WorldWideScience

Sample records for slater determinant

  1. Time-dependent density functional theory beyond Kohn-Sham Slater determinants.

    Science.gov (United States)

    Fuks, Johanna I; Nielsen, Søren E B; Ruggenthaler, Michael; Maitra, Neepa T

    2016-08-03

    When running time-dependent density functional theory (TDDFT) calculations for real-time simulations of non-equilibrium dynamics, the user has a choice of initial Kohn-Sham state, and typically a Slater determinant is used. We explore the impact of this choice on the exchange-correlation potential when the physical system begins in a 50 : 50 superposition of the ground and first-excited state of the system. We investigate the possibility of judiciously choosing a Kohn-Sham initial state that minimizes errors when adiabatic functionals are used. We find that if the Kohn-Sham state is chosen to have a configuration matching the one that dominates the interacting state, this can be achieved for a finite time duration for some but not all such choices. When the Kohn-Sham system does not begin in a Slater determinant, we further argue that the conventional splitting of the exchange-correlation potential into exchange and correlation parts has limited value, and instead propose a decomposition into a "single-particle" contribution that we denote v, and a remainder. The single-particle contribution can be readily computed as an explicit orbital-functional, reduces to exchange in the Slater determinant case, and offers an alternative to the adiabatic approximation as a starting point for TDDFT approximations.

  2. Natural generalization of Slater determinants to more than one dimension

    Science.gov (United States)

    Sunko, Denis

    The calculation of realistic N-body wave functions for identical fermions is still an open problem in physics, chemistry, and materials science, even for N as small as two. Here a fundamental algebraic structure of many-body Hilbert space is described, enabling theoretically well-founded systematic investigation of wave-function space. The structure allows an arbitrary many-fermion wave function to be written in terms of a finite number of antisymmetric functions called shapes, which cannot be constructed by combining one-dimensional wave functions. Shapes naturally generalize the single-Slater-determinant form for the ground state to more than one dimension. Their number is exactly N! d - 1 in d dimensions. A general algorithm is given to list them all in terms of standard Slater determinants. Conversely, excitations which can be induced from the one-dimensional case are bosonised into a system of distinguishable bosons, called Euler bosons, much like the electromagnetic field is quantized in terms of photons distinguishable by their wave numbers. Their wave functions are given explicitly in terms of elementary symmetric functions, reflecting the fact that the fermion sign problem is trivial in one dimension. The shapes are all possible vacua for the Euler bosons.

  3. Exact Slater integrals

    International Nuclear Information System (INIS)

    Golden, L.B.

    1968-01-01

    In atomic structure calculations, one has to evaluate the Slater integrals. In the present program, the authors evaluate exactly the Slater integral when hydrogenic wave functions are used for the bound-state orbitals. When hydrogenic wave functions are used, the Slater integrals involve integrands which can be written in the form of a product of an exponential, exp(ax) and a known analytic polynomial function, f(x). By repeated partial integration such an integral can be expressed in terms of a finite series involving the exponential, the polynomial function and its derivatives. PL/1-FORMAC has a built-in subroutine that will analytically find the derivatives of any multinomial. Thus, the finite series and hence the Slater integral can be evaluated analytically. (Auth.)

  4. Hyperspherical Slater determinant approach to few-body fractional quantum Hall states

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Bin, E-mail: yanbin@purdue.edu; Wooten, Rachel E.; Daily, Kevin M.; Greene, Chris H.

    2017-05-15

    In a recent study (Daily et al., 2015), a hyperspherical approach has been developed to study few-body fractional quantum Hall states. This method has been successfully applied to the exploration of few boson and fermion problems in the quantum Hall region, as well as the study of inter-Landau level collective excitations (Rittenhouse et al., 2016; Wooten et al., 2016). However, the hyperspherical method as it is normally implemented requires a subsidiary (anti-)symmetrization process, which limits its computational effectiveness. The present work overcomes these difficulties and extends the power of this method by implementing a representation of the hyperspherical many-body basis space in terms of Slater determinants of single particle eigenfunctions. A clear connection between the hyperspherical representation and the conventional single particle picture is presented, along with a compact operator representation of the theoretical framework. - Highlights: • A hyperspherical method has been implemented to study the quantum Hall effect. • The hyperspherical many-body basis space is represented with Slater determinants. • Example numerical studies of the 4- and 8-electron systems are presented.

  5. Approximating a wavefunction as an unconstrained sum of Slater determinants

    International Nuclear Information System (INIS)

    Beylkin, Gregory; Perez, Fernando; Mohlenkamp, Martin J.

    2008-01-01

    The wavefunction for the multiparticle Schroedinger equation is a function of many variables and satisfies an antisymmetry condition, so it is natural to approximate it as a sum of Slater determinants. Many current methods do so, but they impose additional structural constraints on the determinants, such as orthogonality between orbitals or an excitation pattern. We present a method without any such constraints, by which we hope to obtain much more efficient expansions and insight into the inherent structure of the wavefunction. We use an integral formulation of the problem, a Green's function iteration, and a fitting procedure based on the computational paradigm of separated representations. The core procedure is the construction and solution of a matrix-integral system derived from antisymmetric inner products involving the potential operators. We show how to construct and solve this system with computational complexity competitive with current methods

  6. Delayed Slater determinant update algorithms for high efficiency quantum Monte Carlo

    Science.gov (United States)

    McDaniel, T.; D'Azevedo, E. F.; Li, Y. W.; Wong, K.; Kent, P. R. C.

    2017-11-01

    Within ab initio Quantum Monte Carlo simulations, the leading numerical cost for large systems is the computation of the values of the Slater determinants in the trial wavefunction. Each Monte Carlo step requires finding the determinant of a dense matrix. This is most commonly iteratively evaluated using a rank-1 Sherman-Morrison updating scheme to avoid repeated explicit calculation of the inverse. The overall computational cost is, therefore, formally cubic in the number of electrons or matrix size. To improve the numerical efficiency of this procedure, we propose a novel multiple rank delayed update scheme. This strategy enables probability evaluation with an application of accepted moves to the matrices delayed until after a predetermined number of moves, K. The accepted events are then applied to the matrices en bloc with enhanced arithmetic intensity and computational efficiency via matrix-matrix operations instead of matrix-vector operations. This procedure does not change the underlying Monte Carlo sampling or its statistical efficiency. For calculations on large systems and algorithms such as diffusion Monte Carlo, where the acceptance ratio is high, order of magnitude improvements in the update time can be obtained on both multi-core central processing units and graphical processing units.

  7. From Slater orbitals to Coulomb Sturmians

    Indian Academy of Sciences (India)

    The simple connection between the Slater orbitals, venerable in quantum chemistry, and ... Thanks to the growth of computing ... of classical mechanics for the motion of planets or pro- ... riments show that a ionized gas of H atom has a con-.

  8. A direct method to transform between expansions in the configuration state function and Slater determinant bases

    International Nuclear Information System (INIS)

    Olsen, Jeppe

    2014-01-01

    A novel algorithm is introduced for the transformation of wave functions between the bases of Slater determinants (SD) and configuration state functions (CSF) in the genealogical coupling scheme. By modifying the expansion coefficients as each electron is spin-coupled, rather than performing a single many-electron transformation, the large transformation matrix that plagues previous approaches is avoided and the required number of operations is drastically reduced. As an example of the efficiency of the algorithm, the transformation for a configuration with 30 unpaired electrons and singlet spin is discussed. For this case, the 10 × 10 6 coefficients in the CSF basis is obtained from the 150 × 10 6 coefficients in the SD basis in 1 min, which should be compared with the seven years that the previously employed method is estimated to require

  9. Relativity and pseudopotentials in the Hartree-Fock-Slater method

    International Nuclear Information System (INIS)

    Snijders, J.G.

    1979-01-01

    The methodological problems involved in electronic structure determinations of compounds containing heavy elements by the Hartree-Fock-Slater scheme are investigated. It is shown that the effect of the inner electrons can be simulated by a so called pseudopotential, so that only the valence electrons have to be treated explicitly which constitutes a considerable reduction of computation time. It is further shown that a pseudopotential calculation is able to achieve an accuracy that is comparable to the results of a calculation including the core. (Auth.)

  10. 76 FR 48179 - Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound...

    Science.gov (United States)

    2011-08-08

    ... Museum of Natural History, University of Puget Sound, Tacoma, WA AGENCY: National Park Service, Interior. ACTION: Notice. SUMMARY: The Slater Museum of Natural History, University of Puget Sound has completed an... contact the Slater Museum of Natural History, University of Puget Sound. Disposition of the human remain...

  11. Molecular integrals for slater type orbitals using coulomb sturmians

    DEFF Research Database (Denmark)

    Avery, James Emil; Avery, John Scales

    2014-01-01

    The use of Slater type orbitals in molecular calculations is hindered by the slowness of integral evaluation. In the present paper, we introduce a method for overcoming this problem by expanding STO's in terms of Coulomb Sturmians, for which the problem of evaluating molecular integrals rapidly has...

  12. Acute kidney injury from Paraquat poisoning: a case report. | Slater ...

    African Journals Online (AJOL)

    Acute kidney injury from Paraquat poisoning: a case report. H. E. Slater, O.C.A. Okoye, O. Okperi, N. Rajora. Abstract. Paraquat is a salt widely used as a herbicide. Although paraquat poisoning is rare in the general population, it may be considered as one of the most toxic poisons frequently used for suicide attempts, and is ...

  13. Integration by cell algorithm for Slater integrals in a spline basis

    International Nuclear Information System (INIS)

    Qiu, Y.; Fischer, C.F.

    1999-01-01

    An algorithm for evaluating Slater integrals in a B-spline basis is introduced. Based on the piecewise property of the B-splines, the algorithm divides the two-dimensional (r 1 , r 2 ) region into a number of rectangular cells according to the chosen grid and implements the two-dimensional integration over each individual cell using Gaussian quadrature. Over the off-diagonal cells, the integrands are separable so that each two-dimensional cell-integral is reduced to a product of two one-dimensional integrals. Furthermore, the scaling invariance of the B-splines in the logarithmic region of the chosen grid is fully exploited such that only some of the cell integrations need to be implemented. The values of given Slater integrals are obtained by assembling the cell integrals. This algorithm significantly improves the efficiency and accuracy of the traditional method that relies on the solution of differential equations and renders the B-spline method more effective when applied to multi-electron atomic systems

  14. Calculation Of Multicenter Electric Field Integrals Over Slater Type Orbitals

    International Nuclear Information System (INIS)

    Zaim, N.

    2010-01-01

    Using the properties of complete orthonormal sets of Ψ α -exponential type orbitals (α1,0,-1,-2, ...) and the relations for overlap integrals, the calculations for the multicenter electric field integrals of Slater type orbitals are performed. The results of computer calculations are presented. The convergence of the series is tested by calculating concrete cases for the arbitrary values of quantum numbers, orbital parameters and internuclear distances.

  15. Method of renormalization potential for one model of Hartree-Fock-Slater type

    CERN Document Server

    Zasorin, Y V

    2002-01-01

    A new method of the potential renormalization for the quasiclassical model of the Hartree-Fock-Slater real potential is proposed. The method makes it possible to easily construct the wave functions and contrary to the majority od similar methods it does not require the knowledge of the real-type potential

  16. A Hartree-Fock-Slater-Boltzmann-Saha method for detailed atomic structure and equation of state of plasmas

    International Nuclear Information System (INIS)

    Jiang Minhao; Meng Xujun

    2005-01-01

    The effect of the free electron background in plasmas is introduced in Hartree-Fock-Slater self-consistent field atomic model to correct the single electron energies for each electron configuration, and to provide accurate atomic data for Boltzmann-Saha equation. In the iteration process chemical potential is adjusted to change the free electron background to satisfy simultaneously the conservation of the free electrons in Saha equation as well as in Hartree-Fock-Slater self-consistent field atomic model. As examples the equations of state of the carbon and aluminum plasmas are calculated to show the applicability of this method. (authors)

  17. Extremely compact formulas for the Fourier transform of a product of two-centre Slater-type orbitals

    International Nuclear Information System (INIS)

    Vukovic, T; Dmitrovic, S

    2010-01-01

    A compact formula for the Fourier transform of a product of Slater-type orbitals on different centres is derived. The integral is reduced to a finite one-dimensional integration over non-oscillatory hypergeometric functions of type 1 F 2 (x;y;z). The formula is valid for all quantum numbers and does not involve the reduced Bessel functions that are usually used to evaluate these integrals. Reduced formulas are calculated for some special directions in the reciprocal space. Also, some useful identities for the Fourier transforms of a product of Slater-type orbitals with correlated sets of parameters are obtained. In order to illustrate simple and efficient use of the presented results, we have applied them to graphene.

  18. Measuring market orientation: further evidence on Narver and Slater's three-component scale.

    Science.gov (United States)

    Chakrabarty, Subhra; Rogé, Joseph N

    2003-12-01

    A mail survey of a national random sample of 2,000 marketing managers was conducted. The data provided by 222 respondents were analyzed to assess the dimensionality of Narver and Slater's 15-item measure of market orientation. A confirmatory factor analysis, using LISREL 8.53, provided support for each of the separate dimensions of customer orientation, competitor orientation, and interfunctional coordination. However, a combined 3-factor model of market orientation was not supported. Directions for research are suggested.

  19. A method for the calculation of collision strengths for complex atomic structures based on Slater parameter optimisation

    International Nuclear Information System (INIS)

    Fawcett, B.C.; Mason, H.E.

    1989-02-01

    This report presents details of a new method to enable the computation of collision strengths for complex ions which is adapted from long established optimisation techniques previously applied to the calculation of atomic structures and oscillator strengths. The procedure involves the adjustment of Slater parameters so that they determine improved energy levels and eigenvectors. They provide a basis for collision strength calculations in ions where ab initio computations break down or result in reducible errors. This application is demonstrated through modifications of the DISTORTED WAVE collision code and SUPERSTRUCTURE atomic-structure code which interface via a transformation code JAJOM which processes their output. (author)

  20. Energy band structure of Cr by the Slater-Koster interpolation scheme

    International Nuclear Information System (INIS)

    Seifu, D.; Mikusik, P.

    1986-04-01

    The matrix elements of the Hamiltonian between nine localized wave-functions in tight-binding formalism are derived. The symmetry adapted wave-functions and the secular equations are formed by the group theory method for high symmetry points in the Brillouin zone. A set of interaction integrals is chosen on physical ground and fitted via the Slater-Koster interpolation scheme to the abinito band structure of chromium calculated by the Green function method. Then the energy band structure of chromium is interpolated and extrapolated in the Brillouin zone. (author)

  1. 78 FR 19299 - Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound...

    Science.gov (United States)

    2013-03-29

    ... DEPARTMENT OF THE INTERIOR National Park Service [NPS-WASO-NAGPRA-12395; PPWOCRADN0-PCU00RP14.R50000] Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound... History, University of Puget Sound, has completed an inventory of human remains in consultation with the...

  2. Marketing Ignorance and the Validity of Narver and Slater's MKTOR Scale in High-Tech Russian Firms

    NARCIS (Netherlands)

    Roersen, Mariska J.; Kraaijenbrink, Jeroen; Groen, Aard J.

    A firm's market orientation is an important factor influencing its ability to successfully develop and introduce new products. To measure market orientation, Narver and Slater's MKTOR scale has been accepted in the literature as a valid and reliable scale. In fact, it can be considered state of the

  3. Marketing ignorance and the validity of Narver and Slater's MKTOR scale in high-tech Russian firms

    NARCIS (Netherlands)

    Roersen, Mariska; Kraaijenbrink, Jeroen; Groen, Arend J.

    2013-01-01

    A firm's market orientation is an important factor influencing its ability to successfully develop and introduce new products. To measure market orientation, Narver and Slater's MKTOR scale has been accepted in the literature as a valid and reliable scale. In fact, it can be considered state of the

  4. Numerical evaluation of two-center integrals over Slater type orbitals

    Energy Technology Data Exchange (ETDEWEB)

    Kurt, S. A., E-mail: slaykurt@gmail.com [Department of Physics, Natural Sciences Institute, Ondokuz Mayıs University, 55139, Samsun (Turkey); Yükçü, N., E-mail: nyukcu@gmail.com [Department of Energy Systems Engineering, Faculty of Technology, Adıyaman University, 02040, Adıyaman (Turkey)

    2016-03-25

    Slater Type Orbitals (STOs) which one of the types of exponential type orbitals (ETOs) are used usually as basis functions in the multicenter molecular integrals to better understand physical and chemical properties of matter. In this work, we develop algorithms for two-center overlap and two-center two-electron hybrid and Coulomb integrals which are calculated with help of translation method for STOs and some auxiliary functions by V. Magnasco’s group. We use Mathematica programming language to produce algorithms for these calculations. Numerical results for some quantum numbers are presented in the tables. Consequently, we compare our obtained numerical results with the other known literature results and other details of evaluation method are discussed.

  5. Numerical evaluation of two-center integrals over Slater type orbitals

    International Nuclear Information System (INIS)

    Kurt, S. A.; Yükçü, N.

    2016-01-01

    Slater Type Orbitals (STOs) which one of the types of exponential type orbitals (ETOs) are used usually as basis functions in the multicenter molecular integrals to better understand physical and chemical properties of matter. In this work, we develop algorithms for two-center overlap and two-center two-electron hybrid and Coulomb integrals which are calculated with help of translation method for STOs and some auxiliary functions by V. Magnasco’s group. We use Mathematica programming language to produce algorithms for these calculations. Numerical results for some quantum numbers are presented in the tables. Consequently, we compare our obtained numerical results with the other known literature results and other details of evaluation method are discussed.

  6. Modular relations for the Rogers-Ramanujan-Slater type functions of order fifteen and its applications to partitions

    Directory of Open Access Journals (Sweden)

    Chandrashekar Adiga

    2013-10-01

    Full Text Available In a manuscript of Ramanujan, published with his Lost Notebook [20] there are forty identities involving the Rogers-Ramanujan functions. In this paper, we establish several modular relations involving the Rogers-Ramanujan functions and the Rogers-Ramanujan-Slater type functions of order fifteen which are analogues to Ramanujan’s well known forty identities. Furthermore, we give partition theoretic interpretations of two modular relations.

  7. Efficient evaluation of the Fourier transform over products of Slater-type orbitals on different centers

    International Nuclear Information System (INIS)

    Niehaus, T A; Lopez, R; Rico, J F

    2008-01-01

    Using the shift-operator technique, a compact formula for the Fourier transform of a product of two Slater-type orbitals located on different atomic centers is derived. The result is valid for arbitrary quantum numbers and was found to be numerically stable for a wide range of geometrical parameters and momenta. Details of the implementation are presented together with benchmark data for representative integrals. We also discuss the assets and drawbacks of alternative algorithms available and analyze the numerical efficiency of the new scheme

  8. Investigation of the structure change of atomic shells due to uranium ionization by the Dirac-Fock-Slater method

    International Nuclear Information System (INIS)

    Shchornak, G.

    1979-01-01

    The influence of outer vacancies in the atomic shells of uranium on the atomic shell structure is claculated by the Dirac-Fock-Slater method. It is found out that the energy of the X-ray transitions increases due to the detachment of the electrons with the lowest binding energies. The electron detachment from the subshells of the 4f level gives rise to negative energy shifts of the X-ray transitions.(author)

  9. On the Least-Squares Fitting of Slater-Type Orbitals with Gaussians: Reproduction of the STO-NG Fits Using Microsoft Excel and Maple

    Science.gov (United States)

    Pye, Cory C.; Mercer, Colin J.

    2012-01-01

    The symbolic algebra program Maple and the spreadsheet Microsoft Excel were used in an attempt to reproduce the Gaussian fits to a Slater-type orbital, required to construct the popular STO-NG basis sets. The successes and pitfalls encountered in such an approach are chronicled. (Contains 1 table and 3 figures.)

  10. Dirac-Fock-Slater calculations on the geometric and electronic structure of neutral and multiply charged C60 fullerenes

    International Nuclear Information System (INIS)

    Bastug, T.; Kuerpick, P.; Meyer, J.; Sepp, W.; Fricke, B.; Rosen, A.

    1997-01-01

    Using a self-consistent relativistic molecular Dirac-Fock-Slater method we have determined the geometric structures and ionization energies of C 60 x t (x=0 endash 7). The lengths of the bonds for the pentagonal edge (single bonds) and the bonds shared by hexagonal rings (double bonds) are found to increase as a function of charge state with an expansion of the cage. The binding energy per atom of C 60 x t (x=0 endash 7) shows a quadratic dependence on the charge state of the C 60 cluster and an extrapolation to higher charge states reveals that C 60 x t should still be bound up to x=13. Charging of the clusters are analyzed using a classical capacitance model and compared with results from other calculations. Calculated ionization potentials are found to increase linearly with the charge while the available experimental data with comparatively big uncertainties indicate a small quadratic dependence. copyright 1997 The American Physical Society

  11. Unified analytical treatment of multicentre electron attraction, electric field and electric field gradient integrals over Slater orbitals

    International Nuclear Information System (INIS)

    Guseinov, I I

    2004-01-01

    The new central and noncentral potential functions (CPFs and NCPFs) of a molecule depending on the coordinates of the nuclei are introduced. Using complete orthonormal sets of Ψ α -exponential-type orbitals (Ψ α -ETOs) introduced by the author, the series expansion formulae for the multicentre electronic attraction (EA), electric field (EF) and electric field gradient (EFG) integrals over Slater-type orbitals (STOs) in terms of CPFs and NCPFs are derived. The relationships obtained are valid for the arbitrary location, quantum numbers and screening constants of STOs

  12. On the Evaluation Overlap Integrals with the Same and Different Screening Parameters Over Slater Type Orbitals via the Fourier-Transform Method

    International Nuclear Information System (INIS)

    Yavuz, M.; Yuekcue, N.; Oeztekin, E.; Yilmaz, H.; Doenduer, S.

    2005-01-01

    In this paper, derivation of analytical expressions for overlap integrals with the same and different screening parameters of Slater type orbitals (STOs) via the Fourier-transform method is presented. Consequently, it is relatively easy to express the Fourier integral representations of the overlap integrals with same and different screening parameters mentioned as finite sums of Gegenbauer, Gaunt, binomial coefficients, and STOs.

  13. The Analytical Evaluation Of Three-Center Magnetic Multipole Moment Integrals By Using Slater Type Orbitals

    International Nuclear Information System (INIS)

    Oztekin, E.

    2010-01-01

    In this study, magnetic multipole moment integrals are calculated by using Slater type orbitals (STOs), Fourier transform and translation formulas. Firstly, multipole moment operators which appear in the three-center magnetic multipole moment integrals are translated to b-center from 0-center. So, three-center magnetic multipole moment integrals have been reduced to the two-center. Then, the obtained analytical expressions have been written in terms of overlap integrals. When the magnetic multipole moment integrals calculated, matrix representations for x-, y- and z-components of multipole moments was composed and every component was separately calculated to analytically. Consequently, magnetic multipole moment integrals are also given in terms of the same and different screening parameters.

  14. Performance assessment of density functional methods with Gaussian and Slater basis sets using 7σ orbital momentum distributions of N2O

    Science.gov (United States)

    Wang, Feng; Pang, Wenning; Duffy, Patrick

    2012-12-01

    Performance of a number of commonly used density functional methods in chemistry (B3LYP, Bhandh, BP86, PW91, VWN, LB94, PBe0, SAOP and X3LYP and the Hartree-Fock (HF) method) has been assessed using orbital momentum distributions of the 7σ orbital of nitrous oxide (NNO), which models electron behaviour in a chemically significant region. The density functional methods are combined with a number of Gaussian basis sets (Pople's 6-31G*, 6-311G**, DGauss TZVP and Dunning's aug-cc-pVTZ as well as even-tempered Slater basis sets, namely, et-DZPp, et-QZ3P, et-QZ+5P and et-pVQZ). Orbital momentum distributions of the 7σ orbital in the ground electronic state of NNO, which are obtained from a Fourier transform into momentum space from single point electronic calculations employing the above models, are compared with experimental measurement of the same orbital from electron momentum spectroscopy (EMS). The present study reveals information on performance of (a) the density functional methods, (b) Gaussian and Slater basis sets, (c) combinations of the density functional methods and basis sets, that is, the models, (d) orbital momentum distributions, rather than a group of specific molecular properties and (e) the entire region of chemical significance of the orbital. It is found that discrepancies of this orbital between the measured and the calculated occur in the small momentum region (i.e. large r region). In general, Slater basis sets achieve better overall performance than the Gaussian basis sets. Performance of the Gaussian basis sets varies noticeably when combining with different Vxc functionals, but Dunning's augcc-pVTZ basis set achieves the best performance for the momentum distributions of this orbital. The overall performance of the B3LYP and BP86 models is similar to newer models such as X3LYP and SAOP. The present study also demonstrates that the combinations of the density functional methods and the basis sets indeed make a difference in the quality of the

  15. Unified treatment of complete orthonormal sets for wave functions, and Slater orbitals of particles with arbitrary spin in coordinate, momentum and four-dimensional spaces

    International Nuclear Information System (INIS)

    Guseinov, I.I.

    2007-01-01

    The new analytical relations of complete orthonormal sets for the tensor wave functions and the tensor Slater orbitals of particles with arbitrary spin in coordinate, momentum and four-dimensional spaces are derived using the properties of tensor spherical harmonics and complete orthonormal scalar basis sets of ψ α -exponential type orbitals, φ α -momentum space orbitals and z α -hyperspherical harmonics introduced by the author for particles with spin s=0, where the α=1,0,-1,-2,.... All of the tensor wave functions obtained are complete without the inclusion of the continuum and, therefore, their group of transformations is the four-dimensional rotation group O(4). The analytical formulas in coordinate space are also derived for the overlap integrals over tensor Slater orbitals with the same screening constant. We notice that the new idea presented in this work is the combination of tensor spherical harmonics of rank s with complete orthonormal scalar sets for radial parts of ψ α -, φ α - and z α -orbitals, where s=1/2,1,3/2,2,...

  16. Hartree--Slater calculation of the cross section for L-shell ionization of argon by simple heavy charged particles

    International Nuclear Information System (INIS)

    Choi, B.

    1975-01-01

    The cross sections for L-shell and subshell ionization by direct Coulomb excitation of argon by incident heavy charged particles are evaluated. Incident particles are described in the plane-wave Born approximation, and nonrelativistic Hartree-Slater (HS) wave functions are used for the atomic electrons. Form factors, energy distributions, and ionization cross sections are compared with those obtained from screened hydrogenic wave functions. At most incident energies, the HS results for the total ionization cross section are only slightly smaller than those obtained with screened hydrogenic wave functions, but considerable discrepancies are found for form factors and energy distributions near the ionization threshold

  17. Oscillator strength of partially ionized high-Z atom on Hartree-Fock Slater model

    International Nuclear Information System (INIS)

    Nakamura, S.; Nishikawa, T.; Takabe, H.; Mima, K.

    1991-01-01

    The Hartree-Fock Slater (HFS) model has been solved for the partially ionized gold ions generated when an intense laser light is irradiated on a gold foil target. The resultant energy levels are compared with those obtained by a simple screened hydrogenic model with l-splitting effect (SHML). It is shown that the energy levels are poorly model by SHML as the ionization level becomes higher. The resultant wave functions are used to evaluate oscillator strength of important line radiations and compared with those obtained by a simple model using hydrogenic wave functions. Its demonstrated that oscillator strength of the 4p-4d and 4d-4f lines are well modeled by the simple method, while the 4-5 transitions such as 4f-5g, 4d-5f, 4p-5d, and 4f-5p forming the so-called N-band emission are poorly modeled and HFS results less strong line emissions. (author)

  18. Simple formalism for efficient derivatives and multi-determinant expansions in quantum Monte Carlo

    NARCIS (Netherlands)

    Filippi, Claudia; Assaraf, R.; Moroni, S.

    2016-01-01

    We present a simple and general formalism to compute efficiently the derivatives of a multi-determinant Jastrow-Slater wave function, the local energy, the interatomic forces, and similar quantities needed in quantum Monte Carlo. Through a straightforward manipulation of matrices evaluated on the

  19. Determination of calibration constants for perturbing objects of cavity resonators

    International Nuclear Information System (INIS)

    Franco, M.A.R.; Serrao, V.A.; Fuhrmann, C.

    1989-05-01

    Using the Slater theorem, the calibrating constants for objects utilized in the tecnique of perturbing measurements of cavities electric and magnetic fields have been determined. Such perturbing objects are utilized in the measurements of the shunt impedance and electric field relative intensity ocurring in linac accelerating structures. To determine the calibrating constants of the perturbing objects, a cylindrical cavity of well know field pattern has been utilized. The cavity was excited in two differente modes of oscillation and the experimental results are in good aggrement with the theoretical values. (author) [pt

  20. Generator coordinate representation of the time independent mean field theory of collisions

    International Nuclear Information System (INIS)

    Giraud, B.G.; Lemm, J.; Weiguny, A.; Wierling, A.

    1991-01-01

    We show how matrix elements of the T-matrix can be easily estimated on a basis of Slater determinants, with a mean field approximation. Linear superpositions of these Slater determinants then generate plane waves, or distorted (Coulomb) waves. This provides physical matrix elements of T

  1. Slater-Koster Tight-Binding parametrization of single and few-layer Black-Phosphorus from first-principles calculations

    Science.gov (United States)

    Menezes, Marcos; Capaz, Rodrigo

    Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.

  2. A Slater parameter optimisation interface for the CIV3 atomic structure code and its possible use with the R-matrix close coupling collision code

    International Nuclear Information System (INIS)

    Fawcett, B.C.; Hibbert, A.

    1989-11-01

    Details are here provided of amendments to the atomic structure code CIV3 which allow the optional adjustment of Slater parameters and average energies of configurations so that they result in improved energy levels and eigenvectors. It is also indicated how, in principle, the resultant improved eigenvectors can be utilised by the R-matrix collision code, thus providing an optimised target for close coupling collision strength calculations. An analogous computational method was recently reported for distorted wave collision strength calculations and applied to Fe XIII. The general method is suitable for the computation of collision strengths for complex ions and in some cases can then provide a basis for collision strength calculations in ions where ab initio computations break down or result in unnecessarily large errors. (author)

  3. Basis set construction for molecular electronic structure theory: natural orbital and Gauss-Slater basis for smooth pseudopotentials.

    Science.gov (United States)

    Petruzielo, F R; Toulouse, Julien; Umrigar, C J

    2011-02-14

    A simple yet general method for constructing basis sets for molecular electronic structure calculations is presented. These basis sets consist of atomic natural orbitals from a multiconfigurational self-consistent field calculation supplemented with primitive functions, chosen such that the asymptotics are appropriate for the potential of the system. Primitives are optimized for the homonuclear diatomic molecule to produce a balanced basis set. Two general features that facilitate this basis construction are demonstrated. First, weak coupling exists between the optimal exponents of primitives with different angular momenta. Second, the optimal primitive exponents for a chosen system depend weakly on the particular level of theory employed for optimization. The explicit case considered here is a basis set appropriate for the Burkatzki-Filippi-Dolg pseudopotentials. Since these pseudopotentials are finite at nuclei and have a Coulomb tail, the recently proposed Gauss-Slater functions are the appropriate primitives. Double- and triple-zeta bases are developed for elements hydrogen through argon. These new bases offer significant gains over the corresponding Burkatzki-Filippi-Dolg bases at various levels of theory. Using a Gaussian expansion of the basis functions, these bases can be employed in any electronic structure method. Quantum Monte Carlo provides an added benefit: expansions are unnecessary since the integrals are evaluated numerically.

  4. Simple formalism for efficient derivatives and multi-determinant expansions in quantum Monte Carlo

    Energy Technology Data Exchange (ETDEWEB)

    Filippi, Claudia, E-mail: c.filippi@utwente.nl [MESA+ Institute for Nanotechnology, University of Twente, P.O. Box 217, 7500 AE Enschede (Netherlands); Assaraf, Roland, E-mail: assaraf@lct.jussieu.fr [Sorbonne Universités, UPMC Univ Paris 06, CNRS, Laboratoire de Chimie Théorique CC 137-4, place Jussieu F-75252 Paris Cedex 05 (France); Moroni, Saverio, E-mail: moroni@democritos.it [CNR-IOM DEMOCRITOS, Istituto Officina dei Materiali, and SISSA Scuola Internazionale Superiore di Studi Avanzati, Via Bonomea 265, I-34136 Trieste (Italy)

    2016-05-21

    We present a simple and general formalism to compute efficiently the derivatives of a multi-determinant Jastrow-Slater wave function, the local energy, the interatomic forces, and similar quantities needed in quantum Monte Carlo. Through a straightforward manipulation of matrices evaluated on the occupied and virtual orbitals, we obtain an efficiency equivalent to algorithmic differentiation in the computation of the interatomic forces and the optimization of the orbital parameters. Furthermore, for a large multi-determinant expansion, the significant computational gain afforded by a recently introduced table method is here extended to the local value of any one-body operator and to its derivatives, in both all-electron and pseudopotential calculations.

  5. Quantum statistics of ideal parafermi gases III: The Slater quasi-determinant

    International Nuclear Information System (INIS)

    Rachidi, M.; Zerouaoui, J.; Saidi, E.H.

    1995-09-01

    The wave function ψ (1,2,...,N) of a gas of N identical two-dimensional exotic particles of spin 1/M (mod 1), M = 2,3,4,... is constructed. It is shown that ψ (1,2,...,N) obeys a generalized Pauli exclusion principle according to which no more than (M - 1) identical particles of spin 1/M (mod 1) can live in the same quantum state. The Fermi nilpotency and the Bose condensation are recovered as special cases. Examples are given. (author). 9 refs

  6. Quantum statistics of ideal parafermi gases III: The Slater quasi-determinant

    Energy Technology Data Exchange (ETDEWEB)

    Rachidi, M; Zerouaoui, J [Faculte de Sciences, Rabat (Morocco). Section de Physique de Hautes Energies (LMPHE); Saidi, E H [International Centre for Theoretical Physics, Trieste (Italy)

    1995-09-01

    The wave function {psi} (1,2,...,N) of a gas of N identical two-dimensional exotic particles of spin 1/M (mod 1), M = 2,3,4,... is constructed. It is shown that {psi} (1,2,...,N) obeys a generalized Pauli exclusion principle according to which no more than (M - 1) identical particles of spin 1/M (mod 1) can live in the same quantum state. The Fermi nilpotency and the Bose condensation are recovered as special cases. Examples are given. (author). 9 refs.

  7. Linear-scaling evaluation of the local energy in quantum Monte Carlo

    International Nuclear Information System (INIS)

    Austin, Brian; Aspuru-Guzik, Alan; Salomon-Ferrer, Romelia; Lester, William A. Jr.

    2006-01-01

    For atomic and molecular quantum Monte Carlo calculations, most of the computational effort is spent in the evaluation of the local energy. We describe a scheme for reducing the computational cost of the evaluation of the Slater determinants and correlation function for the correlated molecular orbital (CMO) ansatz. A sparse representation of the Slater determinants makes possible efficient evaluation of molecular orbitals. A modification to the scaled distance function facilitates a linear scaling implementation of the Schmidt-Moskowitz-Boys-Handy (SMBH) correlation function that preserves the efficient matrix multiplication structure of the SMBH function. For the evaluation of the local energy, these two methods lead to asymptotic linear scaling with respect to the molecule size

  8. Calculation of the total electron excitation cross section in the Born approximation using Slater wave functions for the Li (2s yields 2p), Li (2s yields 3p), Na (3s yields 4p), Mg (3p yields 4s), Ca (4s yields 4p) and K (4s yields 4p) excitations. M.S. Thesis

    Science.gov (United States)

    Simsic, P. L.

    1974-01-01

    Excitation of neutral atoms by inelastic scattering of incident electrons in gaseous nebulae were investigated using Slater Wave functions to describe the initial and final states of the atom. Total cross sections using the Born Approximation are calculated for: Li(2s yields 2p), Na(3s yields 4p), k(4s yields 4p). The intensity of emitted radiation from gaseous nebulae is also calculated, and Maxwell distribution is employed to average the kinetic energy of electrons.

  9. Program package for calculating matrix elements of two-cluster structures in nuclei

    International Nuclear Information System (INIS)

    Krivec, R.; Mihailovic, M.V.; Kernforschungszentrum Karlsruhe G.m.b.H.

    1982-01-01

    Matrix elements of operators between Slater determinants of two-cluster structures must be expanded into partial waves for the purpose of angular momentum projection. The expansion coefficients contain integrals over the spherical angles theta and phi. (orig.)

  10. SCF MS Xα determination of ionization energies and atomic populations of octaedral TiO6-8 cluster

    International Nuclear Information System (INIS)

    Michel-Calendini, F.M.; Chermette, H.; Pertosa, P.

    1979-02-01

    The ionization energies of titanium and oxygen states in BaTiO 3 crystal have been investigated through the self-consistent-field-Xα-scattered-wave (SCF MS Xα) method, with the Slater transition state model, applied to a TiO 6 -8 cluster of octaedral symmetry. Ionization energies and electronic charge distribution are compared to XPS data and related to results obtained from tight-binding band computations

  11. Generalized Hartree-Fock method for electron-atom scattering

    International Nuclear Information System (INIS)

    Rosenberg, L.

    1997-01-01

    In the widely used Hartree-Fock procedure for atomic structure calculations, trial functions in the form of linear combinations of Slater determinants are constructed and the Rayleigh-Ritz minimum principle is applied to determine the best in that class. A generalization of this approach, applicable to low-energy electron-atom scattering, is developed here. The method is based on a unique decomposition of the scattering wave function into open- and closed-channel components, so chosen that an approximation to the closed-channel component may be obtained by adopting it as a trial function in a minimum principle, whose rigor can be maintained even when the target wave functions are imprecisely known. Given a closed-channel trial function, the full scattering function may be determined from the solution of an effective one-body Schroedinger equation. Alternatively, in a generalized Hartree-Fock approach, the minimum principle leads to coupled integrodifferential equations to be satisfied by the basis functions appearing in a Slater-determinant representation of the closed-channel wave function; it also provides a procedure for optimizing the choice of nonlinear parameters in a variational determination of these basis functions. Inclusion of additional Slater determinants in the closed-channel trial function allows for systematic improvement of that function, as well as the calculated scattering parameters, with the possibility of spurious singularities avoided. Electron-electron correlations can be important in accounting for long-range forces and resonances. These correlation effects can be included explicitly by suitable choice of one component of the closed-channel wave function; the remaining component may then be determined by the generalized Hartree-Fock procedure. As a simple test, the method is applied to s-wave scattering of positrons by hydrogen. copyright 1997 The American Physical Society

  12. Correlations in rare-earth transition-metal permanent magnets

    International Nuclear Information System (INIS)

    Skomski, R.; Manchanda, P.; Kashyap, A.

    2015-01-01

    It is investigated how electron-electron correlations affect the intrinsic properties of rare-earth transition-metal magnets. Focusing on orbital moment and anisotropy, we perform model calculations for 3d-4f alloys and density-functional theory (DFT) calculations for NdCo 5 . On an independent-electron level, the use of a single Slater determinant with broken spin symmetry introduces Hund's rule correlations, which govern the behavior of rare-earth ions and of alloys described by the local spin density approximation (LSDA) and LSDA + U approximations to DFT. By contrast, rare-earth ions in intermetallics involve configuration interactions between two or more Slater determinants and lead to phenomena such as spin-charge distribution. Analyzing DFT as a Legendre transformation and using Bethe's crystal-field theory, we show that the corresponding density functionals are very different from familiar LSDA-type expressions and outline the effect of spin-charge separation on the magnetocrystalline anisotropy

  13. Correlations in rare-earth transition-metal permanent magnets

    Science.gov (United States)

    Skomski, R.; Manchanda, P.; Kashyap, A.

    2015-05-01

    It is investigated how electron-electron correlations affect the intrinsic properties of rare-earth transition-metal magnets. Focusing on orbital moment and anisotropy, we perform model calculations for 3d-4f alloys and density-functional theory (DFT) calculations for NdCo5. On an independent-electron level, the use of a single Slater determinant with broken spin symmetry introduces Hund's rule correlations, which govern the behavior of rare-earth ions and of alloys described by the local spin density approximation (LSDA) and LSDA + U approximations to DFT. By contrast, rare-earth ions in intermetallics involve configuration interactions between two or more Slater determinants and lead to phenomena such as spin-charge distribution. Analyzing DFT as a Legendre transformation and using Bethe's crystal-field theory, we show that the corresponding density functionals are very different from familiar LSDA-type expressions and outline the effect of spin-charge separation on the magnetocrystalline anisotropy.

  14. Effects of Ga substitution on the structural and magnetic properties of half metallic Fe{sub 2}MnSi Heusler compound

    Energy Technology Data Exchange (ETDEWEB)

    Pedro, S. S., E-mail: sandrapedro@uerj.br; Caraballo Vivas, R. J.; Andrade, V. M.; Cruz, C.; Paixão, L. S.; Contreras, C.; Costa-Soares, T.; Rocco, D. L.; Reis, M. S. [Instituto de Física, Universidade Federal Fluminense, Niterói-RJ (Brazil); Caldeira, L. [IF Sudeste MG, Campus Juiz de Fora - Núcleo de Física, Juiz de Fora-MG (Brazil); Coelho, A. A. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas - Unicamp, Campinas-SP (Brazil); Carvalho, A. Magnus G. [Laboratório Nacional de Luz Sincrotron, CNPEM, Campinas-SP (Brazil)

    2015-01-07

    The so-called half-metallic magnets have been proposed as good candidates for spintronic applications due to the feature of exhibiting a hundred percent spin polarization at the Fermi level. Such materials follow the Slater-Pauling rule, which relates the magnetic moment with the valence electrons in the system. In this paper, we study the bulk polycrystalline half-metallic Fe{sub 2}MnSi Heusler compound replacing Si by Ga to determine how the Ga addition changes the magnetic, the structural, and the half-metal properties of this compound. The material does not follow the Slater-Pauling rule, probably due to a minor structural disorder degree in the system, but a linear dependence on the magnetic transition temperature with the valence electron number points to the half-metallic behavior of this compound.

  15. Application of some Hartree-Fock model calculations to the analysis of atomic and free-ion optical spectra

    International Nuclear Information System (INIS)

    Hayhurst, T.L.

    1980-01-01

    Techniques for applying ab-initio calculations to the analysis of atomic spectra are investigated, along with the relationship between the semi-empirical and ab-initio forms of Slater-Condon theory. Slater-Condon theory is reviewed with a focus on the essential features that lead to the effective Hamiltonians associated with the semi-empirical form of the theory. Ab-initio spectroscopic parameters are calculated from wavefunctions obtained via self-consistent field methods, while multiconfiguration Hamiltonian matrices are constructed and diagonalized with computer codes written by Robert Cowan of Los Alamos Scientific Laboratory. Group theoretical analysis demonstrates that wavefunctions more general than Slater determinants (i.e. wavefunctions with radical correlations between electrons) lead to essentially the same parameterization of effective Hamiltonians. In the spirit of this analysis, a strategy is developed for adjusting ab-initio values of the spectroscopic parameters, reproducing parameters obtained by fitting the corresponding effective Hamiltonian. Secondary parameters are used to screen the calculated (primary) spectroscopic parameters, their values determined by least squares. Extrapolations of the secondary parameters determined from analyzed spectra are attempted to correct calculations of atoms and ions without experimental levels. The adjustment strategy and extrapolations are tested on the KI sequence from K 0+ through Fe 7+ , fitting to experimental levels for V 4+ , and Cr 5+ ; unobserved levels and spectra are predicted for several members of the sequence. A related problem is also discussed: Energy levels of the Uranium hexahalide complexes, (UX 6 ) 2- for X = F, Cl, Br, and I, are fit to an effective Hamiltonian (the f 2 configuration in O/sub h/ symmetry) with corrections proposed by Brian Judd

  16. Application of some Hartree-Fock model calculations to the analysis of atomic and free-ion optical spectra

    International Nuclear Information System (INIS)

    Hayhurst, T.L.

    1980-05-01

    Techniques for applying ab-initio calculations to the analysis of atomic spectra are investigated, along with the relationship between the semi-empirical and ab-initio forms of Slater-Condon theory. Slater-Condon theory is reviewed with a focus on the essential features that lead to the effective Hamiltonians associated with the semi-empirical form of the theory. Ab-initio spectroscopic parameters are calculated from wavefunctions obtained via self-consistent field methods, while multi-configuration Hamiltonian matrices are constructed and diagonalized with computer codes written by Robert Cowan of Los Alamos Scientific Laboratory. Group theoretical analysis demonstrates that wavefunctions more general than Slater determinants (i.e., wavefunctions with radial correlations between electrons) lead to essentially the same parameterization of effective Hamiltonians. In the spirit of this analysis, a strategy is developed for adjusting ab-initio values of the spectroscopic parameters, reproducing parameters obtained by fitting the corresponding effective Hamiltonian. Secondary parameters are used to screen the calculated (primary) spectroscopic parameters, their values determined by least squares. Extrapolations of the secondary parameters determined from analyzed spectra are attempted to correct calculations of atoms and ions without experimental levels. The adjustment strategy and extrapolations are tested on the K I sequence from K 0+ through Fe 7+ , fitting to experimental levels for V 4+ , and Cr 5+ ; unobserved levels and spectra are predicted for several members of the sequence. A related problem is also discussed: energy levels of the uranium hexahalide complexes, (UX 6 ) 2- for X = F, Cl, Br, and I, are fit to an effective Hamiltonian (the f 2 configuration in O/sub h/ symmetry) with corrections proposed by Brian Judd

  17. On the electron to proton mass ratio and the proton structure

    DEFF Research Database (Denmark)

    Trinhammer, Ole L.

    2013-01-01

    We derive an expression for the electron to nucleon mass ratio from a reinterpreted lattice gauge theory Hamiltonian to describe interior baryon dynamics. We use the classical electron radius as our fundamental length scale. Based on expansions on trigonometric Slater determinants for a neutral s...... and d valence quarks of the proton....

  18. Study of Atoms and Molecules with Auxiliary-Field Quantum Monte Carlo

    Science.gov (United States)

    Purwanto, Wirawan; Suewattana, Malliga; Krakauer, Henry; Zhang, Shiwei; Walter, Eric J.

    2006-03-01

    We study the ground-state properties of second-row atoms and molecules using the phaseless auxiliary-field quantum Monte Carlo (AF QMC) method. This method projects the many-body ground state from a trial wave function by means of random walks in the Slater-determinant space. We use a single Slater-determinant trial wave function obtained from density-functional theory (DFT) or Hartree-Fock (HF) calculations. The calculations were done with a plane-wave basis and supercells with periodic boundary condition. We investigate the finite-size effects and the accuracy of pseudopotentials within DFT, HF, and AF QMC frameworks. Pseudopotentials generated from both LDA (OPIUM) and HF are employed. We find that the many-body QMC calculations show a greater sensitivity to the accuracy of the pseudopotentials. With reliable pseudopotentials, the ionization potentials and dissociation energies obtained using AF QMC are in excellent agreement with the experimental results. S. Zhang and H. Krakauer, Phys. Rev. Lett. 90, 136401 (2003) http://opium.sourceforge.net I. Ovcharenko, A. Aspuru-Guzik, and W. A. Lester, J. Chem. Phys. 114, 7790 (2001)

  19. Consistent microscopic theory of collective motion in the framework of an ATDHF approach

    International Nuclear Information System (INIS)

    Goeke, K.; Reinhard, P.

    1978-01-01

    Based on merely two assumptions, namely the existence of a collective Hamiltonian and that the collective motion evolves along Slater determinants, we first derive a set of adiabatic time-dependent Hartree-Fock equations (ATDHF) which determine the collective path, the mass and the potential, second give a unique procedure for quantizing the resulting classical collective Hamiltonian, and third explain how to use the collective wavefunctions, which are eigenstates of the quantized Hamiltonian

  20. Geography and Powerful Knowledge: A Contribution to the Debate

    Science.gov (United States)

    Maude, Alaric

    2018-01-01

    This paper is a contribution to the debate on powerful knowledge in geography that began in a 2015 issue of IRGEE and was continued by Frances Slater and Norman Graves in 2016. It addresses some of the questions raised by Slater and Graves. First, it suggests an alternative way of describing and identifying powerful knowledge than the one in their…

  1. Stochastic TDHF and the Boltzman-Langevin equation

    International Nuclear Information System (INIS)

    Suraud, E.; Reinhard, P.G.

    1991-01-01

    Outgoing from a time-dependent theory of correlations, we present a stochastic differential equation for the propagation of ensembles of Slater determinants, called Stochastic Time-Dependent Hartree-Fock (Stochastic TDHF). These ensembles are allowed to develop large fluctuations in the Hartree-Fock mean fields. An alternative stochastic differential equation, the Boltzmann-Langevin equation, can be derived from Stochastic TDHF by averaging over subensembles with small fluctuations

  2. Volume and surface photoemission from tungsten. I. Calculation of band structure and emission spectra

    DEFF Research Database (Denmark)

    Christensen, N. Egede; Feuerbacher, B.

    1974-01-01

    is obtained from an ad hoc potential based on a Dirac-Slater atomic calculation for the ground-state configuration and with full Slater exchange in the atomic as well as in the crystal potential. The selection of this best potential is justified by comparing the calculated band structure to Fermi...... of states. The present work includes a crude estimate of this surface density of states, which is derived from the bulk band structure by narrowing the d bands according to an effective number of neighbors per surface atom. Estimates of surface relaxation effects are also included.......The electronic energy-band structure of tungsten has been calculated by means of the relativistic-augmented-plane-wave method. A series of mutually related potentials are constructed by varying the electronic configuration and the amount of Slater exchange included. The best band structure...

  3. Kritické zhodnocení psychoanalytických přístupů k řeckému náboženství

    OpenAIRE

    Maľová, Anna

    2011-01-01

    Two psychoanalytic interpretations are subjected to scrutiny in this thesis. Richard Caldwell, the author of the first interpretation, presents psychoanalytic interpretation of Greek theogonic myths in his book The Origin of the Gods. The Greek family and its influence on Greek myths is subject of the second interpretation presented in the work The Glory of Hera by Philip E. Slater. While Caldwell prefers classical psychoana- lysis Slater is interested in specific schema of the Greek family w...

  4. Geminal embedding scheme for optimal atomic basis set construction in correlated calculations

    Energy Technology Data Exchange (ETDEWEB)

    Sorella, S., E-mail: sorella@sissa.it [International School for Advanced Studies (SISSA), Via Beirut 2-4, 34014 Trieste, Italy and INFM Democritos National Simulation Center, Trieste (Italy); Devaux, N.; Dagrada, M., E-mail: mario.dagrada@impmc.upmc.fr [Institut de Minéralogie, de Physique des Matériaux et de Cosmochimie, Université Pierre et Marie Curie, Case 115, 4 Place Jussieu, 75252 Paris Cedex 05 (France); Mazzola, G., E-mail: gmazzola@phys.ethz.ch [Theoretische Physik, ETH Zurich, 8093 Zurich (Switzerland); Casula, M., E-mail: michele.casula@impmc.upmc.fr [CNRS and Institut de Minéralogie, de Physique des Matériaux et de Cosmochimie, Université Pierre et Marie Curie, Case 115, 4 Place Jussieu, 75252 Paris Cedex 05 (France)

    2015-12-28

    We introduce an efficient method to construct optimal and system adaptive basis sets for use in electronic structure and quantum Monte Carlo calculations. The method is based on an embedding scheme in which a reference atom is singled out from its environment, while the entire system (atom and environment) is described by a Slater determinant or its antisymmetrized geminal power (AGP) extension. The embedding procedure described here allows for the systematic and consistent contraction of the primitive basis set into geminal embedded orbitals (GEOs), with a dramatic reduction of the number of variational parameters necessary to represent the many-body wave function, for a chosen target accuracy. Within the variational Monte Carlo method, the Slater or AGP part is determined by a variational minimization of the energy of the whole system in presence of a flexible and accurate Jastrow factor, representing most of the dynamical electronic correlation. The resulting GEO basis set opens the way for a fully controlled optimization of many-body wave functions in electronic structure calculation of bulk materials, namely, containing a large number of electrons and atoms. We present applications on the water molecule, the volume collapse transition in cerium, and the high-pressure liquid hydrogen.

  5. M sub shell X-ray emission cross section measurements for Pt, Au, Hg, Pb, Th and U at 8 and 10 keV synchrotron photons

    International Nuclear Information System (INIS)

    Kaur, Gurpreet; Gupta, Sheenu; Tiwari, M.K.; Mittal, Raj

    2014-01-01

    Highlights: • First time M sub shell fluorescence cross section measurements at 8 and 10 keV photons. • Comparison with theoretical evaluations from different model data for parameters. • Explained the large deviations from the trend of parameters with atomic number Z. • A specific pattern of cross sections with Z is predicted in the region, 78 ⩽ Z ⩽ 92. • Confirmation of prediction requires more experiment in these Z and energy region. -- Abstract: M sub shell X-ray emission cross sections of Pt, Au, Hg, Pb, Th and U at 8 and 10 keV photon energies have been determined with linearly polarized photon beam from Indus-2 synchrotron source. The measured cross sections have been reported for the first time and were used to check the available theoretical Dirac–Hartree–Slater (DHS) and Dirac–Fock (DF) values reported in literature and also the presently derived Non Relativistic Hartree–Slater (NRHS), DF and DHS values for M ξ , M δ , M α , M β , M γ , M m1 and M m2 group of X-rays

  6. Li (i = 1-3) subshell X-ray production cross sections and fluorescence yields for some elements with 56 ≤ Z ≤ 68 at 22.6 keV

    International Nuclear Information System (INIS)

    Chauhan, Yogeshwar; Tiwari, M.K.; Puri, Sanjiv

    2008-01-01

    The L k (k = l, α, β 1,4 , β 3,6 , β 2,15,9,10,7 , γ 1,5 and γ 2,3,4 ) X-ray production (XRP) cross sections have been measured for six elements with 56 ≤ Z ≤ 68 at 22.6 keV incident photon energy using the EDXRF spectrometer. The incident photon intensity, detector efficiency and geometrical factors have been determined from the K X-ray yields emitted from elemental targets with 22 ≤ Z ≤ 42 in the same geometrical setup and from knowledge of the K XRP cross sections. The L 1 and L 2 subshell fluorescence yields have been deduced from the present measured L k XRP cross sections using the relativistic Hartree-Fock-Slater (HFS) model based photoionization cross sections. The present deduced ω 1 (exp) values have been found to be, on an average, higher by 15% and 20% than those based on the Dirac-Hartree-Slater (DHS) model and the semi-empirical values compiled by Krause, respectively, for elements with 60 ≤ Z ≤ 68

  7. Itinerant Ferromagnetism in Ultracold Fermi Gases

    DEFF Research Database (Denmark)

    Heiselberg, Henning

    2012-01-01

    Itinerant ferromagnetism in cold Fermi gases with repulsive interactions is studied applying the Jastrow-Slater approximation generalized to finite polarization and temperature. For two components at zero temperature a second order transition is found at akF ≃ 0.90 compatible with QMC. Thermodyna......Itinerant ferromagnetism in cold Fermi gases with repulsive interactions is studied applying the Jastrow-Slater approximation generalized to finite polarization and temperature. For two components at zero temperature a second order transition is found at akF ≃ 0.90 compatible with QMC...

  8. The Impact of Alternative Market Orientation Strategies on Firm Performance: Customer versus Competitor Orientation

    OpenAIRE

    Micheels, Eric T.; Gow, Hamish R.

    2010-01-01

    Research studies have differed over the importance of the relative emphasis of a customer versus competitor orientation in the development of a market orientation (Slater and Narver, 1994; Tajeddini, 2010). In this study, we assess whether the emphasis of one component over another of a market orientation is an important determinant of firm performance within the Illinois beef industry, specifically the cow-calf sector. Using a series of OLS regressions, we examine the importance of a market ...

  9. Quantification of entanglement entropies for doubly excited resonance states in two-electron atomic systems

    International Nuclear Information System (INIS)

    Ho, Yew Kam; Lin, Chien-Hao

    2015-01-01

    In this work, we study the quantum entanglement for doubly excited resonance states in two-electron atomic systems such as the H - and Ps - ions and the He atom by using highly correlated Hylleraas type functions The resonance states are determined by calculation of density of resonance states with the stabilization method. The spatial (electron-electron orbital) entanglement entropies (linear and von Neumann) for the low-lying doubly excited states are quantified using the Schmidt-Slater decomposition method. (paper)

  10. Component separation in harmonically trapped boson-fermion mixtures

    DEFF Research Database (Denmark)

    Nygaard, Nicolai; Mølmer, Klaus

    1999-01-01

    We present a numerical study of mixed boson-fermion systems at zero temperature in isotropic and anise tropic harmonic traps. We investigate the phenomenon of component separation as a function of the strength ut the interparticle interaction. While solving a Gross-Pitaevskii mean-field equation ...... for the boson distribution in the trap, we utilize two different methods to extract the density profile of the fermion component; a semiclassical Thomas-Fermi approximation and a quantum-mechanical Slater determinant Schrodinger equation....

  11. Atomic emission spectroscopy

    Science.gov (United States)

    Andrew, K. H.

    1975-01-01

    The relationship between the Slater-Condon theory and the conditions within the atom as revealed by experimental data was investigated. The first spectrum of Si, Rb, Cl, Br, I, Ne, Ar, and Xe-136 and the second spectrum of As, Cu, and P were determined. Methods for assessing the phase stability of fringe counting interferometers and the design of an autoranging scanning system for digitizing the output of an infrared spectrometer and recording it on magnetic tape are described.

  12. A hybrid configuration interaction treatment based on seniority number and excitation schemes

    International Nuclear Information System (INIS)

    Alcoba, Diego R.; Capuzzi, Pablo; Torre, Alicia; Lain, Luis; Oña, Ofelia B.; Van Raemdonck, Mario; Bultinck, Patrick; Van Neck, Dimitri

    2014-01-01

    We present a configuration interaction method in which the Hamiltonian of an N-electron system is projected on Slater determinants selected according to the seniority-number criterion along with the traditional excitation-based procedure. This proposed method is especially useful to describe systems which exhibit dynamic (weak) correlation at determined geometric arrangements (where the excitation-based procedure is more suitable) but show static (strong) correlation at other arrangements (where the seniority-number technique is preferred). The hybrid method amends the shortcomings of both individual determinant selection procedures, yielding correct shapes of potential energy curves with results closer to those provided by the full configuration interaction method

  13. A hybrid configuration interaction treatment based on seniority number and excitation schemes

    Energy Technology Data Exchange (ETDEWEB)

    Alcoba, Diego R.; Capuzzi, Pablo [Departamento de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and Instituto de Física de Buenos Aires, Consejo Nacional de Investigaciones Científicas y Técnicas, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Torre, Alicia; Lain, Luis, E-mail: qfplapel@lg.ehu.es [Departamento de Química Física, Facultad de Ciencia y Tecnología, Universidad del País Vasco, Apdo. 644 E-48080 Bilbao (Spain); Oña, Ofelia B. [Instituto de Investigaciones Fisicoquímicas Teóricas y Aplicadas, Universidad Nacional de La Plata, CCT La Plata, Consejo Nacional de Investigaciones Científicas y Técnicas, Diag. 113 y 64 (S/N), Sucursal 4, CC 16, 1900 La Plata (Argentina); Van Raemdonck, Mario; Bultinck, Patrick [Department of Inorganic and Physical Chemistry, Ghent University, Krijgslaan 281 (S3), 9000 Gent (Belgium); Van Neck, Dimitri [Center for Molecular Modelling, Ghent University, Technologiepark 903, 9052 Zwijnaarde (Belgium)

    2014-12-28

    We present a configuration interaction method in which the Hamiltonian of an N-electron system is projected on Slater determinants selected according to the seniority-number criterion along with the traditional excitation-based procedure. This proposed method is especially useful to describe systems which exhibit dynamic (weak) correlation at determined geometric arrangements (where the excitation-based procedure is more suitable) but show static (strong) correlation at other arrangements (where the seniority-number technique is preferred). The hybrid method amends the shortcomings of both individual determinant selection procedures, yielding correct shapes of potential energy curves with results closer to those provided by the full configuration interaction method.

  14. On the initial conditions of time-dependent mean-field equations of evolution. Pt. 2

    International Nuclear Information System (INIS)

    Troudet, T.; Paris-11 Univ., 91 - Orsay

    1986-01-01

    We analyze the problem so far untouched of determining the initial mean-field wavefunction in the context of zero-temperature mean-field descriptions of time-dependent expectation values and quantum fluctuations of nuclear observables. The nucleus, at zero temperature, is taken to be in a low-lying excited many-body eigenstate and is approximated by the corresponding RPA wavefunction as a continuous superposition of coherent states (i.e. Slater determinants). A generating function Gsub(A)(lambda) for time-dependent expectation values and quantum fluctuations is constructed within the formalism of functional integration. By applying the saddle-point method to the functional action of Gsub(A)(lambda) and then taking its lambda-derivatives, we recover the well-known TDHF theory and propose a simple determination of the initial Slater determinant for an appropriate mean-field description of time-dependent expectation values. The analog mean-field description of quadratic-quantum fluctuations proceeds similarly and in addition includes the contribution of the uncorrelated TDHF-RPA phonons coupled to collective excitations of the initial (static) mean-field configuration. When the collective TDHF-RPA excitations are solely taken into account, we obtain an improved version of the Balian-Veneroni dispersion formula by showing how to determine the initial mean-field wavefunction. By first taking the lambda-derivatives of Gsub(A)(lambda) before applying the saddle-point method, the initial mean-field wavefunction is found to be non-linearly coupled to the mean-field dynamics themselves. In return, and in contrast to the first quantization scheme, these both depend non-trivially upon the observable A being measured so that approximations must be proposed to simplify the resulting mean-field equations. (orig.)

  15. Effective hypernetted-chain study of even-denominator-filling state of the fractional quantum Hall effect

    International Nuclear Information System (INIS)

    Ciftja, O.

    1999-01-01

    The microscopic approach for studying the half-filled state of the fractional quantum Hall effect is based on the idea of proposing a trial Fermi wave function of the Jastrow-Slater form, which is then fully projected onto the lowest Landau level. A simplified starting point is to drop the projection operator and to consider an unprojected wave function. A recent study claims that such a wave function approximated in a Jastrow form may still constitute a good starting point on the study of the half-filled state. In this paper we formalize the effective hypernetted-chain approximation and apply it to the unprojected Fermi wave function, which describes the even-denominator-filling states. We test the above approximation by using the Fermi hypernetted-chain theory, which constitutes the natural choice for the present case. Our results suggest that the approximation of the Slater determinant of plane waves as a Jastrow wave function may not be a very accurate approximation. We conclude that the lowest Landau-level projection operator cannot be neglected if one wants a better quantitative understanding of the phenomena. copyright 1999 The American Physical Society

  16. Angular distribution of Auger electrons due to 3d-shell ionization of krypton

    Science.gov (United States)

    Omidvar, K.

    1977-01-01

    Cross sections for electron impact ionization of krypton due to ejection of a 3rd shell electron have been calculated using screened hydrogenic and Hartree-Slater wave functions for target atom. While the total ionization cross sections in the two approximations are within 10% of each other, the Auger electron angular distribution, related to cross sections for specific magnetic quantum numbers of the 3rd electrons, is widely different in the two approximations. The angular distribution due to Hartree-Slater approximation is in excellent agreement with measurement. The physical reason for the discrepancies in the two approximations is explained.

  17. Angular distribution of Auger electrons due to 3d-shell impact ionization of krypton

    Science.gov (United States)

    Omidvar, K.

    1977-01-01

    Cross sections for electron impact ionization of krypton due to ejection of a 3d-shell electron have been calculated using screened hydrogenic and Hartree-Slater wavefunctions for the target atom. While the total ionization cross sections in the two approximations are within 10% of each other, the Auger electron angular distribution, related to cross sections for specific magnetic quantum numbers of the 3d electrons, are widely different in the two approximations. The angular distribution due to the Hartree-Slater approximation is in excellent agreement with measurement. The physical reason for the discrepancies in the two approximations is explained.

  18. A theoretical survey of 4s-4p and 4p-4d transitions in nickel-like ions through Sn XXIII

    International Nuclear Information System (INIS)

    Wyart, J.F.

    1987-01-01

    The predictions of 4s-4p and 4p-4d transitions derived from Slater-Condon type calculations of 3d 9 4s, -4p and -4d configurations in the sequence Zn III-Se VII have been recently confirmed experimentally through Mo XV. These new data are used here to refine the predictions in the sequence Mo XV-Sn XXIII. The radial parameters involved in the three configurations are determined in generalized least-squares fits using all known levels in the sequence. (orig.)

  19. Microscopic theories for collective motions of large amplitude

    International Nuclear Information System (INIS)

    Souza Cruz, F.F. de.

    1986-01-01

    The many proposals of ''Collective Paths'' that have appeared in literature, were derived through a local analysis of the Time Dependent Hartree Fock dynamics. Those proposals were compared and validity conditions obtained for Semiclassical Hamiltonians which have only quadratic terms in momenta. A careful analysis of the parametrization of Slater Determinants allowed us to exploit the geometrical features of the Time Dependent Hartree Fock Theory and construct the Paths in a covariant way. The analysis was applied to a three level model (Su(3)). (author) [pt

  20. Birth order in a contemporary sample of gay men.

    Science.gov (United States)

    Purcell, D W; Blanchard, R; Zucker, K J

    2000-08-01

    The birth order of a contemporary North American sample of 97 gay men was quantified using Slater's Index. For the 84 probands with at least one sibling, the results showed a late mean birth order compared with the expected value of .50. Additional birth order indices derived from Slater's Index suggested that the mean later birth order was accounted for more strongly by the proband's number of older brothers than by his number of older sisters. The present findings constitute a replication of a series of recent studies and add to the growing body of evidence that birth order is a reliable correlate of sexual orientation in males.

  1. Novel extrapolation method in the Monte Carlo shell model

    International Nuclear Information System (INIS)

    Shimizu, Noritaka; Abe, Takashi; Utsuno, Yutaka; Mizusaki, Takahiro; Otsuka, Takaharu; Honma, Michio

    2010-01-01

    We propose an extrapolation method utilizing energy variance in the Monte Carlo shell model to estimate the energy eigenvalue and observables accurately. We derive a formula for the energy variance with deformed Slater determinants, which enables us to calculate the energy variance efficiently. The feasibility of the method is demonstrated for the full pf-shell calculation of 56 Ni, and the applicability of the method to a system beyond the current limit of exact diagonalization is shown for the pf+g 9/2 -shell calculation of 64 Ge.

  2. Quantum Monte Carlo calculation of the Fermi-liquid parameters in the two-dimensional electron gas

    International Nuclear Information System (INIS)

    Kwon, Y.; Ceperley, D.M.; Martin, R.M.

    1994-01-01

    Excitations of the two-dimensional electron gas, including many-body effects, are calculated with a variational Monte Carlo method. Correlated sampling is introduced to calculate small energy differences between different excitations. The usual pair-product (Slater-Jastrow) trial wave function is found to lack certain correlations entirely so that backflow correlation is crucial. From the excitation energies calculated here, we determine Fermi-liquid parameters and related physical quantities such as the effective mass and the Lande g factor of the system. Our results for the effective mass are compared with previous analytic calculations

  3. Insulating phase in Sr{sub 2}IrO{sub 4}: An investigation using critical analysis and magnetocaloric effect

    Energy Technology Data Exchange (ETDEWEB)

    Bhatti, Imtiaz Noor; Pramanik, A.K., E-mail: akpramanik@mail.jnu.ac.in

    2017-01-15

    The nature of insulating phase in 5d based Sr{sub 2}IrO{sub 4} is quite debated as the theoretical as well as experimental investigations have put forward evidences in favor of both magnetically driven Slater-type and interaction driven Mott-type insulator. To understand this insulating behavior, we have investigated the nature of magnetic state in Sr{sub 2}IrO{sub 4} through studying critical exponents, low temperature thermal demagnetization and magnetocaloric effect. The estimated critical exponents do not exactly match with any universality class, however, the values obey the scaling behavior. The exponent values suggest that spin interaction in present material is close to mean-field model. The analysis of low temperature thermal demagnetization data, however, shows dual presence of localized- and itinerant-type of magnetic interaction. Moreover, field dependent change in magnetic entropy indicates magnetic interaction is close to mean-field type. While this material shows an insulating behavior across the magnetic transition, yet a distinct change in slope in resistivity is observed around T{sub c}. We infer that though the insulating phase in Sr{sub 2}IrO{sub 4} is more close to be Slater-type but the simultaneous presence of both Slater- and Mott-type is the likely scenario for this material. - Highlights: • Critical analysis shows Sr{sub 2}IrO{sub 4} has ferromagnetic ordering temperature T{sub c}~225 K. • Obtained critical exponents imply spin interaction is close to mean-field model. • Analysis of magneto-entropy data also supports mean-field type interaction. • However, the presence of both itinerant and localized spin interaction is evident. • Sr{sub 2}IrO{sub 4} has simultaneous presence of both Slater- and Mott-type insulating phase.

  4. The time dependent Hartree-Fock-theory for collective nuclear motions

    International Nuclear Information System (INIS)

    Goeke, K.

    1976-11-01

    The time-dependent Hartree-Fock theory (TDHF) approximately solves the Schroedinger equation by a variational method in the space of the time-dependent Slater determinants. As the TDHF wave function, similar to the exact solution has the property of being determined completely for all times by the nucleon-nucleon interaction and by assuming initial conditions. TDHF is expected to describe collective motion of nuclei with large amplitudes, too. The subject of this paper is to formulate the TDHF theory and its adiabatic limiting case (ATDHF) suited for setting up a collective Schroedinger equation, to investigate the relations with other theories, and to show the applicability for solving practical problems. (orig./WL) [de

  5. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  6. Non-orthogonal configuration interaction for the calculation of multielectron excited states

    Energy Technology Data Exchange (ETDEWEB)

    Sundstrom, Eric J., E-mail: eric.jon.sundstrom@berkeley.edu; Head-Gordon, Martin [Department of Chemistry, University of California Berkeley, Berkeley, California 94720, USA and Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

    2014-03-21

    We apply Non-orthogonal Configuration Interaction (NOCI) to molecular systems where multielectron excitations, in this case double excitations, play a substantial role: the linear polyenes and β-carotene. We demonstrate that NOCI when applied to systems with extended conjugation, provides a qualitatively correct wavefunction at a fraction of the cost of many other multireference treatments. We also present a new extension to this method allowing for purification of higher-order spin states by utilizing Generalized Hartree-Fock Slater determinants and the details for computing 〈S{sup 2}〉 for the ground and excited states.

  7. Validating a mathematical model for inverse osmosis in an experimental flat membrane plant; Validacion de un modelo matematico para osmosis inversa con una planta piloto de membranas planas

    Energy Technology Data Exchange (ETDEWEB)

    Gomez Gotor, A.; Salama, B.; Argudo, C.

    1999-05-01

    The different theories regarding inverse osmosis have given rise to mathematical models. This article describes an experiment using the model developed by Slater et al. based on the solution-diffusion theory. A DOW DANMARK SEPARATION SYSTEMS OI LAB-UNIT M 20 was employed together with a pair of type HR 98 PP flat membranes also from DOW DANMARK A/S SEPARATION SYSTEMS. The solution used to study the operational variables was KCI. The findings in regard to volumetric flows and permeate concentrations conformed to the expected trends. The model`s constants were also determined and their predictive value verified. (Author) 9 refs.

  8. Quantum Monte Carlo calculations of van der Waals interactions between aromatic benzene rings

    Science.gov (United States)

    Azadi, Sam; Kühne, T. D.

    2018-05-01

    The magnitude of finite-size effects and Coulomb interactions in quantum Monte Carlo simulations of van der Waals interactions between weakly bonded benzene molecules are investigated. To that extent, two trial wave functions of the Slater-Jastrow and Backflow-Slater-Jastrow types are employed to calculate the energy-volume equation of state. We assess the impact of the backflow coordinate transformation on the nonlocal correlation energy. We found that the effect of finite-size errors in quantum Monte Carlo calculations on energy differences is particularly large and may even be more important than the employed trial wave function. In addition to the cohesive energy, the singlet excitonic energy gap and the energy gap renormalization of crystalline benzene at different densities are computed.

  9. Competition of multiplet and spin-orbit splitting in open-shells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Qian; Koch, Erik [Institute for Advanced Simulation, Forschungszentrum Juelich (Germany)

    2016-07-01

    To study the trends in the spectra of open-shells across the periodic table, we perform density functional calculations for atoms and ions. We collect the Slater-Condon and spin-orbit parameters from the resulting self-consistent radial wave functions and potentials. To make these easily accessible, we provide a simple least squares fitting formula in the spirit of Slater's rules. Given these parameters we calculate the many-body spectra in LS-, intermediate-, and jj-coupling. To assess the relative importance of Coulomb and spin-orbit interactions, we estimate the width of the spectra by calculating the eigen-energy variance of the corresponding Hamiltonian using a simple formula that does not require diagonalizing a complicated many-body Hamiltonian.

  10. First record of Ligia oceanica (Linnaeus, 1767) (Isopoda: Ligiidae) in the Canary Islands

    OpenAIRE

    Ramírez, Rubén; Riera, Rodrigo

    2013-01-01

    This study presents the first record of L. oceanica in the Canary Islands. Additionally, body features between L. oceanica and Ligia italica Fabricius, 1798, the other sea-slater inhabiting the Archipelago, were compared.

  11. Structure of the optimized effective Kohn-Sham exchange potential and its gradient approximations

    International Nuclear Information System (INIS)

    Gritsenko, O.; Van Leeuwen, R.; Baerends, E.J.

    1996-01-01

    An analysis of the structure of the optimized effective Kohn-Sham exchange potential v, and its gradient approximations is presented. The potential is decomposed into the Slater potential v s and the response of v s to density variations, v resp . The latter exhibits peaks that reflect the atomic shell structure. Kohn-Sham exchange potentials derived from current gradient approaches for the exchange energy are shown to be quite reasonable for the Slater potential, but they fail to approximate the response part, which leads to poor overall potentials. Improved potentials are constructed by a direct fit of v x with a gradient-dependent Pade approximant form. The potentials obtained possess proper asymptotic and scaling properties and reproduce the shell structure of the exact v x . 44 refs., 7 figs., 4 tabs

  12. A Hartree–Fock study of the confined helium atom: Local and global basis set approaches

    Energy Technology Data Exchange (ETDEWEB)

    Young, Toby D., E-mail: tyoung@ippt.pan.pl [Zakład Metod Komputerowych, Instytut Podstawowych Prolemów Techniki Polskiej Akademia Nauk, ul. Pawińskiego 5b, 02-106 Warszawa (Poland); Vargas, Rubicelia [Universidad Autónoma Metropolitana Iztapalapa, División de Ciencias Básicas e Ingenierías, Departamento de Química, San Rafael Atlixco 186, Col. Vicentina, Iztapalapa, D.F. C.P. 09340, México (Mexico); Garza, Jorge, E-mail: jgo@xanum.uam.mx [Universidad Autónoma Metropolitana Iztapalapa, División de Ciencias Básicas e Ingenierías, Departamento de Química, San Rafael Atlixco 186, Col. Vicentina, Iztapalapa, D.F. C.P. 09340, México (Mexico)

    2016-02-15

    Two different basis set methods are used to calculate atomic energy within Hartree–Fock theory. The first is a local basis set approach using high-order real-space finite elements and the second is a global basis set approach using modified Slater-type orbitals. These two approaches are applied to the confined helium atom and are compared by calculating one- and two-electron contributions to the total energy. As a measure of the quality of the electron density, the cusp condition is analyzed. - Highlights: • Two different basis set methods for atomic Hartree–Fock theory. • Galerkin finite element method and modified Slater-type orbitals. • Confined atom model (helium) under small-to-extreme confinement radii. • Detailed analysis of the electron wave-function and the cusp condition.

  13. Electron structure of molecules with very heavy atoms using effective core potentials

    International Nuclear Information System (INIS)

    Pitzer, K.S.

    1982-01-01

    Topics covered include effective potential, Hamiltonian for valence-electron motion, molecular calculations, spin-spin coupling, L-S coupling, numerical results of molecular calculations, and results of configuration-interaction Slater-orbital calculations in L-S coupling

  14. Tucker Tensor analysis of Matern functions in spatial statistics

    KAUST Repository

    Litvinenko, Alexander; Keyes, David E.; Khoromskaia, Venera; Khoromskij, Boris N.; Matthies, Hermann G.

    2018-01-01

    in a low-rank tensor format. We apply the Tucker and canonical tensor decompositions to a family of Matern- and Slater-type functions with varying parameters and demonstrate numerically that their approximations exhibit exponentially fast convergence

  15. Tunneling of self-trapped states and formation of a band

    International Nuclear Information System (INIS)

    Yonemitsu, K.

    1993-12-01

    Tunneling of a self-trapped kink and formation of a band are studied semi classically in the one-dimensional extended Peierls-Hubbard model near half filling, considering up to Gaussian fluctuations around imaginary-time-dependent periodic motion of electrons and phonons on the stationary phase of the action derived using Slater determinants. In the strong-coupling limit of both the Holstein and attractive Hubbard models, it reproduces analytically-known effective hopping of a single bipolaron because the tunneling involves only one in this limit. The method gives new results in other general cases and is easily applied to excited or more complex systems. 13 refs, 4 figs

  16. Exact pairing correlations in one-dimensional trapped fermions with stochastic mean-field wave-functions

    Energy Technology Data Exchange (ETDEWEB)

    Juillet, O.; Gulminelli, F. [Caen Univ., Lab. de Physique Corpusculaire (LPC/ENSICAEN), 14 (France); Chomaz, Ph. [Grand Accelerateur National d' Ions Lourds (GANIL), 14 - Caen (France)

    2003-11-01

    The canonical thermodynamic properties of a one-dimensional system of interacting spin-1/2 fermions with an attractive zero-range pseudo-potential are investigated within an exact approach. The density operator is evaluated as the statistical average of dyadics formed from a stochastic mean-field propagation of independent Slater determinants. For an harmonically trapped Fermi gas and for fermions confined in a 1D-like torus, we observe the transition to a quasi-BCS state with Cooper-like momentum correlations and an algebraic long-range order. For few trapped fermions in a rotating torus, a dominant superfluid component with quantized circulation can be isolated. (author)

  17. Experimental and theoretical Compton profiles of Be, C and Al

    Energy Technology Data Exchange (ETDEWEB)

    Aguiar, Julio C., E-mail: jaguiar@arn.gob.a [Autoridad Regulatoria Nuclear, Av. Del Libertador 8250, C1429BNP, Buenos Aires (Argentina); Instituto de Fisica ' Arroyo Seco' , Facultad de Ciencias Exactas, U.N.C.P.B.A., Pinto 399, 7000 Tandil (Argentina); Di Rocco, Hector O. [Instituto de Fisica ' Arroyo Seco' , Facultad de Ciencias Exactas, U.N.C.P.B.A., Pinto 399, 7000 Tandil (Argentina); Arazi, Andres [Laboratorio TANDAR, Comision Nacional de Energia Atomica, Av. General Paz 1499, 1650 San Martin, Buenos Aires (Argentina)

    2011-02-01

    The results of Compton profile measurements, Fermi momentum determinations, and theoretical values obtained from a linear combination of Slater-type orbital (STO) for core electrons in beryllium; carbon and aluminium are presented. In addition, a Thomas-Fermi model is used to estimate the contribution of valence electrons to the Compton profile. Measurements were performed using monoenergetic photons of 59.54 keV provided by a low-intensity Am-241 {gamma}-ray source. Scattered photons were detected at 90{sup o} from the beam direction using a p-type coaxial high-purity germanium detector (HPGe). The experimental results are in good agreement with theoretical calculations.

  18. Scaling analysis of the optimized effective potentials for the multiplet states of multivalent 3d ions

    International Nuclear Information System (INIS)

    Hamamoto, N; Satoko, C

    2006-01-01

    We apply the optimized effective potential method (OPM) to the multivalent 3d n (n = 2, ..., 8) ions; M ν+ (ν = 2, ..., 8). The total energy functional is approximated by the single-configuration Hartree-Fock. The exchange potential for the average energy configuration is decomposed into the potentials derived from F 2 (3d, 3d) and F 4 (3d, 3d) Slater integrals. To investigate properties of the density-functional potential, we have checked the scaling properties of several physical quantities such as the density, the 3d orbital and these potentials. We find that the potentials of the Slater integrals do not have the scaling property. Instead, the weighted potential V i (r) of an ion i, which is the potential of the Slater integrals times the 3d-orbital density, satisfies the scaling property q 3d i V i (r) ∼ q 3d j λ 4 V j (λr) where q i 3d is the occupation number of the 3d-orbital R 3d (r) for ion i. Furthermore, the weighted potential can be approximated by the ion-independent functional of the 3d-orbital density c k R 8/3 3d (r)/q 3d where c 2 = 0.366 and c 4 0.223. This suggests that the weighted potential can be expressed as a functional of the 3d-orbital density

  19. Theoretical study of relativistic effects in the electronic structure and chemical bonding of UF6

    International Nuclear Information System (INIS)

    Onoe, Jun; Takeuchi, Kazuo; Sekine, Rika; Nakamatsu, Hirohide; Mukoyama, Takeshi; Adachi, Hirohiko.

    1992-01-01

    We have performed the relativistic molecular orbital calculation for the ground state of UF 6 , using the discrete-variational Dirac-Slater method (DV-DS), in order to elucidate the relativistic effects in the electronic structure and chemical bonding. Compared with the electronic structure calculated by the non-relativistic Hartree-Fock-Slater (DV-X α )MO method, not only the direct relativistic effects (spin-orbit splitting etc), but also the indirect effect due to the change in screening core potential charge are shown to be important in the MO level structure. From the U-F bond overlap population analysis, we found that the U-F bond formation can be explained only by the DV-DS, not by the DV-X α . The calculated electronic structure in valence energy region (-20-OeV) and excitation energies in UV region are in agreement with experiments. (author)

  20. The configuration-driven table CI method and comparison with integral-driven CI procedures

    International Nuclear Information System (INIS)

    Buenker, R.J.

    1980-01-01

    A new configuration-driven CI algorithm is outlined which eliminates the need for explicit comparison of pairs of Slater determinants through the use of a series of compact tables. In this scheme each pair of configurations is either shown to be non-interacting or to fall into one of nine cases, each of which is characterized fully once certain orbital permutations are determined. The program is divided into three parts: a case structure analysis step including integral label generation, a sort of the required electron repulsion integrals, and finally a procedure in which the foregoing information is combined with tabulated directions for the evaluation of the necessary Hamiltonian matrix elements over spin-adapted functions. Timing improvements of up to more than a factor of four have been achieved with the new algorithm

  1. Inner-shell corrections to the Bethe stopping-power formula evaluated from a realistic atomic model

    International Nuclear Information System (INIS)

    Inokuti, M.; Manson, S.T.

    1985-01-01

    Generalized oscillator strengths for K- and L-shell ionization have been calculated using a central potential derived from the Hartree-Slater model. In cases in which an ejected electron carries low kinetic energies, sizable differences with hydrogenic-model calculations are evident

  2. What a Decade of Experiments Reveals about Factors that Influence the Sense of Presence: Latest Findings

    Science.gov (United States)

    2007-05-01

    Paper presented at VII Encontro Portugues de Computacao Grafica, Eurographics, Monte de Caparica, Portugal, February. Slater, M., Usoh, M., and Steed...window? An experimental comparison of immersive and non-immersive walkthroughs. Paper presented at VII Encontro Portugues de Computacao Grafica

  3. Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

    Science.gov (United States)

    Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

    2015-01-13

    Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

  4. Equations-of-motion approach to a quantum theory of large-amplitude collective motion

    International Nuclear Information System (INIS)

    Klein, A.

    1984-01-01

    The equations-of-motion approach to large-amplitude collective motion is implemented both for systems of coupled bosons, also studied in a previous paper, and for systems of coupled fermions. For the fermion case, the underlying formulation is that provided by the generalized Hartree-Fock approximation (or generalized density matrix method). To obtain results valid in the semi-classical limit, as in most previous work, we compute the Wigner transform of quantum matrices in the representation in which collective coordinates are diagonal and keep only the leading contributions. Higher-order contributions can be retained, however, and, in any case, there is no ambiguity of requantization. The semi-classical limit is seen to comprise the dynamics of time-dependent Hartree-Fock theory (TDHF) and a classical canonicity condition. By utilizing a well-known parametrization of the manifold of Slater determinants in terms of classical canonical variables, we are able to derive and understand the equations of the adiabatic limit in full parallelism with the boson case. As in the previous paper, we can thus show: (i) to zero and first order in the adiabatic limit the physics is contained in Villar's equations; (ii) to second order there is consistency and no new conditions. The structure of the solution space (discussed thoroughly in the previous paper) is summarized. A discussion of associated variational principles is given. A form of the theory equivalent to self-consistent cranking is described. A method of solution is illustrated by working out several elementary examples. The relationship to previsous work, especially that of Zelevinsky and Marumori and coworkers is discussed briefly. Three appendices deal respectively with the equations-of-motion method, with useful properties of Slater determinants, and with some technical details associated with the fermion equations of motion. (orig.)

  5. Alternative basis for the theory of complex spectra II

    International Nuclear Information System (INIS)

    Harter, W.G.; Patterson, C.W.

    1975-01-01

    The atomic angular factor calculation methods are simplified and extended to include a treatment of spin-orbit operators and multiple shell configurations (II'...) sup(n). A tableau formula is given for the matrix between slater states and states of definite total spin

  6. Magnetic properties and phase stability of half-metal-type Co2Cr1-xFexGa alloys

    International Nuclear Information System (INIS)

    Kobayashi, K.; Umetsu, R.Y.; Fujita, A.; Oikawa, K.; Kainuma, R.; Fukamichi, K.; Ishida, K.

    2005-01-01

    The magnetic properties and phase stability of half-metal-type Co 2 Cr 1-x Fe x Ga alloys were investigated by differential scanning calorimetry (DSC), in a superconducting quantum interference device (SQUID) magnetometer and in a vibrating sample magnetometer (VSM), and by transmission electron microscopy (TEM). It was found that the L2 1 -type single-phase is obtainable for the entire concentration of x and that the value of the saturation magnetic moment M s at 4.2K in the lower composition range of x is in agreement with the generalized Slater-Pauling line, while it is rather larger than the generalized Slater-Pauling line above x=0.6. The Curie temperature T c monotonically increases, whereas the transition temperature from the L2 1 - to B2-type phase T t B2/L2 1 is almost constant at 1082+/-13K with increasing x

  7. Modeling of full-Heusler alloys within tight-binding approximation: Case study of Fe2MnAl

    Science.gov (United States)

    Azhar, A.; Majidi, M. A.; Nanto, D.

    2017-07-01

    Heusler alloys have been known for about a century, and predictions of magnetic moment values using Slater-Pauling rule have been successful for many such materials. However, such a simple counting rule has been found not to always work for all Heusler alloys. For instance, Fe2CuAl has been found to have magnetic moment of 3.30 µB per formula unit although the Slater-Pauling rule suggests the value of 2 µB. On the other hand, a recent experiment shows that a non-stoichiometric Heusler compound Fe2Mn0.5Cu0.5Al possesses magnetic moment of 4 µB, closer to the Slater-Pauling prediction for the stoichiometric compound. Such discrepancies signify that the theory to predict the magnetic moment of Heusler alloys in general is still far from being complete. Motivated by this issue, we propose to do a theoretical study on a full-Heusler alloy Fe2MnAl to understand the formation of magnetic moment microscopically. We model the system by constructing a density-functional-theory-based tight-binding Hamiltonian and incorporating Hubbard repulsive as well as spin-spin interactions for the electrons occupying the d-orbitals. Then, we solve the model using Green's function approach, and treat the interaction terms within the mean-field approximation. At this stage, we aim to formulate the computational algorithm for the overall calculation process. Our final goal is to compute the total magnetic moment per unit cell of this system and compare it with the experimental data.

  8. Exact results for the spectra of bosons and fermions with contact interaction

    Energy Technology Data Exchange (ETDEWEB)

    Mashkevich, Stefan [Schroedinger, 120 West 45th St., New York, NY 10036 (United States)]. E-mail: mash@mashke.org; Matveenko, Sergey [Landau Institute for Theoretical Physics, Kosygina Str. 2, 119334 Moscow (Russian Federation)]. E-mail: matveen@landau.ac.ru; Ouvry, Stephane [Laboratoire de Physique Theorique et Modeles Statistiques, Unite de Recherche de l' Universite Paris 11 associee au CNRS, UMR 8626., Bat. 100, Universite Paris-Sud, 91405 Orsay (France)]. E-mail: ouvry@lptms.u-psud.fr

    2007-02-19

    An N-body bosonic model with delta-contact interactions projected on the lowest Landau level is considered. For a given number of particles in a given angular momentum sector, any energy level can be obtained exactly by means of diagonalizing a finite matrix: they are roots of algebraic equations. A complete solution of the three-body problem is presented, some general properties of the N-body spectrum are pointed out, and a number of novel exact analytic eigenstates are obtained. The FQHE N-fermion model with Laplacian-delta interactions is also considered along the same lines of analysis. New exact eigenstates are proposed, along with the Slater determinant, whose eigenvalues are shown to be related to Catalan numbers.

  9. Fragmentation properties of 6Li

    International Nuclear Information System (INIS)

    Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

    1987-01-01

    The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

  10. Shapes of nuclear configurations in a cranked harmonic oscillator model

    International Nuclear Information System (INIS)

    Troudet, T.; Arvieu, R.

    1980-05-01

    The shapes of nuclear configurations are calculated using Slater determinants built with cranked harmonic oscillator single particle states. The nuclear forces role is played by a volume conservation condition (of the potential or of the density) in a first part. In a second part, we have used the finite range, density dependent interaction of Cogny. A very simple classification of configurations emerges in the first part, the relevant parameter being the equatorial eccentricity of the nuclear density. A critical equatorial eccentricity is obtained which governs the accession to the case for which the nucleus is oblate and symmetric around its axis of rotation. Nuclear configurations calculated in the second part observe remarkably well these behaviors

  11. Treatment outcome of immediate, early and conventional single-tooth implants in the aesthetic zone : a systematic review to survival, bone level, soft-tissue, aesthetics and patient satisfaction

    NARCIS (Netherlands)

    den Hartog, Laurens; Huddleston Slater, James J. R.; Vissink, Arjan; Meijer, Henny J. A.; Raghoebar, Gerry M.

    2008-01-01

    den Hartog L, Huddleston Slater JJR, Vissink A, Meijer HJA, Raghoebar GM. Treatment outcome of immediate, early and conventional single-tooth implants in the aesthetic zone: a systematic review to survival, bone level, soft-tissue, aesthetics and patient satisfaction. J Clin Periodontol 2008; 35:

  12. 76 FR 34964 - Stainless Steel Bar From India: Partial Rescission of Antidumping Duty Administrative Review

    Science.gov (United States)

    2011-06-15

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-533-810] Stainless Steel Bar From... the antidumping duty order on stainless steel bar from India for the period of review February 1, 2010....; Outokumpu Stainless Bar, Inc.; Universal Stainless & Alloy Products, Inc.; and Valbruna Slater Stainless...

  13. Origins of a Stereotype: Categorization of Facial Attractiveness by 6-Month-Old Infants

    Science.gov (United States)

    Ramsey, Jennifer L.; Langlois, Judith H.; Hoss, Rebecca A.; Rubenstein, Adam J.; Griffin, Angela M.

    2004-01-01

    Like adults, young infants prefer attractive to unattractive faces (e.g. Langlois, Roggman, Casey, Ritter, Rieser-Danner & Jenkins, 1987; Slater, von der Schulenburg, Brown, Badenoch, Butterworth, Parsons & Samuels, 1998). Older children and adults stereotype based on facial attractiveness (Eagly, Ashmore, Makhijani & Longo, 1991; Langlois,…

  14. 4-center STO interelectron repulsion integrals with Coulomb Sturmians

    DEFF Research Database (Denmark)

    Avery, James Emil; Avery, John Scales

    2018-01-01

    Abstract We present a method for evaluating 4-center electron repulsion integrals (ERI) for Slater-type orbitals by way of expansions in terms of Coulomb Sturmians. The ERIs can then be evaluated using our previously published methods for rapid evaluation of Coulomb Sturmians through hyperspherical...

  15. Use of combined Hartree–Fock–Roothaan theory in evaluation of ...

    Indian Academy of Sciences (India)

    Keywords. Hartree–Fock–Roothaan equations; noninteger -Slater type orbitals; open shell theory; isoelectronic series. ... with those presented in the literature. The results can be useful in the study of various properties of heavy atomic systems when the combined Hartree–Fock–Roothaan approach is employed.

  16. Ab initio calculation atomics ground state wave function for interactions Ion- Atom

    International Nuclear Information System (INIS)

    Shojaee, F.; Bolori zadeh, M. A.

    2007-01-01

    Ab initio calculation atomics ground state wave function for interactions Ion- Atom Atomic wave function expressed in a Slater - type basis obtained within Roothaan- Hartree - Fock for the ground state of the atoms He through B. The total energy is given for each atom.

  17. African Journal of Drug & Alcohol Studies, 15(1), 2016 Copyright ...

    African Journals Online (AJOL)

    Substance use is rising among young people in developing countries, especially in schools and ... verse health problems (Xie, Rehm, Single, ... use such as parental substance use, (Clark ... (Slater, 2003) poor social and emotional ... likely negative consequences of indulging ... early conduct and predisposes an indi-.

  18. Pseudo q -Engel expansions and Rogers-Ramanujan type identities ...

    African Journals Online (AJOL)

    Abstract. Andrews, Knopfmacher and Knopfmacher have used the Schur polynomials to consider the celebrated Rogers-Ramanujan identities in the context of q-Engel expansions. We extend this view using similar polynomials, provided by Sills, in the context of Slater's list of 130 Rogers-Ramanujan type identities.

  19. Engaging bodies and places online

    DEFF Research Database (Denmark)

    Jordt Jørgensen, Nanna; Rehder, Mads Middelboe

    In this paper, we suggest that embodied learning forms the backdrop for young people’s digitally mediated practices. In line with the early studies of Miller & Slater, we approach online engagements as ‘continuous with and embedded in other social spaces’, happening ‘within mundane social...

  20. Lattice Dynamics of Beryllium from a First-Principles Nonlocal Pseudopotential Approach

    DEFF Research Database (Denmark)

    Walter, F. King; Cutler, P. H.

    1970-01-01

    dielectric-screening function employing the Kohn-Sham approximation for exchange among the conduction electrons. The energy-wave-number characteristic F(q) is constructed from the Hartree-Fock-Slater (HFS) wave function for Be++; this is used to calculate the phonon dispersion relations in the [0001], [011̅...

  1. L1 and L2 sub-shell fluorescence yields for elements with 64 ≤ Z ≤ 70

    International Nuclear Information System (INIS)

    Kumar, Anil; Puri, Sanjiv

    2010-01-01

    The L 1 and L 2 sub-shell fluorescence yields have been deduced for elements with 64 ≤ Z ≤ 70 from the L k (k = l, α, β 1,4 , β 3,6 , β 2,15,9,10,7 , γ 1,5 and γ 2,3,4 ) X-ray production cross sections measured at 22.6 keV incident photon energy using a spectrometer involving a disc type radioisotope of Cd 109 as a photon source and a Peltier cooled X-ray detector. The incident photon intensity, detector efficiency and geometrical factor have been determined from the K X-ray yields emitted from elemental targets with 20 ≤ Z ≤ 42 in the same geometrical setup and from knowledge of the K shell cross sections. The present deduced ω 1 (exp) values, for elements with 64 ≤ Z ≤ 70, are found to be in good agreement with those tabulated by Campbell (J.L. Campbell, Atom. Data Nucl. Data Tables 95 (2009) 115), where as these are, on an average, higher by 19% and 24% than those based on the Dirac-Hartree-Slater model (S. Puri et al., X-ray Spectrometry 22 (1993) 358) and the semi-empirical values compiled by Krause (M.O. Krause, J. Phys. Chem. Ref. Data 8 (1979) 307), respectively. The present deduced ω 2 (exp) values are found to be in good agreement with those based on the Dirac-Hartree-Slater model and are higher by up to ∼13% than the semi-empirical values for the elements under investigation.

  2. L 1 and L 2 sub-shell fluorescence yields for elements with 64 ⩽ Z ⩽ 70

    Science.gov (United States)

    Kumar, Anil; Puri, Sanjiv

    2010-05-01

    The L 1 and L 2 sub-shell fluorescence yields have been deduced for elements with 64 ⩽ Z ⩽ 70 from the L k( k = l, α, β1,4, β3,6, β2,15,9,10,7, γ1,5 and γ2,3,4) X-ray production cross sections measured at 22.6 keV incident photon energy using a spectrometer involving a disc type radioisotope of Cd 109 as a photon source and a Peltier cooled X-ray detector. The incident photon intensity, detector efficiency and geometrical factor have been determined from the K X-ray yields emitted from elemental targets with 20 ⩽ Z ⩽ 42 in the same geometrical setup and from knowledge of the K shell cross sections. The present deduced ω1(exp) values, for elements with 64 ⩽ Z ⩽ 70, are found to be in good agreement with those tabulated by Campbell (J.L. Campbell, Atom. Data Nucl. Data Tables 95 (2009) 115), where as these are, on an average, higher by 19% and 24% than those based on the Dirac-Hartree-Slater model (S. Puri et al., X-ray Spectrometry 22 (1993) 358) and the semi-empirical values compiled by Krause (M.O. Krause, J. Phys. Chem. Ref. Data 8 (1979) 307), respectively. The present deduced ω2(exp) values are found to be in good agreement with those based on the Dirac-Hartree-Slater model and are higher by up to ˜13% than the semi-empirical values for the elements under investigation.

  3. Structure and properties of quarternary and tetragonal Heusler compounds for spintronics and spin transver torque applications

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Vajiheh Alijani

    2012-03-07

    This work is divided into two parts: part 1 is focused on the prediction of half-metallicity in quaternary Heusler compounds and their potential for spintronic applications and part 2 on the structural properties of Mn{sub 2}-based Heusler alloys and tuning the magnetism of them from soft to hard-magnetic for spin-transfer torque applications. In part 1, three different series of quaternary Heusler compounds are investigated, XX'MnGa (X=Cu, Ni and X'=Fe,Co), CoFeMnZ (Z=Al,Ga,Si,Ge), and Co{sub 2-x}Rh{sub x}MnZ (Z=Ga,Sn,Sb). All of these quaternary compounds except CuCoMnGa are predicted to be half-metallic ferromagnets by ab-initio electronic structure calculations. In the XX'MnGa class of compounds, NiFeMnGa has a low Curie temperature for technological applications but NiCoMnGa with a high spin polarization, magnetic moment, and Curie temperature is an interesting new material for spintronics applications. All CoFeMnZ compounds exhibit a cubic Heusler structur and their magnetic moments are in fair agreement with the Slater-Pauling rule indicating the halfmetallicity and high spin polarization required for spintronics applications. Their high Curie temperatures make them suitable for utilization at room temperature and above. The structural investigation revealed that the crystal structure of all Co{sub 2-x}Rh{sub x}MnZ compounds aside from CoRhMnSn exhibit different types of anti-site disorder. The magnetic moments of the disordered compounds deviate from the Slater-Pauling rule indicating that 100% spin polarization are not realized in CoRhMnGa, CoRhMnSb, and Co{sub 0.5}Rh{sub 1.5}MnSb. Exchange of one Co in Co{sub 2}MnSn by Rh results in the stable, well-ordered compound CoRhMnSn. This exchange of one of the magnetic Co atoms by a non-magnetic Rh atom keeps the magnetic properties and half-metallicity intact. In part 2, two series of Mn{sub 2}-based Heusler alloys are investigated, Mn{sub 3-x}Co{sub x}Ga and Mn{sub 2-x}Rh{sub 1+x}Sn. It has been

  4. A pair density functional theory utilizing the correlated wave function

    International Nuclear Information System (INIS)

    Higuchi, M; Higuchi, K

    2009-01-01

    We propose a practical scheme for calculating the ground-state pair density (PD) by utilizing the correlated wave function. As the correlated wave function, we adopt a linear combination of the single Slater determinants that are constructed from the solutions of the initial scheme [Higuchi M and Higuchi K 2007 Physica B 387, 117]. The single-particle equation is derived by performing the variational principle within the set of PDs that are constructed from such correlated wave functions. Since the search region of the PD is substantially extended as compared with the initial scheme, it is expected that the present scheme can cover more correlation effects. The single-particle equation is practical, and may be easily applied to actual calculations.

  5. Computation of Ground-State Properties in Molecular Systems: Back-Propagation with Auxiliary-Field Quantum Monte Carlo.

    Science.gov (United States)

    Motta, Mario; Zhang, Shiwei

    2017-11-14

    We address the computation of ground-state properties of chemical systems and realistic materials within the auxiliary-field quantum Monte Carlo method. The phase constraint to control the Fermion phase problem requires the random walks in Slater determinant space to be open-ended with branching. This in turn makes it necessary to use back-propagation (BP) to compute averages and correlation functions of operators that do not commute with the Hamiltonian. Several BP schemes are investigated, and their optimization with respect to the phaseless constraint is considered. We propose a modified BP method for the computation of observables in electronic systems, discuss its numerical stability and computational complexity, and assess its performance by computing ground-state properties in several molecular systems, including small organic molecules.

  6. Self-consistent calculation of atomic structure for mixture

    International Nuclear Information System (INIS)

    Meng Xujun; Bai Yun; Sun Yongsheng; Zhang Jinglin; Zong Xiaoping

    2000-01-01

    Based on relativistic Hartree-Fock-Slater self-consistent average atomic model, atomic structure for mixture is studied by summing up component volumes in mixture. Algorithmic procedure for solving both the group of Thomas-Fermi equations and the self-consistent atomic structure is presented in detail, and, some numerical results are discussed

  7. ANALYTIC FITS FOR PARTIAL PHOTOIONIZATION CROSS-SECTIONS

    NARCIS (Netherlands)

    VERNER, DA; YAKOVLEV, DG

    We present a compact, uniform and complete set of analytic fits to the partial Hartree-Dirac-Slater photoionization cross sections for the ground state shells of all atoms and ions of elements from H to Zn (Z less-than-or-equal-to 30). Comparison with experiment and theory demonstrates generally

  8. Come on Higher Ed...Get with the Programme! A Study of Market Orientation in International Student Recruitment

    Science.gov (United States)

    Ross, Mitchell; Grace, Debra; Shao, Wei

    2013-01-01

    This paper investigates higher education (HE) student recruitment practices from the standpoint of market orientation. By adopting the well-established market orientation framework of Narver and Slater [1990, The effect of a market orientation on a business profitability. "Journal of Marketing" 54, no. 4: 20-35], we examine the extent to…

  9. DMPD: Signalling pathways mediating type I interferon gene expression. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17904888 Signalling pathways mediating type I interferon gene expression. Edwards M...hways mediating type I interferon gene expression. PubmedID 17904888 Title Signalling pathways...R, Slater L, Johnston SL. Microbes Infect. 2007 Sep;9(11):1245-51. Epub 2007 Jul 1. (.png) (.svg) (.html) (.csml) Show Signalling pat

  10. Using the Screened Coulomb Potential to Illustrate the Variational Method

    Science.gov (United States)

    Zuniga, Jose; Bastida, Adolfo; Requena, Alberto

    2012-01-01

    The screened Coulomb potential, or Yukawa potential, is used to illustrate the application of the single and linear variational methods. The trial variational functions are expressed in terms of Slater-type functions, for which the integrals needed to carry out the variational calculations are easily evaluated in closed form. The variational…

  11. Optimization of parameters for the extended Hueckel method starting from ab-initio atomic calculations

    International Nuclear Information System (INIS)

    Branda, M.M.; Ferullo, R.; Castellani, N.J.

    1990-01-01

    The application of an atomic Hartree-Fock-Slater method is exposed in the present work for the simultaneous obtainment of all parameters used in the extended Hueckel method with charge interaction (IEH): The diagonal elements of the Hamiltonian, the constants of the quadratic relation between. (Author). 16 refs., 3 tabs

  12. Parallel knock-out schemes in networks

    NARCIS (Netherlands)

    Broersma, H.J.; Fomin, F.V.; Woeginger, G.J.

    2004-01-01

    We consider parallel knock-out schemes, a procedure on graphs introduced by Lampert and Slater in 1997 in which each vertex eliminates exactly one of its neighbors in each round. We are considering cases in which after a finite number of rounds, where the minimimum number is called the parallel

  13. Eliminating graphs by means of parallel knock-out schemes

    NARCIS (Netherlands)

    Broersma, H.J.; Fomin, F.V.; Královic, R.; Woeginger, G.J.

    2007-01-01

    In 1997 Lampert and Slater introduced parallel knock-out schemes, an iterative process on graphs that goes through several rounds. In each round of this process, every vertex eliminates exactly one of its neighbors. The parallel knock-out number of a graph is the minimum number of rounds after which

  14. Eliminating graphs by means of parallel knock-out schemes

    NARCIS (Netherlands)

    Broersma, Haitze J.; Fomin, F.V.; Královič, R.; Woeginger, Gerhard

    In 1997 Lampert and Slater introduced parallel knock-out schemes, an iterative process on graphs that goes through several rounds. In each round of this process, every vertex eliminates exactly one of its neighbors. The parallel knock-out number of a graph is the minimum number of rounds after which

  15. Threshold Corrosion Fatigue of Welded Shipbuilding Steels.

    Science.gov (United States)

    1992-01-01

    8. J. C. Walter, E. Olbjorn, 0. Allstad and G. Elde, "Safety Against Corrosion Fatigue Offshore," Publication No. 94, Det Norske Ventas , Horik...Offshore. Publication No;. 94;, Det Norske Ventas , Horik, Norway, April 1976. 18. C. E. Jaske, D. Broek, J. E. Slater, W. E. Anderson. Corrosion Fatigue

  16. Extension of the Kohn-Sham formulation of density functional theory to finite temperature

    Science.gov (United States)

    Gonis, A.; Däne, M.

    2018-05-01

    Based on Mermin's extension of the Hohenberg and Kohn theorems to non-zero temperature, the Kohn-Sham formulation of density functional theory (KS-DFT) is generalized to finite temperature. We show that present formulations are inconsistent with Mermin's functional containing expressions, in particular describing the Coulomb energy, that defy derivation and are even in violation of rules of logical inference. More; current methodology is in violation of fundamental laws of both quantum and classical mechanics. Based on this feature, we demonstrate the impossibility of extending the KS formalism to finite temperature through the self-consistent solutions of the single-particle Schrödinger equation of T > 0. Guided by the form of Mermin's functional that depends on the eigenstates of a Hamiltonian, determined at T = 0, we base our extension of KS-DFT on the determination of the excited states of a non-interacting system at the zero of temperature. The resulting formulation is consistent with that of Mermin constructing the free energy at T > 0 in terms of the excited states of a non-interacting Hamiltonian (system) that, within the KS formalism, are described by Slater determinants. To determine the excited states at T = 0 use is made of the extension of the Hohenberg and Kohn theorems to excited states presented in previous work applied here to a non-interacting collection of replicas of a non-interacting N-particle system, whose ground state density is taken to match that of K non-interacting replicas of an interacting N-particle system at T = 0 . The formalism allows for an ever denser population of the excitation spectrum of a Hamiltonian, within the KS approximation. The form of the auxiliary potential, (Kohn-Sham potential), is formally identical to that in the ground state formalism with the contribution of the Coulomb energy provided by the derivative of the Coulomb energy in all excited states taken into account. Once the excited states are determined, the

  17. Calculation of two-center one-electron molecular integrals with STOs. [BICEN

    Energy Technology Data Exchange (ETDEWEB)

    Rico, J.F.; Lopez, R.; Paniagua, M.; Ramirez, G. (Universidad Autonoma de Madrid (Spain). Dept. de Quimica Fisica y Quimica Cuantica)

    1991-05-01

    A program for the calculation of two-center one-electron integrals (overlap, nuclear attraction and kinetic energy) between real Slater-type orbitals (STOs) is reported. The integrals are obtained by recursion over simple auxiliary matrices, whose elements are calculated in terms of further auxiliary functions evaluated in a quick and accurate way. (orig.).

  18. Calculation of two-center one-electron molecular integrals with STOs

    International Nuclear Information System (INIS)

    Rico, J.F.; Lopez, R.; Paniagua, M.; Ramirez, G.

    1991-01-01

    A program for the calculation of two-center one-electron integrals (overlap, nuclear attraction and kinetic energy) between real Slater-type orbitals (STOs) is reported. The integrals are obtained by recursion over simple auxiliary matrices, whose elements are calculated in terms of further auxiliary functions evaluated in a quick and accurate way. (orig.)

  19. Renovated Parks Improve Physical Activity

    Centers for Disease Control (CDC) Podcasts

    We know that children who are physically active every day are less likely to develop chronic diseases as adults, including obesity. Dr. Sandy Slater, a researcher with the University of Illinois, Chicago Prevention Research Center, discusses how a park improvement project in Chicago helped engage communities to improve areas for play and activity.

  20. The determination of the Dirac density matrix of the d-dimensional harmonic oscillator for an arbitrary number of closed shells

    International Nuclear Information System (INIS)

    Howard, I.A.; March, N.H.; Nieto, L.M.

    2002-01-01

    In 1959, March and Young (Nucl. Phys. 12 237) rewrote the equation of motion for the Dirac density matrix γ(x, x 0 ) in terms of sum and difference variables. Here, γ(r-bar, r-bar 0 ) for the d-dimensional isotropic harmonic oscillator for an arbitrary number of closed shells is shown to satisfy, using the variables vertical bar r-bar + r-bar 0 vertical bar/2 and vertical bar r-bar - r-bar 0 vertical bar/2, a generalized partial differential equation embracing the March-Young equation for d=1. As applications, we take in turn the cases d=1, 2, 3 and 4, and obtain both the density matrix γ (r-bar, r-bar 0 ) and the diagonal density ρ(r)=γ(r-bar, r-bar 0 ) vertical bar r-bar 0 =r-bar, this diagonal element already being known to satisfy a third-order linear homogeneous differential equation for d=1 through 3. Some comments are finally made on the d-dimensional kinetic energy density, which is important for first-principles density functional theory in allowing one to bypass one-particle Schroedinger equations (the so-called Slater-Kohn-Sham equations). (author)

  1. Semiclassical statistical mechanics of fluids

    International Nuclear Information System (INIS)

    Singh, Y.; Sinha, S.K.

    1981-01-01

    The problem of calculating the equilibrium properties of fluids in the semiclassical limit when the quantum effects are small is studied. Particle distribution functions and thermodynamic quantities are defined in terms of the Slater sum and methods for evaluating the Slater sum are discussed. It is shown that the expansion method employing the usual Wigner-Kirkwood or Hemmer-Jancovici series is not suitable to treat the properties of the condensed state. Using the grand canonical ensemble and functional differentiation technique we develop cluster expansion series of the Helmholtz free energy and pair correlation functions. Using topological reduction we transform these series to more compact form involving a renormalized potential or a renormalized Mayer function. Then the convergence of the two series is improved by an optimal choice of the renormalized potential or the Mayer function. Integral equation theories are derived and used to devise perturbation methods. An application of these methods to the calculation of the virial coefficients, thermodynamic properties and the pair correlation function for model fluids is discussed. (orig.)

  2. Constraint, Intelligence, and Control Hierarchy in Virtual Environments. Chapter 1

    Science.gov (United States)

    Sheridan, Thomas B.

    2007-01-01

    This paper seeks to deal directly with the question of what makes virtual actors and objects that are experienced in virtual environments seem real. (The term virtual reality, while more common in public usage, is an oxymoron; therefore virtual environment is the preferred term in this paper). Reality is difficult topic, treated for centuries in those sub-fields of philosophy called ontology- "of or relating to being or existence" and epistemology- "the study of the method and grounds of knowledge, especially with reference to its limits and validity" (both from Webster s, 1965). Advances in recent decades in the technologies of computers, sensors and graphics software have permitted human users to feel present or experience immersion in computer-generated virtual environments. This has motivated a keen interest in probing this phenomenon of presence and immersion not only philosophically but also psychologically and physiologically in terms of the parameters of the senses and sensory stimulation that correlate with the experience (Ellis, 1991). The pages of the journal Presence: Teleoperators and Virtual Environments have seen much discussion of what makes virtual environments seem real (see, e.g., Slater, 1999; Slater et al. 1994; Sheridan, 1992, 2000). Stephen Ellis, when organizing the meeting that motivated this paper, suggested to invited authors that "We may adopt as an organizing principle for the meeting that the genesis of apparently intelligent interaction arises from an upwelling of constraints determined by a hierarchy of lower levels of behavioral interaction. "My first reaction was "huh?" and my second was "yeah, that seems to make sense." Accordingly the paper seeks to explain from the author s viewpoint, why Ellis s hypothesis makes sense. What is the connection of "presence" or "immersion" of an observer in a virtual environment, to "constraints" and what types of constraints. What of "intelligent interaction," and is it the intelligence of the

  3. Configuration interaction wave functions: A seniority number approach

    International Nuclear Information System (INIS)

    Alcoba, Diego R.; Torre, Alicia; Lain, Luis; Massaccesi, Gustavo E.; Oña, Ofelia B.

    2014-01-01

    This work deals with the configuration interaction method when an N-electron Hamiltonian is projected on Slater determinants which are classified according to their seniority number values. We study the spin features of the wave functions and the size of the matrices required to formulate states of any spin symmetry within this treatment. Correlation energies associated with the wave functions arising from the seniority-based configuration interaction procedure are determined for three types of molecular orbital basis: canonical molecular orbitals, natural orbitals, and the orbitals resulting from minimizing the expectation value of the N-electron seniority number operator. The performance of these bases is analyzed by means of numerical results obtained from selected N-electron systems of several spin symmetries. The comparison of the results highlights the efficiency of the molecular orbital basis which minimizes the mean value of the seniority number for a state, yielding energy values closer to those provided by the full configuration interaction procedure

  4. Stiffness-constant variation in nickel-based alloys: Experiment and theory

    International Nuclear Information System (INIS)

    Hennion, M.; Hennion, B.

    1979-01-01

    Recent measurements of the spin-wave stiffness constant in several nickel alloys at various concentrations are interpreted within a random-phase approximation, coherent-potential approximation (RPA-CPA) band model which uses the Hartree-Fock approximation to treat the intraatomic correlations. We give a theoretical description of the possible impurity states in the Hartree-Fock approximation. This allows the determination of the Hartree-Fock solutions which can account for the stiffness-constant behavior and the magnetic moment on the impurity for all the investigated alloys. For alloys such as NiCr, NiV, NiMo, and NiRu, the magnetizations of which deviate from the Slater-Pauling curve, our determination does not correspond to previous works and is consequently discussed. The limits of the model appear mainly due to local-environment effects; in the case of NiMn, it is found that a ternary-alloy model with some Mn atoms in the antiferromagnetic state can account for both stiffness-constant and magnetization behaviors

  5. Configuration interaction wave functions: A seniority number approach

    Energy Technology Data Exchange (ETDEWEB)

    Alcoba, Diego R. [Departamento de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and Instituto de Física de Buenos Aires, Consejo Nacional de Investigaciones Científicas y Técnicas, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Torre, Alicia; Lain, Luis, E-mail: qfplapel@lg.ehu.es [Departamento de Química Física, Facultad de Ciencia y Tecnología, Universidad del País Vasco, Apdo. 644, E-48080 Bilbao (Spain); Massaccesi, Gustavo E. [Departamento de Ciencias Exactas, Ciclo Básico Común, Universidad de Buenos Aires, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Oña, Ofelia B. [Instituto de Investigaciones Fisicoquímicas Teóricas y Aplicadas, Universidad Nacional de La Plata, CCT La Plata, Consejo Nacional de Investigaciones Científicas y Técnicas, Diag. 113 y 64 (S/N), Sucursal 4, CC 16, 1900 La Plata (Argentina)

    2014-06-21

    This work deals with the configuration interaction method when an N-electron Hamiltonian is projected on Slater determinants which are classified according to their seniority number values. We study the spin features of the wave functions and the size of the matrices required to formulate states of any spin symmetry within this treatment. Correlation energies associated with the wave functions arising from the seniority-based configuration interaction procedure are determined for three types of molecular orbital basis: canonical molecular orbitals, natural orbitals, and the orbitals resulting from minimizing the expectation value of the N-electron seniority number operator. The performance of these bases is analyzed by means of numerical results obtained from selected N-electron systems of several spin symmetries. The comparison of the results highlights the efficiency of the molecular orbital basis which minimizes the mean value of the seniority number for a state, yielding energy values closer to those provided by the full configuration interaction procedure.

  6. Jazz Leader Helps a Band Take Giant Steps

    Science.gov (United States)

    Kelderman, Eric

    2008-01-01

    This article profiles Neil Slater, the longtime leader of the jazz program at the University of North Texas who encouraged both musical perfection and artistic freedom among his star pupils. Standards are high at North Texas, which has become a Camelot where aspiring jazz musicians have come to hone their skills since 1947, when it offered one of…

  7. A note on neighborhood total domination in graphs

    Indian Academy of Sciences (India)

    [1] Arumugam S and Sivagnanam C, Neighborhood total domination in graphs, Opuscula. Mathematica 31 (2011) 519–531. [2] Chellali M and Haynes T W, A note on the total domination number of a tree, J. Combin. Math. Combin. Comput. 58 (2006) 189–193. [3] Haynes T W, Hedetniemi S T and Slater P J, Fundamentals ...

  8. Introduction to Density Functional Theory: Calculations by Hand on the Helium Atom

    Science.gov (United States)

    Baseden, Kyle A.; Tye, Jesse W.

    2014-01-01

    Density functional theory (DFT) is a type of electronic structure calculation that has rapidly gained popularity. In this article, we provide a step-by-step demonstration of a DFT calculation by hand on the helium atom using Slater's X-Alpha exchange functional on a single Gaussian-type orbital to represent the atomic wave function. This DFT…

  9. Anisotropic p-f mixing mechanism explaining anomalous magnetic properties in Ce monopnictides

    International Nuclear Information System (INIS)

    Takahashi, H.; Kasuya, T.

    1985-01-01

    The crystal-field splittings in CeP, PrP and NdP are calculated by considering the point-charge Coulomb interaction, the intra-atomic d-f Coulomb interaction, and the p-f and d-f mixings. The p-f mixing mechanisms, not only between the occupied 4f states and the conduction bands, but also between the unoccupied 4f states and the valence bands make an important contribution to the crystal-field splitting. The fact that the crystal-field potential in CeP is smaller than those in PrP and NdP is due to the occupied 4f level in CeP being shallower. The values of the Slater-Koster integrals, (pfσ) and (pfπ), are determined uniquely from the crystal-field fitting for PrP and NdP. (author)

  10. Sign Learning Kink-based (SiLK) Quantum Monte Carlo for molecular systems

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Xiaoyao [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Hall, Randall W. [Department of Natural Sciences and Mathematics, Dominican University of California, San Rafael, California 94901 (United States); Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Löffler, Frank [Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Kowalski, Karol [William R. Wiley Environmental Molecular Sciences Laboratory, Battelle, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States); Bhaskaran-Nair, Kiran; Jarrell, Mark; Moreno, Juana [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803 (United States)

    2016-01-07

    The Sign Learning Kink (SiLK) based Quantum Monte Carlo (QMC) method is used to calculate the ab initio ground state energies for multiple geometries of the H{sub 2}O, N{sub 2}, and F{sub 2} molecules. The method is based on Feynman’s path integral formulation of quantum mechanics and has two stages. The first stage is called the learning stage and reduces the well-known QMC minus sign problem by optimizing the linear combinations of Slater determinants which are used in the second stage, a conventional QMC simulation. The method is tested using different vector spaces and compared to the results of other quantum chemical methods and to exact diagonalization. Our findings demonstrate that the SiLK method is accurate and reduces or eliminates the minus sign problem.

  11. Sign Learning Kink-based (SiLK) Quantum Monte Carlo for molecular systems

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Xiaoyao [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Hall, Randall W. [Department of Natural Sciences and Mathematics, Dominican University of California, San Rafael, California 94901, USA; Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Löffler, Frank [Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Kowalski, Karol [William R. Wiley Environmental Molecular Sciences Laboratory, Battelle, Pacific Northwest National Laboratory, Richland, Washington 99352, USA; Bhaskaran-Nair, Kiran [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Jarrell, Mark [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Moreno, Juana [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803, USA; Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803, USA

    2016-01-07

    The Sign Learning Kink (SiLK) based Quantum Monte Carlo (QMC) method is used to calculate the ab initio ground state energies for multiple geometries of the H2O, N2, and F2 molecules. The method is based on Feynman’s path integral formulation of quantum mechanics and has two stages. The first stage is called the learning stage and reduces the well-known QMC minus sign problem by optimizing the linear combinations of Slater determinants which are used in the second stage, a conventional QMC simulation. The method is tested using different vector spaces and compared to the results of other quantum chemical methods and to exact diagonalization. Our findings demonstrate that the SiLK method is accurate and reduces or eliminates the minus sign problem.

  12. Hartree and Exchange in Ensemble Density Functional Theory: Avoiding the Nonuniqueness Disaster.

    Science.gov (United States)

    Gould, Tim; Pittalis, Stefano

    2017-12-15

    Ensemble density functional theory is a promising method for the efficient and accurate calculation of excitations of quantum systems, at least if useful functionals can be developed to broaden its domain of practical applicability. Here, we introduce a guaranteed single-valued "Hartree-exchange" ensemble density functional, E_{Hx}[n], in terms of the right derivative of the universal ensemble density functional with respect to the coupling constant at vanishing interaction. We show that E_{Hx}[n] is straightforwardly expressible using block eigenvalues of a simple matrix [Eq. (14)]. Specialized expressions for E_{Hx}[n] from the literature, including those involving superpositions of Slater determinants, can now be regarded as originating from the unifying picture presented here. We thus establish a clear and practical description for Hartree and exchange in ensemble systems.

  13. Large-scale ab initio configuration interaction calculations for light nuclei

    International Nuclear Information System (INIS)

    Maris, Pieter; Potter, Hugh; Vary, James P; Aktulga, H Metin; Ng, Esmond G; Yang Chao; Caprio, Mark A; Çatalyürek, Ümit V; Saule, Erik; Oryspayev, Dossay; Sosonkina, Masha; Zhou Zheng

    2012-01-01

    In ab-initio Configuration Interaction calculations, the nuclear wavefunction is expanded in Slater determinants of single-nucleon wavefunctions and the many-body Schrodinger equation becomes a large sparse matrix problem. The challenge is to reach numerical convergence to within quantified numerical uncertainties for physical observables using finite truncations of the infinite-dimensional basis space. We discuss strategies for constructing and solving the resulting large sparse matrix eigenvalue problems on current multicore computer architectures. Several of these strategies have been implemented in the code MFDn, a hybrid MPI/OpenMP Fortran code for ab-initio nuclear structure calculations that can scale to 100,000 cores and more. Finally, we will conclude with some recent results for 12 C including emerging collective phenomena such as rotational band structures using SRG evolved chiral N3LO interactions.

  14. Modified potentials in many-body perturbation theory

    International Nuclear Information System (INIS)

    Silver, D.M.; Bartlett, R.J.

    1976-01-01

    Many-body perturbation-theory calculations of the pair-correlation energy within the regime of various finite expansions in two-center Slater-type basis sets are performed using a wide variety of modified potentials for the determination of unoccupied orbitals. To achieve meaningful convergence, it appears that the perturbation series must be carried through third order, using shifted denominators to include contributions from various higher-order diagrams. Moreover, certain denominator shifts are found necessary to ensure that a negative-definite resolvent accompanies the perturbation scheme when an arbitrary modified potential is employed. Through third order with denominator shifts, well-behaved modified potentials are found to give results that are equivalent, within 1 kcal/mole, to those obtained for pair-correlation energies with the standard self-consistent-field-V/sup N/ potential

  15. Quantum Chemistry on Quantum Computers: A Polynomial-Time Quantum Algorithm for Constructing the Wave Functions of Open-Shell Molecules.

    Science.gov (United States)

    Sugisaki, Kenji; Yamamoto, Satoru; Nakazawa, Shigeaki; Toyota, Kazuo; Sato, Kazunobu; Shiomi, Daisuke; Takui, Takeji

    2016-08-18

    Quantum computers are capable to efficiently perform full configuration interaction (FCI) calculations of atoms and molecules by using the quantum phase estimation (QPE) algorithm. Because the success probability of the QPE depends on the overlap between approximate and exact wave functions, efficient methods to prepare accurate initial guess wave functions enough to have sufficiently large overlap with the exact ones are highly desired. Here, we propose a quantum algorithm to construct the wave function consisting of one configuration state function, which is suitable for the initial guess wave function in QPE-based FCI calculations of open-shell molecules, based on the addition theorem of angular momentum. The proposed quantum algorithm enables us to prepare the wave function consisting of an exponential number of Slater determinants only by a polynomial number of quantum operations.

  16. Sign Learning Kink-based (SiLK) Quantum Monte Carlo for molecular systems

    International Nuclear Information System (INIS)

    Ma, Xiaoyao; Hall, Randall W.; Löffler, Frank; Kowalski, Karol; Bhaskaran-Nair, Kiran; Jarrell, Mark; Moreno, Juana

    2016-01-01

    The Sign Learning Kink (SiLK) based Quantum Monte Carlo (QMC) method is used to calculate the ab initio ground state energies for multiple geometries of the H 2 O, N 2 , and F 2 molecules. The method is based on Feynman’s path integral formulation of quantum mechanics and has two stages. The first stage is called the learning stage and reduces the well-known QMC minus sign problem by optimizing the linear combinations of Slater determinants which are used in the second stage, a conventional QMC simulation. The method is tested using different vector spaces and compared to the results of other quantum chemical methods and to exact diagonalization. Our findings demonstrate that the SiLK method is accurate and reduces or eliminates the minus sign problem

  17. Optimized Enhanced Bioremediation Through 4D Geophysical Monitoring and Autonomous Data Collection, Processing and Analysis

    Science.gov (United States)

    2014-09-01

    organic acids and fluid conductivity. .......................... 62 Figure 5-19 Predicted vs. observed TOA concentrations for August 2010 sampling...including most recently the system developed and demonstrated by the British Geological Survey (BGS) (Ogilvy, Meldrum et al. 2009). However, while the...increase in organic acids . ER has also been used to verify installation of permeable reactive barriers (Slater and Binley 2003).  Induced

  18. A Tribute to Professor Rene H. Miller - A Pioneer in Aeromechanics and Rotary Wing Flight Transportation

    Science.gov (United States)

    Friedmann, Peretz P.; Johnson, Wayne; Scully, Michael P.

    2011-01-01

    Rene H. Miller (May 19, 1916 January 28, 2003), Emeritus H. N. Slater Professor of Flight Transportation, was one of the most influential pioneers in rotary wing aeromechanics as well as a visionary whose dream was the development of a tilt-rotor based short haul air transportation system. This paper pays a long overdue tribute to his memory and to his extraordinary contributions.

  19. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 50 of 408 ... H. E. Slater, O.C.A. Okoye, O. Okperi, N. Rajora. Vol 15, No 1 (2016), Acute pancreatic pseudocyst in an 18-month old girl in a resource limited centre, Abstract. OE Udefiagbon, C Odion, J Akerele. Vol 7, No 1-2 (2008), Age At Menarche Of School Girls In Urban Benin City, Abstract. MI Momoh, C Okonkwo.

  20. Atomic spectrum of plutonium

    International Nuclear Information System (INIS)

    Blaise, J.; Fred, M.; Gutmacher, R.G.

    1984-08-01

    This report contains plutonium wavelengths, energy level classifications, and other spectroscopic data accumulated over the past twenty years at Laboratoire Aime Cotton (LAC) Argonne National Laboratory (ANL), and Lawrence Livermore National Laboratory (LLNL). The primary purpose was term analysis: deriving the energy levels in terms of quantum numbers and electron configurations, and evaluating the Slater-Condon and other parameters from the levels

  1. Exact exchange potential for slabs: Asymptotic behavior of the Krieger-Li-Iafrate approximation

    Science.gov (United States)

    Engel, Eberhard

    2018-02-01

    The Krieger-Li-Iafrate (KLI) approximation for the exact exchange (EXX) potential of density functional theory is investigated far outside the surface of slabs. For large z the Slater component of the EXX/KLI potential falls off as -1 /z , where z is the distance to the surface of a slab parallel to the x y plane. The Slater potential thus reproduces the behavior of the exact EXX potential. Here it is demonstrated that the second component of the EXX/KLI potential, often called the orbital-shift term, is also proportional to 1 /z for large z , at least in general. This result is obtained by an analytical evaluation of the Brillouin zone integrals involved, relying on the exponential decay of the states into the vacuum. Several situations need to be distinguished in the Brillouin zone integration, depending on the band structure of the slab. In all standard situations, including such prominent cases as graphene and Si(111) slabs, however, a 1 /z dependence of the orbital-shift potential is obtained to leading order. The complete EXX/KLI potential therefore does not reproduce the asymptotic behavior of the exact EXX potential.

  2. Covariant density functional theory beyond mean field and applications for nuclei far from stability

    International Nuclear Information System (INIS)

    Ring, P

    2010-01-01

    Density functional theory provides a very powerful tool for a unified microscopic description of nuclei all over the periodic table. It is not only successful in reproducing bulk properties of nuclear ground states such as binding energies, radii, or deformation parameters, but it also allows the investigation of collective phenomena, such as giant resonances and rotational excitations. However, it is based on the mean field concept and therefore it has its limits. We discuss here two methods based based on covariant density functional theory going beyond the mean field concept, (i) models with an energy dependent self energy allowing the coupling to complex configurations and a quantitative description of the width of giant resonances and (ii) methods of configuration mixing between Slater determinants with different deformation and orientation providing are very successful description of transitional nuclei and quantum phase transitions.

  3. Basic semiconductor physics

    CERN Document Server

    Hamaguchi, Chihiro

    2017-01-01

    This book presents a detailed description of basic semiconductor physics. The text covers a wide range of important phenomena in semiconductors, from the simple to the advanced. Four different methods of energy band calculations in the full band region are explained: local empirical pseudopotential, non-local pseudopotential, KP perturbation and tight-binding methods. The effective mass approximation and electron motion in a periodic potential, Boltzmann transport equation and deformation potentials used for analysis of transport properties are discussed. Further, the book examines experiments and theoretical analyses of cyclotron resonance in detail. Optical and transport properties, magneto-transport, two-dimensional electron gas transport (HEMT and MOSFET) and quantum transport are reviewed, while optical transition, electron-phonon interaction and electron mobility are also addressed. Energy and electronic structure of a quantum dot (artificial atom) are explained with the help of Slater determinants. The...

  4. Spectra of Nb XII-XVII from a low-inductance vacuum spark

    International Nuclear Information System (INIS)

    Burkhalter, P.G.; Cohen, L.; Cowan, R.D.; Sweeney, B.V.

    1982-01-01

    The XUV spectrum of niobium was obtained by using a low-inductance vaccum spark and grazing-incidence, high-resolution spectrograph. Identification of wavelengths and lines were made in the 2060-A region for complex arrays involving 3d--p and 3d--4f transitions. Atomic structure calculations using relativistically corrected Hartree-Fock wave functions provided the theoretical basis for line classifications. The 3d 9 --3d 8 4p,4f and 3p 5 3d 10 -3p 5 3d 9 4p,4f transitions in Nb XV and satellites to the Ni-like 3d 10 --3d 9 4p,4f lines were classified. Energy levels for the 3d 8 4p and 3d 8 4f configurations in Nb XV were determined by using Slater integrals scaled by least-squares fitting

  5. Comparison of Methods for Computing the Exchange Energy of quantum helium and hydrogen

    International Nuclear Information System (INIS)

    Cayao, J. L. C. D.

    2009-01-01

    I investigate approach methods to find the exchange energy for quantum helium and hydrogen. I focus on Heitler-London, Hund-Mullikan, Molecular Orbital and variational approach methods. I use Fock-Darwin states centered at the potential minima as the single electron wavefunctions. Using these we build Slater determinants as the basis for the two electron problem. I do a comparison of methods for two electron double dot (quantum hydrogen) and for two electron single dot (quantum helium) in zero and finite magnetic field. I show that the variational, Hund-Mullikan and Heitler-London methods are in agreement with the exact solutions. Also I show that the exchange energy calculation by Heitler-London (HL) method is an excellent approximation for large inter dot distances and for single dot in magnetic field is an excellent approximation the Variational method. (author)

  6. A unitary correlation operator method

    International Nuclear Information System (INIS)

    Feldmeier, H.; Neff, T.; Roth, R.; Schnack, J.

    1997-09-01

    The short range repulsion between nucleons is treated by a unitary correlation operator which shifts the nucleons away from each other whenever their uncorrelated positions are within the repulsive core. By formulating the correlation as a transformation of the relative distance between particle pairs, general analytic expressions for the correlated wave functions and correlated operators are given. The decomposition of correlated operators into irreducible n-body operators is discussed. The one- and two-body-irreducible parts are worked out explicitly and the contribution of three-body correlations is estimated to check convergence. Ground state energies of nuclei up to mass number A=48 are calculated with a spin-isospin-dependent potential and single Slater determinants as uncorrelated states. They show that the deduced energy-and mass-number-independent correlated two-body Hamiltonian reproduces all ''exact'' many-body calculations surprisingly well. (orig.)

  7. Photoionization cross-sections of ground and excited valence levels of actinides

    Directory of Open Access Journals (Sweden)

    Yarzhemsky Victor G.

    2012-01-01

    Full Text Available The photoionization cross-sections of ground and excited atomic states of actinide atoms were calculated by the Dirac-Fock-Slater method for two excitation energies of X-ray radiation (1253.6 eV and 1486.6 eV. These data are required for calculations of intensities of X-ray photoelectron spectra of actinide compound valence bands and interpretation of experimental spectra.

  8. Atomically resolved spectroscopic study of Sr.sub.2./sub.IrO.sub.4./sub.: Experiment and theory

    Czech Academy of Sciences Publication Activity Database

    Li, Q.; Cao, G.; Okamoto, S.; Yi, J.; Lin, W.; Sales, B.C.; Yan, J.; Arita, R.; Kuneš, Jan; Kozhevnikov, A.V.; Eguiluz, A.G.; Imada, M.; Gai, Z.; Pan, M.; Mandrus, D.G.

    2013-01-01

    Roč. 3, OCT (2013), s. 1-7 ISSN 2045-2322 R&D Projects: GA ČR GA13-25251S Institutional support: RVO:68378271 Keywords : Sr 2 IrO 4 * scanning tunneling microscopy * Mott insulator * Slater insulator Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 5.078, year: 2013 http://www.nature.com/srep/2013/131029/srep03073/full/srep03073.html

  9. Dynamics Days US 2013 Conference Held in Denver, Colorado on 3-6 January 2013. Abstracts

    Science.gov (United States)

    2013-12-17

    down before population collapse using replicate laboratory populations of the budding yeast Saccharomyces cerevisiae. We mapped the bifurcation diagram...agreement with the theory. Furthermore, we connected yeast populations spatially to evaluate warning signals based on spatio-temporal fluctuations...Colorado School of Mines $125 ARO 54 Franson, Andrew U Colorado School of Mines $125 ARO 55 Slater, Michael U Colorado School of Mines $125 ARO 56 Brewer

  10. Emergent Leadership and Team Effectiveness on a Team Resource Allocation Task

    Science.gov (United States)

    1987-10-01

    ship rather than socioemotional leadership (Bales & Slater, 1955) and since task- oriented behavior is more likely to occur during the trials (when...Self-attention theory (Mullen, 1983) suggests that sex composition would have other effects on behavior in the group. Mullen argues that self...likely to lead. That firjug is consistent with self-attention theory (Mullen, 1963), which indicates that individuals in a minority are nmore self

  11. Ferromagnetism in the Hubbard-Hirsch model

    International Nuclear Information System (INIS)

    Ivanov, V.A.; Zhuravlev, M.E.

    1991-01-01

    In the Hubbard model U=∞ the energy lowering due to exchange interaction of electrons of opposite spin in states with opposite bonding character is taken into account. In the electron concentration range 0< n<1 nonmonotonous dependence m(n) analogous to Slater-Pauling curves has been obtained. The Curle temperature having nonmonotonous dependence on n, saturated magnetization, the temperature dependences of magnetization have been obtained. (orig.)

  12. On the description of electronic final states in the K-shell ionization by protons

    International Nuclear Information System (INIS)

    Aashamar, O.; Kocbach, L.

    1976-06-01

    The choice of free electronic wave functions in the description of K-shell ionization by protons is discussed. The previously known discrepancies between PWBA and SCA results are shown to be entirely due to two different choices of electronic wave functions. Calculations in the SCA framework with Hartree-Fock-Slater wave functions are reported. Some general features of the SCA calculations are discussed. (Auth.)

  13. Cirrus Dopant Nano-Composite Coatings

    Science.gov (United States)

    2014-11-01

    coatings without alteration to the existing plating process. Glen Slater, Cirrus Materials | Stephen Flint, Auckland UniServices Ltd Report...ADDRESS(ES) University of Auckland ,Cirrus Materials, Auckland , New Zealand, 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY...JiA/ g THE UNIVERSITY ’-" OF AUCKLAND NEW ZEALAND Te Whare Wanan a o Thmaki Makaurau ~"""’ • ........,." ... Southwest Pacific Basin . p

  14. Have the Most Relevant and Answerable Research Questions Facing Librarians Changed Between 2001 and 2006?

    Directory of Open Access Journals (Sweden)

    Suzanne Lewis

    2007-03-01

    Full Text Available Objective ‐ To examine the similarities and differences between research questions asked by librarians in 2001 to those posed in 2006, and to explore to what extent the published research supports the questions being asked.Methods ‐ Questions collected in 2001 by members of the Evidence‐Based Librarianship Implementation Committee (EBLIC of the MLA Research Section were compared with questions collected in 2006 at a cross‐sectoral seminar introducing evidence based library and information practice to Australian librarians. Questions from each list were categorized using the domains of librarianship proposed by Crumley and Koufogiannakis in 2001, and examined with reference to a content analysis of the library and information studies (LIS research published in 2001 by Koufogiannakis, Slater, and Crumley in 2004.Results ‐ In 2001 and 2006 the most commonly asked questions were in the domain of management (29%, 33%, followed by education (24%, 18.5%. In 2001 questions in the marketing/promotion category ranked lowest (1%, however representation was much greater in 2006 (18.5% ranking an equal second with education. Questions in the lowest ranked domain in 2006 (collections, 6% had been more common in 2001 where collections ranked third, representing 19% of the questions. Koufogiannakis, Slater, and Crumley’s content analysis of LIS research published in 2001 revealed that the most popular domain for research was information access and retrieval (38% followed by collections (24%. Only 1% of published LIS research (seven articles was in the domain of marketing/promotion. In contrast, 36 articles originally assigned to one of the six established domains could more appropriately have been included in a proposed new domain of professional issues.Conclusion ‐ The disparity between questions being asked by practitioners and the evidence being generated by researchers suggests that the research‐practice gap is still an issue. A content

  15. The paired-domination and the upper paired-domination numbers of graphs

    Directory of Open Access Journals (Sweden)

    Włodzimierz Ulatowski

    2015-01-01

    Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

  16. Coupled state analysis of electron excitations in asymmetric collision systems

    International Nuclear Information System (INIS)

    Mehler, G.; Reus, T. de; Mueller, U.; Reinhardt, J.; Mueller, B.; Greiner, W.; Soff, G.

    1985-01-01

    A coupled channel formalism is presented, using relativistic basis states of the target atom. Screening effects are incorporated by means of an effective potential of Hartree-Fock-Slater type. Relativistic wave packets are employed for the description of the continuum. The impact parameter dependence of the K-hole production in p-Ag collisions is calculated, including quadrupole contributions of the projectile Coulomb potential. The results are compared with experimental data. (orig.)

  17. Final Report: Identification and Manipulation of Novel Topological Phases

    Science.gov (United States)

    2016-02-09

    Massachusetts Institute of Technology ( MIT ) 77 Massachusetts Ave. NE18-901 Cambridge, MA 02139 -4307 9-Aug-2015 ABSTRACT Number of Papers published in peer...Professorship (2012-2015) Plenary Speaker, 3rd. International Conference in Superconductivity and Magnetism (ICSM2012) Alfred P. Sloan Fellowship (2012...transition ( MIT ) is discontinuous and occurs at temperatures greater or equal to TN , a Slater-type MIT is continuous and occurs exactly atTN .15 Therefore

  18. Relativistic Calculations and Measurements of Energies, Auger Rates, and Lifetimes.

    Science.gov (United States)

    1982-12-01

    Research and Industry, Denton, Texas, 8-10 November 1982. 7. B. Crasemann: "Efectos Relativ’sticos y de QED Sobre las Transiciones Rayos - X y Auger Entre...INNER-SHELL IONIZATION BY PROTONS X -RAY EMISSION BREIT INTERACTION AUGER TRANSITIONS DIRAC-HARTREE-SLATER COMPUTATIONS SYNCHROTRON RADIATION RESONANT...computations, including relativistic and quantum- electrodynamic effects, of atomic energy levels and of x -ray and Auger transitions in atoms with one or

  19. Contribution to the theoretical study of metallic systems containing rare earths: hyperfine interactions and exchange coupling

    International Nuclear Information System (INIS)

    Troper, A.

    1978-01-01

    A theoretical study involving rare earth impurities, which were embedded in transition metals (s-p or noble), from the point of view of the hyperfine interactions is presented. A model was created to describe a d-resonance (Anderson-Moriya) acting on a s-p conduction band which was strongly perturbed by a slater-koster potential, used to describe the rare earths which were diluted in matrices of transition elements. (author)

  20. Change in the Magnitude of River Flooding in the United States, 1965-2015

    Science.gov (United States)

    This figure shows changes in the size and frequency of flooding events in rivers and streams in the United States between 1965 and 2015. Blue upward-pointing symbols show locations where floods have become larger; brown downward-pointing symbols show locations where floods have become smaller. Data were analyzed by Louise Slater and Gabriele Villarini at the University of Iowa. For more information: www.epa.gov/climatechange/science/indicators

  1. Joint Program on Molecular Biology of Marine Organisms

    Science.gov (United States)

    1992-08-20

    and lateral flagella formation in a marine vibrio (Belas and Colwell, 1982). Upon contact with a surface, the polar flagella of Vibrio ... parahemolyticus ceased to function. Shortl’ thereafter, lateral flagella formed around the cells, apparently mediating the "irreversible" attachment process. Pilus...Colwell. 1982. Adsorption kinetics of 18 Slaterally and polarly flagellated Vibrio . J. Bacteriol. 151:1568-1580. S-- Brown, C.M., D.C. Ellwood, and

  2. Analytic formulae for the Hartree-Fock order parameter at arbitrary p/q filling factors for the 2DEG in a magnetic field

    International Nuclear Information System (INIS)

    Cabo Monte Oca, A. de.

    1994-07-01

    Analytic expressions for order parameters are given for the previously introduced general class of Hartree Fock states at arbitrary filling factors ν=p/q for odd q values. The order parameters are expressed as sums of magnetic translations eigenvalues over the filled single electron states. Simple summation formulae for the band spectra in terms of the same eigenvalues are also presented. The energy per particle at ν=1/3 is calculated for various states differing in the way of filling of the 1/3 of the orbitals. The calculated energies are not competing with the usual CDW results. However the high degree of electron overlapping allows for the next corrections to modify this situation. The discussion suggests these Hartree-Fock Slater determinants as interesting alternatives for the Tao-Thouless parent states which may correct their anomalous symmetry and correlation functions properties. (author). 28 refs

  3. The spectrum and term system of S VIII

    International Nuclear Information System (INIS)

    Bengtsson, P.; Jupen, C.; Engstroem, L.; Redfors, A.; Westerlind, M.

    1993-01-01

    The spectrum of seven times ionized sulfur, S VIII, has been observed in the wavelength range 50-1200 A. Both beam-foil and laser-produced plasma light sources have been used. 71 new lines representing the transitions 2p 5 -2p 4 3d, 2p 4 3s-3p, 3p-3d, 3d-4f, 4f-5g and 5g-6h have been identified and 100 energy levels, of which 46 are new, are now accurately established. The spectral analysis is supported by isoelectronic comparisons along the F I-sequence and by parametric least-squares fits of Slater integrals to the observed levels. The ionization potential in S VIII is determined to 2 651 899 ± 60 cm -1 and estimated ionization energies are derived for the isoelectronic elements between F I and Ar X. (orig.)

  4. State-specific transport properties of electronically excited Ar and C

    Science.gov (United States)

    Istomin, V. A.; Kustova, E. V.

    2018-05-01

    In the present study, a theoretical model of state-resolved transport properties in electronically excited atomic species developed earlier is applied to argon and carbon atomic species. It is shown that for Ar and C, similarly to the case of atomic nitrogen and oxygen, the Slater-like models can be applied to calculate diameters of electronically excited atoms. Using the Slater-like model it is shown that for half-filled N (2 px1py1pz1) and full-filled Ar (3 px2py2pz2) electronic shells the growth of atomic radius goes slowly compared to C (2 px1py1) and O (2 px2py1pz1). The effect of collision diameters on the transport properties of Ar and C is evaluated. The influence of accounted number of electronic levels on the transport coefficients is examined for the case of Boltzmann distributions over electronic energy levels. It is emphasized that in the temperature range 1000-14000 K, for Boltzmann-like distributions over electronic states the number of accounted electronic levels do not influence the transport coefficients. Contrary to this, for higher temperatures T > 14000 K this effect becomes of importance, especially for argon.

  5. Charge-density-shear-moduli relationships in aluminum-lithium alloys.

    Science.gov (United States)

    Eberhart, M

    2001-11-12

    Using the first principles full-potential linear-augmented-Slater-type orbital technique, the energies and charge densities of aluminum and aluminum-lithium supercells have been computed. The experimentally observed increase in aluminum's shear moduli upon alloying with lithium is argued to be the result of predictable changes to aluminum's total charge density, suggesting that simple rules may allow the alloy designer to predict the effects of dilute substitutional elements on alloy elastic response.

  6. Market Orientation Capabilities: A Study of Learning Processes in Market-Oriented Companies

    OpenAIRE

    Silkoset, Ragnhild

    2009-01-01

    The literature operates with three perspectives on market orientation. These include market orientation as behavior (Kohli and Jaworski 1990; Narver and Slater 1990), market orientation as a unique resource (Hunt and Morgan 1995) and market orientation as a dynamic learning capability (Sinkula 1994; Day 1994b). A company's level of market orientation will vary with regard to the perspectives, including factors affecting a company’s degree of market orientation and the effect...

  7. Master Lovas-Andai and equivalent formulas verifying the 8/33 two-qubit Hilbert-Schmidt separability probability and companion rational-valued conjectures

    Science.gov (United States)

    Slater, Paul B.

    2018-04-01

    We begin by investigating relationships between two forms of Hilbert-Schmidt two-rebit and two-qubit "separability functions"—those recently advanced by Lovas and Andai (J Phys A Math Theor 50(29):295303, 2017), and those earlier presented by Slater (J Phys A 40(47):14279, 2007). In the Lovas-Andai framework, the independent variable ɛ \\in [0,1] is the ratio σ (V) of the singular values of the 2 × 2 matrix V=D_2^{1/2} D_1^{-1/2} formed from the two 2 × 2 diagonal blocks (D_1, D_2) of a 4 × 4 density matrix D= ||ρ _{ij}||. In the Slater setting, the independent variable μ is the diagonal-entry ratio √{ρ _{11} ρ _ {44}/ρ _ {22 ρ _ {33}}}—with, of central importance, μ =ɛ or μ =1/ɛ when both D_1 and D_2 are themselves diagonal. Lovas and Andai established that their two-rebit "separability function" \\tilde{χ }_1 (ɛ ) (≈ ɛ ) yields the previously conjectured Hilbert-Schmidt separability probability of 29/64. We are able, in the Slater framework (using cylindrical algebraic decompositions [CAD] to enforce positivity constraints), to reproduce this result. Further, we newly find its two-qubit, two-quater[nionic]-bit and "two-octo[nionic]-bit" counterparts, \\tilde{χ _2}(ɛ ) =1/3 ɛ ^2 ( 4-ɛ ^2) , \\tilde{χ _4}(ɛ ) =1/35 ɛ ^4 ( 15 ɛ ^4-64 ɛ ^2+84) and \\tilde{χ _8} (ɛ )= 1/1287ɛ ^8 ( 1155 ɛ ^8-7680 ɛ ^6+20160 ɛ ^4-25088 ɛ ^2+12740) . These immediately lead to predictions of Hilbert-Schmidt separability/PPT-probabilities of 8/33, 26/323 and 44482/4091349, in full agreement with those of the "concise formula" (Slater in J Phys A 46:445302, 2013), and, additionally, of a "specialized induced measure" formula. Then, we find a Lovas-Andai "master formula," \\tilde{χ _d}(ɛ )= ɛ ^d Γ (d+1)^3 _3\\tilde{F}_2( -{d/2,d/2,d;d/2+1,3 d/2+1;ɛ ^2) }/{Γ ( d/2+1) ^2}, encompassing both even and odd values of d. Remarkably, we are able to obtain the \\tilde{χ _d}(ɛ ) formulas, d=1,2,4, applicable to full (9-, 15-, 27-) dimensional sets of

  8. Abstracts from Dietetic Research Event: June 09-11, 2016.

    Science.gov (United States)

    2016-09-01

    Winnipeg, Manitoba was the host city of the 2016 Dietitians of Canada Annual Conference. Through the support of Dietitians of Canada and CFDR, the 2016 event was both an exciting and informative exchange of research and experience-sharing efforts that inspired attendees. The submissions for this year's Canadian Foundation for Dietetic Research (CFDR) event represented the diversity of dietetic research conducted within Canada. The topics highlighted from this year's abstracts include Community Based Nutritional Care, Wellness & Public Health, Determinants of Food Choice, Dietary Intake, Nutrition Health & Education, Dietetic Practice & Education, Clinical Research & Patient Service, and Nutrition Social Media & the Web. Each presenter provided an 11-minute oral presentation (8 minutes for presenting and 3 minutes for questions). This allowed for meaningful interaction between the presenters and those attending the sessions. This year there were professional and student oral research presentations on each day of the conference. These presentations offered the newest insights into important research findings that apply to dietetic practice. This research event would not be possible without the commitment and dedication of many people. On behalf of Dietitians of Canada and CFDR, I would like to extend a special thank you to the 2016 Abstract Review Committee who represented research, clinical nutrition, community nutrition, and education: Masha Jessri (Ph.D Candidate, University of Toronto), Joyce Slater (Associate Professor, University of Manitoba) and Miyoung Suh (Associate Professor, University of Manitoba). We would also like to thank all of our moderators who assisted during the conference to keep our research presentation sessions on time: Marcia Cooper, Miyoung Suh, Andrea Buchholz, Dawna Royall, Paul Fieldhouse, Joyce Slater, Isabelle Giroux, and Bethany Hopkins. Finally, a special thank you to Michelle Naraine and Greg Sarney at CFDR for their assistance and

  9. Malaria-specific metabolite hemozoin mediates the release of several potent endogenous pyrogens (TNF, MIP-1 alpha, and MIP-1 beta) in vitro, and altered thermoregulation in vivo.

    Science.gov (United States)

    Sherry, B A; Alava, G; Tracey, K J; Martiney, J; Cerami, A; Slater, A F

    1995-01-01

    A characteristic feature of malaria infection is the occurrence of periodic bouts of fever. Experimental and clinical studies have strongly implicated inflammatory cytokines, like tumour necrosis factor (TNF), in the induction of these intermittent fevers [Clark et al., Infect Immunol 32:1058-1066, 1981; Clark et al., Am J Pathol 129:192-199, 1987; Karunaweera et al., Proc Natl Acad Sci USA 89:3200-3203, 1992], but the malaria-specific metabolite(s) which induce the production of such endogenous pyrogens have not yet been fully characterized. It is well known that during the course of malaria infection, a unique schizont component, alternatively referred to as "malaria pigment" or hemozoin, is released along with merozoites as the host erythrocyte bursts [Urquhart, Clin Infect Dis 19:117-131, 1994]. We have recently determined that the core structure of hemozoin comprises a novel insoluble polymer of heme units linked by iron-carboxylate bonds [Slater et al., Proc Natl Acad Sci USA 88:325-329, 1991; Slater et al., Nature 355:167-169, 1992]. We now report that purified native, as well as chemically synthesized, hemozoin crystals potently induce the release of several pyrogenic cytokines, including TNF, MIP-1 alpha, and MIP-1 beta, from murine macrophages and human peripheral blood monocytes in vitro. Also, intravenous administration of chemically synthesized preparations of hemozoin to anaesthetized rats results in a marked drop in body temperature. A similar drop in body temperature is observed following the intravenous injection of other well-characterized pyrogenic cytokines (e.g., TNF) which are known to induce a fever response in awake animals, and is thought to reflect the inability of rats to appropriately regulate their body temperature while anaesthetized. As a consequence of its ability to induce pyrogenic cytokines in vitro, and thermal dysregulation in vivo, we propose that this unique parasite metabolite is an important pyrogen released by malaria

  10. Experimental and theoretical studies of the energy level structure of multiply charged many-electron ions

    International Nuclear Information System (INIS)

    Redfors, A.

    1991-01-01

    Magnesiumlike and aluminumlike spectra of the elements calcium - germanium have been obtained through the use of laser-produced plasmas (LPP) and a 3 m normal incidence vacuum spectrograph. The spectral analyses were mainly based on isoelectronic regularities. Intermediate ionization stages of cerium (Ce V) and silicon (SI VI) have also been studied. The light sources in these cases were a sliding spark and a modified version of the LPP. The Eagle spectrograph at the National Institute of Standards and Technology, Gaitherburg, Maryland was used to record the cerium spectrum. Ab initio calculations and least-squares fits of the Slater energy parameters to the experimental energy levels are reported for all investigated spectra. Theoretical predictions of oscillator strengths for Y III and Zr III in the region 1150-3200 AA are presented. The oscillator strengths are needed for abundance determinations of Y 2+ and Zr 2+ in chemically peculiar stars, Cp stars. (65 refs.)

  11. Morphologic, magnetic, and Moessbauer spectral properties of Fe75Co25 nanoparticles prepared by ultrasound-assisted electrochemistry

    International Nuclear Information System (INIS)

    Mancier, Valerie; Delplancke, J.-L.; Delwiche, Jacques; Hubin-Franskin, M.-J.; Piquer, Cristina; Rebbouh, Leila; Grandjean, Fernande

    2004-01-01

    Nanopowders of Fe 75 Co 25 alloys have been prepared by ultrasound-assisted electrochemistry. Their composition, crystallographic structure, morphology, have been studied by X-ray diffraction, transmission electron microscopy, X-ray fluorescence, and high-energy electron diffraction. The nanopowders are found to present a composition well determined by the electrolyte bath composition, they show a bcc structure. The iron and cobalt atoms exhibit a very homogeneous distribution in the particles. The magnetic properties of the nanopowders have been measured between 5 and 295 K with a vibrating sample magnetometer and their Moessbauer spectra have been obtained at 295 K. The saturation magnetization is characteristic of FeCo alloys. The magnetic behavior and transmission electron microscopy observations of the particles indicate strongly interacting particles with a radius of ca. 2-4 nm, particles which may form agglomerates of larger size. The measured average hyperfine field is situated at the maximum of the Slater-Pauling curve for the FeCo alloys

  12. Singly differential electron emission cross sections for ionization of helium by protons

    International Nuclear Information System (INIS)

    Barna, I.F.; Gagyi-Palffy, A.C.; Gulyas, L.; Tokesi, K.; Burgdoerfer, J.

    2005-01-01

    Angular differential cross sections are calculated for electrons emitted in proton-helium collisions within the framework of the time-dependent coupled channel-method. The channel wave functions are constructed from Slater functions and Coulomb wave packets. As projectiles we consider protons with energies between 0.3 and 1.5 MeV. We compare our results with experimental data and other theoretical calculations using the first Born approximation, different distorted wave models and classical trajectory Monte Carlo simulations

  13. Ultraviolet photoelectron spectroscopy of transient species

    International Nuclear Information System (INIS)

    Leeuw, D.M. de.

    1979-01-01

    Transient species are studied in the isolation of the gas phase using ultraviolet photoelectron spectroscopy (PES). A description of the equipment used and a discussion of some theoretical topics, which play a role in the interpretation of PE spectra, are given. Koopmans' theorem, Hartree-Fock-Slater (HFS) calculations and the sum rule are discussed. A versatile ultraviolet PE spectrometer, designed specifically for this purpose, has been built and the construction and performance of this instrument are described. (Auth.)

  14. Prevention Research Matters-Communities Working to Improve Physical Activity

    Centers for Disease Control (CDC) Podcasts

    2018-02-15

    We know that children who are physically active every day are less likely to develop chronic diseases as adults, including obesity. Dr. Sandy Slater, a researcher with the University of Illinois, Chicago Prevention Research Center, discusses how a park improvement project in Chicago helped engage communities to improve areas for play and activity.  Created: 2/15/2018 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 2/15/2018.

  15. Personalisation of power, neoliberalism and the production of corruption

    OpenAIRE

    Ahmad Khair, Amal Hayati; Haniffa, Roszaini; Hudaib, Mohammad; Abd. Karim, Mohamad Nazri

    2015-01-01

    This paper utilises a political lens in considering the cause for the production of corruption and the role of political leadership. Specifically, the notion of personalisation of power as advocated by Slater (2003) is adopted to portray how the adoption of neoliberalism ideology by an aspiring autocratic leader results in the weakening of the infrastructural power through three strategies: packing, rigging and circumventing. We use Perwaja Steel as a case study to demonstrate the modus opera...

  16. Unified description of pf-shell nuclei by the Monte Carlo shell model calculations

    Energy Technology Data Exchange (ETDEWEB)

    Mizusaki, Takahiro; Otsuka, Takaharu [Tokyo Univ. (Japan). Dept. of Physics; Honma, Michio

    1998-03-01

    The attempts to solve shell model by new methods are briefed. The shell model calculation by quantum Monte Carlo diagonalization which was proposed by the authors is a more practical method, and it became to be known that it can solve the problem with sufficiently good accuracy. As to the treatment of angular momentum, in the method of the authors, deformed Slater determinant is used as the basis, therefore, for making angular momentum into the peculiar state, projected operator is used. The space determined dynamically is treated mainly stochastically, and the energy of the multibody by the basis formed as the result is evaluated and selectively adopted. The symmetry is discussed, and the method of decomposing shell model space into dynamically determined space and the product of spin and isospin spaces was devised. The calculation processes are shown with the example of {sup 50}Mn nuclei. The calculation of the level structure of {sup 48}Cr with known exact energy can be done with the accuracy of peculiar absolute energy value within 200 keV. {sup 56}Ni nuclei are the self-conjugate nuclei of Z=N=28. The results of the shell model calculation of {sup 56}Ni nucleus structure by using the interactions of nuclear models are reported. (K.I.)

  17. High-efficiency wavefunction updates for large scale Quantum Monte Carlo

    Science.gov (United States)

    Kent, Paul; McDaniel, Tyler; Li, Ying Wai; D'Azevedo, Ed

    Within ab intio Quantum Monte Carlo (QMC) simulations, the leading numerical cost for large systems is the computation of the values of the Slater determinants in the trial wavefunctions. The evaluation of each Monte Carlo move requires finding the determinant of a dense matrix, which is traditionally iteratively evaluated using a rank-1 Sherman-Morrison updating scheme to avoid repeated explicit calculation of the inverse. For calculations with thousands of electrons, this operation dominates the execution profile. We propose a novel rank- k delayed update scheme. This strategy enables probability evaluation for multiple successive Monte Carlo moves, with application of accepted moves to the matrices delayed until after a predetermined number of moves, k. Accepted events grouped in this manner are then applied to the matrices en bloc with enhanced arithmetic intensity and computational efficiency. This procedure does not change the underlying Monte Carlo sampling or the sampling efficiency. For large systems and algorithms such as diffusion Monte Carlo where the acceptance ratio is high, order of magnitude speedups can be obtained on both multi-core CPU and on GPUs, making this algorithm highly advantageous for current petascale and future exascale computations.

  18. Molecular cluster theory of chemical bonding in actinide oxide

    International Nuclear Information System (INIS)

    Ellis, D.E.; Gubanov, V.A.; Rosen, A.

    1978-01-01

    The electronic structure of actinide monoxides AcO and dioxides AcO 2 , where Ac = Th, U, Np, Pu, Am, Cm and Bk has been studied by molecular cluster methods based on the first-principles one-electron local density theory. Molecular orbitals for nearest neighbor clusters AcO 10- 6 and AcO 12- 8 representative of monoxide and dioxide lattices were obtained using non-relativistic spin-restricted and spin-polarized Hartree-Fock-Slater models for the entire series. Fully relativistic Dirac-Slater calculations were performed for ThO, UO and NpO in order to explore magnitude of spin-orbit splittings and level shifts in valence structure. Self-consistent iterations were carried out for NpO, in which the NpO 6 cluster was embedded in the molecular field of the solid. Finally, a ''moment polarized'' model which combines both spin-polarization and relativistic effects in a consistent fashion was applied to the NpO system. Covalent mixing of oxygen 2p and Ac 5f orbitals was found to increase rapidly across the actinide series; metal s,p,d covalency was found to be nearly constant. Mulliken atomic population analysis of cluster eigenvectors shows that free-ion crystal field models are unreliable, except for the light actinides. X-ray photoelectron line shapes have been calculated and are found to compare rather well with experimental data on the dioxides

  19. Characterization of some electronic spectral parameters for doped Nd (III) ion in saturated aqueous solution of some pharmaceutical compounds

    International Nuclear Information System (INIS)

    Naulakha, Neelam; Soni, K.P.; Bhati, P.R.

    2000-01-01

    The stereo-environment of doped Nd(III) ion in various saturated solutions of some medicinal compounds has been studied for various electronic spectral parameters. The various electronic parameters, viz., Slater Condon (F k ), Lande (ζ 4f ) intensity of hypersensitive band ( 4 G 5/2 ), bonding parameter (b 1/2 ), Judd-Ofelt parameter (Tλ) and Racah parameter (E k ) for Nd(III) ion doped in saturated solution of diphenylhydramine, tripelennamine, chlorophenaramine, promethazine, terfinadine, naproxen, fenoprofen, flurbiprofen, oxaprozine, ketoprofen and ibuprofen have been studied. (author)

  20. The generalized sturmian method for calculating spectra of atoms and ions

    DEFF Research Database (Denmark)

    Avery, James Emil; Avery, John Scales

    2003-01-01

    The properties of generalized Sturmian basis sets are reviewed, and functions of this type are used to perform direct configuration interaction calculations on the spectra of atoms and ions. Singlet excited states calculated in this way show good agreement with experimentally measured spectra. When...... the generalized Sturmian method is applied to atoms, the configurations are constructed from hydrogenlike atomic orbitals with an effective charge which is characteristic of the configuration. Thus, orthonormality between the orbitals of different configurations cannot be assumed, and the generalized Slater...

  1. La aproximación topológica en el cálculo de orbitales moleculares localizados.

    OpenAIRE

    Paniagua, Juan Carlos

    1983-01-01

    [spa] Es bien sabido que cualquier función de onda que se exprese como determinante de Slater construido a partir de orbitales moleculares doblemente ocupados es invariante frente a transformaciones unitarias de dichos orbitales. Aunque las posibilidades de elección son ilimitadas, en la práctica sólo se utilizan dos tipos de orbitales: los canónicos y los localizados. Los primeros se caracterizan por ser funciones propias de algún hamiltoniano monoelectrónico efectivo y entre sus propieda...

  2. Coupled channel calculations of K-shell ionization in asymmetric collision systems

    International Nuclear Information System (INIS)

    Mehler, G.; Greiner, W.; Soff, G.

    1986-07-01

    We report theoretical results on K-shell ionization for a variety of asymmetric collision systems. The calculated ionization rates are compared with experimental data. The coupled channel formalism underlying these calculations is presented. It is based on a set of relativistic target centred states, taking a screened potential of Dirac-Fock-Slater type into account. We discuss the effects of different matrix elements, e.g. continuum-continuum couplings. The binding effect is inherently contained in our approach and described in a dynamical way. (orig.)

  3. On the anisotropy energies for YCo5, RCo5, Y2Co17, and R2Co17

    International Nuclear Information System (INIS)

    Takahashi, H.; Hikosaka, K.; Ohtsuka, S.; Seo, A.; Ukai, T.; Mori, N.

    1988-01-01

    The approximate d bands for YCo 5 , RCo 5 , Y 2 Co 17 , and R 2 Co 17 (Th 2 Zn 17 and Th 2 Ni 17 type) are formulated by Deegan's prescription and the formulas of Slater and Koster. The experimental results of YCo 5 and Y 2 Co 17 are discussed by using these approximate d bands. For RCo 5 and R 2 Co 17 the discussions are made by adopting the localized model and the band model for 4f electrons

  4. Preparation of metastable CoFeNi alloys with ultra-high magnetic saturation (Bs = 2.4-2.59 T) by reverse pulse electrodeposition

    Science.gov (United States)

    Tabakovic, Ibro; Venkatasamy, Venkatram

    2018-04-01

    The results of reverse pulse electrodeposition of CoFeNi films with ultra-high magnetic saturation, i.e. Bs values between 2.4 and 2.59 T, are presented in this work. Based on valence-bond theory (Hund's rule) it was assumed that the electronic configuration of MOH obtained by one electron reduction of electroactive intermediate (MOH+ads + e → MOHads) or oxidation of metal (M - e + HOH → MOH + H+) would result with larger number of spins per atom for each of transition metals in MOH-precipitated in CoFeNi deposit- with one more spin than their respective neutral metal in the order: Fe > Co > Ni. The experimental results showed that the increase of Bs value above Slater-Pauling curve was not observed for CoFe alloys, thus FeOH and CoOH compounds were not present in deposit. However, the increase of the Bs values above the Slater-Pauling curve (Bs = 2.4-2.59 T) was observed, for CoFeNi films obtained by reverse pulse electrodeposition. Therefore, NiOH as a stable compound is probably formed in a one-electron oxidation step during anodic pulse oxidation reaction precipitated presumably at the grain boundaries, giving rise to the ultra-high magnetic saturation of CoFeNi films. The effects of experimental conditions on elemental composition, magnetic properties, crystal structure, and thermal stability of CoFeNi films were studied.

  5. Relativistic multiple scattering X-alpha calculations

    International Nuclear Information System (INIS)

    Chermette, H.; Goursot, A.

    1986-01-01

    The necessity to include self-consistent relativistic corrections in molecular calculations has been pointed out for all compounds involving heavy atoms. Most of the changes in the electronic properties are due to the mass-velocity and the so-called Darwin terms so that the use of Wood and Boring's Hamiltonian is very convenient for this purpose as it can be easily included in MSXalpha programs. Although the spin orbit operator effects are only obtained by perturbation theory, the results compare fairly well with experiment and with other relativistic calculations, namely Hartree-Fock-Slater calculations

  6. Atomic structure calculation of energy levels and oscillator strengths in Ti ion, 2

    International Nuclear Information System (INIS)

    Ishii, Keishi

    1983-10-01

    Energy levels and oscillator strengths are calculated for 3s-3p and 3p-3d transition arrays in Ti X, isoelectronic to Al I. The energy levels are obtained by the Slater-Condon theory of atomic structure, including explicitly the strong configuration interactions. The results are presented both in numerical tables and in diagrams. In the tables, the observed data are included for comparison, where available. The calculated weighted oscillator strengths (gf-value) are also displayed in figures, where the weighted oscillator strengths are plotted as a function of wavelength. (author)

  7. A perceção dos pais sobre a sua responsabilidade nas práticas alimentares dos filhos: relação com a obesidade infantil

    OpenAIRE

    Santos, Ana Luísa Couto de Almeida dos

    2015-01-01

    Dissertação de Mestrado em Enfermagem Comunitária Introdução: O excesso de peso e a obesidade em geral, bem como a obesidade infantil em particular, têm sido considerados um problema emergente de saúde pública a nível mundial. Esta patologia foi considerada pela Organização Mundial de Saúde (WHO, 2000) como uma doença multifatorial podendo ter como etiologia fatores biológicos, comportamentais e ambientais, que para Enes e Slater (2010) se inter-relacionam e se potencializam entre si. Segu...

  8. Aproximación topológica en el cálculo de orbitales moleculares localizados, La

    OpenAIRE

    Paniagua Valle, Juan Carlos

    1983-01-01

    Es bien sabido que cualquier función de onda que se exprese como determinante de Slater construido a partir de orbitales moleculares doblemente ocupados es invariante frente a transformaciones unitarias de dichos orbitales.Aunque las posibilidades de elección son ilimitadas, en la práctica sólo se utilizan dos tipos de orbitales: los canónicos y los localizados. Los primeros se caracterizan por ser funciones propias de algún hamiltoniano monoelectrónico efectivo y entre sus propiedades más in...

  9. Classic Multi-Configuration-Dirac-Fock and Hartree-Fock-Relativistic methods integrated into a program package for the RAL-IBM mainframe with automatic comparative output

    International Nuclear Information System (INIS)

    Cowan, R.D.; Grant, I.P.; Fawcett, B.C.; Rose, S.J.

    1985-11-01

    A Multi-Configuration-Dirac-Fock (MCDF) computer program is adapted to interface with the Hartree-Fock-Relativistic (HFR) program for the RAL IBM mainframe computer. The two codes are integrated into a package which includes the Zeeman Laboratory Slater parameter optimisation routines as well as new RAL routines to further process the HFR and MCDF output. A description of the adaptions to MCDF and new output extensions is included in this report, and details are given regarding HFR FORTRAN subroutines, and lists of Job Control Language (JCL) files for the complete package. (author)

  10. Características de la práctica físico-deportiva del alumnado con discapacidad de la Universitat de València

    OpenAIRE

    Úbeda Colomer, Joan; Campos Granell, José; Llopis Goig, Ramón; Torregrosa Cabrera, Miguel Ángel

    2015-01-01

    En la actualidad, la actividad físico-deportiva es fundamental para las personas con discapacidad debido a los múltiples beneficios físicos, psicológicos y sociales que aporta (Patel y Greydanus, 2010; Slater y Meade, 2004). Estudiar las características de la práctica físico-deportiva de este colectivo puede ser útil para poder desarrollar estrategias y programas que mejoren y aumenten dicha práctica (Bragaru,van Wilgen, Geertzen, Ruijs, Dijsktra y Dekker, 2013). Pese a ello, apenas existen e...

  11. CARACTERÍSTICAS DE LA PRÁCTICA FÍSICO-DEPORTIVA DEL ALUMNADO CON DISCAPACIDAD DE LA UNIVERSITAT DE VALÈNCIA

    OpenAIRE

    Joan Úbeda Colomer; José Campos Granell; Ramón Llopis Goig; Miguel Ángel Torregrosa Cabrera

    2015-01-01

    En la actualidad, la actividad físico-deportiva es fundamental para las personas con discapacidad debido a los múltiples beneficios físicos, psicológicos y sociales que aporta (Patel y Greydanus, 2010; Slater y Meade, 2004). Estudiar las características de la práctica físico-deportiva de este colectivo puede ser útil para poder desarrollar estrategias y programas que mejoren y aumenten dicha práctica (Bragaru, van Wilgen, Geertzen, Ruijs, Dijsktra y Dekker, 2013). Pese a ello, apenas existen ...

  12. Handbook of Gaussian basis sets

    International Nuclear Information System (INIS)

    Poirier, R.; Kari, R.; Csizmadia, I.G.

    1985-01-01

    A collection of a large body of information is presented useful for chemists involved in molecular Gaussian computations. Every effort has been made by the authors to collect all available data for cartesian Gaussian as found in the literature up to July of 1984. The data in this text includes a large collection of polarization function exponents but in this case the collection is not complete. Exponents for Slater type orbitals (STO) were included for completeness. This text offers a collection of Gaussian exponents primarily without criticism. (Auth.)

  13. Structure of the first order reduced density matrix in three electron systems: A generalized Pauli constraints assisted study.

    Science.gov (United States)

    Theophilou, Iris; Lathiotakis, Nektarios N; Helbig, Nicole

    2018-03-21

    We investigate the structure of the one-body reduced density matrix of three electron systems, i.e., doublet and quadruplet spin configurations, corresponding to the smallest interacting system with an open-shell ground state. To this end, we use configuration interaction (CI) expansions of the exact wave function in Slater determinants built from natural orbitals in a finite dimensional Hilbert space. With the exception of maximally polarized systems, the natural orbitals of spin eigenstates are generally spin dependent, i.e., the spatial parts of the up and down natural orbitals form two different sets. A measure to quantify this spin dependence is introduced and it is shown that it varies by several orders of magnitude depending on the system. We also study the ordering issue of the spin-dependent occupation numbers which has practical implications in reduced density matrix functional theory minimization schemes, when generalized Pauli constraints (GPCs) are imposed and in the form of the CI expansion in terms of the natural orbitals. Finally, we discuss the aforementioned CI expansion when there are GPCs that are almost "pinned."

  14. Electronic structure of lanthanide scandates

    Science.gov (United States)

    Mizzi, Christopher A.; Koirala, Pratik; Marks, Laurence D.

    2018-02-01

    X-ray photoelectron spectroscopy, ultraviolet photoelectron spectroscopy, and density functional theory calculations were used to study the electronic structure of three lanthanide scandates: GdSc O3,TbSc O3 , and DySc O3 . X-ray photoelectron spectra simulated from first-principles calculations using a combination of on-site hybrid and GGA +U methods were found to be in good agreement with experimental x-ray photoelectron spectra. The hybrid method was used to model the ground state electronic structure and the GGA +U method accounted for the shift of valence state energies due to photoelectron emission via a Slater-Janak transition state approach. From these results, the lanthanide scandate valence bands were determined to be composed of Ln 4 f ,O 2 p , and Sc 3 d states, in agreement with previous work. However, contrary to previous work the minority Ln 4 f states were found to be located closer to, and in some cases at, the valence band maximum. This suggests that minority Ln 4 f electrons may play a larger role in lanthanide scandate properties than previously thought.

  15. 9Be scattering with microscopic wave functions and the continuum-discretized coupled-channel method

    Science.gov (United States)

    Descouvemont, P.; Itagaki, N.

    2018-01-01

    We use microscopic 9Be wave functions defined in a α +α +n multicluster model to compute 9Be+target scattering cross sections. The parameter sets describing 9Be are generated in the spirit of the stochastic variational method, and the optimal solution is obtained by superposing Slater determinants and by diagonalizing the Hamiltonian. The 9Be three-body continuum is approximated by square-integral wave functions. The 9Be microscopic wave functions are then used in a continuum-discretized coupled-channel (CDCC) calculation of 9Be+208Pb and of 9Be+27Al elastic scattering. Without any parameter fitting, we obtain a fair agreement with experiment. For a heavy target, the influence of 9Be breakup is important, while it is weaker for light targets. This result confirms previous nonmicroscopic CDCC calculations. One of the main advantages of the microscopic CDCC is that it is based on nucleon-target interactions only; there is no adjustable parameter. The present work represents a first step towards more ambitious calculations involving heavier Be isotopes.

  16. Structure of the first order reduced density matrix in three electron systems: A generalized Pauli constraints assisted study

    Science.gov (United States)

    Theophilou, Iris; Lathiotakis, Nektarios N.; Helbig, Nicole

    2018-03-01

    We investigate the structure of the one-body reduced density matrix of three electron systems, i.e., doublet and quadruplet spin configurations, corresponding to the smallest interacting system with an open-shell ground state. To this end, we use configuration interaction (CI) expansions of the exact wave function in Slater determinants built from natural orbitals in a finite dimensional Hilbert space. With the exception of maximally polarized systems, the natural orbitals of spin eigenstates are generally spin dependent, i.e., the spatial parts of the up and down natural orbitals form two different sets. A measure to quantify this spin dependence is introduced and it is shown that it varies by several orders of magnitude depending on the system. We also study the ordering issue of the spin-dependent occupation numbers which has practical implications in reduced density matrix functional theory minimization schemes, when generalized Pauli constraints (GPCs) are imposed and in the form of the CI expansion in terms of the natural orbitals. Finally, we discuss the aforementioned CI expansion when there are GPCs that are almost "pinned."

  17. Ab initio nuclear structure - the large sparse matrix eigenvalue problem

    Energy Technology Data Exchange (ETDEWEB)

    Vary, James P; Maris, Pieter [Department of Physics, Iowa State University, Ames, IA, 50011 (United States); Ng, Esmond; Yang, Chao [Computational Research Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Sosonkina, Masha, E-mail: jvary@iastate.ed [Scalable Computing Laboratory, Ames Laboratory, Iowa State University, Ames, IA, 50011 (United States)

    2009-07-01

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 10{sup 10} and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

  18. Ab initio nuclear structure - the large sparse matrix eigenvalue problem

    International Nuclear Information System (INIS)

    Vary, James P; Maris, Pieter; Ng, Esmond; Yang, Chao; Sosonkina, Masha

    2009-01-01

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 10 10 and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

  19. Solution chemistry of element 105. Pt. III. Hydrolysis and complex formation of Nb, Ta, Db and Pa in HF and HBr solutions

    International Nuclear Information System (INIS)

    Pershina, V.; Bastug, T.

    1999-01-01

    Calculations of the electronic structure of MF 6 - and MBr 6 - complexes of Nb, Ta, Pa and element 105, Db, formed in HF and HBr solutions have been performed using the Dirac-Slater Discrete Variational method. On the basis of results of these calculations, relative values of the free energy change of reactions of complex formation have been determined. The order of the complex formation for both acids is shown to be Pa >> Nb > Db > Ta. Such a sequence is defined by a predominant electrostatic energy of the metal-ligand interaction. The hydrolysis of compounds, as a reverse process, proved to change as Ta > Db > Nb >> Pa. Using the theory of metal extraction by anion exchange, the following trend in the extraction of the anionic species from both the HF and HBr aqueous solutions has been predicted: Pa >> Nb ≥ Db > Ta. The strength of the ML 6 - complexes is shown to decrease from MF 6 , to MCl 6 and further to MBr 6 - which is reflected by shifting the complex formation process to the area of higher acid concentrations. (orig.)

  20. Extended analysis and the ionization potential of the Ni III spectrum

    International Nuclear Information System (INIS)

    Garcia-Riquelme, O.; Rico, F.R.

    1992-01-01

    The Ni III spectrum emitted from a sliding spark in He, has been recorded in the UV 1300-1800A, on the 10.7m normal incidence vacuum spectrograph (plate factor 0.77A/mm), at the NIST in Washington. The low lying configurations 3d 7 4s, 3d 7 4p have been revised, new lines classified and the transitions 4p-4d, 4p-5s analyzed. The analysis has been extended to the spectral region up to 9000A and new terms from the electronic configurations 3d 7 5d, 6s, 5p, 4f and 5g have been identified. Theoretical Slater parametric calculations for these configurations and least square fits to the experimental levels have been performed. The ionization potential has been determined to 283 800±150cm -1 or 35.19±0.02eV. Table of new levels, the list of classified lines in the analyzed ranges 1300-1800, 2200-9000A, and the (LSF) parameters for the calculated configurations, are given. (orig.)

  1. Literacy, imagination and autonomy in A House for Mr. Biswas = Letramento, autonomia e imaginação em A House for Mr. Biswas

    Directory of Open Access Journals (Sweden)

    Mariana Bolfarine

    2012-01-01

    Full Text Available The present article tackles the concepts of literacy, imagination and autonomy in A House for Mr. Biswas (1961 by V. S. Naipaul. The novel reveals that the spread of the English language and Englishness became inevitable during British Imperialism since one of the instruments for its propagation was the imposition of the colonizer’s set of values. It will be shown that although limited and detached from the learners’ reality depicted in the narrative, the missionary school education engendered the imagination as a driving force upon which the protagonist, Mr. Biswas, relies in order to achieve his dreams of autonomy. Theory is mostly foregrounded on works by David Slater, Boaventura dos Santos and Diana Brydon.O presente artigo versa sobre os conceitos de letramento (literacy, imaginação e autonomia em A House for Mr. Biswas (1961, de V. S. Naipaul. O romance revela que a difusão da língua inglesa e da inglesidade (englishness tornou-se inevitável durante o imperialismo britânico, na medida em que estes eram instrumentos de propagação dos valores do colonizador. Demonstraremos que, apesar de limitada e desvinculada da realidade retratada na obra, era a educação proporcionada pelas escolas de missionários que engendrava a imaginação, força motriz que permite ao protagonista, Sr. Biswas, alcançar o seu desejo de autonomia. O campo teórico é constituído principalmente pelos estudos de David Slater, Boaventura dos Santos e Diana Brydon.

  2. Photoelectron angular distribution parameters for elements Z=55 to Z=100 in the photoelectron energy range 100-5000 eV

    CERN Document Server

    Trzhaskovskaya, M B; Yarzhemsky, V G

    2002-01-01

    Presented here are parameters of the angular distribution of photoelectrons along with the subshell photoionization cross sections for all atoms with 55<=Z<=100 and for atomic shells with binding energies lower than 2000 eV. The parameters are given for nine photoelectron energies in the range 100-5000 eV. Relativistic calculations have been carried out within the quadrupole approximation by the use of the central Dirac-Fock-Slater potential. The effect of the hole resulting in the atomic subshell after photoionization has been taken into account in the framework of the frozen orbital approximation.

  3. Further microscopic studies of the fission barriers of heavy nuclei

    International Nuclear Information System (INIS)

    Nhan Hao, T.V.; Le Bloas, J.; Bonneau, L.; Quentin, P.; Koh, Meng-Hock

    2012-01-01

    Two systematic sources of error in most current microscopic evaluations of fission-barrier heights are studied. They are concerned with an approximate treatment of the Coulomb exchange terms (known as the Slater approximation) in the self-consistent mean-fields and the projection on good parity states (e.g., of positive parity for the spontaneous fission of an even–even nucleus) of left–right reflection asymmetric intrinsic solutions (e.g., around the second barrier). Approximate or unprojected solutions are shown to lead each to an underestimation of the barrier heights by a few hundred keV. (author)

  4. Solving conic optimization problems via self-dual embedding and facial reduction: A unified approach

    DEFF Research Database (Denmark)

    Permenter, Frank; Friberg, Henrik A.; Andersen, Erling D.

    2017-01-01

    it fails to return a primal-dual optimal solution or a certificate of infeasibility. Using this observation, we give an algorithm based on facial reduction for solving the primal problem that, in principle, always succeeds. (An analogous algorithm is easily stated for the dual problem.) This algorithm has...... the appealing property that it only performs facial reduction when it is required, not when it is possible; e.g., if a primal-dual optimal solution exists, it will be found in lieu of a facial reduction certificate even if Slater's condition fails. For the case of linear, second-order, and semidefinite...

  5. Electronic absorption spectral studies of Pr(III) chelates with some amino acids

    Science.gov (United States)

    Kachhawa, Chanchal; Solanki, Kanika; Bhandari, H. S.

    2018-05-01

    Investigations on Pr(III) systems with 1:1 metal-ligand stoichiometric ratio have been carried out in different solvents. β - Alanine, Taurine and anthranilic acid have been opted as ligands for the investigations. The Study is based on doped crystal phenomenon. The Slater-Condon, spin-orbit, nephelauxetic, bonding, Racah and Judd-Ofelt parameters have been explored during the study. Four bands for Pr(III) have been observed and recorded in the region 350 nm to 900nm. Partial regression method has been used for calculations. Use of computational chemistry has been explored in order to develop better and easier methods of calculations.

  6. CONDOR simulation of an 11.4-GHz traveling wave output cavity

    International Nuclear Information System (INIS)

    Goren, Y.; Yu, D.

    1991-01-01

    The CONDOR code is used to simulate the cold test and the beam-induced microwave amplification of an 11.4-GHz, six-cell, disk-loaded, traveling wave cavity. Cold test simulation results are in agreement with a modified Slater's theory. Power extraction at the output port is calculated by launching a train of Gaussian electron bunches through the structure. Results are consistent with recent relativistic klystron experiments using a similar TW output cavity. It is further shown that, depending on operating beam parameters, the power extraction efficiency can be maximized by modification of various cells in the TW structure

  7. On the imaginary part of the S-wave pion-nucleus optical potential

    International Nuclear Information System (INIS)

    Germond, J.F.; Lombard, R.J.

    1991-01-01

    The contribution of pion absorption to the imaginary part of the S-wave pion-nucleus optical potential is calculated with Slater determinantal antisymmetrized nuclear wave funtions, taking fully into accout the spin and isospin degrees of freedom. The potential obtained has an explicit dependence on the proton and neutron nuclear densities whose coefficients are directly related to the two-nucleon absorption coupling constants. The values of these coefficients extracted from mesic atoms data are in good agreement with those deduced from exclusive pion absorption experiments in 3 He, but larger than the predictions of the pion rescattering model. (orig.)

  8. Low-energy rate enhancement in recombination processes of electrons into bare uranium ions

    International Nuclear Information System (INIS)

    Wu Yong; Zeng Siliang; Duan Bin; Yan Jun; Wang Jianguo; Chinese Academy of Sciences, Lanzhou; Dong Chenzhong; Ma Xinwen

    2007-01-01

    Based on the Dirac-Fork-Slater method combined with the multichannel quantum defect theory, the recombination processes of electrons into bare uranium ions (U 92+ ) are investigated in the relative energy range close to zero, and the x-ray spectrum emitted in the direct radiative recombination and cascades processes are simulated. Compared with the recent measurement, it is found that the rate enhancement comes from the additional populations on high Rydberg states. These additional populations may be produced by other recombination mechanisms, such as the external electric-magnetic effects and the many-body correlation effects, which still remains an open problem. (authors)

  9. A Hartree-Fock program for atomic structure calculations

    International Nuclear Information System (INIS)

    Mitroy, J.

    1999-01-01

    The Hartree-Fock equations for a general open shell atom are described. The matrix equations that result when the single particle orbitals are written in terms of a linear combination of analytic basis functions are derived. Attention is paid to the complexities that occur when open shells are present. The specifics of a working FORTRAN program which is available for public use are described. The program has the flexibility to handle either Slater-type orbitals or Gaussian-type orbitals. It can be obtained over the internet at http://lacebark.ntu.edu.au/j_mitroy/research/atomic.htm Copyright (1999) CSIRO Australia

  10. Variational Optimization of the Second-Order Density Matrix Corresponding to a Seniority-Zero Configuration Interaction Wave Function.

    Science.gov (United States)

    Poelmans, Ward; Van Raemdonck, Mario; Verstichel, Brecht; De Baerdemacker, Stijn; Torre, Alicia; Lain, Luis; Massaccesi, Gustavo E; Alcoba, Diego R; Bultinck, Patrick; Van Neck, Dimitri

    2015-09-08

    We perform a direct variational determination of the second-order (two-particle) density matrix corresponding to a many-electron system, under a restricted set of the two-index N-representability P-, Q-, and G-conditions. In addition, we impose a set of necessary constraints that the two-particle density matrix must be derivable from a doubly occupied many-electron wave function, i.e., a singlet wave function for which the Slater determinant decomposition only contains determinants in which spatial orbitals are doubly occupied. We rederive the two-index N-representability conditions first found by Weinhold and Wilson and apply them to various benchmark systems (linear hydrogen chains, He, N2, and CN(-)). This work is motivated by the fact that a doubly occupied many-electron wave function captures in many cases the bulk of the static correlation. Compared to the general case, the structure of doubly occupied two-particle density matrices causes the associate semidefinite program to have a very favorable scaling as L(3), where L is the number of spatial orbitals. Since the doubly occupied Hilbert space depends on the choice of the orbitals, variational calculation steps of the two-particle density matrix are interspersed with orbital-optimization steps (based on Jacobi rotations in the space of the spatial orbitals). We also point to the importance of symmetry breaking of the orbitals when performing calculations in a doubly occupied framework.

  11. A Jeziorski-Monkhorst fully uncontracted multi-reference perturbative treatment. I. Principles, second-order versions, and tests on ground state potential energy curves

    Science.gov (United States)

    Giner, Emmanuel; Angeli, Celestino; Garniron, Yann; Scemama, Anthony; Malrieu, Jean-Paul

    2017-06-01

    The present paper introduces a new multi-reference perturbation approach developed at second order, based on a Jeziorski-Mokhorst expansion using individual Slater determinants as perturbers. Thanks to this choice of perturbers, an effective Hamiltonian may be built, allowing for the dressing of the Hamiltonian matrix within the reference space, assumed here to be a CAS-CI. Such a formulation accounts then for the coupling between the static and dynamic correlation effects. With our new definition of zeroth-order energies, these two approaches are strictly size-extensive provided that local orbitals are used, as numerically illustrated here and formally demonstrated in the Appendix. Also, the present formalism allows for the factorization of all double excitation operators, just as in internally contracted approaches, strongly reducing the computational cost of these two approaches with respect to other determinant-based perturbation theories. The accuracy of these methods has been investigated on ground-state potential curves up to full dissociation limits for a set of six molecules involving single, double, and triple bond breaking together with an excited state calculation. The spectroscopic constants obtained with the present methods are found to be in very good agreement with the full configuration interaction results. As the present formalism does not use any parameter or numerically unstable operation, the curves obtained with the two methods are smooth all along the dissociation path.

  12. Electronic structure and magnetic properties of quaternary Heusler alloys CoRhMnZ (Z = Al, Ga, Ge and Si) via first-principle calculations

    Energy Technology Data Exchange (ETDEWEB)

    Benkabou, M. [Laboratoire des Matériaux Magnétiques, Faculté des Sciences, Université DjillaliLiabès de Sidi Bel-Abbès, Sidi Bel-Abbès 22000 (Algeria); Rached, H. [Laboratoire des Matériaux Magnétiques, Faculté des Sciences, Université DjillaliLiabès de Sidi Bel-Abbès, Sidi Bel-Abbès 22000 (Algeria); Département de Physique, Faculté des Sciences, Université Hassiba Benbouali, Chlef 02000 (Algeria); Abdellaoui, A. [Laboratoire des Matériaux Magnétiques, Faculté des Sciences, Université DjillaliLiabès de Sidi Bel-Abbès, Sidi Bel-Abbès 22000 (Algeria); Rached, D., E-mail: rachdj@yahoo.fr [Laboratoire des Matériaux Magnétiques, Faculté des Sciences, Université DjillaliLiabès de Sidi Bel-Abbès, Sidi Bel-Abbès 22000 (Algeria); Khenata, R. [Laboratoire de Physique Quantique et de Modélisation Mathématique de la Matière, (LPQ3M), Université de Mascara, Mascara 29000 (Algeria); and others

    2015-10-25

    First-principle calculations are performed to predict the electronic structure and elastic and magnetic properties of CoRhMnZ (Z = Al, Ga, Ge and Si) Heusler alloys. The calculations employ the full-potential linearized augmented plane wave. The exchange-correlations are treated within the generalized gradient approximation of Perdew–Burke and Ernzerhof (GGA-PBE). The electronic structure calculations show that these compounds exhibit a gap in the minority states band and are clearly half-metallic ferromagnets, with the exception of the CoRhMnAl and CoRhMnGa, which are simple ferromagnets that are nearly half metallic in nature. The CoRhMnGe and CoRhMnSi compounds and their magnetic moments are in reasonable agreement with the Slater-Pauling rule, which indicates the half metallicity and high spin polarization for these compounds. At the pressure transitions, these compounds undergo a structural phase transition from the Y-type I → Y-type II phase. We have determined the elastic constants C{sub 11}, C{sub 12} and C{sub 44} and their pressure dependence, which have not previously been established experimentally or theoretically. - Highlights: • Based on DFT calculations, CoRhMnZ (Z = Al, Ga, Ge and Si) Heusler alloys were investigated. • The magnetic phase stability was determined from the total energy calculations. • The mechanical properties were investigated.

  13. Generalized Pauli constraints in small atoms

    Science.gov (United States)

    Schilling, Christian; Altunbulak, Murat; Knecht, Stefan; Lopes, Alexandre; Whitfield, James D.; Christandl, Matthias; Gross, David; Reiher, Markus

    2018-05-01

    The natural occupation numbers of fermionic systems are subject to nontrivial constraints, which include and extend the original Pauli principle. A recent mathematical breakthrough has clarified their mathematical structure and has opened up the possibility of a systematic analysis. Early investigations have found evidence that these constraints are exactly saturated in several physically relevant systems, e.g., in a certain electronic state of the beryllium atom. It has been suggested that, in such cases, the constraints, rather than the details of the Hamiltonian, dictate the system's qualitative behavior. Here, we revisit this question with state-of-the-art numerical methods for small atoms. We find that the constraints are, in fact, not exactly saturated, but that they lie much closer to the surface defined by the constraints than the geometry of the problem would suggest. While the results seem incompatible with the statement that the generalized Pauli constraints drive the behavior of these systems, they suggest that the qualitatively correct wave-function expansions can in some systems already be obtained on the basis of a limited number of Slater determinants, which is in line with numerical evidence from quantum chemistry.

  14. Matrix elements and few-body calculations within the unitary correlation operator method

    International Nuclear Information System (INIS)

    Roth, R.; Hergert, H.; Papakonstantinou, P.

    2005-01-01

    We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges. (orig.)

  15. Matrix elements and few-body calculations within the unitary correlation operator method

    International Nuclear Information System (INIS)

    Roth, R.; Hergert, H.; Papakonstantinou, P.; Neff, T.; Feldmeier, H.

    2005-01-01

    We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges

  16. Higher-Order Statistical Correlations and Mutual Information Among Particles in a Quantum Well

    Science.gov (United States)

    Yépez, V. S.; Sagar, R. P.; Laguna, H. G.

    2017-12-01

    The influence of wave function symmetry on statistical correlation is studied for the case of three non-interacting spin-free quantum particles in a unidimensional box, in position and in momentum space. Higher-order statistical correlations occurring among the three particles in this quantum system is quantified via higher-order mutual information and compared to the correlation between pairs of variables in this model, and to the correlation in the two-particle system. The results for the higher-order mutual information show that there are states where the symmetric wave functions are more correlated than the antisymmetric ones with same quantum numbers. This holds in position as well as in momentum space. This behavior is opposite to that observed for the correlation between pairs of variables in this model, and the two-particle system, where the antisymmetric wave functions are in general more correlated. These results are also consistent with those observed in a system of three uncoupled oscillators. The use of higher-order mutual information as a correlation measure, is monitored and examined by considering a superposition of states or systems with two Slater determinants.

  17. Auxiliary-field quantum Monte Carlo calculations of molecular systems with a Gaussian basis

    International Nuclear Information System (INIS)

    Al-Saidi, W.A.; Zhang Shiwei; Krakauer, Henry

    2006-01-01

    We extend the recently introduced phaseless auxiliary-field quantum Monte Carlo (QMC) approach to any single-particle basis and apply it to molecular systems with Gaussian basis sets. QMC methods in general scale favorably with the system size as a low power. A QMC approach with auxiliary fields, in principle, allows an exact solution of the Schroedinger equation in the chosen basis. However, the well-known sign/phase problem causes the statistical noise to increase exponentially. The phaseless method controls this problem by constraining the paths in the auxiliary-field path integrals with an approximate phase condition that depends on a trial wave function. In the present calculations, the trial wave function is a single Slater determinant from a Hartree-Fock calculation. The calculated all-electron total energies show typical systematic errors of no more than a few millihartrees compared to exact results. At equilibrium geometries in the molecules we studied, this accuracy is roughly comparable to that of coupled cluster with single and double excitations and with noniterative triples [CCSD(T)]. For stretched bonds in H 2 O, our method exhibits a better overall accuracy and a more uniform behavior than CCSD(T)

  18. Higher-Order Statistical Correlations and Mutual Information Among Particles in a Quantum Well

    International Nuclear Information System (INIS)

    Yépez, V. S.; Sagar, R. P.; Laguna, H. G.

    2017-01-01

    The influence of wave function symmetry on statistical correlation is studied for the case of three non-interacting spin-free quantum particles in a unidimensional box, in position and in momentum space. Higher-order statistical correlations occurring among the three particles in this quantum system is quantified via higher-order mutual information and compared to the correlation between pairs of variables in this model, and to the correlation in the two-particle system. The results for the higher-order mutual information show that there are states where the symmetric wave functions are more correlated than the antisymmetric ones with same quantum numbers. This holds in position as well as in momentum space. This behavior is opposite to that observed for the correlation between pairs of variables in this model, and the two-particle system, where the antisymmetric wave functions are in general more correlated. These results are also consistent with those observed in a system of three uncoupled oscillators. The use of higher-order mutual information as a correlation measure, is monitored and examined by considering a superposition of states or systems with two Slater determinants. (author)

  19. Structural stability, electronic and magnetic behaviour of spin-polarized YCoVZ (Z = Si, Ge) and YCoTiZ (Z = Si, Ge) Heusler alloys

    Energy Technology Data Exchange (ETDEWEB)

    Rasool, Muhammad Nasir, E-mail: nasir4iub@gmail.com [Department of Physics, The Islamia University of Bahawalpur, Bahawalpur, 63100 (Pakistan); Hussain, Altaf, E-mail: altafiub@yahoo.com [Department of Physics, The Islamia University of Bahawalpur, Bahawalpur, 63100 (Pakistan); Javed, Athar [Department of Physics, University of the Punjab, Lahore, 54590 (Pakistan); Khan, Muhammad Azhar; Iqbal, F. [Department of Physics, The Islamia University of Bahawalpur, Bahawalpur, 63100 (Pakistan)

    2016-11-01

    The structural stability, electronic and magnetic behaviour of YCoVZ (Z = Si, Ge) and YCoTiZ (Z = Si, Ge) Heusler alloys have been studied by first principle approach. Generalized gradient approximation (GGA) based on density functional theory (DFT) has been applied to investigate the properties of quaternary Heusler alloys. The YCoVSi, YCoVGe, YCoTiSi and YCoTiGe Heusler alloys of Type-3 structure are found to be stable in spin-polarized/magnetic phase. The YCoVSi and YCoVGe alloys exhibit nearly spin gapless semiconductor (SGS) behaviour while YCoTiSi and YCoTiGe alloys show half-metallic ferromagnetic (HMF) behaviour. For YCoVSi, YCoVGe, YCoTiSi and YCoTiGe alloys, the calculated energy band gaps in spin down (↓) channel are 0.60, 0.54, 0.68 and 0.44 eV, respectively. The YCoVZ and YCoTiZ alloys are found to have integral value of total magnetic moment (M{sub T}), thus obeying the Slater-Pauling rule, M{sub T} = (N{sub v}–18)μ{sub B}. - Highlights: • Four Heusler alloys i.e. YCoVZ (Z = Si, Ge) and YCoTiZ (Z = Si, Ge) are studied. • Type-3 crystal structure of all four alloys is stable in magnetic phase. • The compressibility (S) follows the order: S{sub YCoVSi} > S{sub YCoTiSi} > S{sub YCoVGe} > S{sub YCoTiGe}. • Half metallic ferromagnetic behaviour is observed in all four alloys. • All four alloys obey the Slater-Pauling rule, M{sub T} = (N{sub v} – 18)μ{sub B}.

  20. Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model

    Science.gov (United States)

    Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad

    2018-02-01

    In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.

  1. Ressituando a gentrificação: a classe popular, a ciência e o estado na pesquisa urbana recente

    OpenAIRE

    Wacquant,Loïc

    2010-01-01

    Este artigo amplia o diagnóstico de Tom Slater sobre as causas da gentrificação da pesquisa recente sobre gentrificação. Ele argumenta que o deslocamento de denúncia para celebração da gentrificação, a elisão do deslocamento dos residentes estabelecidos e o foco eufemístico em "mesclagem social" participam de um padrão de invisibilidade da classe operária na esfera pública e na investigação social. Essa obliteração do proletariado na cidade é reforçada pela heteronomia crescente da pesquisa u...

  2. DFTB{sup +} and lanthanides

    Energy Technology Data Exchange (ETDEWEB)

    Hourahine, B [Department of Physics, SUPA, University of Strathclyde, John Anderson Building, 107 Rottenrow, Glasgow G4 0NG (United Kingdom); Aradi, B; Frauenheim, T, E-mail: benjamin.hourahine@strath.ac.u [BCCMS, Universitaet Bremen, Am Fallturm 1, 28359 Bremen (Germany)

    2010-07-01

    DFTB{sup +} is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.

  3. Classical dynamics of triatomic system: energized harmonic molecules

    International Nuclear Information System (INIS)

    Parr, C.A.; Kuppermann, A.; Porter, R.N.

    1976-01-01

    The dynamical assumptions underlying the Slater and RRK classical-mechanical theories of unimolecular reaction rates are investigated. The predictions of these theories for several nonlinear, triatomic, harmonically-bonded molecular models are compared with the results obtained from the integration of the classical equations of motion. The accuracy of the small-vibration and weak-coupling assumptions are found to break down at energies above about one quarter of a bond dissociation energy. Nonetheless, the small-vibration approximation predicts reaction frequencies in good agreement with the exact results for the models. The effects of rotation on intramolecular energy exchange are examined and found to be significant

  4. Status on the heavy elements research using the DV-DFS method

    International Nuclear Information System (INIS)

    Hirata, Masaru; Bastug, T.; Sekine, Rika; Onoe, Jun; Nakamatsu, Hirohide; Mukoyama, Takeshi

    1999-03-01

    In this review report, we describe recent progress on the heavy elements research using the discrete-variational Dirac-Fock-Slater (DV-DFS) method which is being improved by Kyoto University, Shizuoka University, RIKEN and JAERI. The DV-DFS is a versatile method for interpreting spectroscopic data and predicting chemical bonding of polyatomic systems including heavy elements. This review is based on the lectures given in 74th spring meeting of chemical Society of Japan (March, 1998) and also at the workshop on the XAFS-relativistic electronic structure calculation for the actinides research which was held at Tokai Research Establishment of JAERI (November, 1998). (author)

  5. Vacancy induced half-metallicity in half-Heusler semiconductors

    KAUST Repository

    Zhu, Zhiyong

    2011-09-28

    First-principles calculations are performed to investigate the effect of vacancies on the electronic structure and magnetic properties of the two prototypical half-Heusler semiconductors NiTiSn and CoTiSb. The spin degeneracy of the host materials is broken for all types of isolated vacancies under consideration, except for Ni-deficient NiTiSn. A half-metallic character is identified in Sn-deficient NiTiSn and Co/Ti/Sb-deficient CoTiSb. We can explain our findings by introducing an extending Slater-Pauling rule for systems with defects. A ferromagnetic ordering of the local moments due to double exchange appears to be likely.

  6. Dielectric Relaxation of Water: Theory and Experiment

    International Nuclear Information System (INIS)

    Adhikari, Narayan Prasad; Paudyal, Harihar; Johri, Manoj

    2010-06-01

    We have studied the hydrogen bond dynamics and methods for evaluation of probability and relaxation time for hydrogen bond network. Further, dielectric relaxation time has been calculated by using a diagonalization procedure by obtaining eigen values (inverse of relaxation time) of a master equation framed on the basis of Fokker-Planck equations. Microwave cavity spectrometer has been described to make measurements of relaxation time. Slater's perturbation equations are given for the analysis of the data. A comparison of theoretical and experimental data shows that there is a need for improvements in the theoretical model and experimental techniques to provide exact information about structural properties of water. (author)

  7. Environment-dependent crystal-field tight-binding based on density-functional theory

    International Nuclear Information System (INIS)

    Urban, Alexander

    2012-01-01

    Electronic structure calculations based on Kohn-Sham density-functional theory (DFT) allow the accurate prediction of chemical bonding and materials properties. Due to the high computational demand DFT calculations are, however, restricted to structures containing at most several hundreds of atoms, i.e., to length scales of a few nanometers. Though, many processes of technological relevance, for example in the field of nanoelectronics, are governed by phenomena that occur on a slightly larger length scale of up to 100 nanometers, which corresponds to tens of thousands of atoms. The semiempirical Slater-Koster tight-binding (TB) method makes it feasible to calculate the electronic structure of such large systems. In contrast to first-principles-based DFT, which is universally applicable to almost all chemical species, the TB method is based on parametrized models that are usually specialized for a particular application or for one certain class of compounds. Usually the model parameters (Slater-Koster tables) are empirically adjusted to reproduce either experimental reference data (e.g., geometries, elastic constants) or data from first-principles methods such as DFT. The construction of a new TB model is therefore connected with a considerable effort that is often contrasted by a low transferability of the parametrization. In this thesis we develop a systematic methodology for the derivation of accurate and transferable TB models from DFT calculations. Our procedure exploits the formal relationship between the two methods, according to which the TB total energy can be understood as a direct approximation of the Kohn--Sham energy functional. The concept of our method is different to previous approaches such as the DFTB method, since it allows to extract TB parameters from converged DFT wave functions and Hamiltonians of arbitrary reference structures. In the following the different subjects of this thesis are briefly summarized. We introduce a new technique for the

  8. Systematic analysis of spectroscopic characteristics of the lanthanide and actinide ions with the 4f{sup N−1}5d and 5f{sup N−1}6d electronic configurations in a free state

    Energy Technology Data Exchange (ETDEWEB)

    Ma, C.-G. [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Brik, M.G., E-mail: brik@fi.tartu.ee [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Institute of Physics, University of Tartu, Riia 142, Tartu 51014 (Estonia); Institute of Physics, Jan Dlugosz University, Armii Krajowej 13/15, PL-42200 Czestochowa (Poland); Tian, Y.; Li, Q.-X. [College of Mathematics and Physics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China)

    2014-08-01

    Highlights: • Calculated spectroscopic parameters of f{sup N−1}d configurations of the 4f and 5f ions. • Relations between the Slater parameters, spin–orbit constant, atomic number were found. • Barycenters of the electronic configuration energies were calculated. • Obtained relations reduce the number of independent terms in a free ion Hamiltonian. - Abstract: Systematic consideration of the spectroscopic properties of the f{sup N−1}d excited electronic configurations of the di-, tri- and tetravalent lanthanide and actinide ions in a free state is presented. Variations of the Hartree–Fock calculated Slater parameters for the f{sup N−1}d electron configurations, spin–orbit (SO) interaction constant ζ for the f and d electrons, and averaged values of the second, fourth and sixth powers of the 4f, 5f, 5d, 6d electrons’ radial coordinate across both series were considered; functional dependencies between the mentioned quantities were obtained. It has been shown that the Coulomb interaction parameters F{sup 2}(ff), F{sup 4}(ff), and F{sup 6}(ff) for the f{sup N−1} core increase linearly with the atomic number Z, whereas the direct and exchange Coulomb parameters F{sup 2}(fd), F{sup 4}(fd), G{sup 1}(fd), G{sup 3}(fd), G{sup 5}(fd) for the f{sup N−1}d configuration decrease linearly with Z. Since the SO interaction constant ζ{sup 1/4} is also proportional to Z, it was possible to find linear relationships between the Coulomb interaction parameters and SO constants for the f and d electrons, which effectively reduce the number of independent parameters in the free ion Hamiltonian. The constraining relations between the free ion Hamiltonian’s parameters obtained in the present paper can be used for simulations of the f–d transition spectra of these ions in various crystals.

  9. The Development of the Planet Formation Concept Inventory: A Preliminary Analysis of Version 1

    Science.gov (United States)

    Simon, Molly; Impey, Chris David; Buxner, Sanlyn

    2018-01-01

    The topic of planet formation is poorly represented in the educational literature, especially at the college level. As recently as 2014, when developing the Test of Astronomy Standards (TOAST), Slater (2014) noted that for two topics (formation of the Solar System and cosmology), “high quality test items that reflect our current understanding of students’ conceptions were not available [in the literature]” (Slater,2014, p. 8). Furthermore, nearly half of ASTR 101 enrollments are at 2 year/community colleges where both instructors and students have little access to current research and models of planet formation. In response, we administered six student replied response (SSR) short answer questions on the topic of planet formation to n = 1,050 students enrolled in introductory astronomy and planetary science courses at The University of Arizona in the Fall 2016 and Spring 2017 semesters. After analyzing and coding the data from the SSR questions, we developed a preliminary version of the Planet Formation Concept Inventory (PFCI). The PFCI is a multiple-choice instrument with 20 planet formation-related questions, and 4 demographic-related questions. We administered version 1 of the PFCI to six introductory astronomy and planetary science courses (n ~ 700 students) during the Fall 2017 semester. We provided students with 7-8 multiple-choice with explanation of reasoning (MCER) questions from the PFCI. Students selected an answer (similar to a traditional multiple-choice test), and then briefly explained why they chose the answer they did. We also conducted interviews with ~15 students to receive feedback on the quality of the questions and clarity of the instrument. We will present an analysis of the MCER responses and student interviews, and discuss any modifications that will be made to the instrument as a result.

  10. Synthesis and characterization of Fe-Ti-Sb intermetallic compounds: Discovery of a new Slater-Pauling phase

    Science.gov (United States)

    Naghibolashrafi, N.; Keshavarz, S.; Hegde, Vinay I.; Gupta, A.; Butler, W. H.; Romero, J.; Munira, K.; LeClair, P.; Mazumdar, D.; Ma, J.; Ghosh, A. W.; Wolverton, C.

    2016-03-01

    Compounds of Fe, Ti, and Sb were prepared using arc melting and vacuum annealing. Fe2TiSb , expected to be a full Heusler compound crystallizing in the L 21 structure, was shown by XRD and SEM analyses to be composed of weakly magnetic grains of nominal composition Fe1.5TiSb with iron-rich precipitates in the grain boundaries. FeTiSb, a composition consistent with the formation of a half-Heusler compound, also decomposed into Fe1.5TiSb grains with Ti-Sb rich precipitates and was weakly magnetic. The dominant Fe1.5TiSb phase appears to crystallize in a defective L 21 -like structure with iron vacancies. Based on this finding, a first-principles DFT-based binary cluster expansion of Fe and vacancies on the Fe sublattice of the L 21 structure was performed. Using the cluster expansion, we computationally scanned >103 configurations and predict a novel, stable, nonmagnetic semiconductor phase to be the zero-temperature ground state. This new structure is an ordered arrangement of Fe and vacancies, belonging to the space group R 3 m , with composition Fe1.5TiSb , i.e., between the full- and half-Heusler compositions. This phase can be visualized as alternate layers of L 21 phase Fe2TiSb and C 1b phase FeTiSb, with layering along the [111] direction of the original cubic phases. Our experimental results on annealed samples support this predicted ground-state composition, but further work is required to confirm that the R 3 m structure is the ground state.

  11. 76 FR 43710 - Notice of Inventory Completion: Slater Museum of Natural History, University of Puget Sound...

    Science.gov (United States)

    2011-07-21

    ... Washington; Port Gamble Indian Community of the Port Gamble Reservation, Washington; Puyallup Tribe of the... Port Madison Reservation, Washington; Swinomish Indians of the Swinomish Reservation, Washington... alternating dry and wet conditions. Based on 14 morphological characteristics, a physical anthropologist...

  12. Spherical harmonic expansion of short-range screened Coulomb interactions

    Energy Technology Data Exchange (ETDEWEB)

    Angyan, Janos G [Laboratoire de Cristallographie et de Modelisation des Materiaux Mineraux et Biologiques, UMR 7036, CNRS-Universite Henri Poincare, BP 239, F-54506 Vandoeuvre-les-Nancy (France); Gerber, Iann [Laboratoire de Cristallographie et de Modelisation des Materiaux Mineraux et Biologiques, UMR 7036, CNRS-Universite Henri Poincare, BP 239, F-54506 Vandoeuvre-les-Nancy (France); Marsman, Martijn [Institut fuer Materialphysik and Center for Computational Materials Science, Universitaet Wien, Sensengasse 8, A-1090, Vienna (Austria)

    2006-07-07

    Spherical harmonic expansions of the screened Coulomb interaction kernel involving the complementary error function are required in various problems in atomic, molecular and solid state physics, like for the evaluation of Ewald-type lattice sums or for range-separated hybrid density functionals. A general analytical expression is derived for the kernel, which is non-separable in the radial variables. With the help of series expansions a separable approximate form is proposed, which is in close analogy with the conventional multipole expansion of the Coulomb kernel in spherical harmonics. The convergence behaviour of these expansions is studied and illustrated by the electrostatic potential of an elementary charge distribution formed by products of Slater-type atomic orbitals.

  13. The eugenic legacy in psychology and psychiatry.

    Science.gov (United States)

    Pilgrim, David

    2008-05-01

    Assumptions about genetic differences in human mental characteristics can be traced in large part to the eugenic movement, ascendant at the turn of the 20th century. This paper offers historical case studies, of 'innate general cognitive ability' and 'psychiatric genetics', in order to appraise the eugenic legacy in current psychology and psychiatry. Reviewing the work of representatives, Cyril Burt, Franz Kallmann and Eliot Slater, along with their research networks, it is argued that eugenics remains a quiet but powerful background influence in modern-day psychology and psychiatry. At the turn of the 21st century, eugenics remains an important area of inquiry, reflection and education for those in the inter-disciplinary field of social psychiatry.

  14. 199Hg Moessbauer measurements on mercury, alloys and Hg-fluorides

    International Nuclear Information System (INIS)

    Wurtinger, W.; Kankeleit, E.

    1979-01-01

    The Moessbauer effect on the 158 keV 5/2 - -1/2 - transition in 199 Hg, of the order of 10 ppm, has been studied using the current integration technique. The isomer shift between the Hg(I)- and Hg(II)-fluorides as well as the quadrupole splitting in Hg 2 Pt and Hg 2 F 2 are interpreted in terms of relativistic Hartree-Fock-Slater and Molecular Orbital calculations. The following nuclear parameters could be derived: Δ[r 2 ] = (3.2+-1.1) 10 -3 fm 2 and Q(5/2 - ) = (-0.8+-0.4)b. Evidence for an oblate triaxially deformed 199 Hg nucleus is derived from particle plus rotor calculations. (orig.)

  15. Quanty4RIXS: a program for crystal field multiplet calculations of RIXS and RIXS-MCD spectra using Quanty.

    Science.gov (United States)

    Zimmermann, Patric; Green, Robert J; Haverkort, Maurits W; de Groot, Frank M F

    2018-05-01

    Some initial instructions for the Quanty4RIXS program written in MATLAB ® are provided. The program assists in the calculation of 1s 2p RIXS and 1s 2p RIXS-MCD spectra using Quanty. Furthermore, 1s XAS and 2p 3d RIXS calculations in different symmetries can also be performed. It includes the Hartree-Fock values for the Slater integrals and spin-orbit interactions for several 3d transition metal ions that are required to create the .lua scripts containing all necessary parameters and quantum mechanical definitions for the calculations. The program can be used free of charge and is designed to allow for further adjustments of the scripts. open access.

  16. X-ray attenuation cross sections for energies 100 eV to 100 keV and elements Z = 1 to Z = 92

    International Nuclear Information System (INIS)

    Saloman, E.B.; Hubbell, J.H.; Scofield, J.H.

    1988-01-01

    This work presents for the energy range 0.1--100 keV the National Bureau of Standards (NBS) database of experimental x-ray attenuation coefficients (total absorption cross sections) and cross sections calculated using a relativistic Hartree--Slater model for the photoelectric cross section for all elements of atomic number Z = 1--92. The information is displayed in both tabular and graphical form. Also shown on the graphs are cross sections obtained using the semiempirical set of recommended values of B. L. Henke and co-workers (Atomic Data and Nuclear Data Tables 27, 1 (1982)). A bibliography of the NBS database for this energy range is included. copyright 1988 Academic Press, Inc

  17. The Mo/Ta (100) interface

    International Nuclear Information System (INIS)

    Quintanar, C.; Velasco, V.R.; Garcia-Moliner, F.

    1990-12-01

    We have calculated the interface local density of states (ILDOS) formed by the transition metals Mo/Ta using a tight-binding Slater-Koster description and the Green Function matching method together with quickly converging algorithms to compute the transfer matrices. We obtain the surface LDOS as a byproduct. Our result is a useful tool to analyze experimental results and to check models as a function of the value of the tight-binding parameters either of the bulk or at the interface itself. We consider the (100) direction. We compare the interface to the bulk and to the surface and comment on some recently found experimental results for this interface. (author). 17 refs, 2 figs

  18. Extended analysis of Br VIII and predicted trends for the n=4, Δn=0 transistions of nickel-like ions (Kr IX-Mo XV)

    International Nuclear Information System (INIS)

    Wyart, J.F.; Ryabtsev, A.N.

    1986-01-01

    More than one hundred lines of Br VIII have been classified in the spectral region 416-824 A, from which all levels of 3d 9 4d (except 1 S 0 ) have been found. The energy levels of the configurations 3d 9 4s, 3d 9 4p and 3d 9 4d have been interpreted from Zn III to Mo XV by means of the Slater-Condon theory and of generalized least squares techniques and the root mean square deviations are 8, 51 and 40 cm -1 respectively. The strongest lines of the 4s-4p and 4p-4d transitions are predicted from Kr IX to Mo XV. (orig.)

  19. Contribution to the projected Hartree-Fock method and microscopic theory of coupling between rotation bands

    International Nuclear Information System (INIS)

    Brut, F.

    1982-01-01

    The spectroscopy of odd-A nuclei, in the 1p and 2s-1d shells, is studied in the framework of the projected Hartree-Fock method and by the generator coordinate method. The nuclear effective interactions of Cohen and Kurath, on the one hand, and of Kuo or Preedom-Wildenthal, on the other hand, are used. The binding energies, the nuclear spectra, the static moments and the electromagnetic transitions obtained by these two approaches are compared to the same quantities given by a complete diagonalization in the shell model basis. This study of light nuclei gives some possibilities to put in order the energy levels by coupled rotational bands. In the microscopic approach, thus we find all the elements of the unified model of Bohr and Mottelson. To give evidence of such a relation, the functions of the angle β, in the integrals of the projection method of Peierls and Yoccoz, for a Slater determinant, are developed in the vicinity of the bounds β = O and β = π. The microscopic coefficients are evaluated in the Hartree-Fock approximation, using the particle-hole formalism. Calculations are made for 20 Ne and 21 Ne and the resulting microscopic coefficients are compared with the corresponding terms of the unified model of Bohr and Mottelson [fr

  20. Elastic properties of Sr- and Mg-doped lanthanum gallate at elevated temperature

    Science.gov (United States)

    Okamura, T.; Shimizu, S.; Mogi, M.; Tanimura, M.; Furuya, K.; Munakata, F.

    The elastic moduli, i.e., Young's modulus, shear modulus and Poisson's ratio, of a sintered La 0.9Sr 0.1Ga 0.8Mg 0.2O 3- δ bulk have been experimentally determined in the temperature range from room temperature to 1373 K using a resonance technique. Anomalous elastic properties were observed over a wide temperature range from 473 to 1173 K. In the results for internal friction and in X-ray diffraction measurements at elevated temperature, two varieties of structural changes were seen in La 0.9Sr 0.1Ga 0.8Mg 0.2O 3- δ in the examined temperature range. The results agreed with the findings of a previous crystallographic study of the same composition system by Slater et al. In addition, the temperature range in which a successive structural change occurred in La 0.9Sr 0.1Ga 0.8Mg 0.2O 3- δ was the same as that exhibiting the anomalous elastic properties. Taking all the results together, it can be inferred that the successive structural change in the significant temperature range is responsible for the elastic property anomaly of La 0.9Sr 0.1Ga 0.8Mg 0.2O 3- δ.

  1. Cluster form factor calculation in the ab initio no-core shell model

    International Nuclear Information System (INIS)

    Navratil, Petr

    2004-01-01

    We derive expressions for cluster overlap integrals or channel cluster form factors for ab initio no-core shell model (NCSM) wave functions. These are used to obtain the spectroscopic factors and can serve as a starting point for the description of low-energy nuclear reactions. We consider the composite system and the target nucleus to be described in the Slater determinant (SD) harmonic oscillator (HO) basis while the projectile eigenstate to be expanded in the Jacobi coordinate HO basis. This is the most practical case. The spurious center of mass components present in the SD bases are removed exactly. The calculated cluster overlap integrals are translationally invariant. As an illustration, we present results of cluster form factor calculations for 5 He vertical bar 4 He+n>, 5 He vertical bar 3 H+d>, 6 Li vertical bar 4 He+d>, 6 Be vertical bar 3 He+ 3 He>, 7 Li vertical bar 4 He+ 3 H>, 7 Li vertical bar 6 Li+n>, 8 Be vertical bar 6 Li+d>, 8 Be vertical bar 7 Li+p>, 9 Li vertical bar 8 Li+n>, and 13 C vertical bar 12 C+n>, with all the nuclei described by multi-(ℎ/2π)Ω NCSM wave functions

  2. Investigation of electronic, magnetic and thermoelectric properties of Zr{sub 2}NiZ (Z = Al,Ga) ferromagnets

    Energy Technology Data Exchange (ETDEWEB)

    Yousuf, Saleem, E-mail: nengroosaleem17@gmail.com; Gupta, Dinesh C., E-mail: sosfizix@gmail.com

    2017-05-01

    Systematic investigation of impact of electronic structure and magnetism, on the thermoelectric properties of new Zr{sub 2}NiZ (Z = Al, Ga) Heusler alloys are determined using density functional theory calculations. Half-metallicity with ferromagnetic character is supported by their 100% spin polarizations at the Fermi level. Magnetic moment of ∼3 μ{sub B} is according to the Slater-Puling rule, enables their practical applications. Electron density plots are used to analyse the nature of bonding and chemical composition. Boltzmann's theory is conveniently employed to investigate the thermoelectric properties of these compounds. The analysis of the thermal transport properties specifies the Seebeck coefficient as 25.6 μV/K and 18.6 μV/K at room temperature for Zr{sub 2}NiAl and Zr{sub 2}NiGa, respectively. The half-metallic nature with efficient thermoelectric coefficients suggests the likelihood of these materials to have application in designing spintronic devices and imminent thermoelectric materials. - Highlights: • The compounds are half-metallic ferromagnets. • 100% spin-polarized compounds for spintronics. • Increasing Seebeck coefficient over a wide temperature range. • Zr{sub 2}NiAl is efficient thermoelectric material than Zr{sub 2}NiGa.

  3. Application of the resonating Hartree-Fock random phase approximation to the Lipkin model

    International Nuclear Information System (INIS)

    Nishiyama, S.; Ishida, K.; Ido, M.

    1996-01-01

    We have applied the resonating Hartree-Fock (Res-HF) approximation to the exactly solvable Lipkin model by utilizing a newly developed orbital-optimization algorithm. The Res-HF wave function was superposed by two Slater determinants (S-dets) which give two corresponding local energy minima of monopole ''deformations''. The self-consistent Res-HF calculation gives an excellent ground-state correlation energy. There exist excitations due to small vibrational fluctuations of the orbitals and mixing coefficients around their stationary values. They are described by a new approximation called the resonating Hartree-Fock random phase approximation (Res-HF RPA). Matrices of the second-order variation of the Res-HF energy have the same structures as those of the Res-HF RPA's matrices. The quadratic steepest descent of the Res-HF energy in the orbital optimization is considered to include certainly both effects of RPA-type fluctuations up to higher orders and their mode-mode couplings. It is a very important and interesting task to apply the Res-HF RPA to the Lipkin model with the use of the stationary values and to prove the above argument. It turns out that the Res-HF RPA works far better than the usual HF RPA and the renormalized one. We also show some important features of the Res-HF RPA. (orig.)

  4. A new approach to the semi-classical relativistic two-body problem for charged fermions

    International Nuclear Information System (INIS)

    Leiter, D.

    1978-01-01

    Generalizing from a recently developed hybrid formulation of classical electrodynamics with ''direct (charge-field) action'' structure an analogous semi-classical Dirac formulation of the theory is constructed, which is capable of describing the semi-classical quantum mechanics of two identical spin-1/2 particles. This semi-classical formulation is to be used as a heuristic aid in searching for the theoretical structure of a fully ''second quantized'' theory. The Pauli exclusion principle is incorporated by making the interaction fields (in the action principle) antisymmetric with respect to ''charge-field'' labeling. In this manner, ''position correlation'' effects associated with ''configuration interaction'' can also be accounted for. By studying the nature of the stationary-state solutions, the formalism is compared with the conventional quantum-mechanical one (to understand the similarities and the differences between this approach and the usual correlated Hartree-Fock approximation of ordinary relativistic quantum theory). The stationary-state solutions to the semi-classical formalism are shown to closely approximate the usual quantum-mechanical solutions when the wave functions are represented as a superposition of Slater determinants of Dirac-Coulombic-type wave functions with radial parts having a form which extremizes the total Breit energy. The manner in which this semi-classical theory might be extended to a fully ''second quantized'' formalism is sketched. (author)

  5. Self-consistent average-atom scheme for electronic structure of hot and dense plasmas of mixture

    International Nuclear Information System (INIS)

    Yuan Jianmin

    2002-01-01

    An average-atom model is proposed to treat the electronic structures of hot and dense plasmas of mixture. It is assumed that the electron density consists of two parts. The first one is a uniform distribution with a constant value, which is equal to the electron density at the boundaries between the atoms. The second one is the total electron density minus the first constant distribution. The volume of each kind of atom is proportional to the sum of the charges of the second electron part and of the nucleus within each atomic sphere. By this way, one can make sure that electrical neutrality is satisfied within each atomic sphere. Because the integration of the electron charge within each atom needs the size of that atom in advance, the calculation is carried out in a usual self-consistent way. The occupation numbers of electron on the orbitals of each kind of atom are determined by the Fermi-Dirac distribution with the same chemical potential for all kinds of atoms. The wave functions and the orbital energies are calculated with the Dirac-Slater equations. As examples, the electronic structures of the mixture of Au and Cd, water (H 2 O), and CO 2 at a few temperatures and densities are presented

  6. Self-consistent average-atom scheme for electronic structure of hot and dense plasmas of mixture.

    Science.gov (United States)

    Yuan, Jianmin

    2002-10-01

    An average-atom model is proposed to treat the electronic structures of hot and dense plasmas of mixture. It is assumed that the electron density consists of two parts. The first one is a uniform distribution with a constant value, which is equal to the electron density at the boundaries between the atoms. The second one is the total electron density minus the first constant distribution. The volume of each kind of atom is proportional to the sum of the charges of the second electron part and of the nucleus within each atomic sphere. By this way, one can make sure that electrical neutrality is satisfied within each atomic sphere. Because the integration of the electron charge within each atom needs the size of that atom in advance, the calculation is carried out in a usual self-consistent way. The occupation numbers of electron on the orbitals of each kind of atom are determined by the Fermi-Dirac distribution with the same chemical potential for all kinds of atoms. The wave functions and the orbital energies are calculated with the Dirac-Slater equations. As examples, the electronic structures of the mixture of Au and Cd, water (H2O), and CO2 at a few temperatures and densities are presented.

  7. The multifacet graphically contracted function method. I. Formulation and implementation

    International Nuclear Information System (INIS)

    Shepard, Ron; Brozell, Scott R.; Gidofalvi, Gergely

    2014-01-01

    The basic formulation for the multifacet generalization of the graphically contracted function (MFGCF) electronic structure method is presented. The analysis includes the discussion of linear dependency and redundancy of the arc factor parameters, the computation of reduced density matrices, Hamiltonian matrix construction, spin-density matrix construction, the computation of optimization gradients for single-state and state-averaged calculations, graphical wave function analysis, and the efficient computation of configuration state function and Slater determinant expansion coefficients. Timings are given for Hamiltonian matrix element and analytic optimization gradient computations for a range of model problems for full-CI Shavitt graphs, and it is observed that both the energy and the gradient computation scale as O(N 2 n 4 ) for N electrons and n orbitals. The important arithmetic operations are within dense matrix-matrix product computational kernels, resulting in a computationally efficient procedure. An initial implementation of the method is used to present applications to several challenging chemical systems, including N 2 dissociation, cubic H 8 dissociation, the symmetric dissociation of H 2 O, and the insertion of Be into H 2 . The results are compared to the exact full-CI values and also to those of the previous single-facet GCF expansion form

  8. The multifacet graphically contracted function method. I. Formulation and implementation

    Science.gov (United States)

    Shepard, Ron; Gidofalvi, Gergely; Brozell, Scott R.

    2014-08-01

    The basic formulation for the multifacet generalization of the graphically contracted function (MFGCF) electronic structure method is presented. The analysis includes the discussion of linear dependency and redundancy of the arc factor parameters, the computation of reduced density matrices, Hamiltonian matrix construction, spin-density matrix construction, the computation of optimization gradients for single-state and state-averaged calculations, graphical wave function analysis, and the efficient computation of configuration state function and Slater determinant expansion coefficients. Timings are given for Hamiltonian matrix element and analytic optimization gradient computations for a range of model problems for full-CI Shavitt graphs, and it is observed that both the energy and the gradient computation scale as O(N2n4) for N electrons and n orbitals. The important arithmetic operations are within dense matrix-matrix product computational kernels, resulting in a computationally efficient procedure. An initial implementation of the method is used to present applications to several challenging chemical systems, including N2 dissociation, cubic H8 dissociation, the symmetric dissociation of H2O, and the insertion of Be into H2. The results are compared to the exact full-CI values and also to those of the previous single-facet GCF expansion form.

  9. Computation of many-particle quantum trajectories with exchange interaction: application to the simulation of nanoelectronic devices

    International Nuclear Information System (INIS)

    Alarcón, A; Yaro, S; Cartoixà, X; Oriols, X

    2013-01-01

    Following Oriols (2007 Phys. Rev. Lett. 98 066803), an algorithm to deal with the exchange interaction in non-separable quantum systems is presented. The algorithm can be applied to fermions or bosons and, by construction, it exactly ensures that any observable is totally independent of the interchange of particles. It is based on the use of conditional Bohmian wave functions which are solutions of single-particle pseudo-Schrödinger equations. The exchange symmetry is directly defined by demanding symmetry properties of the quantum trajectories in the configuration space with a universal algorithm, rather than through a particular exchange–correlation functional introduced into the single-particle pseudo-Schrödinger equation. It requires the computation of N 2 conditional wave functions to deal with N identical particles. For separable Hamiltonians, the algorithm reduces to the standard Slater determinant for fermions (or permanent for bosons). A numerical test for a two-particle system, where exact solutions for non-separable Hamiltonians are computationally accessible, is presented. The numerical viability of the algorithm for quantum electron transport (in a far-from-equilibrium time-dependent open system) is demonstrated by computing the current and fluctuations in a nano-resistor, with exchange and Coulomb interactions among electrons. (paper)

  10. Statistical approach for calculating opacities of high-Z plasmas

    International Nuclear Information System (INIS)

    Nishikawa, Takeshi; Nakamura, Shinji; Takabe, Hideaki; Mima, Kunioki

    1992-01-01

    For simulating the X-ray radiation from laser produced high-Z plasma, an appropriate atomic modeling is necessary. Based on the average ion model, we have used a rather simple atomic model for opacity calculation in a hydrodynamic code and obtained a fairly good agreement with the experiment on the X-ray spectra from the laser-produced plasmas. We have investigated the accuracy of the atomic model used in the hydrodynamic code. It is found that transition energies of 4p-4d, 4d-4f, 4p-5d, 4d-5f and 4f-5g, which are important in laser produced high-Z plasma, can be given within an error of 15 % compared to the values by the Hartree-Fock-Slater (HFS) calculation and their oscillator strengths obtained by HFS calculation vary by a factor two according to the difference of charge state. We also propose a statistical method to carry out detail configuration accounting for electronic state by use of the population of bound electrons calculated with the average ion model. The statistical method is relatively simple and provides much improvement in calculating spectral opacities of line radiation, when we use the average ion model to determine electronic state. (author)

  11. Time-dependent density functional theory/discrete reaction field spectra of open shell systems: The visual spectrum of [FeIII(PyPepS)2]- in aqueous solution.

    Science.gov (United States)

    van Duijnen, Piet Th; Greene, Shannon N; Richards, Nigel G J

    2007-07-28

    We report the calculated visible spectrum of [FeIII(PyPepS)2]- in aqueous solution. From all-classical molecular dynamics simulations on the solute and 200 water molecules with a polarizable force field, 25 solute/solvent configurations were chosen at random from a 50 ps production run and subjected the systems to calculations using time-dependent density functional theory (TD-DFT) for the solute, combined with a solvation model in which the water molecules carry charges and polarizabilities. In each calculation the first 60 excited states were collected in order to span the experimental spectrum. Since the solute has a doublet ground state several excitations to states are of type "three electrons in three orbitals," each of which gives rise to a manifold of a quartet and two doublet states which cannot properly be represented by single Slater determinants. We applied a tentative scheme to analyze this type of spin contamination in terms of Delta and Delta transitions between the same orbital pairs. Assuming the associated states as pure single determinants obtained from restricted calculations, we construct conformation state functions (CFSs), i.e., eigenfunctions of the Hamiltonian Sz and S2, for the two doublets and the quartet for each Delta,Delta pair, the necessary parameters coming from regular and spin-flip calculations. It appears that the lower final states remain where they were originally calculated, while the higher states move up by some tenths of an eV. In this case filtering out these higher states gives a spectrum that compares very well with experiment, but nevertheless we suggest investigating a possible (re)formulation of TD-DFT in terms of CFSs rather than determinants.

  12. Inner-shell couplings in transiently formed superheavy quasimolecules

    Energy Technology Data Exchange (ETDEWEB)

    Verma, P [Kalindi College, University of Delhi, New Delhi 110008 (India); Mokler, P H [Max-Planck-Institut fuer Kernphysik, 69117 Heidelberg (Germany); Braeuning-Demian, A; Kozhuharov, C; Braeuning, H; Bosch, F; Hagmann, S; Liesen, D [GSI Helmholzzentrum fuer Schwerionenforschung, 64291 Darmstadt (Germany); Anton, J; Fricke, B [Universitaet Kassel, 34109 Kassel (Germany); Stachura, Z [Institute for Nuclear Physics, Cracow PL 31342 (Poland); Wahab, M A, E-mail: p.verma.du@gmail.com [Jamia Millia Islamia, Jamia Nagar, New Delhi 110025 (India)

    2011-06-15

    The inner-shell couplings for U{sup q+}-ions (73{<=}q{<=}91) moving moderately slow at {approx}69 MeV u{sup -1} and bombarding thin Au targets have been investigated. Having established the definite survival probability of incoming projectile K vacancies in these targets in an earlier publication, the transfer of these vacancies to the target K-shell due to inner-shell couplings has been studied. As the system is in the quasiadiabatic collision regime for the K-shell of collision partners, advanced SCF-DFS (self-consistent field-Dirac-Fock-Slater) multielectron level diagrams have been used for interpretation. Using a simple model, the L-K shell coupling interaction distance has been estimated and compared with level diagram calculations.

  13. Mathematical methods in quantum and statistical mechanics

    International Nuclear Information System (INIS)

    Fishman, L.

    1977-01-01

    The mathematical structure and closed-form solutions pertaining to several physical problems in quantum and statistical mechanics are examined in some detail. The J-matrix method, introduced previously for s-wave scattering and based upon well-established Hilbert Space theory and related generalized integral transformation techniques, is extended to treat the lth partial wave kinetic energy and Coulomb Hamiltonians within the context of square integrable (L 2 ), Laguerre (Slater), and oscillator (Gaussian) basis sets. The theory of relaxation in statistical mechanics within the context of the theory of linear integro-differential equations of the Master Equation type and their corresponding Markov processes is examined. Several topics of a mathematical nature concerning various computational aspects of the L 2 approach to quantum scattering theory are discussed

  14. Kinetic-energy matrix elements for atomic Hylleraas-CI wave functions

    Energy Technology Data Exchange (ETDEWEB)

    Harris, Frank E., E-mail: harris@qtp.ufl.edu [Department of Physics, University of Utah, Salt Lake City, Utah 84112, USA and Quantum Theory Project, University of Florida, P.O. Box 118435, Gainesville, Florida 32611 (United States)

    2016-05-28

    Hylleraas-CI is a superposition-of-configurations method in which each configuration is constructed from a Slater-type orbital (STO) product to which is appended (linearly) at most one interelectron distance r{sub ij}. Computations of the kinetic energy for atoms by this method have been difficult due to the lack of formulas expressing these matrix elements for general angular momentum in terms of overlap and potential-energy integrals. It is shown here that a strategic application of angular-momentum theory, including the use of vector spherical harmonics, enables the reduction of all atomic kinetic-energy integrals to overlap and potential-energy matrix elements. The new formulas are validated by showing that they yield correct results for a large number of integrals published by other investigators.

  15. On the treatment of light-ion electronic stopping in dense matter

    Energy Technology Data Exchange (ETDEWEB)

    Schiwietz, G. (Hahn-Meitner-Inst. Berlin GmbH, Div., FD (Germany)); Grande, P.L. (Hahn-Meitner-Inst. Berlin GmbH, Div., FD (Germany))

    1994-05-01

    A review is given on single-electron mechanisms and the corresponding theoretical approaches describing the electronic energy-transfer processes of light ions in gases and solids. Special emphasis is given to a discussion on the connection between exact Bloch-wave treatments and free-atom approximations. In the case of solids, perturbation theory is applied to the stopping of low-energy ions in the alkaline metals Li and Na. These calculations include Bloch wavefunctions of the Wigner-Seitz type obtained from a Hartree-Fock-Slater calculation and allow for a prediction of the mean energy loss under channeling conditions. Results of the most widely used local-density approximation are compared to data of our more complete perturbative treatment. Comparison is also made with recent LCAO calculations. (orig.)

  16. Filling of double vacancy in the K atomic shell with emission of one single photon

    International Nuclear Information System (INIS)

    Jalbert, G.

    1978-12-01

    A method was developed to calculate the transition rate for two-electron one-photon K(sub αα) transition (2s 2p → 1s 2 ). The method was tested for Ni with two K-shell vacancies in the initial state. The (sub αα) rate is calculated within the framework of a single system formed by the atom and the radiation. The transition is originated in the interactiion between the parts of that system. In the dipole approximation, the transition rate is obtained from the second order term of the time dependente perturbation theory. Hartree-Fock-Slater wave functions were used in the calculations for Ni. The results are compared with the available theoretical and experimental information. (Author) [pt

  17. Calculation of the electronic and magnetic structures of 3d impurities in the Hcp Fe matrix

    International Nuclear Information System (INIS)

    Franca, Fernando

    1995-01-01

    In this work we investigate the local magnetic properties and the electronic structure of HCP Fe, as well introducing transition metals atoms 3d (Cs, Ti, Cr, Mn, Co, Ni, Cu, Zn) in HCP iron matrix. We employed the discrete variational method (DVM), which is an orbital molecular method which incorporate the Hartree-Fock-Slater theory and the linear combination of atomic orbitals (LCAO), in the self-consistent charge approximation and the local density approximation of Von Barth and Hedin to the exchange-correlation potential. We used the embedded cluster model to investigate the electronic structure and the local magnetic properties for the central atom of a cluster of 27 atoms immersed in the microcrystal representing the HCP Fe. (author)

  18. Calculation of the electronic and magnetic structures of 3d impurities in the Hcp Fe matrix; Calculo da estrutura eletronica e magnetica de impurezas 3d na matriz do Fe HCP

    Energy Technology Data Exchange (ETDEWEB)

    Franca, Fernando

    1995-12-31

    In this work we investigate the local magnetic properties and the electronic structure of HCP Fe, as well introducing transition metals atoms 3d (Cs, Ti, Cr, Mn, Co, Ni, Cu, Zn) in HCP iron matrix. We employed the discrete variational method (DVM), which is an orbital molecular method which incorporate the Hartree-Fock-Slater theory and the linear combination of atomic orbitals (LCAO), in the self-consistent charge approximation and the local density approximation of Von Barth and Hedin to the exchange-correlation potential. We used the embedded cluster model to investigate the electronic structure and the local magnetic properties for the central atom of a cluster of 27 atoms immersed in the microcrystal representing the HCP Fe. (author) 32 refs., 19 figs., 2 tabs.

  19. Bonding and energy parameters for Pr and Nd complexes of benzimidazoles

    Energy Technology Data Exchange (ETDEWEB)

    Mittal, S; Vyas, P C; Oza, C K [Rajasthan Univ., Jaipur (India). Dept. of Chemistry

    1991-01-01

    Complexes of praseodymium(III) and neodymium(III) with benzimidazoles have been synthesized and characterized by their conductance and infrared spectral studies. The values of interelectronic repulsion, i.e. Slater-Condon (F{sub 2}, F{sub 4}, F{sub 6}), Racah (E{sup 1}, E{sup 2}, E{sup 3}) parameters and spin-orbit interaction referred as Lande' ({zeta}4f) parameters have been calculated from their electronic spectral data. A comparison of these parameters for the complexes with Pr{sup 3+} and Nd{sup 3+} free ion parameters is discussed. Using F{sub 2} values, the nephelauxetic ratio({Beta}) and bonding parameter(b{sup 1/2}) have beeen calculated. The relative variation of covalent bonding in the complexes has been reported. (author). 11 refs., 1 tab.

  20. How good are the internal conversion coefficients now?

    International Nuclear Information System (INIS)

    Raman, S.; Nestor, C.W. Jr.; Ichihara, A.; Trzhaskovskaya, M.B.

    2002-01-01

    To fully utilize experimental internal conversion coefficients, one needs a reliable calculation of theoretical values. We have assembled a set of 100 experimental conversion coefficients, 45 α K and 55 α T values, measured with an accuracy of better than 5%, and generated the corresponding theoretical values using two methods, relativistic Hartree-Fock-Slater (RHFS) and relativistic Dirac-Fock (DF). Extensive comparisons of the experimental values with the two sets of theoretical values show that the DF method is clearly superior to the RHFS method in the overall reproduction of the experimental internal conversion coefficients. We discuss in some detail the differences between various versions of these two theoretical approaches, with a view to understanding which of these differences are most critical to obtaining agreement with experiment

  1. Sex determination

    Indian Academy of Sciences (India)

    The sex-determining system differs considerably among organisms. Even among insect species, the genetic system for sex-determination is highly diversified. In Drosophila melanogaster, somatic sexual differentiation is regulated by a well characterized genetic hierarchy X : A > Sxl > tra/tra2 > dsx and fru. This cascade ...

  2. A supply chain management strategy for the non-ferrous foundry industry in South Africa / by Arland Slater

    OpenAIRE

    Slater, Arland

    2004-01-01

    In today's global knowledge economy, progressive companies must be equipped with a good balance of internal knowledge, both in scope and depth, and must adapt to the rapidly changing business environment. The ability of an organisation to manage knowledge as a corporate strategy is becoming a key competitive advantage. The essence of building an organisation's strength or capability in strategic knowledge management is to deepen the understanding of the exploitation and explora...

  3. Position automatic determination technology

    International Nuclear Information System (INIS)

    1985-10-01

    This book tells of method of position determination and characteristic, control method of position determination and point of design, point of sensor choice for position detector, position determination of digital control system, application of clutch break in high frequency position determination, automation technique of position determination, position determination by electromagnetic clutch and break, air cylinder, cam and solenoid, stop position control of automatic guide vehicle, stacker crane and automatic transfer control.

  4. Determination of cerium

    International Nuclear Information System (INIS)

    Stepin, V.V.; Kurbatova, V.I.; Fedorova, N.D.

    1980-01-01

    Techniques of cerium determination in steels and alloys are developed. Amperometric method of determination which is based on Ce(4) titration by a solution of double salt of sulfuric Fe(2) and ammonium when cerium amount exceeds 0.01% is suggested. Cerium is oxidated to tetravalent state by KMnO 4 . The elements interfering with the determination (Cr, Ni etc.) are separated by means of deposition. When cerium content exceeds 0.005% in steels and alloys the determination is carried out using photometric method with arsenazo 3 in hydrochloric medium (pH 1.8-2.3). Optimum concentration is 5-50 μg [ru

  5. Cave age determination

    International Nuclear Information System (INIS)

    Anon.

    1998-01-01

    To determine the age of a cave we have to determine the age of elements which were created at the same moment when the cave was. Usually a cave is dug out by infiltration of acid waters. During this alteration process rocks free some aluminium and potassium ions. In Carlsbad and Lechuguilla caves, scientists have found alunite, this aluminium and potassium sulfate can be dated by using the carbon method of age determination. (A.C.)

  6. Electrodynamics of spin currents in superconductors

    International Nuclear Information System (INIS)

    Hirsch, J.E.

    2008-01-01

    In recent work we formulated a new set of electrodynamic equations for superconductors as an alternative to the conventional London equations, compatible with the prediction of the theory of hole superconductivity that superconductors expel negative charge from the interior towards the surface. Charge expulsion results in a macroscopically inhomogeneous charge distribution and an electric field in the interior, and because of this a spin current is expected to exist. Furthermore, we have recently shown that a dynamical explanation of the Meissner effect in superconductors leads to the prediction that a spontaneous spin current exists near the surface of superconductors (spin Meissner effect). In this paper we extend the electrodynamic equations proposed earlier for the charge density and charge current to describe also the space and time dependence of the spin density and spin current. This allows us to determine the magnitude of the expelled negative charge and interior electric field as well as of the spin current in terms of other measurable properties of superconductors. We also provide a 'geometric' interpretation of the difference between type I and type II superconductors, discuss how superconductors manage to conserve angular momentum, discuss the relationship between our model and Slater's seminal work on superconductivity, and discuss the magnitude of the expected novel effects for elemental and other superconductors. (Abstract Copyright [2008], Wiley Periodicals, Inc.)

  7. Symmetry broken and restored coupled-cluster theory: I. Rotational symmetry and angular momentum

    International Nuclear Information System (INIS)

    Duguet, T

    2015-01-01

    We extend coupled-cluster (CC) theory performed on top of a Slater determinant breaking rotational symmetry to allow for the exact restoration of the angular momentum at any truncation order. The main objective relates to the description of near-degenerate finite quantum systems with an open-shell character. As such, the newly developed many-body formalism offers a wealth of potential applications and further extensions dedicated to the ab initio description of, e.g., doubly open-shell atomic nuclei and molecule dissociation. The formalism, which encompasses both single-reference CC theory and projected Hartree–Fock theory as particular cases, permits the computation of usual sets of connected diagrams while consistently incorporating static correlations through the highly non-perturbative restoration of rotational symmetry. Interestingly, the yrast spectroscopy of the system, i.e. the lowest energy associated with each angular momentum, is accessed within a single calculation. A key difficulty presently overcome relates to the necessity to handle generalized energy and norm kernels for which naturally terminating CC expansions could be eventually obtained. The present work focuses on SU(2) but can be extended to any (locally) compact Lie group and to discrete groups, such as most point groups. In particular, the formalism will be soon generalized to U(1) symmetry associated with particle number conservation. This is relevant to Bogoliubov CC theory that was recently applied to singly open-shell nuclei. (paper)

  8. Time-dependent exchange and tunneling: detection at the same place of two electrons emitted simultaneously from different sources

    International Nuclear Information System (INIS)

    Marian, D; Colomés, E; Oriols, X

    2015-01-01

    Two-particle scattering probabilities in tunneling scenarios with exchange interaction are analyzed with quasi-particle wave packets. Two initial one-particle wave packets (with opposite central momentums) are spatially localized at each side of a barrier. After impinging upon a tunneling barrier, each wave packet splits into transmitted and reflected components. When the initial two-particle anti-symmetrical state is defined as a Slater determinant of any type of (normalizable) one-particle wave packet, it is shown that the probability of detecting two (identically injected) electrons at the same side of the barrier is different from zero in very common (single or double barrier) scenarios. In some particular scenarios, the transmitted and reflected components become orthogonal and the mentioned probabilities reproduce those values associated to distinguishable particles. These unexpected non-zero probabilities are still present when non-separable Coulomb interaction or non-symmetrical potentials are considered. On the other hand, for initial wave packets close to Hamiltonian eigenstates, the usual zero two-particle probability for electrons at the same side of the barrier found in the literature is recovered. The generalization to many-particle scattering probabilities with quasi-particle wave packets for low and high phase-space density are also analyzed. The far-reaching consequences of these non-zero probabilities in the accurate evaluation of quantum noise in mesoscopic systems are briefly indicated. (paper)

  9. Condensed phase QM/MM simulations utilizing the exchange core functions to describe exchange repulsions at the QM boundary region

    International Nuclear Information System (INIS)

    Umino, Satoru; Takahashi, Hideaki; Morita, Akihiro

    2016-01-01

    In a recent work, we developed a method [H. Takahashi et al., J. Chem. Phys. 143, 084104 (2015)] referred to as exchange-core function (ECF) approach, to compute exchange repulsion E ex between solute and solvent in the framework of the quantum mechanical (QM)/molecular mechanical (MM) method. The ECF, represented with a Slater function, plays an essential role in determining E ex on the basis of the overlap model. In the work of Takahashi et al. [J. Chem. Phys. 143, 084104 (2015)], it was demonstrated that our approach is successful in computing the hydrogen bond energies of minimal QM/MM systems including a cationic QM solute. We provide in this paper the extension of the ECF approach to the free energy calculation in condensed phase QM/MM systems by combining the ECF and the QM/MM-ER approach [H. Takahashi et al., J. Chem. Phys. 121, 3989 (2004)]. By virtue of the theory of solutions in energy representation, the free energy contribution δμ ex from the exchange repulsion was naturally formulated. We found that the ECF approach in combination with QM/MM-ER gives a substantial improvement on the calculation of the hydration free energy of a hydronium ion. This can be attributed to the fact that the ECF reasonably realizes the contraction of the electron density of the cation due to the deficit of an electron.

  10. Unconventional Magnetism and Band Gap Formation in LiFePO4: Consequence of Polyanion Induced Non-planarity.

    Science.gov (United States)

    Jena, Ajit; Nanda, B R K

    2016-01-21

    Oxygen plays a critical role in strongly correlated transition metal oxides as crystal field effect is one of the key factors that determine the degree of localization of the valence d/f states. Based on the localization, a set of conventional mechanisms such as Mott-Hubbard, Charge-transfer and Slater were formulated to explain the antiferromagnetic and insulating (AFI) phenomena in many of these correlated systems. From the case study on LiFePO4, through density-functional calculations, we demonstrate that none of these mechanisms are strictly applicable to explain the AFI behavior when the transition metal oxides have polyanions such as (PO4)(3-). The symmetry-lowering of the metal-oxygen complex, to stabilize the polyanion, creates an asymmetric crystal field for d/f states. In LiFePO4 this field creates completely non-degenerate Fe-d states which, with negligible p-d and d-d covalent interactions, become atomically localized to ensure a gap at the Fermi level. Due to large exchange splitting, high spin state is favored and an antiferromagnetic configuration is stabilized. For the prototype LiFePO4, independent electron approximation is good enough to obtain the AFI ground state. Inclusion of additional correlation measures like Hubbard U simply amplifies the gap and therefore LiFePO4 can be preferably called as weakly coupled Mott insulator.

  11. Alcohol advertising and youth.

    Science.gov (United States)

    Martin, Susan E; Snyder, Leslie B; Hamilton, Mark; Fleming-Milici, Fran; Slater, Michael D; Stacy, Alan; Chen, Meng-Jinn; Grube, Joel W

    2002-06-01

    This article presents the proceedings of a symposium at the 2001 Research Society on Alcoholism meeting in Montreal, Canada. The symposium was organized and chaired by Joel W. Grube. The presentations and presenters were (1) Introduction and background, by Susan E. Martin; (2) The effect of alcohol ads on youth 15-26 years old, by Leslie Snyder, Mark Hamilton, Fran Fleming-Milici, and Michael D. Slater; (3) A comparison of exposure to alcohol advertising and drinking behavior in elementary versus middle school children, by Phyllis L. Ellickson and Rebecca L. Collins; (4) USC health and advertising project: assessment study on alcohol advertisement memory and exposure, by Alan Stacy; and (5) TV beer and soft drink advertising: what young people like and what effects? by Meng-Jinn Chen and Joel W. Grube.

  12. Structural, electronic, and magnetic properties of pristine and oxygen-adsorbed graphene nanoribbons

    Energy Technology Data Exchange (ETDEWEB)

    Miwa, R.H.; Veiga, R.G.A. [Instituto de Fisica, Universidade Federal de Uberlandia, Caixa Postal 593, CEP 38400-902, Uberlandia, MG (Brazil); Srivastava, G.P., E-mail: gps@excc.ex.ac.uk [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)

    2010-07-15

    The structural, electronic and magnetic properties of pristine and oxygen-adsorbed (3,0) zigzag and (6,1) armchair graphene nanoribbons have been investigated theoretically, by employing the ab initio pseudopotential method within the density functional scheme. The zigzag nanoribbon is more stable with antiferromagnetically coupled edges, and is semiconducting. The armchair nanoribbon does not show any preference for magnetic ordering and is semiconducting. The oxygen molecule in its triplet state is adsorbed most stably at the edge of the zigzag nanoribbon. The Stoner metallic behaviour of the ferromagnetic nanoribbons and the Slater insulating (ground state) behaviour of the antiferromagnetic nanoribbons remain intact upon oxygen adsorption. However, the local magnetic moment of the edge carbon atom of the ferromagnetic zigzag ribbon is drastically reduced, due to the formation of a spin-paired C-O bond.

  13. Curvature of the Lanthanide Contraction: An Explanation

    Energy Technology Data Exchange (ETDEWEB)

    Raymond, Kenneth; Wellman, Daniel; Sgarlata, Carmelo; Hill, Aru

    2009-12-21

    A number of studies have shown that for isostructural series of the lanthanides (elements La through Lu), a plot of equivalent metal-ligand bond lengths versus atomic number differs significantly from linearity and can be better fit as a quadratic equation. However, for hydrogen type wave functions, it is the inverse of the average distance of the electron from the nucleus (an estimate of size) that varies linearly with effective nuclear charge. This generates an apparent quadratic dependence of radius with atomic number. Plotting the inverse of lanthanide ion radii (the observed distance minus the ligand size) as a function of effective nuclear charge gives very good linear fits for a variety of lanthanide complexes and materials. Parameters obtained from this fit are in excellent agreement with the calculated Slater shielding constant, k.

  14. Orientação para Aprendizagem, Orientação para Mercado e Desempenho Organizacional: Evidências Empíricas

    Directory of Open Access Journals (Sweden)

    Eduardo Botti Abbade

    2012-01-01

    Full Text Available This study aims to identify how learning orientation (LO and market orientation (MO influence theperformance of enterprises in the central region of the state of Rio Grande do Sul (RS, Brazil. The method usedinvolved a survey of 123 companies in central RS. The instrument for data collection was developed using theLO scale (Sinkula, Baker, & Noordewier, 1997, the MARKOR scale (Kohli, Jaworski, & Kumar, 1993 anditems for evaluation of organizational performance proposed by Narver and Slater (1990 and Baker and Sinkula(1999. The results suggest that MO has a significant positive influence on the organizational performance of thecompanies surveyed. It was also noted that the MO significantly influences organizational performance whenmediated by the LO, just as the LO has a significant influence on organizational performance when mediated byMO.

  15. Sampling procedures using optical-data and partial wave cross sections in a Monte Carlo code for simulating kilovolt electron and positron transport in solids

    International Nuclear Information System (INIS)

    Fernandez-Varea, J.M.; Salvat, F.; Liljequist, D.

    1994-09-01

    The details of a Monte Carlo code for computing the penetration and energy loss of electrons and positrons in solids are described. The code, intended for electrons and positrons with energies from ∼ 100 eV to ∼ 100 keV, is based on the simulation of individual elastic and inelastic collisions. Elastic collisions are simulated using differential cross sections computed by the relativistic partial wave method applied to a muffin-tin Dirac-Hartree-Fock-Slater potential. Inelastic collisions are simulated by means of a model based on optical and photoelectric data, which are extended to the non-zero momentum transfer region by means of somewhat different algorithms for valence electron excitations and inner-shell excitations. This report focuses on the description of detailed formulae and sampling methods. 10 refs, 3 figs, 8 tabs

  16. Analysis of the spectrum six times ionized zinc (Zn VII): the 3d6-3d54p transition array

    International Nuclear Information System (INIS)

    Hof, G.H. van het; Joshi, Y.N.; Raassen, A.J.J.; Ryabtsev, A.N.

    1993-01-01

    The spectrum of zinc was photographed in the 100-300 A region on a 10.7 m grazing incidence spectrograph using a triggered spark light source. 335 lines were classified in the Zn VII 3d 6 -3d 5 4p transition array, resulting in the establishment of 30 of the 34 levels of the 3d 6 configuration and 103 of the 214 levels of the 3d 5 4p. The ground configuration 3d 6 was described by a generalized least-squares fit (GLSF) involving orthogonal operators to a set of 3d N configurations. This yielded a mean error of 3 cm -1 for its level values. The excited configruation was described by the conventional Slater Condon parameter set, giving a mean error of 105 cm -1 . (orig.)

  17. ATR confinement leakage determination

    International Nuclear Information System (INIS)

    Kuan, P.; Buescher, B.J.

    1998-01-01

    The air leakage rate from the Advanced Test Reactor (ATR) confinement is an important parameter in estimating hypothesized accidental releases of radiation to the environment. The leakage rate must be determined periodically to assure that the confinement has not degraded with time and such determination is one of the technical safety requirements of ATR operation. This paper reviews the methods of confinement leakage determination and presents an analysis of leakage determination under windy conditions, which can complicate the interpretation of the determined leakage rates. The paper also presents results of analyses of building air exchange under windy conditions. High wind can enhance air exchange and this could increase the release rates of radioisotopes following an accident

  18. Statistical Attitude Determination

    Science.gov (United States)

    Markley, F. Landis

    2010-01-01

    All spacecraft require attitude determination at some level of accuracy. This can be a very coarse requirement of tens of degrees, in order to point solar arrays at the sun, or a very fine requirement in the milliarcsecond range, as required by Hubble Space Telescope. A toolbox of attitude determination methods, applicable across this wide range, has been developed over the years. There have been many advances in the thirty years since the publication of Reference, but the fundamentals remain the same. One significant change is that onboard attitude determination has largely superseded ground-based attitude determination, due to the greatly increased power of onboard computers. The availability of relatively inexpensive radiation-hardened microprocessors has led to the development of "smart" sensors, with autonomous star trackers being the first spacecraft application. Another new development is attitude determination using interferometry of radio signals from the Global Positioning System (GPS) constellation. This article reviews both the classic material and these newer developments at approximately the level of, with emphasis on. methods suitable for use onboard a spacecraft. We discuss both "single frame" methods that are based on measurements taken at a single point in time, and sequential methods that use information about spacecraft dynamics to combine the information from a time series of measurements.

  19. Hartree-fock-slater method for materials science the DV-X alpha method for design and characterization of materials

    CERN Document Server

    Adachi, H; Kawai, J

    2006-01-01

    Molecular-orbital calculations for materials design such as alloys, ceramics, and coordination compounds are now possible for experimentalists. Molecuar-orbital calculations for the interpretation of chemical effect of spectra are also possible for experimentalists. The most suitable molecular-orbital calculation method for these purpose is the DV-Xa method, which is robust in such a way that the calculation converges to a result even if the structure of the molecule or solid is impossible in the pressure and temperature ranges on earth. This book specially addresses the methods to design novel materials and to predict the spectralline shape of unknown materials using the DV-Xa molecular-orbital method, but is also useful for those who want to calculate electronic structures of materials using any kind of method.

  20. 49 CFR 107.209 - Determination.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Determination. 107.209 Section 107.209... PROGRAM PROCEDURES Preemption Preemption Determinations § 107.209 Determination. (a) Upon consideration of the application and other relevant information received, the Chief Counsel issues a determination. (b...

  1. Asteroids mass determination

    International Nuclear Information System (INIS)

    Hoffmann, M.

    1989-01-01

    Basic methods for asteroid mass determinations and their errors are discussed. New results and some current developments in the astrometric method are reviewed. New methods and techniques, such as electronic imaging, radar ranging and space probes are becoming important for asteroid mass determinations. Mass and density estimations on rotational properties and possible satelites are also discussed

  2. Studies in the theory of solids

    Energy Technology Data Exchange (ETDEWEB)

    Hjalmarson, H. P.

    1979-01-01

    The surface arrangement of atoms in a solid controls the energetically slowly varying features of a LEED spectrum. Because of inelastic collisions within the solid, the LEED electrons mainly sample a surface sandwich of atoms. Thus, the surface sandwich reflectivity, computed by using a method which considers only single reflections of the electron by sheets of atoms in the solid, can be directly compared with the slowly varying, surface dependent features in the data. The method was used to determine that the surface of TiS/sub 2/ is ideal whereas the surface sandwich of TiSe/sub 2/ expands outward slightly. For the final determinations, the smoothing method was used on both the data and a theory which includes multiple scattering to confine the comparison to just the slowly varying surface dependent features. Energies of deep traps associated with impurities in semiconductors are shown to be controlled by the S and P orbital energies of the impurity atoms. First, the qualitative physics of a deep trap is worked out using a defect molecule model. The quantitative theory is worked out using a tight binding Koster-Slater calculation. Predictions of energies of deep traps caused by impurities are made for fourteen different semiconductors. The theory is compared with the data for GaP and the alloy GaAs/sub 1-x/P/sub x/ before developing a phenomenological model which depends mainly on the energy centers of the valence and conduction band density of states as well as atomic energies of impurities. This phenomenological model is used to make predictions of deep trap energies in Si.

  3. Studies in the theory of solids

    International Nuclear Information System (INIS)

    Hjalmarson, H.P.

    1979-01-01

    The surface arrangement of atoms in a solid controls the energetically slowly varying features of a LEED spectrum. Because of inelastic collisions within the solid, the LEED electrons mainly sample a surface sandwich of atoms. Thus, the surface sandwich reflectivity, computed by using a method which considers only single reflections of the electron by sheets of atoms in the solid, can be directly compared with the slowly varying, surface dependent features in the data. The method was used to determine that the surface of TiS 2 is ideal whereas the surface sandwich of TiSe 2 expands outward slightly. For the final determinations, the smoothing method was used on both the data and a theory which includes multiple scattering to confine the comparison to just the slowly varying surface dependent features. Energies of deep traps associated with impurities in semiconductors are shown to be controlled by the S and P orbital energies of the impurity atoms. First, the qualitative physics of a deep trap is worked out using a defect molecule model. The quantitative theory is worked out using a tight binding Koster-Slater calculation. Predictions of energies of deep traps caused by impurities are made for fourteen different semiconductors. The theory is compared with the data for GaP and the alloy GaAs/sub 1-x/P/sub x/ before developing a phenomenological model which depends mainly on the energy centers of the valence and conduction band density of states as well as atomic energies of impurities. This phenomenological model is used to make predictions of deep trap energies in Si

  4. Subcriticality determination of nuclear reactor

    International Nuclear Information System (INIS)

    Borisenko, V.I.; Goranchuk, V.V.; Sidoruk, N.M.; Volokh, A.F.

    2014-01-01

    In this article the subcriticality determination of nuclear reactor is considered. Emphasized that, despite the requirements of regulatory documents on the subcriticality determination of WWER from the beginning of their operation, so far, this problem has not been solved. The results of subcriticality determination of Rossi-α method of the WWER-M is presented. The possibility of subcriticality determination of WWER is considered. The possibility of subcriticality determination of Rossi-α method with time resolution is of about 100 microseconds is also considered. The possible reasons for the error in subcriticality determination of the reactor are indicated

  5. 49 CFR 107.221 - Determination.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Determination. 107.221 Section 107.221... PROGRAM PROCEDURES Preemption Waiver of Preemption Determinations § 107.221 Determination. (a) After... Chief Counsel issues a determination. (b) The Chief Counsel may issue a waiver of preemption only on...

  6. Evaluation of intensity and energy interaction parameters for the complexation of Pr(III) with selected nucleoside and nucleotide through absorption spectral studies

    Science.gov (United States)

    Bendangsenla, N.; Moaienla, T.; David Singh, Th.; Sumitra, Ch.; Rajmuhon Singh, N.; Indira Devi, M.

    2013-02-01

    The interactions of Pr(III) with nucleosides and nucleotides have been studied in different organic solvents employing absorption difference and comparative absorption spectrophotometry. The magnitudes of the variations in both energy and intensity interaction parameters were used to explore the degree of outer and inner sphere co-ordination, incidence of covalency and the extent of metal 4f-orbital involvement in chemical bonding. Various electronic spectral parameters like Slater-Condon (Fk), Racah (Ek), Lande parameter (ξ4f), Nephelauxatic ratio (β), bonding (b1/2), percentage covalency (δ) and intensity parameters like oscillator strength (P) and Judd Ofelt electronic dipole intensity parameter (Tλ, λ = 2, 4, 6) have been evaluated. The variation of these evaluated parameters were employed to interpret the nature of binding of Pr(III) with different ligands i.e. Adenosine/ATP in presence and absence of Ca2+.

  7. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  8. Comment on atomic independent-particle models

    International Nuclear Information System (INIS)

    Doda, D.D.; Gravey, R.H.; Green, A.E.S.

    1975-01-01

    The Hartree-Fock-Slater (HFS) independent-particle model in the form developed by Hermann and Skillman (HS) and the Green, Sellin, and Zachor (GSZ) analytic independent-particle model are being used for many types of applications of atomic theory to avoid cumbersome, albeit more rigorous, many-body calculations. The single-electron eigenvalues obtained with these models are examined and it is found that the GSZ model is capable of yielding energy eigenvalues for valence electrons which are substantially closer to experimental values than are the results of HS-HFS calculations. With the aid of an analytic representation of the equivalent HS-HFS screening function, the difficulty with this model is identified as a weakness of the potential in the neighborhood of the valence shell. Accurate representations of valence states are important in most atomic applications of the independent-particle model

  9. Benchmark Calculation of Radial Expectation Value for Confined Hydrogen-Like Atoms and Isotropic Harmonic Oscillators

    International Nuclear Information System (INIS)

    Yu, Rong Mei; Zan, Li Rong; Jiao, Li Guang; Ho, Yew Kam

    2017-01-01

    Spatially confined atoms have been extensively investigated to model atomic systems in extreme pressures. For the simplest hydrogen-like atoms and isotropic harmonic oscillators, numerous physical quantities have been established with very high accuracy. However, the expectation value of which is of practical importance in many applications has significant discrepancies among calculations by different methods. In this work we employed the basis expansion method with cut-off Slater-type orbitals to investigate these two confined systems. Accurate values for several low-lying bound states were obtained by carefully examining the convergence with respect to the size of basis. A scaling law for was derived and it is used to verify the accuracy of numerical results. Comparison with other calculations show that the present results establish benchmark values for this quantity, which may be useful in future studies. (author)

  10. Characterization of some Pr(III) complexes in terms of electronic spectral parameters

    International Nuclear Information System (INIS)

    Bhati, P.R.; Soni, K.P.; Joshi, G.K.; Swami, S.N.

    1992-01-01

    Pr(III) complexes from the ligands derived from methyl acetoacetate, ethyl acetoacetate, veratraldehyde, ethyl vanillin and 2,5 dimethoxy benzaldehyde forming Schiff-bases with ortho, meta and para phenylene diamines have been synthesized. The complexes have been characterized in terms of various Slater-Condon Lande and Judd-Ofelt parameters. The various trends in the parametric values have also been described. The involvement of 4f-orbital in the Pr(III) complexes including deviation in the symmetry have been discussed on the basis of electronic spectral parameters. The validity of the theories used has been established while comparing observed and calculated energies and intensities of the various bands in the present complexes on the basis of r.m.s deviation. The trends of the curves observed in the solution spectra have also been discussed. (author). 21 refs., 5 tabs., 2 figs

  11. Emergency operation determination system

    International Nuclear Information System (INIS)

    Miki, Tetsushi.

    1993-01-01

    The system of the present invention can determine an emergency operation coping with abnormal events occurring during nuclear plant operation without replying on an operator's judgement. That is, the system of the present invention comprises an intelligence base which divides and classifies the aims of the plant operation for the function, structure and operation manual and puts them into network. Degree of attainment for the extend of the status normality is determined on every aim of operation based on various kinds of measured data during plant operation. For a degree of attainment within a predetermined range, it is judged that an emergency operation is possible although this is in an abnormal state. Degree of emergency is determined by a fuzzy theory based on the degree of attainment, variation coefficient for the degree of attainment and the sensitivity to external disturbance as parameters. Priority for the degree of emergency on every operation aims is determined by comparison. Normality is successively checked for the determined operation aims. As a result, equipments as objects of abnormality suppressing operation are specified, and the operation amount of the equipments as objects are determined so that the measuring data are within a predetermined range. (I.S.)

  12. Spacecraft Attitude Determination

    DEFF Research Database (Denmark)

    Bak, Thomas

    This thesis describes the development of an attitude determination system for spacecraft based only on magnetic field measurements. The need for such system is motivated by the increased demands for inexpensive, lightweight solutions for small spacecraft. These spacecraft demands full attitude...... determination based on simple, reliable sensors. Meeting these objectives with a single vector magnetometer is difficult and requires temporal fusion of data in order to avoid local observability problems. In order to guaranteed globally nonsingular solutions, quaternions are generally the preferred attitude...... is a detailed study of the influence of approximations in the modeling of the system. The quantitative effects of errors in the process and noise statistics are discussed in detail. The third contribution is the introduction of these methods to the attitude determination on-board the Ørsted satellite...

  13. Boundary determinations for trivariate solids

    International Nuclear Information System (INIS)

    Duchaineau, M; Joy, K I

    1999-01-01

    The trivariate tensor-product B-spline solid is a direct extension of the B-spline patch and has been shown to be useful in the creation and visualization of free-form geometric solids. Visualizing these solid objects requires the determination of the boundary surface of the solid, which is a combination of parametric and implicit surfaces. This paper presents a method that determines the implicit boundary surface by examination of the Jacobian determinant of the defining B-spline function. Using an approximation to this determinant, the domain space is adaptively subdivided until a mesh can be determined such that the boundary surface is close to linear in the cells of the mesh. A variation of the marching cubes algorithm is then used to draw the surface. Interval approximation techniques are used to approximate the Jacobian determinant and to approximate the Jacobian determinant gradient for use in the adaptive subdivision methods. This technique can be used to create free-form solid objects, useful in geometric modeling applications

  14. Feasibility study of hydrogen determination in blended gas mixture by an indigenously developed hydrogen determinator

    International Nuclear Information System (INIS)

    Gaikwad, Revati; Sonar, V.R.; Pandey, R.K.; Karekar, C.D.; Raul, Seema; Mahanty, B.; Kelkar, A.; Bhatt, R.B.; Behere, P.G.

    2017-01-01

    It is required to determine accurately the percentage composition of hydrogen in the blended gas of N 2 and H 2 prior to deliver to the sintering furnace. A feasibility study has been carried out to determine the percentage composition of hydrogen in the blended gas by using an indigenously developed hydrogen determinator. The instrument uses gas chromatograph-thermal conductivity (GC-TCD) technique to determine hydrogen. The flow of carrier gas was kept at 100 mL min -1 during the analysis. A very close agreement between the determined value and the reported value of hydrogen content in the commercially available N 2 -H 2 mixed cylinder was found by using the indigenous hydrogen determinator. (author)

  15. Airborne geoid determination

    DEFF Research Database (Denmark)

    Forsberg, René; Olesen, Arne Vestergaard; Bastos, L.

    2000-01-01

    Airborne geoid mapping techniques may provide the opportunity to improve the geoid over vast areas of the Earth, such as polar areas, tropical jungles and mountainous areas, and provide an accurate "seam-less" geoid model across most coastal regions. Determination of the geoid by airborne methods...... relies on the development of airborne gravimetry, which in turn is dependent on developments in kinematic GPS. Routine accuracy of airborne gravimetry are now at the 2 mGal level, which may translate into 5-10 cm geoid accuracy on regional scales. The error behaviour of airborne gravimetry is well......-suited for geoid determination, with high-frequency survey and downward continuation noise being offset by the low-pass gravity to geoid filtering operation. In the paper the basic principles of airborne geoid determination are outlined, and examples of results of recent airborne gravity and geoid surveys...

  16. Robust Growth Determinants

    OpenAIRE

    Doppelhofer, Gernot; Weeks, Melvyn

    2011-01-01

    This paper investigates the robustness of determinants of economic growth in the presence of model uncertainty, parameter heterogeneity and outliers. The robust model averaging approach introduced in the paper uses a flexible and parsi- monious mixture modeling that allows for fat-tailed errors compared to the normal benchmark case. Applying robust model averaging to growth determinants, the paper finds that eight out of eighteen variables found to be significantly related to economic growth ...

  17. CATALYTIC KINETIC SPECTROPHOTOMETRIC DETERMINATION ...

    African Journals Online (AJOL)

    Preferred Customer

    acetylchlorophosphonazo(CPApA) by hydrogen peroxide in 0.10 M phosphoric acid. A novel catalytic kinetic-spectrophotometric method is proposed for the determination of copper based on this principle. Copper(II) can be determined spectrophotometrically ...

  18. Determinants of Actor Rationality

    DEFF Research Database (Denmark)

    Ellegaard, Chris

    Industrial companies must exercise influence on their suppliers (or supplier actors). Actor rationality is a central theme connected to this management task. In this article, relevant literature is studied with the purpose of shedding light on determinants of actor rationality. Two buyer-supplier...... relations are investigated in a multiple case study, leading to the proposal of various additional factors that determine and shape actor rationality. Moreover a conceptual model of rationality determinants in the buyer-supplier relation is proposed, a model that may help supply managers analyse...

  19. Reclaiming Self-Determination from the Indian Self-Determination and Education Assistance Act of 1975

    Science.gov (United States)

    Wilson, Michael D.

    2012-01-01

    This paper examines the way the term "self-determination" is used in the Indian Self-Determination and Education Assistance Act of 1975. Its main thesis is that the Act does not in fact offer tribal governments self-determination, but instead reaffirms old power configurations that go back to the Indian Reorganization Act of 1934.…

  20. Reduction and determination of dixanthogens.

    Science.gov (United States)

    Prasad, M S

    1971-06-01

    A convenient method for the reduction and determination of dixaathogen has been developed. It is based on the quantitative reaction of dixanthogen with zinc amalgam to form xanthate; the latter can be determined by iodine titration, potentiometric titration with silver nitrate or by spectrophotometry at 310 mmu. Dixanthogen can be determined in mixtures containing xanthate, by titration of aliquots with and without reduction. Higher dixanthogens can also be determined, and flotation liquors analysed.

  1. 42 CFR 405.803 - Initial determination.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Initial determination. 405.803 Section 405.803....803 Initial determination. (a) Carriers make initial determinations regarding claims for benefits under Medicare Part B. (b) An initial determination for purposes of this subpart includes determinations...

  2. 42 CFR 405.715 - Reconsidered determination.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Reconsidered determination. 405.715 Section 405.715... Part A § 405.715 Reconsidered determination. (a) In reconsidering an initial determination, the CMS shall review such initial determination, the evidence and findings upon which such determination was...

  3. Impact significance determination-Back to basics

    International Nuclear Information System (INIS)

    Lawrence, David P.

    2007-01-01

    Impact significance determination is widely recognized as a vital and critical EIA activity. But impact significance related concepts are poorly understood. And the quality of approaches for impact significance determination in EIA practice remains highly variable. This article seeks to help establish a sound and practical conceptual foundation for formulating and evaluating impact significance determination approaches. It addresses the nature (what is impact significance?), the core characteristics (what are the major properties of significance determination?), the rationale (why are impact significance determinations necessary?), the procedural and substantive objectives (what do impact significance determinations seek to achieve?), and the process for making impact significance judgments (how is impact significance determination conducted?). By identifying fundamental attributes and key distinctions associated with impact significance determinations, a basis is provided for designing and evaluating impact significance determination procedures at both the regulatory and applied levels

  4. Fluorescence uranium determination

    International Nuclear Information System (INIS)

    Fernandez Cellini, R.; Crus Castillo, F. de la; Barrera Pinero, R.

    1960-01-01

    An equipment for analysis of uranium by fluorescence was developed in order to determine it at such a low concentration that it can not be determined by the most sensible analytical methods. this new fluorimeter was adapted to measure the fluorescence emitted by the phosphorus sodium fluoride-sodium carbonate-potasium carbonate-uranyl, being excited by ultraviolet light of 3,650 A the intensity of the light emitted was measure with a photomultiplicator RCA 5819 and the adequate electronic equipment. (Author) 19 refs

  5. Determining gold content

    International Nuclear Information System (INIS)

    Clayton, C.G.; Wormald, M.R.

    1981-01-01

    A method for determining the gold content of a material, comprises irradiating a body of the material with neutrons and determining the intensity of γ-rays having an energy of 279 keV arising from the reaction 179 Au(nn') 179 Au → 279 keV. The apparatus has means for conveying the materials past an assembly, which has a neutron source, which does not produce neutrons having sufficient energy to excite fast neutron reactions in non-auriferous constituents. (author)

  6. Determining postural stability

    Science.gov (United States)

    Lieberman, Erez (Inventor); Forth, Katharine E. (Inventor); Paloski, William H. (Inventor)

    2011-01-01

    A method for determining postural stability of a person can include acquiring a plurality of pressure data points over a period of time from at least one pressure sensor. The method can also include the step of identifying a postural state for each pressure data point to generate a plurality of postural states. The method can include the step of determining a postural state of the person at a point in time based on at least the plurality of postural states.

  7. 14 CFR 314.16 - Final determination.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Final determination. 314.16 Section 314.16... REGULATIONS EMPLOYEE PROTECTION PROGRAM Determination of Qualifying Dislocation § 314.16 Final determination... determination and, within 3 business days after the determination, serve a copy of the order on the persons...

  8. Small, but Determined: Technological Determinism in Nanoscience

    OpenAIRE

    Cyrus C.M. Mody

    2004-01-01

    Analysis of technological determinism by historians, sociologists, and philosophers has declined in recent years. Yet understanding this topic is necessary, particularly in examining the dynamics of emerging technologies and their associated research areas. This is especially true of nanotechnology, which, because of its roots in futurist traditions, employs unusual variants on classical determinist arguments. In particular, nanotechnology orients much more strongly to the past and future tha...

  9. Determination of vanadium

    International Nuclear Information System (INIS)

    Stepin, V.V.; Kurbatova, V.I.; Fedorova, N.D.

    1980-01-01

    Techniques of vanadium determination in steels and alloys are developed. Extraction-photometric method with N-phenyl-benzohydroxamic acid when V content is 0.005-0.5% is suggested. Molar coefficient of the complex quenching at lambdasub(max)=530 nm constitutes 5750. Optimum concentration is 15-150 μg per 25 ml of the solution, determination limit is 0.05 μg/ml. Chloroform is an extracting agent. A photometric method with acetohydrazide of anthranilic acid is suggested for the analysis of alloyed steels at V content 0.03-1%. The lower limit of V determination constitutes 0.64 μg/ml. Effect of Fe is removed using phosphoric acid. Amperometric method for steels and alloys at V content from 0.05 to 5% and for steels and alloys containing more than 3% W and Cr is also developed. The method is based on amperometric titration with solution of double sulfuric salt of Fe(2) and ammonium [ru

  10. Hierarchy Formation and Self-Determination

    Directory of Open Access Journals (Sweden)

    Stefano I. Di Domenico

    2014-12-01

    Full Text Available We examined how self-determination, the subjective experience of one’s behavior as internally initiated and personally endorsed, depends on one’s standing in real-world social hierarchies. We predicted that those with the traits most relevant to status attainment would be those afforded the most opportunities to be self-determining. We examined the trait of physical attractiveness, given its documented association with social status and no known association with self-determination. First-year undergraduates living in same-sex residences rated their housemates’ social status, while an independent set of observers rated the participants’ physical attractiveness. Consistent with prediction, physically attractive individuals attained the highest levels of social status; in turn, those who attained the highest levels of social status experienced the highest levels of self-determination. These findings provide new insights into self-determination as an inherently relational phenomenon and specifically highlight the formative influence of social status on people’s capacities for self-determination.

  11. Ultrafast absorption of intense x rays by nitrogen molecules

    Energy Technology Data Exchange (ETDEWEB)

    Buth, Christian [Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, 69117 Heidelberg (Germany); PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Argonne National Laboratory, Argonne, Illinois 60439 (United States); Liu Jicai [Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, 69117 Heidelberg (Germany); Department of Mathematics and Physics, North China Electric Power University, 102206 Beijing (China); Chen, Mau Hsiung [Physics Division, Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Cryan, James P. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Physics, Stanford University, Stanford, California 94305 (United States); Fang Li; Hoener, Matthias; Berrah, Nora [Department of Physics, Western Michigan University, Kalamazoo, Michigan 49008 (United States); Glownia, James M. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Applied Physics, Stanford University, Stanford, California 94305 (United States); Coffee, Ryan N. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Linac Coherent Light Source, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

    2012-06-07

    We devise a theoretical description for the response of nitrogen molecules (N{sub 2}) to ultrashort and intense x rays from the free electron laser Linac Coherent Light Source (LCLS). We set out from a rate-equation description for the x-ray absorption by a nitrogen atom. The equations are formulated using all one-x-ray-photon absorption cross sections and the Auger and radiative decay widths of multiply-ionized nitrogen atoms. Cross sections are obtained with a one-electron theory and decay widths are determined from ab initio computations using the Dirac-Hartree-Slater (DHS) method. We also calculate all binding and transition energies of nitrogen atoms in all charge states with the DHS method as the difference of two self-consistent field (SCF) calculations ({Delta}SCF method). To describe the interaction with N{sub 2}, a detailed investigation of intense x-ray-induced ionization and molecular fragmentation are carried out. As a figure of merit, we calculate ion yields and the average charge state measured in recent experiments at the LCLS. We use a series of phenomenological models of increasing sophistication to unravel the mechanisms of the interaction of x rays with N{sub 2}: a single atom, a symmetric-sharing model, and a fragmentation-matrix model are developed. The role of the formation and decay of single and double core holes, the metastable states of N{sub 2}{sup 2+}, and molecular fragmentation are explained.

  12. Condensed phase QM/MM simulations utilizing the exchange core functions to describe exchange repulsions at the QM boundary region

    Energy Technology Data Exchange (ETDEWEB)

    Umino, Satoru; Takahashi, Hideaki, E-mail: hideaki@m.tohoku.ac.jp; Morita, Akihiro [Department of Chemistry, Graduate School of Science, Tohoku University, Sendai, Miyagi 980-8578 (Japan)

    2016-08-28

    In a recent work, we developed a method [H. Takahashi et al., J. Chem. Phys. 143, 084104 (2015)] referred to as exchange-core function (ECF) approach, to compute exchange repulsion E{sub ex} between solute and solvent in the framework of the quantum mechanical (QM)/molecular mechanical (MM) method. The ECF, represented with a Slater function, plays an essential role in determining E{sub ex} on the basis of the overlap model. In the work of Takahashi et al. [J. Chem. Phys. 143, 084104 (2015)], it was demonstrated that our approach is successful in computing the hydrogen bond energies of minimal QM/MM systems including a cationic QM solute. We provide in this paper the extension of the ECF approach to the free energy calculation in condensed phase QM/MM systems by combining the ECF and the QM/MM-ER approach [H. Takahashi et al., J. Chem. Phys. 121, 3989 (2004)]. By virtue of the theory of solutions in energy representation, the free energy contribution δμ{sub ex} from the exchange repulsion was naturally formulated. We found that the ECF approach in combination with QM/MM-ER gives a substantial improvement on the calculation of the hydration free energy of a hydronium ion. This can be attributed to the fact that the ECF reasonably realizes the contraction of the electron density of the cation due to the deficit of an electron.

  13. 19 CFR 212.26 - Determination.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Determination. 212.26 Section 212.26 Customs... IMPLEMENTATION OF THE EQUAL ACCESS TO JUSTICE ACT Procedures for Considering Applications § 212.26 Determination. The presiding officer shall issue a recommended determination on the application within 90 days after...

  14. 44 CFR 68.11 - Determination.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Determination. 68.11 Section... § 68.11 Determination. The board shall render its written decision within 45 days after the conclusion... Administrator for review and approval. The Administrator shall make the final base flood elevation determination...

  15. 18 CFR 158.6 - Determination.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Determination. 158.6 Section 158.6 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT....6 Determination. If no formal hearing is had the matter in issue will be determined by the...

  16. Self-Determination after Kosovo

    DEFF Research Database (Denmark)

    Wolff, Stefan; Rodt, Annemarie Peen

    2013-01-01

    This article discusses the meaning of self-determination in its historical and contemporary contexts and examines the different options available for the accommodation of contested self-determination claims. Among these, the creation of a new state, arguably, is the most radical of options and on...

  17. Self-consistent embedded-cluster calculations of the electronic structure of alkaline earth fluorides in the Hartree-Fock-Slater approximation

    International Nuclear Information System (INIS)

    Amaral, N.C.; Maffeo, B.; Guenzburger, D.J.R.

    1982-01-01

    Molecular orbitals calculations were performed for clusters representing the CaF 2 , SrF 2 and BaF 2 ionic crystals. The discrete variational method was employed, with the Xα approximation for the exchange interaction; a detailed investigation of different models for embedding the clusters in the solids led to a realistic description of the effect of neighbour ions in the infinite crystal. The results obtained were used to interpret optical and photoelectron data reported in the literature. In the case of CaF 2 , comparisons were made with existing band structure calculations. (Author) [pt

  18. 18 CFR 41.6 - Determination.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Determination. 41.6 Section 41.6 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF....6 Determination. If no formal hearing is had the matter in issue will be determined by the...

  19. 18 CFR 349.6 - Determination.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Determination. 349.6 Section 349.6 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... PROPOSED REMEDIES § 349.6 Determination. If no formal hearing is had the matter in issue will be determined...

  20. 28 CFR 44.303 - Determination.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Determination. 44.303 Section 44.303... Enforcement Procedures § 44.303 Determination. (a) Within 120 days of the receipt of a charge, the Special... the end of the 120-day period, the Special Counsel shall issue letters of determination by certified...

  1. Determination of plutonium in environment

    International Nuclear Information System (INIS)

    Sakanoue, Masanobu

    1978-01-01

    Past and present methods of determining the amount of plutonium in the environment are summarized. Determination of the amount of plutonium in uranium ore began in 1941. Plutonium present in polluted environments due to nuclear explosions, nuclear power stations, etc. was measured in soil and sand in Nagasaki in 1951 and in ash in Bikini in 1954. Analytical methods of measuring the least amount of plutonium in the environment were developed twenty years later. Many studies on and reviews of these methods have been reported all over the world, and a standard analytical procedure has been adopted. A basic analytical method of measurement was drafted in Japan in 1976. The yield, treatment of samples, dissolution, separation, control of measurable ray sources determination by α spectrometry, cross-check determination, and treatment of samples containing hardly soluble plutonium were examined. At present, the amount of plutonium can be determined by all of these methods. The presence of plutonium was studied further, and the usefulness of determination of the plutonium isotope ratio is discussed. (Kumagai, S.)

  2. Risk determination

    International Nuclear Information System (INIS)

    1993-01-01

    The issue gives a survey of the legal, theological, statistical and health aspects of risk determination. It includes the opinions of physicians, epidemiologists, mathematicians, toxicologists, biologists, theologists and physicists who explain and illustrate the term of risk from their perspective. (orig./DG) [de

  3. 40 CFR 231.5 - Recommended determination.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended determination. 231.5... 404(c) PROCEDURES § 231.5 Recommended determination. (a) The Regional Administrator or his designee... public notice of the proposed determination, either withdraw the proposed determination or prepare a...

  4. Simultaneous determination of a binary mixture: kinetic method for determination of uranium and vanadium

    International Nuclear Information System (INIS)

    Jianhua, W.; Ronghuan, H.

    1993-01-01

    A kinetic method for simultaneous determination of a binary mixture is proposed, and a procedure for simultaneous determination of uranium (IV) and vanadium (IV) is established based on their inductive effect on chromium (VI)-iodide redox reaction in a weak acidic medium. The reaction was monitored by FIA-spectrophotometry using the I 3 - -starch complex as indicator. The calibration graphs are linear for uranium (IV) and vanadium (IV) within the range of 0 ∼ 3.6 μg/ml and 0 ∼ 2.5 μg/ml respectively. Most foreign ions, except for iron (II) and antimony (III), do not interfere with the determination. The uranium and vanadium content in different samples was determined, and the results were satisfactory. (author). 2 tabs., 2 figs., 9 refs

  5. Determinants of State Aid

    NARCIS (Netherlands)

    Buiren, K.; Brouwer, E.

    2010-01-01

    From economic theory we derive a set of hypotheses on the determination of state aid. Econometric analysis on EU state aid panel data is carried out to test whether the determinants we expect on the basis of theory, correspond to the occurrence of state aid in practice in the EU. We find that

  6. Extraction-spectrophotometric method for silicon determination in high-purity substances. 1. Silicon determination in tellurium

    Energy Technology Data Exchange (ETDEWEB)

    Shaburova, V P; Yudelevich, I G [AN SSSR, Novosibirsk (USSR). Inst. Neorganicheskoj Khimii

    1989-01-01

    The extraction-spectrophotometric method for silicon determination in tellurium based on extraction isolation of the base by tributyl phosphate from hydrochloride solutions and with addition of HNO/sub 3/ and spectrophotometric silicon determination using malachite green is developed. The method permits to determine 2x10/sup -1/-3x10/sup -4/ % Si.

  7. 36 CFR 223.36 - Volume determination.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Volume determination. 223.36... Volume determination. (a) Timber sale contracts may provide for volume determination by scaling... the contract or permit provides for the determination of volume by tree measurement and the timber has...

  8. 36 CFR 902.60 - Initial determination.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Initial determination. 902.60... INFORMATION ACT Time Limitations § 902.60 Initial determination. (a) An initial determination whether or not... workdays in accordance with § 902.62. (b) Upon making initial determination, the Administrative Officer...

  9. 49 CFR 397.211 - Preemption determination.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Preemption determination. 397.211 Section 397.211... MATERIALS; DRIVING AND PARKING RULES Preemption Procedures § 397.211 Preemption determination. (a) Upon... determination. (b) Notwithstanding that an application for a determination has not been filed under § 397.205...

  10. Effect of the business environment on market orientation and performance in an emerging country

    Directory of Open Access Journals (Sweden)

    József Berács

    2010-11-01

    Full Text Available In the paper the relationship between market orientation and performance, and the effect of the business environment on these two factors in an emerging economy, in Hungary, was investigated. In a research conducted at 572 firms we found that both market orientation and the business environment have an effect on business performance, albeit in a different manner. The three components of the market orientation construct (customer orientation, competitor orientation, interfunctional coordination have a positive effect on performance. Contrary to that, environmental variables (technological turbulence, market turbulence, competitive intensity, buyer power etc. proved to have a signficant impact only on the finance-based performance measures. The results provide unambiguous evidence that the environment has a strong effect on market orientation, indicating that the market orientation scale developed by Narver and Slater is a proper tool to describe the transitional processes in an emerging economy characterized by high turbulence

  11. Differential and total cross sections for the ionization of water molecule by electron impact

    International Nuclear Information System (INIS)

    Houamer, S.; Dal Cappello, C.; Mansouri, A.

    2007-01-01

    A theoretical approach is presented to calculate multiply differential and total cross sections of the ionization of H 2 O molecule in the vapour phase. The wave function of the target is described by molecular orbitals consisting of a linear combination of slater type atomic orbitals centered on the heaviest atom which is the oxygen atom in this case. The calculations are carried out in the first Born approximation where the projectile is described by a plane wave while the ejected electron is described by a coulomb wave taking into account its interaction with the residual ion. The spherical average over the Euler solid angle due to the randomly oriented gaseous target molecule is carried out analytically using the rotation matrix properties. The differential and total cross sections are thus evaluated without any special difficulty and compared with experiments and distorted wave calculations. Fair agreements are observed

  12. A Moessbauer effect study of the bonding in several organoiron carbonyl clusters

    International Nuclear Information System (INIS)

    Long, G.J.; O'Brien, J.F.

    1988-01-01

    After a brief review of the applications of the Moessbauer effect to cyclopentadienyl containing compounds, the chemistry and spectral properties of the various iron carbonyl complexes are described. The electronic properties of a series of trinuclear and tetranuclear organoiron clusters have been investigated through Fenske-Hall self-consistent field molecular orbital calculations, and the results are compared with the Moessbauer effect isomer shifts. A linear correlation is found between the Slater effective nuclear charge, as calculated from the Fenske-Hall partial orbital occupancy factors, and the isomer shift. In these compounds the 4s orbital populations are rather constant. However, the cis and trans isomers of [CpFe(CO) 2 ] 2 have a significantly lower 4s orbital populations. In this case, the reduced 4s population must be accounted for by adding it to the effective nuclear charge to obtain a good correlation with the isomer shift. (orig.)

  13. Studies in the electronic structure of matter

    International Nuclear Information System (INIS)

    Swarts, C.A.

    1979-01-01

    The results of various theories for the angular distribution of electrons photoemitted from the outermost p-shell of rare gas atoms are compared. The theories compared are the local density theories of Slater (X/sub α/) and of Hohenberg, Kohn and Sham, the pseudopotential method, Hartree-Fock theory as evaluated by Kennedy and Manson, and Amusia's random phase approximation with exchange (RPAE). Extended Huekel theory is applied to GaAs, GaP, and to the nitrogen isoelectronic trap in GaAs and GaP. The computer perfect crystal band structures are found to be in reasonable agreement with those computed with empirical pseudopotentials. Nitrogen impurity levels in GaAs and GaP are calculated using a cluster model. By means of model calculations for an independent electron metal, exact lineshapes are obtained for the photon absorption, emission and photoemission spectra of deep core states. 97 references

  14. 14 CFR 415.7 - Payload determination.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Payload determination. 415.7 Section 415.7... TRANSPORTATION LICENSING LAUNCH LICENSE General § 415.7 Payload determination. A payload determination is... determination. Either a launch license applicant or a payload owner or operator may request a review of its...

  15. Determination method of radiostrontium

    International Nuclear Information System (INIS)

    1984-01-01

    This manual provides determination methods of strontium-90 and strontium-89 in the environment released from nuclear facilities, and it is a revised edition of the previous manual published in 1974. As for the preparation method of radiation counting sample, ion exchange method, oxalate separation method and solvent extraction method were adopted in addition to the method of fuming nitric acid separation adopted in the previous edition. Strontium-90 is determined by the separation and radioactivity determination of yttrium-90 in radioequilibrium with strontium-90. Strontium-89 is determined by subtraction of radioactivity of strontium-90 plus yttrium-90 from gross radioactivity of isolated strontium carbonate. Radioactivity determination should be carried out with a low-background 2 π-gas-flow counting system for the mounted sample on a filter having a chemical form of ferric hydroxide, yttrium oxalate or strontium carbonate. This manual describes sample preparation procedures as well as radioactivity counting procedures for environmental samples of precipitates as rain or snow, airborne dust, fresh water, sea water and soil, and also for ash sample made from biological or food samples such as grains, vegetables, tea leaves, pine needle, milk, marine organisms, and total diet, by employing a method of fuming nitric acid separation, ion exchange separation, oxalate precipitate separation or solvent extraction separation (only for an ash sample). Procedures for reagent chemicals preparation is also attached to this manual. (Takagi, S.)

  16. Quantum Crystallography: Density Matrix-Density Functional Theory and the X-Ray Diffraction Experiment

    Science.gov (United States)

    Soirat, Arnaud J. A.

    Density Matrix Theory is a Quantum Mechanical formalism in which the wavefunction is eliminated and its role taken over by reduced density matrices. The interest of this is that, it allows one, in principle, to calculate any electronic property of a physical system, without having to solve the Schrodinger equation, using only two entities much simpler than an N-body wavefunction: first and second -order reduced density matrices. In practice, though, this very promising possibility faces the tremendous theoretical problem of N-representability, which has been solved for the former, but, until now, voids any hope of theoretically determining the latter. However, it has been shown that single determinant reduced density matrices of any order may be recovered from coherent X-ray diffraction data, if one provides a proper Quantum Mechanical description of the Crystallography experiment. A deeper investigation of this method is the purpose of this work, where we, first, further study the calculation of X-ray reduced density matrices N-representable by a single Slater determinant. In this context, we independently derive necessary and sufficient conditions for the uniqueness of the method. We then show how to account for electron correlation in this model. For the first time, indeed, we derive highly accurate, yet practical, density matrices approximately N-representable by correlated-determinant wavefunctions. The interest of such a result lies in the Quantum Mechanical validity of these density matrices, their property of being entirely obtainable from X-ray coherent diffraction data, their very high accuracy conferred by this known property of the N-representing wavefunction, as well as their definition as explicit functionals of the density. All of these properties are finally used in both a theoretical and a numerical application: in the former, we show that these density matrices may be used in the context of Density Functional Theory to highly accurately determine

  17. 42 CFR 405.810 - Review determination.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Review determination. 405.810 Section 405.810....810 Review determination. Subject to the provisions of §§ 405.807 through 405.809, the carrier shall... determination affirming or revising in whole or in part the findings and determination in question. [39 FR 12097...

  18. Accurate measurement of absolute experimental inelastic mean free paths and EELS differential cross-sections

    Energy Technology Data Exchange (ETDEWEB)

    Craven, Alan J.; Bobynko, Joanna; Sala, Bianca; MacLaren, Ian, E-mail: ian.maclaren@glasgow.ac.uk

    2016-11-15

    Methods are described for measuring accurate absolute experimental inelastic mean free paths and differential cross-sections using DualEELS. The methods remove the effects of surface layers and give the results for the bulk materials. The materials used are VC{sub 0.83}, TiC{sub 0.98}, VN{sub 0.97} and TiN{sub 0.88} but the method should be applicable to a wide range of materials. The data was taken at 200 keV using a probe half angle of 29 mrad and a collection angle of 36 mrad. The background can be subtracted from under the ionisation edges, which can then be separated from each other. This is achieved by scaling Hartree-Slater calculated cross-sections to the edges in the atomic regions well above the threshold. The average scaling factors required are 1.00 for the non-metal K-edges and 1.01 for the metal L-edges (with uncertainties of a few percent). If preliminary measurements of the chromatic effects in the post-specimen lenses are correct, both drop to 0.99. The inelastic mean free path for TiC{sub 0.98} was measured as 103.6±0.5 nm compared to the prediction of 126.9 nm based on the widely used Iakoubovskii parameterisation. - Highlights: • We show how to extract absolute cross sections for EELS edges using DualEELS. • The method removes the effects of any surface layers on standards. • We use a needle specimen to determining the mean free path for inelastic scattering. • Constrained background fitting is essential to correct background subtraction. • Absolute cross sections are determined for TiC, TiN, VC and VN.

  19. Sodium sampling and impurities determination

    International Nuclear Information System (INIS)

    Docekal, J.; Kovar, C.; Stuchlik, S.

    1980-01-01

    Samples may be obtained from tubes in-built in the sodium facility and further processed or they are taken into crucibles, stored and processed later. Another sampling method is a method involving vacuum distillation of sodium, thus concentrating impurities. Oxygen is determined by malgamation, distillation or vanadium balance methods. Hydrogen is determined by the metal diaphragm extraction, direct extraction or amalgamation methods. Carbon is determined using dry techniques involving burning a sodium sample at 1100 degC or using wet techniques by dissolving the sample with an acid. Trace amounts of metal impurities are determined after dissolving sodium in ethanol. The trace metals are concentrated and sodium excess is removed. (M.S.)

  20. Star trackers for attitude determination

    DEFF Research Database (Denmark)

    Liebe, Carl Christian

    1995-01-01

    One problem comes to all spacecrafts using vector information. That is the problem of determining the attitude. This paper describes how the area of attitude determination instruments has evolved from simple pointing devices into the latest technology, which determines the attitude by utilizing...... a CCD camera and a powerful microcomputer. The instruments are called star trackers and they are capable of determining the attitude with an accuracy better than 1 arcsecond. The concept of the star tracker is explained. The obtainable accuracy is calculated, the numbers of stars to be included...... in the star catalogue are discussed and the acquisition of the initial attitude is explained. Finally the commercial market for star trackers is discussed...

  1. Impact significance determination-Pushing the boundaries

    International Nuclear Information System (INIS)

    Lawrence, David P.

    2007-01-01

    Impact significance determination practice tends to be highly variable. Too often insufficient consideration is given to good practice insights. Also, impact significance determinations are frequently narrowly defined addressing, for example, only individual, negative impacts, focusing on bio-physical impacts, and not seeking to integrate either the Precautionary Principle or sustainability. This article seeks to extend the boundaries of impact significance determination practice by providing an overview of good general impact significance practices, together with stakeholder roles and potential methods for addressing significance determination challenges. Relevant thresholds, criteria, contextual considerations and support methods are also highlighted. The analysis is then extended to address how impact significance determination practices change for positive as compared with negative impacts, for cumulative as compared with individual impacts, for socio-economic as compared with bio-physical impacts, when the Precautionary Principle is integrated into the process, and when sustainability contributions drive the EIA process and related impact significance determinations. These refinements can assist EIA practitioners in ensuring that the scope and nature of impact significance determinations reflect the broadened scope of emerging EIA requirements and practices. Suggestions are included for further refining and testing of the proposed changes to impact significance determination practice

  2. 43 CFR 11.63 - Injury determination phase-pathway determination.

    Science.gov (United States)

    2010-10-01

    ... substance. Indirect exposure can result from food chain processes. (3) If the oil or hazardous substance... organisms in the assessment area; (2) Potential for exposure to the oil or hazardous substance through...) General. (1) To determine the exposure pathways of the oil or hazardous substance, the following shall be...

  3. Determinants of adolescent fertility in Ethiopia

    African Journals Online (AJOL)

    Bernt Lindtjorn

    demographic and economic determinants whereas Bongaarts model was used to determine proximate determinants fertility. ... Organization defines the age group of 10-19 and 15-24 ..... In urban areas, 24% of marital fertility was prevented.

  4. Determination of cadmium selenide nonstoichiometry

    International Nuclear Information System (INIS)

    Brezhnev, V.Yu.; Kharif, Ya.L.; Kovtunenko, P.V.

    1986-01-01

    Physicochemical method of determination of cadmium selenide nonstoichiometry is developed. The method nature consists in the fact, that under definite conditions dissolved cadmium is extracted from crystals to a vapor phase and then is determined in it using the photocolorimetric method. Cadmium solubility in CdSe crystal is calculated from known CdSe mass and amount of separated cadmium. The lower boundary of determined contents constitutes 1x10 -5 % mol at sample of cadmium selenide 10 g

  5. Self-powered detectors sensitivity determination

    International Nuclear Information System (INIS)

    Surkov, V.; Soares, A.J.

    1994-01-01

    The determination of the initial sensitivity of Self Powered Detectors (SPDs) was performed. Measurements of thermal, epithermal and to gamma flux sensitivities were made with Vanadium, Cobalt, Rhodium, Silver and Platinum SPDs and, when possible, the values are compared with the ones from the existing literature. The determination of neutron sensitivity was realized using the IEA-R1 Reactor from IPEN. The thermal and epithermal neutron flux were determined with bare and Cadmium covered activation foils. (GOLD). (author)

  6. The Determining Finite Automata Process

    Directory of Open Access Journals (Sweden)

    M. S. Vinogradova

    2017-01-01

    Full Text Available The theory of formal languages widely uses finite state automata both in implementation of automata-based approach to programming, and in synthesis of logical control algorithms.To ensure unambiguous operation of the algorithms, the synthesized finite state automata must be deterministic. Within the approach to the synthesis of the mobile robot controls, for example, based on the theory of formal languages, there are problems concerning the construction of various finite automata, but such finite automata, as a rule, will not be deterministic. The algorithm of determinization can be applied to the finite automata, as specified, in various ways. The basic ideas of the algorithm of determinization can be most simply explained using the representations of a finite automaton in the form of a weighted directed graph.The paper deals with finite automata represented as weighted directed graphs, and discusses in detail the procedure for determining the finite automata represented in this way. Gives a detailed description of the algorithm for determining finite automata. A large number of examples illustrate a capability of the determinization algorithm.

  7. Electron-impact excitation of the potassium atom

    International Nuclear Information System (INIS)

    Phelps, J.O.; Solomon, J.E.; Korff, D.F.; Lin, C.C.; Lee, E.T.P.

    1979-01-01

    Absolute optical electron-impact excitation functions for 24 transitions of the sharp, principal, diffuse, and fundamental spectral series of potassium have been measured. The determination of the density of the potassium vapor in the collision chamber was made by measuring the degree of transmission, by the vapor, of potassium resonance radiation generated externally in a fluorescence cell. Direct excitation functions were determined for 14 states (5S, 6S, 7S, 8S, 4P, 5P, 6P, 7P, 3D, 5D, 6D, 5F, 6F, and 7F) with the aid of known radiative-transition probabilities. Theoretical calculations of these same 14 excitation functions, as well as 4D and 4F, were carried out by means of the Born approximation. The 4P, 5P, 5S, 3D, and 4D direct excitation functions at intermediate energies (10--25 eV) were also calculated by the method of multistate close coupling, neglecting projectile--target-electron exchange. The high-energy (above 100 eV) Born-approximation cross sections agree with the experimental results for 4P and for all S states, but are lower than experimental results, by 30--40%, for the D and F states. At intermediate energies the close-coupling excitation calculations agree well with the experimental excitation functions for 4P and 5P, but are significantly higher than experimental values for 5S and 3D. The discrepancies between the experimental and theoretical results are probably due to a combination of systematic experimental errors, errors in the available transition-probability values, and errors in the theoretical excitation functions introduced by the use of approximate excited-state wave functions (Hartree-Fock-Slater), by the neglect of projectile--target-electron exchange. The polarization of the 4P-4S and 3D-4P radiation produced by electron impact was measured, and the results were used to determine the direct excitation functions of the separate magnetic sublevels of the 4P state

  8. Determinant of Poverty in Ethiopia

    African Journals Online (AJOL)

    preferred customer

    a logistic regression model to identify determinants of wellbeing of the household ... interest of researchers, public authorities and international organizations. The ... have to understand the determinants of poverty in rural and urban Ethiopia.

  9. A Predictive Framework for Determining How Journalists Determine News.

    Science.gov (United States)

    Gaudino, James L.

    To determine how to articulate a concrete definition of the substance of the journalist's occupation, this paper offers a propositional framework of news value based on Kurt Lewin's gatekeeper model. First, the paper follows the established suggestion that news decisions are best studied from a gatekeeping perspective or that "news is…

  10. Blood flow determinations utilizing digital densitometry

    International Nuclear Information System (INIS)

    Lois, F.; Mankovich, N.J.; Gomes, A.S.

    1987-01-01

    A method of obtaining relative and absolute blood flow measurements from digital densitometry was evaluated with a simulated vessel phantom and a hydrodynamic model. A digital vascular imaging system capable of acquisition in 512 2 and 1024 2 mode was used. Relative and absolute blood flow were measured using parameters derived from the densitometric curve. Since application of densitometric data to absolute flow measurements requires the vessel diameter, an algorithm for vessel size determination was created. Gray scale changes were demonstrated to be linearly related to contrast concentration. The variance of vessel size determination was significantly different in all combinations of 1024 2 and 512 2 imaging with 15 cm or 35 cm field size. The error in vessel size determination was significantly less using the larger 1024 2 matrix and the smaller 15 cm image intensifier field size, as shown by the smaller variance. In relative flow determinations, there was good correlation between the flow and four parameters of the densitometric curve with no significant differences between 512 2 and 1024 2 imaging. Absolute flow determinations had slightly lower correlation to actual flow but were not significantly different from relative flow determinations. Relative and absolute blood flow determinations can be performed adequately with either 512 2 or 1024 2 imaging. The increased accuracy in vessel size determination with 1024 2 imaging makes this high resolution system potentially perferable to determine absolute blood flow. (orig.)

  11. VOLTAMMETRIC DETERMINATION OF TINIDAZOLE IN ...

    African Journals Online (AJOL)

    tablet samples showed the potential applicability of the developed method for the determination of tinidazole in ... determination of TNZ in real samples like tablets, injection, urine and biological fluids [24-27]. Almost all ..... during the storage.

  12. SIS - Status Determination

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Status Determination dataset within the Species Information System (SIS) contains information related to overfishing, overfished, and approaching overfished...

  13. Determinants of Homeownership in Denmark

    DEFF Research Database (Denmark)

    Lauridsen, Jørgen T.; Skak, Morten

    . The paper adds to earlier papers by the same authors where determinants of the homeownership rate were found using (average) data for 270 Danish municipalities. By using data directly related to individual households whose inhabitants have chosen to be or not to be homeowners, the analysis reveals...... characteristics and restrictions that influence the choice between renting and ownership. Among the determinants investigated is civil and social status of the breadwinner and various household characteristics including income. The empirical results generally suggest that the impact of the determinants...

  14. 10 CFR 26.189 - Determination of fitness.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Determination of fitness. 26.189 Section 26.189 Energy NUCLEAR REGULATORY COMMISSION FITNESS FOR DUTY PROGRAMS Determining Fitness-for-Duty Policy Violations and Determining Fitness § 26.189 Determination of fitness. (a) A determination of fitness is the process entered...

  15. 42 CFR 422.566 - Organization determinations.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Organization determinations. 422.566 Section 422... (CONTINUED) MEDICARE PROGRAM MEDICARE ADVANTAGE PROGRAM Grievances, Organization Determinations and Appeals § 422.566 Organization determinations. (a) Responsibilities of the MA organization. Each MA organization...

  16. Health determinants and podiatry.

    Science.gov (United States)

    Brodie, B S

    2001-09-01

    Public health and podiatry have a natural union both through historical development and a shared interest in prevention. Podiatry is considered in terms of health determinants such as income, social support, education and environment. The author considers that podiatry has a constructive role to play in the improvement of health and well-being in terms of the previously unrecognised relationship of the profession to the determinants of health and population health promotion.

  17. Determination of boron in amorphous alloys

    Energy Technology Data Exchange (ETDEWEB)

    Grazhulene, S.S.; Grossman, O.V.; Kuntscher, K.K.; Malygina, L.I.; Muller, E.N.; Telegin, G.F.

    1985-10-01

    In the determination of boron in amorphous alloys containingFe, Co, B, Si, Ni, and P having unusal magnetic and electrical properties, precise analysis and rapid analysis are necessary. To improve the metrological properties of the existing procedure, to find a rapid determination of boron in amorphous alloys, and to verify the accuracy of the results, in the present work the optimization of the photometric determination after extraction of the BF/sup -//sub 4/ ion pair with methylene blue has been studied, and a boron determination by flame photometry using selective methylation has been developed. The determination of boron by the flame photometric and spectrophotometric methods is shown. When a highly precise determination is needed, the spectrophotometric procedure can be used. This procedure is distinguished by its labor intensity and duration. When the need for reproducibility is less severe, the rapid flame photometric procedure is best.

  18. 28 CFR 301.305 - Initial determination.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Initial determination. 301.305 Section... COMPENSATION Compensation for Work-Related Physical Impairment or Death § 301.305 Initial determination. A... determination, including the reasons therefore, together with notification of the right to appeal the...

  19. 33 CFR 136.309 - Advertisement determinations.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Advertisement determinations. 136... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Designation of Source and Advertisement § 136.309 Advertisement determinations. (a) The Director, NPFC, determines for each incident the type, geographic scope...

  20. Radioimmunological determination of 25-hydroxycholecalciferol

    International Nuclear Information System (INIS)

    Gmeiner, M.

    1976-01-01

    The antibody to vitamin D 3 as hapten proved useful in determination of 25-hydroxycalciferol (25-OH-CC). The attempt also to determine vitamin D 3 directly with the aid of this radioimmunological procedure failed because of the poor solubility of the vitamin in aqueous systems. Because of the linkage to the C3 the D-ring and C17 side chain would be expected to be the immunodeterminant sites. Although the antibody can be used to determine 25-OH-CC, there is no cross-reaction with cholesterol. This indicates the importance of the open B-ring of this vitamin. Scruting of the method showed good reproducibility and accuracy. The most favorable evaluation region is 0.1-2 ng/250μl sample. The procedure described enables 25-hydroxy vitamin D 3 to be determined without previous purification of the sample extract. (author)

  1. Waste Determination Equivalency - 12172

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, Rebecca D. [Savannah River Remediation (United States)

    2012-07-01

    The Savannah River Site (SRS) is a Department of Energy (DOE) facility encompassing approximately 800 square kilometers near Aiken, South Carolina which began operations in the 1950's with the mission to produce nuclear materials. The SRS contains fifty-one tanks (2 stabilized, 49 yet to be closed) distributed between two liquid radioactive waste storage facilities at SRS containing carbon steel underground tanks with storage capacities ranging from 2,800,000 to 4,900,000 liters. Treatment of the liquid waste from these tanks is essential both to closing older tanks and to maintaining space needed to treat the waste that is eventually vitrified or disposed of onsite. Section 3116 of the Ronald W. Reagan National Defense Authorization Act of Fiscal Year 2005 (NDAA) provides the Secretary of Energy, in consultation with the Nuclear Regulatory Commission (NRC), a methodology to determine that certain waste resulting from prior reprocessing of spent nuclear fuel are not high-level radioactive waste if it can be demonstrated that the waste meets the criteria set forth in Section 3116(a) of the NDAA. The Secretary of Energy, in consultation with the NRC, signed a determination in January 2006, pursuant to Section 3116(a) of the NDAA, for salt waste disposal at the SRS Saltstone Disposal Facility. This determination is based, in part, on the Basis for Section 3116 Determination for Salt Waste Disposal at the Savannah River Site and supporting references, a document that describes the planned methods of liquid waste treatment and the resulting waste streams. The document provides descriptions of the proposed methods for processing salt waste, dividing them into 'Interim Salt Processing' and later processing through the Salt Waste Processing Facility (SWPF). Interim Salt Processing is separated into Deliquification, Dissolution, and Adjustment (DDA) and Actinide Removal Process/Caustic Side Solvent Extraction Unit (ARP/MCU). The Waste Determination was signed

  2. Immunological methods for gentamicin determination

    International Nuclear Information System (INIS)

    Krugers Dagneauz, P.G.L.C.; Olthuis, F.M.F.G.

    1979-01-01

    For immunoassay, an antibody against the substance to the determined, the pure substance itself, and a labelled form or derivative of the substance are required. The principles and problems of the preparation of antibodies are discussed, some methods for the preparation of derivatives labelled with radioactive tracers or enzymes are reviewed, and homologous enzyme-immunological determination of gentamicin is discussed in detail. A comparison is mae of three radio-immunological determination methods, and the most suitable radio-immunological method is compared with two microbiological techniques. The results are found to be comparable. (Auth.)

  3. 45 CFR 150.217 - Preliminary determination.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Preliminary determination. 150.217 Section 150.217... Are Failing To Substantially Enforce HIPAA Requirements § 150.217 Preliminary determination. If, at... designees). (b) Notifies the State of CMS's preliminary determination that the State has failed to...

  4. 5 CFR 1216.206 - Final determination.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Final determination. 1216.206 Section... PROCEEDINGS Demands or Requests for Testimony and Production of Documents § 1216.206 Final determination. The General Counsel makes the final determination on demands to requests to employees for production of...

  5. 45 CFR 150.219 - Final determination.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Final determination. 150.219 Section 150.219... Are Failing To Substantially Enforce HIPAA Requirements § 150.219 Final determination. If, after... the State a written notice of its final determination. The notice includes the following: (a...

  6. 21 CFR 26.9 - Equivalence determination.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Equivalence determination. 26.9 Section 26.9 Food... Specific Sector Provisions for Pharmaceutical Good Manufacturing Practices § 26.9 Equivalence determination... document insufficient evidence of equivalence, lack of opportunity to assess equivalence or a determination...

  7. 7 CFR 1499.3 - Eligibility determination.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligibility determination. 1499.3 Section 1499.3 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT... determination. (a) An entity will be eligible to become a participant only after FAS determines that the entity...

  8. Formula-derived prostate volume determination

    NARCIS (Netherlands)

    Aarnink, R. G.; de la Rosette, J. J.; Debruyne, F. M.; Wijkstra, H.

    1996-01-01

    OBJECTIVES: Despite disadvantages such as time-consuming and tedious to the user, planimetric volumetry is considered to be the most accurate method for prostate volume determination. This study investigates the possibilities of formula-derived volume determination and reveals the best alternative

  9. Technique for determining training staff size

    International Nuclear Information System (INIS)

    Frye, S.R.

    1985-01-01

    Determining an adequate training staff size is a vital function of a training manager. Today's training requirements and standards have dictated a more stringent work load than ever before. A trainer's role is more than just providing classroom lectures. In most organizations the instructor must develop programs, lesson plans, exercise guides, objectives, test questions, etc. The tasks of a training organization are never ending and the appropriate resources must be determined and allotted to do the total job. A simple method exists for determining an adequate staff. Although not perfect, this method will provide a realistic approach for determining the needed training staff size. This method considers three major factors: instructional man-hours; non-instructional man-hours; and instructor availability. By determining and adding instructional man-hours and non-instructional man-hours a total man-hour distribution can be obtained. By dividing this by instructor availability a staff size can be determined

  10. 37 CFR 501.7 - Agency determination.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Agency determination. 501.7... UNIFORM PATENT POLICY FOR RIGHTS IN INVENTIONS MADE BY GOVERNMENT EMPLOYEES § 501.7 Agency determination... left with the employee, the agency shall notify the employee of this determination. In cases pursuant...

  11. 40 CFR 1042.825 - Baseline determination.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Baseline determination. 1042.825... Provisions for Remanufactured Marine Engines § 1042.825 Baseline determination. (a) For the purpose of this... not valid. (f) Use good engineering judgment for all aspects of the baseline determination. We may...

  12. 7 CFR 766.55 - Eligibility determination.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Eligibility determination. 766.55 Section 766.55 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF... determination. Within 30 days of a complete DSA application, the Agency will determine if the borrower meets the...

  13. 45 CFR 96.41 - General determination.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false General determination. 96.41 Section 96.41 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION BLOCK GRANTS Direct Funding of Indian Tribes and Tribal Organizations § 96.41 General determination. (a) The Department has determined...

  14. 36 CFR 902.61 - Final determination.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Final determination. 902.61 Section 902.61 Parks, Forests, and Public Property PENNSYLVANIA AVENUE DEVELOPMENT CORPORATION FREEDOM OF INFORMATION ACT Time Limitations § 902.61 Final determination. A determination with respect to any appeal made...

  15. Determination production costs using PBC method

    Directory of Open Access Journals (Sweden)

    Todić Vladimir V.

    2014-01-01

    Full Text Available Basic characteristics of modern markets make requirements in quality increasing, decreasing prices and shortening delivery of products. In the middle of this requirements are production costs for whose determination are developed many traditional and alternative methods including PBC method (Process Based Costing. This method enables precisely locating and calculating indirect production costs, and with determined direct costs enables determination of total production costs. This paper shows usage of PBC method for determination production costs for three forms of processing cutting tools.

  16. Discovering determinants influencing faith community nursing practice.

    Science.gov (United States)

    Ziebarth, Deborah Jean

    2014-01-01

    Faith community nursing (FCN) is an important healthcare delivery system for individuals, families, and communities. Determinants are factors that might influence FCN care. A literature review isolated eight determinants that influence practice; however, there are no clear causal relationships linking specific determinants to specific practice changes. Research is needed to assess how determinants influence practice and outcomes, and provide evidence-based solutions to isolate and manage determinants. A Conceptual Model of FCN, Theoretical Definitions and a Diagram of Determinants of FCN Practice are provided.

  17. 16 CFR 901.7 - Adverse determination.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Adverse determination. 901.7 Section 901.7... APPLICATION FOR EXEMPTION FROM THE PROVISIONS OF THE ACT § 901.7 Adverse determination. (a) If, after... of the information before it that it cannot make a favorable determination in connection with the...

  18. 49 CFR 89.45 - Department determination.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Department determination. 89.45 Section 89.45... Referral of Debts to IRS for Tax Refund Offset § 89.45 Department determination. (a) Following review of... supporting rationale. (b) If the Department either sustains or amends its determination, it shall notify the...

  19. 11 CFR 9409.9 - Final determination.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Final determination. 9409.9 Section 9409.9... INFORMATION AND PRODUCTION OF OFFICIAL RECORDS IN LEGAL PROCEEDINGS § 9409.9 Final determination. The General Counsel will make the final determination on demands and requests to employees for production of official...

  20. Commentary Sex determination

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    2008-01-31

    ZW is reserved for female heterogamety.) The Radder et al study used lab incubation regimes that mimic temperature profiles of cool natural nests, so temperature probably determines sex at least occasionally in nature.

  1. Photometric determination of traces of metals

    International Nuclear Information System (INIS)

    Onishi, H.

    1986-01-01

    The first three editions of this widely used classic were published under the title Colorimetric Determination of Traces of Metals, with E.B. Sandell as author. Part I (General Aspects) of the fourth edition was co-authored by E.B. Sandell and H. Onishi and published in 1978. After Sandell's death in 1984, Onishi assumed the monumental task of revising Part II. This book (Part IIA) consists of 21 chapters in which the photometric determinations of the individual metals, aluminium to lithium (including the lanthanoids), are described. Each chapter is divided into three sections: Separations, Methods of Determination, and Applications. The sections on Separations are of general interest and include methods based on precipitation, ion-exchange, chromatography, and liquid-liquid extraction. Molecular absorption and fluorescence techniques are described in the sections on determinations, and the emphasis is on the use of well-established reagents. Several reagents that have been recently introduced for the determination of trace levels of metals are also critically reviewed at the end of each section on methods of determination. Important applications of these methods to the determination of trace metals in complex organic and inorganic materials are described in detail at the end of each chapter

  2. 12 CFR 614.4950 - Determination fees.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Determination fees. 614.4950 Section 614.4950... Insurance Requirements § 614.4950 Determination fees. (a) General. Notwithstanding any Federal or State law... or will be located in a special flood hazard area. A determination fee may also include, but is not...

  3. 38 CFR 36.4707 - Determination fees.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Determination fees. 36...) LOAN GUARANTY Sale of Loans, Guarantee of Payment, and Flood Insurance § 36.4707 Determination fees. (a... will be located in a special flood hazard area. A determination fee may also include, but is not...

  4. Femtogram determination of ACTH by bioradioimmunoassay

    International Nuclear Information System (INIS)

    Bruni, G.; Dal Pra, P.; Segre, G.

    1979-01-01

    A bioradioimmunoassay is described for determining adrenocorticotropic hormone (ACTH) levels in biological fluids. Slices of guinea pig's adrenal gland surviving in vitro and depleted of their cortisol content were used. When challenged with ACTH, the slices release newly synthesised cortisol into the medium which is then determined by radioimmunoasssay. A log-linear relationship was evident between added ACTH and the cortisol measured in the medium. Unlike previous methods, the sensitivity of this assay allows the determination of 0.5 femtogram (10 -15 g) of ACTH. A good correlation was observed when rat plasma ACTH levels were determined by the present bioassay method and by an ACTH radioimmunoassay. Mean values of plasma ACTH determined by the present method are shown for man, child, guinea pig, rabbit, rat, and hamster. (UK)

  5. Femtogram determination of ACTH by bioradioimmunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Bruni, G; Dal Pra, P; Segre, G [Siena Univ. (Italy). Inst. Pharmacology

    1979-11-01

    A bioradioimmunoassay is described for determining adrenocorticotropic hormone (ACTH) levels in biological fluids. Slices of guinea pig's adrenal gland surviving in vitro and depleted of their cortisol content were used. When challenged with ACTH, the slices release newly synthesised cortisol into the medium which is then determined by radioimmunoasssay. A log-linear relationship was evident between added ACTH and the cortisol measured in the medium. Unlike previous methods, the sensitivity of this assay allows the determination of 0.5 femtogram (10/sup -15/g) of ACTH. A good correlation was observed when rat plasma ACTH levels were determined by the present bioassay method and by an ACTH radioimmunoassay. Mean values of plasma ACTH determined by the present method are shown for man, child, guinea pig, rabbit, rat, and hamster.

  6. Determinants of marriage dissolution

    Science.gov (United States)

    Rahim, Mohd Amirul Rafiq Abu; Shafie, Siti Aishah Mohd; Hadi, Az'lina Abdul; Razali, Nornadiah Mohd; Azid @ Maarof, Nur Niswah Naslina

    2015-10-01

    Nowadays, the number of divorce cases among Muslim couples is very worrisome whereby the total cases reported in 2013 increased by half of the total cases reported in the previous year. The questions on the true key factors of dissolution of marriage continue to arise. Thus, the objective of this study is to reveal the factors that contribute to the dissolution of marriage. A total of 181 cases and ten potential determinants were included in this study. The potential determinants considered were age at marriage of husband and wife, educational level of husband and wife, employment status of husband and wife, income of husband and wife, the number of children and the presence at a counseling session. Logistic regression analysis was used to analyze the data. The findings revealed that four determinants, namely the income of husband and wife, number of children and the presence at a counselling session were significant in predicting the likelihood of divorce among Muslim couples.

  7. 12 CFR 760.8 - Determination fees.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Determination fees. 760.8 Section 760.8 Banks... HAVING SPECIAL FLOOD HAZARDS § 760.8 Determination fees. (a) General. Notwithstanding any Federal or... flood hazard area. A determination fee may also include, but is not limited to, a fee for life-of-loan...

  8. 49 CFR 1018.95 - Board determination.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 8 2010-10-01 2010-10-01 false Board determination. 1018.95 Section 1018.95... determination. (a) Following review of the evidence, the Board will issue a written decision which will include... determination, it shall notify the debtor of its intent to refer the debt to the IRS for offset against the...

  9. 40 CFR 13.39 - Agency determination.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Agency determination. 13.39 Section 13... Referral of Debts to IRS for Tax Refund Offset § 13.39 Agency determination. (a) Following review of the evidence, EPA will issue a written decision. (b) If EPA either sustains or amends its determination, it...

  10. 12 CFR 339.8 - Determination fees.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Determination fees. 339.8 Section 339.8 Banks... IN AREAS HAVING SPECIAL FLOOD HAZARDS § 339.8 Determination fees. (a) General. Notwithstanding any... hazard area. A determination fee may also include, but is not limited to, a fee for life-of-loan...

  11. 36 CFR 908.33 - Final determination.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Final determination. 908.33... DEVELOPMENT AREA Review Procedure § 908.33 Final determination. (a) The Chairman or designee(s) shall make a final determination on the claim within 45 days of receipt of the file from the Director of Real Estate...

  12. The Determinants of Food Choice

    DEFF Research Database (Denmark)

    Leng, Gareth; Adan, Roger A. H.; Belot, Michele

    2017-01-01

    , we need to be able to make valid predictions about the consequences of proposed interventions, and for this, we need a better understanding of the determinants of food choice. These determinants include dietary components (e.g. highly palatable foods and alcohol), but also diverse cultural and social...

  13. Diagnostic agent for radioimmunological determinations

    International Nuclear Information System (INIS)

    Updike, S.J.

    1978-01-01

    The invention concerns a diagnostic agent for radioimmunological determinations. According to the invention, a binding protein (protein globulins, antibodies) of an aqueous solution specific for the substance to be determined is incorporated in gel particles of a strongly hydrophilic insoluble gel of controlled pore size. After subsequent drying of the system, a radioactively labelled form of the substance to be determined from a non-aqueous medium is included. The mixture is dried again. The diagnostic agent forred can be well stored and is very stable. There is no loss of activity of the specific bonding protein when drying according to the invented method. The described reagent can be effectively applied to the determination of many antigens and haptens: The gel is rehydrated by the sample to be investigated; as a result of this, the non-bonded tracer is set free and competes with the non-labelled substance for the bonding position. (VJ) [de

  14. Distorted wave models applied to electron emission study in ion-atom collisions at intermediate and high energies

    International Nuclear Information System (INIS)

    Fainstein, P.D.

    1989-01-01

    The electron emission from different atoms induced by impact of multicharged bare ions at intermediate and high energies is studied. To perform these studies, the continuum distorted wave-eikonal initial state model is used. With this distorted wave model, analytical expressions are obtained for the transition amplitudes as a function of the transverse momentum transfer for hydrogen targets in an arbitrary initial state and for every any orbital of a multielectronic target represented as a linear combination of Slater type orbitals. With these expressions, the different cross sections which are compared with the experimental data available are numerically calculated. The results obtained for different targets and projectiles and the comparison with other theoretical models and experimental data allows to explain the electron emission spectra and to predict new effects which have not been measured so far. The results of the present work permit to view the ionization process as the evolution of the active electron in the combined field of the target and projectile nuclei. (Author) [es

  15. A complexity analysis of the Gauss-Bessel quadrature as applied to the evaluation of multi-centre integrals over STFs

    International Nuclear Information System (INIS)

    Bouferguene, Ahmed; Safouhi, Hassan

    2006-01-01

    In a previous work (Bouferguene 2005 J. Phys. A: Math. Gen. 38 3923), we have shown that in the framework of the Gaussian integral transform, multi-centre integrals over Slater type functions can be evaluated to an acceptable accuracy using a tailored Gauss quadrature in which the weight function has the form W(σ, τ; z) = z ν exp(-σz - τ/z). To be considered a solution worth implementing within a software for routine use in ab initio molecular simulations, the method must also prove to be at least as efficient as those methods previously published in the literature. Two major results are provided in this paper. Firstly, an improvement of the procedure used to generate the roots and weights of the Gauss-Bessel quadrature is proposed. Secondly, a computational cost analysis of the present method and the SD-bar (Safouhi 2001 J. Phys. A: Math. Gen. 34 2801) based approach are compared, hence proving the equivalence of the two from a complexity point of view

  16. Theoretical analysis of the structural phase transformation from B3 to B1 in BeO under high pressure

    Science.gov (United States)

    Jain, Arvind; Verma, Saligram; Nagarch, R. K.; Shah, S.; Kaurav, Netram

    2018-05-01

    We have performed the phase transformation and elastic properties of BeO at high pressure by formulating effective interionic interaction potential. The elastic constants, including the long-range Coulomb and van der Waals (vdW) interactions and the short-range repulsive interaction of up to second-neighbor ions within the Hafemeister and Flygare approach, are derived. Assuming that both the ions are polarizable, we employed the Slater-Kirkwood variational method to estimate the vdW coefficients, a structural phase transition (Pt) from ZnS structure (B3) to NaCl structure (B1) at 108 GPa has been predicted for BeO. The estimated value of the phase transition pressure (Pt) and the magnitude of the discontinuity in volume at the transition pressure are consistent as compared to the theoretical data. The variations of elastic constants with pressure follow a systematic trend identical to that observed in others compounds of ZnS type structure family.

  17. Temperature and pressure dependent structural and thermo-physical properties of quaternary CoVTiAl alloy

    Science.gov (United States)

    Yousuf, Saleem; Gupta, Dinesh C.

    2017-09-01

    Investigation of band structure and thermo-physical response of new quaternary CoVTiAl Heusler alloy within the frame work of density functional theory has been analyzed. 100% spin polarization with ferromagnetic stable ground state at the optimized lattice parameter of 6.01 Å is predicted for the compound. Slater-Pauling rule for the total magnetic moment of 3 μB and an indirect semiconducting behavior is also seen for the compound. In order to perfectly analyze the thermo-physical response, the lattice thermal conductivity and thermodynamic properties have been calculated. Thermal effects on some macroscopic properties of CoVTiAl are predicted using the quasi-harmonic Debye model, in which the lattice vibrations are taken into account. The variations of the lattice constant, volume expansion coefficient, heat capacities, and Debye temperature with pressure and temperature in the ranges of 0 GPa to 15 GPa and 0 K to 800 K have been obtained.

  18. Exact exchange-correlation potential and approximate exchange potential in terms of density matrices

    International Nuclear Information System (INIS)

    Holas, A.; March, N.H.

    1995-01-01

    An exact expression in terms of density matrices (DM) is derived for δF[n]/δn(r), the functional derivative of the Hohenberg-Kohn functional. The derivation starts from the differential form of the virial theorem, obtained here for an electron system with arbitrary interactions, and leads to an expression taking the form of an integral over a path that can be chosen arbitrarily. After applying this approach to the equivalent system of noninteracting electrons (Slater-Kohn-Sham scheme) and combining the corresponding result with the previous one, an exact expression for the exchange-correlation potential v xc (r) is obtained which is analogous in character to that for δF[n]/δn(r), but involving, besides the interacting-system DMs, also the noninteracitng DMs. Equating the former DMs to the latter ones, we reduce the result for the exact v xc (r) to that for an approximate exchange-only potential v x (r). This leads naturally to the Harbola-Sahni exchange-only potential

  19. Orientación al mercado que utilizan las Instituciones Prestadoras de Servicios de Salud (IPS en Florencia, Caquetá, Colombia

    Directory of Open Access Journals (Sweden)

    Fernando Penagos Guzmán

    2017-06-01

    Full Text Available esumen Este artículo pretende caracterizar los componentes de la orientación al mercado que utilizan las Instituciones Prestadoras de Servicios de Salud (IPS en Florencia. Como instrumentos de medida se aplicó el enfoque de Test de escalas con ítems Markor de Kohli y Jaworski, y el de Narver y Slater; permitiendo el análisis de la información empresarial y del sector. La propuesta se enmarcó en una forma de investigación cualitativa y cuantitativa, empleando técnicas e instrumentos como entrevista, encuesta, observación directa y fuentes documentales; sometida a la investigación exploratoria-descriptiva. Se concluye que la implementación del modelo y los componentes de orientación al mercado requieren de un gran conocimiento de la empresa, del entorno y sobre todo reconocerlo como generador de una cultura organizacional global, que permita alcanzar los resultados y beneficios con enfoque de largo plazo.

  20. Consideration of relativistic effects in band structure calculations based on the empirical tight-binding method

    International Nuclear Information System (INIS)

    Hanke, M.; Hennig, D.; Kaschte, A.; Koeppen, M.

    1988-01-01

    The energy band structure of cadmium telluride and mercury telluride materials is investigated by means of the tight-binding (TB) method considering relativistic effects and the spin-orbit interaction. Taking into account relativistic effects in the method is rather simple though the size of the Hamilton matrix doubles. Such considerations are necessary for the interesting small-interstice semiconductors, and the experimental results are reflected correctly in the band structures. The transformation behaviour of the eigenvectors within the Brillouin zone gets more complicated, but is, nevertheless, theoretically controllable. If, however, the matrix elements of the Green operator are to be calculated, one has to use formula manipulation programmes in particular for non-diagonal elements. For defect calculations by the Koster-Slater theory of scattering it is necessary to know these matrix elements. Knowledge of the transformation behaviour of eigenfunctions saves frequent diagonalization of the Hamilton matrix and thus permits a numerical solution of the problem. Corresponding results for the sp 3 basis are available

  1. Fast-electron-impact study on excitations of 4p, 4s, and 3d electrons of krypton

    International Nuclear Information System (INIS)

    Yuan Zhensheng; Zhu Linfan; Liu Xiaojing; Li Wenbin; Cheng Huadong; Xu Kezun; Zhong Zhiping

    2002-01-01

    Absolute optical oscillator strength densities for the excitations of the electrons 4p, 4s, and 3d have been measured. Their absolute optical oscillator strengths have also been obtained. An enhancement above the 4p ionization threshold in the photoabsorption spectrum was assigned as a delayed maximum which arises from the photoionization process of 4p→εd according to present Dirac-Slater calculation. In the energy region of 4s autoionization, we have observed several features that are absent in previous fast-electron-impact work, but exist in optical measurements. We clarify this discrepancy here. Two Rydberg series of optically forbidden transitions, i.e., 4s -1 ns( 1 S) (n=5,6,7) and 4s -1 nd( 1 D) (n=4,5,6,7) have been observed when the spectrometer worked at conditions with larger momentum transfers, namely, K 2 =0.23 a.u. and 0.67 a.u. Furthermore, the absolute optical oscillator strengths for the 3d excitation have been obtained

  2. Interesting Features of Ionization Potentials for Elements (Z ≤ 119) along the Periodic Table

    International Nuclear Information System (INIS)

    Gu Chun; Zeng De-Ling; Li Jia-Ming; Jin Rui; Yue Xian-Fang; Gao Xiang

    2016-01-01

    The ionization potential (IP) is a basic property of an atom, which has many applications such as in element analysis. With the Dirac–Slater methods (i.e., mean field theory), IPs of all occupied orbitals for elements with atomic number (Z ≤ 119) are calculated conveniently and systematically. Compared with available experimental measurements, the theoretical accuracies of IPs for various occupied orbitals are ascertained. The map of the inner orbital IPs with good accuracies should be useful to select x-ray energies for element analysis. Based on systematic variations of the first IPs for the outermost orbitals in good agreement with experimental values as well as other IPs, mechanisms of electronic configurations of all atomic elements (Z ≤ 119) along the periodic table are elucidated. It is interesting to note that there exist some deficiencies of the intermediate orbital IPs, which are due to electron correlations and should be treated beyond the mean field theory. (paper)

  3. Band structure of the quaternary Heusler alloys ScMnFeSn and ScFeCoAl

    Science.gov (United States)

    Shanthi, N.; Teja, Y. N.; Shaji, Shephine M.; Hosamani, Shashikala; Divya, H. S.

    2018-04-01

    In our quest for materials with specific applications, a theoretical study plays an important role in predicting the properties of compounds. Heusler alloys or compounds are the most studied in this context. More recently, a lot of quaternary Heusler compounds are investigated for potential applications in fields like Spintronics. We report here our preliminary study of the alloys ScMnFeSn and ScFeCoAl, using the ab-initio linear muffin-tin orbital method within the atomic sphere approximation (LMTO-ASA). The alloy ScMnFeSn shows perfect half-metallicity, namely, one of the spins shows a metallic behaviour and the other spin shows semi-conducting behaviour. Such materials find application in devices such as the spin-transfer torque random access memory (STT-MRAM). In addition, the alloy ScMnFeSn is found to have an integral magnetic moment of 4 µB, as predicted by the Slater-Pauling rule. The alloy ScFeCoAl does not show half-metallicity.

  4. The SU(r){sub 2} string functions as q-diagrams

    Energy Technology Data Exchange (ETDEWEB)

    Genish, Arel, E-mail: Arel.genish@weizmann.ac.il; Gepner, Doron, E-mail: Doron.gepner@weizmann.ac.il

    2016-06-15

    A generalized Roger Ramanujan (GRR) type expression for the characters of A-type parafermions has been a long standing puzzle dating back to conjectures made regarding some of the characters in the 90s. Not long ago we have put forward such GRR type identities describing any of the level two ADE-type generalized parafermions characters at any rank. These characters are the string functions of simply laced Lie algebras at level two, as such, they are also of mathematical interest. In our last joint paper we presented the complete derivation for the D-type generalized parafermions characters identities. Here we generalize our previous discussion and prove the GRR type expressions for the characters of A-type generalized parafermions. To prove the A-type GRR conjecture we study further the q-diagrams, introduced in our last joint paper, and examine the diagrammatic interpretations of known identities among them Slater identities for the characters of the first minimal model, which is the Ising model, and the Bailey lemma.

  5. Modified Moliere's screening parameter and its impact on multiple coulomb scattering

    International Nuclear Information System (INIS)

    Striganov, Sergei

    2015-01-01

    The Moliere approximation of elastic Coulomb scattering cross-sections plays an important role in accurate description of multiple scattering, non-ionisation energy, DPA radiation damage etc. The cross-section depends only on a single parameter that describes the atomic screening. Moliere calculated the screening angle for the Tomas-Fermi distribution of electrons in atoms. In this paper, the screening parameter was recalculated using a more accurate atomic form-factor obtained from the self-consistent Dirac-Hartree-Fock-Slater computations. For relativistic particles, the new screening angle can differ from the Moliere approximation by up to 50%. At the same time, it is rather close to other independent calculations. At low energies, the new screening angle is different for positrons and electrons. The positron screening parameter is much larger than the electron one for heavy nuclei at energies of ∼Z keV. The impact of the screening angle on particle transport and calculated quantities is discussed. (authors)

  6. Comparative studies of atomic independent-particle potentials

    International Nuclear Information System (INIS)

    Talman, J.D.; Ganas, P.S.; Green, A.E.S.

    1979-01-01

    A number of atomic properties are compared in various independent-particle models for atoms. The models studied are the Hartree-Fock method, a variationally optimized potential model, a parametrized analytic form of the same model, parametrized analytic models constructed to fit atomic energy levels, the so-called Hartree-Fock-Slater model, and the Xα model. The physical properties compared are single-particle energy levels, total energies, and dipole polarizabilities. The extent to which the virial theorem is satisfied in the different models is also considered. The atoms Be, Ne, Ar, Kr, and Xe and ions O v and Al iv hav been compared. The results show that the experimental properties can be well represented by several of the independent-particle models. Since it has been shown that the optimized potential models yield wavefunctions that are almost the same as Hartree-Fock wavefunctions, they provide a natural solution to the problem of extending the Hartree-Fock method to excited states

  7. NOSTALGIA, ANTICONSUMO SIMBÓLICO E BEM-ESTAR: A AGRICULTURA URBANA

    Directory of Open Access Journals (Sweden)

    Bruno Henrique Comasseto

    2013-07-01

    Full Text Available The establishment of a global consumption culture had as a consequence a growing concern with the impact of consumption practices on the environment, as well as on the general and personal well-being. In this context emerges the urban agriculture (UA associated to environmental, social and health benefits (SLATER, 2001. The objective of this study is to understand the meaning of the UA phenomenon as a consumption practice, identifying which theories are related to it. In order to reach that goal, a qualitative research used as data collection in-depth interviews. The subjects were experts and practitioners in UA living in 9 neighborhoods in urban areas of a Brazilian city with a population bigger than 1 million inhabitants. Results showed double motivation for the UA practice, extrinsic (example and intrinsic (well-being, linking the UA to environmental concerns, to health and well-being, and the respect and pride for a nostalgic cultural heritage.

  8. Energy levels of 4f3 in the Nd3+ free ion from emission spectra

    International Nuclear Information System (INIS)

    Wyart, Jean-Francois; Meftah, Ali; Bachelier, Annik; Sinzelle, Jocelyne; Tchang-Brillet, Wan-Ue Lydia; Champion, Norbert; Spector, Nissan; Sugar, Jack

    2006-01-01

    The emission spectrum of neodymium produced by vacuum spark sources was observed in the vacuum ultraviolet on two normal-incidence spectrographs. In an initial result, more than 550 lines have been identified as transitions from 85 4f 2 5d levels to 37 levels of the 4f 3 ground configuration in the free ion Nd 3+ . The levels 4f 34 F 3/2 and 4 I 11/2 , responsible for the well-known 1064 nm laser line, have respective positions of 11 698.57 ±0.1 cm -1 and 1897.07 ±0.1 cm -1 above the ground level 4 I 9/2 . The newly found levels of 4f 3 constitute the first isolated 4f N configuration (N > 2) and therefore enable checks of effective parameters that represent far configuration interaction. Slater parameters F k (4f, 4f) derived from Nd 3+ :LaCl 3 are 3% to 5% smaller than in the free ion. (letter to the editor)

  9. CARACTERÍSTICAS DE LA PRÁCTICA FÍSICO-DEPORTIVA DEL ALUMNADO CON DISCAPACIDAD DE LA UNIVERSITAT DE VALÈNCIA

    Directory of Open Access Journals (Sweden)

    Joan Úbeda Colomer

    2015-04-01

    Full Text Available En la actualidad, la actividad físico-deportiva es fundamental para las personas con discapacidad debido a los múltiples beneficios físicos, psicológicos y sociales que aporta (Patel y Greydanus, 2010; Slater y Meade, 2004. Estudiar las características de la práctica físico-deportiva de este colectivo puede ser útil para poder desarrollar estrategias y programas que mejoren y aumenten dicha práctica (Bragaru, van Wilgen, Geertzen, Ruijs, Dijsktra y Dekker, 2013. Pese a ello, apenas existen estudios de carácter cuantitativo sobre el tema. Objetivo: De acuerdo con las carencias señaladas, el objetivo de este trabajo es identificar la cuantía de la práctica físico-deportiva del alumnado con discapacidad de la Universitat de València (UV, así como algunas características y pautas relacionadas con la misma.

  10. The SU(r)_2 string functions as q-diagrams

    International Nuclear Information System (INIS)

    Genish, Arel; Gepner, Doron

    2016-01-01

    A generalized Roger Ramanujan (GRR) type expression for the characters of A-type parafermions has been a long standing puzzle dating back to conjectures made regarding some of the characters in the 90s. Not long ago we have put forward such GRR type identities describing any of the level two ADE-type generalized parafermions characters at any rank. These characters are the string functions of simply laced Lie algebras at level two, as such, they are also of mathematical interest. In our last joint paper we presented the complete derivation for the D-type generalized parafermions characters identities. Here we generalize our previous discussion and prove the GRR type expressions for the characters of A-type generalized parafermions. To prove the A-type GRR conjecture we study further the q-diagrams, introduced in our last joint paper, and examine the diagrammatic interpretations of known identities among them Slater identities for the characters of the first minimal model, which is the Ising model, and the Bailey lemma.

  11. Nano-colloid electrophoretic transport: Fully explicit modelling via dissipative particle dynamics

    Science.gov (United States)

    Hassanzadeh Afrouzi, Hamid; Farhadi, Mousa; Sedighi, Kurosh; Moshfegh, Abouzar

    2018-02-01

    In present study, a novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced for modelling electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Moreover, capability of different thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field in nano scale application (0.072 600 in DPD units regardless of electric field intensity. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0.145 [ v / nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the radial distribution function with available electrolyte structure modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.

  12. Clinical application and observation of curative effect in the near future of iodine-131 therapy in juvenile patients with hyperthyroidism

    International Nuclear Information System (INIS)

    Chen Huilin; Liang Jun; Liang Fengyun

    2004-01-01

    Objective: To assess clinical application of 131 I therapy and observation of curative effect in the near future after treatment in juvenile patients with hyperthyroidism Methods: 44 juvenile patients with hyperthyroidism were divided two subgroups of that children and early youths .The dosage of 131 I were respectively 135.1±34.0(3.65±0.92), 200.2±64.0 MBq(5.41±1.73 mCi). The curative effect belonged in four kinds being to fully recovered, quite a lot, fail to respond to medical and hypothyroidism at six month slater or from then. Results: 46 times treatment were gave and therapy effect was same in every subgroups. The effective rate of total was 89.1% and rater on clinical hypothyroidism was 4.3%. Conclusions: It had an obvious effect that 131 I therapy for juvenile patients with hyperthyroidism. 131 I therapy was also a firmly good select because a well ratio effect/cost. (authors)

  13. Dissipative particle dynamics: Effects of thermostating schemes on nano-colloid electrophoresis

    Science.gov (United States)

    Hassanzadeh Afrouzi, Hamid; Moshfegh, Abouzar; Farhadi, Mousa; Sedighi, Kurosh

    2018-05-01

    A novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced in the present study to model the electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Performance of various thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field (0 . 072 relationships respectively with electric field and colloidal repulsion; although they each respectively behave direct and inverse trends with salt concentration under various thermostats. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0 . 145[v/nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the system radial distribution function with available EW3D modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.

  14. Calculation of self-consistent potentials for substitutionally disordered systems with application to the Ag/sub x/-Pd/sub 1-x/ alloy series

    International Nuclear Information System (INIS)

    Winter, H.; Stocks, G.M.

    1983-01-01

    Previous Korringa-Kohn-Rostoker coherent-potential-approximation electronic-structure calculations for substitutionally random alloys have been based on ad hoc potentials. The lack of procedures suitable to provide self-consistent, parameter-free potentials prevented computations for systems consisting of dissimilar atoms and is also the reason why quantities like, for example, cohesive energies or lattice constants, have not so far been evaluated for systems of similar constituents. We present in full detail a generally applicable scheme devised for calculating the self-consistent electronic structures of substitutionally disordered systems. Its feasibility is demonstrated by presenting the results obtained for the Ag/sub x/Pd/sub 1-x/ alloy series. They are compared with those of former non-self-consistent calculations which use Mattheiss prescription potentials and the α = 1 Slater exchange, whereas the von Barth--Hedin expression is employed in our work. The differences are perceptible and have to be understood as combined self-consistency and exchange-correlation effects. .ID BW2039 .PG 905 909

  15. Bioenergetics molecular biology, biochemistry, and pathology

    CERN Document Server

    Ozawa, Takayuki

    1990-01-01

    The emergence of the Biochemical Sciences is underlined by the FAOB symposium in Seoul and highlighted by this Satellite meeting on the "New Bioenergetics. " Classical mitochondrial electron transfer and energy coupling is now complemented by the emerging molecular biology of the respiratory chain which is studied hand in hand with the recognition of mitochondrial disease as a major and emerging study in the basic and clinical medical sciences. Thus, this symposium has achieved an important balance of the fundamental and applied aspects of bioenergetics in the modern setting of molecular biology and mitochondrial disease. At the same time, the symposium takes note not only of the emerging excellence of Biochemical Studies in the Orient and indeed in Korea itself, but also retrospectively enjoys the history of electron transport and energy conservation as represented by the triumvirate ofYagi, King and Slater. Many thanks are due Drs. Kim and Ozawa for their elegant organization of this meeting and its juxtapo...

  16. Efficient construction of exchange and correlation potentials by inverting the Kohn-Sham equations.

    Science.gov (United States)

    Kananenka, Alexei A; Kohut, Sviataslau V; Gaiduk, Alex P; Ryabinkin, Ilya G; Staroverov, Viktor N

    2013-08-21

    Given a set of canonical Kohn-Sham orbitals, orbital energies, and an external potential for a many-electron system, one can invert the Kohn-Sham equations in a single step to obtain the corresponding exchange-correlation potential, vXC(r). For orbitals and orbital energies that are solutions of the Kohn-Sham equations with a multiplicative vXC(r) this procedure recovers vXC(r) (in the basis set limit), but for eigenfunctions of a non-multiplicative one-electron operator it produces an orbital-averaged potential. In particular, substitution of Hartree-Fock orbitals and eigenvalues into the Kohn-Sham inversion formula is a fast way to compute the Slater potential. In the same way, we efficiently construct orbital-averaged exchange and correlation potentials for hybrid and kinetic-energy-density-dependent functionals. We also show how the Kohn-Sham inversion approach can be used to compute functional derivatives of explicit density functionals and to approximate functional derivatives of orbital-dependent functionals.

  17. Transport coefficients for carbon, hydrogen, and the organic mixture C2H3

    International Nuclear Information System (INIS)

    Rinker, G.

    1986-02-01

    Electrical and thermal transport coefficients are calculated for amorphous elemental carbon and hydrogen, using the best available systematic theoretical methods. The density range considered is 10 -3 g/cm 3 less than or equal to rho less than or equal to 10 6 g/cm 3 for carbon, and 10 -4 g/cm 3 less than or equal to rho less than or equal to 10 5 g/cm 3 for hydrogen. The temperature range considered is 10 -2 eV less than or equal to kT less than or equal to 10 4 eV. Calculational methods include relativistic partial-wave analysis of the extended Ziman theory, and nonrelativistic plane-wave analysis (Born approximation) of the original Ziman theory. Physical models include relativistic Dirac-Fock-Slater and nonrelativistic Thomas-Fermi-Dirac electron-ion potentials, and one-component-plasma ion-ion structure factors. A mixing algorithm is used to obtain approximate transport coefficients for the atomic ratio C 2 H 3 . 10 refs., 31 figs

  18. FEAST fundamental framework for electronic structure calculations: Reformulation and solution of the muffin-tin problem

    Science.gov (United States)

    Levin, Alan R.; Zhang, Deyin; Polizzi, Eric

    2012-11-01

    In a recent article Polizzi (2009) [15], the FEAST algorithm has been presented as a general purpose eigenvalue solver which is ideally suited for addressing the numerical challenges in electronic structure calculations. Here, FEAST is presented beyond the “black-box” solver as a fundamental modeling framework which can naturally address the original numerical complexity of the electronic structure problem as formulated by Slater in 1937 [3]. The non-linear eigenvalue problem arising from the muffin-tin decomposition of the real-space domain is first derived and then reformulated to be solved exactly within the FEAST framework. This new framework is presented as a fundamental and practical solution for performing both accurate and scalable electronic structure calculations, bypassing the various issues of using traditional approaches such as linearization and pseudopotential techniques. A finite element implementation of this FEAST framework along with simulation results for various molecular systems is also presented and discussed.

  19. Handbook of the band structure of elemental solids from Z = 1 to Z = 112

    CERN Document Server

    Papaconstantopoulos, Dimitris A

    2015-01-01

    This handbook presents electronic structure data and tabulations of Slater-Koster parameters for the whole periodic table. This second edition presents data sets for all elements up to Z = 112, Copernicium, whereas the first edition contained only 53 elements. In this new edition, results are given for the equation of state of the elements together with the parameters of a Birch fit, so that the reader can regenerate the results and derive additional information, such as Pressure-Volume relations and variation of Bulk Modulus with Pressure. For each element, in addition to the equation of state, the energy bands, densities of states, and a set of tight-binding parameters is provided. For a majority of elements, the tight-binding parameters are presented for both a two- and three-center approximation. For the hcp structure, new three-center tight-binding results are given. Other new material in this edition include: energy bands and densities of states of all rare-earth metals, a discussion of the McMillan-Gas...

  20. 12 CFR 572.8 - Determination fees.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Determination fees. 572.8 Section 572.8 Banks... FLOOD HAZARDS § 572.8 Determination fees. (a) General. Notwithstanding any Federal or State law other... flood hazard area. A determination fee may also include, but is not limited to, a fee for life-of-loan...

  1. 12 CFR 22.8 - Determination fees.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Determination fees. 22.8 Section 22.8 Banks and... HAZARDS § 22.8 Determination fees. (a) General. Notwithstanding any Federal or State law other than the... home securing the loan is located or will be located in a special flood hazard area. A determination...

  2. 18 CFR 286.108 - Determination.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Determination. 286.108 Section 286.108 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... Contested Audit Findings and Proposed Remedies § 286.108 Determination. If no formal hearing is had the...

  3. 36 CFR 297.5 - Determination.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Determination. 297.5 Section 297.5 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE WILD AND SCENIC RIVERS Water Resources Projects § 297.5 Determination. (a) The Secretary of Agriculture will consent to...

  4. Teaching Determinants Using Rook Arrangements

    Science.gov (United States)

    Hendrickson, Anders O. F.

    2018-01-01

    Teaching determinants poses significant challenges to the instructor of a proof-based undergraduate linear algebra course. The standard definition by cofactor expansion is ugly, lacks symmetry, and is hard for students to use in proofs. We introduce a visual definition of the determinant that interprets permutations as arrangements of…

  5. Determination of sulfur content in fuels

    International Nuclear Information System (INIS)

    Daucik, P.; Zidek, Z.; Kalab, P.

    1998-01-01

    The sulfur content in fuels, Diesel fuels, and in the solutions of dibutylsulfide in a white oil was determined by various methods. The results obtained by elemental analysis have shown that the method is not advisable for the determination of sulfur in fuels. A good agreement was found by comparing the results in the determination of the sulfur by Grote-Krekeler's and Hermann-Moritz's methods and by the energy-dispersive X-ray fluorescence analysis. The last method is the modern, comfortable, and timesaving method enabling the fast and precise determination of sulfur contents in the various types of samples. (authors)

  6. Polarographic determination of uranium dioxide stoichiometry

    International Nuclear Information System (INIS)

    Viguie, J.; Uny, G.

    1966-10-01

    The method described allows the determination of small deviations from stoichiometry for uranium dioxide. It was applied to the study of surface oxidation of bulk samples. The sample is dissolved in phosphoric acid under an argon atmosphere; U(VI) is determined by polarography in PO 4 H 3 4.5 N - H 2 SO 4 4 N. U(IV) is determined by potentiometry. The detection limit is UO 2,0002 . The accuracy for a single determination at the 95% confidence level is ±20 per cent for samples with composition included between UO 2,001 and UO 2,01 . (authors) [fr

  7. Lessons for Inductive Germline Determination

    Science.gov (United States)

    Seervai, Riyad N.H.; Wessel, Gary M.

    2015-01-01

    SUMMARY Formation of the germline in an embryo marks a fresh round of reproductive potential, yet the developmental stage and location within the embryo where the primordial germ cells (PGCs) form differs wildly among species. In most animals, the germline is formed either by an inherited mechanism, in which maternal provisions within the oocyte drive localized germ-cell fate once acquired in the embryo, or an inductive mechanism that involves signaling between cells that directs germ-cell fate. The inherited mechanism has been widely studied in model organisms such as Drosophila melanogaster, Caenorhabditis elegans, Xenopus laevis, and Danio rerio. Given the rapid generation time and the effective adaptation for laboratory research of these organisms, it is not coincidental that research on these organisms has led the field in elucidating mechanisms for germline specification. The inductive mechanism, however, is less well understood and is studied primarily in the mouse (Mus musculus). In this review, we compare and contrast these two fundamental mechanisms for germline determination, beginning with the key molecular determinants that play a role in the formation of germ cells across all animal taxa. We next explore the current understanding of the inductive mechanism of germ-cell determination in mice, and evaluate the hypotheses for selective pressures on these contrasting mechanisms. We then discuss the hypothesis that the transition between these determination mechanisms, which has happened many times in phylogeny, is more of a continuum than a binary change. Finally, we propose an analogy between germline determination and sex determination in vertebrates—two of the milestones of reproduction and development—in which animals use contrasting strategies to activate similar pathways. PMID:23450642

  8. How Darwinian reductionism refutes genetic determinism.

    Science.gov (United States)

    Rosoff, Philip M; Rosenberg, Alex

    2006-03-01

    Genetic determinism labels the morally problematical claim that some socially significant traits, traits we care about, such as sexual orientation, gender roles, violence, alcoholism, mental illness, intelligence, are largely the results of the operation of genes and not much alterable by environment, learning or other human intervention. Genetic determinism does not require that genes literally fix these socially significant traits, but rather that they constrain them within narrow channels beyond human intervention. In this essay we analyze genetic determinism in light of what is now known about the inborn error of metabolism phenylketonuria (PKU), which has for so long been the poster child 'simple' argument in favor of some form of genetic determinism. We demonstrate that this case proves the exact opposite of what it has been proposed to support and provides a strong refutation of genetic determinism in all its guises.

  9. Gender determination in populus

    Energy Technology Data Exchange (ETDEWEB)

    McLetchie, D.N. [Univ. of Kentucky, Lexington, KY (United States). Dept. of Biological Sciences; Tuskan, G.A. [Oak Ridge National Lab., TN (United States)

    1994-12-31

    Gender, the expression of maleness or femaleness, in dioecious plants has been associated with changes in morphology, physiology, ecological position, and commercial importance of several species, including members of the Salicaceae family. Various mechanisms have been proposed to explain the expression of gender in Salicaceae, including sex chromosomes, simple Mendelian genes, quantitative genes, environment, and genotype-by-environment interactions. Published reports would favor a genetic basis for gender. The objective of this study was to identify molecular markers associated with gender in a segregating family of hybrid poplars. Bulked segregant analysis and chi-squared analysis were used to test for the occurrence of sex chromosomes, individual loci, and chromosome ratios (i.e., ploidy levels) as the mechanisms for gender determination. Examination of 2488 PCR based RAPD markers from 1219 primers revealed nine polymorphic bands between male and female bulked samples. However, linkage analysis indicated that none of these markers were significantly associated with gender. Chisquared results for difference in male-to-female ratios between diploid and triploid genotypes also revealed no significant differences. These findings suggest gender is not controlled via sex chromosomes, simple Mendelian loci or ratios of autosome to gender-determining loci. It is possible that gender is determined genetically by regions of the genome not sampled by the tested markers or by a complex of loci operating in an additive threshold manner or in an epistatic manner. It is also possible that gender is determined environmentally at an early zygote stage, canalizing gender expression.

  10. Age determination and geological studies

    International Nuclear Information System (INIS)

    Stevens, R.D.; Delabio, R.N.; Lachance, G.R.

    1982-01-01

    Two hundred and eight potassium-argon age determinations carried out on Canadian rocks and minerals are reported. Each age determination is accompanied by a description of the rock and mineral concentrate used; brief interpretative comments regarding the geological significance of each age are also provided where possible. The experimental procedures employed are described in brief outline and the constants used in the calculation of ages are listed. Two geological time-scales are reproduced in tabular form for ready reference and an index of all Geological Survey of Canada K-Ar age determinations published in this format has been prepared using NTS quadrangles as the primary reference

  11. Framing the Future: Self-Determination

    Science.gov (United States)

    Wehmeyer, Michael L.

    2015-01-01

    There is an established and still-growing evidence base that promoting self-determination has positive school and post-school benefits for students with disabilities, and yet efforts to do so remain sporadic, at best. This article examines the evidence that promoting self-determination is critically important for students with disabilities,…

  12. 42 CFR 436.531 - Determination of blindness.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Determination of blindness. 436.531 Section 436.531... Requirements for Medicaid Eligibility Blindness § 436.531 Determination of blindness. In determining blindness... determine on behalf of the agency— (1) Whether the individual meets the definition of blindness; and (2...

  13. [Social determinants of health and disability: updating the model for determination].

    Science.gov (United States)

    Tamayo, Mauro; Besoaín, Álvaro; Rebolledo, Jaime

    Social determinants of health (SDH) are conditions in which people live. These conditions impact their lives, health status and social inclusion level. In line with the conceptual and comprehensive progression of disability, it is important to update SDH due to their broad implications in implementing health interventions in society. This proposal supports incorporating disability in the model as a structural determinant, as it would lead to the same social inclusion/exclusion of people described in other structural SDH. This proposal encourages giving importance to designing and implementing public policies to improve societal conditions and contribute to social equity. This will be an act of reparation, justice and fulfilment with the Convention on the Rights of Persons with Disabilities. Copyright © 2017 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. Are risks quantitatively determinable

    International Nuclear Information System (INIS)

    Buetzer, P.

    1985-01-01

    ''Chemical risks'' can only be determined with accurate figures in a few extraordinary cases. The difficulties lie, as has been shown by the example of the Flixborough catastrophe, mostly in the determination of the probabilities of occurrence. With a rough semiquantitative estimate of the potential hazards and the corresponding probabilities we can predict the risks with astonishing accuracy. Statistical data from incidents in the chemical industry are very useful, and they also show that ''chemical catastrophes'' are only to a very small extent initiated by uncontrolled chemical reactions. (orig.) [de

  15. Determinants and outcomes of motivation in health professions education: a systematic review based on self-determination theory

    Science.gov (United States)

    2016-01-01

    Purpose: This study aimed at conducting a systematic review in health professions education of determinants, mediators and outcomes of students’ motivation to engage in academic activities based on the self-determination theory’s perspective. Methods: A search was conducted across databases (MEDLINE, CINHAL, EMBASE, PsycINFO, and ERIC databases), hand-search of relevant journals, grey literature, and published research profile of key authors. Quantitative and qualitative studies were included if they reported research in health professions education focused on determinants, mediators, and/or outcomes of motivation from the self-determination and if meeting the quality criteria. Results: A total of 17 studies met the inclusion and quality criteria. Articles retrieved came from diverse locations and mainly from medical education and to a lesser extent from psychology and dental education. Intrapersonal (gender and personality traits) and interpersonal determinants (academic conditions and lifestyle, qualitative method of selection, feedback, and an autonomy supportive learning climate) have been reported to have a positive influence on students’ motivation to engage in academic activities. No studies were found that tested mediation effects between determinants and students’ motivation. In turn, students’ self-determined motivation has been found to be positively associated with different cognitive, affective, and behavioural outcomes. Conclusion: This study has found that generally, motivation could be enhanced by changes in the educational environment and by an early detection of students’ characteristics. Doing so may support future health practitioners’ self-determined motivation and positively influence how they process information and their emotions and how they approach their learning activities. PMID:27134006

  16. Determinants and outcomes of motivation in health professions education: a systematic review based on self-determination theory

    Directory of Open Access Journals (Sweden)

    Cesar Orsini

    2016-05-01

    Full Text Available Purpose: This study aimed at conducting a systematic review in health professions education of determinants, mediators and outcomes of students’ motivation to engage in academic activities based on the self-determination theory’s perspective. Methods: A search was conducted across databases (MEDLINE, CINHAL, EMBASE, PsycINFO, and ERIC databases, hand-search of relevant journals, grey literature, and published research profile of key authors. Quantitative and qualitative studies were included if they reported research in health professions education focused on determinants, mediators, and/or outcomes of motivation from the self-determination and if meeting the quality criteria. Results: A total of 17 studies met the inclusion and quality criteria. Articles retrieved came from diverse locations and mainly from medical education and to a lesser extent from psychology and dental education. Intrapersonal (gender and personality traits and interpersonal determinants (academic conditions and lifestyle, qualitative method of selection, feedback, and an autonomy supportive learning climate have been reported to have a positive influence on students’ motivation to engage in academic activities. No studies were found that tested mediation effects between determinants and students’ motivation. In turn, students’ self-determined motivation has been found to be positively associated with different cognitive, affective, and behavioural outcomes. Conclusion: This study has found that generally, motivation could be enhanced by changes in the educational environment and by an early detection of students’ characteristics. Doing so may support future health practitioners’ self-determined motivation and positively influence how they process information and their emotions and how they approach their learning activities.

  17. Determinants and outcomes of motivation in health professions education: a systematic review based on self-determination theory.

    Science.gov (United States)

    Orsini, Cesar; Binnie, Vivian I; Wilson, Sarah L

    2016-01-01

    This study aimed at conducting a systematic review in health professions education of determinants, mediators and outcomes of students' motivation to engage in academic activities based on the self-determination theory's perspective. A search was conducted across databases (MEDLINE, CINHAL, EMBASE, PsycINFO, and ERIC databases), hand-search of relevant journals, grey literature, and published research profile of key authors. Quantitative and qualitative studies were included if they reported research in health professions education focused on determinants, mediators, and/or outcomes of motivation from the self-determination and if meeting the quality criteria. A total of 17 studies met the inclusion and quality criteria. Articles retrieved came from diverse locations and mainly from medical education and to a lesser extent from psychology and dental education. Intrapersonal (gender and personality traits) and interpersonal determinants (academic conditions and lifestyle, qualitative method of selection, feedback, and an autonomy supportive learning climate) have been reported to have a positive influence on students' motivation to engage in academic activities. No studies were found that tested mediation effects between determinants and students' motivation. In turn, students' self-determined motivation has been found to be positively associated with different cognitive, affective, and behavioural outcomes. This study has found that generally, motivation could be enhanced by changes in the educational environment and by an early detection of students' characteristics. Doing so may support future health practitioners' self-determined motivation and positively influence how they process information and their emotions and how they approach their learning activities.

  18. Perceived teaching behaviors and self-determined motivation in physical education: a test of self-determination theory.

    Science.gov (United States)

    Koka, Andre; Hagger, Martin S

    2010-03-01

    In the present study, we tested the effects of specific dimensions of perceived teaching behaviors on students' self-determined motivation in physical education. In accordance with the tenets of self-determination theory (Deci & Ryan, 1985, 2000), we expected the psychological needs for competence, autonomy, and relatedness would mediate these effects. Secondary school students (N=498) ages 12-17 years completed measures of perceived teaching behaviors for seven dimensions: (a) democratic behavior, (b) autocratic behavior (c) teaching and instruction, (d) situation consideration, (e) positive general feedback, (f) positive nonverbal feedback, and (h) negative nonverbal feedback. They also completed measures of perceived satisfaction for competence, autonomy, relatedness, and self-determined motivation. A path-analytic model revealed a positive, indirect effect of perceived positive general feedback on self-determined motivation. The effects of perceived autocratic behavior and negative nonverbal feedback were direct and negative, whereas the effects of teaching and instruction and situation consideration were direct and positive. Results suggest that feedback, situation consideration, and teaching and instruction are essential antecedents to self-determined motivation.

  19. On Psychic Determinism.

    Science.gov (United States)

    Brown, Robin Gordon

    2017-06-01

    A confusion persists in the psychoanalytic literature regarding the concept of psychic determinism. Two authors are cited in whose works the concept is identified as foundational to psychoanalysis, in the one case as a "fundamental hypothesis" (Charles Brenner) and in the other as an "underlying presupposition" or assumption (Linda A.W. Brakel). Both claims are based on a conflation of the concept Freud had in mind with a philosophical doctrine going by the same name but meaning something quite different. The philosophical doctrine has no place in psychoanalysis at all, and Freud's concept does not play a foundational role there. In a second section a restricted concept of psychic determinism is critically examined. A third section deals with the impact of that restricted concept on clinical theory and contemporary controversies about clinical practice. Finally, some possible reasons for this confusion are suggested.

  20. Uranium hexafluoride. Bromine spectrophotometric determination

    International Nuclear Information System (INIS)

    Anon.

    Bromine determination in hydrolized uranium hexafluoride by reduction of bromates by ferrous sulfate, oxidation of bromides by potassium permanganate to give bromine which is extracted into carbon tetrachloride and transformed in eosine for spectrophotometry at 510 nm. The method is suitable for determining 5 to 150 ppm with respect to uranium [fr

  1. Interaction cross sections and matter radii of oxygen isotopes using the Glauber model

    Science.gov (United States)

    Ahmad, Suhel; Usmani, A. A.; Ahmad, Shakeb; Khan, Z. A.

    2017-05-01

    Using the Coulomb modified correlation expansion for the Glauber model S matrix, we calculate the interaction cross sections of oxygen isotopes (O-2616) on 12C at 1.0 GeV/nucleon. The densities of O-2616 are obtained using (i) the Slater determinants consisting of the harmonic oscillator single-particle wave functions (SDHO) and (ii) the relativistic mean-field approach (RMF). Retaining up to the two-body density term in the correlation expansion, the calculations are performed employing the free as well as the in-medium nucleon-nucleon (N N ) scattering amplitude. The in-medium N N amplitude considers the effects arising due to phase variation, higher momentum transfer components, and Pauli blocking. Our main focus in this work is to reveal how could one make the best use of SDHO densities with reference to the RMF one. The results demonstrate that the SDHO densities, along with the in-medium N N amplitude, are able to provide satisfactory explanation of the experimental data. It is found that, except for O,2423, the predicted SDHO matter rms radii of oxygen isotopes closely agree with those obtained using the RMF densities. However, for O,2423, our results require reasonably larger SDHO matter rms radii than the RMF values, thereby predicting thicker neutron skins in 23O and 24O as compared to RMF ones. In conclusion, the results of the present analysis establish the utility of SDHO densities in predicting fairly reliable estimates of the matter rms radii of neutron-rich nuclei.

  2. The description of dense hydrogen with Wave Packet Molecular Dynamics (WPMD) simulations; Die Beschreibung von dichtem Wasserstoff mit der Methode der Wellenpaket-Molekulardynamik (WPMD)

    Energy Technology Data Exchange (ETDEWEB)

    Jakob, B.

    2006-10-10

    In this work the wave packet molecular dynamics (WPMD) is presented and applied to dense hydrogen. In the WPMD method the electrons are described by a slater determinant of periodic Gaussian wave packets. Each single particle wave function can parametrised through 8 coordinates which can be interpreted as the position and momentum, the width and its conjugate momentum. The equation of motion for these coordinates can be derived from a time depended variational principle. Properties of the equilibrium can be ascertained by a Monte Carlo simulation. With the now completely implemented antisymmetrisation the simulation yields a fundamental different behavior for dense hydrogen compare to earlier simplified models. The results show a phase transition to metallic hydrogen with a higher density than in the molecular phase. This behavior has e.g. a large implication to the physics of giant planets. This work describes the used model and explains in particular the calculation of the energy and forces. The periodicity of the wave function leads to a description in the Fourier space. The antisymmetrisation is done by Matrix operations. Moreover the numerical implementation is described in detail to allow the further development of the code. The results provided in this work show the equation of state in the temperature range 300K - 50000K an density 10{sup 23}-10{sup 24} cm{sup -3}, according a pressure 1 GPa-1000 GPa. In a phase diagram the phase transition to metallic hydrogen can be red off. The electrical conductivity of both phases is destined. (orig.)

  3. Fixed-Node Diffusion Quantum Monte Carlo Method on Dissociation Energies and Their Trends for R-X Bonds (R = Me, Et, i-Pr, t-Bu).

    Science.gov (United States)

    Hou, Aiqiang; Zhou, Xiaojun; Wang, Ting; Wang, Fan

    2018-05-15

    Achieving both bond dissociation energies (BDEs) and their trends for the R-X bonds with R = Me, Et, i-Pr, and t-Bu reliably is nontrivial. Density functional theory (DFT) methods with traditional exchange-correlation functionals usually have large error on both the BDEs and their trends. The M06-2X functional gives rise to reliable BDEs, but the relative BDEs are determined not as accurately. More demanding approaches such as some double-hybrid functionals, for example, G4 and CCSD(T), are generally required to achieve the BDEs and their trends reliably. The fixed-node diffusion quantum Monte Carlo method (FN-DMC) is employed to calculated BDEs of these R-X bonds with X = H, CH 3 , OCH 3 , OH, and F in this work. The single Slater-Jastrow wave function is adopted as trial wave function, and pseudopotentials (PPs) developed for quantum Monte Carlo calculations are chosen. Error of these PPs is modest in wave function methods, while it is more pronounced in DFT calculations. Our results show that accuracy of BDEs with FN-DMC is similar to that of M06-2X and G4, and trends in BDEs are calculated more reliably than M06-2X. Both BDEs and trends in BDEs of these bonds are reproduced reasonably with FN-DMC. FN-DMC using PPs can thus be applied to BDEs and their trends of similar chemical bonds in larger molecules reliably and provide valuable information on properties of these molecules.

  4. Hearing shapes of few electrons quantum drums: A configuration–interaction study

    International Nuclear Information System (INIS)

    Ţolea, F.; Ţolea, M.

    2015-01-01

    The – highly remarkable – existence of non-congruent yet vibrationally isospectral shapes has been first proved theoretically and then also tested experimentally – by using electromagnetic waves in cavities, vibrating smectic films or electrons in nanostructures. In this context, we address the question whether isospectrality holds if two or more electrons interact electrostatically, using the accurate configuration–interaction method, in a discrete representation of the Bilby and Hawk shapes. Isospectral pairs offer an unique possibility to test how identical sets of single-particle energies may combine differently in the few-electrons eigenmodes, due to different wave functions spatial distributions. Our results point towards the break down of isospectrality in the presence of interactions. Thus one should be able to ”hear” the shapes of few electrons quantum drums. Interestingly however, for the analyzed two and three electrons cases, there exists an interaction strength (which can be tuned by changing the size of the shapes), for which the ground states energies of Bilby and Hawk coincide, but not the excited states as well. Wigner localization is studied and shown to occur at about the same size for both Bilby and Hawk shapes. Next, an exercise is proposed to use the two-electrons charge density of the Bilby and Hawk ground states in the phase extraction scheme as proposed by Moon et al. (2008). Results show that out-of-phase regions appear if the linear size of the shapes exceeds the Bohr radius as occupation of higher Slater determinants becomes significant

  5. Hearing shapes of few electrons quantum drums: A configuration–interaction study

    Energy Technology Data Exchange (ETDEWEB)

    Ţolea, F.; Ţolea, M., E-mail: tzolea@infim.ro

    2015-02-01

    The – highly remarkable – existence of non-congruent yet vibrationally isospectral shapes has been first proved theoretically and then also tested experimentally – by using electromagnetic waves in cavities, vibrating smectic films or electrons in nanostructures. In this context, we address the question whether isospectrality holds if two or more electrons interact electrostatically, using the accurate configuration–interaction method, in a discrete representation of the Bilby and Hawk shapes. Isospectral pairs offer an unique possibility to test how identical sets of single-particle energies may combine differently in the few-electrons eigenmodes, due to different wave functions spatial distributions. Our results point towards the break down of isospectrality in the presence of interactions. Thus one should be able to ”hear” the shapes of few electrons quantum drums. Interestingly however, for the analyzed two and three electrons cases, there exists an interaction strength (which can be tuned by changing the size of the shapes), for which the ground states energies of Bilby and Hawk coincide, but not the excited states as well. Wigner localization is studied and shown to occur at about the same size for both Bilby and Hawk shapes. Next, an exercise is proposed to use the two-electrons charge density of the Bilby and Hawk ground states in the phase extraction scheme as proposed by Moon et al. (2008). Results show that out-of-phase regions appear if the linear size of the shapes exceeds the Bohr radius as occupation of higher Slater determinants becomes significant.

  6. Direct Observation of Cr3+ 3d States in Ruby: Toward Experimental Mechanistic Evidence of Metal Chemistry.

    Science.gov (United States)

    Hunault, Myrtille O J Y; Harada, Yoshihisa; Miyawaki, Jun; Wang, Jian; Meijerink, Andries; de Groot, Frank M F; van Schooneveld, Matti M

    2018-04-26

    The role of transition metals in chemical reactions is often derived from probing the metal 3d states. However, the relation between metal site geometry and 3d electronic states, arising from multielectronic effects, makes the spectral data interpretation and modeling of these optical excited states a challenge. Here we show, using the well-known case of red ruby, that unique insights into the density of transition metal 3d excited states can be gained with 2p3d resonant inelastic X-ray scattering (RIXS). We compare the experimental determination of the 3d excited states of Cr 3+ impurities in Al 2 O 3 with 190 meV resolution 2p3d RIXS to optical absorption spectroscopy and to simulations. Using the crystal field multiplet theory, we calculate jointly for the first time the Cr 3+ multielectronic states, RIXS, and optical spectra based on a unique set of parameters. We demonstrate that (i) anisotropic 3d multielectronic interactions causes different scaling of Slater integrals, and (ii) a previously not observed doublet excited state exists around 3.35 eV. These results allow to discuss the influence of interferences in the RIXS intermediate state, of core-hole lifetime broadenings, and of selection rules on the RIXS intensities. Finally, our results demonstrate that using an intermediate excitation energy between L 3 and L 2 edges allows measurement of the density of 3d excited states as a fingerprint of the metal local structure. This opens up a new direction to pump-before-destroy investigations of transition metal complex structures and reaction mechanisms.

  7. Tucker Tensor analysis of Matern functions in spatial statistics

    KAUST Repository

    Litvinenko, Alexander

    2018-03-09

    In this work, we describe advanced numerical tools for working with multivariate functions and for the analysis of large data sets. These tools will drastically reduce the required computing time and the storage cost, and, therefore, will allow us to consider much larger data sets or finer meshes. Covariance matrices are crucial in spatio-temporal statistical tasks, but are often very expensive to compute and store, especially in 3D. Therefore, we approximate covariance functions by cheap surrogates in a low-rank tensor format. We apply the Tucker and canonical tensor decompositions to a family of Matern- and Slater-type functions with varying parameters and demonstrate numerically that their approximations exhibit exponentially fast convergence. We prove the exponential convergence of the Tucker and canonical approximations in tensor rank parameters. Several statistical operations are performed in this low-rank tensor format, including evaluating the conditional covariance matrix, spatially averaged estimation variance, computing a quadratic form, determinant, trace, loglikelihood, inverse, and Cholesky decomposition of a large covariance matrix. Low-rank tensor approximations reduce the computing and storage costs essentially. For example, the storage cost is reduced from an exponential O(n^d) to a linear scaling O(drn), where d is the spatial dimension, n is the number of mesh points in one direction, and r is the tensor rank. Prerequisites for applicability of the proposed techniques are the assumptions that the data, locations, and measurements lie on a tensor (axes-parallel) grid and that the covariance function depends on a distance, ||x-y||.

  8. Neutron activation determination of impurities in molybdenum

    International Nuclear Information System (INIS)

    Usmanova, M.M.; Mukhamedshina, N.M.; Obraztsova, T.V.; Saidakhmedov, K.Kh.

    1984-01-01

    Instrumental neutron-activation techniques of impurity element determination in molybdenum and MoO 3 (solid and powdered samples) have been developed. When determining impurities of Na, K, Mn, Cu, W, Re molybdenum has been irradiated by thermal neutrons in reactor for 20 min, the sample mass constituted 200-300 mg, sample cooling time after irradiation - 2.5-3.5 h. It is shown that in the process of Cr, Fe, Co, Zn determination the samples should be irradiated with thermal neutrons, and in the process of Sb, Ta and Ni determination - with resonance and fast neutrons. Simultaneous determination of the elements during irradiation with neutrons with reactor spectrum is possible. When determining P and S the samples are irradiated with thermal and epithermal neutrons and β-activity of samples and comparison samples are measured using β-spectrometer with anthracene crystal. The techniques developed permit to determine impurities in Mo with a relative standard deviation 0.07-0.15 and lower boundaries of contents determined - 10 -4 - 10 -7 %

  9. Methods of humidity determination Part II: Determination of material humidity

    OpenAIRE

    Rübner, Katrin; Balköse, Devrim; Robens, E.

    2008-01-01

    Part II covers the most common methods of measuring the humidity of solid material. State of water near solid surfaces, gravimetric measurement of material humidity, measurement of water sorption isotherms, chemical methods for determination of water content, measurement of material humidity via the gas phase, standardisation, cosmonautical observations are reviewed.

  10. Total Body Water Determination: Have We To Adapt Its Determination To The Patient Clinical Status?

    Directory of Open Access Journals (Sweden)

    Almudena Pérez Torres

    2012-06-01

    Conclusion: There is a good concordance between both methods in the determination of the TBW. The Watson formula overestimates the TBW in patients with high %FM and underestimates in those with high FFM. In the clinical practice, it is necessary to adapt the determination of TBW to the patient situation.

  11. Method of molybdenum kinetic determination

    International Nuclear Information System (INIS)

    Krejngol'd, S.U.; Dzotsenidze, N.E.; Ruseishviyai, T.G.; Nelen', I.M.

    1980-01-01

    The method molybdenum kinetic determination according to oxidation of pyrogallol with bromate in the medium of 0.05-0.15 M perchloric or sulphuric acids is presented. 1 mg of Ni, Co, Mn, Mg, Zn, Cr(3); 100 μg of Ca, Al, Cu, 10 μg of Cr(4), W; 10 μg of Fe in the presence of 22x10 - 4 M solution of EDTA, as well as 10 - 4 M solutions of chlorides and fluorides, 10 - 5 M solutions of bromides do not interfere with molybdenum determination using the given method. The method is rather simple, it takes 30 min to carry out the analysis. Determination limit of molybdenum constitutes 0.01 μg/ml

  12. Calculation methods for determining dose equivalent

    International Nuclear Information System (INIS)

    Endres, G.W.R.; Tanner, J.E.; Scherpelz, R.I.; Hadlock, D.E.

    1987-11-01

    A series of calculations of neutron fluence as a function of energy in an anthropomorphic phantom was performed to develop a system for determining effective dose equivalent for external radiation sources. Critical organ dose equivalents are calculated and effective dose equivalents are determined using ICRP-26 [1] methods. Quality factors based on both present definitions and ICRP-40 definitions are used in the analysis. The results of these calculations are presented and discussed. The effective dose equivalent determined using ICRP-26 methods is significantly smaller than the dose equivalent determined by traditional methods. No existing personnel dosimeter or health physics instrument can determine effective dose equivalent. At the present time, the conversion of dosimeter response to dose equivalent is based on calculations for maximal or ''cap'' values using homogeneous spherical or cylindrical phantoms. The evaluated dose equivalent is, therefore, a poor approximation of the effective dose equivalent as defined by ICRP Publication 26. 3 refs., 2 figs., 1 tab

  13. Gravimetric gas determinations for volume calibration

    International Nuclear Information System (INIS)

    Gibbs, P.W.

    1991-01-01

    Gravimetric measurements of gases is one of the methods available for calibrating gas volumes. By inputting a known quantity of gas and measuring the resulting pressure and temperature, the system volume can be calculated using gas law principles. Historically, this method has been less accurate due to the difficulty in the mass determination. This difficulty comes from several sources. Two examples are the large tare weight of the gas container relative to the weight of gas and the external volume of the gas container relative to the standards. The application of a gravimetric gas determination to tank volume calibrations at the savannah River Site is discussed. Mass determinations on a 25,00 gram gas container were such that a 1500 gram quantity of gas was routinely determined to within ±0.2 gram at the 99% confidence level. In this paper the weighting design and the methods used to address the difficulties of the mass determination are detailed

  14. Determination Of Ph Including Hemoglobin Correction

    Science.gov (United States)

    Maynard, John D.; Hendee, Shonn P.; Rohrscheib, Mark R.; Nunez, David; Alam, M. Kathleen; Franke, James E.; Kemeny, Gabor J.

    2005-09-13

    Methods and apparatuses of determining the pH of a sample. A method can comprise determining an infrared spectrum of the sample, and determining the hemoglobin concentration of the sample. The hemoglobin concentration and the infrared spectrum can then be used to determine the pH of the sample. In some embodiments, the hemoglobin concentration can be used to select an model relating infrared spectra to pH that is applicable at the determined hemoglobin concentration. In other embodiments, a model relating hemoglobin concentration and infrared spectra to pH can be used. An apparatus according to the present invention can comprise an illumination system, adapted to supply radiation to a sample; a collection system, adapted to collect radiation expressed from the sample responsive to the incident radiation; and an analysis system, adapted to relate information about the incident radiation, the expressed radiation, and the hemoglobin concentration of the sample to pH.

  15. Determination of Formula for Vickers Hardness Measurements Uncertainty

    International Nuclear Information System (INIS)

    Purba, Asli

    2007-01-01

    The purpose of formula determination is to obtain the formula of Vickers hardness measurements uncertainty. The approach to determine the formula: influenced parameters identification, creating a cause and effect diagram, determination of sensitivity, determination of standard uncertainty and determination of formula for Vickers hardness measurements uncertainty. The results is a formula for determination of Vickers hardness measurements uncertainty. (author)

  16. Determination of radium in water

    International Nuclear Information System (INIS)

    Hohorst, F.A.; Huntley, M.W.; Hartenstein, S.D.

    1995-10-01

    These detailed work instructions (DWIs) are tailored for the analysis of radium-226 and radium-228 in drinking water supplies from ground water and surface water sources and composites derived from them. The instructions have been adapted from several sources, including a draft EPA method. One objective was to minimize the generation of mixed wastes. Quantitative determinations of actinium-228 are made at 911 keV. The minimum detection level (MDL) for the gamma spectrometric measurements at this energy vary with matrix, volume, geometry, detector, background, and counting statistics. The range of MDL's for current detectors is 0.07 to 0.5 Bq/sample. Quantitative determinations of radium-226 are made by counting the high energy alpha particles which radium-226 progeny emit using liquid scintillation counting (LSC). The minimum detectable activity (MDA) is 3.8 E-3 Bq/sample. The maximum concentration which may be counted on available instruments without dilution is about 2 E + 5 Bq/sample. Typically, this determination of radium in a 2 L sample has a yield of 80%. If radium-228 is determined using a 16 h count after 50 h grow-in, the typical MDL is 1 E-9 to 8 E-9 μCi/mL (1 to 8 pCi/L). If radium-226 is determined using a 2.5 h count after 150 h grow-in, the typical MDA is about 1 E-10 μCi/mL (0. 1 pCi/L)

  17. Determination of radium in water

    Energy Technology Data Exchange (ETDEWEB)

    Hohorst, F.A.; Huntley, M.W.; Hartenstein, S.D.

    1995-10-01

    These detailed work instructions (DWIs) are tailored for the analysis of radium-226 and radium-228 in drinking water supplies from ground water and surface water sources and composites derived from them. The instructions have been adapted from several sources, including a draft EPA method. One objective was to minimize the generation of mixed wastes. Quantitative determinations of actinium-228 are made at 911 keV. The minimum detection level (MDL) for the gamma spectrometric measurements at this energy vary with matrix, volume, geometry, detector, background, and counting statistics. The range of MDL`s for current detectors is 0.07 to 0.5 Bq/sample. Quantitative determinations of radium-226 are made by counting the high energy alpha particles which radium-226 progeny emit using liquid scintillation counting (LSC). The minimum detectable activity (MDA) is 3.8 E-3 Bq/sample. The maximum concentration which may be counted on available instruments without dilution is about 2 E + 5 Bq/sample. Typically, this determination of radium in a 2 L sample has a yield of 80%. If radium-228 is determined using a 16 h count after 50 h grow-in, the typical MDL is 1 E-9 to 8 E-9 {mu}Ci/mL (1 to 8 pCi/L). If radium-226 is determined using a 2.5 h count after 150 h grow-in, the typical MDA is about 1 E-10 {mu}Ci/mL (0. 1 pCi/L).

  18. Polarographic determination of selenium in indium

    International Nuclear Information System (INIS)

    Kaplan, B.Ya.; Mikheeva, V.A.; Priz, N.B.

    1978-01-01

    The procedure of determining nx10 -6 % Se in indium after concentrating in an elemental form on arsenic and sulphur has been developed. The selenium content is determined by inversion a.c. polarography on a sulphuric-acid background in the presence of Cu(2), potassium bichromate, and sodium pyrophosphate. 5.7x10 -6 % Se in metal indium has been determined by this procedure, the mean standard deviation being Sr=0.26

  19. Liquidity Determinants of Moroccan Banking Industry

    OpenAIRE

    FERROUHI, El Mehdi; LEHADIRI, Abderrassoul

    2013-01-01

    This paper analyzes the behavior of Moroccan bank’s liquidity during the period 2001 – 2012. The research aims to identify the determinants of Moroccan bank’s liquidity. We first evaluate Moroccan banks’ liquidity positions through different liquidity ratios to determine the effects of financial crisis on bank’s liquidity. We then highlight the effect of banks’ size on banks’ liquidity. Finally, we identify determinants of Moroccan bank’s liquidity using panel data regression. ...

  20. Fluorimetric determination of uranium in water

    International Nuclear Information System (INIS)

    Acosta L, E.

    1992-02-01

    The fluorimetric method for the determination of microquantities of uranium in water is described. This method covers the determination of uranium in water in the interval from 0.2 to 50 ppm on 50 ml. of radioactive base sample. These limits can be variable if the volume of the aliquot one of the base sample is changed, as well as the volume of the used aliquot one for to the final determination of uranium. (Author)

  1. Determining distances using asteroseismic methods

    DEFF Research Database (Denmark)

    Aguirre, Victor Silva; Casagrande, L.; Basu, Sarbina

    2013-01-01

    Asteroseismology has been extremely successful in determining the properties of stars in different evolutionary stages with a remarkable level of precision. However, to fully exploit its potential, robust methods for estimating stellar parameters are required and independent verification of the r......Asteroseismology has been extremely successful in determining the properties of stars in different evolutionary stages with a remarkable level of precision. However, to fully exploit its potential, robust methods for estimating stellar parameters are required and independent verification...... fluxes, and thus distances for field stars in a self-consistent manner. Applying our method to a sample of solar-like oscillators in the {\\it Kepler} field that have accurate {\\it Hipparcos} parallaxes, we find agreement in our distance determinations to better than 5%. Comparison with measurements...

  2. New determinants for gallstone disease?


    DEFF Research Database (Denmark)

    Shabanzadeh, Daniel Mønsted

    2018-01-01

    screened for gallstone disease with multiple ultrasound examinations, it was possible to both confirm previously identified determinants and to identify new determinants for gallstone disease. Temporal associations for incident gallstone disease and female sex, BMI, non-HDL cholesterol, and inverse...... is the self-reported exposures which may cause misclassification bias. If explored in future studies, assessment of lifestyle habits should include objective measures in order to contribute any further to existing evidence on determinants for gallstone disease.
Associations for biomarkers of insulin...... formation have a long history and the most established include bile cholesterol saturation, gallbladder motor function, and the enterohepatic circulation of secondary bile salts produced by fecal microbiota. A small number of determinants that are believed to affect these mechanisms have been identified...

  3. 24 CFR 581.4 - Suitability determination.

    Science.gov (United States)

    2010-04-01

    ... earlier than six months prior to the expected date when the property will become unutilized or... determination for a particular piece of property, and the reasons for that determination; and (2) The...

  4. Solution NMR structure determination of proteins revisited

    International Nuclear Information System (INIS)

    Billeter, Martin; Wagner, Gerhard; Wuethrich, Kurt

    2008-01-01

    This 'Perspective' bears on the present state of protein structure determination by NMR in solution. The focus is on a comparison of the infrastructure available for NMR structure determination when compared to protein crystal structure determination by X-ray diffraction. The main conclusion emerges that the unique potential of NMR to generate high resolution data also on dynamics, interactions and conformational equilibria has contributed to a lack of standard procedures for structure determination which would be readily amenable to improved efficiency by automation. To spark renewed discussion on the topic of NMR structure determination of proteins, procedural steps with high potential for improvement are identified

  5. Selenium determination by fluorimetric method

    International Nuclear Information System (INIS)

    Lavorenti, A.

    1981-01-01

    A fluorimetric method to determine selenium both in vegetable samples and blood serum is developed. The method consists of a radioisotope 75 Se initially in order to optimize the determination of analytical conditions. Three samples digestion processes and also some factors related to methodology is studied. The nitric-percloric digestion process for 40 samples and the analytical process is shown. (M.J.C.) [pt

  6. Plasma beta HCG determination

    International Nuclear Information System (INIS)

    Amaral, L.B.D.; Pinto, J.C.M.; Linhares, E.; Linhares, Estevao

    1981-01-01

    There are three important indications for the early diagnosis of pregnancy through the determination of the beta sub-unit of chorionic gonadotrophin using radioimmunoassay: 1) some patient's or doctor's anxiety to discover the problem; 2) when it will be necessary to employ diagnostic or treatment procedures susceptible to affect the ovum; and 3) in the differential diagnosis of amenorrhoea, uterine hemorrhage and abdominal tumors. Other user's are the diagnosis of missed absortion, and the diagnosis and follow-up of chrorioncarcinoma. The AA. studied 200 determinations of plasma beta-HCG, considering the main difficulties occuring in the clinical use of this relevant laboratory tool in actual Obstetrics. (author) [pt

  7. 40 CFR 94.218 - Deterioration factor determination.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Deterioration factor determination. 94... Deterioration factor determination. Manufacturers shall determine exhaust emission deterioration factors using good engineering judgement according to the provisions of this section. Every deterioration factor must...

  8. Protein determination in single corns

    International Nuclear Information System (INIS)

    Knorr, J.; Schiekel, M.; Franke, W.; Focke, F.

    1994-01-01

    Determination of protein content in food materials is usually done by analyzing the nitrogen amount by wet chemical Kjeldahl method. An improved accuracy accompanied by smaller analyzing intervals can be achieved using nondestructive neutron activation. Analyses have been performed using 14 MeV neutrons to determine the content of N and P in single wheat corns. Irradiation parameters have been optimized to prevent serious radiation damage in grains. About 200 single corns have been investigated with total net weights ranging from 30 to 70 mg. The tested arrangement allows determination of nitrogen amount in a single corn down to 0.3 mg with an accuracy of better than 4 %. Mean nitrogen concentrations in the range from 9 to 19% per corn have been detected. (author) 5 refs.; 6 figs

  9. Determining

    Directory of Open Access Journals (Sweden)

    Bahram Andarzian

    2015-06-01

    Full Text Available Wheat production in the south of Khuzestan, Iran is constrained by heat stress for late sowing dates. For optimization of yield, sowing at the appropriate time to fit the cultivar maturity length and growing season is critical. Crop models could be used to determine optimum sowing window for a locality. The objectives of this study were to evaluate the Cropping System Model (CSM-CERES-Wheat for its ability to simulate growth, development, grain yield of wheat in the tropical regions of Iran, and to study the impact of different sowing dates on wheat performance. The genetic coefficients of cultivar Chamran were calibrated for the CSM-CERES-Wheat model and crop model performance was evaluated with experimental data. Wheat cultivar Chamran was sown on different dates, ranging from 5 November to 9 January during 5 years of field experiments that were conducted in the Khuzestan province, Iran, under full and deficit irrigation conditions. The model was run for 8 sowing dates starting on 25 October and repeated every 10 days until 5 January using long-term historical weather data from the Ahvaz, Behbehan, Dezful and Izeh locations. The seasonal analysis program of DSSAT was used to determine the optimum sowing window for different locations as well. Evaluation with the experimental data showed that performance of the model was reasonable as indicated by fairly accurate simulation of crop phenology, biomass accumulation and grain yield against measured data. The normalized RMSE were 3%, 2%, 11.8%, and 3.4% for anthesis date, maturity date, grain yield and biomass, respectively. Optimum sowing window was different among locations. It was opened and closed on 5 November and 5 December for Ahvaz; 5 November and 15 December for Behbehan and Dezful;and 1 November and 15 December for Izeh, respectively. CERES-Wheat model could be used as a tool to evaluate the effect of sowing date on wheat performance in Khuzestan conditions. Further model evaluations

  10. Zirconium determination in refractories (gravimetric method)

    International Nuclear Information System (INIS)

    Capiotto, N.; Narahashi, Y.; Perish, C.G.; Souza, J.R.

    1991-01-01

    The zirconium determination in refractories is described, consisting in two separation methods for eliminating the interferences. The formatted product is calcined at 1100 0 C and determined gravimetrically as Zr P z 07. (author)

  11. 36 CFR 242.15 - Rural determination process.

    Science.gov (United States)

    2010-07-01

    ... SUBSISTENCE MANAGEMENT REGULATIONS FOR PUBLIC LANDS IN ALASKA Program Structure § 242.15 Rural determination...) Development and diversity of the economy; (iii) Community infrastructure; (iv) Transportation; and (v... years shall be required before the non-rural determination becomes effective. (c) Current determinations...

  12. Determination of the scattering amplitude

    International Nuclear Information System (INIS)

    Gangal, A.D.; Kupsch, J.

    1984-01-01

    The problem to determine the elastic scattering amplitude from the differential cross-section by the unitarity equation is reexamined. We prove that the solution is unique and can be determined by a convergent iteration if the parameter lambda=sin μ of Newton and Martin is bounded by lambda 2 approx.=0.86. The method is based on a fixed point theorem for holomorphic mappings in a complex Banach space. (orig.)

  13. The determinants of the antibiotic resistance process.

    Science.gov (United States)

    Franco, Beatriz Espinosa; Altagracia Martínez, Marina; Sánchez Rodríguez, Martha A; Wertheimer, Albert I

    2009-01-01

    The use of antibiotic drugs triggers a complex interaction involving many biological, sociological, and psychological determinants. Resistance to antibiotics is a serious worldwide problem which is increasing and has implications for morbidity, mortality, and health care both in hospitals and in the community. To analyze current research on the determinants of antibiotic resistance and comprehensively review the main factors in the process of resistance in order to aid our understanding and assessment of this problem. We conducted a MedLine search using the key words "determinants", "antibiotic", and "antibiotic resistance" to identify publications between 1995 and 2007 on the determinants of antibiotic resistance. Publications that did not address the determinants of antibiotic resistance were excluded. The process and determinants of antibiotic resistance are described, beginning with the development of antibiotics, resistance and the mechanisms of resistance, sociocultural determinants of resistance, the consequences of antibiotic resistance, and alternative measures proposed to combat antibiotic resistance. Analysis of the published literature identified the main determinants of antibiotic resistance as irrational use of antibiotics in humans and animal species, insufficient patient education when antibiotics are prescribed, lack of guidelines for treatment and control of infections, lack of scientific information for physicians on the rational use of antibiotics, and lack of official government policy on the rational use of antibiotics in public and private hospitals.

  14. Perceived Teaching Behaviors and Self-Determined Motivation in Physical Education: A Test of Self-Determination Theory

    Science.gov (United States)

    Koka, Andre; Hagger, Martin S.

    2010-01-01

    In the present study, we tested the effects of specific dimensions of perceived teaching behaviors on students' self-determined motivation in physical education. In accordance with the tenets of self-determination theory (Deci & Ryan, 1985, 2000), we expected the psychological needs for competence, autonomy, and relatedness would mediate these…

  15. Fermion determinants in lattice QCD

    International Nuclear Information System (INIS)

    Johnson, Christopher Andrew

    2001-01-01

    The main topic of this thesis concerns efficient algorithms for the calculation of determinants of the kind of matrix typically encountered in lattice QCD. In particular an efficient method for calculating the fermion determinant is described. Such a calculation is useful to illustrate the effects of light dynamical (virtual) quarks. The methods employed in this thesis are stochastic methods, based on the Lanczos algorithm, which is used for the solution of large, sparse matrix problems via a partial tridiagonalisation of the matrix. Here an implementation is explored which requires less exhaustive treatment of the matrix than previous Lanczos methods. This technique exploits the analogy between the Lanczos tridiagonalisation algorithm and Gaussian quadrature in order to calculate the fermion determinant. A technique for determining a number of the eigenvalues of the matrix is also presented. A demonstration is then given of how one can improve upon this estimate considerably using variance reduction techniques, reducing the variance by a factor of order 100 with a further, equal amount of work. The variance reduction method is a two-stage process, involving a Chebyshev approximation to the quantity in question and then the subtraction of traceless operators. The method is applied to the fermion determinant for non-perturbatively improved Wilson fermions on a 16 3 x 32 lattice. It is also applicable to a wider class of matrix operators. Finally we discuss how dynamical quark effects may be simulated in a Monte Carlo process with an effective partitioning of low and high eigenmodes. This may be done via selective updating of a trial configuration which highlights the physically relevant effects of light quark modes. (author)

  16. Structural determination of organic compounds

    International Nuclear Information System (INIS)

    Kintzinger, J.P.

    1991-01-01

    This paper reports that the current methods available in high-field NMR spectroscopy are such that the tridimensional structure determination of any rigid molecule containing only carbon and hydrogen atoms may be achieved. The connectivities between carbon-carbon, carbon-hydrogen, and hydrogen-hydrogen atoms are determined by multipulse and two-dimensional (2D) experiments. These connectivity patterns or maps allow a step-by-step reconstruction of the molecular structures. From the carbon-carbon connectivity map, the carbon framework of the molecule is obtained, whereas the carbon-hydrogen pattern allows determination of the positions of the hydrogen atoms on their corresponding carbon atoms. High-field spectrometers are then necessary to remove fortuitous degeneracy and to reduce the proton spectra to a nearly first-order one, allowing an easy measurement of the chemical shifts and the coupling constants

  17. Determining Polarities Of Distant Lightning Strokes

    Science.gov (United States)

    Blakeslee, Richard J.; Brook, Marx

    1990-01-01

    Method for determining polarities of lightning strokes more than 400 km away. Two features of signal from each stroke correlated. New method based on fact each stroke observed thus far for which polarity determined unambiguously, initial polarity of tail same as polarity of initial deflection before initial-deflection signal altered by propagation effects. Receiving station equipped with electric-field-change antenna coupled to charge amplifier having time constant of order of 1 to 10 seconds. Output of amplifier fed to signal-processing circuitry, which determines initial polarity of tail.

  18. 42 CFR 435.531 - Determinations of blindness.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Determinations of blindness. 435.531 Section 435... ISLANDS, AND AMERICAN SAMOA Categorical Requirements for Eligibility Blindness § 435.531 Determinations of blindness. (a) Except as specified in paragraph (b) of this section, in determining blindness— (1) A...

  19. 42 CFR 456.609 - Determinations by team.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Determinations by team. 456.609 Section 456.609 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Facilities and Institutions for Mental Diseases § 456.609 Determinations by team. The team must determine in...

  20. Determining Optimal Decision Version

    Directory of Open Access Journals (Sweden)

    Olga Ioana Amariei

    2014-06-01

    Full Text Available In this paper we start from the calculation of the product cost, applying the method of calculating the cost of hour- machine (THM, on each of the three cutting machines, namely: the cutting machine with plasma, the combined cutting machine (plasma and water jet and the cutting machine with a water jet. Following the calculation of cost and taking into account the precision of manufacturing of each machine, as well as the quality of the processed surface, the optimal decisional version needs to be determined regarding the product manufacturing. To determine the optimal decisional version, we resort firstly to calculating the optimal version on each criterion, and then overall using multiattribute decision methods.