m) of degraded Posidonia and dead matte in front of the study beach

  8. Lack of Impact of Posidonia oceanica Leaf Nutrient Enrichment on Sarpa salpa Herbivory: Additional Evidence for the Generalist Consumer Behavior of This Cornerstone Mediterranean Herbivore.

    Science.gov (United States)

    Marco-Méndez, Candela; Wessel, Caitlin; Scheffel, Whitney; Ferrero-Vicente, Luis; Fernández-Torquemada, Yolanda; Cebrián, Just; Heck, Kenneth L; Sánchez-Lizaso, Jose Luis

    2016-01-01

    The fish Sarpa salpa (L.) is one of the main macroherbivores in the western Mediterranean. Through direct and indirect mechanisms, this herbivore can exert significant control on the structure and functional dynamics of seagrass beds and macroalgae. Past research has suggested nutritional quality of their diet influences S. salpa herbivory, with the fish feeding more intensively and exerting greater top down control on macrophytes with higher internal nutrient contents. However recent findings have questioned this notion and shown that herbivores do not preferentially feed on macrophytes with higher nutrient contents, but rather feed on a wide variety of them with no apparent selectivity. To contribute to this debate, we conducted a field fertilization experiment where we enriched leaves of the seagrass Posidonia oceanica, a staple diet for S. salpa, and examined the response by the herbivore. These responses included quantification of leaf consumption in fertilized and non-fertilized/control plots within the bed, and food choice assays where fertilized and non-fertilized/control leaves were simultaneously offered to the herbivore. Despite the duration of leaf exposure to herbivores (30 days) and abundant schools of S. salpa observed around the plots, leaf consumption was generally low in the plots examined. Consumption was not higher on fertilized than on non-fertilized leaves. Food choice experiments did not show strong evidence for selectivity of enriched leaves. These results add to a recent body of work reporting a broad generalist feeding behavior by S. salpa with no clear selectivity for seagrass with higher nutrient content. In concert, this and other studies suggest S. salpa is often generalist consumers not only dictated by diet nutrient content but by complex interactions between other traits of nutritional quality, habitat heterogeneity within their ample foraging area, and responses to predation risk.

  9. Calculation of the total electron excitation cross section in the Born approximation using Slater wave functions for the Li (2s yields 2p), Li (2s yields 3p), Na (3s yields 4p), Mg (3p yields 4s), Ca (4s yields 4p) and K (4s yields 4p) excitations. M.S. Thesis

    Science.gov (United States)

    Simsic, P. L.

    1974-01-01

    Excitation of neutral atoms by inelastic scattering of incident electrons in gaseous nebulae were investigated using Slater Wave functions to describe the initial and final states of the atom. Total cross sections using the Born Approximation are calculated for: Li(2s yields 2p), Na(3s yields 4p), k(4s yields 4p). The intensity of emitted radiation from gaseous nebulae is also calculated, and Maxwell distribution is employed to average the kinetic energy of electrons.

  10. Impact of ISWEC sea wave energy converter on posidonia oceanica meadows assessed by satellite remote sensing in the coastal areas of Pantelleria island

    Science.gov (United States)

    Borfecchia, Flavio; Micheli, Carla; Belmonte, Alessandro; De Cecco, Luigi; Sannino, Gianmaria; Bracco, Giovanni; Mattiazzo, Giuliana; Vittoria Struglia, Maria

    2016-04-01

    Marine renewable energy extraction plays a key role both in energy security of small islands and in mitigation of climate change, but at the same time poses the important question of monitoring the effects of the interaction of such devices with the marine environment. In this work we present a new methodology, integrating satellite remote sensing techniques with in situ observations and biophysical parameters analysis, for the monitoring and mapping of Posidonia Oceanica (PO) meadows in shallow coastal waters. This methodology has been applied to the coastal area offshore Pantelleria Island (Southern Mediterranean) where the first Italian Inertial Sea Wave Energy Converter (ISWEC) prototype has been recently installed. The prototype, developed by the Polytechnic of Turin consists of a platform 8 meters wide, 15 meters long and 4.5 meters high, moored at about 800 meters from the shore and at 31 m depth. It is characterized by high conversion efficiency, resulting from its adaptability to different wave conditions, and a limited environmental impact due to its mooring innovative method with absence of fixed anchors to the seabed. The island of Pantelleria, is characterized by high transparency of coastal waters and PO meadows ecosystems with still significant levels of biodiversity and specific adaptation to accentuated hydrodynamics of these shores. Although ISWEC is a low-impact mooring inertial system able to ensure a reliable connection to the electric grid with minimal impact on seagrass growing in the seabed, the prototype installation and operation involves an interaction with local PO and seagrass meadows and possible water transparency decreasing. In this view monitoring of local PO ecosystem is mandatory in order to allow the detection of potential stress and damages due to ISWEC related activities and/or other factors. However, monitoring and collection of accurate and repetitive information over large areas of the necessary parameters by means of

  11. Methylthio-Aspochalasins from a Marine-Derived Fungus Aspergillus sp.

    Directory of Open Access Journals (Sweden)

    Ying Liu

    2014-09-01

    Full Text Available Two novel aspochalasins, 20-β-methylthio-aspochalsin Q (named as aspochalasin V, (1 and aspochalasin W (2, were isolated from culture broth of Aspergillus sp., which was found in the gut of a marine isopod Ligia oceanica. The structures were determined on the basis of NMR and mass spectral data analysis. This is the first report about methylthio-substituted aspochalasin derivatives. Cytotoxicity against the prostate cancer PC3 cell line and HCT116 cell line was assayed using the MTT method. Apochalasin V showed moderate activity at IC50 values of 30.4 and 39.2 μM, respectively.

  12. Quantum statistics of ideal parafermi gases III: The Slater quasi-determinant

    International Nuclear Information System (INIS)

    Rachidi, M.; Zerouaoui, J.; Saidi, E.H.

    1995-09-01

    The wave function ψ (1,2,...,N) of a gas of N identical two-dimensional exotic particles of spin 1/M (mod 1), M = 2,3,4,... is constructed. It is shown that ψ (1,2,...,N) obeys a generalized Pauli exclusion principle according to which no more than (M - 1) identical particles of spin 1/M (mod 1) can live in the same quantum state. The Fermi nilpotency and the Bose condensation are recovered as special cases. Examples are given. (author). 9 refs

  13. Quantum statistics of ideal parafermi gases III: The Slater quasi-determinant

    Energy Technology Data Exchange (ETDEWEB)

    Rachidi, M; Zerouaoui, J [Faculte de Sciences, Rabat (Morocco). Section de Physique de Hautes Energies (LMPHE); Saidi, E H [International Centre for Theoretical Physics, Trieste (Italy)

    1995-09-01

    The wave function {psi} (1,2,...,N) of a gas of N identical two-dimensional exotic particles of spin 1/M (mod 1), M = 2,3,4,... is constructed. It is shown that {psi} (1,2,...,N) obeys a generalized Pauli exclusion principle according to which no more than (M - 1) identical particles of spin 1/M (mod 1) can live in the same quantum state. The Fermi nilpotency and the Bose condensation are recovered as special cases. Examples are given. (author). 9 refs.

  14. 76 FR 43710 - Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound...

    Science.gov (United States)

    2011-07-21

    ... Washington; Port Gamble Indian Community of the Port Gamble Reservation, Washington; Puyallup Tribe of the... Port Madison Reservation, Washington; Swinomish Indians of the Swinomish Reservation, Washington... alternating dry and wet conditions. Based on 14 morphological characteristics, a physical anthropologist...

  15. Synthesis and characterization of Fe-Ti-Sb intermetallic compounds: Discovery of a new Slater-Pauling phase

    Science.gov (United States)

    Naghibolashrafi, N.; Keshavarz, S.; Hegde, Vinay I.; Gupta, A.; Butler, W. H.; Romero, J.; Munira, K.; LeClair, P.; Mazumdar, D.; Ma, J.; Ghosh, A. W.; Wolverton, C.

    2016-03-01

    Compounds of Fe, Ti, and Sb were prepared using arc melting and vacuum annealing. Fe2TiSb , expected to be a full Heusler compound crystallizing in the L 21 structure, was shown by XRD and SEM analyses to be composed of weakly magnetic grains of nominal composition Fe1.5TiSb with iron-rich precipitates in the grain boundaries. FeTiSb, a composition consistent with the formation of a half-Heusler compound, also decomposed into Fe1.5TiSb grains with Ti-Sb rich precipitates and was weakly magnetic. The dominant Fe1.5TiSb phase appears to crystallize in a defective L 21 -like structure with iron vacancies. Based on this finding, a first-principles DFT-based binary cluster expansion of Fe and vacancies on the Fe sublattice of the L 21 structure was performed. Using the cluster expansion, we computationally scanned >103 configurations and predict a novel, stable, nonmagnetic semiconductor phase to be the zero-temperature ground state. This new structure is an ordered arrangement of Fe and vacancies, belonging to the space group R 3 m , with composition Fe1.5TiSb , i.e., between the full- and half-Heusler compositions. This phase can be visualized as alternate layers of L 21 phase Fe2TiSb and C 1b phase FeTiSb, with layering along the [111] direction of the original cubic phases. Our experimental results on annealed samples support this predicted ground-state composition, but further work is required to confirm that the R 3 m structure is the ground state.

  16. Hartree-fock-slater method for materials science the DV-X alpha method for design and characterization of materials

    CERN Document Server

    Adachi, H; Kawai, J

    2006-01-01

    Molecular-orbital calculations for materials design such as alloys, ceramics, and coordination compounds are now possible for experimentalists. Molecuar-orbital calculations for the interpretation of chemical effect of spectra are also possible for experimentalists. The most suitable molecular-orbital calculation method for these purpose is the DV-Xa method, which is robust in such a way that the calculation converges to a result even if the structure of the molecule or solid is impossible in the pressure and temperature ranges on earth. This book specially addresses the methods to design novel materials and to predict the spectralline shape of unknown materials using the DV-Xa molecular-orbital method, but is also useful for those who want to calculate electronic structures of materials using any kind of method.

  17. A supply chain management strategy for the non-ferrous foundry industry in South Africa / by Arland Slater

    OpenAIRE

    Slater, Arland

    2004-01-01

    In today's global knowledge economy, progressive companies must be equipped with a good balance of internal knowledge, both in scope and depth, and must adapt to the rapidly changing business environment. The ability of an organisation to manage knowledge as a corporate strategy is becoming a key competitive advantage. The essence of building an organisation's strength or capability in strategic knowledge management is to deepen the understanding of the exploitation and explora...

  18. Seagrass (Posidonia oceanica) seedlings in a high-CO2 world: from physiology to herbivory

    KAUST Repository

    Herná n, Gema; Ramajo, Laura; Basso, Lorena; Delgado, Antonio; Terrados, Jorge; Duarte, Carlos M.; Tomas, Fiona

    2016-01-01

    , which allow plant dispersal and provide the potential for adaptation under changing environmental conditions. Furthermore, the outcome of the concomitant biochemical changes in plant-herbivore interactions has been poorly studied, yet may have important

  19. Settlement pattern of Posidonia oceanica epibionts along a gradient of ocean acidification: an approach with mimics

    Directory of Open Access Journals (Sweden)

    L. DONNARUMMA

    2014-02-01

    Full Text Available Effects of ocean acidification (OA on the colonization/settlement pattern of the epibiont community of the leaves and rhizomesof the Mediterranean seagrass,Posidoniaoceanica, have been studied at volcanic CO2vents off Ischia (Italy, using “mimics”as artificial substrates. The experiments were conducted in shallowPosidoniastands (2-3 m depth, in three stations on the northand three on the south sides of the study area, distributed along a pH gradient. At each station, 4 rhizome mimics and 6 artificialleaves were collected every three months (Sept 2009-Sept 2010. The epibionts on both leaf and rhizome mimics showed clearchanges along the pH gradient; coralline algae and calcareous invertebrates (bryozoans, serpulid polychaetes and barnacles weredominant at control stations but progressively disappeared at the most acidified stations. In these extremely low pH sites theassemblage was dominated by filamentous algae and non calcareous taxa such as hydroids and tunicates. Settlement pattern onthe artificial leaves and rhizome mimics over time showed a consistent distribution pattern along the pH gradient and highlightedthe peak of recruitment of the various organisms in different periods according to their life history.Posidoniamimics at theacidified station showed a poor and very simplified assemblage where calcifying epibionts seemed less competitive for space. Thisprofound difference in epiphyte communities in low pH conditions suggests cascading effects on the food web of the meadow and,consequently, on the functioning of the system

  20. Architecture of the light-harvesting apparatus of the eustigmatophyte alga Nannochloropsis oceanica

    Czech Academy of Sciences Publication Activity Database

    Litvín, Radek; Bína, David; Herbstová, Miroslava; Gardian, Zdenko

    2016-01-01

    Roč. 130, 1-3 (2016), s. 137-150 ISSN 0166-8595 R&D Projects: GA ČR(CZ) GP14-01377P Institutional support: RVO:60077344 Keywords : Light harvesting * Thylakoid membrane * Vaucheriaxanthin * Violaxanthin–chlorophyll protein Subject RIV: BO - Biophysics Impact factor: 3.864, year: 2016

  1. Efficient light-harvesting using non-carbonyl carotenoids: Energy transfer dynamics in the VCP complex from Nannochloropsis oceanica

    Czech Academy of Sciences Publication Activity Database

    Kesan, G.; Litvín, Radek; Bína, David; Durchan, Milan; Šlouf, V.; Polívka, Tomáš

    2016-01-01

    Roč. 1857, č. 4 (2016), s. 370-379 ISSN 0005-2728 R&D Projects: GA ČR(CZ) GAP205/11/1164; GA ČR GBP501/12/G055; GA ČR(CZ) GP14-01377P Institutional support: RVO:60077344 Keywords : Carotenoids * Energy transfer * Light-harvesting complex Subject RIV: BO - Biophysics Impact factor: 4.932, year: 2016

  2. Spanish leadership in marine renewable energies. The project Ocean Lider; Liderazgo espanol en energias renovables oceanicas. El proyecto Ocean Lider

    Energy Technology Data Exchange (ETDEWEB)

    Amante, J.

    2012-07-01

    The Cenit-e Ocean Lider project is an ambitious R+D technological initiative promoted by a consortium of companies with a strong research capability which addresses the challenge of developing the necessary technologies to set up integrated large scale installations that can harness energies of marine renewable sources, such as waves, tidal currents and wind. Ocean Lider developed knowledge and technologies would provide some new power plant concepts, devices, structures, data acquisition and site characterization systems, vessels, etc. In this way, some new technologies for harnessing ocean energy generation, distribution and transmission would be developed and sized according to a large scale scheme, to make this hybrid harvest (wave, current and wind) as profitable as possible. (Author)

  3. Modular antenna of photosystem I in secondary plastids of red algal origin: a Nannochloropsis oceanica case study

    Czech Academy of Sciences Publication Activity Database

    Bína, David; Gardian, Zdenko; Herbstová, Miroslava; Litvín, Radek

    2017-01-01

    Roč. 131, č. 3 (2017), s. 255-266 ISSN 0166-8595 R&D Projects: GA ČR(CZ) GP14-01377P Institutional support: RVO:60077344 Keywords : light-harvesting complexes * diatom phaeodactylum-tricornutum * em structure determination Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.864, year: 2016

  4. Experimental assessment and modeling evaluation of the effects of seagrass Posidonia oceanica on flow and particle trapping

    NARCIS (Netherlands)

    Hendriks, I.E.; Sintes, T.; Bouma, T.J.; Duarte, C.M.

    2008-01-01

    Retention of particles in seagrass canopies is usually attributed to only the indirect, attenuating effects canopies have on flow, turbulence and wave action, promoting sedimentation and reducing resuspension within seagrass meadows. Yet recent evidence suggests that seagrasses are also able to

  5. Utilisation de Posidonia oceanica (L.) Delile comme bio-indicateur de la contamination métallique

    OpenAIRE

    Lafabrie, Céline

    2007-01-01

    La zone littorale du plateau continental renferme une grande richesse écologique. Or, cette zone présente une grande fragilité vis-à-vis des xénobiotiques ; la pollution de ce milieu peut porter atteinte à la structure des biocénoses et à la productivité des écosystèmes. Les métaux sont des constituants normaux de l'environnement à l'état de traces, contrairement à de nombreux contaminants, et sont tous toxiques au dessus d'un certain seuil. A la fin des années 1970, plusieurs chercheurs prop...

  6. Anatomically and morphologically unique dark septate endophytic association in the roots of the Mediterranean endemic seagrass Posidonia oceanica

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Borovec, Ondřej; Župan, I.; Vondrášek, D.; Petrtýl, M.; Sudová, Radka

    2015-01-01

    Roč. 25, č. 8 (2015), s. 663-672 ISSN 0940-6360 R&D Projects: GA ČR GAP504/10/0781 Institutional support: RVO:67985939 Keywords : seagrasses * fungal symbioses * Mediterranean Sea Subject RIV: EF - Botanics Impact factor: 3.252, year: 2015

  7. Comparison of the Koster-Slater and the equation-of-motion method for calculation of the electronic structure of defects in compound semiconductors

    International Nuclear Information System (INIS)

    Tit, N.; Halley, J.W.

    1992-01-01

    Traditional methods of calculating the electronic structure of defects in semiconductors rely on matrix-diagonalization methods which use the unperturbed crystalline wave functions as a basis. Equation-of-motion (EOM) methods, on the other hand, give excellent results with strong disorder and many defects and make no use of the basis of unperturbed wave functions, but require self-averaging properties of the wave functions which appear superficially to make them unsuitable for study of local properties. We show here that EOM methods are better than traditional methods for calculating the electronic structure of essentially any finite-range impurity potential. The reason is basically that the numerical cost of the traditional Green's-function methods grows approximately as R 7 o/Iper sitet/P, where R is the range of the potential, whereas the cost of the EOM methods per site is independent of the range of the potential. Our detailed calculations on a model of an oxygen vacancy in rutile TiO 2 show that a crossover occurs very soon, so that equation-of-motion methods are better than the traditional ones in the case of potentials of realistic range

  8. Self-consistent embedded-cluster calculations of the electronic structure of alkaline earth fluorides in the Hartree-Fock-Slater approximation

    International Nuclear Information System (INIS)

    Amaral, N.C.; Maffeo, B.; Guenzburger, D.J.R.

    1982-01-01

    Molecular orbitals calculations were performed for clusters representing the CaF 2 , SrF 2 and BaF 2 ionic crystals. The discrete variational method was employed, with the Xα approximation for the exchange interaction; a detailed investigation of different models for embedding the clusters in the solids led to a realistic description of the effect of neighbour ions in the infinite crystal. The results obtained were used to interpret optical and photoelectron data reported in the literature. In the case of CaF 2 , comparisons were made with existing band structure calculations. (Author) [pt

  9. Blowout heroes : while his crew mate risked fire and falling rock to save him, Curly Slater fought right to the last breath

    Energy Technology Data Exchange (ETDEWEB)

    Louie, J.

    2008-11-15

    This article discussed a blow-out that resulted in a fatality at a drilling rig near Helmut, British Columbia (BC). The blowout caused a column of fire, drilling mud, and rock to explode from the floor of the rig. As the rig's derrickman was trapped when drilling mud caked onto his easy rider cable and froze the escape sliding mechanism. The derrickman fell and was left dangling by his harness. Crew members spotted him from a distance and returned to the site in order to unhook the easy rider cable from the manifold shack and move the steel line to a location that would allow him to descend more easily. The derrickman was unable to un-jam his fall arrestor. He freed himself using his own strength, seized a cable, but lost his grip while still 75 feet in the air and fell to his death. The tragedy was caused by the presence of a very large gas pocket encountered at an unusually shallow depth. Several of the crew members have been unable to continue working in the oil and gas industry, due to the psychological trauma of witnessing the man's death. The Canadian Association of Oilwell Drilling Contractors (CAODC) has issued awards of merit for the crew men who attempted to save the derrickman, and the entire crew will receive medals of bravery from the Governor General of Canada. 2 figs.

  10. Observation of a Slater-type metal-to-insulator transition in Sr$_2$IrO$_4$ from time-resolved photo-carrier dynamics

    OpenAIRE

    Hsieh, D.; Mahmood, F.; Torchinsky, D. H.; Cao, G.; Gedik, N.

    2012-01-01

    We perform a time-resolved optical study of Sr$_2$IrO$_4$ to understand the influence of magnetic ordering on the low energy electronic structure of a strongly spin-orbit coupled $J_{eff}$=1/2 Mott insulator. By studying the recovery dynamics of photo-carriers excited across the Mott gap, we find that upon cooling through the N\\'{e}el temperature $T_N$ the system evolves continuously from a metal-like phase with fast ($\\sim$50 fs) and excitation density independent relaxation dynamics to a ga...

  11. Communities of cultivable root mycobionts of the seagrass Posidonia oceanica in the northwest Mediterranean Sea are dominated by a hitherto undescribed pleosporalean dark septate endophyte

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Borovec, Ondřej; Kolařík, Miroslav

    2016-01-01

    Roč. 71, č. 2 (2016), s. 442-451 ISSN 0095-3628 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : seagrasses * fungal symbioses * Mediterranean Sea Subject RIV: EH - Ecology, Behaviour; EE - Microbiology, Virology (MBU-M) Impact factor: 3.630, year: 2016

  12. Seasonal variation in fishery diversity of some wetlands of the Salcete Taluka, Goa, India

    Digital Repository Service at National Institute of Oceanography (India)

    Fernandes, B.; Achuthankutty, C.T.

    (SAC), Ahmedabad to Dept. of Ocean Development (DoD), New Delhi No. SAC/RESA/MWRD/DoD- COS/SN/17/98. 2 Noronha Ligia & Nairy K S, 2003. Changing uses, ecosystem valuation and perceptions: the case of Khazans in Goa, In Coastal tourism, environment...

  13. Nutrient Loading Fosters Seagrass Productivity Under Ocean Acidification

    OpenAIRE

    Ravaglioli, Chiara; Lauritano, Chiara; Buia, Maria Cristina; Balestri, Elena; Capocchi, Antonella; Fontanini, Debora; Pardi, Giuseppina; Tamburello, Laura; Procaccini, Gabriele; Bulleri, Fabio

    2017-01-01

    The effects of climate change are likely to be dependent on local settings. Nonetheless, the compounded effects of global and regional stressors remain poorly understood. Here, we used CO2 vents to assess how the effects of ocean acidification on the seagrass, Posidonia oceanica, and the associated epiphytic community can be modified by enhanced nutrient loading. P. oceanica at ambient and low pH sites was exposed to three nutrient levels for 16 months. The response of P. oceanica to experime...

  14. Araxa Group in the type-area: A fragment of Neoproterozoic oceanic crust in the Brasilia Fold Belt; Grupo Araxa em sua area tipo: um fragmento de crosta oceanica Neoproterozoica na faixa de dobramentos Brasilia

    Energy Technology Data Exchange (ETDEWEB)

    Seer, Hildor Jose [Centro Federal de Educacao Tecnologica de Araxa, (CEFET), MG (Brazil); Brod, Jose Affonso; Fuck, Reinhardt Adolfo; Pimentel, Marcio Martins; Boaventura, Geraldo Resende; Dardenne, Marcel Auguste [Brasilia Univ., DF (Brazil). Inst. de Geociencias

    2001-09-01

    This study reviews the geological characteristics and puts forward a new evolution model for the Araxa Group in its type-area, the southern segment of the Neo proterozoic Brasilia Belt, Minas Gerais, Brazil. The Araxa Group is confined within a thrust sheet belonging to a syn formal regional fold, the Araxa Syn form, overlying two other thrust sheets made of the Ibia and Canastra Groups. The Araxa Group is described as a tectono stratigraphic terrane in the sense of Howell (1993). It comprises an igneous mafic sequence, with fine and coarse grained amphibolites, associated with pelitic meta sedimentary rocks, and subordinate psanmites. All rocks were metamorphosed to amphibolite facies at ca. 630 Ma ago and were intruded by collisional granites. The amphibolites represent original basaltic and gabbroic rocks, with minor ultramafic (serpentinite/ amphibole-talc schist). The basalts are similar to high Fe O tholeiites, with REE signatures that resemble E-MORB and {epsilon}{sub Nd(T)} =+ 1.1. The meta sedimentary rocks are interpreted as the result of a marine deep-water sedimentation. They have Sm-Nd model ages of 1,9 Ga, and {epsilon}{sub Nd(T)} = -10.21. The amphibolites and metasediments could represent a fragment of back-arc oceanic crust. The data presented here differ significantly from the original definition of Barbosa et al. (1970) who describe the Araxa Group as a pelitic/psanmitic sequence and the collisional granites as a basement complex. (author)

  15. The NE Rift of Tenerife: towards a model on the origin and evolution of ocean island rifts; La dorsal NE de Tenerife: hacia un modelo del origen y evolucion de los rifts de islas oceanicas

    Energy Technology Data Exchange (ETDEWEB)

    Carracedo, J. C.; Guillou, H.; Rodriguez Badiola, E.; Perez-Torrado, F. J.; Rodriguez Gonzalez, A.; Peris, R.; Troll, V.; Wiesmaier, S.; Delcamp, A.; Fernandez-Turiel, J. L.

    2009-07-01

    The NE Rift of Tenerife is an excellent example of a persistent, recurrent rift, providing important evidence of the origin and dynamics of these major volcanic features. The rift developed in three successive, intense and relatively short eruptive stages (a few hundred ka), separated by longer periods of quiescence or reduced activity: A Miocene stage (7266 {+-}156 ka), apparently extending the central Miocene shield of Tenerife towards the Anaga massif; an Upper Pliocene stage (2710{+-} 58 ka) and the latest stage, with the main eruptive phase in the Pleistocene. Detailed geological (GIS) mapping, geomagnetic reversal mapping and stratigraphic correlation, and radioisotopic (K/Ar) dating of volcanic formations allowed the reconstruction of the latest period of rift activity. In the early phases of this stage the majority of the eruptions grouped tightly along the axis of the rift and show reverse polarity (corresponding to the Matuyama chron). Dykes are of normal and reverse polarities. In the final phase of activity, eruptions are more disperse and lavas and dykes are consistently of normal polarity (Brunhes chron). Volcanic units of normal polarity crossed by dykes of normal and reverse polarities yield ages apparently compatible with normal subchrons (M-B Precursor and Jaramillo) in the Upper Matuyama chron. Three lateral collapses successively mass-wasted the rift: The Micheque collapse, completely concealed by subsequent nested volcanism, and the Guimar and La Orotava collapses, that are only partially filled. Time occurrence of collapses in the NE rift apparently coincides with glacial stages, suggesting that giant landslides may be finally triggered by sea level chan-ges during glaciations. Pre-collapse and nested volcanism is predominantly basaltic, except in the Micheque collapse, where magmas evolved towards intermediate and felsic (trachytic) compositions. Rifts in the Canary Islands are long-lasting, recurrent features, probably related to primordial, plume-related fractures acting throughout the entire growth of the islands. Basaltic volcanism forms the bulk of the islands and rift zones. However, collapses of the flanks of the rifts disrupt their established fissural feeding system, frequently favouring magma accumulation and residence at shallow emplacements, leading to differentiation of magmas, and intermediate to felsic nested eruptions. Rifts and their collapse may therefore act as an important factor in providing petrological variability to oceanic volcanoes. Conversely, the possibility exists that the presence of important felsic volcanism may indicate lateral collapses in oceanic shields and ridge-like volcanoes, even if they are concealed by post-collapse volcanism or partially mass-wasted by erosion. (Author) 76 refs.

  16. Seagrass as major source of transparent exopolymer particles in the oligotrophic Mediterranean coast

    KAUST Repository

    Iuculano, Francesca; Duarte, Carlos M.; Marbà , Nú ria; Agusti, Susana

    2017-01-01

    rates of TEP production by P. oceanica litter, allowing calculations of the associated TEP yield. We demonstrated that P. oceanica is an important source of TEP to the Mediterranean Sea, contributing an estimated 0.10 Tg C as TEP annually. TEP release

  17. Reduced resilience of a globally distributed coccolithophore to ocean acidification: Confirmed up to 2000 generations

    KAUST Repository

    Jin, Peng; Gao, Kunshan

    2015-01-01

    been poorly studied. Here we examined the coccolithophore Gephyrocapsa oceanica, while growing it for 2000 generations under ambient and elevated CO2 levels. While OA stimulated growth in the earlier selection period (from generations ~700 to ~1550

  18. Reduced resilience of a globally distributed coccolithophore to ocean acidification: Confirmed up to 2000 generations, supplement to: Jin, Peng; Gao, Kunshan (2016): Reduced resilience of a globally distributed coccolithophore to ocean acidification: Confirmed up to 2000 generations. Marine Pollution Bulletin, 103(1-2), 101-108

    KAUST Repository

    Jin, Peng; Gao, Kunshan

    2016-01-01

    . Here we examined the coccolithophore Gephyrocapsa oceanica, while growing it for 2000 generations under ambient and elevated CO2 levels. While OA stimulated growth in the earlier selection period (from generations 700 to 1550), it reduced

  19. Carbon and nitrogen translocation between seagrass ramets

    NARCIS (Netherlands)

    Marbà, N.; Hemminga, M.A.; Mateo, M.A.; Duarte, C.M.; Maas, Y.E.M.; Terrados, J.; Gacia, E.

    2002-01-01

    The spatial scale and the magnitude of carbon and nitrogen translocation was examined in 5 tropical (Cymodocea serrulata, Halophila stipulacea, Halodule uninervis, Thalassodendron ciliatum, Thalassia hemprichii) and 3 temperate (Cymodocea nodosa, Posidonia oceanica, Zostera noltii) seagrass species

  20. Generator coordinate representation of the time independent mean field theory of collisions

    International Nuclear Information System (INIS)

    Giraud, B.G.; Lemm, J.; Weiguny, A.; Wierling, A.

    1991-01-01

    We show how matrix elements of the T-matrix can be easily estimated on a basis of Slater determinants, with a mean field approximation. Linear superpositions of these Slater determinants then generate plane waves, or distorted (Coulomb) waves. This provides physical matrix elements of T

  1. Geography and Powerful Knowledge: A Contribution to the Debate

    Science.gov (United States)

    Maude, Alaric

    2018-01-01

    This paper is a contribution to the debate on powerful knowledge in geography that began in a 2015 issue of IRGEE and was continued by Frances Slater and Norman Graves in 2016. It addresses some of the questions raised by Slater and Graves. First, it suggests an alternative way of describing and identifying powerful knowledge than the one in their…

  2. Vulnerability of marine habitats to the invasive green alga Caulerpa racemosa var. cylindracea within a marine protected area.

    Science.gov (United States)

    Katsanevakis, Stelios; Issaris, Yiannis; Poursanidis, Dimitris; Thessalou-Legaki, Maria

    2010-08-01

    The relative vulnerability of various habitat types to Caulerpa racemosa var. cylindracea invasion was investigated in the National Marine Park of Zakynthos (Ionian Sea, Greece). The density of C. racemosa fronds was modelled with generalized additive models for location, scale and shape (GAMLSS), based on an information theory approach. The species was present in as much as 33% of 748 randomly placed quadrats, which documents its aggressive establishment in the area. The probability of presence of the alga within randomly placed 20 x 20 cm quadrats was 83% on 'matte morte' (zones of fibrous remnants of a former Posidonia oceanica bed), 69% on rocky bottoms, 86% along the margins of P. oceanica meadows, 10% on sandy/muddy substrates, and 6% within P. oceanica meadows. The high frond density on 'matte morte' and rocky bottoms indicates their high vulnerability. The lowest frond density was observed within P. oceanica meadows. However, on the margins of P. oceanica meadows and within gaps in fragmented meadows relative high C. racemosa densities were observed. Such gaps within meadows represent spots of high vulnerability to C. racemosa invasion.

  3. Program package for calculating matrix elements of two-cluster structures in nuclei

    International Nuclear Information System (INIS)

    Krivec, R.; Mihailovic, M.V.; Kernforschungszentrum Karlsruhe G.m.b.H.

    1982-01-01

    Matrix elements of operators between Slater determinants of two-cluster structures must be expanded into partial waves for the purpose of angular momentum projection. The expansion coefficients contain integrals over the spherical angles theta and phi. (orig.)

  4. Tucker Tensor analysis of Matern functions in spatial statistics

    KAUST Repository

    Litvinenko, Alexander; Keyes, David E.; Khoromskaia, Venera; Khoromskij, Boris N.; Matthies, Hermann G.

    2018-01-01

    in a low-rank tensor format. We apply the Tucker and canonical tensor decompositions to a family of Matern- and Slater-type functions with varying parameters and demonstrate numerically that their approximations exhibit exponentially fast convergence

  5. Kritické zhodnocení psychoanalytických přístupů k řeckému náboženství

    OpenAIRE

    Maľová, Anna

    2011-01-01

    Two psychoanalytic interpretations are subjected to scrutiny in this thesis. Richard Caldwell, the author of the first interpretation, presents psychoanalytic interpretation of Greek theogonic myths in his book The Origin of the Gods. The Greek family and its influence on Greek myths is subject of the second interpretation presented in the work The Glory of Hera by Philip E. Slater. While Caldwell prefers classical psychoana- lysis Slater is interested in specific schema of the Greek family w...

  6. The detrimental consequences for seagrass of ineffective marine park management related to boat anchoring.

    Science.gov (United States)

    La Manna, G; Donno, Y; Sarà, G; Ceccherelli, G

    2015-01-15

    Posidonia oceanica (L.) Delile meadows are recognized as priority habitat for conservation by the EU Habitats Directive. The La Maddalena Archipelago National Park (Mediterranean Sea) P. oceanica meadow, the dominant coastal habitat of the area, is mostly threatened by boat anchoring. 12 years after the establishment of mooring fields and anchoring restrictions, a study was conducted to measure their effectiveness on the conservation of seagrass and the mitigation of anchoring damage. We found that: (i) the condition of P. oceanica was disturbed, both in the mooring fields and in control locations; (ii) mooring fields and anchoring restrictions did not show to be an efficient system for the protection of seagrass, in fact anchor scars increased after the tourist season; (iii) the mooring systems had an impact on the surrounding area of the meadow, probably due to their misuse. On the basis of these results, management recommendations for marine parks are proposed. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Retention of lignin in seagrasses: angiosperms that returned to the sea

    NARCIS (Netherlands)

    Klap, V.A.; Hemminga, M.A.; Boon, J.J.

    2000-01-01

    Using Curie-point Pyrolysis Gas Chromatography Mass Spectrometry (Py-GCMS) and Direct Temperature-resolved Mass Spectrometry (DT-MS), lignin was detected in highly purified preparations (Milled Wood Lignin = MWL) of various tissues of the seagrasses Zostera marina and Posidonia oceanica. The results

  8. The Potential of Microalgae Lipids for Edible Oil Production.

    Science.gov (United States)

    Huang, Yanfei; Zhang, Dongmei; Xue, Shengzhang; Wang, Meng; Cong, Wei

    2016-10-01

    The objective of this study was to evaluate the potential of oil-rich green algae, Chlorella vulgaris, Scenedesmus obliquus, and Nannochloropsis oceanica, to produce edible oil with respect to lipid and residue properties. The results showed that C. vulgaris and N. oceanica had similarly much higher lipid recovery (about 50 %) in hexane extraction than that of S. obliquus (about 25 %), and C. vulgaris had the highest content of neutral lipids among the three algae. The fatty acid compositions of neutral lipids from C. vulgaris and S. obliquus were mainly C16 and C18, resembling that of vegetable oils. ARA and EPA were the specific valuable fatty acids in lipids of N. oceanica, but the content of which was lower in neutral lipids. Phytol was identified as the major unsaponifiable component in lipids of the three algae. Combined with the evaluation of the ratios in SFA/MUFA/PUFA, (n-6):(n-3) and content of free fatty acids, lipids obtained from C. vulgaris displayed the great potential for edible oil production. Lipids of N. oceanica showed the highest antioxidant activity, and its residue contained the largest amounts of protein as well as the amino acid compositions were greatly beneficial to the health of human beings.

  9. Seagrass as major source of transparent exopolymer particles in the oligotrophic Mediterranean coast

    KAUST Repository

    Iuculano, Francesca

    2017-01-09

    The role of seagrass, Posidonia oceanica, meadows as a source of transparent exopolymer particles (TEP) to Mediterranean coastal waters was tested by comparing the TEP dynamics in two adjacent coastal waters in the oligotrophic NW Mediterranean Sea, one characterized by oligotrophic open-sea waters and the other accumulating seagrass leaf litter, together with an experimental examination of TEP release by seagrass litter. TEP concentrations ranged from 4.6 µg XG Eq L−1 to 90.6 µg XG Eq L−1, with mean (±SE) values of 38.7 (±2.02) µg XG Eq L−1 in the site devoid of seagrass litter, whereas the coastal beach site accumulating leaf litter had > 10-fold mean TEP concentrations of 487.02 (±72.8) µg XG Eq L−1 . Experimental evaluation confirmed high rates of TEP production by P. oceanica litter, allowing calculations of the associated TEP yield. We demonstrated that P. oceanica is an important source of TEP to the Mediterranean Sea, contributing an estimated 0.10 Tg C as TEP annually. TEP release by P. oceanica seagrass explains the elevated TEP concentration relative to the low chlorophyll a concentration in the Mediterranean Sea.

  10. Whole-system metabolism and CO2 fluxes in a Mediterranean Bay dominated by seagrass beds (Palma Bay, NW Mediterranean)

    NARCIS (Netherlands)

    Gazeau, F.P.H.; Duarte, C.M.; Gattuso, J.P.; Barrón, C.; Navarro, N.; Ruiz, S.; Prairie, Y.T.; Calleja, M.; Delille, B.; Frankignoulle, M.; Borges, A.V.

    2005-01-01

    Planktonic and benthic incubations (bare and Posidonia oceanica vegetated sediments) were performed at monthly intervals from March 2001 to October 2002 in a seagrass vegetated area of the Bay of Palma (Mallorca, Spain). Results showed a contrast between the planktonic compartment, which was on

  11. Physiological and molecular evidence of differential short-term heat tolerance in Mediterranean seagrasses.

    Science.gov (United States)

    Marín-Guirao, Lazaro; Ruiz, Juan M; Dattolo, Emanuela; Garcia-Munoz, Rocio; Procaccini, Gabriele

    2016-06-27

    The increase in extreme heat events associated to global warming threatens seagrass ecosystems, likely by affecting key plant physiological processes such as photosynthesis and respiration. Understanding species' ability to acclimate to warming is crucial to better predict their future trends. Here, we study tolerance to warming in two key Mediterranean seagrasses, Posidonia oceanica and Cymodocea nodosa. Stress responses of shallow and deep plants were followed during and after short-term heat exposure in mesocosms by coupling photo-physiological measures with analysis of expression of photosynthesis and stress-related genes. Contrasting tolerance and capacity to heat acclimation were shown by shallow and deep P. oceanica ecotypes. While shallow plants acclimated through respiratory homeostasis and activation of photo-protective mechanisms, deep ones experienced photosynthetic injury and impaired carbon balance. This suggests that P. oceanica ecotypes are thermally adapted to local conditions and that Mediterranean warming will likely diversely affect deep and shallow meadow stands. On the other hand, contrasting mechanisms of heat-acclimation were adopted by the two species. P. oceanica regulates photosynthesis and respiration at the level of control plants while C. nodosa balances both processes at enhanced rates. These acclimation discrepancies are discussed in relation to inherent attributes of the two species.

  12. Physiological and molecular evidence of differential short-term heat tolerance in Mediterranean seagrasses

    Science.gov (United States)

    Marín-Guirao, Lazaro; Ruiz, Juan M.; Dattolo, Emanuela; Garcia-Munoz, Rocio; Procaccini, Gabriele

    2016-06-01

    The increase in extreme heat events associated to global warming threatens seagrass ecosystems, likely by affecting key plant physiological processes such as photosynthesis and respiration. Understanding species’ ability to acclimate to warming is crucial to better predict their future trends. Here, we study tolerance to warming in two key Mediterranean seagrasses, Posidonia oceanica and Cymodocea nodosa. Stress responses of shallow and deep plants were followed during and after short-term heat exposure in mesocosms by coupling photo-physiological measures with analysis of expression of photosynthesis and stress-related genes. Contrasting tolerance and capacity to heat acclimation were shown by shallow and deep P. oceanica ecotypes. While shallow plants acclimated through respiratory homeostasis and activation of photo-protective mechanisms, deep ones experienced photosynthetic injury and impaired carbon balance. This suggests that P. oceanica ecotypes are thermally adapted to local conditions and that Mediterranean warming will likely diversely affect deep and shallow meadow stands. On the other hand, contrasting mechanisms of heat-acclimation were adopted by the two species. P. oceanica regulates photosynthesis and respiration at the level of control plants while C. nodosa balances both processes at enhanced rates. These acclimation discrepancies are discussed in relation to inherent attributes of the two species.

  13. Volume and surface photoemission from tungsten. I. Calculation of band structure and emission spectra

    DEFF Research Database (Denmark)

    Christensen, N. Egede; Feuerbacher, B.

    1974-01-01

    is obtained from an ad hoc potential based on a Dirac-Slater atomic calculation for the ground-state configuration and with full Slater exchange in the atomic as well as in the crystal potential. The selection of this best potential is justified by comparing the calculated band structure to Fermi...... of states. The present work includes a crude estimate of this surface density of states, which is derived from the bulk band structure by narrowing the d bands according to an effective number of neighbors per surface atom. Estimates of surface relaxation effects are also included.......The electronic energy-band structure of tungsten has been calculated by means of the relativistic-augmented-plane-wave method. A series of mutually related potentials are constructed by varying the electronic configuration and the amount of Slater exchange included. The best band structure...

  14. Difundindo saberes da vigilância sanitária

    Directory of Open Access Journals (Sweden)

    André Luís Gemal

    2013-05-01

    Full Text Available É com enorme prazer que anunciamos o segundo número da revista Vigilância Sanitária em Debate: Sociedade, Ciência & Tecnologia. Nesta edição contamos com valiosas contribuições autorais, ao mesmo tempo em que inauguramos a seção de resenhas, com a descrição crítica do livro Sistemas de Salud en Suramérica: desafios para la universalidad, la integralidad y la equidad (2012, elaborado pelo Instituto Suramericano de Gobierno en Salud (Isags/Unasur e organizado por Ligia Giovanella, Oscar Feo, Mariana Faria e Sebastián Tobar.

  15. Arthropod gut symbionts from the Balearic Islands: Majorca and Cabrera. Diversity and biogeography

    Directory of Open Access Journals (Sweden)

    Guàrdia Valle, Laia

    2009-12-01

    Full Text Available This study includes a catalogue with all the current data concerning the presence of trichomycetes (sensu lato in Majorca and Cabrera, as well as information on the biology, ecology and biogeographic implications of the insularity for each taxon of these arthropod-gut symbionts. Of the 13 species here reported, 10 are new for the Balearic Islands, including 4 Mesomycetozoan, of which 3 Eccrinales (Astreptonema gammari, Eccrinidus flexilis, Parataeniella dilatata, 1 Amoebidiales (Paramoebidium curvum and 6 kixckellomycotina Harpellales (Genistellospora homothallica, Harpella melusinae, Smittium culisetae, S. simulii, Stachylina grandispora and St. nana; the additional 3 were previously reported elsewhere: Asellaria ligiae (Aslleariales, Legeriomyces rarus and Stipella vigilans (Harpellales, but are here included as indissoluble part of the present Balearic catalogue. All taxa are commented, illustrated and their biogeographic implications are discussed.

    El presente estudio incluye una recopilación de todos los datos concernientes al conocimiento de los tricomicetos (sensu lato en las islas Baleares de Mallorca y Cabrera, incluyendo un catálogo de especies y notas sobre la biología, ecología e implicaciones biogeográficas de su insularidad. De las 13 especies citadas, 10 son nuevas para las Baleares, incluyendo 4 Mesomycetozoos, de los cuales 3 Eccrinales (Astreptonema gammari, Eccrinidus flexilis, Parataeniella dilatata, 1 Amoebidiales (Paramoebidium curvum y 6 Harpellales (kixckellomycotina (Genistellospora homothallica, Harpella melusinae, Smittium culisetae, S. simulii, Stachylina grandispora y St. nana; aunque las 3 especies restantes: Asellaria ligiae (Aslleariales, Legeriomyces rarus y Stipella vigilans (Harpellales fueron citadas anteriormente, se incluyen aquí brevemente como parte del catálogo.

  16. Itinerant Ferromagnetism in Ultracold Fermi Gases

    DEFF Research Database (Denmark)

    Heiselberg, Henning

    2012-01-01

    Itinerant ferromagnetism in cold Fermi gases with repulsive interactions is studied applying the Jastrow-Slater approximation generalized to finite polarization and temperature. For two components at zero temperature a second order transition is found at akF ≃ 0.90 compatible with QMC. Thermodyna......Itinerant ferromagnetism in cold Fermi gases with repulsive interactions is studied applying the Jastrow-Slater approximation generalized to finite polarization and temperature. For two components at zero temperature a second order transition is found at akF ≃ 0.90 compatible with QMC...

  17. Angular distribution of Auger electrons due to 3d-shell ionization of krypton

    Science.gov (United States)

    Omidvar, K.

    1977-01-01

    Cross sections for electron impact ionization of krypton due to ejection of a 3rd shell electron have been calculated using screened hydrogenic and Hartree-Slater wave functions for target atom. While the total ionization cross sections in the two approximations are within 10% of each other, the Auger electron angular distribution, related to cross sections for specific magnetic quantum numbers of the 3rd electrons, is widely different in the two approximations. The angular distribution due to Hartree-Slater approximation is in excellent agreement with measurement. The physical reason for the discrepancies in the two approximations is explained.

  18. Angular distribution of Auger electrons due to 3d-shell impact ionization of krypton

    Science.gov (United States)

    Omidvar, K.

    1977-01-01

    Cross sections for electron impact ionization of krypton due to ejection of a 3d-shell electron have been calculated using screened hydrogenic and Hartree-Slater wavefunctions for the target atom. While the total ionization cross sections in the two approximations are within 10% of each other, the Auger electron angular distribution, related to cross sections for specific magnetic quantum numbers of the 3d electrons, are widely different in the two approximations. The angular distribution due to the Hartree-Slater approximation is in excellent agreement with measurement. The physical reason for the discrepancies in the two approximations is explained.

  19. Birth order in a contemporary sample of gay men.

    Science.gov (United States)

    Purcell, D W; Blanchard, R; Zucker, K J

    2000-08-01

    The birth order of a contemporary North American sample of 97 gay men was quantified using Slater's Index. For the 84 probands with at least one sibling, the results showed a late mean birth order compared with the expected value of .50. Additional birth order indices derived from Slater's Index suggested that the mean later birth order was accounted for more strongly by the proband's number of older brothers than by his number of older sisters. The present findings constitute a replication of a series of recent studies and add to the growing body of evidence that birth order is a reliable correlate of sexual orientation in males.

  20. Macro-grazer herbivory regulates seagrass response to pulse and press nutrient loading.

    Science.gov (United States)

    Ravaglioli, Chiara; Capocchi, Antonella; Fontanini, Debora; Mori, Giovanna; Nuccio, Caterina; Bulleri, Fabio

    2018-05-01

    Coastal ecosystems are exposed to multiple stressors. Predicting their outcomes is complicated by variations in their temporal regimes. Here, by means of a 16-month experiment, we investigated tolerance and resistance traits of Posidonia oceanica to herbivore damage under different regimes of nutrient loading. Chronic and pulse nutrient supply were combined with simulated fish herbivory, treated as a pulse stressor. At ambient nutrient levels, P. oceanica could cope with severe herbivory, likely through an increase in photosynthetic activity. Elevated nutrient levels, regardless of the temporal regime, negatively affected plant growth and increased leaf nutritional quality. This ultimately resulted in a reduction of plant biomass that was particularly severe under chronic fertilization. Our results suggest that both chronic and pulse nutrient loadings increase plant palatability to macro-grazers. Strategies for seagrass management should not be exclusively applied in areas exposed to chronic fertilization since even short-term nutrient pulses could alter seagrass meadows. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Complete genome sequence of Marinomonas posidonica type strain (IVIA-Po-181T)

    Energy Technology Data Exchange (ETDEWEB)

    Lucas-Elio, Patricia [University of Murcia, Murcia, Spain; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Detter, J C [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Lu, Megan [Los Alamos National Laboratory (LANL); Bruce, David [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Johnston, Andrew W. B. [University of East Anglia, Norwich, United Kingdom; Sanchez-Amat, Antonio [University of Murcia, Murcia, Spain

    2012-01-01

    Marinomonas posidonica IVIA-Po-181T Lucas-Eli o et al. 2011 belongs to the family Oceanospirillaceae within the phylum Proteobacteria. Different species of the genus Marinomonas can be readily isolated from the seagrass Posidonia oceanica. M. posidonica is among the most abundant species of the genus detected in the cultured microbiota of P. oceanica, suggesting a close relationship with this plant, which has a great ecological value in the Mediterranean Sea, covering an estimated surface of 38,000 Km2. Here we describe the genomic features of M. posidonica. The 3,899,940 bp long genome harbors 3,544 pro- tein-coding genes and 107 RNA genes and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  2. Epiphytic bryozoans on Neptune grass - a sample-based data set.

    Science.gov (United States)

    Lepoint, Gilles; Heughebaert, André; Michel, Loïc N

    2016-01-01

    The seagrass Posidonia oceanica L. Delile, commonly known as Neptune grass, is an endemic species of the Mediterranean Sea. It hosts a distinctive and diverse epiphytic community, dominated by various macroalgal and animal organisms. Mediterranean bryozoans have been extensively studied but quantitative data assessing temporal and spatial variability have rarely been documented. In Lepoint et al. (2014a, b) occurrence and abundance data of epiphytic bryozoan communities on leaves of Posidonia oceanica inhabiting Revellata Bay (Corsica, Mediterranean Sea) were reported and trophic ecology of Electra posidoniae Gautier assessed. Here, metadata information is provided on the data set discussed in Lepoint et al. (2014a) and published on the GBIF portal as a sampling-event data set: http://ipt.biodiversity.be/resource?r=ulg_bryozoa&v=1.0). The data set is enriched by data concerning species settled on Posidonia scales (dead petiole of Posidonia leaves, remaining after limb abscission).

  3. On the electron to proton mass ratio and the proton structure

    DEFF Research Database (Denmark)

    Trinhammer, Ole L.

    2013-01-01

    We derive an expression for the electron to nucleon mass ratio from a reinterpreted lattice gauge theory Hamiltonian to describe interior baryon dynamics. We use the classical electron radius as our fundamental length scale. Based on expansions on trigonometric Slater determinants for a neutral s...... and d valence quarks of the proton....

  4. 76 FR 34964 - Stainless Steel Bar From India: Partial Rescission of Antidumping Duty Administrative Review

    Science.gov (United States)

    2011-06-15

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-533-810] Stainless Steel Bar From... the antidumping duty order on stainless steel bar from India for the period of review February 1, 2010....; Outokumpu Stainless Bar, Inc.; Universal Stainless & Alloy Products, Inc.; and Valbruna Slater Stainless...

  5. Come on Higher Ed...Get with the Programme! A Study of Market Orientation in International Student Recruitment

    Science.gov (United States)

    Ross, Mitchell; Grace, Debra; Shao, Wei

    2013-01-01

    This paper investigates higher education (HE) student recruitment practices from the standpoint of market orientation. By adopting the well-established market orientation framework of Narver and Slater [1990, The effect of a market orientation on a business profitability. "Journal of Marketing" 54, no. 4: 20-35], we examine the extent to…

  6. Alternative basis for the theory of complex spectra II

    International Nuclear Information System (INIS)

    Harter, W.G.; Patterson, C.W.

    1975-01-01

    The atomic angular factor calculation methods are simplified and extended to include a treatment of spin-orbit operators and multiple shell configurations (II'...) sup(n). A tableau formula is given for the matrix between slater states and states of definite total spin

  7. 4-center STO interelectron repulsion integrals with Coulomb Sturmians

    DEFF Research Database (Denmark)

    Avery, James Emil; Avery, John Scales

    2018-01-01

    Abstract We present a method for evaluating 4-center electron repulsion integrals (ERI) for Slater-type orbitals by way of expansions in terms of Coulomb Sturmians. The ERIs can then be evaluated using our previously published methods for rapid evaluation of Coulomb Sturmians through hyperspherical...

  8. Using the Screened Coulomb Potential to Illustrate the Variational Method

    Science.gov (United States)

    Zuniga, Jose; Bastida, Adolfo; Requena, Alberto

    2012-01-01

    The screened Coulomb potential, or Yukawa potential, is used to illustrate the application of the single and linear variational methods. The trial variational functions are expressed in terms of Slater-type functions, for which the integrals needed to carry out the variational calculations are easily evaluated in closed form. The variational…

  9. Calculation of two-center one-electron molecular integrals with STOs. [BICEN

    Energy Technology Data Exchange (ETDEWEB)

    Rico, J.F.; Lopez, R.; Paniagua, M.; Ramirez, G. (Universidad Autonoma de Madrid (Spain). Dept. de Quimica Fisica y Quimica Cuantica)

    1991-05-01

    A program for the calculation of two-center one-electron integrals (overlap, nuclear attraction and kinetic energy) between real Slater-type orbitals (STOs) is reported. The integrals are obtained by recursion over simple auxiliary matrices, whose elements are calculated in terms of further auxiliary functions evaluated in a quick and accurate way. (orig.).

  10. Calculation of two-center one-electron molecular integrals with STOs

    International Nuclear Information System (INIS)

    Rico, J.F.; Lopez, R.; Paniagua, M.; Ramirez, G.

    1991-01-01

    A program for the calculation of two-center one-electron integrals (overlap, nuclear attraction and kinetic energy) between real Slater-type orbitals (STOs) is reported. The integrals are obtained by recursion over simple auxiliary matrices, whose elements are calculated in terms of further auxiliary functions evaluated in a quick and accurate way. (orig.)

  11. A Tribute to Professor Rene H. Miller - A Pioneer in Aeromechanics and Rotary Wing Flight Transportation

    Science.gov (United States)

    Friedmann, Peretz P.; Johnson, Wayne; Scully, Michael P.

    2011-01-01

    Rene H. Miller (May 19, 1916 January 28, 2003), Emeritus H. N. Slater Professor of Flight Transportation, was one of the most influential pioneers in rotary wing aeromechanics as well as a visionary whose dream was the development of a tilt-rotor based short haul air transportation system. This paper pays a long overdue tribute to his memory and to his extraordinary contributions.

  12. Engaging bodies and places online

    DEFF Research Database (Denmark)

    Jordt Jørgensen, Nanna; Rehder, Mads Middelboe

    In this paper, we suggest that embodied learning forms the backdrop for young people’s digitally mediated practices. In line with the early studies of Miller & Slater, we approach online engagements as ‘continuous with and embedded in other social spaces’, happening ‘within mundane social...

  13. DMPD: Signalling pathways mediating type I interferon gene expression. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17904888 Signalling pathways mediating type I interferon gene expression. Edwards M...hways mediating type I interferon gene expression. PubmedID 17904888 Title Signalling pathways...R, Slater L, Johnston SL. Microbes Infect. 2007 Sep;9(11):1245-51. Epub 2007 Jul 1. (.png) (.svg) (.html) (.csml) Show Signalling pat

  14. Electron structure of molecules with very heavy atoms using effective core potentials

    International Nuclear Information System (INIS)

    Pitzer, K.S.

    1982-01-01

    Topics covered include effective potential, Hamiltonian for valence-electron motion, molecular calculations, spin-spin coupling, L-S coupling, numerical results of molecular calculations, and results of configuration-interaction Slater-orbital calculations in L-S coupling

  15. Origins of a Stereotype: Categorization of Facial Attractiveness by 6-Month-Old Infants

    Science.gov (United States)

    Ramsey, Jennifer L.; Langlois, Judith H.; Hoss, Rebecca A.; Rubenstein, Adam J.; Griffin, Angela M.

    2004-01-01

    Like adults, young infants prefer attractive to unattractive faces (e.g. Langlois, Roggman, Casey, Ritter, Rieser-Danner & Jenkins, 1987; Slater, von der Schulenburg, Brown, Badenoch, Butterworth, Parsons & Samuels, 1998). Older children and adults stereotype based on facial attractiveness (Eagly, Ashmore, Makhijani & Longo, 1991; Langlois,…

  16. Simple formalism for efficient derivatives and multi-determinant expansions in quantum Monte Carlo

    NARCIS (Netherlands)

    Filippi, Claudia; Assaraf, R.; Moroni, S.

    2016-01-01

    We present a simple and general formalism to compute efficiently the derivatives of a multi-determinant Jastrow-Slater wave function, the local energy, the interatomic forces, and similar quantities needed in quantum Monte Carlo. Through a straightforward manipulation of matrices evaluated on the

  17. ANALYTIC FITS FOR PARTIAL PHOTOIONIZATION CROSS-SECTIONS

    NARCIS (Netherlands)

    VERNER, DA; YAKOVLEV, DG

    We present a compact, uniform and complete set of analytic fits to the partial Hartree-Dirac-Slater photoionization cross sections for the ground state shells of all atoms and ions of elements from H to Zn (Z less-than-or-equal-to 30). Comparison with experiment and theory demonstrates generally

  18. Treatment outcome of immediate, early and conventional single-tooth implants in the aesthetic zone : a systematic review to survival, bone level, soft-tissue, aesthetics and patient satisfaction

    NARCIS (Netherlands)

    den Hartog, Laurens; Huddleston Slater, James J. R.; Vissink, Arjan; Meijer, Henny J. A.; Raghoebar, Gerry M.

    2008-01-01

    den Hartog L, Huddleston Slater JJR, Vissink A, Meijer HJA, Raghoebar GM. Treatment outcome of immediate, early and conventional single-tooth implants in the aesthetic zone: a systematic review to survival, bone level, soft-tissue, aesthetics and patient satisfaction. J Clin Periodontol 2008; 35:

  19. Inner-shell corrections to the Bethe stopping-power formula evaluated from a realistic atomic model

    International Nuclear Information System (INIS)

    Inokuti, M.; Manson, S.T.

    1985-01-01

    Generalized oscillator strengths for K- and L-shell ionization have been calculated using a central potential derived from the Hartree-Slater model. In cases in which an ejected electron carries low kinetic energies, sizable differences with hydrogenic-model calculations are evident

  20. Self-consistent calculation of atomic structure for mixture

    International Nuclear Information System (INIS)

    Meng Xujun; Bai Yun; Sun Yongsheng; Zhang Jinglin; Zong Xiaoping

    2000-01-01

    Based on relativistic Hartree-Fock-Slater self-consistent average atomic model, atomic structure for mixture is studied by summing up component volumes in mixture. Algorithmic procedure for solving both the group of Thomas-Fermi equations and the self-consistent atomic structure is presented in detail, and, some numerical results are discussed

  1. Pseudo q -Engel expansions and Rogers-Ramanujan type identities ...

    African Journals Online (AJOL)

    Abstract. Andrews, Knopfmacher and Knopfmacher have used the Schur polynomials to consider the celebrated Rogers-Ramanujan identities in the context of q-Engel expansions. We extend this view using similar polynomials, provided by Sills, in the context of Slater's list of 130 Rogers-Ramanujan type identities.

  2. Atomic spectrum of plutonium

    International Nuclear Information System (INIS)

    Blaise, J.; Fred, M.; Gutmacher, R.G.

    1984-08-01

    This report contains plutonium wavelengths, energy level classifications, and other spectroscopic data accumulated over the past twenty years at Laboratoire Aime Cotton (LAC) Argonne National Laboratory (ANL), and Lawrence Livermore National Laboratory (LLNL). The primary purpose was term analysis: deriving the energy levels in terms of quantum numbers and electron configurations, and evaluating the Slater-Condon and other parameters from the levels

  3. Renovated Parks Improve Physical Activity

    Centers for Disease Control (CDC) Podcasts

    We know that children who are physically active every day are less likely to develop chronic diseases as adults, including obesity. Dr. Sandy Slater, a researcher with the University of Illinois, Chicago Prevention Research Center, discusses how a park improvement project in Chicago helped engage communities to improve areas for play and activity.

  4. Optimization of parameters for the extended Hueckel method starting from ab-initio atomic calculations

    International Nuclear Information System (INIS)

    Branda, M.M.; Ferullo, R.; Castellani, N.J.

    1990-01-01

    The application of an atomic Hartree-Fock-Slater method is exposed in the present work for the simultaneous obtainment of all parameters used in the extended Hueckel method with charge interaction (IEH): The diagonal elements of the Hamiltonian, the constants of the quadratic relation between. (Author). 16 refs., 3 tabs

  5. A note on neighborhood total domination in graphs

    Indian Academy of Sciences (India)

    [1] Arumugam S and Sivagnanam C, Neighborhood total domination in graphs, Opuscula. Mathematica 31 (2011) 519–531. [2] Chellali M and Haynes T W, A note on the total domination number of a tree, J. Combin. Math. Combin. Comput. 58 (2006) 189–193. [3] Haynes T W, Hedetniemi S T and Slater P J, Fundamentals ...

  6. Use of combined Hartree–Fock–Roothaan theory in evaluation of ...

    Indian Academy of Sciences (India)

    Keywords. Hartree–Fock–Roothaan equations; noninteger -Slater type orbitals; open shell theory; isoelectronic series. ... with those presented in the literature. The results can be useful in the study of various properties of heavy atomic systems when the combined Hartree–Fock–Roothaan approach is employed.

  7. Jazz Leader Helps a Band Take Giant Steps

    Science.gov (United States)

    Kelderman, Eric

    2008-01-01

    This article profiles Neil Slater, the longtime leader of the jazz program at the University of North Texas who encouraged both musical perfection and artistic freedom among his star pupils. Standards are high at North Texas, which has become a Camelot where aspiring jazz musicians have come to hone their skills since 1947, when it offered one of…

  8. Introduction to Density Functional Theory: Calculations by Hand on the Helium Atom

    Science.gov (United States)

    Baseden, Kyle A.; Tye, Jesse W.

    2014-01-01

    Density functional theory (DFT) is a type of electronic structure calculation that has rapidly gained popularity. In this article, we provide a step-by-step demonstration of a DFT calculation by hand on the helium atom using Slater's X-Alpha exchange functional on a single Gaussian-type orbital to represent the atomic wave function. This DFT…

  9. Ab initio calculation atomics ground state wave function for interactions Ion- Atom

    International Nuclear Information System (INIS)

    Shojaee, F.; Bolori zadeh, M. A.

    2007-01-01

    Ab initio calculation atomics ground state wave function for interactions Ion- Atom Atomic wave function expressed in a Slater - type basis obtained within Roothaan- Hartree - Fock for the ground state of the atoms He through B. The total energy is given for each atom.

  10. Parallel knock-out schemes in networks

    NARCIS (Netherlands)

    Broersma, H.J.; Fomin, F.V.; Woeginger, G.J.

    2004-01-01

    We consider parallel knock-out schemes, a procedure on graphs introduced by Lampert and Slater in 1997 in which each vertex eliminates exactly one of its neighbors in each round. We are considering cases in which after a finite number of rounds, where the minimimum number is called the parallel

  11. Eliminating graphs by means of parallel knock-out schemes

    NARCIS (Netherlands)

    Broersma, H.J.; Fomin, F.V.; Královic, R.; Woeginger, G.J.

    2007-01-01

    In 1997 Lampert and Slater introduced parallel knock-out schemes, an iterative process on graphs that goes through several rounds. In each round of this process, every vertex eliminates exactly one of its neighbors. The parallel knock-out number of a graph is the minimum number of rounds after which

  12. Eliminating graphs by means of parallel knock-out schemes

    NARCIS (Netherlands)

    Broersma, Haitze J.; Fomin, F.V.; Královič, R.; Woeginger, Gerhard

    In 1997 Lampert and Slater introduced parallel knock-out schemes, an iterative process on graphs that goes through several rounds. In each round of this process, every vertex eliminates exactly one of its neighbors. The parallel knock-out number of a graph is the minimum number of rounds after which

  13. Threshold Corrosion Fatigue of Welded Shipbuilding Steels.

    Science.gov (United States)

    1992-01-01

    8. J. C. Walter, E. Olbjorn, 0. Allstad and G. Elde, "Safety Against Corrosion Fatigue Offshore," Publication No. 94, Det Norske Ventas , Horik...Offshore. Publication No;. 94;, Det Norske Ventas , Horik, Norway, April 1976. 18. C. E. Jaske, D. Broek, J. E. Slater, W. E. Anderson. Corrosion Fatigue

  14. What a Decade of Experiments Reveals about Factors that Influence the Sense of Presence: Latest Findings

    Science.gov (United States)

    2007-05-01

    Paper presented at VII Encontro Portugues de Computacao Grafica, Eurographics, Monte de Caparica, Portugal, February. Slater, M., Usoh, M., and Steed...window? An experimental comparison of immersive and non-immersive walkthroughs. Paper presented at VII Encontro Portugues de Computacao Grafica

  15. Lattice Dynamics of Beryllium from a First-Principles Nonlocal Pseudopotential Approach

    DEFF Research Database (Denmark)

    Walter, F. King; Cutler, P. H.

    1970-01-01

    dielectric-screening function employing the Kohn-Sham approximation for exchange among the conduction electrons. The energy-wave-number characteristic F(q) is constructed from the Hartree-Fock-Slater (HFS) wave function for Be++; this is used to calculate the phonon dispersion relations in the [0001], [011̅...

  16. African Journal of Drug & Alcohol Studies, 15(1), 2016 Copyright ...

    African Journals Online (AJOL)

    Substance use is rising among young people in developing countries, especially in schools and ... verse health problems (Xie, Rehm, Single, ... use such as parental substance use, (Clark ... (Slater, 2003) poor social and emotional ... likely negative consequences of indulging ... early conduct and predisposes an indi-.

  17. Dynamics of carbon sources supporting burial in seagrass sediments under increasing anthropogenic pressure

    KAUST Repository

    Mazarrasa, Inés

    2017-03-15

    Seagrass meadows are strong coastal carbon sinks of autochthonous and allochthonous carbon. The aim of this study was to assess the effect of coastal anthropogenic pressure on the variability of carbon sources in seagrass carbon sinks during the last 150 yr. We did so by examining the composition of the sediment organic carbon (Corg) stocks by measuring the δ13Corg signature and C : N ratio in 210Pb dated sediments of 11 Posidonia oceanica seagrass meadows around the Balearic Islands (Spain, Western Mediterranean) under different levels of human pressure. On average, the top meter sediment carbon deposits were mainly (59% ± 12%) composed by P. oceanica derived carbon whereas seston contribution was generally lower (41% ± 8%). The contribution of P. oceanica to the total sediment carbon stock was the highest (∼ 80%) in the most pristine sites whereas the sestonic contribution was the highest (∼ 40–80%) in the meadows located in areas under moderate to very high human pressure. Furthermore, an increase in the contribution of sestonic carbon and a decrease in that of seagrass derived carbon toward present was observed in most of the meadows examined, coincident with the onset of the tourism industry development and coastal urbanization in the region. Our results demonstrate a general increase of total carbon accumulation rate in P. oceanica sediments during the last century, mainly driven by the increase in sestonic Corg carbon burial, which may have important implications in the long-term carbon sink capacity of the seagrass meadows in the region examined.

  18. Morphological and Phylogenetic Characterization of New Gephyrocapsa Isolates Suggests Introgressive Hybridization in the Emiliania/Gephyrocapsa Complex (Haptophyta).

    Science.gov (United States)

    Bendif, El Mahdi; Probert, Ian; Young, Jeremy R; von Dassow, Peter

    2015-07-01

    The coccolithophore genus Gephyrocapsa contains a cosmopolitan assemblage of pelagic species, including the bloom-forming Gephyrocapsa oceanica, and is closely related to the emblematic coccolithophore Emiliania huxleyi within the Noëlaerhabdaceae. These two species have been extensively studied and are well represented in culture collections, whereas cultures of other species of this family are lacking. We report on three new strains of Gephyrocapsa isolated into culture from samples from the Chilean coastal upwelling zone using a novel flow cytometric single-cell sorting technique. The strains were characterized by morphological analysis using scanning electron microscopy and phylogenetic analysis of 6 genes (nuclear 18S and 28S rDNA, plastidial 16S and tufA, and mitochondrial cox1 and cox3 genes). Morphometric features of the coccoliths indicate that these isolates are distinct from G. oceanica and best correspond to G. muellerae. Surprisingly, both plastidial and mitochondrial gene phylogenies placed these strains within the E. huxleyi clade and well separated from G. oceanica isolates, making Emiliania appear polyphyletic. The only nuclear sequence difference, 1bp in the 28S rDNA region, also grouped E. huxleyi with the new Gephyrocapsa isolates and apart from G. oceanica. Specifically, the G. muellerae morphotype strains clustered with the mitochondrial β clade of E. huxleyi, which, like G. muellerae, has been associated with cold (temperate and sub-polar) waters. Among putative evolutionary scenarios that could explain these results we discuss the possibility that E. huxleyi is not a valid taxonomic unit, or, alternatively the possibility of past hybridization and introgression between each E. huxleyi clade and older Gephyrocapsa clades. In either case, the results support the transfer of Emiliania to Gephyrocapsa. These results have important implications for relating morphological species concepts to ecological and evolutionary units of diversity

  19. Whole-system metabolism and CO2 fluxes in a Mediterranean Bay dominated by seagrass beds (Palma Bay, NW Mediterranean

    Directory of Open Access Journals (Sweden)

    F. Gazeau

    2005-01-01

    Full Text Available Planktonic and benthic incubations (bare and Posidonia oceanica vegetated sediments were performed at monthly intervals from March 2001 to October 2002 in a seagrass vegetated area of the Bay of Palma (Mallorca, Spain. Results showed a contrast between the planktonic compartment, which was on average near metabolic balance (−4.6±5.9 mmol O2 m-2 d-1 and the benthic compartment, which was autotrophic (17.6±8.5 mmol O2 m-2 d-1. During two cruises in March and June 2002, planktonic and benthic incubations were performed at several stations in the bay to estimate the whole-system metabolism and to examine its relationship with partial pressure of CO2 (pCO2 and apparent oxygen utilisation (AOU spatial patterns. Moreover, during the second cruise, when the residence time of water was long enough, net ecosystem production (NEP estimates based on incubations were compared, over the Posidonia oceanica meadow, to rates derived from dissolved inorganic carbon (DIC and oxygen (O2 mass balance budgets. These budgets provided NEP estimates in fair agreement with those derived from direct metabolic estimates based on incubated samples over the Posidonia oceanica meadow. Whereas the seagrass community was autotrophic, the excess organic carbon production therein could only balance the planktonic heterotrophy in shallow waters relative to the maximum depth of the bay (55 m. This generated a horizontal gradient from autotrophic or balanced communities in the shallow seagrass-covered areas, to strongly heterotrophic communities in deeper areas of the bay. It seems therefore that, on an annual scale in the whole bay, the organic matter production by the Posidonia oceanica may not be sufficient to fully compensate the heterotrophy of the planktonic compartment, which may require external organic carbon inputs, most likely from land.

  20. TOXICITY PROPENSITIES OF SOME MARINE AND FRESH-WATERALGAE AS THEIR CHEMICAL DEFENSE

    OpenAIRE

    ORHAN, İlkay; WISESPONGPAND, Puntip; ATICI, Tahir; ŞENER, Bilge

    2003-01-01

    Five species of the marine brown-algae, namely Halopteris scoparia (L.) Sauvagau, Padina vickersiae Hoyt, Dictyota dichotoma (Huds) Lam., Scinaia furcellata L., and Sargassum natans (L.) J. Meyer, a species of the marine green-alga, Ulva lactuca L., a species of the sea grass, Posidonia oceanica L., six species of fresh-water green-algae, namely Vaucheria sessilis (Vauch.) De Candolle, Zygnema pectinatum (Vauch.) C.A. Agardh, Maugeotia sp. (C.A. Agardh) Wittrock, Cladophora fracta (Dilw.) Kti...

  1. Progetto NERIES: analisi preliminare dei dati della prima campagna OBS nello Ionio meridionale

    OpenAIRE

    D'Anna, G.; D'Alessandro, A.; Mangano, G.; Amato, A.; Piana Agostinetti, N.; Selvaggi, G.

    2008-01-01

    La definizione di un modello crostale per l’area dello Ionio è di fondamentale importanza per la comprensione dell’evoluzione geodinamica del Mediterraneo. Anche se quasi tutti gli autori concordano nel ritenere la crosta del Mar Ionio assimilabile a una crosta oceanica matura (De Voogd et al., 1992, Catalano et al., 2001; Finetti e Del Ben, 2005; Argnani, 2005), esistono tuttavia ipotesi alternative (Farrugia and Panza, 1981; Ismail-Zadeh et al., 1998..) e rimangono da chiarir...

  2. Coccolithophores from the central Arabian Sea: Sediment trap results

    Digital Repository Service at National Institute of Oceanography (India)

    Mergulhao, L.P.; Mohan, R.; Murty, V.S.N.; Guptha, M.V.S.; Sinha, D.K.

    , Anoplosolenia braciliensisi, Calciosolenia murrayi and Oolithotus antillarum. Minor species such as Discosphaera tubifera, Syracosphaera pulchra, Umbellosphaera tenuis, Neosphaera coccolithomor- pha, Algirosphaera oryza, Michaelsarsia adriati- cus, Gladiolithus... profunda, Oolithotus antillarum) are presented (figure 2a?b). In addition to the majority of isolated coccol- iths, a few coccospheres comprising of G. oceanica, E. huxleyi, G. flabellatus, A. oryza, F. profunda, C. leptoporus were also observed...

  3. Distribution of coccolithophores as a potential proxy in paleoceanography: The case of the Oman Sea monsoonal pattern

    Directory of Open Access Journals (Sweden)

    Mojtahedin Elham

    2015-02-01

    Full Text Available High abundances of coccoliths have been observed in surface sediment samples from near the coasts of the Oman Sea in February 2011. At the end of the NE monsoon, the locally observed high Gephyrocapsa oceanica production is hypothesized to respond to local injections of nutrient-rich deep water into the surface water due to sea-surface cooling leading to convection. The most abundant coccolithophore species are G. oceanica followed by Emiliania huxleyi, Helicosphaera carteri, Calcidiscus leptoporus. Some species, such as Gephyrocapsa muellerae, Gephyrocapsa ericsonii, Umbilicosphaera sibogae, Umbellosphaera tenuis and Florisphaera profunda, are rare. The G. oceanica suggested a prevalence of upwelling conditions or high supply of nutrients in the Oman Sea (especially West Jask at the end of the NE monsoon. E. huxleyi showed low relative abundances at the end of the NE monsoon. Due to the location of the Oman Sea in low latitudes with high temperatures, we have observed low abundances of G. muellerae in the study area. Additionally, we have identified low abundances of G. ericsonii at the end of the NE monsoon. Helicosphaera carteri showed a clear negative response with decreasing amounts (relative abundances at the end of the NE monsoon. C. leptoporus, U. sibogae and U. tenuis have very low relative abundances in the NE monsoon and declined extremely at the end of the NE monsoon. F. profunda, which is known to inhabit the lower photic zone (<100 m depht was rarely observed in the samples.

  4. Distribution of coccolithophores as a potential proxy in paleoceanography: The case of the Oman Sea monsoonal pattern

    Science.gov (United States)

    Mojtahedin, Elham; Hadavi, Fatemeh; Lak, Razyeh

    2015-02-01

    High abundances of coccoliths have been observed in surface sediment samples from near the coasts of the Oman Sea in February 2011. At the end of the NE monsoon, the locally observed high Gephyrocapsa oceanica production is hypothesized to respond to local injections of nutrient-rich deep water into the surface water due to sea-surface cooling leading to convection. The most abundant coccolithophore species are G. oceanica followed by Emiliania huxleyi, Helicosphaera carteri, Calcidiscus leptoporus. Some species, such as Gephyrocapsa muellerae, Gephyrocapsa ericsonii, Umbilicosphaera sibogae, Umbellosphaera tenuis and Florisphaera profunda, are rare. The G. oceanica suggested a prevalence of upwelling conditions or high supply of nutrients in the Oman Sea (especially West Jask) at the end of the NE monsoon. E. huxleyi showed low relative abundances at the end of the NE monsoon. Due to the location of the Oman Sea in low latitudes with high temperatures, we have observed low abundances of G. muellerae in the study area. Additionally, we have identified low abundances of G. ericsonii at the end of the NE monsoon. Helicosphaera carteri showed a clear negative response with decreasing amounts (relative abundances) at the end of the NE monsoon. C. leptoporus, U. sibogae and U. tenuis have very low relative abundances in the NE monsoon and declined extremely at the end of the NE monsoon. F. profunda, which is known to inhabit the lower photic zone (<100 m depht) was rarely observed in the samples.

  5. The trace metals accumulation in marine organisms of the southeastern Adriatic coast, Montenegro

    Directory of Open Access Journals (Sweden)

    Joksimovic Danijela

    2012-01-01

    Full Text Available The concentration and accumulation of trace metals (Co, Ni, As, Cd, Pb and Hg were measured in sea water, sediments and marine organisms in the coastline of the Montenegro. The obtained results of trace metals in seagrass and mussels were compared with those found in the water column and sediment. Sampling was performed in the fall of 2005 at five locations in the Montenegrin coastline, Sveta Stasija, Herceg Novi, Zanjice, Budva and Bar, which present different levels and sources of human impact. The heavy metals analyses in seawater, sediment, P. oceanica and M. galloprovincialis identified the harbor of Bar as the most Hg-contaminated site, Zanjice as the most As contaminated and Sveta Stasija as the most Pb-contaminated areas of the Montenegrin coastal area. This study showed that P. oceanica may have a greater bioaccumulation capacity than M. galloprovincialis for the considered metals, except for As and Hg, and both organisms may reflect contamination in the water column and in the sediment. For the first time, seagrass P. oceanica and M. galloprovincialis were employed as metal bioindicators for the southeastern Adriatic. The results of this study could serve as a baseline in the future for the assessment of anthropogenic effects in this marine ecosystem.

  6. Establishing research strategies, methodologies and technologies to link genomics and proteomics to seagrass productivity, community metabolism, and ecosystem carbon fluxes.

    Science.gov (United States)

    Mazzuca, Silvia; Björk, M; Beer, S; Felisberto, P; Gobert, S; Procaccini, G; Runcie, J; Silva, J; Borges, A V; Brunet, C; Buapet, P; Champenois, W; Costa, M M; D'Esposito, D; Gullström, M; Lejeune, P; Lepoint, G; Olivé, I; Rasmusson, L M; Richir, J; Ruocco, M; Serra, I A; Spadafora, A; Santos, Rui

    2013-01-01

    A complete understanding of the mechanistic basis of marine ecosystem functioning is only possible through integrative and interdisciplinary research. This enables the prediction of change and possibly the mitigation of the consequences of anthropogenic impacts. One major aim of the European Cooperation in Science and Technology (COST) Action ES0609 "Seagrasses productivity. From genes to ecosystem management," is the calibration and synthesis of various methods and the development of innovative techniques and protocols for studying seagrass ecosystems. During 10 days, 20 researchers representing a range of disciplines (molecular biology, physiology, botany, ecology, oceanography, and underwater acoustics) gathered at The Station de Recherches Sous-marines et Océanographiques (STARESO, Corsica) to study together the nearby Posidonia oceanica meadow. STARESO is located in an oligotrophic area classified as "pristine site" where environmental disturbances caused by anthropogenic pressure are exceptionally low. The healthy P. oceanica meadow, which grows in front of the research station, colonizes the sea bottom from the surface to 37 m depth. During the study, genomic and proteomic approaches were integrated with ecophysiological and physical approaches with the aim of understanding changes in seagrass productivity and metabolism at different depths and along daily cycles. In this paper we report details on the approaches utilized and we forecast the potential of the data that will come from this synergistic approach not only for P. oceanica but for seagrasses in general.

  7. Establishing research strategies, methodologies and technologies to link genomics and proteomics to seagrass productivity, community metabolism and ecosystem carbon fluxes

    Directory of Open Access Journals (Sweden)

    Silvia eMazzuca

    2013-03-01

    Full Text Available A complete understanding of the mechanistic basis of marine ecosystem functioning is only possible through integrative and interdisciplinary research. This enables the prediction of change and possibly the mitigation of the consequences of anthropogenic impacts. One major aim of the COST Action ES0609 Seagrasses productivity. From genes to ecosystem management, is the calibration and synthesis of various methods and the development of innovative techniques and protocols for studying seagrass ecosystems.During ten days, twenty researchers representing a range of disciplines (molecular biology, physiology, botany, ecology, oceanography, underwater acoustics gathered at the marine station of STARESO (Corsica to study together the nearby Posidonia oceanica meadow. The Station de Recherches Sous-marine et Océanographiques (STARESO is located in an oligotrophic area classified as "pristine site" where environmental disturbances caused by anthropogenic pressure are exceptionally low. The healthy P. oceanica meadow, that grows in front of the lab, colonizes the sea bottom from the surface to 37 m depth. During the study, genomic and proteomic approaches were integrated with ecophysiological and physical approaches with the aim of understanding changes in seagrass productivity and metabolism at different depths and along daily cycles. In this paper we report details on the approaches utilized and we forecast the potential of the data that will come from this synergistic approach not only for P. oceanica but for seagrasses in general.

  8. Mechanisms of Phosphorus Acquisition and Lipid Class Remodeling under P Limitation in a Marine Microalga.

    Science.gov (United States)

    Mühlroth, Alice; Winge, Per; El Assimi, Aimen; Jouhet, Juliette; Maréchal, Eric; Hohmann-Marriott, Martin F; Vadstein, Olav; Bones, Atle M

    2017-12-01

    Molecular mechanisms of phosphorus (P) limitation are of great interest for understanding algal production in aquatic ecosystems. Previous studies point to P limitation-induced changes in lipid composition. As, in microalgae, the molecular mechanisms of this specific P stress adaptation remain unresolved, we reveal a detailed phospholipid-recycling scheme in Nannochloropsis oceanica and describe important P acquisition genes based on highly corresponding transcriptome and lipidome data. Initial responses to P limitation showed increased expression of genes involved in P uptake and an expansion of the P substrate spectrum based on purple acid phosphatases. Increase in P trafficking displayed a rearrangement between compartments by supplying P to the chloroplast and carbon to the cytosol for lipid synthesis. We propose a novel phospholipid-recycling scheme for algae that leads to the rapid reduction of phospholipids and synthesis of the P-free lipid classes. P mobilization through membrane lipid degradation is mediated mainly by two glycerophosphoryldiester phosphodiesterases and three patatin-like phospholipases A on the transcriptome level. To compensate for low phospholipids in exponential growth, N. oceanica synthesized sulfoquinovosyldiacylglycerol and diacylglyceroltrimethylhomoserine. In this study, it was shown that an N. oceanica strain has a unique repertoire of genes that facilitate P acquisition and the degradation of phospholipids compared with other stramenopiles. The novel phospholipid-recycling scheme opens new avenues for metabolic engineering of lipid composition in algae. © 2017 American Society of Plant Biologists. All Rights Reserved.

  9. Global warming enhances sulphide stress in a key seagrass species (NW Mediterranean).

    Science.gov (United States)

    García, Rosa; Holmer, Marianne; Duarte, Carlos M; Marbà, Núria

    2013-12-01

    The build-up of sulphide concentrations in sediments, resulting from high inputs of organic matter and the mineralization through sulphate reduction, can be lethal to the benthos. Sulphate reduction is temperature dependent, thus global warming may contribute to even higher sulphide concentrations and benthos mortality. The seagrass Posidonia oceanica is very sensitive to sulphide stress. Hence, if concentrations build up with global warming, this key Mediterranean species could be seriously endangered. An 8-year monitoring of daily seawater temperature, the sulphur isotopic signatures of water (δ(34)S(water)), sediment (δ(34)SCRS ) and P. oceanica leaf tissue (δ(34)S(leaves)), along with total sulphur in leaves (TS(leaves)) and annual net population growth along the coast of the Balearic archipelago (Western Mediterranean) allowed us to determine if warming triggers P. oceanica sulphide stress and constrains seagrass survival. From the isotopic S signatures, we estimated sulphide intrusion into the leaves (F(sulphide)) and sulphur incorporation into the leaves from sedimentary sulphides (SS(leaves)). We observed lower δ(34)S(leaves), higher F(sulphide) and SS(leaves) coinciding with a 6-year period when two heat waves were recorded. Warming triggered sulphide stress as evidenced by the negative temperature dependence of δ(34)S(leaves) and the positive one of F(sulphide), TS(leaves) and SS(leaves). Lower P. oceanica net population growth rates were directly related to higher contents of TS(leaves). At equivalent annual maximum sea surface water temperature (SST(max)), deep meadows were less affected by sulphide intrusion than shallow ones. Thus, water depth acts as a protecting mechanism against sulphide intrusion. However, water depth would be insufficient to buffer seagrass sulphide stress triggered by Mediterranean seawater summer temperatures projected for the end of the 21st century even under scenarios of moderate greenhouse gas emissions, A1B

  10. Structure of the optimized effective Kohn-Sham exchange potential and its gradient approximations

    International Nuclear Information System (INIS)

    Gritsenko, O.; Van Leeuwen, R.; Baerends, E.J.

    1996-01-01

    An analysis of the structure of the optimized effective Kohn-Sham exchange potential v, and its gradient approximations is presented. The potential is decomposed into the Slater potential v s and the response of v s to density variations, v resp . The latter exhibits peaks that reflect the atomic shell structure. Kohn-Sham exchange potentials derived from current gradient approaches for the exchange energy are shown to be quite reasonable for the Slater potential, but they fail to approximate the response part, which leads to poor overall potentials. Improved potentials are constructed by a direct fit of v x with a gradient-dependent Pade approximant form. The potentials obtained possess proper asymptotic and scaling properties and reproduce the shell structure of the exact v x . 44 refs., 7 figs., 4 tabs

  11. Effects of Ga substitution on the structural and magnetic properties of half metallic Fe{sub 2}MnSi Heusler compound

    Energy Technology Data Exchange (ETDEWEB)

    Pedro, S. S., E-mail: sandrapedro@uerj.br; Caraballo Vivas, R. J.; Andrade, V. M.; Cruz, C.; Paixão, L. S.; Contreras, C.; Costa-Soares, T.; Rocco, D. L.; Reis, M. S. [Instituto de Física, Universidade Federal Fluminense, Niterói-RJ (Brazil); Caldeira, L. [IF Sudeste MG, Campus Juiz de Fora - Núcleo de Física, Juiz de Fora-MG (Brazil); Coelho, A. A. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas - Unicamp, Campinas-SP (Brazil); Carvalho, A. Magnus G. [Laboratório Nacional de Luz Sincrotron, CNPEM, Campinas-SP (Brazil)

    2015-01-07

    The so-called half-metallic magnets have been proposed as good candidates for spintronic applications due to the feature of exhibiting a hundred percent spin polarization at the Fermi level. Such materials follow the Slater-Pauling rule, which relates the magnetic moment with the valence electrons in the system. In this paper, we study the bulk polycrystalline half-metallic Fe{sub 2}MnSi Heusler compound replacing Si by Ga to determine how the Ga addition changes the magnetic, the structural, and the half-metal properties of this compound. The material does not follow the Slater-Pauling rule, probably due to a minor structural disorder degree in the system, but a linear dependence on the magnetic transition temperature with the valence electron number points to the half-metallic behavior of this compound.

  12. Competition of multiplet and spin-orbit splitting in open-shells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Qian; Koch, Erik [Institute for Advanced Simulation, Forschungszentrum Juelich (Germany)

    2016-07-01

    To study the trends in the spectra of open-shells across the periodic table, we perform density functional calculations for atoms and ions. We collect the Slater-Condon and spin-orbit parameters from the resulting self-consistent radial wave functions and potentials. To make these easily accessible, we provide a simple least squares fitting formula in the spirit of Slater's rules. Given these parameters we calculate the many-body spectra in LS-, intermediate-, and jj-coupling. To assess the relative importance of Coulomb and spin-orbit interactions, we estimate the width of the spectra by calculating the eigen-energy variance of the corresponding Hamiltonian using a simple formula that does not require diagonalizing a complicated many-body Hamiltonian.

  13. Theoretical study of relativistic effects in the electronic structure and chemical bonding of UF6

    International Nuclear Information System (INIS)

    Onoe, Jun; Takeuchi, Kazuo; Sekine, Rika; Nakamatsu, Hirohide; Mukoyama, Takeshi; Adachi, Hirohiko.

    1992-01-01

    We have performed the relativistic molecular orbital calculation for the ground state of UF 6 , using the discrete-variational Dirac-Slater method (DV-DS), in order to elucidate the relativistic effects in the electronic structure and chemical bonding. Compared with the electronic structure calculated by the non-relativistic Hartree-Fock-Slater (DV-X α )MO method, not only the direct relativistic effects (spin-orbit splitting etc), but also the indirect effect due to the change in screening core potential charge are shown to be important in the MO level structure. From the U-F bond overlap population analysis, we found that the U-F bond formation can be explained only by the DV-DS, not by the DV-X α . The calculated electronic structure in valence energy region (-20-OeV) and excitation energies in UV region are in agreement with experiments. (author)

  14. Linear-scaling evaluation of the local energy in quantum Monte Carlo

    International Nuclear Information System (INIS)

    Austin, Brian; Aspuru-Guzik, Alan; Salomon-Ferrer, Romelia; Lester, William A. Jr.

    2006-01-01

    For atomic and molecular quantum Monte Carlo calculations, most of the computational effort is spent in the evaluation of the local energy. We describe a scheme for reducing the computational cost of the evaluation of the Slater determinants and correlation function for the correlated molecular orbital (CMO) ansatz. A sparse representation of the Slater determinants makes possible efficient evaluation of molecular orbitals. A modification to the scaled distance function facilitates a linear scaling implementation of the Schmidt-Moskowitz-Boys-Handy (SMBH) correlation function that preserves the efficient matrix multiplication structure of the SMBH function. For the evaluation of the local energy, these two methods lead to asymptotic linear scaling with respect to the molecule size

  15. Quantum Monte Carlo calculations of van der Waals interactions between aromatic benzene rings

    Science.gov (United States)

    Azadi, Sam; Kühne, T. D.

    2018-05-01

    The magnitude of finite-size effects and Coulomb interactions in quantum Monte Carlo simulations of van der Waals interactions between weakly bonded benzene molecules are investigated. To that extent, two trial wave functions of the Slater-Jastrow and Backflow-Slater-Jastrow types are employed to calculate the energy-volume equation of state. We assess the impact of the backflow coordinate transformation on the nonlocal correlation energy. We found that the effect of finite-size errors in quantum Monte Carlo calculations on energy differences is particularly large and may even be more important than the employed trial wave function. In addition to the cohesive energy, the singlet excitonic energy gap and the energy gap renormalization of crystalline benzene at different densities are computed.

  16. Magnetic properties and phase stability of half-metal-type Co2Cr1-xFexGa alloys

    International Nuclear Information System (INIS)

    Kobayashi, K.; Umetsu, R.Y.; Fujita, A.; Oikawa, K.; Kainuma, R.; Fukamichi, K.; Ishida, K.

    2005-01-01

    The magnetic properties and phase stability of half-metal-type Co 2 Cr 1-x Fe x Ga alloys were investigated by differential scanning calorimetry (DSC), in a superconducting quantum interference device (SQUID) magnetometer and in a vibrating sample magnetometer (VSM), and by transmission electron microscopy (TEM). It was found that the L2 1 -type single-phase is obtainable for the entire concentration of x and that the value of the saturation magnetic moment M s at 4.2K in the lower composition range of x is in agreement with the generalized Slater-Pauling line, while it is rather larger than the generalized Slater-Pauling line above x=0.6. The Curie temperature T c monotonically increases, whereas the transition temperature from the L2 1 - to B2-type phase T t B2/L2 1 is almost constant at 1082+/-13K with increasing x

  17. A Hartree–Fock study of the confined helium atom: Local and global basis set approaches

    Energy Technology Data Exchange (ETDEWEB)

    Young, Toby D., E-mail: tyoung@ippt.pan.pl [Zakład Metod Komputerowych, Instytut Podstawowych Prolemów Techniki Polskiej Akademia Nauk, ul. Pawińskiego 5b, 02-106 Warszawa (Poland); Vargas, Rubicelia [Universidad Autónoma Metropolitana Iztapalapa, División de Ciencias Básicas e Ingenierías, Departamento de Química, San Rafael Atlixco 186, Col. Vicentina, Iztapalapa, D.F. C.P. 09340, México (Mexico); Garza, Jorge, E-mail: jgo@xanum.uam.mx [Universidad Autónoma Metropolitana Iztapalapa, División de Ciencias Básicas e Ingenierías, Departamento de Química, San Rafael Atlixco 186, Col. Vicentina, Iztapalapa, D.F. C.P. 09340, México (Mexico)

    2016-02-15

    Two different basis set methods are used to calculate atomic energy within Hartree–Fock theory. The first is a local basis set approach using high-order real-space finite elements and the second is a global basis set approach using modified Slater-type orbitals. These two approaches are applied to the confined helium atom and are compared by calculating one- and two-electron contributions to the total energy. As a measure of the quality of the electron density, the cusp condition is analyzed. - Highlights: • Two different basis set methods for atomic Hartree–Fock theory. • Galerkin finite element method and modified Slater-type orbitals. • Confined atom model (helium) under small-to-extreme confinement radii. • Detailed analysis of the electron wave-function and the cusp condition.

  18. Optimized Enhanced Bioremediation Through 4D Geophysical Monitoring and Autonomous Data Collection, Processing and Analysis

    Science.gov (United States)

    2014-09-01

    organic acids and fluid conductivity. .......................... 62 Figure 5-19 Predicted vs. observed TOA concentrations for August 2010 sampling...including most recently the system developed and demonstrated by the British Geological Survey (BGS) (Ogilvy, Meldrum et al. 2009). However, while the...increase in organic acids . ER has also been used to verify installation of permeable reactive barriers (Slater and Binley 2003).  Induced

  19. Charge-density-shear-moduli relationships in aluminum-lithium alloys.

    Science.gov (United States)

    Eberhart, M

    2001-11-12

    Using the first principles full-potential linear-augmented-Slater-type orbital technique, the energies and charge densities of aluminum and aluminum-lithium supercells have been computed. The experimentally observed increase in aluminum's shear moduli upon alloying with lithium is argued to be the result of predictable changes to aluminum's total charge density, suggesting that simple rules may allow the alloy designer to predict the effects of dilute substitutional elements on alloy elastic response.

  20. SCF MS Xα determination of ionization energies and atomic populations of octaedral TiO6-8 cluster

    International Nuclear Information System (INIS)

    Michel-Calendini, F.M.; Chermette, H.; Pertosa, P.

    1979-02-01

    The ionization energies of titanium and oxygen states in BaTiO 3 crystal have been investigated through the self-consistent-field-Xα-scattered-wave (SCF MS Xα) method, with the Slater transition state model, applied to a TiO 6 -8 cluster of octaedral symmetry. Ionization energies and electronic charge distribution are compared to XPS data and related to results obtained from tight-binding band computations

  1. The Impact of Alternative Market Orientation Strategies on Firm Performance: Customer versus Competitor Orientation

    OpenAIRE

    Micheels, Eric T.; Gow, Hamish R.

    2010-01-01

    Research studies have differed over the importance of the relative emphasis of a customer versus competitor orientation in the development of a market orientation (Slater and Narver, 1994; Tajeddini, 2010). In this study, we assess whether the emphasis of one component over another of a market orientation is an important determinant of firm performance within the Illinois beef industry, specifically the cow-calf sector. Using a series of OLS regressions, we examine the importance of a market ...

  2. Coupled state analysis of electron excitations in asymmetric collision systems

    International Nuclear Information System (INIS)

    Mehler, G.; Reus, T. de; Mueller, U.; Reinhardt, J.; Mueller, B.; Greiner, W.; Soff, G.

    1985-01-01

    A coupled channel formalism is presented, using relativistic basis states of the target atom. Screening effects are incorporated by means of an effective potential of Hartree-Fock-Slater type. Relativistic wave packets are employed for the description of the continuum. The impact parameter dependence of the K-hole production in p-Ag collisions is calculated, including quadrupole contributions of the projectile Coulomb potential. The results are compared with experimental data. (orig.)

  3. Dynamics Days US 2013 Conference Held in Denver, Colorado on 3-6 January 2013. Abstracts

    Science.gov (United States)

    2013-12-17

    down before population collapse using replicate laboratory populations of the budding yeast Saccharomyces cerevisiae. We mapped the bifurcation diagram...agreement with the theory. Furthermore, we connected yeast populations spatially to evaluate warning signals based on spatio-temporal fluctuations...Colorado School of Mines $125 ARO 54 Franson, Andrew U Colorado School of Mines $125 ARO 55 Slater, Michael U Colorado School of Mines $125 ARO 56 Brewer

  4. Quantification of entanglement entropies for doubly excited resonance states in two-electron atomic systems

    International Nuclear Information System (INIS)

    Ho, Yew Kam; Lin, Chien-Hao

    2015-01-01

    In this work, we study the quantum entanglement for doubly excited resonance states in two-electron atomic systems such as the H - and Ps - ions and the He atom by using highly correlated Hylleraas type functions The resonance states are determined by calculation of density of resonance states with the stabilization method. The spatial (electron-electron orbital) entanglement entropies (linear and von Neumann) for the low-lying doubly excited states are quantified using the Schmidt-Slater decomposition method. (paper)

  5. Consistent microscopic theory of collective motion in the framework of an ATDHF approach

    International Nuclear Information System (INIS)

    Goeke, K.; Reinhard, P.

    1978-01-01

    Based on merely two assumptions, namely the existence of a collective Hamiltonian and that the collective motion evolves along Slater determinants, we first derive a set of adiabatic time-dependent Hartree-Fock equations (ATDHF) which determine the collective path, the mass and the potential, second give a unique procedure for quantizing the resulting classical collective Hamiltonian, and third explain how to use the collective wavefunctions, which are eigenstates of the quantized Hamiltonian

  6. Photoionization cross-sections of ground and excited valence levels of actinides

    Directory of Open Access Journals (Sweden)

    Yarzhemsky Victor G.

    2012-01-01

    Full Text Available The photoionization cross-sections of ground and excited atomic states of actinide atoms were calculated by the Dirac-Fock-Slater method for two excitation energies of X-ray radiation (1253.6 eV and 1486.6 eV. These data are required for calculations of intensities of X-ray photoelectron spectra of actinide compound valence bands and interpretation of experimental spectra.

  7. Singly differential electron emission cross sections for ionization of helium by protons

    International Nuclear Information System (INIS)

    Barna, I.F.; Gagyi-Palffy, A.C.; Gulyas, L.; Tokesi, K.; Burgdoerfer, J.

    2005-01-01

    Angular differential cross sections are calculated for electrons emitted in proton-helium collisions within the framework of the time-dependent coupled channel-method. The channel wave functions are constructed from Slater functions and Coulomb wave packets. As projectiles we consider protons with energies between 0.3 and 1.5 MeV. We compare our results with experimental data and other theoretical calculations using the first Born approximation, different distorted wave models and classical trajectory Monte Carlo simulations

  8. Ultraviolet photoelectron spectroscopy of transient species

    International Nuclear Information System (INIS)

    Leeuw, D.M. de.

    1979-01-01

    Transient species are studied in the isolation of the gas phase using ultraviolet photoelectron spectroscopy (PES). A description of the equipment used and a discussion of some theoretical topics, which play a role in the interpretation of PE spectra, are given. Koopmans' theorem, Hartree-Fock-Slater (HFS) calculations and the sum rule are discussed. A versatile ultraviolet PE spectrometer, designed specifically for this purpose, has been built and the construction and performance of this instrument are described. (Auth.)

  9. Ferromagnetism in the Hubbard-Hirsch model

    International Nuclear Information System (INIS)

    Ivanov, V.A.; Zhuravlev, M.E.

    1991-01-01

    In the Hubbard model U=∞ the energy lowering due to exchange interaction of electrons of opposite spin in states with opposite bonding character is taken into account. In the electron concentration range 0< n<1 nonmonotonous dependence m(n) analogous to Slater-Pauling curves has been obtained. The Curle temperature having nonmonotonous dependence on n, saturated magnetization, the temperature dependences of magnetization have been obtained. (orig.)

  10. Emergent Leadership and Team Effectiveness on a Team Resource Allocation Task

    Science.gov (United States)

    1987-10-01

    ship rather than socioemotional leadership (Bales & Slater, 1955) and since task- oriented behavior is more likely to occur during the trials (when...Self-attention theory (Mullen, 1983) suggests that sex composition would have other effects on behavior in the group. Mullen argues that self...likely to lead. That firjug is consistent with self-attention theory (Mullen, 1963), which indicates that individuals in a minority are nmore self

  11. Final Report: Identification and Manipulation of Novel Topological Phases

    Science.gov (United States)

    2016-02-09

    Massachusetts Institute of Technology ( MIT ) 77 Massachusetts Ave. NE18-901 Cambridge, MA 02139 -4307 9-Aug-2015 ABSTRACT Number of Papers published in peer...Professorship (2012-2015) Plenary Speaker, 3rd. International Conference in Superconductivity and Magnetism (ICSM2012) Alfred P. Sloan Fellowship (2012...transition ( MIT ) is discontinuous and occurs at temperatures greater or equal to TN , a Slater-type MIT is continuous and occurs exactly atTN .15 Therefore

  12. Atomically resolved spectroscopic study of Sr.sub.2./sub.IrO.sub.4./sub.: Experiment and theory

    Czech Academy of Sciences Publication Activity Database

    Li, Q.; Cao, G.; Okamoto, S.; Yi, J.; Lin, W.; Sales, B.C.; Yan, J.; Arita, R.; Kuneš, Jan; Kozhevnikov, A.V.; Eguiluz, A.G.; Imada, M.; Gai, Z.; Pan, M.; Mandrus, D.G.

    2013-01-01

    Roč. 3, OCT (2013), s. 1-7 ISSN 2045-2322 R&D Projects: GA ČR GA13-25251S Institutional support: RVO:68378271 Keywords : Sr 2 IrO 4 * scanning tunneling microscopy * Mott insulator * Slater insulator Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 5.078, year: 2013 http://www.nature.com/srep/2013/131029/srep03073/full/srep03073.html

  13. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 50 of 408 ... H. E. Slater, O.C.A. Okoye, O. Okperi, N. Rajora. Vol 15, No 1 (2016), Acute pancreatic pseudocyst in an 18-month old girl in a resource limited centre, Abstract. OE Udefiagbon, C Odion, J Akerele. Vol 7, No 1-2 (2008), Age At Menarche Of School Girls In Urban Benin City, Abstract. MI Momoh, C Okonkwo.

  14. Change in the Magnitude of River Flooding in the United States, 1965-2015

    Science.gov (United States)

    This figure shows changes in the size and frequency of flooding events in rivers and streams in the United States between 1965 and 2015. Blue upward-pointing symbols show locations where floods have become larger; brown downward-pointing symbols show locations where floods have become smaller. Data were analyzed by Louise Slater and Gabriele Villarini at the University of Iowa. For more information: www.epa.gov/climatechange/science/indicators

  15. Contribution to the theoretical study of metallic systems containing rare earths: hyperfine interactions and exchange coupling

    International Nuclear Information System (INIS)

    Troper, A.

    1978-01-01

    A theoretical study involving rare earth impurities, which were embedded in transition metals (s-p or noble), from the point of view of the hyperfine interactions is presented. A model was created to describe a d-resonance (Anderson-Moriya) acting on a s-p conduction band which was strongly perturbed by a slater-koster potential, used to describe the rare earths which were diluted in matrices of transition elements. (author)

  16. Relativistic Calculations and Measurements of Energies, Auger Rates, and Lifetimes.

    Science.gov (United States)

    1982-12-01

    Research and Industry, Denton, Texas, 8-10 November 1982. 7. B. Crasemann: "Efectos Relativ’sticos y de QED Sobre las Transiciones Rayos - X y Auger Entre...INNER-SHELL IONIZATION BY PROTONS X -RAY EMISSION BREIT INTERACTION AUGER TRANSITIONS DIRAC-HARTREE-SLATER COMPUTATIONS SYNCHROTRON RADIATION RESONANT...computations, including relativistic and quantum- electrodynamic effects, of atomic energy levels and of x -ray and Auger transitions in atoms with one or

  17. Stochastic TDHF and the Boltzman-Langevin equation

    International Nuclear Information System (INIS)

    Suraud, E.; Reinhard, P.G.

    1991-01-01

    Outgoing from a time-dependent theory of correlations, we present a stochastic differential equation for the propagation of ensembles of Slater determinants, called Stochastic Time-Dependent Hartree-Fock (Stochastic TDHF). These ensembles are allowed to develop large fluctuations in the Hartree-Fock mean fields. An alternative stochastic differential equation, the Boltzmann-Langevin equation, can be derived from Stochastic TDHF by averaging over subensembles with small fluctuations

  18. On the description of electronic final states in the K-shell ionization by protons

    International Nuclear Information System (INIS)

    Aashamar, O.; Kocbach, L.

    1976-06-01

    The choice of free electronic wave functions in the description of K-shell ionization by protons is discussed. The previously known discrepancies between PWBA and SCA results are shown to be entirely due to two different choices of electronic wave functions. Calculations in the SCA framework with Hartree-Fock-Slater wave functions are reported. Some general features of the SCA calculations are discussed. (Auth.)

  19. Joint Program on Molecular Biology of Marine Organisms

    Science.gov (United States)

    1992-08-20

    and lateral flagella formation in a marine vibrio (Belas and Colwell, 1982). Upon contact with a surface, the polar flagella of Vibrio ... parahemolyticus ceased to function. Shortl’ thereafter, lateral flagella formed around the cells, apparently mediating the "irreversible" attachment process. Pilus...Colwell. 1982. Adsorption kinetics of 18 Slaterally and polarly flagellated Vibrio . J. Bacteriol. 151:1568-1580. S-- Brown, C.M., D.C. Ellwood, and

  20. Cirrus Dopant Nano-Composite Coatings

    Science.gov (United States)

    2014-11-01

    coatings without alteration to the existing plating process. Glen Slater, Cirrus Materials | Stephen Flint, Auckland UniServices Ltd Report...ADDRESS(ES) University of Auckland ,Cirrus Materials, Auckland , New Zealand, 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY...JiA/ g THE UNIVERSITY ’-" OF AUCKLAND NEW ZEALAND Te Whare Wanan a o Thmaki Makaurau ~"""’ • ........,." ... Southwest Pacific Basin . p

  1. Prevention Research Matters-Communities Working to Improve Physical Activity

    Centers for Disease Control (CDC) Podcasts

    2018-02-15

    We know that children who are physically active every day are less likely to develop chronic diseases as adults, including obesity. Dr. Sandy Slater, a researcher with the University of Illinois, Chicago Prevention Research Center, discusses how a park improvement project in Chicago helped engage communities to improve areas for play and activity.  Created: 2/15/2018 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 2/15/2018.

  2. Atomic emission spectroscopy

    Science.gov (United States)

    Andrew, K. H.

    1975-01-01

    The relationship between the Slater-Condon theory and the conditions within the atom as revealed by experimental data was investigated. The first spectrum of Si, Rb, Cl, Br, I, Ne, Ar, and Xe-136 and the second spectrum of As, Cu, and P were determined. Methods for assessing the phase stability of fringe counting interferometers and the design of an autoranging scanning system for digitizing the output of an infrared spectrometer and recording it on magnetic tape are described.

  3. Insulating phase in Sr{sub 2}IrO{sub 4}: An investigation using critical analysis and magnetocaloric effect

    Energy Technology Data Exchange (ETDEWEB)

    Bhatti, Imtiaz Noor; Pramanik, A.K., E-mail: akpramanik@mail.jnu.ac.in

    2017-01-15

    The nature of insulating phase in 5d based Sr{sub 2}IrO{sub 4} is quite debated as the theoretical as well as experimental investigations have put forward evidences in favor of both magnetically driven Slater-type and interaction driven Mott-type insulator. To understand this insulating behavior, we have investigated the nature of magnetic state in Sr{sub 2}IrO{sub 4} through studying critical exponents, low temperature thermal demagnetization and magnetocaloric effect. The estimated critical exponents do not exactly match with any universality class, however, the values obey the scaling behavior. The exponent values suggest that spin interaction in present material is close to mean-field model. The analysis of low temperature thermal demagnetization data, however, shows dual presence of localized- and itinerant-type of magnetic interaction. Moreover, field dependent change in magnetic entropy indicates magnetic interaction is close to mean-field type. While this material shows an insulating behavior across the magnetic transition, yet a distinct change in slope in resistivity is observed around T{sub c}. We infer that though the insulating phase in Sr{sub 2}IrO{sub 4} is more close to be Slater-type but the simultaneous presence of both Slater- and Mott-type is the likely scenario for this material. - Highlights: • Critical analysis shows Sr{sub 2}IrO{sub 4} has ferromagnetic ordering temperature T{sub c}~225 K. • Obtained critical exponents imply spin interaction is close to mean-field model. • Analysis of magneto-entropy data also supports mean-field type interaction. • However, the presence of both itinerant and localized spin interaction is evident. • Sr{sub 2}IrO{sub 4} has simultaneous presence of both Slater- and Mott-type insulating phase.

  4. Personalisation of power, neoliberalism and the production of corruption

    OpenAIRE

    Ahmad Khair, Amal Hayati; Haniffa, Roszaini; Hudaib, Mohammad; Abd. Karim, Mohamad Nazri

    2015-01-01

    This paper utilises a political lens in considering the cause for the production of corruption and the role of political leadership. Specifically, the notion of personalisation of power as advocated by Slater (2003) is adopted to portray how the adoption of neoliberalism ideology by an aspiring autocratic leader results in the weakening of the infrastructural power through three strategies: packing, rigging and circumventing. We use Perwaja Steel as a case study to demonstrate the modus opera...

  5. Market Orientation Capabilities: A Study of Learning Processes in Market-Oriented Companies

    OpenAIRE

    Silkoset, Ragnhild

    2009-01-01

    The literature operates with three perspectives on market orientation. These include market orientation as behavior (Kohli and Jaworski 1990; Narver and Slater 1990), market orientation as a unique resource (Hunt and Morgan 1995) and market orientation as a dynamic learning capability (Sinkula 1994; Day 1994b). A company's level of market orientation will vary with regard to the perspectives, including factors affecting a company’s degree of market orientation and the effect...

  6. Scaling analysis of the optimized effective potentials for the multiplet states of multivalent 3d ions

    International Nuclear Information System (INIS)

    Hamamoto, N; Satoko, C

    2006-01-01

    We apply the optimized effective potential method (OPM) to the multivalent 3d n (n = 2, ..., 8) ions; M ν+ (ν = 2, ..., 8). The total energy functional is approximated by the single-configuration Hartree-Fock. The exchange potential for the average energy configuration is decomposed into the potentials derived from F 2 (3d, 3d) and F 4 (3d, 3d) Slater integrals. To investigate properties of the density-functional potential, we have checked the scaling properties of several physical quantities such as the density, the 3d orbital and these potentials. We find that the potentials of the Slater integrals do not have the scaling property. Instead, the weighted potential V i (r) of an ion i, which is the potential of the Slater integrals times the 3d-orbital density, satisfies the scaling property q 3d i V i (r) ∼ q 3d j λ 4 V j (λr) where q i 3d is the occupation number of the 3d-orbital R 3d (r) for ion i. Furthermore, the weighted potential can be approximated by the ion-independent functional of the 3d-orbital density c k R 8/3 3d (r)/q 3d where c 2 = 0.366 and c 4 0.223. This suggests that the weighted potential can be expressed as a functional of the 3d-orbital density

  7. Desconstruir para edificar: uma visão acerca da infância e uma proposta para sua compreensão através da chave da mudança

    Directory of Open Access Journals (Sweden)

    Laryssa Frezze e Silva

    2015-08-01

    Full Text Available O presente trabalho buscará refletir sobre o papel da educação na formação do indivíduo, considerando para isso o lugar da escola na sociedade atual, o que se espera dessa instituição e como ela pode vir a intervir na dinâmica social que vivemos. O artigo está dividido em três seções; primeiramente, discute-se acerca da necessidade de modificação do sistema educacional brasileiro, fato que já é tomado como inquestionável, mas cuja aplicabilidade é sempre posta em xeque. Usamos como fundamento idéias de Walter Benjamin, Theodor Adorno e Ligia Averbuck. Depois fala-se brevemente sobre o construtivismo e, por fim, há um estudo de comparação entre dois programas televisivos infantis veiculados pela TV Cultura em diferentes épocas, quais sejam “O Castelo Rá-tim-bum” e “O Quintal da Cultura”. O objetivo desse estudo é o de comparar as diferentes visões de infância que cada programa apresenta e, a partir disso, fazer um julgamento de valor.

  8. Quantum mechanical analysis on faujasite-type molecular sieves by using fermi dirac statistics and quantum theory of dielectricity

    International Nuclear Information System (INIS)

    Jabeen, S.; Raza, S.M.; Ahmed, M.A.; Zai, M.Y.; Akbar, S.; Jafri, Y.Z.

    2012-01-01

    We studied Faujasite type molecular sieves by using Fermi Dirac statistics and the quantum theory of dielectricity. We developed an empirical relationship for quantum capacitance which follows an inverse Gaussian profile in the frequency range of 66 Hz - 3 MHz. We calculated quantum capacitance, sample crystal momentum, charge quantization and quantized energy of Faujasite type molecular sieves in the frequency range of 0.1 Hz - 10/sup 4/ MHz. Our calculations for diameter of sodalite and super-cages of Faujasite type molecular sieves are in agreement with experimental results reported in this manuscript. We also calculated quantum polarizability, quantized molecular field, orientational polarizability and deformation polarizability by using experimental results of Ligia Frunza etal. The phonons are over damped in the frequency range 0.1 Hz - 10 kHz and become a source for producing cages in the Faujasite type molecular sieves. Ion exchange recovery processes occur due to over damped phonon excitations in Faujasite type molecular sieves and with increasing temperatures. (author)

  9. preconceito e experiência

    Directory of Open Access Journals (Sweden)

    Luciene M. da Silva

    2006-01-01

    Full Text Available Se discute las relaciones entre prejuicio y deficiencia. Tomo como referencia fundamental los estudios de T. Adorno y M. Horkheimer sobre prejuicio, además de las contribuciones de autores como Ligia Amaral y José Leon Crochik. Para ellos el prejuicio a las personas con deficiencia se configura como un mecanismo de negación social, una vez que sus diferencias son destacadas como una falta, carencia o imposibilidad. La diferencia inscribe en el propio cuerpo del individuo su carácter particular. El cuerpo deficiente es insuficiente para una sociedad que demanda de él el uso intensivo, que lo lleva al desgaste físico, resultado del trabajo subsirviente; o para una construcción corporal cuyo objetivo es meramente el control y corrección, en función de una estética de supremacía del cuerpo, con intereses económicos. En este sentido, todos nosotros nos distanciamos cada vez más de la autonomía y de la posibilidad de diferenciación, restándonos apenas la adaptación a la situación existente, que se constituye en un esfuerzo para aceptar la mentira necesaria para sobrevivir o para la autoprotección.

  10. Millennial scale impact on the marine biogeochemical cycle of mercury from early mining on the Iberian Peninsula

    Science.gov (United States)

    Serrano, O.; Martínez-Cortizas, A.; Mateo, M. A.; Biester, H.; Bindler, R.

    2013-01-01

    The high-resolution mercury record of a Posidonia oceanica mat in the northwest Mediterranean provides an unprecedented testimony of changes in environmental mercury (Hg) loading to the coastal marine environment over the past 4315 yr BP. The period reconstructed made it possible to establish tentative preanthropogenic background Hg levels for the area (6.8 ± 1.5 ng g-1 in bulk sediments). A small, but significant, anthropogenic Hg increase was identifiable by 2500 yr BP, in agreement with the beginning of intense mining in Spain. Changes in the record suggest four major periods of anthropogenic Hg pollution inputs to the Mediterranean: first, during the Roman Empire (2100-1800 yr BP); second, in the Late Middle Ages (970-650 yr BP); third, in the modern historical era (530-380 yr BP); and fourth, in the industrial period (last 250 years), with Hg concentrations two-, four-, five-, and tenfold higher than background concentrations, respectively. Hg from anthropogenic sources has dominated during the last millennium (increase from 12 to 100 ng g-1), which can be related to the widespread historical exploitation of ore resources on the Iberian Peninsula. The chronology of Hg concentrations in the mat archive, together with other Hg pollution records from the Iberian Peninsula, suggests regional-scale Hg transport and deposition and shows earlier marine Hg pollution than elsewhere in Europe. Moreover, the mat also records a higher number of historic contamination phases, in comparison with other natural archives, probably due to the fact that the bioaccumulating capacity of P. oceanica magnify environmental changes in Hg concentrations. In this study, we demonstrate the uniqueness of P. oceanica meadows as a long-term archive recording trends in Hg abundance in the marine coastal environment, as well as its potential role in the Mediterranean as a long-term Hg sink.

  11. Impact of trace metal concentrations on coccolithophore growth and morphology: laboratory simulations of Cretaceous stress

    Science.gov (United States)

    Faucher, Giulia; Hoffmann, Linn; Bach, Lennart T.; Bottini, Cinzia; Erba, Elisabetta; Riebesell, Ulf

    2017-07-01

    The Cretaceous ocean witnessed intervals of profound perturbations such as volcanic input of large amounts of CO2, anoxia, eutrophication and introduction of biologically relevant metals. Some of these extreme events were characterized by size reduction and/or morphological changes of a few calcareous nannofossil species. The correspondence between intervals of high trace metal concentrations and coccolith dwarfism suggests a negative effect of these elements on nannoplankton biocalcification processes in past oceans. In order to test this hypothesis, we explored the potential effect of a mixture of trace metals on growth and morphology of four living coccolithophore species, namely Emiliania huxleyi, Gephyrocapsa oceanica, Pleurochrysis carterae and Coccolithus pelagicus. The phylogenetic history of coccolithophores shows that the selected living species are linked to Mesozoic species showing dwarfism under excess metal concentrations. The trace metals tested were chosen to simulate the environmental stress identified in the geological record and upon known trace metal interactions with living coccolithophore algae.Our laboratory experiments demonstrated that elevated trace metal concentrations, similarly to the fossil record, affect coccolithophore algae size and/or weight. Smaller coccoliths were detected in E. huxleyi and C. pelagicus, while coccoliths of G. oceanica showed a decrease in size only at the highest trace metal concentrations. P. carterae coccolith size was unresponsive to changing trace metal concentrations. These differences among species allow discriminating the most- (P. carterae), intermediate- (E. huxleyi and G. oceanica) and least-tolerant (C. pelagicus) taxa. The fossil record and the experimental results converge on a selective response of coccolithophores to metal availability.These species-specific differences must be considered before morphological features of coccoliths are used to reconstruct paleo-chemical conditions.

  12. Calcareous Nannofossils and Variation of the Kuroshio Current in the Okinawa Tro ugh During the Last 14000 Years

    Directory of Open Access Journals (Sweden)

    Xin

    2005-01-01

    Full Text Available A quantitative census study on calcareous nannofossils from sediments of Site 1202 recovered by ODP Leg 195 and surface sediments from the East China Sea was carried out to obtain a high-resolution nannofossil record of the change of the Kuroshio Current during the late Quaternary. Two nannofossil ratio indices were designed and employed in this study: (1 ratio of Florisphaera profunda against F. profunda, Emiliania huxleyi and Gephyrocapsa oceanica (F-EG ratio as a nannofossil proxy of the Kuroshio Current, (2 ratio of G. oceanica against F. profunda and E. huxleyi and G. oceanica (G-FE ratio as a proxy of near-coast environment. Results from the 14 surface nannofossil samples demonstrate that the F-EG ratio is > 15% in the assemblage lying directly under the main route of the Kuroshio Current, whereas it is very low ( 30% were seen from all samples on the East China Sea continental shelf or from near-coast cores. Down hole nannofossil record from the top 60 mbsf sediment interval at ODP Hole 1202B reflects the change of the Kuroshio Current in the last glacial and postglacial period since 14 ka. Extreme low F-EG ratio together with very high G-FE ratio at Hole 1202B during the time of the latest Pleistocene and the earliest Holocene suggest the absence of the Kuroshio Current in the area studied. The event of intrusion of the Kuroshio Current was clearly recorded by a dramatically increase of F-EG ratio and notably a reduction in the G-FE ratio around 9 ka. Furthermore, based on the variation of the F-EG ratio and _ of planktonic foraminifera Neogloboquadrina dutertrei, variation of the Kuroshio Current in the Holocene shows three long-term cycles (with a periodicity of ~3000 yr.

  13. Impact of trace metal concentrations on coccolithophore growth and morphology: laboratory simulations of Cretaceous stress

    Directory of Open Access Journals (Sweden)

    G. Faucher

    2017-07-01

    Full Text Available The Cretaceous ocean witnessed intervals of profound perturbations such as volcanic input of large amounts of CO2, anoxia, eutrophication and introduction of biologically relevant metals. Some of these extreme events were characterized by size reduction and/or morphological changes of a few calcareous nannofossil species. The correspondence between intervals of high trace metal concentrations and coccolith dwarfism suggests a negative effect of these elements on nannoplankton biocalcification processes in past oceans. In order to test this hypothesis, we explored the potential effect of a mixture of trace metals on growth and morphology of four living coccolithophore species, namely Emiliania huxleyi, Gephyrocapsa oceanica, Pleurochrysis carterae and Coccolithus pelagicus. The phylogenetic history of coccolithophores shows that the selected living species are linked to Mesozoic species showing dwarfism under excess metal concentrations. The trace metals tested were chosen to simulate the environmental stress identified in the geological record and upon known trace metal interactions with living coccolithophore algae.Our laboratory experiments demonstrated that elevated trace metal concentrations, similarly to the fossil record, affect coccolithophore algae size and/or weight. Smaller coccoliths were detected in E. huxleyi and C. pelagicus, while coccoliths of G. oceanica showed a decrease in size only at the highest trace metal concentrations. P. carterae coccolith size was unresponsive to changing trace metal concentrations. These differences among species allow discriminating the most- (P. carterae, intermediate- (E. huxleyi and G. oceanica and least-tolerant (C. pelagicus taxa. The fossil record and the experimental results converge on a selective response of coccolithophores to metal availability.These species-specific differences must be considered before morphological features of coccoliths are used to reconstruct paleo-chemical conditions.

  14. Coccolithophore response to climate and surface hydrography in Santa Barbara Basin, California, AD 1917–2004

    Directory of Open Access Journals (Sweden)

    M. Grelaud

    2009-10-01

    Full Text Available The varved sedimentary AD 1917–2004 record from the depositional center of the Santa Barbara Basin (SBB, California was analyzed with monthly to triannual resolution to yield relative abundances of six coccolithophore species representing at least 96% of the coccolithophore assemblage. Seasonal/annual relative abundances respond to climatic and surface hydrographic conditions in the SBB, whereby (i the three species G. oceanica, H. carteri and F. profunda are characteristic of the strength of the northward flowing warm California Counter Current, (ii the two species G. ericsonii and G. muellerae are associated with the cold equatorward flowing California Current, (iii and E. huxleyi appears to be endemic to the SBB. Spectral analyses on relative abundances of these species show that all are influenced by the El Niño Southern Oscillation (ENSO and/or by the Pacific Decadal Oscillation (PDO. Increased relative abundances of G. oceanica and H. carteri are associated with warm ENSO events, G. muellerae responds to warm PDO events and the abundance of G. ericsonii increases during cold PDO events. Morphometric parameters measured on E. huxleyi, G. muellerae and G. oceanica indicate increasing coccolithophore shell carbonate mass from ~1917 until 2004 concomitant with rising pCO2 and sea surface temperature in the region of the SBB.

  15. Climate change and Mediterranean seagrass meadows: a synopsis for environmental managers

    Directory of Open Access Journals (Sweden)

    G. PERGENT

    2014-02-01

    Full Text Available This synopsis focuses on the effects of climate change on Mediterranean seagrasses, and associated communities, and on the contribution of the main species, Posidonia oceanica, to the mitigation of climate change effects through its role of sequestering carbon dioxide. Whilst the regression of seagrass meadows is well documented, generally linked to anthropogenic pressures, global warming could be a cause of new significant regressions, notably linked to the introduction of exotic species, the rise of Sea-Surface Temperature (SST, and relative sea level. Seagrass communities could also be affected by climate change through the replacement of seagrass species having high structural complexity by species of lower complexity and even by opportunistic introduced species. Although it is currently very difficult to predict the consequences of these alterations and their cascade effects, two main conflicting trends in the functioning of seagrass ecosystems that could occur are acceleration of the herbivore pathway or of the detritivore pathway. The mean net primary production of the dominant species, Posidonia oceanica, is relatively high and can be estimated to range between 92.5 to 144.7 g C m-2 a-1. Around 27% of the total carbon fixed by this species enters the sedimentary pathway leading to formation, over millennia, of highly organic deposits rich in refractory carbon. At the Mediterranean scale, the sequestration rate might reach 1.09 Tg C a-1. The amount of this stored carbon is estimated to range from 71 to 273 kg C m-2, which when considered at the Mediterranean scale would represent 11 to 42% of the CO2 emissions produced by Mediterranean countries since the beginning of the Industrial Revolution. The greatest value of the P. oceanica ecosystem, in the context of mitigation of global climate change, is linked to this vast long-term carbon stock accumulated over the millennia, and therefore, efforts should be focused on preserving the

  16. Is the endemic Maltese Top-shell Gibbula nivosa extinct?

    OpenAIRE

    Schembri, Patrick J.; Borg, Joseph A.; Deidun, Alan; Knittweis, Leyla; Mellado Lopez, T.

    2007-01-01

    The trochid gastropod Gibbula nivosa, endemic to the Maltese Islands, has recently only been found in two Maltese bays, where it occurred on seagrass leaves and under stones at depths of 1-4m. Intensive sampling of Cymodocea nodosa and Posidonia oceanica meadows, sediment and pebbles at depths of 2-12m, carried out in 2000 and 2002, resulted only in empty shells but no live animals, suggesting that the species is extinct from these localities where previously good populations were found. Howe...

  17. New host and distributional records for Cryptosporidium sp. (Apicomplexa: Cryptosporidiidae) from lizards (Sauria: Gekkonidae, Scincidae) from the Cook Islands and Vanuatu, South Pacific

    Science.gov (United States)

    McAllister, Chris T.; Duszynski, Donald W.; Fisher, Robert N.

    2013-01-01

    Between 1991 and 1993, 295 lizards, comprising 21 species in 2 families (Gekkonidae, Scincidae) from the Cook Islands, Fiji, Palau, Takapoto, and Vanuatu in the South Pacific, were examined for Cryptosporidium oocysts. Only 6 lizards (2%) were found to be passing Cryptosporidium oocysts in their feces, including 2 of 30 (7%) Oceania geckos, Gehyra oceanica, from Rarotonga, Cook Islands, and 4 of 26 (15%) Pacific blue-tailed skinks, Emoia caeruleocauda, from Efate Island, Vanuatu. This represents the largest survey for Cryptosporidium in Pacific island lizards, and we document 2 new host and 2 new locality records for this parasite genus.

  18. Abstracts of Papers Submitted in 1975 for Publication,

    Science.gov (United States)

    1975-01-01

    Atmosferica del Departmento de Comercio de los Estados Unidos de Norte- Americak Boulder, Colorado, 197S, Sobre el Derrame de Petroleo del VLCC...UNCLSSIFIED F/G 5/2 NI ElhEEEEllEEEEE EIlEEllEEEEEDIE EIIIIIII- El /EEEEEEEllhI, /I//E.E//EI//E /IE//I/E/I/I/E V .* 1.0 uL 11112 .1 W- IIII I’II IH...Organizado por el Programa de Analisis de Ecosistemas Marinos, de Los Lab- oratorios de Investigacion Ambiental, de la Administracion Nacional Oceanica y

  19. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life

    Directory of Open Access Journals (Sweden)

    Reusch Thorsten BH

    2011-01-01

    Full Text Available Abstract Background Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L. Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. Results In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. Conclusions These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  20. Location and associated carbon storage of erosional escarpments of seagrass Posidonia mats

    Directory of Open Access Journals (Sweden)

    Oscar eSerrano

    2016-03-01

    Full Text Available Seagrasses of the genus Posidonia can form an irregular seascape due to erosional processes exposing thick walls of organic matter-rich soils. However, little is known about the location and characteristics of these particular formations. Here we provide comprehensive estimates of organic carbon (Corg storage in P. oceanica and P. australis meadows, while providing insight into their location and mechanisms of formation, and highlighting future research directions. Erosional reef escarpments are restricted to shallow highly productive P. oceanica meadows from the Mediterranean Sea and P. australis meadows from the Indian Ocean, and sustain the existence of Corg-rich deposits in surrounding meadows. The thickness of the mat escarpments can reach up to 3 m and their length can vary from few to hundreds meters. Mechanisms of formation appear to differ among sites, from naturally-induced escarpments by wave action and/or tidal flow to human-induced escarpments by dredging activities. The inter-twined remains of seagrass shoots within the sediment matrix consolidate the sandy substrate and hold the exposed Posidonia mat escarpments together, maintaining a semi-rigid structure. This phenomenon is unusual but of exceptional importance in marine biogeochemical cycles, revealing the largest Corg sinks among seagrasses worldwide (ranging from 15-176 kg Corg m-2 in 2 m-thick mats accumulated at 2-249 g Corg m-2 yr-1 over 300 to 3000 yr.

  1. Variations and controlling factors of the coccolith weight in the Western Pacific Warm Pool over the last 200 ka

    Science.gov (United States)

    Liang, Dan; Liu, Chuanlian

    2016-06-01

    Using a coccolith weight analytic software (Particle Analyser), we analyze most abundant coccolith species in a sediment core from the central Western Pacific Warm Pool (WPWP) and calculate coccolith size and weight variations over the last 200 ka. These variations are compared with the trends of sea surface temperature (SST), primary productivity (PP), sea surface salinity (SSS), and insolation. Our results demonstrate that the size and weight of the coccoliths varied in response to variations of these factors, and their average total weight is primarily related to the relative abundance of the dominant species GEO ( Gephyrocapsa oceanica). The variation in weight of EMI ( Emiliania huxleyi) and GEE ( Gephyrocapsa ericsonii) are mainly influenced by nutrients, and the variation of GEM ( G. muellerae conformis) and GEO ( G. oceanica) weight are mainly influenced by SST. For all of the taxa weight, PP and SST present apparent precession or semi-precession cycles, we consider that the mono-coccolith weight of the Equatorial Western Pacific is primarily affected by precession drived thermocline and nutricline variation.

  2. Density, size structure, shell orientation and epibiontic colonization of the fan mussel Pinna nobilis L. 1758 (Mollusca: Bivalvia in three contrasting habitats in an estuarine area of Sardinia (W Mediterranean

    Directory of Open Access Journals (Sweden)

    Piero Addis

    2009-03-01

    Full Text Available We investigated the spatial distribution, size structure, shell orientation and valve colonization by epibionts of the endangered Mediterranean bivalve Pinna nobilis in three continuous but different habitats in the Gulf of Oristano (Sardinia, western Mediterranean. The sampling stations chosen were: an estuarine area (E of coastal salt-marshes characterized by unvegetated sea-bottoms; and two areas in a seagrass meadow characterized by an extensive Posidonia oceanica meadow (Mw and patched mixed meadows of P. oceanica and Cymodocea nodosa (Me. We found significant differences in mean densities among stations and the highest value was found in the estuarine area. Shell orientation showed that there was uniform circular distribution of specimens in the Mw station and a unimodal distribution in the Me and E stations, where specimens were set at 0°N and 10°NNE, which is a pattern related to sea drift. Shell epibiosis displayed differences between habitats. The highest valve colonization was in the estuary, with filamentous dark algae and Ostrea edulis reaching almost 90 percent of shell coverage. This study provides new information on habitat preferences and data for assessing local populations of P. nobilis that is useful for its conservation and improving the knowledge of its ecology.

  3. Cumulative impacts from multiple human activities on seagrass meadows in eastern Mediterranean waters: the case of Saronikos Gulf (Aegean Sea, Greece).

    Science.gov (United States)

    Brodersen, Maren Myrto; Pantazi, Maria; Kokkali, Athina; Panayotidis, Panayotis; Gerakaris, Vasilis; Maina, Irida; Kavadas, Stefanos; Kaberi, Helen; Vassilopoulou, Vassiliki

    2017-12-05

    Ecosystem-based management (EBM) addresses the fundamental need to account for cumulative impacts of human activities with the aim of sustainably delivering ecosystem services. The Saronikos Gulf, a large embayment of the Aegean Sea, provides a wide range of ecosystem services that are impacted by multiple human activities, deriving from the metropolitan area of Athens (situated at the northeast part of the Gulf). The anthropogenic impacts affect the status of several marine ecosystem components, e.g., seagrass meadows. Cymodocea nodosa meadows are only present at the most confined western part of the Gulf, whereas Posidonia oceanica meadows are mainly distributed in the inner and outer part of the Gulf. The aim of this study is to assess the cumulative impacts from multiple human activities on the seagrass meadows in the Gulf. The main results indicated that most impacted meadows are P. oceanica in the inner part of the Gulf, adjacent to the most urbanized coastal areas, and near port infrastructures. Land-based pollution, as well as physical damage and loss seem to be the main pressures exerted on the meadows. Understanding cumulative impacts is crucial for informing policy decisions under an EBM approach.

  4. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life.

    Science.gov (United States)

    Wissler, Lothar; Codoñer, Francisco M; Gu, Jenny; Reusch, Thorsten B H; Olsen, Jeanine L; Procaccini, Gabriele; Bornberg-Bauer, Erich

    2011-01-12

    Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs) of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L.) Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica) and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  5. Linking Seed Photosynthesis and Evolution of the Australian and Mediterranean Seagrass Genus Posidonia.

    Directory of Open Access Journals (Sweden)

    David Celdran

    Full Text Available Recent findings have shown that photosynthesis in the skin of the seed of Posidonia oceanica enhances seedling growth. The seagrass genus Posidonia is found only in two distant parts of the world, the Mediterranean Sea and southern Australia. This fact led us to question whether the acquisition of this novel mechanism in the evolution of this seagrass was a pre-adaptation prior to geological isolation of the Mediterranean from Tethys Sea in the Eocene. Photosynthetic activity in seeds of Australian species of Posidonia is still unknown. This study shows oxygen production and respiration rates, and maximum PSII photochemical efficiency (Fv : Fm in seeds of two Australian Posidonia species (P. australis and P. sinuosa, and compares these with previous results for P. oceanica. Results showed relatively high oxygen production and respiratory rates in all three species but with significant differences among them, suggesting the existence of an adaptive mechanism to compensate for the relatively high oxygen demands of the seeds. In all cases maximal photochemical efficiency of photosystem II rates reached similar values. The existence of photosynthetic activity in the seeds of all three species implicates that it was an ability probably acquired from a common ancestor during the Late Eocene, when this adaptive strategy could have helped Posidonia species to survive in nutrient-poor temperate seas. This study sheds new light on some aspects of the evolution of marine plants and represents an important contribution to global knowledge of the paleogeographic patterns of seagrass distribution.

  6. Linking Seed Photosynthesis and Evolution of the Australian and Mediterranean Seagrass Genus Posidonia.

    Science.gov (United States)

    Celdran, David; Lloret, Javier; Verduin, Jennifer; van Keulen, Mike; Marín, Arnaldo

    2015-01-01

    Recent findings have shown that photosynthesis in the skin of the seed of Posidonia oceanica enhances seedling growth. The seagrass genus Posidonia is found only in two distant parts of the world, the Mediterranean Sea and southern Australia. This fact led us to question whether the acquisition of this novel mechanism in the evolution of this seagrass was a pre-adaptation prior to geological isolation of the Mediterranean from Tethys Sea in the Eocene. Photosynthetic activity in seeds of Australian species of Posidonia is still unknown. This study shows oxygen production and respiration rates, and maximum PSII photochemical efficiency (Fv : Fm) in seeds of two Australian Posidonia species (P. australis and P. sinuosa), and compares these with previous results for P. oceanica. Results showed relatively high oxygen production and respiratory rates in all three species but with significant differences among them, suggesting the existence of an adaptive mechanism to compensate for the relatively high oxygen demands of the seeds. In all cases maximal photochemical efficiency of photosystem II rates reached similar values. The existence of photosynthetic activity in the seeds of all three species implicates that it was an ability probably acquired from a common ancestor during the Late Eocene, when this adaptive strategy could have helped Posidonia species to survive in nutrient-poor temperate seas. This study sheds new light on some aspects of the evolution of marine plants and represents an important contribution to global knowledge of the paleogeographic patterns of seagrass distribution.

  7. Ocean acidification alters the photosynthetic responses of a coccolithophorid to fluctuating ultraviolet and visible radiation.

    Science.gov (United States)

    Jin, Peng; Gao, Kunshan; Villafañe, Virginia E; Campbell, Douglas A; Helbling, E Walter

    2013-08-01

    Mixing of seawater subjects phytoplankton to fluctuations in photosynthetically active radiation (400-700 nm) and ultraviolet radiation (UVR; 280-400 nm). These irradiance fluctuations are now superimposed upon ocean acidification and thinning of the upper mixing layer through stratification, which alters mixing regimes. Therefore, we examined the photosynthetic carbon fixation and photochemical performance of a coccolithophore, Gephyrocapsa oceanica, grown under high, future (1,000 μatm) and low, current (390 μatm) CO₂ levels, under regimes of fluctuating irradiances with or without UVR. Under both CO₂ levels, fluctuating irradiances, as compared with constant irradiance, led to lower nonphotochemical quenching and less UVR-induced inhibition of carbon fixation and photosystem II electron transport. The cells grown under high CO₂ showed a lower photosynthetic carbon fixation rate but lower nonphotochemical quenching and less ultraviolet B (280-315 nm)-induced inhibition. Ultraviolet A (315-400 nm) led to less enhancement of the photosynthetic carbon fixation in the high-CO₂-grown cells under fluctuating irradiance. Our data suggest that ocean acidification and fast mixing or fluctuation of solar radiation will act synergistically to lower carbon fixation by G. oceanica, although ocean acidification may decrease ultraviolet B-related photochemical inhibition.

  8. Modeling of full-Heusler alloys within tight-binding approximation: Case study of Fe2MnAl

    Science.gov (United States)

    Azhar, A.; Majidi, M. A.; Nanto, D.

    2017-07-01

    Heusler alloys have been known for about a century, and predictions of magnetic moment values using Slater-Pauling rule have been successful for many such materials. However, such a simple counting rule has been found not to always work for all Heusler alloys. For instance, Fe2CuAl has been found to have magnetic moment of 3.30 µB per formula unit although the Slater-Pauling rule suggests the value of 2 µB. On the other hand, a recent experiment shows that a non-stoichiometric Heusler compound Fe2Mn0.5Cu0.5Al possesses magnetic moment of 4 µB, closer to the Slater-Pauling prediction for the stoichiometric compound. Such discrepancies signify that the theory to predict the magnetic moment of Heusler alloys in general is still far from being complete. Motivated by this issue, we propose to do a theoretical study on a full-Heusler alloy Fe2MnAl to understand the formation of magnetic moment microscopically. We model the system by constructing a density-functional-theory-based tight-binding Hamiltonian and incorporating Hubbard repulsive as well as spin-spin interactions for the electrons occupying the d-orbitals. Then, we solve the model using Green's function approach, and treat the interaction terms within the mean-field approximation. At this stage, we aim to formulate the computational algorithm for the overall calculation process. Our final goal is to compute the total magnetic moment per unit cell of this system and compare it with the experimental data.

  9. Application of some Hartree-Fock model calculations to the analysis of atomic and free-ion optical spectra

    International Nuclear Information System (INIS)

    Hayhurst, T.L.

    1980-01-01

    Techniques for applying ab-initio calculations to the analysis of atomic spectra are investigated, along with the relationship between the semi-empirical and ab-initio forms of Slater-Condon theory. Slater-Condon theory is reviewed with a focus on the essential features that lead to the effective Hamiltonians associated with the semi-empirical form of the theory. Ab-initio spectroscopic parameters are calculated from wavefunctions obtained via self-consistent field methods, while multiconfiguration Hamiltonian matrices are constructed and diagonalized with computer codes written by Robert Cowan of Los Alamos Scientific Laboratory. Group theoretical analysis demonstrates that wavefunctions more general than Slater determinants (i.e. wavefunctions with radical correlations between electrons) lead to essentially the same parameterization of effective Hamiltonians. In the spirit of this analysis, a strategy is developed for adjusting ab-initio values of the spectroscopic parameters, reproducing parameters obtained by fitting the corresponding effective Hamiltonian. Secondary parameters are used to screen the calculated (primary) spectroscopic parameters, their values determined by least squares. Extrapolations of the secondary parameters determined from analyzed spectra are attempted to correct calculations of atoms and ions without experimental levels. The adjustment strategy and extrapolations are tested on the KI sequence from K 0+ through Fe 7+ , fitting to experimental levels for V 4+ , and Cr 5+ ; unobserved levels and spectra are predicted for several members of the sequence. A related problem is also discussed: Energy levels of the Uranium hexahalide complexes, (UX 6 ) 2- for X = F, Cl, Br, and I, are fit to an effective Hamiltonian (the f 2 configuration in O/sub h/ symmetry) with corrections proposed by Brian Judd

  10. Application of some Hartree-Fock model calculations to the analysis of atomic and free-ion optical spectra

    International Nuclear Information System (INIS)

    Hayhurst, T.L.

    1980-05-01

    Techniques for applying ab-initio calculations to the analysis of atomic spectra are investigated, along with the relationship between the semi-empirical and ab-initio forms of Slater-Condon theory. Slater-Condon theory is reviewed with a focus on the essential features that lead to the effective Hamiltonians associated with the semi-empirical form of the theory. Ab-initio spectroscopic parameters are calculated from wavefunctions obtained via self-consistent field methods, while multi-configuration Hamiltonian matrices are constructed and diagonalized with computer codes written by Robert Cowan of Los Alamos Scientific Laboratory. Group theoretical analysis demonstrates that wavefunctions more general than Slater determinants (i.e., wavefunctions with radial correlations between electrons) lead to essentially the same parameterization of effective Hamiltonians. In the spirit of this analysis, a strategy is developed for adjusting ab-initio values of the spectroscopic parameters, reproducing parameters obtained by fitting the corresponding effective Hamiltonian. Secondary parameters are used to screen the calculated (primary) spectroscopic parameters, their values determined by least squares. Extrapolations of the secondary parameters determined from analyzed spectra are attempted to correct calculations of atoms and ions without experimental levels. The adjustment strategy and extrapolations are tested on the K I sequence from K 0+ through Fe 7+ , fitting to experimental levels for V 4+ , and Cr 5+ ; unobserved levels and spectra are predicted for several members of the sequence. A related problem is also discussed: energy levels of the uranium hexahalide complexes, (UX 6 ) 2- for X = F, Cl, Br, and I, are fit to an effective Hamiltonian (the f 2 configuration in O/sub h/ symmetry) with corrections proposed by Brian Judd

  11. Generalized Hartree-Fock method for electron-atom scattering

    International Nuclear Information System (INIS)

    Rosenberg, L.

    1997-01-01

    In the widely used Hartree-Fock procedure for atomic structure calculations, trial functions in the form of linear combinations of Slater determinants are constructed and the Rayleigh-Ritz minimum principle is applied to determine the best in that class. A generalization of this approach, applicable to low-energy electron-atom scattering, is developed here. The method is based on a unique decomposition of the scattering wave function into open- and closed-channel components, so chosen that an approximation to the closed-channel component may be obtained by adopting it as a trial function in a minimum principle, whose rigor can be maintained even when the target wave functions are imprecisely known. Given a closed-channel trial function, the full scattering function may be determined from the solution of an effective one-body Schroedinger equation. Alternatively, in a generalized Hartree-Fock approach, the minimum principle leads to coupled integrodifferential equations to be satisfied by the basis functions appearing in a Slater-determinant representation of the closed-channel wave function; it also provides a procedure for optimizing the choice of nonlinear parameters in a variational determination of these basis functions. Inclusion of additional Slater determinants in the closed-channel trial function allows for systematic improvement of that function, as well as the calculated scattering parameters, with the possibility of spurious singularities avoided. Electron-electron correlations can be important in accounting for long-range forces and resonances. These correlation effects can be included explicitly by suitable choice of one component of the closed-channel wave function; the remaining component may then be determined by the generalized Hartree-Fock procedure. As a simple test, the method is applied to s-wave scattering of positrons by hydrogen. copyright 1997 The American Physical Society

  12. Mindfulness-Based Symptom and Stress Management Apps for Adults With Chronic Lung Disease: Systematic Search in App Stores.

    Science.gov (United States)

    Owens, Otis L; Beer, Jenay M; Reyes, Ligia I; Gallerani, David G; Myhren-Bennett, Amanda R; McDonnell, Karen K

    2018-05-15

    Up to 70% of lung cancer survivors are affected by chronic obstructive pulmonary disease (COPD), a common, debilitating, comorbid disease. Lung cancer and COPD are both characterized by symptoms such as breathlessness, fatigue, and psychological distress. These distressing chronic symptoms are exacerbated by stress and detract from an individual's quality of life. The aim of this study was to identify and evaluate evidence-based, commercially available apps for promoting mindfulness-based strategies among adults with a COPD or lung cancer history (ie, chronic lung disease). For this review, an interdisciplinary research team used 19 keyword combinations in the search engines of Google and iOS app stores in May 2017. Evaluations were conducted on the apps' (1) content, (2) usability heuristics, (3) grade-level readability, and (4) cultural sensitivity. The search resulted in 768 apps (508 in iOS and 260 in Google stores). A total of 9 apps met the inclusion criteria and received further evaluation. Only 1 app had below an eighth-grade reading level; the ninth one did not have enough text to calculate a readability score. None of the 9 apps met the cultural sensitivity evaluation criteria. This systematic review identified critical design flaws that may affect the ease of using the apps in this study. Few mobile apps promote mindfulness-based strategies among adults with chronic lung disease (ie, COPD or lung cancer or both), but those that exist, overall, do not meet the latest scientific evidence. Recommendations include more stringent regulation of health-related apps, use of evidence-based frameworks and participatory design processes, following evidence-based usability practices, use of culturally sensitive language and images, and ensuring that content is written in plain language. ©Otis L Owens, Jenay M Beer, Ligia I Reyes, David G Gallerani, Amanda R Myhren-Bennett, Karen K McDonnell. Originally published in JMIR Mhealth and Uhealth (http

  13. A theoretical survey of 4s-4p and 4p-4d transitions in nickel-like ions through Sn XXIII

    International Nuclear Information System (INIS)

    Wyart, J.F.

    1987-01-01

    The predictions of 4s-4p and 4p-4d transitions derived from Slater-Condon type calculations of 3d 9 4s, -4p and -4d configurations in the sequence Zn III-Se VII have been recently confirmed experimentally through Mo XV. These new data are used here to refine the predictions in the sequence Mo XV-Sn XXIII. The radial parameters involved in the three configurations are determined in generalized least-squares fits using all known levels in the sequence. (orig.)

  14. A perceção dos pais sobre a sua responsabilidade nas práticas alimentares dos filhos: relação com a obesidade infantil

    OpenAIRE

    Santos, Ana Luísa Couto de Almeida dos

    2015-01-01

    Dissertação de Mestrado em Enfermagem Comunitária Introdução: O excesso de peso e a obesidade em geral, bem como a obesidade infantil em particular, têm sido considerados um problema emergente de saúde pública a nível mundial. Esta patologia foi considerada pela Organização Mundial de Saúde (WHO, 2000) como uma doença multifatorial podendo ter como etiologia fatores biológicos, comportamentais e ambientais, que para Enes e Slater (2010) se inter-relacionam e se potencializam entre si. Segu...

  15. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  16. Electronic absorption spectral studies of Pr(III) chelates with some amino acids

    Science.gov (United States)

    Kachhawa, Chanchal; Solanki, Kanika; Bhandari, H. S.

    2018-05-01

    Investigations on Pr(III) systems with 1:1 metal-ligand stoichiometric ratio have been carried out in different solvents. β - Alanine, Taurine and anthranilic acid have been opted as ligands for the investigations. The Study is based on doped crystal phenomenon. The Slater-Condon, spin-orbit, nephelauxetic, bonding, Racah and Judd-Ofelt parameters have been explored during the study. Four bands for Pr(III) have been observed and recorded in the region 350 nm to 900nm. Partial regression method has been used for calculations. Use of computational chemistry has been explored in order to develop better and easier methods of calculations.

  17. CONDOR simulation of an 11.4-GHz traveling wave output cavity

    International Nuclear Information System (INIS)

    Goren, Y.; Yu, D.

    1991-01-01

    The CONDOR code is used to simulate the cold test and the beam-induced microwave amplification of an 11.4-GHz, six-cell, disk-loaded, traveling wave cavity. Cold test simulation results are in agreement with a modified Slater's theory. Power extraction at the output port is calculated by launching a train of Gaussian electron bunches through the structure. Results are consistent with recent relativistic klystron experiments using a similar TW output cavity. It is further shown that, depending on operating beam parameters, the power extraction efficiency can be maximized by modification of various cells in the TW structure

  18. Low-energy rate enhancement in recombination processes of electrons into bare uranium ions

    International Nuclear Information System (INIS)

    Wu Yong; Zeng Siliang; Duan Bin; Yan Jun; Wang Jianguo; Chinese Academy of Sciences, Lanzhou; Dong Chenzhong; Ma Xinwen

    2007-01-01

    Based on the Dirac-Fork-Slater method combined with the multichannel quantum defect theory, the recombination processes of electrons into bare uranium ions (U 92+ ) are investigated in the relative energy range close to zero, and the x-ray spectrum emitted in the direct radiative recombination and cascades processes are simulated. Compared with the recent measurement, it is found that the rate enhancement comes from the additional populations on high Rydberg states. These additional populations may be produced by other recombination mechanisms, such as the external electric-magnetic effects and the many-body correlation effects, which still remains an open problem. (authors)

  19. Atomic structure calculation of energy levels and oscillator strengths in Ti ion, 2

    International Nuclear Information System (INIS)

    Ishii, Keishi

    1983-10-01

    Energy levels and oscillator strengths are calculated for 3s-3p and 3p-3d transition arrays in Ti X, isoelectronic to Al I. The energy levels are obtained by the Slater-Condon theory of atomic structure, including explicitly the strong configuration interactions. The results are presented both in numerical tables and in diagrams. In the tables, the observed data are included for comparison, where available. The calculated weighted oscillator strengths (gf-value) are also displayed in figures, where the weighted oscillator strengths are plotted as a function of wavelength. (author)

  20. Solving conic optimization problems via self-dual embedding and facial reduction: A unified approach

    DEFF Research Database (Denmark)

    Permenter, Frank; Friberg, Henrik A.; Andersen, Erling D.

    2017-01-01

    it fails to return a primal-dual optimal solution or a certificate of infeasibility. Using this observation, we give an algorithm based on facial reduction for solving the primal problem that, in principle, always succeeds. (An analogous algorithm is easily stated for the dual problem.) This algorithm has...... the appealing property that it only performs facial reduction when it is required, not when it is possible; e.g., if a primal-dual optimal solution exists, it will be found in lieu of a facial reduction certificate even if Slater's condition fails. For the case of linear, second-order, and semidefinite...

  1. Characterization of some electronic spectral parameters for doped Nd (III) ion in saturated aqueous solution of some pharmaceutical compounds

    International Nuclear Information System (INIS)

    Naulakha, Neelam; Soni, K.P.; Bhati, P.R.

    2000-01-01

    The stereo-environment of doped Nd(III) ion in various saturated solutions of some medicinal compounds has been studied for various electronic spectral parameters. The various electronic parameters, viz., Slater Condon (F k ), Lande (ζ 4f ) intensity of hypersensitive band ( 4 G 5/2 ), bonding parameter (b 1/2 ), Judd-Ofelt parameter (Tλ) and Racah parameter (E k ) for Nd(III) ion doped in saturated solution of diphenylhydramine, tripelennamine, chlorophenaramine, promethazine, terfinadine, naproxen, fenoprofen, flurbiprofen, oxaprozine, ketoprofen and ibuprofen have been studied. (author)

  2. Photoelectron angular distribution parameters for elements Z=55 to Z=100 in the photoelectron energy range 100-5000 eV

    CERN Document Server

    Trzhaskovskaya, M B; Yarzhemsky, V G

    2002-01-01

    Presented here are parameters of the angular distribution of photoelectrons along with the subshell photoionization cross sections for all atoms with 55<=Z<=100 and for atomic shells with binding energies lower than 2000 eV. The parameters are given for nine photoelectron energies in the range 100-5000 eV. Relativistic calculations have been carried out within the quadrupole approximation by the use of the central Dirac-Fock-Slater potential. The effect of the hole resulting in the atomic subshell after photoionization has been taken into account in the framework of the frozen orbital approximation.

  3. Further microscopic studies of the fission barriers of heavy nuclei

    International Nuclear Information System (INIS)

    Nhan Hao, T.V.; Le Bloas, J.; Bonneau, L.; Quentin, P.; Koh, Meng-Hock

    2012-01-01

    Two systematic sources of error in most current microscopic evaluations of fission-barrier heights are studied. They are concerned with an approximate treatment of the Coulomb exchange terms (known as the Slater approximation) in the self-consistent mean-fields and the projection on good parity states (e.g., of positive parity for the spontaneous fission of an even–even nucleus) of left–right reflection asymmetric intrinsic solutions (e.g., around the second barrier). Approximate or unprojected solutions are shown to lead each to an underestimation of the barrier heights by a few hundred keV. (author)

  4. La aproximación topológica en el cálculo de orbitales moleculares localizados.

    OpenAIRE

    Paniagua, Juan Carlos

    1983-01-01

    [spa] Es bien sabido que cualquier función de onda que se exprese como determinante de Slater construido a partir de orbitales moleculares doblemente ocupados es invariante frente a transformaciones unitarias de dichos orbitales. Aunque las posibilidades de elección son ilimitadas, en la práctica sólo se utilizan dos tipos de orbitales: los canónicos y los localizados. Los primeros se caracterizan por ser funciones propias de algún hamiltoniano monoelectrónico efectivo y entre sus propieda...

  5. Aproximación topológica en el cálculo de orbitales moleculares localizados, La

    OpenAIRE

    Paniagua Valle, Juan Carlos

    1983-01-01

    Es bien sabido que cualquier función de onda que se exprese como determinante de Slater construido a partir de orbitales moleculares doblemente ocupados es invariante frente a transformaciones unitarias de dichos orbitales.Aunque las posibilidades de elección son ilimitadas, en la práctica sólo se utilizan dos tipos de orbitales: los canónicos y los localizados. Los primeros se caracterizan por ser funciones propias de algún hamiltoniano monoelectrónico efectivo y entre sus propiedades más in...

  6. Tunneling of self-trapped states and formation of a band

    International Nuclear Information System (INIS)

    Yonemitsu, K.

    1993-12-01

    Tunneling of a self-trapped kink and formation of a band are studied semi classically in the one-dimensional extended Peierls-Hubbard model near half filling, considering up to Gaussian fluctuations around imaginary-time-dependent periodic motion of electrons and phonons on the stationary phase of the action derived using Slater determinants. In the strong-coupling limit of both the Holstein and attractive Hubbard models, it reproduces analytically-known effective hopping of a single bipolaron because the tunneling involves only one in this limit. The method gives new results in other general cases and is easily applied to excited or more complex systems. 13 refs, 4 figs

  7. Classical dynamics of triatomic system: energized harmonic molecules

    International Nuclear Information System (INIS)

    Parr, C.A.; Kuppermann, A.; Porter, R.N.

    1976-01-01

    The dynamical assumptions underlying the Slater and RRK classical-mechanical theories of unimolecular reaction rates are investigated. The predictions of these theories for several nonlinear, triatomic, harmonically-bonded molecular models are compared with the results obtained from the integration of the classical equations of motion. The accuracy of the small-vibration and weak-coupling assumptions are found to break down at energies above about one quarter of a bond dissociation energy. Nonetheless, the small-vibration approximation predicts reaction frequencies in good agreement with the exact results for the models. The effects of rotation on intramolecular energy exchange are examined and found to be significant

  8. Relativistic multiple scattering X-alpha calculations

    International Nuclear Information System (INIS)

    Chermette, H.; Goursot, A.

    1986-01-01

    The necessity to include self-consistent relativistic corrections in molecular calculations has been pointed out for all compounds involving heavy atoms. Most of the changes in the electronic properties are due to the mass-velocity and the so-called Darwin terms so that the use of Wood and Boring's Hamiltonian is very convenient for this purpose as it can be easily included in MSXalpha programs. Although the spin orbit operator effects are only obtained by perturbation theory, the results compare fairly well with experiment and with other relativistic calculations, namely Hartree-Fock-Slater calculations

  9. Experimental and theoretical Compton profiles of Be, C and Al

    Energy Technology Data Exchange (ETDEWEB)

    Aguiar, Julio C., E-mail: jaguiar@arn.gob.a [Autoridad Regulatoria Nuclear, Av. Del Libertador 8250, C1429BNP, Buenos Aires (Argentina); Instituto de Fisica ' Arroyo Seco' , Facultad de Ciencias Exactas, U.N.C.P.B.A., Pinto 399, 7000 Tandil (Argentina); Di Rocco, Hector O. [Instituto de Fisica ' Arroyo Seco' , Facultad de Ciencias Exactas, U.N.C.P.B.A., Pinto 399, 7000 Tandil (Argentina); Arazi, Andres [Laboratorio TANDAR, Comision Nacional de Energia Atomica, Av. General Paz 1499, 1650 San Martin, Buenos Aires (Argentina)

    2011-02-01

    The results of Compton profile measurements, Fermi momentum determinations, and theoretical values obtained from a linear combination of Slater-type orbital (STO) for core electrons in beryllium; carbon and aluminium are presented. In addition, a Thomas-Fermi model is used to estimate the contribution of valence electrons to the Compton profile. Measurements were performed using monoenergetic photons of 59.54 keV provided by a low-intensity Am-241 {gamma}-ray source. Scattered photons were detected at 90{sup o} from the beam direction using a p-type coaxial high-purity germanium detector (HPGe). The experimental results are in good agreement with theoretical calculations.

  10. Classic Multi-Configuration-Dirac-Fock and Hartree-Fock-Relativistic methods integrated into a program package for the RAL-IBM mainframe with automatic comparative output

    International Nuclear Information System (INIS)

    Cowan, R.D.; Grant, I.P.; Fawcett, B.C.; Rose, S.J.

    1985-11-01

    A Multi-Configuration-Dirac-Fock (MCDF) computer program is adapted to interface with the Hartree-Fock-Relativistic (HFR) program for the RAL IBM mainframe computer. The two codes are integrated into a package which includes the Zeeman Laboratory Slater parameter optimisation routines as well as new RAL routines to further process the HFR and MCDF output. A description of the adaptions to MCDF and new output extensions is included in this report, and details are given regarding HFR FORTRAN subroutines, and lists of Job Control Language (JCL) files for the complete package. (author)

  11. Determination of calibration constants for perturbing objects of cavity resonators

    International Nuclear Information System (INIS)

    Franco, M.A.R.; Serrao, V.A.; Fuhrmann, C.

    1989-05-01

    Using the Slater theorem, the calibrating constants for objects utilized in the tecnique of perturbing measurements of cavities electric and magnetic fields have been determined. Such perturbing objects are utilized in the measurements of the shunt impedance and electric field relative intensity ocurring in linac accelerating structures. To determine the calibrating constants of the perturbing objects, a cylindrical cavity of well know field pattern has been utilized. The cavity was excited in two differente modes of oscillation and the experimental results are in good aggrement with the theoretical values. (author) [pt

  12. Component separation in harmonically trapped boson-fermion mixtures

    DEFF Research Database (Denmark)

    Nygaard, Nicolai; Mølmer, Klaus

    1999-01-01

    We present a numerical study of mixed boson-fermion systems at zero temperature in isotropic and anise tropic harmonic traps. We investigate the phenomenon of component separation as a function of the strength ut the interparticle interaction. While solving a Gross-Pitaevskii mean-field equation ...... for the boson distribution in the trap, we utilize two different methods to extract the density profile of the fermion component; a semiclassical Thomas-Fermi approximation and a quantum-mechanical Slater determinant Schrodinger equation....

  13. DFTB{sup +} and lanthanides

    Energy Technology Data Exchange (ETDEWEB)

    Hourahine, B [Department of Physics, SUPA, University of Strathclyde, John Anderson Building, 107 Rottenrow, Glasgow G4 0NG (United Kingdom); Aradi, B; Frauenheim, T, E-mail: benjamin.hourahine@strath.ac.u [BCCMS, Universitaet Bremen, Am Fallturm 1, 28359 Bremen (Germany)

    2010-07-01

    DFTB{sup +} is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.

  14. On the imaginary part of the S-wave pion-nucleus optical potential

    International Nuclear Information System (INIS)

    Germond, J.F.; Lombard, R.J.

    1991-01-01

    The contribution of pion absorption to the imaginary part of the S-wave pion-nucleus optical potential is calculated with Slater determinantal antisymmetrized nuclear wave funtions, taking fully into accout the spin and isospin degrees of freedom. The potential obtained has an explicit dependence on the proton and neutron nuclear densities whose coefficients are directly related to the two-nucleon absorption coupling constants. The values of these coefficients extracted from mesic atoms data are in good agreement with those deduced from exclusive pion absorption experiments in 3 He, but larger than the predictions of the pion rescattering model. (orig.)

  15. A hybrid configuration interaction treatment based on seniority number and excitation schemes

    International Nuclear Information System (INIS)

    Alcoba, Diego R.; Capuzzi, Pablo; Torre, Alicia; Lain, Luis; Oña, Ofelia B.; Van Raemdonck, Mario; Bultinck, Patrick; Van Neck, Dimitri

    2014-01-01

    We present a configuration interaction method in which the Hamiltonian of an N-electron system is projected on Slater determinants selected according to the seniority-number criterion along with the traditional excitation-based procedure. This proposed method is especially useful to describe systems which exhibit dynamic (weak) correlation at determined geometric arrangements (where the excitation-based procedure is more suitable) but show static (strong) correlation at other arrangements (where the seniority-number technique is preferred). The hybrid method amends the shortcomings of both individual determinant selection procedures, yielding correct shapes of potential energy curves with results closer to those provided by the full configuration interaction method

  16. The generalized sturmian method for calculating spectra of atoms and ions

    DEFF Research Database (Denmark)

    Avery, James Emil; Avery, John Scales

    2003-01-01

    The properties of generalized Sturmian basis sets are reviewed, and functions of this type are used to perform direct configuration interaction calculations on the spectra of atoms and ions. Singlet excited states calculated in this way show good agreement with experimentally measured spectra. When...... the generalized Sturmian method is applied to atoms, the configurations are constructed from hydrogenlike atomic orbitals with an effective charge which is characteristic of the configuration. Thus, orthonormality between the orbitals of different configurations cannot be assumed, and the generalized Slater...

  17. Status on the heavy elements research using the DV-DFS method

    International Nuclear Information System (INIS)

    Hirata, Masaru; Bastug, T.; Sekine, Rika; Onoe, Jun; Nakamatsu, Hirohide; Mukoyama, Takeshi

    1999-03-01

    In this review report, we describe recent progress on the heavy elements research using the discrete-variational Dirac-Fock-Slater (DV-DFS) method which is being improved by Kyoto University, Shizuoka University, RIKEN and JAERI. The DV-DFS is a versatile method for interpreting spectroscopic data and predicting chemical bonding of polyatomic systems including heavy elements. This review is based on the lectures given in 74th spring meeting of chemical Society of Japan (March, 1998) and also at the workshop on the XAFS-relativistic electronic structure calculation for the actinides research which was held at Tokai Research Establishment of JAERI (November, 1998). (author)

  18. Coupled channel calculations of K-shell ionization in asymmetric collision systems

    International Nuclear Information System (INIS)

    Mehler, G.; Greiner, W.; Soff, G.

    1986-07-01

    We report theoretical results on K-shell ionization for a variety of asymmetric collision systems. The calculated ionization rates are compared with experimental data. The coupled channel formalism underlying these calculations is presented. It is based on a set of relativistic target centred states, taking a screened potential of Dirac-Fock-Slater type into account. We discuss the effects of different matrix elements, e.g. continuum-continuum couplings. The binding effect is inherently contained in our approach and described in a dynamical way. (orig.)

  19. Novel extrapolation method in the Monte Carlo shell model

    International Nuclear Information System (INIS)

    Shimizu, Noritaka; Abe, Takashi; Utsuno, Yutaka; Mizusaki, Takahiro; Otsuka, Takaharu; Honma, Michio

    2010-01-01

    We propose an extrapolation method utilizing energy variance in the Monte Carlo shell model to estimate the energy eigenvalue and observables accurately. We derive a formula for the energy variance with deformed Slater determinants, which enables us to calculate the energy variance efficiently. The feasibility of the method is demonstrated for the full pf-shell calculation of 56 Ni, and the applicability of the method to a system beyond the current limit of exact diagonalization is shown for the pf+g 9/2 -shell calculation of 64 Ge.

  20. On the anisotropy energies for YCo5, RCo5, Y2Co17, and R2Co17

    International Nuclear Information System (INIS)

    Takahashi, H.; Hikosaka, K.; Ohtsuka, S.; Seo, A.; Ukai, T.; Mori, N.

    1988-01-01

    The approximate d bands for YCo 5 , RCo 5 , Y 2 Co 17 , and R 2 Co 17 (Th 2 Zn 17 and Th 2 Ni 17 type) are formulated by Deegan's prescription and the formulas of Slater and Koster. The experimental results of YCo 5 and Y 2 Co 17 are discussed by using these approximate d bands. For RCo 5 and R 2 Co 17 the discussions are made by adopting the localized model and the band model for 4f electrons

  1. Validating a mathematical model for inverse osmosis in an experimental flat membrane plant; Validacion de un modelo matematico para osmosis inversa con una planta piloto de membranas planas

    Energy Technology Data Exchange (ETDEWEB)

    Gomez Gotor, A.; Salama, B.; Argudo, C.

    1999-05-01

    The different theories regarding inverse osmosis have given rise to mathematical models. This article describes an experiment using the model developed by Slater et al. based on the solution-diffusion theory. A DOW DANMARK SEPARATION SYSTEMS OI LAB-UNIT M 20 was employed together with a pair of type HR 98 PP flat membranes also from DOW DANMARK A/S SEPARATION SYSTEMS. The solution used to study the operational variables was KCI. The findings in regard to volumetric flows and permeate concentrations conformed to the expected trends. The model`s constants were also determined and their predictive value verified. (Author) 9 refs.

  2. Dielectric Relaxation of Water: Theory and Experiment

    International Nuclear Information System (INIS)

    Adhikari, Narayan Prasad; Paudyal, Harihar; Johri, Manoj

    2010-06-01

    We have studied the hydrogen bond dynamics and methods for evaluation of probability and relaxation time for hydrogen bond network. Further, dielectric relaxation time has been calculated by using a diagonalization procedure by obtaining eigen values (inverse of relaxation time) of a master equation framed on the basis of Fokker-Planck equations. Microwave cavity spectrometer has been described to make measurements of relaxation time. Slater's perturbation equations are given for the analysis of the data. A comparison of theoretical and experimental data shows that there is a need for improvements in the theoretical model and experimental techniques to provide exact information about structural properties of water. (author)

  3. Non-orthogonal configuration interaction for the calculation of multielectron excited states

    Energy Technology Data Exchange (ETDEWEB)

    Sundstrom, Eric J., E-mail: eric.jon.sundstrom@berkeley.edu; Head-Gordon, Martin [Department of Chemistry, University of California Berkeley, Berkeley, California 94720, USA and Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

    2014-03-21

    We apply Non-orthogonal Configuration Interaction (NOCI) to molecular systems where multielectron excitations, in this case double excitations, play a substantial role: the linear polyenes and β-carotene. We demonstrate that NOCI when applied to systems with extended conjugation, provides a qualitatively correct wavefunction at a fraction of the cost of many other multireference treatments. We also present a new extension to this method allowing for purification of higher-order spin states by utilizing Generalized Hartree-Fock Slater determinants and the details for computing 〈S{sup 2}〉 for the ground and excited states.

  4. A Hartree-Fock program for atomic structure calculations

    International Nuclear Information System (INIS)

    Mitroy, J.

    1999-01-01

    The Hartree-Fock equations for a general open shell atom are described. The matrix equations that result when the single particle orbitals are written in terms of a linear combination of analytic basis functions are derived. Attention is paid to the complexities that occur when open shells are present. The specifics of a working FORTRAN program which is available for public use are described. The program has the flexibility to handle either Slater-type orbitals or Gaussian-type orbitals. It can be obtained over the internet at http://lacebark.ntu.edu.au/j_mitroy/research/atomic.htm Copyright (1999) CSIRO Australia

  5. Microscopic theories for collective motions of large amplitude

    International Nuclear Information System (INIS)

    Souza Cruz, F.F. de.

    1986-01-01

    The many proposals of ''Collective Paths'' that have appeared in literature, were derived through a local analysis of the Time Dependent Hartree Fock dynamics. Those proposals were compared and validity conditions obtained for Semiclassical Hamiltonians which have only quadratic terms in momenta. A careful analysis of the parametrization of Slater Determinants allowed us to exploit the geometrical features of the Time Dependent Hartree Fock Theory and construct the Paths in a covariant way. The analysis was applied to a three level model (Su(3)). (author) [pt

  6. Características de la práctica físico-deportiva del alumnado con discapacidad de la Universitat de València

    OpenAIRE

    Úbeda Colomer, Joan; Campos Granell, José; Llopis Goig, Ramón; Torregrosa Cabrera, Miguel Ángel

    2015-01-01

    En la actualidad, la actividad físico-deportiva es fundamental para las personas con discapacidad debido a los múltiples beneficios físicos, psicológicos y sociales que aporta (Patel y Greydanus, 2010; Slater y Meade, 2004). Estudiar las características de la práctica físico-deportiva de este colectivo puede ser útil para poder desarrollar estrategias y programas que mejoren y aumenten dicha práctica (Bragaru,van Wilgen, Geertzen, Ruijs, Dijsktra y Dekker, 2013). Pese a ello, apenas existen e...

  7. CARACTERÍSTICAS DE LA PRÁCTICA FÍSICO-DEPORTIVA DEL ALUMNADO CON DISCAPACIDAD DE LA UNIVERSITAT DE VALÈNCIA

    OpenAIRE

    Joan Úbeda Colomer; José Campos Granell; Ramón Llopis Goig; Miguel Ángel Torregrosa Cabrera

    2015-01-01

    En la actualidad, la actividad físico-deportiva es fundamental para las personas con discapacidad debido a los múltiples beneficios físicos, psicológicos y sociales que aporta (Patel y Greydanus, 2010; Slater y Meade, 2004). Estudiar las características de la práctica físico-deportiva de este colectivo puede ser útil para poder desarrollar estrategias y programas que mejoren y aumenten dicha práctica (Bragaru, van Wilgen, Geertzen, Ruijs, Dijsktra y Dekker, 2013). Pese a ello, apenas existen ...

  8. Handbook of Gaussian basis sets

    International Nuclear Information System (INIS)

    Poirier, R.; Kari, R.; Csizmadia, I.G.

    1985-01-01

    A collection of a large body of information is presented useful for chemists involved in molecular Gaussian computations. Every effort has been made by the authors to collect all available data for cartesian Gaussian as found in the literature up to July of 1984. The data in this text includes a large collection of polarization function exponents but in this case the collection is not complete. Exponents for Slater type orbitals (STO) were included for completeness. This text offers a collection of Gaussian exponents primarily without criticism. (Auth.)

  9. Quantum Monte Carlo calculation of the Fermi-liquid parameters in the two-dimensional electron gas

    International Nuclear Information System (INIS)

    Kwon, Y.; Ceperley, D.M.; Martin, R.M.

    1994-01-01

    Excitations of the two-dimensional electron gas, including many-body effects, are calculated with a variational Monte Carlo method. Correlated sampling is introduced to calculate small energy differences between different excitations. The usual pair-product (Slater-Jastrow) trial wave function is found to lack certain correlations entirely so that backflow correlation is crucial. From the excitation energies calculated here, we determine Fermi-liquid parameters and related physical quantities such as the effective mass and the Lande g factor of the system. Our results for the effective mass are compared with previous analytic calculations

  10. A hybrid configuration interaction treatment based on seniority number and excitation schemes

    Energy Technology Data Exchange (ETDEWEB)

    Alcoba, Diego R.; Capuzzi, Pablo [Departamento de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and Instituto de Física de Buenos Aires, Consejo Nacional de Investigaciones Científicas y Técnicas, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Torre, Alicia; Lain, Luis, E-mail: qfplapel@lg.ehu.es [Departamento de Química Física, Facultad de Ciencia y Tecnología, Universidad del País Vasco, Apdo. 644 E-48080 Bilbao (Spain); Oña, Ofelia B. [Instituto de Investigaciones Fisicoquímicas Teóricas y Aplicadas, Universidad Nacional de La Plata, CCT La Plata, Consejo Nacional de Investigaciones Científicas y Técnicas, Diag. 113 y 64 (S/N), Sucursal 4, CC 16, 1900 La Plata (Argentina); Van Raemdonck, Mario; Bultinck, Patrick [Department of Inorganic and Physical Chemistry, Ghent University, Krijgslaan 281 (S3), 9000 Gent (Belgium); Van Neck, Dimitri [Center for Molecular Modelling, Ghent University, Technologiepark 903, 9052 Zwijnaarde (Belgium)

    2014-12-28

    We present a configuration interaction method in which the Hamiltonian of an N-electron system is projected on Slater determinants selected according to the seniority-number criterion along with the traditional excitation-based procedure. This proposed method is especially useful to describe systems which exhibit dynamic (weak) correlation at determined geometric arrangements (where the excitation-based procedure is more suitable) but show static (strong) correlation at other arrangements (where the seniority-number technique is preferred). The hybrid method amends the shortcomings of both individual determinant selection procedures, yielding correct shapes of potential energy curves with results closer to those provided by the full configuration interaction method.

  11. Evaluation of artificial radioactivity of the north Western mediterranean sea and evaluation of the sanitary consequences

    International Nuclear Information System (INIS)

    Calmet, D.; Daburon, M.L.; Willemot, J.M.

    1985-01-01

    The results of radiological measurements of the north west mediterranean observation network outline the level of artificial radionuclides coming from industrial seewages, 106 Ru and from atmospheric fall out, 137 Cs and sup(239+240)Pu measured on 3 differents types of bioindicators: Mytilus sp., Posidonia oceanica (L.) Del. and demersal fishes as Solea sp., Anguilla anguilla L., Conger conger L. Mytilus sp. is quite a perfect bioindicator of radionuclides contamination but must be linked with fishes sampling which muscles concentrate Cesium at higher level. The sanitary consequences for the waterside population involved by molluscs and fishes ingestion contamined by these 3 radionuclides lead to a fraction (10 -5 ) of the annual dose limit recommanded by the ICRP 26 [fr

  12. Reduced resilience of a globally distributed coccolithophore to ocean acidification: Confirmed up to 2000 generations, supplement to: Jin, Peng; Gao, Kunshan (2016): Reduced resilience of a globally distributed coccolithophore to ocean acidification: Confirmed up to 2000 generations. Marine Pollution Bulletin, 103(1-2), 101-108

    KAUST Repository

    Jin, Peng

    2016-01-01

    Ocean acidification (OA), induced by rapid anthropogenic CO2 rise and its dissolution in seawater, is known to have consequences for marine organisms. However, knowledge on the evolutionary responses of phytoplankton to OA has been poorly studied. Here we examined the coccolithophore Gephyrocapsa oceanica, while growing it for 2000 generations under ambient and elevated CO2 levels. While OA stimulated growth in the earlier selection period (from generations 700 to 1550), it reduced it in the later selection period up to 2000 generations. Similarly, stimulated production of particulate organic carbon and nitrogen reduced with increasing selection period and decreased under OA up to 2000 generations. The specific adaptation of growth to OA disappeared in generations 1700 to 2000 when compared with that at 1000 generations. Both phenotypic plasticity and fitness decreased within selection time, suggesting that the species\\' resilience to OA decreased after 2000 generations under high CO2 selection.

  13. Pervasive plastisphere: First record of plastics in egagropiles (Posidonia spheroids).

    Science.gov (United States)

    Pietrelli, Loris; Di Gennaro, Alessia; Menegoni, Patrizia; Lecce, Francesca; Poeta, Gianluca; Acosta, Alicia T R; Battisti, Corrado; Iannilli, Valentina

    2017-10-01

    The ability of Posidonia oceanica spheroids (egagropiles, EG) to incorporate plastics was investigated along the central Italy coast. Plastics were found in the 52.84% of the egagropiles collected (n = 685). The more represented size of plastics has range within 1-1.5 cm, comparable to the size of natural fibres. Comparing plastics occurring both in EG and in surrounding sand, Polyethylene, Polyester and Nylon were the most abundant polymers in EG, while PSE, PE, PP and PET were the most represented in sand. In particular PE and PP were significantly more represented in sand, while PE, Nylon, Polyester and microfibers (as pills) were more represented in EG. Within plastics found in EG, 26.9% were microfibers as small pills (PET mixing. These microfibers might be produced by discharges from washing machines and currently represents an emerging pollutant with widespread distribution in marine and freshwater ecosystems. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Looking for hotspots of marine metacommunity connectivity: a methodological framework

    Science.gov (United States)

    Melià, Paco; Schiavina, Marcello; Rossetto, Marisa; Gatto, Marino; Fraschetti, Simonetta; Casagrandi, Renato

    2016-03-01

    Seascape connectivity critically affects the spatiotemporal dynamics of marine metacommunities. Understanding how connectivity patterns emerge from physically and biologically-mediated interactions is therefore crucial to conserve marine ecosystem functions and biodiversity. Here, we develop a set of biophysical models to explore connectivity in assemblages of species belonging to a typical Mediterranean community (Posidonia oceanica meadows) and characterized by different dispersing traits. We propose a novel methodological framework to synthesize species-specific results into a set of community connectivity metrics and show that spatiotemporal variation in magnitude and direction of the connections, as well as interspecific differences in dispersing traits, are key factors structuring community connectivity. We eventually demonstrate how these metrics can be used to characterize the functional role of each marine area in determining patterns of community connectivity at the basin level and to support marine conservation planning.

  15. Diel activity and variability in habitat use of white sea bream in a temperate marine protected area.

    Science.gov (United States)

    Di Lorenzo, Manfredi; Fernández, Tomás Vega; Badalamenti, Fabio; Guidetti, Paolo; Starr, Richard M; Giacalone, Vincenzo Maximiliano; Di Franco, Antonio; D'Anna, Giovanni

    2016-05-01

    Fish populations are often comprised of individuals that use habitats and associated resources in different ways. We placed sonic transmitters in, and tracked movements of, white sea bream (Diplodus sargus sargus) in the no-take zone of a Mediterranean marine protected area: the Torre Guaceto marine protected area, (Adriatic Sea, Italy). Tagged fish displayed three types of diel activity patterns in three different habitats: sand, rocky reefs and "matte" of the seagrass Posidonia oceanica. Individuals were more active during the day than at night. Overall, white sea bream displayed a remarkable behavioural plasticity in habitat use. Our results indicate that the observed behavioural plasticity in the marine protected area could be the result of multiple ecological and environmental drivers such as size, sex and increased intra-specific competition. Our findings support the view that habitat diversity helps support high densities of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Reduced resilience of a globally distributed coccolithophore to ocean acidification: Confirmed up to 2000 generations

    KAUST Repository

    Jin, Peng

    2015-12-30

    © 2015 Elsevier Ltd. Ocean acidification (OA), induced by rapid anthropogenic CO2 rise and its dissolution in seawater, is known to have consequences for marine organisms. However, knowledge on the evolutionary responses of phytoplankton to OA has been poorly studied. Here we examined the coccolithophore Gephyrocapsa oceanica, while growing it for 2000 generations under ambient and elevated CO2 levels. While OA stimulated growth in the earlier selection period (from generations ~700 to ~1550), it reduced it in the later selection period up to 2000 generations. Similarly, stimulated production of particulate organic carbon and nitrogen reduced with increasing selection period and decreased under OA up to 2000 generations. The specific adaptation of growth to OA disappeared in generations 1700 to 2000 when compared with that at 1000 generations. Both phenotypic plasticity and fitness decreased within selection time, suggesting that the species\\' resilience to OA decreased after 2000 generations under high CO2 selection.

  17. Semiclassical statistical mechanics of fluids

    International Nuclear Information System (INIS)

    Singh, Y.; Sinha, S.K.

    1981-01-01

    The problem of calculating the equilibrium properties of fluids in the semiclassical limit when the quantum effects are small is studied. Particle distribution functions and thermodynamic quantities are defined in terms of the Slater sum and methods for evaluating the Slater sum are discussed. It is shown that the expansion method employing the usual Wigner-Kirkwood or Hemmer-Jancovici series is not suitable to treat the properties of the condensed state. Using the grand canonical ensemble and functional differentiation technique we develop cluster expansion series of the Helmholtz free energy and pair correlation functions. Using topological reduction we transform these series to more compact form involving a renormalized potential or a renormalized Mayer function. Then the convergence of the two series is improved by an optimal choice of the renormalized potential or the Mayer function. Integral equation theories are derived and used to devise perturbation methods. An application of these methods to the calculation of the virial coefficients, thermodynamic properties and the pair correlation function for model fluids is discussed. (orig.)

  18. Molecular cluster theory of chemical bonding in actinide oxide

    International Nuclear Information System (INIS)

    Ellis, D.E.; Gubanov, V.A.; Rosen, A.

    1978-01-01

    The electronic structure of actinide monoxides AcO and dioxides AcO 2 , where Ac = Th, U, Np, Pu, Am, Cm and Bk has been studied by molecular cluster methods based on the first-principles one-electron local density theory. Molecular orbitals for nearest neighbor clusters AcO 10- 6 and AcO 12- 8 representative of monoxide and dioxide lattices were obtained using non-relativistic spin-restricted and spin-polarized Hartree-Fock-Slater models for the entire series. Fully relativistic Dirac-Slater calculations were performed for ThO, UO and NpO in order to explore magnitude of spin-orbit splittings and level shifts in valence structure. Self-consistent iterations were carried out for NpO, in which the NpO 6 cluster was embedded in the molecular field of the solid. Finally, a ''moment polarized'' model which combines both spin-polarization and relativistic effects in a consistent fashion was applied to the NpO system. Covalent mixing of oxygen 2p and Ac 5f orbitals was found to increase rapidly across the actinide series; metal s,p,d covalency was found to be nearly constant. Mulliken atomic population analysis of cluster eigenvectors shows that free-ion crystal field models are unreliable, except for the light actinides. X-ray photoelectron line shapes have been calculated and are found to compare rather well with experimental data on the dioxides

  19. State-specific transport properties of electronically excited Ar and C

    Science.gov (United States)

    Istomin, V. A.; Kustova, E. V.

    2018-05-01

    In the present study, a theoretical model of state-resolved transport properties in electronically excited atomic species developed earlier is applied to argon and carbon atomic species. It is shown that for Ar and C, similarly to the case of atomic nitrogen and oxygen, the Slater-like models can be applied to calculate diameters of electronically excited atoms. Using the Slater-like model it is shown that for half-filled N (2 px1py1pz1) and full-filled Ar (3 px2py2pz2) electronic shells the growth of atomic radius goes slowly compared to C (2 px1py1) and O (2 px2py1pz1). The effect of collision diameters on the transport properties of Ar and C is evaluated. The influence of accounted number of electronic levels on the transport coefficients is examined for the case of Boltzmann distributions over electronic energy levels. It is emphasized that in the temperature range 1000-14000 K, for Boltzmann-like distributions over electronic states the number of accounted electronic levels do not influence the transport coefficients. Contrary to this, for higher temperatures T > 14000 K this effect becomes of importance, especially for argon.

  20. Geminal embedding scheme for optimal atomic basis set construction in correlated calculations

    Energy Technology Data Exchange (ETDEWEB)

    Sorella, S., E-mail: sorella@sissa.it [International School for Advanced Studies (SISSA), Via Beirut 2-4, 34014 Trieste, Italy and INFM Democritos National Simulation Center, Trieste (Italy); Devaux, N.; Dagrada, M., E-mail: mario.dagrada@impmc.upmc.fr [Institut de Minéralogie, de Physique des Matériaux et de Cosmochimie, Université Pierre et Marie Curie, Case 115, 4 Place Jussieu, 75252 Paris Cedex 05 (France); Mazzola, G., E-mail: gmazzola@phys.ethz.ch [Theoretische Physik, ETH Zurich, 8093 Zurich (Switzerland); Casula, M., E-mail: michele.casula@impmc.upmc.fr [CNRS and Institut de Minéralogie, de Physique des Matériaux et de Cosmochimie, Université Pierre et Marie Curie, Case 115, 4 Place Jussieu, 75252 Paris Cedex 05 (France)

    2015-12-28

    We introduce an efficient method to construct optimal and system adaptive basis sets for use in electronic structure and quantum Monte Carlo calculations. The method is based on an embedding scheme in which a reference atom is singled out from its environment, while the entire system (atom and environment) is described by a Slater determinant or its antisymmetrized geminal power (AGP) extension. The embedding procedure described here allows for the systematic and consistent contraction of the primitive basis set into geminal embedded orbitals (GEOs), with a dramatic reduction of the number of variational parameters necessary to represent the many-body wave function, for a chosen target accuracy. Within the variational Monte Carlo method, the Slater or AGP part is determined by a variational minimization of the energy of the whole system in presence of a flexible and accurate Jastrow factor, representing most of the dynamical electronic correlation. The resulting GEO basis set opens the way for a fully controlled optimization of many-body wave functions in electronic structure calculation of bulk materials, namely, containing a large number of electrons and atoms. We present applications on the water molecule, the volume collapse transition in cerium, and the high-pressure liquid hydrogen.

  1. Preparation of metastable CoFeNi alloys with ultra-high magnetic saturation (Bs = 2.4-2.59 T) by reverse pulse electrodeposition

    Science.gov (United States)

    Tabakovic, Ibro; Venkatasamy, Venkatram

    2018-04-01

    The results of reverse pulse electrodeposition of CoFeNi films with ultra-high magnetic saturation, i.e. Bs values between 2.4 and 2.59 T, are presented in this work. Based on valence-bond theory (Hund's rule) it was assumed that the electronic configuration of MOH obtained by one electron reduction of electroactive intermediate (MOH+ads + e → MOHads) or oxidation of metal (M - e + HOH → MOH + H+) would result with larger number of spins per atom for each of transition metals in MOH-precipitated in CoFeNi deposit- with one more spin than their respective neutral metal in the order: Fe > Co > Ni. The experimental results showed that the increase of Bs value above Slater-Pauling curve was not observed for CoFe alloys, thus FeOH and CoOH compounds were not present in deposit. However, the increase of the Bs values above the Slater-Pauling curve (Bs = 2.4-2.59 T) was observed, for CoFeNi films obtained by reverse pulse electrodeposition. Therefore, NiOH as a stable compound is probably formed in a one-electron oxidation step during anodic pulse oxidation reaction precipitated presumably at the grain boundaries, giving rise to the ultra-high magnetic saturation of CoFeNi films. The effects of experimental conditions on elemental composition, magnetic properties, crystal structure, and thermal stability of CoFeNi films were studied.

  2. Study of Atoms and Molecules with Auxiliary-Field Quantum Monte Carlo

    Science.gov (United States)

    Purwanto, Wirawan; Suewattana, Malliga; Krakauer, Henry; Zhang, Shiwei; Walter, Eric J.

    2006-03-01

    We study the ground-state properties of second-row atoms and molecules using the phaseless auxiliary-field quantum Monte Carlo (AF QMC) method. This method projects the many-body ground state from a trial wave function by means of random walks in the Slater-determinant space. We use a single Slater-determinant trial wave function obtained from density-functional theory (DFT) or Hartree-Fock (HF) calculations. The calculations were done with a plane-wave basis and supercells with periodic boundary condition. We investigate the finite-size effects and the accuracy of pseudopotentials within DFT, HF, and AF QMC frameworks. Pseudopotentials generated from both LDA (OPIUM) and HF are employed. We find that the many-body QMC calculations show a greater sensitivity to the accuracy of the pseudopotentials. With reliable pseudopotentials, the ionization potentials and dissociation energies obtained using AF QMC are in excellent agreement with the experimental results. S. Zhang and H. Krakauer, Phys. Rev. Lett. 90, 136401 (2003) http://opium.sourceforge.net I. Ovcharenko, A. Aspuru-Guzik, and W. A. Lester, J. Chem. Phys. 114, 7790 (2001)

  3. M sub shell X-ray emission cross section measurements for Pt, Au, Hg, Pb, Th and U at 8 and 10 keV synchrotron photons

    International Nuclear Information System (INIS)

    Kaur, Gurpreet; Gupta, Sheenu; Tiwari, M.K.; Mittal, Raj

    2014-01-01

    Highlights: • First time M sub shell fluorescence cross section measurements at 8 and 10 keV photons. • Comparison with theoretical evaluations from different model data for parameters. • Explained the large deviations from the trend of parameters with atomic number Z. • A specific pattern of cross sections with Z is predicted in the region, 78 ⩽ Z ⩽ 92. • Confirmation of prediction requires more experiment in these Z and energy region. -- Abstract: M sub shell X-ray emission cross sections of Pt, Au, Hg, Pb, Th and U at 8 and 10 keV photon energies have been determined with linearly polarized photon beam from Indus-2 synchrotron source. The measured cross sections have been reported for the first time and were used to check the available theoretical Dirac–Hartree–Slater (DHS) and Dirac–Fock (DF) values reported in literature and also the presently derived Non Relativistic Hartree–Slater (NRHS), DF and DHS values for M ξ , M δ , M α , M β , M γ , M m1 and M m2 group of X-rays

  4. Li (i = 1-3) subshell X-ray production cross sections and fluorescence yields for some elements with 56 ≤ Z ≤ 68 at 22.6 keV

    International Nuclear Information System (INIS)

    Chauhan, Yogeshwar; Tiwari, M.K.; Puri, Sanjiv

    2008-01-01

    The L k (k = l, α, β 1,4 , β 3,6 , β 2,15,9,10,7 , γ 1,5 and γ 2,3,4 ) X-ray production (XRP) cross sections have been measured for six elements with 56 ≤ Z ≤ 68 at 22.6 keV incident photon energy using the EDXRF spectrometer. The incident photon intensity, detector efficiency and geometrical factors have been determined from the K X-ray yields emitted from elemental targets with 22 ≤ Z ≤ 42 in the same geometrical setup and from knowledge of the K XRP cross sections. The L 1 and L 2 subshell fluorescence yields have been deduced from the present measured L k XRP cross sections using the relativistic Hartree-Fock-Slater (HFS) model based photoionization cross sections. The present deduced ω 1 (exp) values have been found to be, on an average, higher by 15% and 20% than those based on the Dirac-Hartree-Slater (DHS) model and the semi-empirical values compiled by Krause, respectively, for elements with 60 ≤ Z ≤ 68

  5. Exact exchange potential for slabs: Asymptotic behavior of the Krieger-Li-Iafrate approximation

    Science.gov (United States)

    Engel, Eberhard

    2018-02-01

    The Krieger-Li-Iafrate (KLI) approximation for the exact exchange (EXX) potential of density functional theory is investigated far outside the surface of slabs. For large z the Slater component of the EXX/KLI potential falls off as -1 /z , where z is the distance to the surface of a slab parallel to the x y plane. The Slater potential thus reproduces the behavior of the exact EXX potential. Here it is demonstrated that the second component of the EXX/KLI potential, often called the orbital-shift term, is also proportional to 1 /z for large z , at least in general. This result is obtained by an analytical evaluation of the Brillouin zone integrals involved, relying on the exponential decay of the states into the vacuum. Several situations need to be distinguished in the Brillouin zone integration, depending on the band structure of the slab. In all standard situations, including such prominent cases as graphene and Si(111) slabs, however, a 1 /z dependence of the orbital-shift potential is obtained to leading order. The complete EXX/KLI potential therefore does not reproduce the asymptotic behavior of the exact EXX potential.

  6. Correlations in rare-earth transition-metal permanent magnets

    International Nuclear Information System (INIS)

    Skomski, R.; Manchanda, P.; Kashyap, A.

    2015-01-01

    It is investigated how electron-electron correlations affect the intrinsic properties of rare-earth transition-metal magnets. Focusing on orbital moment and anisotropy, we perform model calculations for 3d-4f alloys and density-functional theory (DFT) calculations for NdCo 5 . On an independent-electron level, the use of a single Slater determinant with broken spin symmetry introduces Hund's rule correlations, which govern the behavior of rare-earth ions and of alloys described by the local spin density approximation (LSDA) and LSDA + U approximations to DFT. By contrast, rare-earth ions in intermetallics involve configuration interactions between two or more Slater determinants and lead to phenomena such as spin-charge distribution. Analyzing DFT as a Legendre transformation and using Bethe's crystal-field theory, we show that the corresponding density functionals are very different from familiar LSDA-type expressions and outline the effect of spin-charge separation on the magnetocrystalline anisotropy

  7. Correlations in rare-earth transition-metal permanent magnets

    Science.gov (United States)

    Skomski, R.; Manchanda, P.; Kashyap, A.

    2015-05-01

    It is investigated how electron-electron correlations affect the intrinsic properties of rare-earth transition-metal magnets. Focusing on orbital moment and anisotropy, we perform model calculations for 3d-4f alloys and density-functional theory (DFT) calculations for NdCo5. On an independent-electron level, the use of a single Slater determinant with broken spin symmetry introduces Hund's rule correlations, which govern the behavior of rare-earth ions and of alloys described by the local spin density approximation (LSDA) and LSDA + U approximations to DFT. By contrast, rare-earth ions in intermetallics involve configuration interactions between two or more Slater determinants and lead to phenomena such as spin-charge distribution. Analyzing DFT as a Legendre transformation and using Bethe's crystal-field theory, we show that the corresponding density functionals are very different from familiar LSDA-type expressions and outline the effect of spin-charge separation on the magnetocrystalline anisotropy.

  8. Effective hypernetted-chain study of even-denominator-filling state of the fractional quantum Hall effect

    International Nuclear Information System (INIS)

    Ciftja, O.

    1999-01-01

    The microscopic approach for studying the half-filled state of the fractional quantum Hall effect is based on the idea of proposing a trial Fermi wave function of the Jastrow-Slater form, which is then fully projected onto the lowest Landau level. A simplified starting point is to drop the projection operator and to consider an unprojected wave function. A recent study claims that such a wave function approximated in a Jastrow form may still constitute a good starting point on the study of the half-filled state. In this paper we formalize the effective hypernetted-chain approximation and apply it to the unprojected Fermi wave function, which describes the even-denominator-filling states. We test the above approximation by using the Fermi hypernetted-chain theory, which constitutes the natural choice for the present case. Our results suggest that the approximation of the Slater determinant of plane waves as a Jastrow wave function may not be a very accurate approximation. We conclude that the lowest Landau-level projection operator cannot be neglected if one wants a better quantitative understanding of the phenomena. copyright 1999 The American Physical Society

  9. Setting an ecological baseline prior to the bottom-up establishment of a marine protected area in Santorini island, Aegean Sea

    Directory of Open Access Journals (Sweden)

    M. SALOMIDI

    2016-08-01

    Full Text Available Since 2010, a bottom-up initiative has been launched in Santorini Island (Aegean Sea, Eastern Mediterranean for the establishment of the first fully-protected marine protected area in the Cyclades, aiming at improving fisheries and enhancing responsible recreational uses at sea. Following discussions with local small-scale fishers and divers, two sites along the southern and southeastern coasts of the island were suggested as suitable to this end. In 2012, a baseline study was conducted at these areas to assess their state and provide an ecological snapshot that would enable sound designation and monitoring. Several ad hoc indices and metrics were applied, taking into account structural and functional features of the upper infralittoral algae and Posidonia oceanica beds. An integrated assessment of the infralittoral fish assemblages and their associated benthic communities was also performed. Our most important findings were: (i the low total fish biomass and the absence of adult top predators, indicating overfishing; (ii the overgrazing effects of the overabundant alien herbivore spinefoot fishes (Siganus spp., as reflected by the abnormal structure of the algal communities; (iii the scarcity of signs of pollution or other direct anthropogenic pressures, as indicated by the good environmental status of the P. oceanica meadows and the upper infralittoral vegetation; and (iv the presence of a rich diversity of species and habitats, especially along the Akrotiri Peninsula and the wider volcanic Caldera. These findings provide useful insights on strengths and weaknesses of the study area and are discussed together with their implications for protection and management.

  10. Selenium Uptake and Volatilization by Marine Algae

    Science.gov (United States)

    Luxem, Katja E.; Vriens, Bas; Wagner, Bettina; Behra, Renata; Winkel, Lenny H. E.

    2015-04-01

    Selenium (Se) is an essential trace nutrient for humans. An estimated one half to one billion people worldwide suffer from Se deficiency, which is due to low concentrations and bioavailability of Se in soils where crops are grown. It has been hypothesized that more than half of the atmospheric Se deposition to soils is derived from the marine system, where microorganisms methylate and volatilize Se. Based on model results from the late 1980s, the atmospheric flux of these biogenic volatile Se compounds is around 9 Gt/year, with two thirds coming from the marine biosphere. Algae, fungi, and bacteria are known to methylate Se. Although algal Se uptake, metabolism, and methylation influence the speciation and bioavailability of Se in the oceans, these processes have not been quantified under environmentally relevant conditions and are likely to differ among organisms. Therefore, we are investigating the uptake and methylation of the two main inorganic Se species (selenate and selenite) by three globally relevant microalgae: Phaeocystis globosa, the coccolithophorid Emiliania huxleyi, and the diatom Thalassiosira oceanica. Selenium uptake and methylation were quantified in a batch experiment, where parallel gas-tight microcosms in a climate chamber were coupled to a gas-trapping system. For E. huxleyi, selenite uptake was strongly dependent on aqueous phosphate concentrations, which agrees with prior evidence that selenite uptake by phosphate transporters is a significant Se source for marine algae. Selenate uptake was much lower than selenite uptake. The most important volatile Se compounds produced were dimethyl selenide, dimethyl diselenide, and dimethyl selenyl sulfide. Production rates of volatile Se species were larger with increasing intracellular Se concentration and in the decline phase of the alga. Similar experiments are being carried out with P. globosa and T. oceanica. Our results indicate that marine algae are important for the global cycling of Se

  11. Temperature modulates coccolithophorid sensitivity of growth, photosynthesis and calcification to increasing seawater pCO₂.

    Directory of Open Access Journals (Sweden)

    Scarlett Sett

    Full Text Available Increasing atmospheric CO₂ concentrations are expected to impact pelagic ecosystem functioning in the near future by driving ocean warming and acidification. While numerous studies have investigated impacts of rising temperature and seawater acidification on planktonic organisms separately, little is presently known on their combined effects. To test for possible synergistic effects we exposed two coccolithophore species, Emiliania huxleyi and Gephyrocapsa oceanica, to a CO₂ gradient ranging from ∼0.5-250 µmol kg⁻¹ (i.e. ∼20-6000 µatm pCO₂ at three different temperatures (i.e. 10, 15, 20°C for E. huxleyi and 15, 20, 25°C for G. oceanica. Both species showed CO₂-dependent optimum-curve responses for growth, photosynthesis and calcification rates at all temperatures. Increased temperature generally enhanced growth and production rates and modified sensitivities of metabolic processes to increasing CO₂. CO₂ optimum concentrations for growth, calcification, and organic carbon fixation rates were only marginally influenced from low to intermediate temperatures. However, there was a clear optimum shift towards higher CO₂ concentrations from intermediate to high temperatures in both species. Our results demonstrate that the CO₂ concentration where optimum growth, calcification and carbon fixation rates occur is modulated by temperature. Thus, the response of a coccolithophore strain to ocean acidification at a given temperature can be negative, neutral or positive depending on that strain's temperature optimum. This emphasizes that the cellular responses of coccolithophores to ocean acidification can only be judged accurately when interpreted in the proper eco-physiological context of a given strain or species. Addressing the synergistic effects of changing carbonate chemistry and temperature is an essential step when assessing the success of coccolithophores in the future ocean.

  12. Reviews and Syntheses: Responses of coccolithophores to ocean acidification: a meta-analysis

    Science.gov (United States)

    Meyer, J.; Riebesell, U.

    2015-03-01

    Concerning their sensitivity to ocean acidification, coccolithophores, a group of calcifying single-celled phytoplankton, are one of the best-studied groups of marine organisms. However, in spite of the large number of studies investigating coccolithophore physiological responses to ocean acidification, uncertainties still remain due to variable and partly contradictory results. In the present study we have used all existing data in a meta-analysis to estimate the effect size of future pCO2 changes on the rates of calcification and photosynthesis and the ratio of particulate inorganic to organic carbon (PIC / POC) in different coccolithophore species. Our results indicate that ocean acidification has a negative effect on calcification and the cellular PIC / POC ratio in the two most abundant coccolithophore species: Emiliania huxleyi and Gephyrocapsa oceanica. In contrast, the more heavily calcified species Coccolithus braarudii did not show a distinct response when exposed to elevated pCO2/reduced pH. Photosynthesis in Gephyrocapsa oceanica was positively affected by high CO2, while no effect was observed for the other coccolithophore species. There was no indication that the method of carbonate chemistry manipulation was responsible for the inconsistent results regarding observed responses in calcification and the PIC / POC ratio. The perturbation method, however, appears to affect photosynthesis, as responses varied significantly between total alkalinity (TA) and dissolved inorganic carbon (DIC) manipulations. These results emphasize that coccolithophore species respond differently to ocean acidification, both in terms of calcification and photosynthesis. Where negative effects occur, they become evident at CO2 levels in the range projected for this century in the case of unabated CO2 emissions. As the data sets used in this meta-analysis do not account for adaptive responses, ecological fitness and ecosystem interactions, the question remains as to how these

  13. Copper-containing plastocyanin used for electron transport by an oceanic diatom.

    Science.gov (United States)

    Peers, Graham; Price, Neil M

    2006-05-18

    The supply of some essential metals to pelagic ecosystems is less than the demand, so many phytoplankton have slow rates of photosynthetic production and restricted growth. The types and amounts of metals required by phytoplankton depends on their evolutionary history and on their adaptations to metal availability, which varies widely among ocean habitats. Diatoms, for example, need considerably less iron (Fe) to grow than chlorophyll-b-containing taxa, and the oceanic species demand roughly one-tenth the amount of coastal strains. Like Fe, copper (Cu) is scarce in the open sea, but notably higher concentrations of it are required for the growth of oceanic than of coastal isolates. Here we report that the greater Cu requirement in an oceanic diatom, Thalassiosira oceanica, is entirely due to a single Cu-containing protein, plastocyanin, which--until now--was only known to exist in organisms with chlorophyll b and cyanobacteria. Algae containing chlorophyll c, including the closely related coastal species T. weissflogii, are thought to lack plastocyanin and contain a functionally equivalent Fe-containing homologue, cytochrome c6 (ref. 9). Copper deficiency in T. oceanica inhibits electron transport regardless of Fe status, implying a constitutive role for plastocyanin in the light reactions of photosynthesis in this species. The results suggest that selection pressure imposed by Fe limitation has resulted in the use of a Cu protein for photosynthesis in an oceanic diatom. This biochemical switch reduces the need for Fe and increases the requirement for Cu, which is relatively more abundant in the open sea.

  14. Impact of temperature and light intensity on triacylglycerol accumulation in marine microalgae

    International Nuclear Information System (INIS)

    Kurpan Nogueira, Daniel P.; Silva, Anita F.; Araújo, Ofélia Q.F.; Chaloub, Ricardo M.

    2015-01-01

    Triacylglycerol (TAG) productivity of Isochrysis galbana, Nannochloropsis oceanica and Phaeodactylum tricornutum was compared to study their suitability for biotechnological applications. Photoautotrophic batch cultures grown at 20 °C and 50 μmol photons m −2  s −1 showed that N. oceanica had the least TAG content and TAG productivity of the three microalgae. Hence, effects of temperature and light intensity on growth rate and accumulation of TAG were subsequently assessed only in I. galbana and P. tricornutum by cultivation at 20 and 30 °C under 50, 300 and 600 μmol photons m −2  s −1 . Although P. tricornutum did not grow at temperatures higher than 20 °C, an increase in both TAG content (from 28.37 to 39.53%) and productivity (from 15.58 to 31.39 mg L −1  d −1 ) was observed at the highest irradiance values. We also found that combined effects of temperature and light intensity enhanced TAG content (from 18.59 to 31.71%) and productivity (from 11.76 to 21.67 mg L −1  d −1 ) in I. galbana. - Highlights: • Productivity of oil and biomass in batch-cultured marine microalgae was compared. • Increase in temperature and irradiance rose oil productivity in Isochrysis galbana. • An increase in light intensity rose oil productivity in Phaeodactylum tricornutum. • Phaeodactylum tricornutum showed the highest productivity in biomass and neutral lipids

  15. Structure and properties of quarternary and tetragonal Heusler compounds for spintronics and spin transver torque applications

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Vajiheh Alijani

    2012-03-07

    This work is divided into two parts: part 1 is focused on the prediction of half-metallicity in quaternary Heusler compounds and their potential for spintronic applications and part 2 on the structural properties of Mn{sub 2}-based Heusler alloys and tuning the magnetism of them from soft to hard-magnetic for spin-transfer torque applications. In part 1, three different series of quaternary Heusler compounds are investigated, XX'MnGa (X=Cu, Ni and X'=Fe,Co), CoFeMnZ (Z=Al,Ga,Si,Ge), and Co{sub 2-x}Rh{sub x}MnZ (Z=Ga,Sn,Sb). All of these quaternary compounds except CuCoMnGa are predicted to be half-metallic ferromagnets by ab-initio electronic structure calculations. In the XX'MnGa class of compounds, NiFeMnGa has a low Curie temperature for technological applications but NiCoMnGa with a high spin polarization, magnetic moment, and Curie temperature is an interesting new material for spintronics applications. All CoFeMnZ compounds exhibit a cubic Heusler structur and their magnetic moments are in fair agreement with the Slater-Pauling rule indicating the halfmetallicity and high spin polarization required for spintronics applications. Their high Curie temperatures make them suitable for utilization at room temperature and above. The structural investigation revealed that the crystal structure of all Co{sub 2-x}Rh{sub x}MnZ compounds aside from CoRhMnSn exhibit different types of anti-site disorder. The magnetic moments of the disordered compounds deviate from the Slater-Pauling rule indicating that 100% spin polarization are not realized in CoRhMnGa, CoRhMnSb, and Co{sub 0.5}Rh{sub 1.5}MnSb. Exchange of one Co in Co{sub 2}MnSn by Rh results in the stable, well-ordered compound CoRhMnSn. This exchange of one of the magnetic Co atoms by a non-magnetic Rh atom keeps the magnetic properties and half-metallicity intact. In part 2, two series of Mn{sub 2}-based Heusler alloys are investigated, Mn{sub 3-x}Co{sub x}Ga and Mn{sub 2-x}Rh{sub 1+x}Sn. It has been

  16. Have the Most Relevant and Answerable Research Questions Facing Librarians Changed Between 2001 and 2006?

    Directory of Open Access Journals (Sweden)

    Suzanne Lewis

    2007-03-01

    Full Text Available Objective ‐ To examine the similarities and differences between research questions asked by librarians in 2001 to those posed in 2006, and to explore to what extent the published research supports the questions being asked.Methods ‐ Questions collected in 2001 by members of the Evidence‐Based Librarianship Implementation Committee (EBLIC of the MLA Research Section were compared with questions collected in 2006 at a cross‐sectoral seminar introducing evidence based library and information practice to Australian librarians. Questions from each list were categorized using the domains of librarianship proposed by Crumley and Koufogiannakis in 2001, and examined with reference to a content analysis of the library and information studies (LIS research published in 2001 by Koufogiannakis, Slater, and Crumley in 2004.Results ‐ In 2001 and 2006 the most commonly asked questions were in the domain of management (29%, 33%, followed by education (24%, 18.5%. In 2001 questions in the marketing/promotion category ranked lowest (1%, however representation was much greater in 2006 (18.5% ranking an equal second with education. Questions in the lowest ranked domain in 2006 (collections, 6% had been more common in 2001 where collections ranked third, representing 19% of the questions. Koufogiannakis, Slater, and Crumley’s content analysis of LIS research published in 2001 revealed that the most popular domain for research was information access and retrieval (38% followed by collections (24%. Only 1% of published LIS research (seven articles was in the domain of marketing/promotion. In contrast, 36 articles originally assigned to one of the six established domains could more appropriately have been included in a proposed new domain of professional issues.Conclusion ‐ The disparity between questions being asked by practitioners and the evidence being generated by researchers suggests that the research‐practice gap is still an issue. A content

  17. [The Testimony. Contributions to the Construction of Historical Memory].

    Science.gov (United States)

    Roldán, Ismael

    2013-06-01

    Testimony is a complex act that contributes significantly to the elaboration of mourning, both individually and on a collective level. This is the central idea that is discussed in the text, using as a basis, the results of research conducted as a pilot intervention in the year 2010 for Visible Victims Foundation, and was then replicated in four other regions. In 1998 the National Liberation Army attacked the pipeline OCENSA causing severe damage to the people of Machuca (Segovia, Antioquia). In 2010 the psychologist Ligia Rascovsky implemented an intervention strategy to support the construction of individual and collective memory among survivors of the attack, who, in addition to serious injuries, suffered physical and psychosocial after effects such as post-traumatic stress disorder (PTSD). The results of this work are used to understand the relevance of the testimony in the psychosocial recovery processes, which is a major challenge for Colombian society today. The type of study was psychosocial intervention in 43 adults of both sexes, Machuca residents who were affected by the bombing, and agreed to voluntarily participate in designed workshops. The workshops followed experiential type techniques (psychodrama, psycho-fantasies, etc.), in which the purpose was to identify the damage by developing testimonial memory of what happened. The workshops express the emotions of grief, recognize the injustice of suffering, fight memory defense that justifies violence and raising awareness of human rights. It also facilitated the process of dignity, empowerment and security in personal and collective reconstruction. In expressing their memoirs thus, they could be free from fear and gain more confidence in themselves as individuals and as a social group, as seen in the formation of individual leadership. These results are the basis of the discussion presented. In this context it has been found that the testimonial narrative is an instrument of personal and social healing

  18. O processo de formação de conceitos e dinâmicas alternativas na construção de referenciais para a alfabetização da criança prematura

    Directory of Open Access Journals (Sweden)

    Ana Reni Goncalves

    2011-07-01

    Full Text Available O estudo de caso do processo de alfabetização de prematuro, compreende os processos evolutivos do desenvolvimento de uma criança nascida prematuramente, com ‘muito baixo peso’, que nesta fase encontra-se no período de alfabetização. Esta pesquisa apresenta a identificação de complicações tardias da prematuridade, a necessidade de intervenções de profissionais de áreas específicas e ao mesmo tempo múltiplas e dialéticas, e principalmente da referência do professor como incentivador e conhecedor das alternativas e práticas do desenvolvimento cognitivo, assim como as contribuições da neurociência aplicadas a educação, sob o enfoque biológico, neurológico e físico direcionados ao processo de alfabetização. Apresenta informações de natureza diversas sobre a criança foco de estudo, através de textos, diálogos, relatório e observações. A criança atualmente reside em Sorriso-MT, estuda em escola particular, os estudos iniciaram quando tinha seis anos e estava cursando o primeiro ano do Ensino Fundamental de Nove Anos, sendo que atualmente está com oito anos e cursa o terceiro ano do Ensino Fundamental de Nove Anos, em uma nova escola. Este estudo de caso se fundamenta teoricamente entre outros em: Ligia Rugolo, Vygotsky, Wallon, Suzana Herculano-Houzel, Jean Piaget, Gislene Oliveira. Cumprindo o objetivo da pesquisa acredita-se que os resultados serão aporte aos profissionais pedagogos que possuem alunos prematuros de baixo peso, subsídios científicos aos pais para condução de prioridades e estratégias para que seus filhos possam evoluírem no processo da construção dos saberes.Palavras-chave: educação; prematuro; criança; alfabetização.

  19. Spherical harmonic expansion of short-range screened Coulomb interactions

    Energy Technology Data Exchange (ETDEWEB)

    Angyan, Janos G [Laboratoire de Cristallographie et de Modelisation des Materiaux Mineraux et Biologiques, UMR 7036, CNRS-Universite Henri Poincare, BP 239, F-54506 Vandoeuvre-les-Nancy (France); Gerber, Iann [Laboratoire de Cristallographie et de Modelisation des Materiaux Mineraux et Biologiques, UMR 7036, CNRS-Universite Henri Poincare, BP 239, F-54506 Vandoeuvre-les-Nancy (France); Marsman, Martijn [Institut fuer Materialphysik and Center for Computational Materials Science, Universitaet Wien, Sensengasse 8, A-1090, Vienna (Austria)

    2006-07-07

    Spherical harmonic expansions of the screened Coulomb interaction kernel involving the complementary error function are required in various problems in atomic, molecular and solid state physics, like for the evaluation of Ewald-type lattice sums or for range-separated hybrid density functionals. A general analytical expression is derived for the kernel, which is non-separable in the radial variables. With the help of series expansions a separable approximate form is proposed, which is in close analogy with the conventional multipole expansion of the Coulomb kernel in spherical harmonics. The convergence behaviour of these expansions is studied and illustrated by the electrostatic potential of an elementary charge distribution formed by products of Slater-type atomic orbitals.

  20. Alcohol advertising and youth.

    Science.gov (United States)

    Martin, Susan E; Snyder, Leslie B; Hamilton, Mark; Fleming-Milici, Fran; Slater, Michael D; Stacy, Alan; Chen, Meng-Jinn; Grube, Joel W

    2002-06-01

    This article presents the proceedings of a symposium at the 2001 Research Society on Alcoholism meeting in Montreal, Canada. The symposium was organized and chaired by Joel W. Grube. The presentations and presenters were (1) Introduction and background, by Susan E. Martin; (2) The effect of alcohol ads on youth 15-26 years old, by Leslie Snyder, Mark Hamilton, Fran Fleming-Milici, and Michael D. Slater; (3) A comparison of exposure to alcohol advertising and drinking behavior in elementary versus middle school children, by Phyllis L. Ellickson and Rebecca L. Collins; (4) USC health and advertising project: assessment study on alcohol advertisement memory and exposure, by Alan Stacy; and (5) TV beer and soft drink advertising: what young people like and what effects? by Meng-Jinn Chen and Joel W. Grube.

  1. Spectra of Nb XII-XVII from a low-inductance vacuum spark

    International Nuclear Information System (INIS)

    Burkhalter, P.G.; Cohen, L.; Cowan, R.D.; Sweeney, B.V.

    1982-01-01

    The XUV spectrum of niobium was obtained by using a low-inductance vaccum spark and grazing-incidence, high-resolution spectrograph. Identification of wavelengths and lines were made in the 2060-A region for complex arrays involving 3d--p and 3d--4f transitions. Atomic structure calculations using relativistically corrected Hartree-Fock wave functions provided the theoretical basis for line classifications. The 3d 9 --3d 8 4p,4f and 3p 5 3d 10 -3p 5 3d 9 4p,4f transitions in Nb XV and satellites to the Ni-like 3d 10 --3d 9 4p,4f lines were classified. Energy levels for the 3d 8 4p and 3d 8 4f configurations in Nb XV were determined by using Slater integrals scaled by least-squares fitting

  2. Temperature and pressure dependent structural and thermo-physical properties of quaternary CoVTiAl alloy

    Science.gov (United States)

    Yousuf, Saleem; Gupta, Dinesh C.

    2017-09-01

    Investigation of band structure and thermo-physical response of new quaternary CoVTiAl Heusler alloy within the frame work of density functional theory has been analyzed. 100% spin polarization with ferromagnetic stable ground state at the optimized lattice parameter of 6.01 Å is predicted for the compound. Slater-Pauling rule for the total magnetic moment of 3 μB and an indirect semiconducting behavior is also seen for the compound. In order to perfectly analyze the thermo-physical response, the lattice thermal conductivity and thermodynamic properties have been calculated. Thermal effects on some macroscopic properties of CoVTiAl are predicted using the quasi-harmonic Debye model, in which the lattice vibrations are taken into account. The variations of the lattice constant, volume expansion coefficient, heat capacities, and Debye temperature with pressure and temperature in the ranges of 0 GPa to 15 GPa and 0 K to 800 K have been obtained.

  3. Basic semiconductor physics

    CERN Document Server

    Hamaguchi, Chihiro

    2017-01-01

    This book presents a detailed description of basic semiconductor physics. The text covers a wide range of important phenomena in semiconductors, from the simple to the advanced. Four different methods of energy band calculations in the full band region are explained: local empirical pseudopotential, non-local pseudopotential, KP perturbation and tight-binding methods. The effective mass approximation and electron motion in a periodic potential, Boltzmann transport equation and deformation potentials used for analysis of transport properties are discussed. Further, the book examines experiments and theoretical analyses of cyclotron resonance in detail. Optical and transport properties, magneto-transport, two-dimensional electron gas transport (HEMT and MOSFET) and quantum transport are reviewed, while optical transition, electron-phonon interaction and electron mobility are also addressed. Energy and electronic structure of a quantum dot (artificial atom) are explained with the help of Slater determinants. The...

  4. Effect of the business environment on market orientation and performance in an emerging country

    Directory of Open Access Journals (Sweden)

    József Berács

    2010-11-01

    Full Text Available In the paper the relationship between market orientation and performance, and the effect of the business environment on these two factors in an emerging economy, in Hungary, was investigated. In a research conducted at 572 firms we found that both market orientation and the business environment have an effect on business performance, albeit in a different manner. The three components of the market orientation construct (customer orientation, competitor orientation, interfunctional coordination have a positive effect on performance. Contrary to that, environmental variables (technological turbulence, market turbulence, competitive intensity, buyer power etc. proved to have a signficant impact only on the finance-based performance measures. The results provide unambiguous evidence that the environment has a strong effect on market orientation, indicating that the market orientation scale developed by Narver and Slater is a proper tool to describe the transitional processes in an emerging economy characterized by high turbulence

  5. Configuration interaction wave functions: A seniority number approach

    International Nuclear Information System (INIS)

    Alcoba, Diego R.; Torre, Alicia; Lain, Luis; Massaccesi, Gustavo E.; Oña, Ofelia B.

    2014-01-01

    This work deals with the configuration interaction method when an N-electron Hamiltonian is projected on Slater determinants which are classified according to their seniority number values. We study the spin features of the wave functions and the size of the matrices required to formulate states of any spin symmetry within this treatment. Correlation energies associated with the wave functions arising from the seniority-based configuration interaction procedure are determined for three types of molecular orbital basis: canonical molecular orbitals, natural orbitals, and the orbitals resulting from minimizing the expectation value of the N-electron seniority number operator. The performance of these bases is analyzed by means of numerical results obtained from selected N-electron systems of several spin symmetries. The comparison of the results highlights the efficiency of the molecular orbital basis which minimizes the mean value of the seniority number for a state, yielding energy values closer to those provided by the full configuration interaction procedure

  6. Inner-shell couplings in transiently formed superheavy quasimolecules

    Energy Technology Data Exchange (ETDEWEB)

    Verma, P [Kalindi College, University of Delhi, New Delhi 110008 (India); Mokler, P H [Max-Planck-Institut fuer Kernphysik, 69117 Heidelberg (Germany); Braeuning-Demian, A; Kozhuharov, C; Braeuning, H; Bosch, F; Hagmann, S; Liesen, D [GSI Helmholzzentrum fuer Schwerionenforschung, 64291 Darmstadt (Germany); Anton, J; Fricke, B [Universitaet Kassel, 34109 Kassel (Germany); Stachura, Z [Institute for Nuclear Physics, Cracow PL 31342 (Poland); Wahab, M A, E-mail: p.verma.du@gmail.com [Jamia Millia Islamia, Jamia Nagar, New Delhi 110025 (India)

    2011-06-15

    The inner-shell couplings for U{sup q+}-ions (73{<=}q{<=}91) moving moderately slow at {approx}69 MeV u{sup -1} and bombarding thin Au targets have been investigated. Having established the definite survival probability of incoming projectile K vacancies in these targets in an earlier publication, the transfer of these vacancies to the target K-shell due to inner-shell couplings has been studied. As the system is in the quasiadiabatic collision regime for the K-shell of collision partners, advanced SCF-DFS (self-consistent field-Dirac-Fock-Slater) multielectron level diagrams have been used for interpretation. Using a simple model, the L-K shell coupling interaction distance has been estimated and compared with level diagram calculations.

  7. Master Lovas-Andai and equivalent formulas verifying the 8/33 two-qubit Hilbert-Schmidt separability probability and companion rational-valued conjectures

    Science.gov (United States)

    Slater, Paul B.

    2018-04-01

    We begin by investigating relationships between two forms of Hilbert-Schmidt two-rebit and two-qubit "separability functions"—those recently advanced by Lovas and Andai (J Phys A Math Theor 50(29):295303, 2017), and those earlier presented by Slater (J Phys A 40(47):14279, 2007). In the Lovas-Andai framework, the independent variable ɛ \\in [0,1] is the ratio σ (V) of the singular values of the 2 × 2 matrix V=D_2^{1/2} D_1^{-1/2} formed from the two 2 × 2 diagonal blocks (D_1, D_2) of a 4 × 4 density matrix D= ||ρ _{ij}||. In the Slater setting, the independent variable μ is the diagonal-entry ratio √{ρ _{11} ρ _ {44}/ρ _ {22 ρ _ {33}}}—with, of central importance, μ =ɛ or μ =1/ɛ when both D_1 and D_2 are themselves diagonal. Lovas and Andai established that their two-rebit "separability function" \\tilde{χ }_1 (ɛ ) (≈ ɛ ) yields the previously conjectured Hilbert-Schmidt separability probability of 29/64. We are able, in the Slater framework (using cylindrical algebraic decompositions [CAD] to enforce positivity constraints), to reproduce this result. Further, we newly find its two-qubit, two-quater[nionic]-bit and "two-octo[nionic]-bit" counterparts, \\tilde{χ _2}(ɛ ) =1/3 ɛ ^2 ( 4-ɛ ^2) , \\tilde{χ _4}(ɛ ) =1/35 ɛ ^4 ( 15 ɛ ^4-64 ɛ ^2+84) and \\tilde{χ _8} (ɛ )= 1/1287ɛ ^8 ( 1155 ɛ ^8-7680 ɛ ^6+20160 ɛ ^4-25088 ɛ ^2+12740) . These immediately lead to predictions of Hilbert-Schmidt separability/PPT-probabilities of 8/33, 26/323 and 44482/4091349, in full agreement with those of the "concise formula" (Slater in J Phys A 46:445302, 2013), and, additionally, of a "specialized induced measure" formula. Then, we find a Lovas-Andai "master formula," \\tilde{χ _d}(ɛ )= ɛ ^d Γ (d+1)^3 _3\\tilde{F}_2( -{d/2,d/2,d;d/2+1,3 d/2+1;ɛ ^2) }/{Γ ( d/2+1) ^2}, encompassing both even and odd values of d. Remarkably, we are able to obtain the \\tilde{χ _d}(ɛ ) formulas, d=1,2,4, applicable to full (9-, 15-, 27-) dimensional sets of

  8. Orientação para Aprendizagem, Orientação para Mercado e Desempenho Organizacional: Evidências Empíricas

    Directory of Open Access Journals (Sweden)

    Eduardo Botti Abbade

    2012-01-01

    Full Text Available This study aims to identify how learning orientation (LO and market orientation (MO influence theperformance of enterprises in the central region of the state of Rio Grande do Sul (RS, Brazil. The method usedinvolved a survey of 123 companies in central RS. The instrument for data collection was developed using theLO scale (Sinkula, Baker, & Noordewier, 1997, the MARKOR scale (Kohli, Jaworski, & Kumar, 1993 anditems for evaluation of organizational performance proposed by Narver and Slater (1990 and Baker and Sinkula(1999. The results suggest that MO has a significant positive influence on the organizational performance of thecompanies surveyed. It was also noted that the MO significantly influences organizational performance whenmediated by the LO, just as the LO has a significant influence on organizational performance when mediated byMO.

  9. Mathematical methods in quantum and statistical mechanics

    International Nuclear Information System (INIS)

    Fishman, L.

    1977-01-01

    The mathematical structure and closed-form solutions pertaining to several physical problems in quantum and statistical mechanics are examined in some detail. The J-matrix method, introduced previously for s-wave scattering and based upon well-established Hilbert Space theory and related generalized integral transformation techniques, is extended to treat the lth partial wave kinetic energy and Coulomb Hamiltonians within the context of square integrable (L 2 ), Laguerre (Slater), and oscillator (Gaussian) basis sets. The theory of relaxation in statistical mechanics within the context of the theory of linear integro-differential equations of the Master Equation type and their corresponding Markov processes is examined. Several topics of a mathematical nature concerning various computational aspects of the L 2 approach to quantum scattering theory are discussed

  10. Ressituando a gentrificação: a classe popular, a ciência e o estado na pesquisa urbana recente

    OpenAIRE

    Wacquant,Loïc

    2010-01-01

    Este artigo amplia o diagnóstico de Tom Slater sobre as causas da gentrificação da pesquisa recente sobre gentrificação. Ele argumenta que o deslocamento de denúncia para celebração da gentrificação, a elisão do deslocamento dos residentes estabelecidos e o foco eufemístico em "mesclagem social" participam de um padrão de invisibilidade da classe operária na esfera pública e na investigação social. Essa obliteração do proletariado na cidade é reforçada pela heteronomia crescente da pesquisa u...

  11. Simple formalism for efficient derivatives and multi-determinant expansions in quantum Monte Carlo

    Energy Technology Data Exchange (ETDEWEB)

    Filippi, Claudia, E-mail: c.filippi@utwente.nl [MESA+ Institute for Nanotechnology, University of Twente, P.O. Box 217, 7500 AE Enschede (Netherlands); Assaraf, Roland, E-mail: assaraf@lct.jussieu.fr [Sorbonne Universités, UPMC Univ Paris 06, CNRS, Laboratoire de Chimie Théorique CC 137-4, place Jussieu F-75252 Paris Cedex 05 (France); Moroni, Saverio, E-mail: moroni@democritos.it [CNR-IOM DEMOCRITOS, Istituto Officina dei Materiali, and SISSA Scuola Internazionale Superiore di Studi Avanzati, Via Bonomea 265, I-34136 Trieste (Italy)

    2016-05-21

    We present a simple and general formalism to compute efficiently the derivatives of a multi-determinant Jastrow-Slater wave function, the local energy, the interatomic forces, and similar quantities needed in quantum Monte Carlo. Through a straightforward manipulation of matrices evaluated on the occupied and virtual orbitals, we obtain an efficiency equivalent to algorithmic differentiation in the computation of the interatomic forces and the optimization of the orbital parameters. Furthermore, for a large multi-determinant expansion, the significant computational gain afforded by a recently introduced table method is here extended to the local value of any one-body operator and to its derivatives, in both all-electron and pseudopotential calculations.

  12. Analytic formulae for the Hartree-Fock order parameter at arbitrary p/q filling factors for the 2DEG in a magnetic field

    International Nuclear Information System (INIS)

    Cabo Monte Oca, A. de.

    1994-07-01

    Analytic expressions for order parameters are given for the previously introduced general class of Hartree Fock states at arbitrary filling factors ν=p/q for odd q values. The order parameters are expressed as sums of magnetic translations eigenvalues over the filled single electron states. Simple summation formulae for the band spectra in terms of the same eigenvalues are also presented. The energy per particle at ν=1/3 is calculated for various states differing in the way of filling of the 1/3 of the orbitals. The calculated energies are not competing with the usual CDW results. However the high degree of electron overlapping allows for the next corrections to modify this situation. The discussion suggests these Hartree-Fock Slater determinants as interesting alternatives for the Tao-Thouless parent states which may correct their anomalous symmetry and correlation functions properties. (author). 28 refs

  13. Experimental and theoretical studies of the energy level structure of multiply charged many-electron ions

    International Nuclear Information System (INIS)

    Redfors, A.

    1991-01-01

    Magnesiumlike and aluminumlike spectra of the elements calcium - germanium have been obtained through the use of laser-produced plasmas (LPP) and a 3 m normal incidence vacuum spectrograph. The spectral analyses were mainly based on isoelectronic regularities. Intermediate ionization stages of cerium (Ce V) and silicon (SI VI) have also been studied. The light sources in these cases were a sliding spark and a modified version of the LPP. The Eagle spectrograph at the National Institute of Standards and Technology, Gaitherburg, Maryland was used to record the cerium spectrum. Ab initio calculations and least-squares fits of the Slater energy parameters to the experimental energy levels are reported for all investigated spectra. Theoretical predictions of oscillator strengths for Y III and Zr III in the region 1150-3200 AA are presented. The oscillator strengths are needed for abundance determinations of Y 2+ and Zr 2+ in chemically peculiar stars, Cp stars. (65 refs.)

  14. X-ray attenuation cross sections for energies 100 eV to 100 keV and elements Z = 1 to Z = 92

    International Nuclear Information System (INIS)

    Saloman, E.B.; Hubbell, J.H.; Scofield, J.H.

    1988-01-01

    This work presents for the energy range 0.1--100 keV the National Bureau of Standards (NBS) database of experimental x-ray attenuation coefficients (total absorption cross sections) and cross sections calculated using a relativistic Hartree--Slater model for the photoelectric cross section for all elements of atomic number Z = 1--92. The information is displayed in both tabular and graphical form. Also shown on the graphs are cross sections obtained using the semiempirical set of recommended values of B. L. Henke and co-workers (Atomic Data and Nuclear Data Tables 27, 1 (1982)). A bibliography of the NBS database for this energy range is included. copyright 1988 Academic Press, Inc

  15. Modified potentials in many-body perturbation theory

    International Nuclear Information System (INIS)

    Silver, D.M.; Bartlett, R.J.

    1976-01-01

    Many-body perturbation-theory calculations of the pair-correlation energy within the regime of various finite expansions in two-center Slater-type basis sets are performed using a wide variety of modified potentials for the determination of unoccupied orbitals. To achieve meaningful convergence, it appears that the perturbation series must be carried through third order, using shifted denominators to include contributions from various higher-order diagrams. Moreover, certain denominator shifts are found necessary to ensure that a negative-definite resolvent accompanies the perturbation scheme when an arbitrary modified potential is employed. Through third order with denominator shifts, well-behaved modified potentials are found to give results that are equivalent, within 1 kcal/mole, to those obtained for pair-correlation energies with the standard self-consistent-field-V/sup N/ potential

  16. Structural, electronic, and magnetic properties of pristine and oxygen-adsorbed graphene nanoribbons

    Energy Technology Data Exchange (ETDEWEB)

    Miwa, R.H.; Veiga, R.G.A. [Instituto de Fisica, Universidade Federal de Uberlandia, Caixa Postal 593, CEP 38400-902, Uberlandia, MG (Brazil); Srivastava, G.P., E-mail: gps@excc.ex.ac.uk [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)

    2010-07-15

    The structural, electronic and magnetic properties of pristine and oxygen-adsorbed (3,0) zigzag and (6,1) armchair graphene nanoribbons have been investigated theoretically, by employing the ab initio pseudopotential method within the density functional scheme. The zigzag nanoribbon is more stable with antiferromagnetically coupled edges, and is semiconducting. The armchair nanoribbon does not show any preference for magnetic ordering and is semiconducting. The oxygen molecule in its triplet state is adsorbed most stably at the edge of the zigzag nanoribbon. The Stoner metallic behaviour of the ferromagnetic nanoribbons and the Slater insulating (ground state) behaviour of the antiferromagnetic nanoribbons remain intact upon oxygen adsorption. However, the local magnetic moment of the edge carbon atom of the ferromagnetic zigzag ribbon is drastically reduced, due to the formation of a spin-paired C-O bond.

  17. Computation of Ground-State Properties in Molecular Systems: Back-Propagation with Auxiliary-Field Quantum Monte Carlo.

    Science.gov (United States)

    Motta, Mario; Zhang, Shiwei

    2017-11-14

    We address the computation of ground-state properties of chemical systems and realistic materials within the auxiliary-field quantum Monte Carlo method. The phase constraint to control the Fermion phase problem requires the random walks in Slater determinant space to be open-ended with branching. This in turn makes it necessary to use back-propagation (BP) to compute averages and correlation functions of operators that do not commute with the Hamiltonian. Several BP schemes are investigated, and their optimization with respect to the phaseless constraint is considered. We propose a modified BP method for the computation of observables in electronic systems, discuss its numerical stability and computational complexity, and assess its performance by computing ground-state properties in several molecular systems, including small organic molecules.

  18. Anisotropic p-f mixing mechanism explaining anomalous magnetic properties in Ce monopnictides

    International Nuclear Information System (INIS)

    Takahashi, H.; Kasuya, T.

    1985-01-01

    The crystal-field splittings in CeP, PrP and NdP are calculated by considering the point-charge Coulomb interaction, the intra-atomic d-f Coulomb interaction, and the p-f and d-f mixings. The p-f mixing mechanisms, not only between the occupied 4f states and the conduction bands, but also between the unoccupied 4f states and the valence bands make an important contribution to the crystal-field splitting. The fact that the crystal-field potential in CeP is smaller than those in PrP and NdP is due to the occupied 4f level in CeP being shallower. The values of the Slater-Koster integrals, (pfσ) and (pfπ), are determined uniquely from the crystal-field fitting for PrP and NdP. (author)

  19. Covariant density functional theory beyond mean field and applications for nuclei far from stability

    International Nuclear Information System (INIS)

    Ring, P

    2010-01-01

    Density functional theory provides a very powerful tool for a unified microscopic description of nuclei all over the periodic table. It is not only successful in reproducing bulk properties of nuclear ground states such as binding energies, radii, or deformation parameters, but it also allows the investigation of collective phenomena, such as giant resonances and rotational excitations. However, it is based on the mean field concept and therefore it has its limits. We discuss here two methods based based on covariant density functional theory going beyond the mean field concept, (i) models with an energy dependent self energy allowing the coupling to complex configurations and a quantitative description of the width of giant resonances and (ii) methods of configuration mixing between Slater determinants with different deformation and orientation providing are very successful description of transitional nuclei and quantum phase transitions.

  20. Interesting Features of Ionization Potentials for Elements (Z ≤ 119) along the Periodic Table

    International Nuclear Information System (INIS)

    Gu Chun; Zeng De-Ling; Li Jia-Ming; Jin Rui; Yue Xian-Fang; Gao Xiang

    2016-01-01

    The ionization potential (IP) is a basic property of an atom, which has many applications such as in element analysis. With the Dirac–Slater methods (i.e., mean field theory), IPs of all occupied orbitals for elements with atomic number (Z ≤ 119) are calculated conveniently and systematically. Compared with available experimental measurements, the theoretical accuracies of IPs for various occupied orbitals are ascertained. The map of the inner orbital IPs with good accuracies should be useful to select x-ray energies for element analysis. Based on systematic variations of the first IPs for the outermost orbitals in good agreement with experimental values as well as other IPs, mechanisms of electronic configurations of all atomic elements (Z ≤ 119) along the periodic table are elucidated. It is interesting to note that there exist some deficiencies of the intermediate orbital IPs, which are due to electron correlations and should be treated beyond the mean field theory. (paper)

  1. Exact results for the spectra of bosons and fermions with contact interaction

    Energy Technology Data Exchange (ETDEWEB)

    Mashkevich, Stefan [Schroedinger, 120 West 45th St., New York, NY 10036 (United States)]. E-mail: mash@mashke.org; Matveenko, Sergey [Landau Institute for Theoretical Physics, Kosygina Str. 2, 119334 Moscow (Russian Federation)]. E-mail: matveen@landau.ac.ru; Ouvry, Stephane [Laboratoire de Physique Theorique et Modeles Statistiques, Unite de Recherche de l' Universite Paris 11 associee au CNRS, UMR 8626., Bat. 100, Universite Paris-Sud, 91405 Orsay (France)]. E-mail: ouvry@lptms.u-psud.fr

    2007-02-19

    An N-body bosonic model with delta-contact interactions projected on the lowest Landau level is considered. For a given number of particles in a given angular momentum sector, any energy level can be obtained exactly by means of diagonalizing a finite matrix: they are roots of algebraic equations. A complete solution of the three-body problem is presented, some general properties of the N-body spectrum are pointed out, and a number of novel exact analytic eigenstates are obtained. The FQHE N-fermion model with Laplacian-delta interactions is also considered along the same lines of analysis. New exact eigenstates are proposed, along with the Slater determinant, whose eigenvalues are shown to be related to Catalan numbers.

  2. Sign Learning Kink-based (SiLK) Quantum Monte Carlo for molecular systems

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Xiaoyao [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Hall, Randall W. [Department of Natural Sciences and Mathematics, Dominican University of California, San Rafael, California 94901 (United States); Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Löffler, Frank [Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Kowalski, Karol [William R. Wiley Environmental Molecular Sciences Laboratory, Battelle, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States); Bhaskaran-Nair, Kiran; Jarrell, Mark; Moreno, Juana [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803 (United States)

    2016-01-07

    The Sign Learning Kink (SiLK) based Quantum Monte Carlo (QMC) method is used to calculate the ab initio ground state energies for multiple geometries of the H{sub 2}O, N{sub 2}, and F{sub 2} molecules. The method is based on Feynman’s path integral formulation of quantum mechanics and has two stages. The first stage is called the learning stage and reduces the well-known QMC minus sign problem by optimizing the linear combinations of Slater determinants which are used in the second stage, a conventional QMC simulation. The method is tested using different vector spaces and compared to the results of other quantum chemical methods and to exact diagonalization. Our findings demonstrate that the SiLK method is accurate and reduces or eliminates the minus sign problem.

  3. Sign Learning Kink-based (SiLK) Quantum Monte Carlo for molecular systems

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Xiaoyao [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Hall, Randall W. [Department of Natural Sciences and Mathematics, Dominican University of California, San Rafael, California 94901, USA; Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Löffler, Frank [Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Kowalski, Karol [William R. Wiley Environmental Molecular Sciences Laboratory, Battelle, Pacific Northwest National Laboratory, Richland, Washington 99352, USA; Bhaskaran-Nair, Kiran [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Jarrell, Mark [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Moreno, Juana [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA

    2016-01-07

    The Sign Learning Kink (SiLK) based Quantum Monte Carlo (QMC) method is used to calculate the ab initio ground state energies for multiple geometries of the H2O, N2, and F2 molecules. The method is based on Feynman’s path integral formulation of quantum mechanics and has two stages. The first stage is called the learning stage and reduces the well-known QMC minus sign problem by optimizing the linear combinations of Slater determinants which are used in the second stage, a conventional QMC simulation. The method is tested using different vector spaces and compared to the results of other quantum chemical methods and to exact diagonalization. Our findings demonstrate that the SiLK method is accurate and reduces or eliminates the minus sign problem.

  4. On the treatment of light-ion electronic stopping in dense matter

    Energy Technology Data Exchange (ETDEWEB)

    Schiwietz, G. (Hahn-Meitner-Inst. Berlin GmbH, Div., FD (Germany)); Grande, P.L. (Hahn-Meitner-Inst. Berlin GmbH, Div., FD (Germany))

    1994-05-01

    A review is given on single-electron mechanisms and the corresponding theoretical approaches describing the electronic energy-transfer processes of light ions in gases and solids. Special emphasis is given to a discussion on the connection between exact Bloch-wave treatments and free-atom approximations. In the case of solids, perturbation theory is applied to the stopping of low-energy ions in the alkaline metals Li and Na. These calculations include Bloch wavefunctions of the Wigner-Seitz type obtained from a Hartree-Fock-Slater calculation and allow for a prediction of the mean energy loss under channeling conditions. Results of the most widely used local-density approximation are compared to data of our more complete perturbative treatment. Comparison is also made with recent LCAO calculations. (orig.)

  5. Fragmentation properties of 6Li

    International Nuclear Information System (INIS)

    Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

    1987-01-01

    The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

  6. Large-scale ab initio configuration interaction calculations for light nuclei

    International Nuclear Information System (INIS)

    Maris, Pieter; Potter, Hugh; Vary, James P; Aktulga, H Metin; Ng, Esmond G; Yang Chao; Caprio, Mark A; Çatalyürek, Ümit V; Saule, Erik; Oryspayev, Dossay; Sosonkina, Masha; Zhou Zheng

    2012-01-01

    In ab-initio Configuration Interaction calculations, the nuclear wavefunction is expanded in Slater determinants of single-nucleon wavefunctions and the many-body Schrodinger equation becomes a large sparse matrix problem. The challenge is to reach numerical convergence to within quantified numerical uncertainties for physical observables using finite truncations of the infinite-dimensional basis space. We discuss strategies for constructing and solving the resulting large sparse matrix eigenvalue problems on current multicore computer architectures. Several of these strategies have been implemented in the code MFDn, a hybrid MPI/OpenMP Fortran code for ab-initio nuclear structure calculations that can scale to 100,000 cores and more. Finally, we will conclude with some recent results for 12 C including emerging collective phenomena such as rotational band structures using SRG evolved chiral N3LO interactions.

  7. The time dependent Hartree-Fock-theory for collective nuclear motions

    International Nuclear Information System (INIS)

    Goeke, K.

    1976-11-01

    The time-dependent Hartree-Fock theory (TDHF) approximately solves the Schroedinger equation by a variational method in the space of the time-dependent Slater determinants. As the TDHF wave function, similar to the exact solution has the property of being determined completely for all times by the nucleon-nucleon interaction and by assuming initial conditions. TDHF is expected to describe collective motion of nuclei with large amplitudes, too. The subject of this paper is to formulate the TDHF theory and its adiabatic limiting case (ATDHF) suited for setting up a collective Schroedinger equation, to investigate the relations with other theories, and to show the applicability for solving practical problems. (orig./WL) [de

  8. A pair density functional theory utilizing the correlated wave function

    International Nuclear Information System (INIS)

    Higuchi, M; Higuchi, K

    2009-01-01

    We propose a practical scheme for calculating the ground-state pair density (PD) by utilizing the correlated wave function. As the correlated wave function, we adopt a linear combination of the single Slater determinants that are constructed from the solutions of the initial scheme [Higuchi M and Higuchi K 2007 Physica B 387, 117]. The single-particle equation is derived by performing the variational principle within the set of PDs that are constructed from such correlated wave functions. Since the search region of the PD is substantially extended as compared with the initial scheme, it is expected that the present scheme can cover more correlation effects. The single-particle equation is practical, and may be easily applied to actual calculations.

  9. Filling of double vacancy in the K atomic shell with emission of one single photon

    International Nuclear Information System (INIS)

    Jalbert, G.

    1978-12-01

    A method was developed to calculate the transition rate for two-electron one-photon K(sub αα) transition (2s 2p → 1s 2 ). The method was tested for Ni with two K-shell vacancies in the initial state. The (sub αα) rate is calculated within the framework of a single system formed by the atom and the radiation. The transition is originated in the interactiion between the parts of that system. In the dipole approximation, the transition rate is obtained from the second order term of the time dependente perturbation theory. Hartree-Fock-Slater wave functions were used in the calculations for Ni. The results are compared with the available theoretical and experimental information. (Author) [pt

  10. A Moessbauer effect study of the bonding in several organoiron carbonyl clusters

    International Nuclear Information System (INIS)

    Long, G.J.; O'Brien, J.F.

    1988-01-01

    After a brief review of the applications of the Moessbauer effect to cyclopentadienyl containing compounds, the chemistry and spectral properties of the various iron carbonyl complexes are described. The electronic properties of a series of trinuclear and tetranuclear organoiron clusters have been investigated through Fenske-Hall self-consistent field molecular orbital calculations, and the results are compared with the Moessbauer effect isomer shifts. A linear correlation is found between the Slater effective nuclear charge, as calculated from the Fenske-Hall partial orbital occupancy factors, and the isomer shift. In these compounds the 4s orbital populations are rather constant. However, the cis and trans isomers of [CpFe(CO) 2 ] 2 have a significantly lower 4s orbital populations. In this case, the reduced 4s population must be accounted for by adding it to the effective nuclear charge to obtain a good correlation with the isomer shift. (orig.)

  11. Quantum Chemistry on Quantum Computers: A Polynomial-Time Quantum Algorithm for Constructing the Wave Functions of Open-Shell Molecules.

    Science.gov (United States)

    Sugisaki, Kenji; Yamamoto, Satoru; Nakazawa, Shigeaki; Toyota, Kazuo; Sato, Kazunobu; Shiomi, Daisuke; Takui, Takeji

    2016-08-18

    Quantum computers are capable to efficiently perform full configuration interaction (FCI) calculations of atoms and molecules by using the quantum phase estimation (QPE) algorithm. Because the success probability of the QPE depends on the overlap between approximate and exact wave functions, efficient methods to prepare accurate initial guess wave functions enough to have sufficiently large overlap with the exact ones are highly desired. Here, we propose a quantum algorithm to construct the wave function consisting of one configuration state function, which is suitable for the initial guess wave function in QPE-based FCI calculations of open-shell molecules, based on the addition theorem of angular momentum. The proposed quantum algorithm enables us to prepare the wave function consisting of an exponential number of Slater determinants only by a polynomial number of quantum operations.

  12. The eugenic legacy in psychology and psychiatry.

    Science.gov (United States)

    Pilgrim, David

    2008-05-01

    Assumptions about genetic differences in human mental characteristics can be traced in large part to the eugenic movement, ascendant at the turn of the 20th century. This paper offers historical case studies, of 'innate general cognitive ability' and 'psychiatric genetics', in order to appraise the eugenic legacy in current psychology and psychiatry. Reviewing the work of representatives, Cyril Burt, Franz Kallmann and Eliot Slater, along with their research networks, it is argued that eugenics remains a quiet but powerful background influence in modern-day psychology and psychiatry. At the turn of the 21st century, eugenics remains an important area of inquiry, reflection and education for those in the inter-disciplinary field of social psychiatry.

  13. Evaluation of intensity and energy interaction parameters for the complexation of Pr(III) with selected nucleoside and nucleotide through absorption spectral studies

    Science.gov (United States)

    Bendangsenla, N.; Moaienla, T.; David Singh, Th.; Sumitra, Ch.; Rajmuhon Singh, N.; Indira Devi, M.

    2013-02-01

    The interactions of Pr(III) with nucleosides and nucleotides have been studied in different organic solvents employing absorption difference and comparative absorption spectrophotometry. The magnitudes of the variations in both energy and intensity interaction parameters were used to explore the degree of outer and inner sphere co-ordination, incidence of covalency and the extent of metal 4f-orbital involvement in chemical bonding. Various electronic spectral parameters like Slater-Condon (Fk), Racah (Ek), Lande parameter (ξ4f), Nephelauxatic ratio (β), bonding (b1/2), percentage covalency (δ) and intensity parameters like oscillator strength (P) and Judd Ofelt electronic dipole intensity parameter (Tλ, λ = 2, 4, 6) have been evaluated. The variation of these evaluated parameters were employed to interpret the nature of binding of Pr(III) with different ligands i.e. Adenosine/ATP in presence and absence of Ca2+.

  14. Curvature of the Lanthanide Contraction: An Explanation

    Energy Technology Data Exchange (ETDEWEB)

    Raymond, Kenneth; Wellman, Daniel; Sgarlata, Carmelo; Hill, Aru

    2009-12-21

    A number of studies have shown that for isostructural series of the lanthanides (elements La through Lu), a plot of equivalent metal-ligand bond lengths versus atomic number differs significantly from linearity and can be better fit as a quadratic equation. However, for hydrogen type wave functions, it is the inverse of the average distance of the electron from the nucleus (an estimate of size) that varies linearly with effective nuclear charge. This generates an apparent quadratic dependence of radius with atomic number. Plotting the inverse of lanthanide ion radii (the observed distance minus the ligand size) as a function of effective nuclear charge gives very good linear fits for a variety of lanthanide complexes and materials. Parameters obtained from this fit are in excellent agreement with the calculated Slater shielding constant, k.

  15. Comparison of Methods for Computing the Exchange Energy of quantum helium and hydrogen

    International Nuclear Information System (INIS)

    Cayao, J. L. C. D.

    2009-01-01

    I investigate approach methods to find the exchange energy for quantum helium and hydrogen. I focus on Heitler-London, Hund-Mullikan, Molecular Orbital and variational approach methods. I use Fock-Darwin states centered at the potential minima as the single electron wavefunctions. Using these we build Slater determinants as the basis for the two electron problem. I do a comparison of methods for two electron double dot (quantum hydrogen) and for two electron single dot (quantum helium) in zero and finite magnetic field. I show that the variational, Hund-Mullikan and Heitler-London methods are in agreement with the exact solutions. Also I show that the exchange energy calculation by Heitler-London (HL) method is an excellent approximation for large inter dot distances and for single dot in magnetic field is an excellent approximation the Variational method. (author)

  16. Hartree and Exchange in Ensemble Density Functional Theory: Avoiding the Nonuniqueness Disaster.

    Science.gov (United States)

    Gould, Tim; Pittalis, Stefano

    2017-12-15

    Ensemble density functional theory is a promising method for the efficient and accurate calculation of excitations of quantum systems, at least if useful functionals can be developed to broaden its domain of practical applicability. Here, we introduce a guaranteed single-valued "Hartree-exchange" ensemble density functional, E_{Hx}[n], in terms of the right derivative of the universal ensemble density functional with respect to the coupling constant at vanishing interaction. We show that E_{Hx}[n] is straightforwardly expressible using block eigenvalues of a simple matrix [Eq. (14)]. Specialized expressions for E_{Hx}[n] from the literature, including those involving superpositions of Slater determinants, can now be regarded as originating from the unifying picture presented here. We thus establish a clear and practical description for Hartree and exchange in ensemble systems.

  17. NOSTALGIA, ANTICONSUMO SIMBÓLICO E BEM-ESTAR: A AGRICULTURA URBANA

    Directory of Open Access Journals (Sweden)

    Bruno Henrique Comasseto

    2013-07-01

    Full Text Available The establishment of a global consumption culture had as a consequence a growing concern with the impact of consumption practices on the environment, as well as on the general and personal well-being. In this context emerges the urban agriculture (UA associated to environmental, social and health benefits (SLATER, 2001. The objective of this study is to understand the meaning of the UA phenomenon as a consumption practice, identifying which theories are related to it. In order to reach that goal, a qualitative research used as data collection in-depth interviews. The subjects were experts and practitioners in UA living in 9 neighborhoods in urban areas of a Brazilian city with a population bigger than 1 million inhabitants. Results showed double motivation for the UA practice, extrinsic (example and intrinsic (well-being, linking the UA to environmental concerns, to health and well-being, and the respect and pride for a nostalgic cultural heritage.

  18. The spectrum and term system of S VIII

    International Nuclear Information System (INIS)

    Bengtsson, P.; Jupen, C.; Engstroem, L.; Redfors, A.; Westerlind, M.

    1993-01-01

    The spectrum of seven times ionized sulfur, S VIII, has been observed in the wavelength range 50-1200 A. Both beam-foil and laser-produced plasma light sources have been used. 71 new lines representing the transitions 2p 5 -2p 4 3d, 2p 4 3s-3p, 3p-3d, 3d-4f, 4f-5g and 5g-6h have been identified and 100 energy levels, of which 46 are new, are now accurately established. The spectral analysis is supported by isoelectronic comparisons along the F I-sequence and by parametric least-squares fits of Slater integrals to the observed levels. The ionization potential in S VIII is determined to 2 651 899 ± 60 cm -1 and estimated ionization energies are derived for the isoelectronic elements between F I and Ar X. (orig.)

  19. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  20. Sampling procedures using optical-data and partial wave cross sections in a Monte Carlo code for simulating kilovolt electron and positron transport in solids

    International Nuclear Information System (INIS)

    Fernandez-Varea, J.M.; Salvat, F.; Liljequist, D.

    1994-09-01

    The details of a Monte Carlo code for computing the penetration and energy loss of electrons and positrons in solids are described. The code, intended for electrons and positrons with energies from ∼ 100 eV to ∼ 100 keV, is based on the simulation of individual elastic and inelastic collisions. Elastic collisions are simulated using differential cross sections computed by the relativistic partial wave method applied to a muffin-tin Dirac-Hartree-Fock-Slater potential. Inelastic collisions are simulated by means of a model based on optical and photoelectric data, which are extended to the non-zero momentum transfer region by means of somewhat different algorithms for valence electron excitations and inner-shell excitations. This report focuses on the description of detailed formulae and sampling methods. 10 refs, 3 figs, 8 tabs

  1. 199Hg Moessbauer measurements on mercury, alloys and Hg-fluorides

    International Nuclear Information System (INIS)

    Wurtinger, W.; Kankeleit, E.

    1979-01-01

    The Moessbauer effect on the 158 keV 5/2 - -1/2 - transition in 199 Hg, of the order of 10 ppm, has been studied using the current integration technique. The isomer shift between the Hg(I)- and Hg(II)-fluorides as well as the quadrupole splitting in Hg 2 Pt and Hg 2 F 2 are interpreted in terms of relativistic Hartree-Fock-Slater and Molecular Orbital calculations. The following nuclear parameters could be derived: Δ[r 2 ] = (3.2+-1.1) 10 -3 fm 2 and Q(5/2 - ) = (-0.8+-0.4)b. Evidence for an oblate triaxially deformed 199 Hg nucleus is derived from particle plus rotor calculations. (orig.)

  2. Exact pairing correlations in one-dimensional trapped fermions with stochastic mean-field wave-functions

    Energy Technology Data Exchange (ETDEWEB)

    Juillet, O.; Gulminelli, F. [Caen Univ., Lab. de Physique Corpusculaire (LPC/ENSICAEN), 14 (France); Chomaz, Ph. [Grand Accelerateur National d' Ions Lourds (GANIL), 14 - Caen (France)

    2003-11-01

    The canonical thermodynamic properties of a one-dimensional system of interacting spin-1/2 fermions with an attractive zero-range pseudo-potential are investigated within an exact approach. The density operator is evaluated as the statistical average of dyadics formed from a stochastic mean-field propagation of independent Slater determinants. For an harmonically trapped Fermi gas and for fermions confined in a 1D-like torus, we observe the transition to a quasi-BCS state with Cooper-like momentum correlations and an algebraic long-range order. For few trapped fermions in a rotating torus, a dominant superfluid component with quantized circulation can be isolated. (author)

  3. A unitary correlation operator method

    International Nuclear Information System (INIS)

    Feldmeier, H.; Neff, T.; Roth, R.; Schnack, J.

    1997-09-01

    The short range repulsion between nucleons is treated by a unitary correlation operator which shifts the nucleons away from each other whenever their uncorrelated positions are within the repulsive core. By formulating the correlation as a transformation of the relative distance between particle pairs, general analytic expressions for the correlated wave functions and correlated operators are given. The decomposition of correlated operators into irreducible n-body operators is discussed. The one- and two-body-irreducible parts are worked out explicitly and the contribution of three-body correlations is estimated to check convergence. Ground state energies of nuclei up to mass number A=48 are calculated with a spin-isospin-dependent potential and single Slater determinants as uncorrelated states. They show that the deduced energy-and mass-number-independent correlated two-body Hamiltonian reproduces all ''exact'' many-body calculations surprisingly well. (orig.)

  4. Nano-colloid electrophoretic transport: Fully explicit modelling via dissipative particle dynamics

    Science.gov (United States)

    Hassanzadeh Afrouzi, Hamid; Farhadi, Mousa; Sedighi, Kurosh; Moshfegh, Abouzar

    2018-02-01

    In present study, a novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced for modelling electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Moreover, capability of different thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field in nano scale application (0.072 600 in DPD units regardless of electric field intensity. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0.145 [ v / nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the radial distribution function with available electrolyte structure modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.

  5. Vacancy induced half-metallicity in half-Heusler semiconductors

    KAUST Repository

    Zhu, Zhiyong

    2011-09-28

    First-principles calculations are performed to investigate the effect of vacancies on the electronic structure and magnetic properties of the two prototypical half-Heusler semiconductors NiTiSn and CoTiSb. The spin degeneracy of the host materials is broken for all types of isolated vacancies under consideration, except for Ni-deficient NiTiSn. A half-metallic character is identified in Sn-deficient NiTiSn and Co/Ti/Sb-deficient CoTiSb. We can explain our findings by introducing an extending Slater-Pauling rule for systems with defects. A ferromagnetic ordering of the local moments due to double exchange appears to be likely.

  6. Differential and total cross sections for the ionization of water molecule by electron impact

    International Nuclear Information System (INIS)

    Houamer, S.; Dal Cappello, C.; Mansouri, A.

    2007-01-01

    A theoretical approach is presented to calculate multiply differential and total cross sections of the ionization of H 2 O molecule in the vapour phase. The wave function of the target is described by molecular orbitals consisting of a linear combination of slater type atomic orbitals centered on the heaviest atom which is the oxygen atom in this case. The calculations are carried out in the first Born approximation where the projectile is described by a plane wave while the ejected electron is described by a coulomb wave taking into account its interaction with the residual ion. The spherical average over the Euler solid angle due to the randomly oriented gaseous target molecule is carried out analytically using the rotation matrix properties. The differential and total cross sections are thus evaluated without any special difficulty and compared with experiments and distorted wave calculations. Fair agreements are observed

  7. Quanty4RIXS: a program for crystal field multiplet calculations of RIXS and RIXS-MCD spectra using Quanty.

    Science.gov (United States)

    Zimmermann, Patric; Green, Robert J; Haverkort, Maurits W; de Groot, Frank M F

    2018-05-01

    Some initial instructions for the Quanty4RIXS program written in MATLAB ® are provided. The program assists in the calculation of 1s 2p RIXS and 1s 2p RIXS-MCD spectra using Quanty. Furthermore, 1s XAS and 2p 3d RIXS calculations in different symmetries can also be performed. It includes the Hartree-Fock values for the Slater integrals and spin-orbit interactions for several 3d transition metal ions that are required to create the .lua scripts containing all necessary parameters and quantum mechanical definitions for the calculations. The program can be used free of charge and is designed to allow for further adjustments of the scripts. open access.

  8. Kinetic-energy matrix elements for atomic Hylleraas-CI wave functions

    Energy Technology Data Exchange (ETDEWEB)

    Harris, Frank E., E-mail: harris@qtp.ufl.edu [Department of Physics, University of Utah, Salt Lake City, Utah 84112, USA and Quantum Theory Project, University of Florida, P.O. Box 118435, Gainesville, Florida 32611 (United States)

    2016-05-28

    Hylleraas-CI is a superposition-of-configurations method in which each configuration is constructed from a Slater-type orbital (STO) product to which is appended (linearly) at most one interelectron distance r{sub ij}. Computations of the kinetic energy for atoms by this method have been difficult due to the lack of formulas expressing these matrix elements for general angular momentum in terms of overlap and potential-energy integrals. It is shown here that a strategic application of angular-momentum theory, including the use of vector spherical harmonics, enables the reduction of all atomic kinetic-energy integrals to overlap and potential-energy matrix elements. The new formulas are validated by showing that they yield correct results for a large number of integrals published by other investigators.

  9. Calculation of the electronic and magnetic structures of 3d impurities in the Hcp Fe matrix

    International Nuclear Information System (INIS)

    Franca, Fernando

    1995-01-01

    In this work we investigate the local magnetic properties and the electronic structure of HCP Fe, as well introducing transition metals atoms 3d (Cs, Ti, Cr, Mn, Co, Ni, Cu, Zn) in HCP iron matrix. We employed the discrete variational method (DVM), which is an orbital molecular method which incorporate the Hartree-Fock-Slater theory and the linear combination of atomic orbitals (LCAO), in the self-consistent charge approximation and the local density approximation of Von Barth and Hedin to the exchange-correlation potential. We used the embedded cluster model to investigate the electronic structure and the local magnetic properties for the central atom of a cluster of 27 atoms immersed in the microcrystal representing the HCP Fe. (author)

  10. The Mo/Ta (100) interface

    International Nuclear Information System (INIS)

    Quintanar, C.; Velasco, V.R.; Garcia-Moliner, F.

    1990-12-01

    We have calculated the interface local density of states (ILDOS) formed by the transition metals Mo/Ta using a tight-binding Slater-Koster description and the Green Function matching method together with quickly converging algorithms to compute the transfer matrices. We obtain the surface LDOS as a byproduct. Our result is a useful tool to analyze experimental results and to check models as a function of the value of the tight-binding parameters either of the bulk or at the interface itself. We consider the (100) direction. We compare the interface to the bulk and to the surface and comment on some recently found experimental results for this interface. (author). 17 refs, 2 figs

  11. Benchmark Calculation of Radial Expectation Value for Confined Hydrogen-Like Atoms and Isotropic Harmonic Oscillators

    International Nuclear Information System (INIS)

    Yu, Rong Mei; Zan, Li Rong; Jiao, Li Guang; Ho, Yew Kam

    2017-01-01

    Spatially confined atoms have been extensively investigated to model atomic systems in extreme pressures. For the simplest hydrogen-like atoms and isotropic harmonic oscillators, numerous physical quantities have been established with very high accuracy. However, the expectation value of which is of practical importance in many applications has significant discrepancies among calculations by different methods. In this work we employed the basis expansion method with cut-off Slater-type orbitals to investigate these two confined systems. Accurate values for several low-lying bound states were obtained by carefully examining the convergence with respect to the size of basis. A scaling law for was derived and it is used to verify the accuracy of numerical results. Comparison with other calculations show that the present results establish benchmark values for this quantity, which may be useful in future studies. (author)

  12. Sign Learning Kink-based (SiLK) Quantum Monte Carlo for molecular systems

    International Nuclear Information System (INIS)

    Ma, Xiaoyao; Hall, Randall W.; Löffler, Frank; Kowalski, Karol; Bhaskaran-Nair, Kiran; Jarrell, Mark; Moreno, Juana

    2016-01-01

    The Sign Learning Kink (SiLK) based Quantum Monte Carlo (QMC) method is used to calculate the ab initio ground state energies for multiple geometries of the H 2 O, N 2 , and F 2 molecules. The method is based on Feynman’s path integral formulation of quantum mechanics and has two stages. The first stage is called the learning stage and reduces the well-known QMC minus sign problem by optimizing the linear combinations of Slater determinants which are used in the second stage, a conventional QMC simulation. The method is tested using different vector spaces and compared to the results of other quantum chemical methods and to exact diagonalization. Our findings demonstrate that the SiLK method is accurate and reduces or eliminates the minus sign problem

  13. Comment on atomic independent-particle models

    International Nuclear Information System (INIS)

    Doda, D.D.; Gravey, R.H.; Green, A.E.S.

    1975-01-01

    The Hartree-Fock-Slater (HFS) independent-particle model in the form developed by Hermann and Skillman (HS) and the Green, Sellin, and Zachor (GSZ) analytic independent-particle model are being used for many types of applications of atomic theory to avoid cumbersome, albeit more rigorous, many-body calculations. The single-electron eigenvalues obtained with these models are examined and it is found that the GSZ model is capable of yielding energy eigenvalues for valence electrons which are substantially closer to experimental values than are the results of HS-HFS calculations. With the aid of an analytic representation of the equivalent HS-HFS screening function, the difficulty with this model is identified as a weakness of the potential in the neighborhood of the valence shell. Accurate representations of valence states are important in most atomic applications of the independent-particle model

  14. The configuration-driven table CI method and comparison with integral-driven CI procedures

    International Nuclear Information System (INIS)

    Buenker, R.J.

    1980-01-01

    A new configuration-driven CI algorithm is outlined which eliminates the need for explicit comparison of pairs of Slater determinants through the use of a series of compact tables. In this scheme each pair of configurations is either shown to be non-interacting or to fall into one of nine cases, each of which is characterized fully once certain orbital permutations are determined. The program is divided into three parts: a case structure analysis step including integral label generation, a sort of the required electron repulsion integrals, and finally a procedure in which the foregoing information is combined with tabulated directions for the evaluation of the necessary Hamiltonian matrix elements over spin-adapted functions. Timing improvements of up to more than a factor of four have been achieved with the new algorithm

  15. Studies in the electronic structure of matter

    International Nuclear Information System (INIS)

    Swarts, C.A.

    1979-01-01

    The results of various theories for the angular distribution of electrons photoemitted from the outermost p-shell of rare gas atoms are compared. The theories compared are the local density theories of Slater (X/sub α/) and of Hohenberg, Kohn and Sham, the pseudopotential method, Hartree-Fock theory as evaluated by Kennedy and Manson, and Amusia's random phase approximation with exchange (RPAE). Extended Huekel theory is applied to GaAs, GaP, and to the nitrogen isoelectronic trap in GaAs and GaP. The computer perfect crystal band structures are found to be in reasonable agreement with those computed with empirical pseudopotentials. Nitrogen impurity levels in GaAs and GaP are calculated using a cluster model. By means of model calculations for an independent electron metal, exact lineshapes are obtained for the photon absorption, emission and photoemission spectra of deep core states. 97 references

  16. Characterization of some Pr(III) complexes in terms of electronic spectral parameters

    International Nuclear Information System (INIS)

    Bhati, P.R.; Soni, K.P.; Joshi, G.K.; Swami, S.N.

    1992-01-01

    Pr(III) complexes from the ligands derived from methyl acetoacetate, ethyl acetoacetate, veratraldehyde, ethyl vanillin and 2,5 dimethoxy benzaldehyde forming Schiff-bases with ortho, meta and para phenylene diamines have been synthesized. The complexes have been characterized in terms of various Slater-Condon Lande and Judd-Ofelt parameters. The various trends in the parametric values have also been described. The involvement of 4f-orbital in the Pr(III) complexes including deviation in the symmetry have been discussed on the basis of electronic spectral parameters. The validity of the theories used has been established while comparing observed and calculated energies and intensities of the various bands in the present complexes on the basis of r.m.s deviation. The trends of the curves observed in the solution spectra have also been discussed. (author). 21 refs., 5 tabs., 2 figs

  17. Bonding and energy parameters for Pr and Nd complexes of benzimidazoles

    Energy Technology Data Exchange (ETDEWEB)

    Mittal, S; Vyas, P C; Oza, C K [Rajasthan Univ., Jaipur (India). Dept. of Chemistry

    1991-01-01

    Complexes of praseodymium(III) and neodymium(III) with benzimidazoles have been synthesized and characterized by their conductance and infrared spectral studies. The values of interelectronic repulsion, i.e. Slater-Condon (F{sub 2}, F{sub 4}, F{sub 6}), Racah (E{sup 1}, E{sup 2}, E{sup 3}) parameters and spin-orbit interaction referred as Lande' ({zeta}4f) parameters have been calculated from their electronic spectral data. A comparison of these parameters for the complexes with Pr{sup 3+} and Nd{sup 3+} free ion parameters is discussed. Using F{sub 2} values, the nephelauxetic ratio({Beta}) and bonding parameter(b{sup 1/2}) have beeen calculated. The relative variation of covalent bonding in the complexes has been reported. (author). 11 refs., 1 tab.

  18. Extended analysis of Br VIII and predicted trends for the n=4, Δn=0 transistions of nickel-like ions (Kr IX-Mo XV)

    International Nuclear Information System (INIS)

    Wyart, J.F.; Ryabtsev, A.N.

    1986-01-01

    More than one hundred lines of Br VIII have been classified in the spectral region 416-824 A, from which all levels of 3d 9 4d (except 1 S 0 ) have been found. The energy levels of the configurations 3d 9 4s, 3d 9 4p and 3d 9 4d have been interpreted from Zn III to Mo XV by means of the Slater-Condon theory and of generalized least squares techniques and the root mean square deviations are 8, 51 and 40 cm -1 respectively. The strongest lines of the 4s-4p and 4p-4d transitions are predicted from Kr IX to Mo XV. (orig.)

  19. Analysis of the spectrum six times ionized zinc (Zn VII): the 3d6-3d54p transition array

    International Nuclear Information System (INIS)

    Hof, G.H. van het; Joshi, Y.N.; Raassen, A.J.J.; Ryabtsev, A.N.

    1993-01-01

    The spectrum of zinc was photographed in the 100-300 A region on a 10.7 m grazing incidence spectrograph using a triggered spark light source. 335 lines were classified in the Zn VII 3d 6 -3d 5 4p transition array, resulting in the establishment of 30 of the 34 levels of the 3d 6 configuration and 103 of the 214 levels of the 3d 5 4p. The ground configuration 3d 6 was described by a generalized least-squares fit (GLSF) involving orthogonal operators to a set of 3d N configurations. This yielded a mean error of 3 cm -1 for its level values. The excited configruation was described by the conventional Slater Condon parameter set, giving a mean error of 105 cm -1 . (orig.)

  20. Shapes of nuclear configurations in a cranked harmonic oscillator model

    International Nuclear Information System (INIS)

    Troudet, T.; Arvieu, R.

    1980-05-01

    The shapes of nuclear configurations are calculated using Slater determinants built with cranked harmonic oscillator single particle states. The nuclear forces role is played by a volume conservation condition (of the potential or of the density) in a first part. In a second part, we have used the finite range, density dependent interaction of Cogny. A very simple classification of configurations emerges in the first part, the relevant parameter being the equatorial eccentricity of the nuclear density. A critical equatorial eccentricity is obtained which governs the accession to the case for which the nucleus is oblate and symmetric around its axis of rotation. Nuclear configurations calculated in the second part observe remarkably well these behaviors

  1. FEAST fundamental framework for electronic structure calculations: Reformulation and solution of the muffin-tin problem

    Science.gov (United States)

    Levin, Alan R.; Zhang, Deyin; Polizzi, Eric

    2012-11-01

    In a recent article Polizzi (2009) [15], the FEAST algorithm has been presented as a general purpose eigenvalue solver which is ideally suited for addressing the numerical challenges in electronic structure calculations. Here, FEAST is presented beyond the “black-box” solver as a fundamental modeling framework which can naturally address the original numerical complexity of the electronic structure problem as formulated by Slater in 1937 [3]. The non-linear eigenvalue problem arising from the muffin-tin decomposition of the real-space domain is first derived and then reformulated to be solved exactly within the FEAST framework. This new framework is presented as a fundamental and practical solution for performing both accurate and scalable electronic structure calculations, bypassing the various issues of using traditional approaches such as linearization and pseudopotential techniques. A finite element implementation of this FEAST framework along with simulation results for various molecular systems is also presented and discussed.

  2. Calculation of the electronic and magnetic structures of 3d impurities in the Hcp Fe matrix; Calculo da estrutura eletronica e magnetica de impurezas 3d na matriz do Fe HCP

    Energy Technology Data Exchange (ETDEWEB)

    Franca, Fernando

    1995-12-31

    In this work we investigate the local magnetic properties and the electronic structure of HCP Fe, as well introducing transition metals atoms 3d (Cs, Ti, Cr, Mn, Co, Ni, Cu, Zn) in HCP iron matrix. We employed the discrete variational method (DVM), which is an orbital molecular method which incorporate the Hartree-Fock-Slater theory and the linear combination of atomic orbitals (LCAO), in the self-consistent charge approximation and the local density approximation of Von Barth and Hedin to the exchange-correlation potential. We used the embedded cluster model to investigate the electronic structure and the local magnetic properties for the central atom of a cluster of 27 atoms immersed in the microcrystal representing the HCP Fe. (author) 32 refs., 19 figs., 2 tabs.

  3. Bioenergetics molecular biology, biochemistry, and pathology

    CERN Document Server

    Ozawa, Takayuki

    1990-01-01

    The emergence of the Biochemical Sciences is underlined by the FAOB symposium in Seoul and highlighted by this Satellite meeting on the "New Bioenergetics. " Classical mitochondrial electron transfer and energy coupling is now complemented by the emerging molecular biology of the respiratory chain which is studied hand in hand with the recognition of mitochondrial disease as a major and emerging study in the basic and clinical medical sciences. Thus, this symposium has achieved an important balance of the fundamental and applied aspects of bioenergetics in the modern setting of molecular biology and mitochondrial disease. At the same time, the symposium takes note not only of the emerging excellence of Biochemical Studies in the Orient and indeed in Korea itself, but also retrospectively enjoys the history of electron transport and energy conservation as represented by the triumvirate ofYagi, King and Slater. Many thanks are due Drs. Kim and Ozawa for their elegant organization of this meeting and its juxtapo...

  4. How good are the internal conversion coefficients now?

    International Nuclear Information System (INIS)

    Raman, S.; Nestor, C.W. Jr.; Ichihara, A.; Trzhaskovskaya, M.B.

    2002-01-01

    To fully utilize experimental internal conversion coefficients, one needs a reliable calculation of theoretical values. We have assembled a set of 100 experimental conversion coefficients, 45 α K and 55 α T values, measured with an accuracy of better than 5%, and generated the corresponding theoretical values using two methods, relativistic Hartree-Fock-Slater (RHFS) and relativistic Dirac-Fock (DF). Extensive comparisons of the experimental values with the two sets of theoretical values show that the DF method is clearly superior to the RHFS method in the overall reproduction of the experimental internal conversion coefficients. We discuss in some detail the differences between various versions of these two theoretical approaches, with a view to understanding which of these differences are most critical to obtaining agreement with experiment

  5. Configuration interaction wave functions: A seniority number approach

    Energy Technology Data Exchange (ETDEWEB)

    Alcoba, Diego R. [Departamento de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and Instituto de Física de Buenos Aires, Consejo Nacional de Investigaciones Científicas y Técnicas, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Torre, Alicia; Lain, Luis, E-mail: qfplapel@lg.ehu.es [Departamento de Química Física, Facultad de Ciencia y Tecnología, Universidad del País Vasco, Apdo. 644, E-48080 Bilbao (Spain); Massaccesi, Gustavo E. [Departamento de Ciencias Exactas, Ciclo Básico Común, Universidad de Buenos Aires, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Oña, Ofelia B. [Instituto de Investigaciones Fisicoquímicas Teóricas y Aplicadas, Universidad Nacional de La Plata, CCT La Plata, Consejo Nacional de Investigaciones Científicas y Técnicas, Diag. 113 y 64 (S/N), Sucursal 4, CC 16, 1900 La Plata (Argentina)

    2014-06-21

    This work deals with the configuration interaction method when an N-electron Hamiltonian is projected on Slater determinants which are classified according to their seniority number values. We study the spin features of the wave functions and the size of the matrices required to formulate states of any spin symmetry within this treatment. Correlation energies associated with the wave functions arising from the seniority-based configuration interaction procedure are determined for three types of molecular orbital basis: canonical molecular orbitals, natural orbitals, and the orbitals resulting from minimizing the expectation value of the N-electron seniority number operator. The performance of these bases is analyzed by means of numerical results obtained from selected N-electron systems of several spin symmetries. The comparison of the results highlights the efficiency of the molecular orbital basis which minimizes the mean value of the seniority number for a state, yielding energy values closer to those provided by the full configuration interaction procedure.

  6. Structural stability, electronic and magnetic behaviour of spin-polarized YCoVZ (Z = Si, Ge) and YCoTiZ (Z = Si, Ge) Heusler alloys

    Energy Technology Data Exchange (ETDEWEB)

    Rasool, Muhammad Nasir, E-mail: nasir4iub@gmail.com [Department of Physics, The Islamia University of Bahawalpur, Bahawalpur, 63100 (Pakistan); Hussain, Altaf, E-mail: altafiub@yahoo.com [Department of Physics, The Islamia University of Bahawalpur, Bahawalpur, 63100 (Pakistan); Javed, Athar [Department of Physics, University of the Punjab, Lahore, 54590 (Pakistan); Khan, Muhammad Azhar; Iqbal, F. [Department of Physics, The Islamia University of Bahawalpur, Bahawalpur, 63100 (Pakistan)

    2016-11-01

    The structural stability, electronic and magnetic behaviour of YCoVZ (Z = Si, Ge) and YCoTiZ (Z = Si, Ge) Heusler alloys have been studied by first principle approach. Generalized gradient approximation (GGA) based on density functional theory (DFT) has been applied to investigate the properties of quaternary Heusler alloys. The YCoVSi, YCoVGe, YCoTiSi and YCoTiGe Heusler alloys of Type-3 structure are found to be stable in spin-polarized/magnetic phase. The YCoVSi and YCoVGe alloys exhibit nearly spin gapless semiconductor (SGS) behaviour while YCoTiSi and YCoTiGe alloys show half-metallic ferromagnetic (HMF) behaviour. For YCoVSi, YCoVGe, YCoTiSi and YCoTiGe alloys, the calculated energy band gaps in spin down (↓) channel are 0.60, 0.54, 0.68 and 0.44 eV, respectively. The YCoVZ and YCoTiZ alloys are found to have integral value of total magnetic moment (M{sub T}), thus obeying the Slater-Pauling rule, M{sub T} = (N{sub v}–18)μ{sub B}. - Highlights: • Four Heusler alloys i.e. YCoVZ (Z = Si, Ge) and YCoTiZ (Z = Si, Ge) are studied. • Type-3 crystal structure of all four alloys is stable in magnetic phase. • The compressibility (S) follows the order: S{sub YCoVSi} > S{sub YCoTiSi} > S{sub YCoVGe} > S{sub YCoTiGe}. • Half metallic ferromagnetic behaviour is observed in all four alloys. • All four alloys obey the Slater-Pauling rule, M{sub T} = (N{sub v} – 18)μ{sub B}.

  7. L1 and L2 sub-shell fluorescence yields for elements with 64 ≤ Z ≤ 70

    International Nuclear Information System (INIS)

    Kumar, Anil; Puri, Sanjiv

    2010-01-01

    The L 1 and L 2 sub-shell fluorescence yields have been deduced for elements with 64 ≤ Z ≤ 70 from the L k (k = l, α, β 1,4 , β 3,6 , β 2,15,9,10,7 , γ 1,5 and γ 2,3,4 ) X-ray production cross sections measured at 22.6 keV incident photon energy using a spectrometer involving a disc type radioisotope of Cd 109 as a photon source and a Peltier cooled X-ray detector. The incident photon intensity, detector efficiency and geometrical factor have been determined from the K X-ray yields emitted from elemental targets with 20 ≤ Z ≤ 42 in the same geometrical setup and from knowledge of the K shell cross sections. The present deduced ω 1 (exp) values, for elements with 64 ≤ Z ≤ 70, are found to be in good agreement with those tabulated by Campbell (J.L. Campbell, Atom. Data Nucl. Data Tables 95 (2009) 115), where as these are, on an average, higher by 19% and 24% than those based on the Dirac-Hartree-Slater model (S. Puri et al., X-ray Spectrometry 22 (1993) 358) and the semi-empirical values compiled by Krause (M.O. Krause, J. Phys. Chem. Ref. Data 8 (1979) 307), respectively. The present deduced ω 2 (exp) values are found to be in good agreement with those based on the Dirac-Hartree-Slater model and are higher by up to ∼13% than the semi-empirical values for the elements under investigation.

  8. On the initial conditions of time-dependent mean-field equations of evolution. Pt. 2

    International Nuclear Information System (INIS)

    Troudet, T.; Paris-11 Univ., 91 - Orsay

    1986-01-01

    We analyze the problem so far untouched of determining the initial mean-field wavefunction in the context of zero-temperature mean-field descriptions of time-dependent expectation values and quantum fluctuations of nuclear observables. The nucleus, at zero temperature, is taken to be in a low-lying excited many-body eigenstate and is approximated by the corresponding RPA wavefunction as a continuous superposition of coherent states (i.e. Slater determinants). A generating function Gsub(A)(lambda) for time-dependent expectation values and quantum fluctuations is constructed within the formalism of functional integration. By applying the saddle-point method to the functional action of Gsub(A)(lambda) and then taking its lambda-derivatives, we recover the well-known TDHF theory and propose a simple determination of the initial Slater determinant for an appropriate mean-field description of time-dependent expectation values. The analog mean-field description of quadratic-quantum fluctuations proceeds similarly and in addition includes the contribution of the uncorrelated TDHF-RPA phonons coupled to collective excitations of the initial (static) mean-field configuration. When the collective TDHF-RPA excitations are solely taken into account, we obtain an improved version of the Balian-Veneroni dispersion formula by showing how to determine the initial mean-field wavefunction. By first taking the lambda-derivatives of Gsub(A)(lambda) before applying the saddle-point method, the initial mean-field wavefunction is found to be non-linearly coupled to the mean-field dynamics themselves. In return, and in contrast to the first quantization scheme, these both depend non-trivially upon the observable A being measured so that approximations must be proposed to simplify the resulting mean-field equations. (orig.)

  9. Systematic analysis of spectroscopic characteristics of the lanthanide and actinide ions with the 4f{sup N−1}5d and 5f{sup N−1}6d electronic configurations in a free state

    Energy Technology Data Exchange (ETDEWEB)

    Ma, C.-G. [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Brik, M.G., E-mail: brik@fi.tartu.ee [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Institute of Physics, University of Tartu, Riia 142, Tartu 51014 (Estonia); Institute of Physics, Jan Dlugosz University, Armii Krajowej 13/15, PL-42200 Czestochowa (Poland); Tian, Y.; Li, Q.-X. [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China)

    2014-08-01

    Highlights: • Calculated spectroscopic parameters of f{sup N−1}d configurations of the 4f and 5f ions. • Relations between the Slater parameters, spin–orbit constant, atomic number were found. • Barycenters of the electronic configuration energies were calculated. • Obtained relations reduce the number of independent terms in a free ion Hamiltonian. - Abstract: Systematic consideration of the spectroscopic properties of the f{sup N−1}d excited electronic configurations of the di-, tri- and tetravalent lanthanide and actinide ions in a free state is presented. Variations of the Hartree–Fock calculated Slater parameters for the f{sup N−1}d electron configurations, spin–orbit (SO) interaction constant ζ for the f and d electrons, and averaged values of the second, fourth and sixth powers of the 4f, 5f, 5d, 6d electrons’ radial coordinate across both series were considered; functional dependencies between the mentioned quantities were obtained. It has been shown that the Coulomb interaction parameters F{sup 2}(ff), F{sup 4}(ff), and F{sup 6}(ff) for the f{sup N−1} core increase linearly with the atomic number Z, whereas the direct and exchange Coulomb parameters F{sup 2}(fd), F{sup 4}(fd), G{sup 1}(fd), G{sup 3}(fd), G{sup 5}(fd) for the f{sup N−1}d configuration decrease linearly with Z. Since the SO interaction constant ζ{sup 1/4} is also proportional to Z, it was possible to find linear relationships between the Coulomb interaction parameters and SO constants for the f and d electrons, which effectively reduce the number of independent parameters in the free ion Hamiltonian. The constraining relations between the free ion Hamiltonian’s parameters obtained in the present paper can be used for simulations of the f–d transition spectra of these ions in various crystals.

  10. Literacy, imagination and autonomy in A House for Mr. Biswas = Letramento, autonomia e imaginação em A House for Mr. Biswas

    Directory of Open Access Journals (Sweden)

    Mariana Bolfarine

    2012-01-01

    Full Text Available The present article tackles the concepts of literacy, imagination and autonomy in A House for Mr. Biswas (1961 by V. S. Naipaul. The novel reveals that the spread of the English language and Englishness became inevitable during British Imperialism since one of the instruments for its propagation was the imposition of the colonizer’s set of values. It will be shown that although limited and detached from the learners’ reality depicted in the narrative, the missionary school education engendered the imagination as a driving force upon which the protagonist, Mr. Biswas, relies in order to achieve his dreams of autonomy. Theory is mostly foregrounded on works by David Slater, Boaventura dos Santos and Diana Brydon.O presente artigo versa sobre os conceitos de letramento (literacy, imaginação e autonomia em A House for Mr. Biswas (1961, de V. S. Naipaul. O romance revela que a difusão da língua inglesa e da inglesidade (englishness tornou-se inevitável durante o imperialismo britânico, na medida em que estes eram instrumentos de propagação dos valores do colonizador. Demonstraremos que, apesar de limitada e desvinculada da realidade retratada na obra, era a educação proporcionada pelas escolas de missionários que engendrava a imaginação, força motriz que permite ao protagonista, Sr. Biswas, alcançar o seu desejo de autonomia. O campo teórico é constituído principalmente pelos estudos de David Slater, Boaventura dos Santos e Diana Brydon.

  11. Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

    Science.gov (United States)

    Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

    2015-01-13

    Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

  12. L 1 and L 2 sub-shell fluorescence yields for elements with 64 ⩽ Z ⩽ 70

    Science.gov (United States)

    Kumar, Anil; Puri, Sanjiv

    2010-05-01

    The L 1 and L 2 sub-shell fluorescence yields have been deduced for elements with 64 ⩽ Z ⩽ 70 from the L k( k = l, α, β1,4, β3,6, β2,15,9,10,7, γ1,5 and γ2,3,4) X-ray production cross sections measured at 22.6 keV incident photon energy using a spectrometer involving a disc type radioisotope of Cd 109 as a photon source and a Peltier cooled X-ray detector. The incident photon intensity, detector efficiency and geometrical factor have been determined from the K X-ray yields emitted from elemental targets with 20 ⩽ Z ⩽ 42 in the same geometrical setup and from knowledge of the K shell cross sections. The present deduced ω1(exp) values, for elements with 64 ⩽ Z ⩽ 70, are found to be in good agreement with those tabulated by Campbell (J.L. Campbell, Atom. Data Nucl. Data Tables 95 (2009) 115), where as these are, on an average, higher by 19% and 24% than those based on the Dirac-Hartree-Slater model (S. Puri et al., X-ray Spectrometry 22 (1993) 358) and the semi-empirical values compiled by Krause (M.O. Krause, J. Phys. Chem. Ref. Data 8 (1979) 307), respectively. The present deduced ω2(exp) values are found to be in good agreement with those based on the Dirac-Hartree-Slater model and are higher by up to ˜13% than the semi-empirical values for the elements under investigation.

  13. Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model

    Science.gov (United States)

    Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad

    2018-02-01

    In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.

  14. The Development of the Planet Formation Concept Inventory: A Preliminary Analysis of Version 1

    Science.gov (United States)

    Simon, Molly; Impey, Chris David; Buxner, Sanlyn

    2018-01-01

    The topic of planet formation is poorly represented in the educational literature, especially at the college level. As recently as 2014, when developing the Test of Astronomy Standards (TOAST), Slater (2014) noted that for two topics (formation of the Solar System and cosmology), “high quality test items that reflect our current understanding of students’ conceptions were not available [in the literature]” (Slater,2014, p. 8). Furthermore, nearly half of ASTR 101 enrollments are at 2 year/community colleges where both instructors and students have little access to current research and models of planet formation. In response, we administered six student replied response (SSR) short answer questions on the topic of planet formation to n = 1,050 students enrolled in introductory astronomy and planetary science courses at The University of Arizona in the Fall 2016 and Spring 2017 semesters. After analyzing and coding the data from the SSR questions, we developed a preliminary version of the Planet Formation Concept Inventory (PFCI). The PFCI is a multiple-choice instrument with 20 planet formation-related questions, and 4 demographic-related questions. We administered version 1 of the PFCI to six introductory astronomy and planetary science courses (n ~ 700 students) during the Fall 2017 semester. We provided students with 7-8 multiple-choice with explanation of reasoning (MCER) questions from the PFCI. Students selected an answer (similar to a traditional multiple-choice test), and then briefly explained why they chose the answer they did. We also conducted interviews with ~15 students to receive feedback on the quality of the questions and clarity of the instrument. We will present an analysis of the MCER responses and student interviews, and discuss any modifications that will be made to the instrument as a result.

  15. Equations-of-motion approach to a quantum theory of large-amplitude collective motion

    International Nuclear Information System (INIS)

    Klein, A.

    1984-01-01

    The equations-of-motion approach to large-amplitude collective motion is implemented both for systems of coupled bosons, also studied in a previous paper, and for systems of coupled fermions. For the fermion case, the underlying formulation is that provided by the generalized Hartree-Fock approximation (or generalized density matrix method). To obtain results valid in the semi-classical limit, as in most previous work, we compute the Wigner transform of quantum matrices in the representation in which collective coordinates are diagonal and keep only the leading contributions. Higher-order contributions can be retained, however, and, in any case, there is no ambiguity of requantization. The semi-classical limit is seen to comprise the dynamics of time-dependent Hartree-Fock theory (TDHF) and a classical canonicity condition. By utilizing a well-known parametrization of the manifold of Slater determinants in terms of classical canonical variables, we are able to derive and understand the equations of the adiabatic limit in full parallelism with the boson case. As in the previous paper, we can thus show: (i) to zero and first order in the adiabatic limit the physics is contained in Villar's equations; (ii) to second order there is consistency and no new conditions. The structure of the solution space (discussed thoroughly in the previous paper) is summarized. A discussion of associated variational principles is given. A form of the theory equivalent to self-consistent cranking is described. A method of solution is illustrated by working out several elementary examples. The relationship to previsous work, especially that of Zelevinsky and Marumori and coworkers is discussed briefly. Three appendices deal respectively with the equations-of-motion method, with useful properties of Slater determinants, and with some technical details associated with the fermion equations of motion. (orig.)

  16. IV National Conference on Dermatocosmetic Sciences - Proceedings

    Directory of Open Access Journals (Sweden)

    Escola de Ciências e Tecnologias da Saúde (ECTS da Univ Lusófona de Humanidades e Tecnologias

    2013-06-01

    Full Text Available Honor Committee/ Comissão de Honra Reitor da Universidade Lusó fona, Mário Moutinho Presidente do Conselho de Administração da Universidade Lusófona, Manuel de Almeida Damásio, Ministro da Saúde, Paulo Macedo Presidente do Conselho Directivo do INFARMED, Eurico Castro Alves Bastonário da Ordem dos Farmacêuticos, Carlos Mauricio Barbosa Bastonária da Ordem dos Nutricionistas, Alexandra Bento Presidente da Associação Industriais Cosmética, Ana Maria Couras Presidente da SPCC, Luís Monteiro Rodrigues (Presidente do Congresso Scientific Committee / Comissão Cientifica Amílcar Roberto, Universidade Lusófona Catarina Rosado, Universidade Lusófona Fernanda Guedes Bahia, Universidade do Porto Helena Margarida Ribeiro, Universidade de Lisboa Isabel Almeida, Universidade do Porto Ligia Reis Luís Monteiro Rodrigues, Universidade Lusófona Manuel Fitas, Universidade Lusófona Maria de Lurdes Rebelo, Universidade de Coimbra Organizing Committee / Comissão Organizadora Escola de Ciências e Tecnologias da Saúde (ECTS da Univ Lusófona de Humanidades e Tecnologias Sociedade Portuguesa de Ciências Cosmetológicas ALIES – Associação Lusófona para o Desenvolvimento do Ensino e Investigação das Ciências da Saúde CBIOS - Unidade de Dermatologia Experimental (UDE Programm / Programa Open Session | Sessão de abertura Magnífico Reitor da Universidade Lusófona, Mário Moutinho Pres. do Conselho de Admin da Univ Lusófona, Manuel de A. Damásio Sr Presidente do INFARMED, Eurico Castro Alves Srª Pres. da Secção Regional de Lisboa da OF, Ema Paulino Srª Bastonária da Ordem dos Nutricionistas, Alexandra Bento* Srª Pres. da Associação dos Industriais de Cosmética, Ana Maria Couras Presidente da SPCC, Luís Monteiro Rodrigues (Presidente do Congresso 1st Session | Sessão 1 Cosmetics and Society | Cosméticos e Sociedade Moderator / Moderador- Ligia Reis, Impact of the new regulation for Cosmetics | Impacto da entrada em vigor do

  17. Spatial and temporal variability in coccolithophore abundance and distribution in the NW Iberian coastal upwelling system

    Directory of Open Access Journals (Sweden)

    B. Ausín

    2018-01-01

    Full Text Available A systematic investigation of the spatial and temporal variability in coccolithophore abundance and distribution through the water column of the NW Iberian coastal upwelling system was performed. From July 2011 to June 2012, monthly sampling at various water depths was conducted at two parallel stations located at 42° N. Total coccosphere abundance was higher at the outer-shelf station, where warmer, nutrient-depleted waters favoured coccolithophore rather than phytoplanktonic diatom blooms, which are known to dominate the inner-shelf location. In seasonal terms, higher coccosphere and coccolith abundances were registered at both stations during upwelling seasons, coinciding with high irradiance levels. This was typically in conjunction with stratified, nutrient-poor conditions (i.e. relaxing upwelling conditions. However, it also occurred during some upwelling events of colder, nutrient-rich subsurface waters onto the continental shelf. Minimum abundances were generally found during downwelling periods, with unexpectedly high coccolith abundance registered in subsurface waters at the inner-shelf station. This finding can only be explained if strong storms during these downwelling periods favoured resuspension processes, thus remobilizing deposited coccoliths from surface sediments, and hence hampering the identification of autochthonous coccolithophore community structure. At both locations, the major coccolithophore assemblages were dominated by Emiliania huxleyi, small Gephyrocapsa group, Gephyrocapsa oceanica, Florisphaera profunda, Syracosphaera spp., Coronosphaera mediterranea, and Calcidiscus leptoporus. Ecological preferences of the different taxa were assessed by exploring the relationships between environmental conditions and temporal and vertical variability in coccosphere abundance. These findings provide relevant information for the use of fossil coccolith assemblages in marine sediment records, in order to infer past

  18. Spatial and temporal variability in coccolithophore abundance and distribution in the NW Iberian coastal upwelling system

    Science.gov (United States)

    Ausín, Blanca; Zúñiga, Diana; Flores, Jose A.; Cavaleiro, Catarina; Froján, María; Villacieros-Robineau, Nicolás; Alonso-Pérez, Fernando; Arbones, Belén; Santos, Celia; de la Granda, Francisco; Castro, Carmen G.; Abrantes, Fátima; Eglinton, Timothy I.; Salgueiro, Emilia

    2018-01-01

    A systematic investigation of the spatial and temporal variability in coccolithophore abundance and distribution through the water column of the NW Iberian coastal upwelling system was performed. From July 2011 to June 2012, monthly sampling at various water depths was conducted at two parallel stations located at 42° N. Total coccosphere abundance was higher at the outer-shelf station, where warmer, nutrient-depleted waters favoured coccolithophore rather than phytoplanktonic diatom blooms, which are known to dominate the inner-shelf location. In seasonal terms, higher coccosphere and coccolith abundances were registered at both stations during upwelling seasons, coinciding with high irradiance levels. This was typically in conjunction with stratified, nutrient-poor conditions (i.e. relaxing upwelling conditions). However, it also occurred during some upwelling events of colder, nutrient-rich subsurface waters onto the continental shelf. Minimum abundances were generally found during downwelling periods, with unexpectedly high coccolith abundance registered in subsurface waters at the inner-shelf station. This finding can only be explained if strong storms during these downwelling periods favoured resuspension processes, thus remobilizing deposited coccoliths from surface sediments, and hence hampering the identification of autochthonous coccolithophore community structure. At both locations, the major coccolithophore assemblages were dominated by Emiliania huxleyi, small Gephyrocapsa group, Gephyrocapsa oceanica, Florisphaera profunda, Syracosphaera spp., Coronosphaera mediterranea, and Calcidiscus leptoporus. Ecological preferences of the different taxa were assessed by exploring the relationships between environmental conditions and temporal and vertical variability in coccosphere abundance. These findings provide relevant information for the use of fossil coccolith assemblages in marine sediment records, in order to infer past environmental conditions, of

  19. Kinetic control on Zn isotope signatures recorded in marine diatoms

    Science.gov (United States)

    Köbberich, Michael; Vance, Derek

    2017-08-01

    Marine diatoms dominate the oceanic cycle of the essential micronutrient zinc (Zn). The stable isotopes of zinc and other metals are increasingly used to understand trace metal micronutrient cycling in the oceans. One clear feature of the early isotope data is the heavy Zn isotope signature of the average oceanic dissolved pool relative to the inputs, potentially driven by uptake of light isotopes into phytoplankton cells and export to sediments. However, despite the fact that diatoms strip Zn from surface waters across the Antarctic polar front in the Southern Ocean, the local upper ocean is not isotopically heavy. Here we use culturing experiments to quantify the extent of Zn isotope fractionation by diatoms and to elucidate the mechanisms driving it. We have cultured two different open-ocean diatom species (T. oceanica and Chaetoceros sp.) in a series of experiments at constant medium Zn concentration but at bioavailable medium Fe ranging from limiting to replete. We find that T. oceanica can maintain high growth rates and Zn uptake rates over the full range of bioavailable iron (Fe) investigated, and that the Zn taken up has a δ66Zn that is unfractionated relative to that of the bioavailable free Zn in the medium. The studied representative of the genus Chaetoceros, on the other hand, shows more significantly reduced Zn uptake rates at low Fe and records more variable biomass δ66Zn signatures, of up to 0.85‰ heavier than the medium. We interpret the preferential uptake of heavy isotopes at extremely low Zn uptake rates as potentially due to either of the following two mechanisms. First, the release of extracellular polymeric substances (EPS), at low Fe levels, may preferentially scavenge heavy Zn isotopes. Second, the Zn uptake rate may be slow enough to establish pseudo-equilibrium conditions at the transporter site, with heavy Zn isotopes forming more stable surface complexes. Thus we find that, in our experiments, Fe-limitation exerts a key control that

  20. A review on phytochemical, ethnomedical and pharmacological studies on genus Sophora, Fabaceae

    Directory of Open Access Journals (Sweden)

    Panthati Murali Krishna

    2012-10-01

    Full Text Available Sophora is a genus of the Fabaceae family, contains about 52 species, nineteen varieties, and seven forms that are widely distributed in Asia, Oceanica, and the Pacific islands, in the family Fabaceae of herbaceous (Sophora flavescens Aiton to trees (Sophora japonica L.. More than fifteen species in this genus have a long history of use in traditional Chinese medicines. In the last decades the use of this genus in traditional Chinese drugs has led to rapid increase in the information available on active components and reported to posses various pharmacological/therapeutic properties. The paper reviews the ethnopharmacology, the biological activities and the correlated chemical compounds of genus Sophora, Fabaceae. More than 300 compounds has been isolated, among them major are quinolizidine alkaloids particularly matrine and oxymatrine and flavonoids particularly prenylated and isoprenylated flavonoids. Modern pharmacological studies and clinical studies demonstrated that these chemical constituens possess wide reaching pharmacological actions like anti oxidant, anticancer, anti-asthamatic, anti-neoplastic, antimicrobial, antiviral, antidote, anti pyretic, cardiotonic, antinflammatory, diuretic and in the treatment of skin diseases like eczema, colitis and psoriasis.

  1. Plate motions, Gondwana Dinosaurs, Noah's Arks, Beached Viking Funeral Ships, Ghost Ships, and Landspans

    Directory of Open Access Journals (Sweden)

    Louis L. Jacobs

    2011-03-01

    Full Text Available Gondwana landmasses have served as large-scale biogeographic Noah's Arks and Beached Viking Funeral Ships, as defined by McKenna. The latitudinal trajectories of selected Gondwana dinosaur localities were traced through time in order to evaluate their movement through climate zones relative to those in which they originally formed. The dispersal of fauna during the breakup of Gondwana may have been facilitated by the presence of offshelf islands forming landspans (sensu Iturralde-Vinent and MacPhee in the Equatorial Atlantic Gateway and elsewhere.As massas de terra do Gondwana serviram como Arcas de Noe biogeograficas de grande escala e Navios Funerarios Vikings encalhados, conforme definido por McKenna. As trajetorias latitudinais de areas selecionadas de dinossauros do Gondwana foram tracadas ao longo do tempo a fim de avaliar seu movimento atraves de zonas climaticas relativas aquelas nas quais elas foram originalmente formadas. A dispersao da fauna durante a quebra do Gondwana pode ter sido facilitada pela presenca de ilhas oceanicas formando extensoes de terra (sensu Iturralde-Vinent e MacPhee na entrada do Atlantico Equatorial e em outros lugares.

  2. A massive ingression of the alien species Mytilus edulis L. (Bivalvia: Mollusca into the Mediterranean Sea following the Costa Concordia cruise-ship disaster

    Directory of Open Access Journals (Sweden)

    E. CASOLI

    2016-03-01

    Full Text Available The Costa Concordia cruise-ship disaster occurred just off the coast of Italy on January 13th, 2012, and entailed the largest marine salvage operation in history. The salvage employed vessels from different European harbours, providing an unexpected means for transporting alien species into the Mediterranean. In this work we identified mussel species using fragments length polymorphism of a nuclear locus and report the first evidence of the transport of the blue mussel, Mytilus edulis Linnaeus, 1758 (Bivalvia: Mollusca, into the Mediterranean Sea, as a part of the fouling community of the hull of an accommodation barge arrived from a NE Atlantic location in October 2012. Furthermore, we describe the rapid growth of this species, under the ASV Pioneer, until its almost total extinction during the summer of 2013, which left a covering of mussel shells on the underlying Posidonia oceanica (Linnaeus Delile, 1813. meadow. This high mortality rate indicated that M. edulis had been exposed to high stress conditions, probably due to different salinity, temperature, and oligotrophic conditions from its place of origin, and there was no spawning event or known settlement on the nearest infralittoral natural habitats. This event reminds us of how the Mediterranean Sea is constantly under alien-species pressure, due to human activities.

  3. Unlocking nature’s treasure-chest: screening for oleaginous algae

    Science.gov (United States)

    Slocombe, Stephen P.; Zhang, QianYi; Ross, Michael; Anderson, Avril; Thomas, Naomi J.; Lapresa, Ángela; Rad-Menéndez, Cecilia; Campbell, Christine N.; Black, Kenneth D.; Stanley, Michele S.; Day, John G.

    2015-01-01

    Micro-algae synthesize high levels of lipids, carbohydrates and proteins photoautotrophically, thus attracting considerable interest for the biotechnological production of fuels, environmental remediation, functional foods and nutraceuticals. Currently, only a few micro-algae species are grown commercially at large-scale, primarily for “health-foods” and pigments. For a range of potential products (fuel to pharma), high lipid productivity strains are required to mitigate the economic costs of mass culture. Here we present a screen concentrating on marine micro-algal strains, which if suitable for scale-up would minimise competition with agriculture for water. Mass-Spectrophotometric analysis (MS) of nitrogen (N) and carbon (C) was subsequently validated by measurement of total fatty acids (TFA) by Gas-Chromatography (GC). This identified a rapid and accurate screening strategy based on elemental analysis. The screen identified Nannochloropsis oceanica CCAP 849/10 and a marine isolate of Chlorella vulgaris CCAP 211/21A as the best lipid producers. Analysis of C, N, protein, carbohydrate and Fatty Acid (FA) composition identified a suite of strains for further biotechnological applications e.g. Dunaliella polymorpha CCAP 19/14, significantly the most productive for carbohydrates, and Cyclotella cryptica CCAP 1070/2, with utility for EPA production and N-assimilation. PMID:26202369

  4. Rapid Aggregation of Biofuel-Producing Algae by the Bacterium Bacillus sp. Strain RP1137

    Science.gov (United States)

    Powell, Ryan J.

    2013-01-01

    Algal biofuels represent one of the most promising means of sustainably replacing liquid fuels. However, significant challenges remain before alga-based fuels become competitive with fossil fuels. One of the largest challenges is the ability to harvest the algae in an economical and low-energy manner. In this article, we describe the isolation of a bacterial strain, Bacillus sp. strain RP1137, which can rapidly aggregate several algae that are candidates for biofuel production, including a Nannochloropsis sp. This bacterium aggregates algae in a pH-dependent and reversible manner and retains its aggregation ability after paraformaldehyde fixation, opening the possibility for reuse of the cells. The optimal ratio of bacteria to algae is described, as is the robustness of aggregation at different salinities and temperatures. Aggregation is dependent on the presence of calcium or magnesium ions. The efficiency of aggregation of Nannochloropsis oceanica IMET1 is between 70 and 95% and is comparable to that obtained by other means of harvest; however, the rate of harvest is fast, with aggregates forming in 30 s. PMID:23892750

  5. Bioaccumulation of PCBs in the sea urchin Paracentrotus lividus: seawater and food exposures to a 14C-radiolabelled congener (PCB no. 153)

    International Nuclear Information System (INIS)

    Danis, B.; Cotret, O.; Teyssie, J.L.; Bustamante, P.; Fowler, S.W.; Warnau, M.

    2005-01-01

    Adult Paracentrotus lividus were exposed to a 14 C-labelled PCB congener (PCB no. 153) using two different exposure modes: (1) the surrounding sea water and (2) the food (viz. the phanerogam Posidonia oceanica and the brown alga Taonia atomaria). Uptake kinetics from water and loss kinetics after single feeding were followed in four body compartments of the sea urchins (body wall, spines, gut and gonads). Results indicate that PCB bioaccumulation in P. lividus varies from one body compartment to another, with the exposure mode and the nature of the food. The echinoids accumulate PCB no. 153 more efficiently when exposed via water than via the food (the transfer efficiency is higher by one order of magnitude). Target body compartments of PCB no. 153 were found to be body wall and spines when individuals were exposed via water, and gut when they were exposed via food. It is concluded that P. lividus is an efficient bioaccumulator of PCB and that it could be considered as an interesting indicator for monitoring PCB contamination in the marine environment. - The sea urchin Paracentrotus lividus is a valuable indicator for PCB contamination

  6. Design and development of an instrument to measure radiative absorption of seawater. Sumarad

    International Nuclear Information System (INIS)

    Fasano, G.; Materassi, A.

    2003-01-01

    In the present work, a low-cost instrument is presented that provides the ratio between underwater radiation and radiation outside water for the four spectral ranges fundamental for photosynthetic activity (Sub Marine Radiometer). The instrument essentially consists of two radiometers which operate in the same four bands: one acquires radiation outside the water, the other underwater radiation at a pre-established depth. The two acquisition systems are synchronized when the instrument is turned on and then, in the course of data elaboration, the ratio is obtained between underwater and outside water radiation for each spectral band, at any determined moment, at a predetermined depth. This ratio, in accordance with the Beer-Lambert equation, represents the transmittance of the medium crossed by radiation. By applying the Linke equation to collected data, it is also possible to determine the turbidity of the considered medium. The system can acquire as many as 1,472 data, with programmable temporal scanning, and can operate at depths up to 50 meters. Applications of this instrument are already in progress in studies concerning the relationship between solar radiation and photosynthetic activity of Posidonia oceanica. The proposed instrument has a relatively low cost, when compared with that of other instruments currently on the market, making it particularly suitable for applications that require numerous instruments to monitor sea, lacustrine or fluvial water in various points at the same time [it

  7. Occurrence of Coccolithophorids in the Northeastern and Central South China Sea

    Directory of Open Access Journals (Sweden)

    Tien-Nan Yang

    2003-03-01

    Full Text Available Coccolithophorids in the northeastern and central South China Sea (SCS were surveyed in March and October 1996. The cell density of coccolithophorids ranged from 25 x 103 cells L-1 to 31 x 103 cells L-1 in sea-surface water (0–25 m in depth, and from 12 x 103 cells L-1 to 62 x 103 cells L-1 in subsurface water (150 m in depth. The lowest cell number was recorded in the subsurface (150 m in depth in the central gyral area, while the highest one was at the same depth in the northeastern realm. A total of thirty-one species were identified. The species richness in the northeastern SCS is higher than in the central area. Emiliania huxleyi (Lohmann Hay et Mohler, Gephyrocapsa oceanica Kamptner, Umbellosphaera Paasche spp. And Syracosphaera Lohmann spp. Dominated the surface assemblages, whereas Florisphaera profunda Okada et Honjo, Gladiolithus flabellatus (Halldal et Markali Jordan et Chamberlain predominated in the subsurface layer. In contrast, Palusphaera vandeli Lecal emend. R. E. Norris presented in both surface and subsurface assemblages.

  8. Nineteen-year time-series sediment trap study of Coccolithus pelagicus and Emiliania huxleyi (calcareous nannoplankton) fluxes in the Bering Sea and subarctic Pacific Ocean

    Science.gov (United States)

    Tsutsui, Hideto; Takahashi, Kozo; Asahi, Hirofumi; Jordan, Richard W.; Nishida, Shiro; Nishiwaki, Niichi; Yamamoto, Sumito

    2016-03-01

    Coccolithophore fluxes at two sediment trap stations, Station AB in the Bering Sea and Station SA in the subarctic Pacific Ocean, were studied over a nineteen-year (August 1990-July 2009) interval. Two major species, Coccolithus pelagicus and Emiliania huxleyi, occur at both stations, with Gephyrocapsa oceanica, Umbilicosphaera sibogae, Braarudosphaera bigelowii, and Syracosphaera spp. as minor components. The mean coccolithophore fluxes at Stations AB and SA increased from 28.9×106 m2 d-1 and 61.9×106 m2 d-1 in 1990-1999 to 54.4×106 m2 d-1 and 130.2×106 m2 d-1 in 2002-2009, respectively. Furthermore, in late 1999 to early 2000, there was a significant shift in the most dominant species from E. huxleyi to C. pelagicus. High abundances of E. huxleyi correspond to the positive mode of the Pacific Decadal Oscillation (PDO), while those of C. pelagicus respond to the PDO negative mode and are related to water temperature changes at huxleyi. At both stations the mean seawater temperature in the top 45 m from August to October increased ca. 1 °C with linear recurrence from 1990 to 2008. The coccosphere fluxes after Year 2000 at Stations AB and SA, and the shift in species dominance, may have been influenced by this warming.

  9. Ecological and taphonomical influences on coccoliths in surface sediments in the shelf of the Yellow and East China Seas

    Science.gov (United States)

    Jin, Xiaobo; Liu, Chuanlian

    2017-05-01

    Coccoliths, combined with sediment grain size, carbonate calcium and organic matters content, were analyzed to assess the ecological and taphonomical influences on coccolith distribution patterns in surface sediments in the continental shelf of the Yellow and East China Seas. Coccolith abundances ranged from 0 to 2.08×109 coccoliths g-1 sediment. The increasing abundance from the coastal inner shelf to the seaward middle shelf generally reflects the ecological fact that living coccolithophores are more abundant in the mesotrophic shelf waters than in the eutrophic coastal waters, although their deposits are still controlled by taphonomical effects, such as bottom (tidal) currents and calcite preservation conditions. Most abundant coccoliths are found in the fine-grained sediments of southwestern Cheju Island, where both ecology and taphonomy favor coccolith preservation. Still, large densities of coccoliths (>108 coccoliths g-1 sediment) are also found in coarse-grained relict sediments in the middle shelf. Coccolith assemblages were predominated by Gephyrocapsa oceanica and Emiliania huxleyi. The relative abundance of E. huxleyi, in addition to ecological reasons, may relate to selective post-mortem dissolution, since small E. huxleyi coccoliths are more susceptible to dissolution. Coccolith calcite has minor contributions (<1% to 12%) to total sediment CaCO3, and the main parts are attributed to terrigenous CaCO3 debris and relict shell fragments.

  10. Losses, Expansions, and Novel Subunit Discovery of Adaptor Protein Complexes in Haptophyte Algae.

    Science.gov (United States)

    Lee, Laura J Y; Klute, Mary J; Herman, Emily K; Read, Betsy; Dacks, Joel B

    2015-11-01

    The phylum Haptophyta (Diaphoratickes) contains marine algae that perform biomineralization, extruding large, distinctive calcium carbonate scales (coccoliths) that completely cover the cell. Coccolith production is an important part of global carbon cycling; however, the membrane trafficking pathway by which they are secreted has not yet been elucidated. In most eukaryotes, post-Golgi membrane trafficking involves five heterotetrameric adaptor protein (AP) complexes, which impart cargo selection specificity. To better understand coccolith secretion, we performed comparative genomic, phylogenetic, and transcriptomic analyses of the AP complexes in Emiliania huxleyi strains 92A, Van556, EH2, and CCMP1516, and related haptophytes Gephyrocapsa oceanica and Isochrysis galbana; the latter has lost the ability to biomineralize. We show that haptophytes have a modified membrane trafficking system (MTS), as we found both AP subunit losses and duplications. Additionally, we identified a single conserved subunit of the AP-related TSET complex, whose expression suggests a functional role in membrane trafficking. Finally, we detected novel alpha adaptin ear and gamma adaptin ear proteins, the first of their kind to be described outside of opisthokonts. These novel ear proteins and the sculpting of the MTS may support the capacity for biomineralization in haptophytes, enhancing their ability to perform this highly specialized form of secretion. Copyright © 2015 Elsevier GmbH. All rights reserved.

  11. New technologies for the detection of natural and anthropic features in coastal areas

    International Nuclear Information System (INIS)

    Cappucci, Sergio; Del Monte, Maurizio; Paci, M.; Valentini, Emiliana

    2015-01-01

    Some results of the sub project GE.RI.N (Natural Resources Management) conducted in the Marine Protected Area of Egadi Islands (Western Sicily) are presented. Coastal and sea floor morphology has been investigated integrating different data sources and using remote sensing data acquired by the Ministry of Environment during the MAMPIRA Project. This approach allowed us to recognize the real extent and distribution of several rocky outcrops emerging from the sandy bottom, south of Favignana Island (known as I Pali ) , and the anthropogenic features generated by the effects of traps, trawling and anchor on the 'Posidonia oceanica' meadow that, within the Egadi Archipelago, is the largest in the Mediterranean Sea (www.ampisoleegadi.it). Unpublished and detailed characterization of the seafloor and assessment of human impacts are the main results of the present study, which demonstrate how remote sensing technologies have a great potential and relevant management implication for Marine Protected Areas and the preservation of emerged and submerged environment [it

  12. Spatial distribution modelling of the endangered bivalve Pinna nobilis in a Marine Protected Area

    Directory of Open Access Journals (Sweden)

    M. VÁZQUEZ-LUIS

    2014-09-01

    Full Text Available The spatial distribution of Pinna nobilis densities have been analysed through a geostatistical approach in the MPA of Cabrera National Park, Balearic Islands (Spain, Western Mediterranean Sea. Regression kriging was used to model the effect of environmental variables on the density of living individuals of P. nobilis and generate a predictive map of its distribution within the MPA. The environmental variables considered for the model were: depth; slope; habitat type and heterogeneity; wave exposure; and MPA zoning. A total of 378 transects were randomly distributed with a total of 149,000 m2 surveyed at a depth range from 4.2 to 46 m. The recorded P. nobilis densities are among the highest in the Mediterranean Sea. With respect to the prediction model, results indicate that benthic habitats play a key role in the spatial distribution of P. nobilis, with higher densities in seagrass meadows of Posidonia oceanica. The fan mussel population density peaked at 9 m depth, decreasing with depth. Also, decreasing densities are expected with increasing exposure to waves. The predicted map shows some hotspots of density different in size and distributed along the MPA, and provides valuable information for the spatial conservation management of this species.

  13. Reduced calcification of marine plankton in response to increased atmospheric CO2.

    Science.gov (United States)

    Riebesell, U; Zondervan, I; Rost, B; Tortell, P D; Zeebe, R E; Morel, F M

    2000-09-21

    The formation of calcareous skeletons by marine planktonic organisms and their subsequent sinking to depth generates a continuous rain of calcium carbonate to the deep ocean and underlying sediments. This is important in regulating marine carbon cycling and ocean-atmosphere CO2 exchange. The present rise in atmospheric CO2 levels causes significant changes in surface ocean pH and carbonate chemistry. Such changes have been shown to slow down calcification in corals and coralline macroalgae, but the majority of marine calcification occurs in planktonic organisms. Here we report reduced calcite production at increased CO2 concentrations in monospecific cultures of two dominant marine calcifying phytoplankton species, the coccolithophorids Emiliania huxleyi and Gephyrocapsa oceanica. This was accompanied by an increased proportion of malformed coccoliths and incomplete coccospheres. Diminished calcification led to a reduction in the ratio of calcite precipitation to organic matter production. Similar results were obtained in incubations of natural plankton assemblages from the north Pacific ocean when exposed to experimentally elevated CO2 levels. We suggest that the progressive increase in atmospheric CO2 concentrations may therefore slow down the production of calcium carbonate in the surface ocean. As the process of calcification releases CO2 to the atmosphere, the response observed here could potentially act as a negative feedback on atmospheric CO2 levels.

  14. Recent reticulate evolution in the ecologically dominant lineage of coccolithophores

    Directory of Open Access Journals (Sweden)

    El Mahdi eBendif

    2016-05-01

    Full Text Available The coccolithophore family Noëlaerhabdaceae contains a number of taxa that are very abundant in modern oceans, including the cosmopolitan bloom-forming Emiliania huxleyi. Introgressive hybridization has been suggested to account for incongruences between nuclear, mitochondrial and plastidial phylogenies of morphospecies within this lineage, but the number of species cultured to date remains rather limited. Here, we present the characterization of 5 new Noëlaerhabdaceae culture strains isolated from samples collected in the south-east Pacific Ocean. These were analyzed morphologically using scanning electron microscopy and phylogenetically by sequencing 5 marker genes (nuclear 18S and 28S rDNA, plastidial tufA, and mitochondrial cox1 and cox3 genes. Morphologically, one of these strains corresponded to Gephyrocapsa ericsonii and the four others to Reticulofenestra parvula. Ribosomal gene sequences were near identical between these new strains, but divergent from G. oceanica, G. muellerae and E. huxleyi. In contrast to the clear distinction in ribosomal phylogenies, sequences from other genomic compartments clustered with those of E. huxleyi strains with which they share an ecological range (i.e. warm temperate to tropical waters. These data provide strong support for the hypothesis of past (and potentially ongoing introgressive hybridization within this ecologically important lineage and for the transfer of R. parvula to Gephyrocapsa. These results have important implications for understanding the role of hybridization in speciation in vast ocean meta-populations of phytoplankton.

  15. 226Ra activity in the mullet species Liza aurata and South Adriatic sea marine environment of Montenegro

    International Nuclear Information System (INIS)

    Antovic, N. M.; Antovic, I.; Svrkota, N.

    2010-01-01

    226 Ra activity in the South Adriatic Sea-water, surface sediment, mud with detritus, sea-grass (Posidonia oceanica) samples and the mullet (Mugilidae) species Liza aurata, as well as soil and sand from the Montenegrin Coast-was measured using the six-crystal gamma-coincidence spectrometer PRIPYAT-2M. The results are used for calculation of the absorbed (and annual effective) dose rates in air due to the 226 Ra gamma radiation. The absorbed dose rates ranged from 5.94 to 97.16 nGy h -1 (soil) and from 0.65 to 7.65 nGy h -1 (sand). In seawater 226 Ra activity is found to be from 0.08 to 0.15 Bq l -1 , while in whole L. aurata individuals from 0.58 to 1.97 Bq kg -1 . Annual intake of 226 Ra by human consumers of this fish species has been estimated to provide an effective dose of 0.006 mSv y -1 . (authors)

  16. Protection enhances community and habitat stability: evidence from a mediterranean marine protected area.

    Science.gov (United States)

    Fraschetti, Simonetta; Guarnieri, Giuseppe; Bevilacqua, Stanislao; Terlizzi, Antonio; Boero, Ferdinando

    2013-01-01

    Rare evidences support that Marine Protected Areas (MPAs) enhance the stability of marine habitats and assemblages. Based on nine years of observation (2001-2009) inside and outside a well managed MPA, we assessed the potential of conservation and management actions to modify patterns of spatial and/or temporal variability of Posidonia oceanica meadows, the lower midlittoral and the shallow infralittoral rock assemblages. Significant differences in both temporal variations and spatial patterns were observed between protected and unprotected locations. A lower temporal variability in the protected vs. unprotected assemblages was found in the shallow infralittoral, demonstrating that, at least at local scale, protection can enhance community stability. Macrobenthos with long-lived and relatively slow-growing invertebrates and structurally complex algal forms were homogeneously distributed in space and went through little fluctuations in time. In contrast, a mosaic of disturbed patches featured unprotected locations, with small-scale shifts from macroalgal stands to barrens, and harsh temporal variations between the two states. Opposite patterns of spatial and temporal variability were found for the midlittoral assemblages. Despite an overall clear pattern of seagrass regression through time, protected meadows showed a significantly higher shoot density than unprotected ones, suggesting a higher resistance to local human activities. Our results support the assumption that the exclusion/management of human activities within MPAs enhance the stability of the structural components of protected marine systems, reverting or arresting threat-induced trajectories of change.

  17. Genetic and nutritional characterization of some macrophytes, inhabiting the Bardawil Lagoon, Sinai, Egypt

    Directory of Open Access Journals (Sweden)

    Hosam E. Elsaied

    2015-12-01

    Full Text Available The ecological and economical significances of macrophytes, inhabiting the Mediterranean Lagoon, Bardawil, northern Sinai, Egypt, are still ambiguous, due to lack of knowledge. This study focused on genetic and nutritional characterization of three dominant macrophyte species at Bardawil Lagoon. Genetic identifications were done through genomic DNA extraction, followed by PCR amplifications and sequencing of 18S rRNA genes of the studied species. Phylogenetic analyses indicated that two of the recorded species showed homologies with the seagrass species, Posidonia oceanica and Halophila ovalis, with nucleotide identities 94.5% and 96.8%, respectively. The third species showed a unique phylogenetic lineage, representing nucleotide identity average, 86.5%, among the brown seaweeds, Heterokontophyta. Nutritional analyses indicated that the recorded seaweed-like macrophyte had the highest recommended nutritional contents, crude protein, 24.67%, with a total amino acid composition of 6.64 g/100 g protein, and carbohydrate, 38.16%, besides a calorific value of 3.063 K cal/g, among the studied macrophytes. To the best of our knowledge, this is the first attempt to characterize macrophyte community in Bardawil Lagoon, using both genetic and biochemical approaches.

  18. A numerical investigation of the atmosphere-ocean thermal contrast over the coastal upwelling region of Cabo Frio, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dourado, M. [Departamento de Meteorologia, Universidade Federal de Pelotas, Pelotas RS (Brazil)]. E-mail: marcelo_dourado@ufpel.edu.br; Pereira de Oliveira, A. [Departamento de Ciencias Atmosfericas, Instituto de Astronomia, Geofisica e Ciencias Atmosfericas, Universidade de Sao Paulo, (Brazil)

    2008-01-15

    in Cabo Frio. [Spanish] En este trabajo se utiliza un modelo atmosferico unidimensional con una cerradura de segundo orden, conectado a un modelo de capa de mezcla oceanica, para investigar las variaciones temporales de intervalo corto de tiempo de las capas limite atmosferica y oceanica en la region de surgencia costera de Cabo Frio, Brasil (23 grados Celsius S, 42 grados Celsius 08' W). Se realizaron simulaciones numericas para evaluar el impacto de los contrastes termicos entre la atmosfera y el oceano sobre la extension vertical y otras propiedades de estas capas limite. Las simulaciones fueron disenadas tomando en consideracion las observaciones hechas durante la incursion de un frente frio que interrumpio el regimen de surgencia en Cabo Frio en julio de 1992. Las simulaciones han demostrado que, transcurridas 10 horas de mezcla mecanica, debido a una corriente atmosferica constante de 10 m s-1, aumento la altura de la capa limite atmosferica en 214 m cuando el contraste termico inicial es positivo e igual a 2 K (la atmosfera es mas caliente que el oceano durante la surgencia). Para un contraste termico inicial negativo de -2 K (la atmosfera es mas fria que el oceano cuando el regimen de surgencia esta alterado), la incipiente conveccion termica incrementa la mezcla mecanica incrementando la capa limite atmosferica en 360 m. La evolucion vertical de la capa limite atmosferica simulada es consistente con las observaciones en Cabo Frio en regimen de surgencia. Cuando la surgencia no esta presente, la altura de la capa limite atmosferica simulada es cerca de la mitad que la observada en Cabo Frio en julio de 1992. Durante el periodo de 10 horas analizando la capa de mezcla oceanica se incrementa en 2 y 5.4 m, respectivamente, para los contrastes termicos iniciales positivo y negativo de 2 K y -2 K. La extension vertical de la capa de mezcla oceanica es controlada por la presencia de la conveccion termica en la capa limite atmosferica asociada a la ausencia de

  19. Towards a framework for assessment and management of cumulative human impacts on marine food webs.

    Science.gov (United States)

    Giakoumi, Sylvaine; Halpern, Benjamin S; Michel, Loïc N; Gobert, Sylvie; Sini, Maria; Boudouresque, Charles-François; Gambi, Maria-Cristina; Katsanevakis, Stelios; Lejeune, Pierre; Montefalcone, Monica; Pergent, Gerard; Pergent-Martini, Christine; Sanchez-Jerez, Pablo; Velimirov, Branko; Vizzini, Salvatrice; Abadie, Arnaud; Coll, Marta; Guidetti, Paolo; Micheli, Fiorenza; Possingham, Hugh P

    2015-08-01

    Effective ecosystem-based management requires understanding ecosystem responses to multiple human threats, rather than focusing on single threats. To understand ecosystem responses to anthropogenic threats holistically, it is necessary to know how threats affect different components within ecosystems and ultimately alter ecosystem functioning. We used a case study of a Mediterranean seagrass (Posidonia oceanica) food web and expert knowledge elicitation in an application of the initial steps of a framework for assessment of cumulative human impacts on food webs. We produced a conceptual seagrass food web model, determined the main trophic relationships, identified the main threats to the food web components, and assessed the components' vulnerability to those threats. Some threats had high (e.g., coastal infrastructure) or low impacts (e.g., agricultural runoff) on all food web components, whereas others (e.g., introduced carnivores) had very different impacts on each component. Partitioning the ecosystem into its components enabled us to identify threats previously overlooked and to reevaluate the importance of threats commonly perceived as major. By incorporating this understanding of system vulnerability with data on changes in the state of each threat (e.g., decreasing domestic pollution and increasing fishing) into a food web model, managers may be better able to estimate and predict cumulative human impacts on ecosystems and to prioritize conservation actions. © 2015 Society for Conservation Biology.

  20. A review on phytochemical, ethnomedical and pharmacological studies on genus Sophora, Fabaceae

    Directory of Open Access Journals (Sweden)

    Panthati Murali Krishna

    2012-04-01

    Full Text Available Sophora is a genus of the Fabaceae family, contains about 52 species, nineteen varieties, and seven forms that are widely distributed in Asia, Oceanica, and the Pacific islands, in the family Fabaceae of herbaceous (Sophora flavescens Aiton to trees (Sophora japonica L.. More than fifteen species in this genus have a long history of use in traditional Chinese medicines. In the last decades the use of this genus in traditional Chinese drugs has led to rapid increase in the information available on active components and reported to posses various pharmacological/therapeutic properties. The paper reviews the ethnopharmacology, the biological activities and the correlated chemical compounds of genus Sophora, Fabaceae. More than 300 compounds has been isolated, among them major are quinolizidine alkaloids particularly matrine and oxymatrine and flavonoids particularly prenylated and isoprenylated flavonoids. Modern pharmacological studies and clinical studies demonstrated that these chemical constituens possess wide reaching pharmacological actions like anti oxidant, anticancer, anti-asthamatic, anti-neoplastic, antimicrobial, antiviral, antidote, anti pyretic, cardiotonic, antinflammatory, diuretic and in the treatment of skin diseases like eczema, colitis and psoriasis.

  1. Laboratory investigation of the acoustic response of seagrass tissue in the frequency band 0.5-2.5 kHz.

    Science.gov (United States)

    Wilson, Preston S; Dunton, Kenneth H

    2009-04-01

    Previous in situ investigations of seagrass have revealed acoustic phenomena that depend on plant density, tissue gas content, and free bubbles produced by photosynthetic activity, but corresponding predictive models that could be used to optimize acoustic remote sensing, shallow water sonar, and mine hunting applications have not appeared. To begin to address this deficiency, low frequency (0.5-2.5 kHz) acoustic laboratory experiments were conducted on three freshly collected Texas Gulf Coast seagrass species. A one-dimensional acoustic resonator technique was used to assess the biomass and effective acoustic properties of the leaves and rhizomes of Thalassia testudinum (turtle grass), Syringodium filiforme (manatee grass), and Halodule wrightii (shoal grass). Independent biomass and gas content estimates were obtained via microscopic cross-section imagery. The acoustic results were compared to model predictions based on Wood's equation for a two-phase medium. The effective sound speed in the plant-filled resonator was strongly dependent on plant biomass, but the Wood's equation model (based on tissue gas content alone) could not predict the effective sound speed for the low irradiance conditions of the experiment, in which no free bubbles were generated by photosynthesis. The results corroborate previously published results obtained in situ for another seagrass species, Posidonia oceanica.

  2. Effects of habitat and substrate complexity on shallow sublittoral fish assemblages in the Cyclades Archipelago, North-eastern Mediterranean Sea

    Directory of Open Access Journals (Sweden)

    S. GIAKOUMI

    2013-02-01

    Full Text Available This is the first study to explore fish community structure and its relations to habitat and topographic complexity in the shallow coastal waters of the Cyclades Archipelago, North-eastern Mediterranean Sea. In situ visual surveys were carried out at 233 sampling sites in 26 islands of the Cyclades Archipelago. Fish community parameters and biomass were estimated across seven substrate types: sand, seagrass, vertical walls, boulders, horizontal/subhorizontal continuous rock, rocky substrate with patches of sand, and rocky substrate with patches of sand and Posidonia oceanica. Topographic complexity and percentage of algal cover were estimated on hard substrate. Substrate type was found to be a determining factor affecting the structure and composition of fish assemblages. Species number, abundance and biomass were significantly lower in sandy areas and always higher on hard substrates, with seagrass habitats presenting intermediate values. Topographic complexity in rocky bottoms did not seem to affect species richness, density or biomass. This study provides a baseline for future evaluation of changes produced by potential management actions such as the creation of marine protected areas in the study region.

  3. Editorial das organizadoras do VI ENANCIB

    Directory of Open Access Journals (Sweden)

    Ligia Maria Arruda Café

    2006-07-01

    , realizado em Florianópolis de 28 a 30 de novembro de 2005, selecionados em cada Grupo de Trabalho como os mais significativos de sua área. Destacamos do conjunto dos artigos apresentados aspectos relacionados às novas abordagens e métodos de trabalho, ao deslocamento do enfoque dos espaços tradicionais para novos ambientes, ao uso intensivo das tecnologias e sua relação com o ambiente em que estão inseridas, às aplicações de pesquisa em contextos específicos como, por exemplo, as agências de fomento, as bibliotecas digitais, o meio empresarial e as redes sociais, entre outros. Florianópolis, fevereiro de 2006. Ligia Café Miriam Vieira da Cunha Presidente da Comissão Científica Presidente do VI ENANCIB

  4. Extension of the Kohn-Sham formulation of density functional theory to finite temperature

    Science.gov (United States)

    Gonis, A.; Däne, M.

    2018-05-01

    Based on Mermin's extension of the Hohenberg and Kohn theorems to non-zero temperature, the Kohn-Sham formulation of density functional theory (KS-DFT) is generalized to finite temperature. We show that present formulations are inconsistent with Mermin's functional containing expressions, in particular describing the Coulomb energy, that defy derivation and are even in violation of rules of logical inference. More; current methodology is in violation of fundamental laws of both quantum and classical mechanics. Based on this feature, we demonstrate the impossibility of extending the KS formalism to finite temperature through the self-consistent solutions of the single-particle Schrödinger equation of T > 0. Guided by the form of Mermin's functional that depends on the eigenstates of a Hamiltonian, determined at T = 0, we base our extension of KS-DFT on the determination of the excited states of a non-interacting system at the zero of temperature. The resulting formulation is consistent with that of Mermin constructing the free energy at T > 0 in terms of the excited states of a non-interacting Hamiltonian (system) that, within the KS formalism, are described by Slater determinants. To determine the excited states at T = 0 use is made of the extension of the Hohenberg and Kohn theorems to excited states presented in previous work applied here to a non-interacting collection of replicas of a non-interacting N-particle system, whose ground state density is taken to match that of K non-interacting replicas of an interacting N-particle system at T = 0 . The formalism allows for an ever denser population of the excitation spectrum of a Hamiltonian, within the KS approximation. The form of the auxiliary potential, (Kohn-Sham potential), is formally identical to that in the ground state formalism with the contribution of the Coulomb energy provided by the derivative of the Coulomb energy in all excited states taken into account. Once the excited states are determined, the

  5. Abstracts from Dietetic Research Event: June 09-11, 2016.

    Science.gov (United States)

    2016-09-01

    Winnipeg, Manitoba was the host city of the 2016 Dietitians of Canada Annual Conference. Through the support of Dietitians of Canada and CFDR, the 2016 event was both an exciting and informative exchange of research and experience-sharing efforts that inspired attendees. The submissions for this year's Canadian Foundation for Dietetic Research (CFDR) event represented the diversity of dietetic research conducted within Canada. The topics highlighted from this year's abstracts include Community Based Nutritional Care, Wellness & Public Health, Determinants of Food Choice, Dietary Intake, Nutrition Health & Education, Dietetic Practice & Education, Clinical Research & Patient Service, and Nutrition Social Media & the Web. Each presenter provided an 11-minute oral presentation (8 minutes for presenting and 3 minutes for questions). This allowed for meaningful interaction between the presenters and those attending the sessions. This year there were professional and student oral research presentations on each day of the conference. These presentations offered the newest insights into important research findings that apply to dietetic practice. This research event would not be possible without the commitment and dedication of many people. On behalf of Dietitians of Canada and CFDR, I would like to extend a special thank you to the 2016 Abstract Review Committee who represented research, clinical nutrition, community nutrition, and education: Masha Jessri (Ph.D Candidate, University of Toronto), Joyce Slater (Associate Professor, University of Manitoba) and Miyoung Suh (Associate Professor, University of Manitoba). We would also like to thank all of our moderators who assisted during the conference to keep our research presentation sessions on time: Marcia Cooper, Miyoung Suh, Andrea Buchholz, Dawna Royall, Paul Fieldhouse, Joyce Slater, Isabelle Giroux, and Bethany Hopkins. Finally, a special thank you to Michelle Naraine and Greg Sarney at CFDR for their assistance and

  6. Constraint, Intelligence, and Control Hierarchy in Virtual Environments. Chapter 1

    Science.gov (United States)

    Sheridan, Thomas B.

    2007-01-01

    This paper seeks to deal directly with the question of what makes virtual actors and objects that are experienced in virtual environments seem real. (The term virtual reality, while more common in public usage, is an oxymoron; therefore virtual environment is the preferred term in this paper). Reality is difficult topic, treated for centuries in those sub-fields of philosophy called ontology- "of or relating to being or existence" and epistemology- "the study of the method and grounds of knowledge, especially with reference to its limits and validity" (both from Webster s, 1965). Advances in recent decades in the technologies of computers, sensors and graphics software have permitted human users to feel present or experience immersion in computer-generated virtual environments. This has motivated a keen interest in probing this phenomenon of presence and immersion not only philosophically but also psychologically and physiologically in terms of the parameters of the senses and sensory stimulation that correlate with the experience (Ellis, 1991). The pages of the journal Presence: Teleoperators and Virtual Environments have seen much discussion of what makes virtual environments seem real (see, e.g., Slater, 1999; Slater et al. 1994; Sheridan, 1992, 2000). Stephen Ellis, when organizing the meeting that motivated this paper, suggested to invited authors that "We may adopt as an organizing principle for the meeting that the genesis of apparently intelligent interaction arises from an upwelling of constraints determined by a hierarchy of lower levels of behavioral interaction. "My first reaction was "huh?" and my second was "yeah, that seems to make sense." Accordingly the paper seeks to explain from the author s viewpoint, why Ellis s hypothesis makes sense. What is the connection of "presence" or "immersion" of an observer in a virtual environment, to "constraints" and what types of constraints. What of "intelligent interaction," and is it the intelligence of the

  7. Malaria-specific metabolite hemozoin mediates the release of several potent endogenous pyrogens (TNF, MIP-1 alpha, and MIP-1 beta) in vitro, and altered thermoregulation in vivo.

    Science.gov (United States)

    Sherry, B A; Alava, G; Tracey, K J; Martiney, J; Cerami, A; Slater, A F

    1995-01-01

    A characteristic feature of malaria infection is the occurrence of periodic bouts of fever. Experimental and clinical studies have strongly implicated inflammatory cytokines, like tumour necrosis factor (TNF), in the induction of these intermittent fevers [Clark et al., Infect Immunol 32:1058-1066, 1981; Clark et al., Am J Pathol 129:192-199, 1987; Karunaweera et al., Proc Natl Acad Sci USA 89:3200-3203, 1992], but the malaria-specific metabolite(s) which induce the production of such endogenous pyrogens have not yet been fully characterized. It is well known that during the course of malaria infection, a unique schizont component, alternatively referred to as "malaria pigment" or hemozoin, is released along with merozoites as the host erythrocyte bursts [Urquhart, Clin Infect Dis 19:117-131, 1994]. We have recently determined that the core structure of hemozoin comprises a novel insoluble polymer of heme units linked by iron-carboxylate bonds [Slater et al., Proc Natl Acad Sci USA 88:325-329, 1991; Slater et al., Nature 355:167-169, 1992]. We now report that purified native, as well as chemically synthesized, hemozoin crystals potently induce the release of several pyrogenic cytokines, including TNF, MIP-1 alpha, and MIP-1 beta, from murine macrophages and human peripheral blood monocytes in vitro. Also, intravenous administration of chemically synthesized preparations of hemozoin to anaesthetized rats results in a marked drop in body temperature. A similar drop in body temperature is observed following the intravenous injection of other well-characterized pyrogenic cytokines (e.g., TNF) which are known to induce a fever response in awake animals, and is thought to reflect the inability of rats to appropriately regulate their body temperature while anaesthetized. As a consequence of its ability to induce pyrogenic cytokines in vitro, and thermal dysregulation in vivo, we propose that this unique parasite metabolite is an important pyrogen released by malaria

  8. Evaluation of the energy potential, biogenesis and essential characteristics of the geothermal submarine systems in Mexico; Evaluacion del potencial, biogenesis y caracteristicas esenciales de los sistemas geotermicos submarinos en Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Suarez Arriaga, Mario Cesar [Universidad Michoacana de San Nicolas Hidalgo, Morelia, Michoacan (Mexico)

    2004-12-01

    profundidad, hasta los recursos geotermicos profundos, a mas de 3000 metros de profundidad. Las fuentes geotermicas no tradicionales incluyen las partes profundas y los limites de los reservorios hidrotermales tradicionales, los sistemas en roca seca o humeda caliente, los yacimientos geopresurizados del Golfo de Mexico y los sistemas submarinos hidrotermales observados principalmente en la costa norte mexicana del Oceano Pacifico. La energia geotermica submarina surge por la existencia de rupturas profundas en el fondo marino, a lo largo de los centros de dispersion oceanicos entre las placas tectonicas. Estos sistemas tienen una longitud total aproximada de 65,000 Km. en la corteza oceanica. Hay dos tipos basicos de sistemas marinos existentes en el Golfo de California: los recursos profundos, localizados a lo largo de las cordilleras entre las placas de la corteza oceanica a mas de 2000 m bajo el nivel del mar, y los recursos poco profundos cerca de las plataformas continentales, entre 20 y 50 metros de profundidad. El calor submarino poco profundo tambien se relaciona con fallas y fracturas en el fondo del mar cerca de algunas costas. Este subsistema se encuentra tambien en la costa de Punta Banda en Ensenada, Baja California. El potencial preliminar de la energia contenida en tales reservorios se estima, en promedio, en 1120 MWt por cada km3 de roca submarina. Las caracteristicas quimicas especificas de las aguas hidrotermales encontradas en esos sistemas oceanicos indican que las interacciones agua-roca, ocurren bajo condiciones de presion y temperatura altas. La energia geotermica submarina soporta ricas variedades de comunidades biologicas a profundidades donde las plantas no tienen acceso a la luz solar para realizar la fotosintesis. Hay indicios de que las posibles condiciones para la sintesis de sustancias y elementos quimicos necesaria para el origen de la vida primitiva, pudieron ser los sistemas hidrotermales submarinos.

  9. First record of Caulerpa cylindracea (Caulerpaceae, Chlorophyta in Andalusia (Southern Spain

    Directory of Open Access Journals (Sweden)

    Altamirano, María

    2014-12-01

    Full Text Available Three different species of Caulerpa (Caulerpaceae, Chlorophyta co-occur in the Mediterranean Sea: two of them are found at the central-eastern basin and are typically considered non aggressive components of the Lessepsian flora [(C. chemnitzia(Esper J.V. Lamouroux and C. racemosa var. lamourouxii (Turner Weber-van Bosse f. requienii(Montagne Weber van Bosse]; a third taxon, C. cylindracea Sonder has aggressively expanded its range since its first observation in 1990, and it is nowadays reported from nearly all the Mediterranean countries. We report a population of C. cylindracea from Almería (Andalusia, Southern Iberian Peninsula at −30 m depth as to be the westernmost record of the invasive variety on the Mediterranean European coast. Therefore, we made use of morphological description and molecular phylogenetics to provide a complete identification of this invasive seaweed in Southern Spain. Our findings are discussed in light of the composition of the receptor communities, such as maërl bed, edges of Posidonia oceanica (Linnaeus Delile, and their ecology. Our results confirmed the suggested directionality of the invasive pathway to be westward to the Strait of Gibraltar, mainly supported by sea currents and vectors of anthropogenic origin.En el Mar Mediterráneo se encuentran tres especies diferentes de Caulerpa (Caulerpaceae, Chlorophyta: dos de ellas se localizan en la cuenca centro oriental y se consideran componentes no agresivos de la flora Lessepsiana (C. chemnitzia(Esper J.V. Lamouroux and C. racemosa var. lamourouxii (Turner Weber-van Bosse f. requienii(Montagne Weber van Bosse; un tercer taxon, C. cylindracea Sonder ha expandido de manera agresiva su rango de distribución desde su primera observación en 1990, y actualmente se registra en casi todos los países de la cuenca mediterránea. En este trabajo se informa sobre una población de C. cylindracea en Almería (Andalucía, Sur de España, a −30 m de profundidad, que

  10. Computed oscillator strengths and energy levels for Fe III, Fe IV, Fe V, and Fe VI with calculated wavelengths and wavelengths derived from established data

    International Nuclear Information System (INIS)

    Fawcett, B.C.

    1989-01-01

    Calculated weighted oscillator strengths are tabulated for spectral lines of Fe III, Fe IV, Fe V, and Fe VI. The lines belong to transition arrays 3d 6 -3d 5 4p and 3d 5 4s-3d 5 4p in Fe III, 3d 5 -3d 4 4p and 3d 4 4s-3d 4 4p in Fe IV, 3d 4 -3d 3 4p and 3d 3 4s-3d 3 4p in Fe V, and 3d 3 -3d 2 4p and 3d 2 4s-3d 2 4p in Fe VI. For the calculations, Slater parameters are optimized on the basis of minimizing the discrepancies between observed and computed wavelengths. Configuration interaction was included among the 3d n , 3d n-1 4s, 3d n-2 4s 2 , 3d n-1 4d, and 3d n-1 5s even configurations and among the 3d n-1 4p, 3d n-2 4s4p, and 3d n-1 5p odd configurations, with 3p 5 3d n+1 added for Fe VI. Calculated wavelengths are compared with observational data, and the compositions of energy levels are listed. This completes a series of similar computations for these complex configurations covering Fe I to Fe VI

  11. Extension of the analysis of the 3d4-3d34p transition array in Ni VII

    International Nuclear Information System (INIS)

    Hof, G.J. van het; Raassen, A.J.J.; Uylings, P.H.M.; Podobedova, L.I.; Ryabtsev, A.N.

    1989-01-01

    The spectrum of Ni VII has been photographed in the 190-265 A region using grazing incidence vacuum spectrographs. More than 400 lines have been classified. In the 3d 4 -configuration 32 of the 34 possible levels and in the 3d 3 4p-configuration 93 of the 110 levels are established. The lines and levels which have already been published are confirmed. The configurations are described both with the conventional Slater-Condon parameters and the recently developed orthogonal parameter set. The conventional set yields a standard deviation for the levels in the 3d 4 configuration of 46 cm -1 and of 163 cm -1 for the levels in the 3d 3 4p configuration. With the orthogonal set this decreases to 3.5 cm -1 and 130 cm -1 respectively. As a consequence of the perturbation by the inner shell excited 3p 5 3d 5 configuration the levels of the 3d 3 ( 2 F) 4p 3 F term show an average deviation of approx. -1400 cm -1 from their calculated values. The other levels can be described very well without taking this perturbation into account. (orig.)

  12. Matrix elements and few-body calculations within the unitary correlation operator method

    International Nuclear Information System (INIS)

    Roth, R.; Hergert, H.; Papakonstantinou, P.

    2005-01-01

    We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges. (orig.)

  13. Matrix elements and few-body calculations within the unitary correlation operator method

    International Nuclear Information System (INIS)

    Roth, R.; Hergert, H.; Papakonstantinou, P.; Neff, T.; Feldmeier, H.

    2005-01-01

    We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges

  14. Phase stability, magnetic, electronic, half-metallic and mechanical properties of a new equiatomic quaternary Heusler compound ZrRhTiIn: A first-principles investigation

    Science.gov (United States)

    Wang, Jia-Xing; Chen, Z. B.; Gao, Y. C.

    2018-05-01

    In this manuscript, we have studied the electronic, magnetic, half-metallic and mechanical properties of a new Zr-based equiatomic quaternary Heusler (EQH) compound, ZrRhTiIn using first-principles calculations. The generalized gradient approximation (GGA) calculation results imply that at its equilibrium lattice constant of 6.70 Å, ZrRhTiIn is a half-metallic material (HMM) with a considerable band gap (Ebg) of 0.530 eV and a spin-filter/half-metallic band-gap (EHM) of 0.080 eV in the minority-spin channel. For ZrRhTiIn, the formation energy of -2.738 eV and the cohesive energy of 21.38 eV indicate that it is a thermodynamically stable material according to theory. The minority-spin EHM arises from the hybridization among Zr-4d, Ti-3d and Rh-4d electrons. The calculated total magnetic moment of ZrRhTiIn is 2 μB, meeting the well-known Slater-Pauling rule Mt = Zt -18. Furthermore, uniform strain and tetragonal strain were applied in this work to examine the magneto-electronic and half-metallic behaviors of the ZrRhTiIn system. Finally, we show that ZrRhTiIn is mechanically stable, ductile and anisotropic.

  15. Lattice constant changes leading to significant changes of the spin-gapless features and physical nature in a inverse Heusler compound Zr2MnGa

    Science.gov (United States)

    Wang, Xiaotian; Cheng, Zhenxiang; Khenata, Rabah; Wu, Yang; Wang, Liying; Liu, Guodong

    2017-12-01

    The spin-gapless semiconductors with parabolic energy dispersions [1-3] have been recently proposed as a new class of materials for potential applications in spintronic devices. In this work, according to the Slater-Pauling rule, we report the fully-compensated ferrimagnetic (FCF) behavior and spin-gapless semiconducting (SGS) properties for a new inverse Heusler compound Zr2MnGa by means of the plane-wave pseudo-potential method based on density functional theory. With the help of GGA-PBE, the electronic structures and the magnetism of Zr2MnGa compound at its equilibrium and strained lattice constants are systematically studied. The calculated results show that the Zr2MnGa is a new SGS at its equilibrium lattice constant: there is an energy gap between the conduction and valence bands for both the majority and minority electrons, while there is no gap between the majority electrons in the valence band and the minority electrons in the conduction band. Remarkably, not only a diverse physical nature transition, but also different types of spin-gapless features can be observed with the change of the lattice constants. Our calculated results of Zr2MnGa compound indicate that this material has great application potential in spintronic devices.

  16. Cluster form factor calculation in the ab initio no-core shell model

    International Nuclear Information System (INIS)

    Navratil, Petr

    2004-01-01

    We derive expressions for cluster overlap integrals or channel cluster form factors for ab initio no-core shell model (NCSM) wave functions. These are used to obtain the spectroscopic factors and can serve as a starting point for the description of low-energy nuclear reactions. We consider the composite system and the target nucleus to be described in the Slater determinant (SD) harmonic oscillator (HO) basis while the projectile eigenstate to be expanded in the Jacobi coordinate HO basis. This is the most practical case. The spurious center of mass components present in the SD bases are removed exactly. The calculated cluster overlap integrals are translationally invariant. As an illustration, we present results of cluster form factor calculations for 5 He vertical bar 4 He+n>, 5 He vertical bar 3 H+d>, 6 Li vertical bar 4 He+d>, 6 Be vertical bar 3 He+ 3 He>, 7 Li vertical bar 4 He+ 3 H>, 7 Li vertical bar 6 Li+n>, 8 Be vertical bar 6 Li+d>, 8 Be vertical bar 7 Li+p>, 9 Li vertical bar 8 Li+n>, and 13 C vertical bar 12 C+n>, with all the nuclei described by multi-(ℎ/2π)Ω NCSM wave functions

  17. Electrodynamics of spin currents in superconductors

    International Nuclear Information System (INIS)

    Hirsch, J.E.

    2008-01-01

    In recent work we formulated a new set of electrodynamic equations for superconductors as an alternative to the conventional London equations, compatible with the prediction of the theory of hole superconductivity that superconductors expel negative charge from the interior towards the surface. Charge expulsion results in a macroscopically inhomogeneous charge distribution and an electric field in the interior, and because of this a spin current is expected to exist. Furthermore, we have recently shown that a dynamical explanation of the Meissner effect in superconductors leads to the prediction that a spontaneous spin current exists near the surface of superconductors (spin Meissner effect). In this paper we extend the electrodynamic equations proposed earlier for the charge density and charge current to describe also the space and time dependence of the spin density and spin current. This allows us to determine the magnitude of the expelled negative charge and interior electric field as well as of the spin current in terms of other measurable properties of superconductors. We also provide a 'geometric' interpretation of the difference between type I and type II superconductors, discuss how superconductors manage to conserve angular momentum, discuss the relationship between our model and Slater's seminal work on superconductivity, and discuss the magnitude of the expected novel effects for elemental and other superconductors. (Abstract Copyright [2008], Wiley Periodicals, Inc.)

  18. Quantal density functional theory. 2. ed.

    International Nuclear Information System (INIS)

    Sahni, Viraht

    2016-01-01

    This book is on quantal density functional theory (QDFT) which is a time-dependent local effective potential theory of the electronic structure of matter. The time-independent QDFT constitutes a special case. The 2 nd edition describes the further development of the theory, and extends it to include the presence of an external magnetostatic field. The theory is based on the 'quantal Newtonian' second and first laws for the individual electron. These laws are in terms of 'classical' fields that pervade all space, and their quantal sources. The fields are separately representative of the electron correlations that must be accounted for in local potential theory. Recent developments show that irrespective of the type of external field the electrons are subject to, the only correlations beyond those due to the Pauli exclusion principle and Coulomb repulsion that need be considered are solely of the correlation-kinetic effects. Foundational to QDFT, the book describes Schroedinger theory from the new perspective of the single electron in terms of the 'quantal Newtonian' laws. Hohenberg-Kohn density functional theory (DFT), new understandings of the theory and its extension to the presence of an external uniform magnetostatic field are described. The physical interpretation via QDFT, in terms of electron correlations, of Kohn-Sham DFT, approximations to it and Slater theory are provided.

  19. Application of the resonating Hartree-Fock random phase approximation to the Lipkin model

    International Nuclear Information System (INIS)

    Nishiyama, S.; Ishida, K.; Ido, M.

    1996-01-01

    We have applied the resonating Hartree-Fock (Res-HF) approximation to the exactly solvable Lipkin model by utilizing a newly developed orbital-optimization algorithm. The Res-HF wave function was superposed by two Slater determinants (S-dets) which give two corresponding local energy minima of monopole ''deformations''. The self-consistent Res-HF calculation gives an excellent ground-state correlation energy. There exist excitations due to small vibrational fluctuations of the orbitals and mixing coefficients around their stationary values. They are described by a new approximation called the resonating Hartree-Fock random phase approximation (Res-HF RPA). Matrices of the second-order variation of the Res-HF energy have the same structures as those of the Res-HF RPA's matrices. The quadratic steepest descent of the Res-HF energy in the orbital optimization is considered to include certainly both effects of RPA-type fluctuations up to higher orders and their mode-mode couplings. It is a very important and interesting task to apply the Res-HF RPA to the Lipkin model with the use of the stationary values and to prove the above argument. It turns out that the Res-HF RPA works far better than the usual HF RPA and the renormalized one. We also show some important features of the Res-HF RPA. (orig.)

  20. Investigation of electronic, magnetic and thermoelectric properties of Zr{sub 2}NiZ (Z = Al,Ga) ferromagnets

    Energy Technology Data Exchange (ETDEWEB)

    Yousuf, Saleem, E-mail: nengroosaleem17@gmail.com; Gupta, Dinesh C., E-mail: sosfizix@gmail.com

    2017-05-01

    Systematic investigation of impact of electronic structure and magnetism, on the thermoelectric properties of new Zr{sub 2}NiZ (Z = Al, Ga) Heusler alloys are determined using density functional theory calculations. Half-metallicity with ferromagnetic character is supported by their 100% spin polarizations at the Fermi level. Magnetic moment of ∼3 μ{sub B} is according to the Slater-Puling rule, enables their practical applications. Electron density plots are used to analyse the nature of bonding and chemical composition. Boltzmann's theory is conveniently employed to investigate the thermoelectric properties of these compounds. The analysis of the thermal transport properties specifies the Seebeck coefficient as 25.6 μV/K and 18.6 μV/K at room temperature for Zr{sub 2}NiAl and Zr{sub 2}NiGa, respectively. The half-metallic nature with efficient thermoelectric coefficients suggests the likelihood of these materials to have application in designing spintronic devices and imminent thermoelectric materials. - Highlights: • The compounds are half-metallic ferromagnets. • 100% spin-polarized compounds for spintronics. • Increasing Seebeck coefficient over a wide temperature range. • Zr{sub 2}NiAl is efficient thermoelectric material than Zr{sub 2}NiGa.