WorldWideScience

Sample records for skin keratinocytes modulate

  1. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    2010-08-01

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  3. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  4. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  5. Modulation of keratinocyte expression of antioxidants by 4-hydroxynonenal, a lipid peroxidation end product

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Ruijin [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Heck, Diane E. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Mishin, Vladimir; Black, Adrienne T. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Shakarjian, Michael P. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Kong, Ah-Ng Tony; Laskin, Debra L. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Laskin, Jeffrey D., E-mail: jlaskin@eohsi.rutgers.edu [Environmental and Occupational Medicine, Rutgers University-Robert Wood Johnson Medical School, Piscataway, NJ (United States)

    2014-03-01

    4-Hydroxynonenal (4-HNE) is a lipid peroxidation end product generated in response to oxidative stress in the skin. Keratinocytes contain an array of antioxidant enzymes which protect against oxidative stress. In these studies, we characterized 4-HNE-induced changes in antioxidant expression in mouse keratinocytes. Treatment of primary mouse keratinocytes and PAM 212 keratinocytes with 4-HNE increased mRNA expression for heme oxygenase-1 (HO-1), catalase, NADPH:quinone oxidoreductase (NQO1) and glutathione S-transferase (GST) A1-2, GSTA3 and GSTA4. In both cell types, HO-1 was the most sensitive, increasing 86–98 fold within 6 h. Further characterization of the effects of 4-HNE on HO-1 demonstrated concentration- and time-dependent increases in mRNA and protein expression which were maximum after 6 h with 30 μM. 4-HNE stimulated keratinocyte Erk1/2, JNK and p38 MAP kinases, as well as PI3 kinase. Inhibition of these enzymes suppressed 4-HNE-induced HO-1 mRNA and protein expression. 4-HNE also activated Nrf2 by inducing its translocation to the nucleus. 4-HNE was markedly less effective in inducing HO-1 mRNA and protein in keratinocytes from Nrf2 −/− mice, when compared to wild type mice, indicating that Nrf2 also regulates 4-HNE-induced signaling. Western blot analysis of caveolar membrane fractions isolated by sucrose density centrifugation demonstrated that 4-HNE-induced HO-1 is localized in keratinocyte caveolae. Treatment of the cells with methyl-β-cyclodextrin, which disrupts caveolar structure, suppressed 4-HNE-induced HO-1. These findings indicate that 4-HNE modulates expression of antioxidant enzymes in keratinocytes, and that this can occur by different mechanisms. Changes in expression of keratinocyte antioxidants may be important in protecting the skin from oxidative stress. - Highlights: • Lipid peroxidation generates 4-hydroxynonenal, a reactive aldehyde. • 4-HNE induces antioxidant proteins in mouse keratinocytes. • Induction of

  6. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M

    2017-08-22

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema.

  7. Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

    Science.gov (United States)

    Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

    2012-04-01

    For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

  8. Cdc42 expression in keratinocytes is required for the maintenance of the basement membrane in skin

    DEFF Research Database (Denmark)

    Wu, Xunwei; Quondamatteo, Fabio; Brakebusch, Cord

    2006-01-01

    , structure and number of hemidesomosomes were not significantly changed in the Cdc42 mutant skin compared with the control mice and no blister formation was observed in mutant skin. These data indicate that Cdc42 in keratinocytes is important for maintenance of the basement membrane of skin....... process, which requires directed secretion, deposition and organization of basement membrane components at the basal side of epithelial cells. In the current study, we analyzed the maintenance of skin basement membrane in mice with a keratinocyte-restricted deletion of the Cdc42 gene. In the absence...

  9. Interleukin-1α Induction in Human Keratinocytes (HaCaT: An In Vitro Model for Chemoprevention in Skin

    Directory of Open Access Journals (Sweden)

    T. Magcwebeba

    2012-01-01

    Full Text Available Long-term exposure to UV irradiation and toxic chemicals is associated with chronic inflammation that contributes to skin cancer development with interleukin-1 alpha (IL-1α, constitutively produced by keratinocytes, playing a pivotal role in skin inflammation. The aim of this study was to investigate the modulation of IL-1α production in the HaCaT keratinocyte cell line. Phorbol 12-myristate 13-acetate failed to induce IL-1α in HaCaT cells, and this might be associated with the specific deficiency known to affect downstream signalling of the MEK/ERK pathway in these cells. The calcium ionophore, ionomycin, slightly enhanced the production of intracellular (icIL-1α, but this resulted in a necrotic release at higher concentrations. UV-B exposure significantly increased the production of icIL-1α in a dose-dependent manner with a maximal induction exhibited at 24 h with minimal necrotic and apoptotic effects. Validation of the HaCaT cell model indicated that the nonsteroidal anti-inflammatory drug (NSAID, ibuprofen, and the glucocorticoid, dexamethasone, inhibited icIL-1α production, and this was associated with a slight inhibition of cell viability. The UV-B-induced keratinocyte cell model provides an in vitro system that could, apart from phorbol ester-like compounds, be utilised as a screening assay in identifying skin irritants and/or therapeutic topical agents via the modulation of IL-1α production.

  10. Aldefluor protocol to sort keratinocytes stem cells from skin

    OpenAIRE

    Noronha, Samuel Marcos Ribeiro; Gragnani, Alfredo; Pereira, Thiago Antônio Calado; Correa, Silvana Aparecida Alves; Bonucci, Jessica; Ferreira, Lydia Masako

    2017-01-01

    Abstract Purpose: To investigate the use Aldefluor® and N, N - Dimethylaminobenzaldehyde (DEAB) to design a protocol to sort keratinocyte stem cells from cultured keratinocytes from burned patients. Methods: Activated Aldefluor® aliquots were prepared and maintained at temperature between 2 to 8°C, or stored at -20°C. Next, the cells were collected following the standard protocol of sample preparation. Results: Best results were obtained with Aldefluor® 1.5µl and DEAB 15 µl for 1 x 106 c...

  11. Allogeneic cultured keratinocytes vs. cadaveric skin to cover wide-mesh autogenous split-thickness skin grafts.

    Science.gov (United States)

    Monstrey, S; Beele, H; Kettler, M; Van Landuyt, K; Blondeel, P; Matton, G; Naeyaert, J M

    1999-09-01

    Improved shock therapy has extended the limits of survival in patients with massive burns, and nowadays skin coverage has become the major problem in burn management. The use of mesh skin grafts is still the simplest technique to expand the amount of available donor skin. However, very wide-mesh skin grafts take a very long time to heal, often resulting in unaesthetic scar formation. On the other hand, allogeneic cultured keratinocytes have been reported as a natural source of growth factors and thus could be useful to improve wound healing of these wide-mesh grafts. A clinical study was performed to compare the use of cryopreserved allogeneic cultured keratinocytes vs. the traditional cadaveric skin as a double layer over widely expanded autogenous skin grafts. This procedure was performed in 18 pairs of full-thickness burn wounds (with similar depth and location) in 11 severely burned patients. Early clinical evaluation was made at 2, 3, and 4 to 5 weeks. Parameters such as epithelialization, granulation tissue formation, infection, and scar formation were evaluated. Biopsies were taken to compare the histological characteristics of the epidermis, the epidermal-dermal junction, and the dermis. Late evaluations were performed at 6 and 12 months regarding color, softness, thickness, and subjective feeling of the scar tissue. Aside from a faster (p keratinocyte group at 2 weeks, there were no statistically different results in any of the early evaluated parameters, neither clinically nor histologically. At long-term follow-up, clinical results and scar characteristics were not significantly different in the two compared groups. It is concluded from the results of this study that, during the early phase, epithelialization was faster with allogeneic cultured keratinocytes compared with cadaveric skin. However, taking into account the substantial difference in costs, the described use of cryopreserved allogeneic cultured keratinocytes as a double layer on meshed

  12. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  13. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  14. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Science.gov (United States)

    Noguchi, Fumihito; Nakajima, Takeshi; Inui, Shigeki; Reddy, Janardan K; Itami, Satoshi

    2014-01-01

    MED1 (Mediator complex subunit 1) is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/-)) that develop epidermal hyperplasia. Herein, to investigate the function(s) of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/-) and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/-) mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/-) mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/-) keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/-) keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/-) keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/-) keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/-) mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/-) mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/-) mice, indicating a decreased contribution of hair

  15. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Directory of Open Access Journals (Sweden)

    Fumihito Noguchi

    Full Text Available MED1 (Mediator complex subunit 1 is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/- that develop epidermal hyperplasia. Herein, to investigate the function(s of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/- and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/- mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/- mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/- keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/- keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/- keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/- keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/- mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/- mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/- mice, indicating a decreased contribution of hair

  16. The effect of keratinocytes on the biomechanical characteristics and pore microstructure of tissue engineered skin using deep dermal fibroblasts.

    Science.gov (United States)

    Varkey, Mathew; Ding, Jie; Tredget, Edward E

    2014-12-01

    Fibrosis affects most organs, it results in replacement of normal parenchymal tissue with collagen-rich extracellular matrix, which compromises tissue architecture and ultimately causes loss of function of the affected organ. Biochemical pathways that contribute to fibrosis have been extensively studied, but the role of biomechanical signaling in fibrosis is not clearly understood. In this study, we assessed the effect keratinocytes have on the biomechanical characteristics and pore microstructure of tissue engineered skin made with superficial or deep dermal fibroblasts in order to determine any biomaterial-mediated anti-fibrotic influences on tissue engineered skin. Tissue engineered skin with deep dermal fibroblasts and keratinocytes were found to be less stiff and contracted and had reduced number of myofibroblasts and lower expression of matrix crosslinking factors compared to matrices with deep fibroblasts alone. However, there were no such differences between tissue engineered skin with superficial fibroblasts and keratinocytes and matrices with superficial fibroblasts alone. Also, tissue engineered skin with deep fibroblasts and keratinocytes had smaller pores compared to those with superficial fibroblasts and keratinocytes; pore size of tissue engineered skin with deep fibroblasts and keratinocytes were not different from those matrices with deep fibroblasts alone. A better understanding of biomechanical characteristics and pore microstructure of tissue engineered skin may prove beneficial in promoting normal wound healing over pathologic healing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice

    2015-01-01

    . In comparison, blood -derived in vitro differentiated Th2 cells only induced a weak response in a few of the mice. Thus, we conclude that human AD skin-derived T cells can induce a reaction in mouse skin through induction of a proliferative response in the mouse keratinocytes. This article is protected......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  18. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    International Nuclear Information System (INIS)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao

    1996-01-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0 o C for 20 min and at 5 o C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0 o C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0 o C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author)

  19. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao [Hirosaki Univ., Aomori (Japan). School of Medicine

    1996-12-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0{sup o}C for 20 min and at 5{sup o}C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0{sup o}C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0{sup o}C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author).

  20. Significance of Ubiad1 for Epidermal Keratinocytes Involves More Than CoQ10 Synthesis: Implications for Skin Aging

    Directory of Open Access Journals (Sweden)

    Florian Labarrade

    2018-01-01

    Full Text Available The significance of Coenzyme Q10 (CoQ10 as an anti-oxidant barrier of the skin, as well as a key component in anti-aging strategies for skin care products, has been firmly established. Biosynthesis of CoQ10 in the mitochondria is well known, but there is only limited information on the non-mitochondrial synthesis of CoQ10 in the skin. Recent findings in zebrafish identified that a tumor suppressor, Ubiad1, is also a key enzyme in the non-mitochondrial synthesis of CoQ10. The purpose of this study was to investigate expression of Ubiad1 in human skin, and its implication in the skin’s cutaneous response to oxidative stress. We observed Ubiad1 localization in the epidermis, particularly a subcellular localization in the Golgi apparatus. Ubiad1 modulation by a pentapeptide was associated with an observed reduction in ROS/RNS stresses (−44%/−19% respectively, lipid peroxidation (−25% and preservation of membrane fluidity under stress conditions. Electron microscopy of keratinocytes revealed a significant degree of stimulation of the Golgi complex, as well as significantly improved mitochondrial morphology. Given the importance of CoQ10 in mitigating the visible signs of skin aging, our findings identify Ubiad1 as an essential component of the defensive barriers of the epidermis.

  1. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    International Nuclear Information System (INIS)

    Senthilkumar, P.K.; Robertson, L.W.; Ludewig, G.

    2012-01-01

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  2. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    International Nuclear Information System (INIS)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-01-01

    The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.

  3. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  4. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  5. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  6. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...... cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...

  7. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  8. Skin and hair follicle integrity is crucially dependent on beta 1 integrin expression on keratinocytes

    DEFF Research Database (Denmark)

    Brakebusch, C; Grose, R; Quondamatteo, F

    2000-01-01

    developed severe hair loss due to a reduced proliferation of hair matrix cells and severe hair follicle abnormalities. Eventually, the malformed hair follicles were removed by infiltrating macrophages. The epidermis of the back skin became hyperthickened, the basal keratinocytes showed reduced expression......, the integrity of the basement membrane surrounding the beta 1-deficient hair follicle was not affected. Finally, the dermis became fibrotic. These results demonstrate an important role of beta 1 integrins in hair follicle morphogenesis, in the processing of basement membrane components, in the maintenance...

  9. Enhancement of keratinocyte performance in the production of tissue-engineered skin using a low-calcium medium.

    Science.gov (United States)

    Hernon, Catherine A; Harrison, Caroline A; Thornton, Daniel J A; MacNeil, Sheila

    2007-01-01

    The success of laboratory-expanded autologous keratinocytes for the treatment of severe burn injuries is often compromised by their lack of dermal remnants and failure to establish a secure dermo-epidermal junction on the wound bed. We have developed a tissue-engineered skin substitute for in vivo use, based on a sterilized donor human dermis seeded with autologous keratinocytes and fibroblasts. However, culture rates are currently too slow for clinical use in acute burns. Our aim in this study was to increase the rate of production of tissue-engineered skin. Two approaches were explored: one using a commercial low-calcium media and the other supplementing well-established media for keratinocyte culture with the calcium-chelating agent ethylene glutamine tetra-acetic acid (EGTA). Using commercial low-calcium media for both the initial cell culture and subsequent culture of tissue-engineered skin did not produce tissue suitable for clinical use. However, it was possible to enhance the initial proliferation of keratinocytes and to increase their horizontal migration in tissue-engineered skin by supplementing established culture medium with 0.04 mM EGTA without sacrificing epidermal attachment and differentiation. Enhancement of keratinocyte migration with EGTA was also maximal in the absence of fibroblasts or basement membrane.

  10. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  11. Sacha Inchi Oil (Plukenetia volubilis L.), effect on adherence of Staphylococus aureus to human skin explant and keratinocytes in vitro.

    Science.gov (United States)

    Gonzalez-Aspajo, German; Belkhelfa, Haouaria; Haddioui-Hbabi, Laïla; Bourdy, Geneviève; Deharo, Eric

    2015-08-02

    Plukenetia volubilis L. (Euphorbiaceae) is a domesticated vine distributed from the high-altitude Andean rain forest to the lowlands of the Peruvian Amazon. Oil from the cold-pressed seeds, sold under the commercial name of Sacha Inchi Oil (SIO) is actually much in favour because it contains a high percentage of omega 3 and omega 6, and is hence used as a dietary supplement. SIO is also used traditionally for skin care, in order to maintain skin softness, and for the treatment of wounds, insect bites and skin infections, in a tropical context where the skin is frequently damaged. This study was designed in order to verify whether the traditional use of SIO for skin care would have any impact on Staphylococcus aureus growth and skin adherence, as S. aureus is involved in many skin pathologies (impetigo, folliculitis, furuncles and subcutaneous abscesses) being one if the main pathogens that can be found on the skin. Therefore, our objective was to assess SIO bactericidal activity and interference with adherence to human skin explants and the keratinocyte cell line. Cytotoxicity on that cells was also determined. The activity of SIO was compared to coconut oil (CocO), which is widely used for skin care but has different unsaturated fatty acids contents. Laboratory testing with certified oil, determined antibacterial activity against radio labelled S. aureus. Cytotoxic effects were measured with XTT on keratinocyte cells and with neutral red on human skin explants; phenol was used as cytotoxic control. Adherence assays were carried out by mixing H3-labelled S. aureus bacteria with keratinocyte cells and human skin explants, incubated with oils 2h before (to determine the inhibition of adherence, assimilated to a preventive effect) or 2h after the contact of the biological material with S. aureus (to assess the detachment of the bacteria, assimilated to a curative effect). Residual radioactivity measured after washings made it possible to determine the adherence

  12. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)

    2016-04-08

    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  13. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  14. Integrin-linked kinase and ELMO2 modulate recycling endosomes in keratinocytes.

    Science.gov (United States)

    Ho, Ernest; Ivanova, Iordanka A; Dagnino, Lina

    2016-12-01

    The formation of tight cell-cell junctions is essential in the epidermis for its barrier properties. In this tissue, keratinocytes follow a differentiation program tightly associated with their movement from the innermost basal to the outer suprabasal layers, and with changes in their cell-cell adhesion profile. Intercellular adhesion in keratinocytes is mediated through cell-cell contacts, including E-cadherin-based adherens junctions. Although the mechanisms that mediate E-cadherin delivery to the plasma membrane have been widely studied in simple epithelia, this process is less well understood in the stratified epidermis. In this study, we have investigated the role of Engulfment and Cell Motility 2 (ELMO2) and integrin-linked kinase (ILK) in the positioning of E-cadherin-containing recycling endosomes during establishment of cell-cell contacts in differentiating keratinocytes. We now show that induction of keratinocyte differentiation by Ca 2+ is accompanied by localization of ELMO2 and ILK to Rab4- and Rab11a-containing recycling endosomes. The positioning of long-loop Rab11a-positive endosomes at areas adjacent to cell-cell contacts is disrupted in ELMO2- or ILK-deficient keratinocytes, and is associated with impaired localization of E-cadherin to cell borders. Our studies show a previously unrecognized role for ELMO2 and ILK in modulation of endosomal positioning, which may play key roles in epidermal sheet maintenance and permeability barrier function. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Characterization of Fetal Keratinocytes, Showing Enhanced Stem Cell-Like Properties: A Potential Source of Cells for Skin Reconstruction

    Directory of Open Access Journals (Sweden)

    Kenneth K.B. Tan

    2014-08-01

    Full Text Available Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  16. Dysregulation of suppressor of cytokine signaling 3 in keratinocytes causes skin inflammation mediated by interleukin-20 receptor-related cytokines.

    Directory of Open Access Journals (Sweden)

    Ayako Uto-Konomi

    Full Text Available Homeostatic regulation of epidermal keratinocytes is controlled by the local cytokine milieu. However, a role for suppressor of cytokine signaling (SOCS, a negative feedback regulator of cytokine networks, in skin homeostasis remains unclear. Keratinocyte specific deletion of Socs3 (Socs3 cKO caused severe skin inflammation with hyper-production of IgE, epidermal hyperplasia, and S100A8/9 expression, although Socs1 deletion caused no inflammation. The inflamed skin showed constitutive STAT3 activation and up-regulation of IL-6 and IL-20 receptor (IL-20R related cytokines, IL-19, IL-20 and IL-24. Disease development was rescued by deletion of the Il6 gene, but not by the deletion of Il23, Il4r, or Rag1 genes. The expression of IL-6 in Socs3 cKO keratinocytes increased expression of IL-20R-related cytokines that further facilitated STAT3 hyperactivation, epidermal hyperplasia and neutrophilia. These results demonstrate that skin homeostasis is strictly regulated by the IL-6-STAT3-SOCS3 axis. Moreover, the SOCS3-mediated negative feedback loop in keratinocytes has a critical mechanistic role in the prevention of skin inflammation caused by hyperactivation of STAT3.

  17. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  18. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  19. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    Science.gov (United States)

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  20. Mesenchymal stem cell-conditioned medium accelerates skin wound healing: An in vitro study of fibroblast and keratinocyte scratch assays

    International Nuclear Information System (INIS)

    Walter, M.N.M.; Wright, K.T.; Fuller, H.R.; MacNeil, S.; Johnson, W.E.B.

    2010-01-01

    We have used in vitro scratch assays to examine the relative contribution of dermal fibroblasts and keratinocytes in the wound repair process and to test the influence of mesenchymal stem cell (MSC) secreted factors on both skin cell types. Scratch assays were established using single cell and co-cultures of L929 fibroblasts and HaCaT keratinocytes, with wound closure monitored via time-lapse microscopy. Both in serum supplemented and serum free conditions, wound closure was faster in L929 fibroblast than HaCaT keratinocyte scratch assays, and in co-culture the L929 fibroblasts lead the way in closing the scratches. MSC-CM generated under serum free conditions significantly enhanced the wound closure rate of both skin cell types separately and in co-culture, whereas conditioned medium from L929 or HaCaT cultures had no significant effect. This enhancement of wound closure in the presence of MSC-CM was due to accelerated cell migration rather than increased cell proliferation. A number of wound healing mediators were identified in MSC-CM, including TGF-β1, the chemokines IL-6, IL-8, MCP-1 and RANTES, and collagen type I, fibronectin, SPARC and IGFBP-7. This study suggests that the trophic activity of MSC may play a role in skin wound closure by affecting both dermal fibroblast and keratinocyte migration, along with a contribution to the formation of extracellular matrix.

  1. Performance of a novel keratinocyte-based reporter cell line to screen skin sensitizers in vitro

    International Nuclear Information System (INIS)

    Emter, Roger; Ellis, Graham; Natsch, Andreas

    2010-01-01

    In vitro tests are needed to replace animal tests to screen for the skin sensitization potential of chemicals. Skin sensitizers are electrophilic molecules and the Nrf2-electrophile-sensing pathway comprising the repressor protein Keap1, the transcription factor Nrf2 and the antioxidant response element (ARE) is emerging as a toxicity pathway induced by skin sensitizers. Previously, we screened a large set of chemicals in the reporter cell line AREc32, which contains an eight-fold repeat of the rat GSTA2 ARE-sequence upstream of a luciferase reporter gene in the human breast cancer cell line MCF7. This approach was now further developed to bring it closer to the conditions in the human skin and to propose a fully standardized assay. To this end, a luciferase reporter gene under control of a single copy of the ARE-element of the human AKR1C2 gene was stably inserted into HaCaT keratinocytes. A standard operating procedure was developed whereby chemicals are routinely tested at 12 concentrations in triplicate for significant induction of gene activity. We report results from this novel assay on (i) a list of reference chemicals published by ECVAM, (ii) the ICCVAM list of chemicals for validation of alternative endpoints in the LLNA and (iii) on a more general list of 67 chemicals derived from the ICCVAM database. For comparison, peptide reactivity data are presented for the same chemicals. The results indicate a good predictive value of this approach for hazard identification. Its technical simplicity, the high-throughput format and the good predictivity may make this assay a candidate for rapid validation to meet the tight deadline to replace animal tests for skin sensitization by 2013 set by the European authorities.

  2. The Benefit of Microskin in Combination With Autologous Keratinocyte Suspension to Treat Full Skin Loss In Vivo.

    Science.gov (United States)

    Yuru, Shang; Dawei, Li; Chuanan, Shen; Kai, Yin; Li, Ma; Longzhu, Li; Dongxu, Zhao; Wenfeng, Cheng

    Patients with extensive deep burns often lack enough autologous skin to cover the wounds. This study explores a new method using microskin in combination with autologous keratinocytes in the treatment of extensive deep burn. Wounds in the combination group were treated with automicroskin at an area expansion ratio of 20:1 (wound area to automicroskin area) and autologous keratinocyte suspension, which were compared with the following treatments: no autotransplant, only allografts (control group); autologous keratinocyte suspension only (keratinocyte only group); automicroskin at an area expansion ratio of 20:1 (20:1 group); and automicroskin at an area expansion ratio of 10:1 (10:1 group, positive control). The authors used epithelialization rate (epithelialized area on day 21 divided by original wound area), hematoxylin and eosin staining, laminin, and type IV collagen immunohistochemistry to assess wound healing. The epithelialization rate of combination group (74.2% ± 8.0%) was similar to that of 10: 1 group (84.3% ± 11.9%, P = .085) and significantly (P < .05) higher than that of 20:1 group (59.2% ± 10.8%), keratinocyte only group (53.8% ± 11.5%), and control group (22.7% ± 5.5%). The hematoxylin and eosin staining and immunohistochemistry showed the epithelialization in the combination group was better than that in the keratinocyte only group and control group. Microskin in combination with autologous keratinocyte suspension can promote the reepithelialization of full-thickness wounds and reduce the requirements for automircoskin, and it is a useful option in the treatment of extensive deep burns.

  3. SOCS3 inhibits the pathological effects of IL-22 in non-melanoma skin tumor-derived keratinocytes.

    Science.gov (United States)

    Madonna, Stefania; Scarponi, Claudia; Morelli, Martina; Sestito, Rosanna; Scognamiglio, Pasqualina Liana; Marasco, Daniela; Albanesi, Cristina

    2017-04-11

    Basal cell carcinomas (BCC) and squamous-cell carcinomas (SCC) are common malignancies in humans, caused by neoplastic transformation of keratinocytes of the basal or suprabasal layers of epidermis, respectively. Tumor-infiltrating lymphocytes (TILs) are frequently found in BCC and SCC, and functionally promote epithelial carcinogenesis. TILs secreting IL-22, in particular, participate to BCC and SCC growth by inducing keratinocyte proliferation and migration, as well as the expression of inflammatory, anti-apoptotic and pro-angiogenic genes.In this study, we identified SOCS3 as a valid candidate to be manipulated for suppressing tumorigenic functions in BCC and SCC. We found that SOCS3 and SOCS1 expression was reduced in vivo, in tumor lesions of BCC and SCC, as compared to other skin inflammatory conditions such as psoriasis, despite the high number of IL-22-secreting TILs. Moreover, IL-22 was not able to induce in vitro the transcriptional expression of SOCS3 in BCC-or SCC-derived keratinocytes, contrarily to healthy cells. Aimed at rescuing SOCS3 activity in these tumor contexts, a SOCS3-derived peptide, named KIR-ESS, was synthesized, and its ability in suppressing IL-22-induced responses was evaluated in healthy and transformed keratinocytes. We found that KIR-ESS peptide efficiently suppressed the IL-22 molecular signaling in keratinocytes, by acting on STAT3 and Erk1/2 cascade, as well as on the expression of STAT3-dependent downstream genes. Interestingly, after treatment with peptide, both healthy and transformed keratinocytes could no longer aberrantly proliferate and migrate in response to IL-22. Finally, treatment of athymic nude mice bearing SCC xenografts with KIR-ESS peptide concomitantly reduced tumor growth and activated STAT3 levels. As a whole, these data provides the rationale for the use in BCC and SCC skin tumors of SOCS3 mimetics, being able to inhibit the deleterious effects of IL-22 in these contexts.

  4. Full-thickness skin wound healing using autologous keratinocytes and dermal fibroblasts with fibrin: bilayered versus single-layered substitute.

    Science.gov (United States)

    Idrus, Ruszymah Bt Hj; Rameli, Mohd Adha bin P; Low, Kiat Cheong; Law, Jia Xian; Chua, Kien Hui; Latiff, Mazlyzam Bin Abdul; Saim, Aminuddin Bin

    2014-04-01

    Split-skin grafting (SSG) is the gold standard treatment for full-thickness skin defects. For certain patients, however, an extensive skin lesion resulted in inadequacies of the donor site. Tissue engineering offers an alternative approach by using a very small portion of an individual's skin to harvest cells for propagation and biomaterials to support the cells for implantation. The objective of this study was to determine the effectiveness of autologous bilayered tissue-engineered skin (BTES) and single-layer tissue-engineered skin composed of only keratinocytes (SLTES-K) or fibroblasts (SLTES-F) as alternatives for full-thickness wound healing in a sheep model. Full-thickness skin biopsies were harvested from adult sheep. Isolated fibroblasts were cultured using medium Ham's F12: Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum, whereas the keratinocytes were cultured using Define Keratinocytes Serum Free Medium. The BTES, SLTES-K, and SLTES-F were constructed using autologous fibrin as a biomaterial. Eight full-thickness wounds were created on the dorsum of the body of the sheep. On 4 wounds, polyvinyl chloride rings were used as chambers to prevent cell migration at the edge. The wounds were observed at days 7, 14, and 21. After 3 weeks of implantation, the sheep were euthanized and the skins were harvested. The excised tissues were fixed in formalin for histological examination via hematoxylin-eosin, Masson trichrome, and elastin van Gieson staining. The results showed that BTES, SLTES-K, and SLTES-F promote wound healing in nonchambered and chambered wounds, and BTES demonstrated the best healing potential. In conclusion, BTES proved to be an effective tissue-engineered construct that can promote the healing of full-thickness skin lesions. With the support of further clinical trials, this procedure could be an alternative to SSG for patients with partial- and full-thickness burns.

  5. Isolation, identification, and pathological effects of beach sand bacterial extract on human skin keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Fazli Subhan

    2018-01-01

    Full Text Available Background Beaches are recreational spots for people. However, beach sand contains harmful microbes that affect human health, and there are no established methods for either sampling and identifying beach-borne pathogens or managing the quality of beach sand. Method This study was conducted with the aim of improving human safety at beaches and augmenting the quality of the beach experience. Beach sand was used as a resource to isolate bacteria due to its distinctive features and the biodiversity of the beach sand biota. A selected bacterial isolate termed FSRS was identified as Pseudomonas stutzeri using 16S rRNA sequencing and phylogenetic analysis, and the sequence was deposited in the NCBI GenBank database under the accession number MF599548. The isolated P. stutzeri bacterium was cultured in Luria–Bertani growth medium, and a crude extract was prepared using ethyl acetate to examine the potential pathogenic effect of P. stutzeri on human skin. A human skin keratinocyte cell line (HaCaT was used to assess cell adhesion, cell viability, and cell proliferation using a morphological analysis and a WST-1 assay. Result The crude P. stutzeri extract inhibited cell adhesion and decreased cell viability in HaCaT cells. We concluded that the crude extract of P. stutzeri FSRS had a strong pathological effect on human skin cells. Discussion Beach visitors frequently get skin infections, but the exact cause of the infections is yet to be determined. The beach sand bacterium P. stutzeri may, therefore, be responsible for some of the dermatological problems experienced by people visiting the beach.

  6. CRISPR-assisted receptor deletion reveals distinct roles for ERBB2 and ERBB3 in skin keratinocytes.

    Science.gov (United States)

    Dahlhoff, Maik; Gaborit, Nadège; Bultmann, Sebastian; Leonhardt, Heinrich; Yarden, Yosef; Schneider, Marlon R

    2017-10-01

    While the epidermal growth factor receptor (EGFR) is an established regulator of skin development and homeostasis, the functions of the related tyrosine kinase receptors ERBB2 and ERBB3 in this tissue have only recently been examined. Previously reported, skin-specific deletion of each of these receptors in mice resulted in similar defects in keratinocyte proliferation and migration, resulting in impaired wound healing and tumorigenesis. Because both ERBB2 and ERBB3 are targets for treating an array of cancer types, it is important to examine the consequences of receptor inhibition in human keratinocytes. Here, we employed the CRISPR/Cas9 technology to generate HaCaT cells (an established human keratinocyte cell line) lacking ERBB2 or ERBB3. HaCaT clones lacking ERBB2 or ERBB3 showed comparable reductions in cell proliferation as assessed by BrdU staining. Apoptosis, in contrast, was reduced in ERBB3-deficient HaCaT cells only. Assessment of cell migration using a wound healing (scratch) assay showed that the closure of the wound gaps was completed by 48 h in mock and in ERBB3 knockout clones. In contrast, this process was considerably delayed in ERBB2 knockout clones, and a complete closure of the gap in the latter cells did not occur before 72 h. In conclusion, both ERBB2 and ERBB3 are essential for normal proliferation of skin keratinocytes, but in contrast to ERBB3, ERBB2 is essential for migration of human keratinocytes. These observations might bear significance to patient adverse effects of therapeutic agents targeting ERBB2 and ERBB3. © 2017 Federation of European Biochemical Societies.

  7. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration.

    Science.gov (United States)

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther

    2016-08-11

    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections.

  8. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  9. Sarcoptes scabiei mites modulate gene expression in human skin equivalents.

    Directory of Open Access Journals (Sweden)

    Marjorie S Morgan

    Full Text Available The ectoparasitic mite, Sarcoptes scabiei that burrows in the epidermis of mammalian skin has a long co-evolution with its hosts. Phenotypic studies show that the mites have the ability to modulate cytokine secretion and expression of cell adhesion molecules in cells of the skin and other cells of the innate and adaptive immune systems that may assist the mites to survive in the skin. The purpose of this study was to identify genes in keratinocytes and fibroblasts in human skin equivalents (HSEs that changed expression in response to the burrowing of live scabies mites. Overall, of the more than 25,800 genes measured, 189 genes were up-regulated >2-fold in response to scabies mite burrowing while 152 genes were down-regulated to the same degree. HSEs differentially expressed large numbers of genes that were related to host protective responses including those involved in immune response, defense response, cytokine activity, taxis, response to other organisms, and cell adhesion. Genes for the expression of interleukin-1α (IL-1α precursor, IL-1β, granulocyte/macrophage-colony stimulating factor (GM-CSF precursor, and G-CSF precursor were up-regulated 2.8- to 7.4-fold, paralleling cytokine secretion profiles. A large number of genes involved in epithelium development and keratinization were also differentially expressed in response to live scabies mites. Thus, these skin cells are directly responding as expected in an inflammatory response to products of the mites and the disruption of the skin's protective barrier caused by burrowing. This suggests that in vivo the interplay among these skin cells and other cell types, including Langerhans cells, dendritic cells, lymphocytes and endothelial cells, is responsible for depressing the host's protective response allowing these mites to survive in the skin.

  10. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  11. Ultraviolet-evoked prostaglandin biosynthesis in varying stages of keratinocyte differentiation in guinea pig skin

    Energy Technology Data Exchange (ETDEWEB)

    Karmali, R A; Safai, B

    1984-09-01

    Prostaglandin (PG) production by guinea pig epidermal cells was evaluated at various incubation intervals in normal and UV-exposed cultures. Prostaglandins have been implicated as mediators of the early phase of erythema in skin exposed to sunlight or UV-radiation. Using a density gradient centrifugation procedure, the epidermal cells were fractionated according to the various maturation stages of epidermal keratinocytes: high-density epidermal cells (HDEC) consisting of round, less mature cells; low-density epidermal cells (LDEC) consisting of polygonal keratinized cells; and intermediate-density epidermal cells (IDEC) consisting of both HDEC and LDEC. When cultures of 1 X 10(6) cells were incubated at 37 degrees C in 5% CO/sub 2/ the highest concentrations of five PG moieties measured were present in supernatants from the LDEC cultures as compared to those of IDEC or HDEC. Levels of PGF 2 alpha were much higher than the rest, which were found in the order PGF2 alpha greater than PGE2 greater than PGE1 greater than 6-keto-PGF1 alpha greater than thromboxane (TX)B2. UV-irradiation induced increases in all but TXA2 production. These results identify and quantitate five compounds produced as a result of exaggerated activity of the cyclooxygenase induced by UV-irradiation.

  12. Sarcoptes scabiei Mites Modulate Gene Expression in Human Skin Equivalents

    Science.gov (United States)

    Morgan, Marjorie S.; Arlian, Larry G.; Markey, Michael P.

    2013-01-01

    The ectoparasitic mite, Sarcoptes scabiei that burrows in the epidermis of mammalian skin has a long co-evolution with its hosts. Phenotypic studies show that the mites have the ability to modulate cytokine secretion and expression of cell adhesion molecules in cells of the skin and other cells of the innate and adaptive immune systems that may assist the mites to survive in the skin. The purpose of this study was to identify genes in keratinocytes and fibroblasts in human skin equivalents (HSEs) that changed expression in response to the burrowing of live scabies mites. Overall, of the more than 25,800 genes measured, 189 genes were up-regulated >2-fold in response to scabies mite burrowing while 152 genes were down-regulated to the same degree. HSEs differentially expressed large numbers of genes that were related to host protective responses including those involved in immune response, defense response, cytokine activity, taxis, response to other organisms, and cell adhesion. Genes for the expression of interleukin-1α (IL-1α) precursor, IL-1β, granulocyte/macrophage-colony stimulating factor (GM-CSF) precursor, and G-CSF precursor were up-regulated 2.8- to 7.4-fold, paralleling cytokine secretion profiles. A large number of genes involved in epithelium development and keratinization were also differentially expressed in response to live scabies mites. Thus, these skin cells are directly responding as expected in an inflammatory response to products of the mites and the disruption of the skin’s protective barrier caused by burrowing. This suggests that in vivo the interplay among these skin cells and other cell types, including Langerhans cells, dendritic cells, lymphocytes and endothelial cells, is responsible for depressing the host’s protective response allowing these mites to survive in the skin. PMID:23940705

  13. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

    Science.gov (United States)

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-09-19

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

  14. Comparative study of human-induced pluripotent stem cells derived from bone marrow cells, hair keratinocytes, and skin fibroblasts.

    Science.gov (United States)

    Streckfuss-Bömeke, Katrin; Wolf, Frieder; Azizian, Azadeh; Stauske, Michael; Tiburcy, Malte; Wagner, Stefan; Hübscher, Daniela; Dressel, Ralf; Chen, Simin; Jende, Jörg; Wulf, Gerald; Lorenz, Verena; Schön, Michael P; Maier, Lars S; Zimmermann, Wolfram H; Hasenfuss, Gerd; Guan, Kaomei

    2013-09-01

    Induced pluripotent stem cells (iPSCs) provide a unique opportunity for the generation of patient-specific cells for use in disease modelling, drug screening, and regenerative medicine. The aim of this study was to compare human-induced pluripotent stem cells (hiPSCs) derived from different somatic cell sources regarding their generation efficiency and cardiac differentiation potential, and functionalities of cardiomyocytes. We generated hiPSCs from hair keratinocytes, bone marrow mesenchymal stem cells (MSCs), and skin fibroblasts by using two different virus systems. We show that MSCs and fibroblasts are more easily reprogrammed than keratinocytes. This corresponds to higher methylation levels of minimal promoter regions of the OCT4 and NANOG genes in keratinocytes than in MSCs and fibroblasts. The success rate and reprogramming efficiency was significantly higher by using the STEMCCA system than the OSNL system. All analysed hiPSCs are pluripotent and show phenotypical characteristics similar to human embryonic stem cells. We studied the cardiac differentiation efficiency of generated hiPSC lines (n = 24) and found that MSC-derived hiPSCs exhibited a significantly higher efficiency to spontaneously differentiate into beating cardiomyocytes when compared with keratinocyte-, and fibroblast-derived hiPSCs. There was no significant difference in the functionalities of the cardiomyocytes derived from hiPSCs with different origins, showing the presence of pacemaker-, atrial-, ventricular- and Purkinje-like cardiomyocytes, and exhibiting rhythmic Ca2+ transients and Ca2+ sparks in hiPSC-derived cardiomyocytes. Furthermore, spontaneously and synchronously beating and force-developing engineered heart tissues were generated. Human-induced pluripotent stem cells can be reprogrammed from all three somatic cell types, but with different efficiency. All analysed iPSCs can differentiate into cardiomyocytes, and the functionalities of cardiomyocytes derived from different cell

  15. Low levels of glutathione are sufficient for survival of keratinocytes after UV irradiation and for healing of mouse skin wounds.

    Science.gov (United States)

    Telorack, Michèle; Abplanalp, Jeannette; Werner, Sabine

    2016-08-01

    Reduced levels of the cellular antioxidant glutathione are associated with premature skin aging, cancer and impaired wound healing, but the in vivo functions of glutathione in the skin remain largely unknown. Therefore, we analyzed mice lacking the modifier subunit of the glutamate cysteine ligase (Gclm), the enzyme that catalyzes the rate-limiting step of glutathione biosynthesis. Glutathione levels in the skin of these mice were reduced by 70 %. However, neither skin development and homeostasis, nor UVA- or UVB-induced apoptosis in the epidermis were affected. Histomorphometric analysis of excisional wounds did not reveal wound healing abnormalities in young Gclm-deficient mice, while the area of hyperproliferative epithelium as well as keratinocyte proliferation were affected in aged mice. These findings suggest that low levels of glutathione are sufficient for wound repair in young mice, but become rate-limiting upon aging.

  16. Suppression of skin inflammation in keratinocytes and acute/chronic disease models by caffeic acid phenethyl ester.

    Science.gov (United States)

    Lim, Kyung-Min; Bae, SeungJin; Koo, Jung Eun; Kim, Eun-Sun; Bae, Ok-Nam; Lee, Joo Young

    2015-04-01

    Skin inflammation plays a central role in the pathophysiology and symptoms of diverse chronic skin diseases including atopic dermatitis (AD). In this study, we examined if caffeic acid phenethyl ester (CAPE), a skin-permeable bioactive compound from propolis, was protective against skin inflammation using in vitro cell system and in vivo animal disease models. CAPE suppressed TNF-α-induced NF-κB activation and expression of inflammatory cytokines in human keratinocytes (HaCaT). The potency and efficacy of CAPE were superior to those of a non-phenethyl derivative, caffeic acid. Consistently, topical treatment of CAPE (0.5 %) attenuated 12-O-tetradecanoylphorbol-13-acetate(TPA)-induced skin inflammation on mouse ear as CAPE reduced ear swelling and histologic inflammation scores. CAPE suppressed increased expression of pro-inflammatory molecules such as TNF-α, cyclooxygenase-2 and inducible NO synthase in TPA-stimulated skin. TPA-induced phosphorylation of IκB and ERK was blocked by CAPE suggesting that protective effects of CAPE on skin inflammation is attributed to inhibition of NF-κB activation. Most importantly, in an oxazolone-induced chronic dermatitis model, topical application of CAPE (0.5 and 1 %) was effective in alleviating AD-like symptoms such as increases of trans-epidermal water loss, skin thickening and serum IgE as well as histologic inflammation assessment. Collectively, our results propose CAPE as a promising candidate for a novel topical drug for skin inflammatory diseases.

  17. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  18. Fibre optic confocal imaging (FOCI) of keratinocytes, blood vessels and nerves in hairless mouse skin in vivo

    Science.gov (United States)

    BUSSAU, L. J.; VO, L. T.; DELANEY, P. M.; PAPWORTH, G. D.; BARKLA, D. H.; KING, R. G.

    1998-01-01

    Fibre optic confocal imaging (FOCI) enabled subsurface fluorescence microscopy of the skin of hairless mice in vivo. Application of acridine orange enabled imaging of the layers of the epidermis. The corneocytes of the stratum corneum, the keratinocytes in the basal layers and redundant hair follicles were visualised at depths greater than 100 μm. Cellular and nuclear membranes of keratinocytes of the skin were visualised by the use of acridine orange and DIOC5(3). Imaging of the skin after injection of FITC-dextran revealed an extensive network of blood vessels with a size range up to 20 μm. Blood cells could be seen moving through dermal vessels and the blood circulation through the dermal vascular bed was video-taped. The fluorescent dye 4-di-2-ASP showed the presence of nerves fibres around the hair follicles and subsurface blood vessels. Comparison was made between images obtained in vivo using FOCI and in vitro scanning electron microscopy and conventional histology. FOCI offers the potential to study dynamic events in vivo, such as blood flow, skin growth, nerve regeneration and many pathological processes, in ways which have not previously been possible. PMID:9643419

  19. How Does Chronic Cigarette Smoke Exposure Affect Human Skin? A Global Proteomics Study in Primary Human Keratinocytes.

    Science.gov (United States)

    Rajagopalan, Pavithra; Nanjappa, Vishalakshi; Raja, Remya; Jain, Ankit P; Mangalaparthi, Kiran K; Sathe, Gajanan J; Babu, Niraj; Patel, Krishna; Cavusoglu, Nükhet; Soeur, Jeremie; Pandey, Akhilesh; Roy, Nita; Breton, Lionel; Chatterjee, Aditi; Misra, Namita; Gowda, Harsha

    2016-11-01

    Cigarette smoking has been associated with multiple negative effects on human skin. Long-term physiological effects of cigarette smoke are through chronic and not acute exposure. Molecular alterations due to chronic exposure to cigarette smoke remain unclear. Primary human skin keratinocytes chronically exposed to cigarette smoke condensate (CSC) showed a decreased wound-healing capacity with an increased expression of NRF2 and MMP9. Using quantitative proteomics, we identified 4728 proteins, of which 105 proteins were overexpressed (≥2-fold) and 41 proteins were downregulated (≤2-fold) in primary skin keratinocytes chronically exposed to CSC. We observed an alteration in the expression of several proteins involved in maintenance of epithelial barrier integrity, including keratin 80 (5.3 fold, p value 2.5 × 10 -7 ), cystatin A (3.6-fold, p value 3.2 × 10 -3 ), and periplakin (2.4-fold, p value 1.2 × 10 -8 ). Increased expression of proteins associated with skin hydration, including caspase 14 (2.2-fold, p value 4.7 × 10 -2 ) and filaggrin (3.6-fold, p value 5.4 × 10 -7 ), was also observed. In addition, we report differential expression of several proteins, including adipogenesis regulatory factor (2.5-fold, p value 1.3 × 10 -3 ) and histone H1.0 (2.5-fold, p value 6.3 × 10 -3 ) that have not been reported earlier. Bioinformatics analyses demonstrated that proteins differentially expressed in response to CSC are largely related to oxidative stress, maintenance of skin integrity, and anti-inflammatory responses. Importantly, treatment with vitamin E, a widely used antioxidant, could partially rescue adverse effects of CSC exposure in primary skin keratinocytes. The utility of antioxidant-based new dermatological formulations in delaying or preventing skin aging and oxidative damages caused by chronic cigarette smoke exposure warrants further clinical investigations and multi-omics research.

  20. Should dermal scald burns in children be covered with autologous skin grafts or with allogeneic cultivated keratinocytes?--"The Viennese concept".

    Science.gov (United States)

    Rab, Matthias; Koller, Rupert; Ruzicka, Margot; Burda, Gudrun; Kamolz, Lars Peter; Bierochs, Bettina; Meissl, Guenther; Frey, Manfred

    2005-08-01

    The treatment of scald burns in children is still under discussion. The aim of the present study was to evaluate an optimised treatment regime for scald burns in children. Between 1997 and 2002, 124 children underwent surgical intervention due to burn injuries. Thirty-six out of these 124 children were enrolled into the evaluation of our recent treatment protocol. Twenty-two children with scald burns covering an average body surface area (TBSA) of 18.5% were treated by early excision and coverage with allogeneic keratinocytes in case of partial thickness lesions (keratinocyte group). Fourteen children with a TBSA of 17.2% were treated with autologous skin grafts alone (skin graft group). Both groups were comparable according to age, burn depth and affected TBSA. The complete clinical follow-up examination of at least 17 months was performed in 12 out of 22 children of the keratinocyte group and in 9 out of 14 patients of the comparative group. Visible scar formations were classified according to the Vancouver Scar Scale (VSS) in each patient. The use of allogeneic keratinocytes led to complete epithelialisation within 12 days in 20 of the 22 cases. No secondary skin grafting procedures had to be done. Skin take rate at the sixth postoperative day was 100% in the skin graft group. Blood transfusions were administered intraoperatively according to the clinical need of the patients by the responsible anaesthesiologist. The mean volume of blood, which had to be transfused was 63.9 ml in the keratinocyte group and significantly lower than the volume of 151.4 ml, which was administered in the skin graft group (p=0.04). At follow up the VSS observed in areas covered by keratinocytes was 2.33 on the average and therefore, significantly lower than the VSS of 5.22 in skin grafted areas of the comparative group (p=0.04). In children the use of cultivated keratinocytes in partial thickness scald burns is a procedure, which renders constantly reliable results. It minimizes the

  1. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  2. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  3. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  4. Keratinocytes propagated in serum-free, feeder-free culture conditions fail to form stratified epidermis in a reconstituted skin model.

    Directory of Open Access Journals (Sweden)

    Rebecca Lamb

    Full Text Available Primary human epidermal stem cells isolated from skin tissues and subsequently expanded in tissue culture are used for human therapeutic use to reconstitute skin on patients and to generate artificial skin in culture for academic and commercial research. Classically, epidermal cells, known as keratinocytes, required fibroblast feeder support and serum-containing media for serial propagation. In alignment with global efforts to remove potential animal contaminants, many serum-free, feeder-free culture methods have been developed that support derivation and growth of these cells in 2-dimensional culture. Here we show that keratinocytes grown continually in serum-free and feeder-free conditions were unable to form into a stratified, mature epidermis in a skin equivalent model. This is not due to loss of cell potential as keratinocytes propagated in serum-free, feeder-free conditions retain their ability to form stratified epidermis when re-introduced to classic serum-containing media. Extracellular calcium supplementation failed to improve epidermis development. In contrast, the addition of serum to commercial, growth media developed for serum-free expansion of keratinocytes facilitated 3-dimensional stratification in our skin equivalent model. Moreover, the addition of heat-inactivated serum improved the epidermis structure and thickness, suggesting that serum contains factors that both aid and inhibit stratification.

  5. Transfer of a two-tiered keratinocyte assay: IL-18 production by NCTC2544 to determine the skin sensitizing capacity and epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2013-01-01

    . The two tiered approach may offer an unique opportunity to provide an alternative method to the Local Lymph Node Assay (LLNA). These assays are both based on the use of human keratinocytes, which have been shown over the last two decades, to play a key role in all phases of skin sensitization....

  6. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

    Science.gov (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  7. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  8. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  9. Modulation of radiation effects in tissues by keratinocyte growth factor (KGF)

    International Nuclear Information System (INIS)

    Doerr, W.; Lacmann, A.; Noack, R.; Spekl, K.

    2000-01-01

    Keratinocyte Growth Factor (KGF) is a member of the fibroblast growth factor family. KGF is produced by mesenchymal cells, predominantly fibroblasts; target cells are epithelial cells in a variety of tissues. Hence, KGF is a mediator of the mesenchymal-epithelial communication and a regulator of tissue homeostasis in epithelia. Systemic administration of KGF in animal models induces stimulation of proliferation and modulation of migration and differentiation processes in squamous epithelia. This results in a transient increase in cell numbers and epithelial thickness. Radiation exposure of epithelia causes an imbalance between cell production and cell loss, which in consequence causes progressive cell depletion and eventually complete denudation. Systemic application of KGF reduces the radiation-induced cell loss. This effect is most pronounced when KGF is given after the radiation exposure. With regard to epithelial radiation tolerance, KGF-application in animal models results in a significant increase, by a factor of 1.7-2.3, in the doses required to induce epithelial ulceration as a clinically most relevant endpoint. After exposure with a given dose, this translates into a significant reduction of the clinical manifestation of the acute radiation sequelae. This effect is accompanied by a modification of the time course of the response. In conclusion, although the mechanisms underlying the protective efficacy remain unclear, KGF may represent an effective approach for amelioration of radiation effects in oral, gastrointestinal and cutaneous epithelia. Results from a clinical pilot study indicate that KGF is well tolerated and effective in humans. (orig.) [de

  10. Human lactoferrin stimulates skin keratinocyte function and wound re-epithelialization.

    Science.gov (United States)

    Tang, L; Wu, J J; Ma, Q; Cui, T; Andreopoulos, F M; Gil, J; Valdes, J; Davis, S C; Li, J

    2010-07-01

    Human lactoferrin (hLF), a member of the transferrin family, is known for its antimicrobial and anti-inflammatory effects. Recent studies on various nonskin cell lines indicate that hLF may have a stimulatory effect on cell proliferation. To study the potential role of hLF in wound re-epithelialization. The effects of hLF on cell growth, migration, attachment and survival were assessed, with a rice-derived recombinant hLF (holo-rhLF), using proliferation analysis, scratch migration assay, calcein-AM/propidium iodide staining and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) method, respectively. The mechanisms of hLF on cell proliferation and migration were explored using specific pathway inhibitors. The involvement of lactoferrin receptor low-density lipoprotein receptor-related protein 1 (LRP1) was examined with RNA interference technique. An in vivo swine second-degree burn wound model was also used to assess wound re-epithelialization. Studies revealed that holo-rhLF significantly stimulated keratinocyte proliferation which could be blocked by mitogen-activated protein kinase (MAPK) kinase 1 inhibitor. Holo-rhLF also showed strong promoting effects on keratinocyte migration, which could be blocked by either inhibition of the MAPK, Src and Rho/ROCK pathways, or downregulation of the LRP1 receptor. With cells under starving or 12-O-tetradecanoylphorbol-13-acetate exposure, the addition of holo-rhLF was found greatly to increase cell viability and inhibit cell apoptosis. Additionally, holo-rhLF significantly increased the rate of wound re-epithelialization in swine second-degree burn wounds. Our studies demonstrate the direct effects of holo-rhLF on wound re-epithelialization including the enhancement of keratinocyte proliferation and migration as well as the protection of cells from apoptosis. The data strongly indicate its potential therapeutic applications in wound healing.

  11. Correlation of initiating potency of skin carcinogens with potency to induce resistance to terminal differentiation in cultured mouse keratinocytes

    International Nuclear Information System (INIS)

    Kilkenny, A.E.; Morgan, D.; Spangler, E.F.; Yuspa, S.H.

    1985-01-01

    The induction by chemical carcinogens of resistance to terminal differentiation in cultured mouse keratinocytes has been proposed to represent a cellular change associated with the initiation phase of skin carcinogenesis. Previous results with this culture model indicated that the number of differentiation-resistant foci was correlated with the dose and known potency for several chemical carcinogens. Assay conditions were optimized to provide quantitative results for screening a variety of carcinogens for their potency as inducers of foci resistant to terminal differentiation. Eight skin initiators of varying potency and from different chemical classes and ultraviolet light were studied for their activity to induce this alteration in cultured epidermal cells from newborn BALB/c mice. There was an excellent positive correlation for the potency of these agents as initiators in vivo and as inducers of altered differentiation in vitro. The induction of resistant foci was independent of the relative cytotoxic effects of each agent except where cytotoxicity was extensive and reduced the number of foci. The results support the hypothesis that initiation of carcinogenesis in skin results in an alteration in the program of epidermal cell differentiation. The results also suggest that the assay is useful for identifying relative potency classes (strong, moderate, weak) of initiating agents

  12. Modulation of LXR-α and the effector genes by Ascorbic acid and Statins in psoriatic keratinocytes.

    Science.gov (United States)

    Soodgupta, Deepti; Kaul, Deepak; Kanwar, A J; Parsad, Davinder

    2014-12-01

    Recent studies have revealed critical roles that nuclear receptors like LXR-α (Liver X Receptor- alpha) plays as a class of post-transcriptional gene regulator in skin development and diseases. Keeping in view the fact that LXR-α plays crucial role in keratinocyte proliferation and differentiation, it becomes imperative to dissect the pathways and role of LXR-α genomics in the pathogenesis of psoriasis with ultimate aim to explore novel preventive/therapeutic strategies as treatment options. To explore the effects of agonists and activators of LXR-α on its own gene expression and the putative targets in psoriatic keratinocytes. Identification of promoter sequences for (vitamin D receptor) VDR and Catalase were done using in silico analysis followed by β-galactosidase (β-gal) reporter plasmid assay in keratinocytes from clinically heathy subjects. Determination of relative levels of LXR-α,VDR and catalase in control versus treated cells upon activation of LXR-α with Atorvastatin + 22R hydroxycholestrol and Ascorbic acid + 22R hydroxycholestrol was done by PCR and Cell Proliferation Assay. The cells transfected with the reporter plasmid element for VDR and catalase showed more than 5 and 4 fold increase respectively in the β-gal activity compared to the control. An increase of 55% in LXR-α gene expression at RNA level was observed in Atorvastatin + 22-R hydroxycholestrol compared to 24% in Ascorbic acid + 22-ROH cholesterol. The expression of the VDR and Catalase was significantly increased in both treated keratinocytes compared to its normal counterpart.

  13. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  14. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  15. Protective effect of indole-3-pyruvate against ultraviolet b-induced damage to cultured HaCaT keratinocytes and the skin of hairless mice.

    Directory of Open Access Journals (Sweden)

    Reiji Aoki

    Full Text Available Previous investigations demonstrated that pyruvate protects human keratinocytes against cell damage stemming from exposure to ultraviolet B (UVB radiation. This study endeavoured to elucidate the protective capacity of aromatic pyruvates (e.g., phenylpyruvate (PPyr, 4-hydroxyphenylpyruvate (HPPyr, and indole-3-pyruvate (IPyr against UVB-induced injury to skin cells, both in vitro and in vivo. Cultured human HaCaT keratinocytes were irradiated with UVB light (60 mJ/cm2 and maintained with or without test compounds (1-25 mM.In addition, the dorsal skin of hairless mice (HR-1 was treated with test compounds (10 μmol and exposed to UVB light (1 J/cm2 twice [corrected]. The ability of the test compounds to ameliorate UVB-induced cytotoxicity and inflammation was then assessed. Aromatic pyruvates reduced cytotoxicity in UVB-irradiated HaCaT keratinocytes, and also diminished the expression of interleukin 1β (IL-1β and interleukin 6 (IL-6. IPyr was more efficacious than either PPyr or HPPyr. Furthermore, only IPyr inhibited cyclooxygenase-2 (Cox-2 expression at both the mRNA and the protein level in UVB-treated keratinocytes. Topical application of IPyr to the dorsal skin of hairless mice reduced the severity of UVB-induced skin lesions, the augmentation of dermal thickness, and transepithelial water loss. Overproduction of IL-1β and IL-6 in response to UVB radiation was also suppressed in vivo by the topical administration of IPyr. These data strongly suggest that IPyr might find utility as a UVB-blocking reagent in therapeutic strategies to lessen UVB-induced inflammatory skin damage.

  16. Transmembrane collagen XVII modulates integrin dependent keratinocyte migration via PI3K/Rac1 signaling.

    Directory of Open Access Journals (Sweden)

    Stefanie Löffek

    Full Text Available The hemidesmosomal transmembrane component collagen XVII (ColXVII plays an important role in the anchorage of the epidermis to the underlying basement membrane. However, this adhesion protein seems to be also involved in the regulation of keratinocyte migration, since its expression in these cells is strongly elevated during reepithelialization of acute wounds and in the invasive front of squamous cell carcinoma, while its absence in ColXVII-deficient keratinocytes leads to altered cell motility. Using a genetic model of murine Col17a1⁻/⁻ keratinocytes we elucidated ColXVII mediated signaling pathways in cell adhesion and migration. Col17a1⁻/⁻ keratinocytes exhibited increased spreading on laminin 332 and accelerated, but less directed cell motility. These effects were accompanied by increased expression of the integrin subunits β4 and β1. The migratory phenotype, as evidenced by formation of multiple unstable lamellipodia, was associated with enhanced phosphoinositide 3-kinase (PI3K activity. Dissection of the signaling pathway uncovered enhanced phosphorylation of the β4 integrin subunit and the focal adhesion kinase (FAK as activators of PI3K. This resulted in elevated Rac1 activity as a downstream consequence. These results provide mechanistic evidence that ColXVII coordinates keratinocyte adhesion and directed motility by interfering integrin dependent PI3K activation and by stabilizing lamellipodia at the leading edge of reepithelializing wounds and in invasive squamous cell carcinoma.

  17. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  18. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    Energy Technology Data Exchange (ETDEWEB)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C. [Athens Univ. (Greece). School of Medicine

    1996-06-28

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 {+-} 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK).

  19. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C.

    1996-01-01

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 ± 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK)

  20. GHK Peptide as a Natural Modulator of Multiple Cellular Pathways in Skin Regeneration

    Directory of Open Access Journals (Sweden)

    Loren Pickart

    2015-01-01

    Full Text Available GHK (glycyl-L-histidyl-L-lysine is present in human plasma, saliva, and urine but declines with age. It is proposed that GHK functions as a complex with copper 2+ which accelerates wound healing and skin repair. GHK stimulates both synthesis and breakdown of collagen and glycosaminoglycans and modulates the activity of both metalloproteinases and their inhibitors. It stimulates collagen, dermatan sulfate, chondroitin sulfate, and the small proteoglycan, decorin. It also restores replicative vitality to fibroblasts after radiation therapy. The molecule attracts immune and endothelial cells to the site of an injury. It accelerates wound-healing of the skin, hair follicles, gastrointestinal tract, boney tissue, and foot pads of dogs. It also induces systemic wound healing in rats, mice, and pigs. In cosmetic products, it has been found to tighten loose skin and improve elasticity, skin density, and firmness, reduce fine lines and wrinkles, reduce photodamage, and hyperpigmentation, and increase keratinocyte proliferation. GHK has been proposed as a therapeutic agent for skin inflammation, chronic obstructive pulmonary disease, and metastatic colon cancer. It is capable of up- and downregulating at least 4,000 human genes, essentially resetting DNA to a healthier state. The present review revisits GHK’s role in skin regeneration in the light of recent discoveries.

  1. Assessment of the potential skin irritation of lysine-derivative anionic surfactants using mouse fibroblast and human keratinocytes as an alternative to animal testing

    OpenAIRE

    Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar

    2004-01-01

    Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...

  2. cFLIP Regulates Skin Homeostasis and Protects against TNF-Induced Keratinocyte Apoptosis

    Directory of Open Access Journals (Sweden)

    Diana Panayotova-Dimitrova

    2013-10-01

    Full Text Available FADD, caspase-8, and cFLIP regulate the outcome of cell death signaling. Mice that constitutively lack these molecules die at an early embryonic age, whereas tissue-specific constitutive deletion of FADD or caspase-8 results in inflammatory skin disease caused by increased necroptosis. The function of cFLIP in the skin in vivo is unknown. In contrast to tissue-specific caspase-8 knockout, we show that mice constitutively lacking cFLIP in the epidermis die around embryonic days 10 and 11. When cFLIP expression was abrogated in adult skin of cFLIPfl/fl-K14CreERtam mice, severe inflammation of the skin with concomitant caspase activation and apoptotic, but not necroptotic, cell death developed. Apoptosis was dependent of autocrine tumor necrosis factor production triggered by loss of cFLIP. In addition, epidermal cFLIP protein was lost in patients with severe drug reactions associated with epidermal apoptosis. Our data demonstrate the importance of cFLIP for the integrity of the epidermis and for silencing of spontaneous skin inflammation.

  3. Oxidative stress drives CD8+ T-cell skin trafficking in patients with vitiligo through CXCL16 upregulation by activating the unfolded protein response in keratinocytes.

    Science.gov (United States)

    Li, Shuli; Zhu, Guannan; Yang, Yuqi; Jian, Zhe; Guo, Sen; Dai, Wei; Shi, Qiong; Ge, Rui; Ma, Jingjing; Liu, Ling; Li, Kai; Luan, Qi; Wang, Gang; Gao, Tianwen; Li, Chunying

    2017-07-01

    In patients with vitiligo, an increased reactive oxygen species (ROS) level has been proved to be a key player during disease initiation and progression in melanocytes. Nevertheless, little is known about the effects of ROS on other cells involved in the aberrant microenvironment, such as keratinocytes and the following immune events. CXCL16 is constitutively expressed in keratinocytes and was recently found to mediate homing of CD8 + T cells in human skin. We sought to explicate the effect of oxidative stress on human keratinocytes and its capacity to drive CD8 + T-cell trafficking through CXCL16 regulation. We first detected putative T-cell skin-homing chemokines and ROS in serum and lesions of patients with vitiligo. The production of candidate chemokines was detected by using quantitative real-time PCR and ELISA in keratinocytes exposed to H 2 O 2 . Furthermore, the involved mediators were analyzed by using quantitative real-time PCR, Western blotting, ELISA, and immunofluorescence. Next, we tested the chemotactic migration of CD8 + T cells from patients with vitiligo mediated by the CXCL16-CXCR6 pair using the transwell assay. CXCL16 expression increased and showed a positive correlation with oxidative stress levels in serum and lesions of patients with vitiligo. The H 2 O 2 -induced CXCL16 expression was due to the activation of 2 unfolded protein response pathways: kinase RNA (PKR)-like ER kinase-eukaryotic initiation factor 2α and inositol-requiring enzyme 1α-X-box binding protein 1. CXCL16 produced by stressed keratinocytes induced migration of CXCR6 + CD8 + T cells derived from patients with vitiligo. CXCR6 + CD8 + T-cell skin infiltration is accompanied by melanocyte loss in lesions of patients with vitiligo. Our study demonstrated that CXCL16-CXCR6 mediates CD8 + T-cell skin trafficking under oxidative stress in patients with vitiligo. The CXCL16 expression in human keratinocytes induced by ROS is, at least in part, caused by unfolded protein response

  4. Mesenchymal stem cells ameliorate impaired wound healing through enhancing keratinocyte functions in diabetic foot ulcerations on the plantar skin of rats.

    Science.gov (United States)

    Kato, Jiro; Kamiya, Hideki; Himeno, Tatsuhito; Shibata, Taiga; Kondo, Masaki; Okawa, Tetsuji; Fujiya, Atsushi; Fukami, Ayako; Uenishi, Eita; Seino, Yusuke; Tsunekawa, Shin; Hamada, Yoji; Naruse, Keiko; Oiso, Yutaka; Nakamura, Jiro

    2014-01-01

    Although the initial healing stage involves a re-epithelialization in humans, diabetic foot ulceration (DFU) has been investigated using rodent models with wounds on the thigh skin, in which a wound contraction is initiated. In this study, we established a rodent model of DFU on the plantar skin and evaluated the therapeutic efficacy of bone-marrow-derived mesenchymal stem cells (BM-MSCs) in this model. The wounds made on the hind paws or thighs of streptozotocin induced diabetic or control rats were treated with BM-MSCs. Expression levels of phosphorylated focal adhesion kinase (pFAK), matrix metaroprotease (MMP)-2, EGF, and IGF-1, were evaluated in human keratinocytes, which were cultured in conditioned media of BM-MSCs (MSC-CM) with high glucose levels. Re-epithelialization initiated the healing process on the plantar, but not on the thigh, skin. The therapy utilizing BM-MSCs ameliorated the delayed healing in diabetic rats. In the keratinocytes cultured with MSC-CM, the decreased pFAK levels in the high glucose condition were restored, and the MMP2, EGF, and IGF-1 levels increased. Our study established a novel rat DFU model. The impaired healing process in diabetic rats was ameliorated by transplantation of BM-MSCs. This amelioration might be accounted for by the modification of keratinocyte functions. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  6. Differential role of basal keratinocytes in UV-induced immunosuppression and skin cancer

    NARCIS (Netherlands)

    J. Jans (Judith); G.A. Garinis (George); W. Schul; A. van Oudenaren (Adri); M.J. Moorhouse (Michael); M. Smid (Marcel); Y.-G. Sert (Yurda-Gul); A. van der Velde (Albertina); Y.M. Rijksen (Yvonne); F.R. de Gruijl (Frank); P.J. van der Spek (Peter); A. Yasui (Akira); J.H.J. Hoeijmakers (Jan); P.J. Leenen (Pieter); G.T.J. van der Horst (Gijsbertus)

    2006-01-01

    textabstractCyclobutane pyrimidine dimers (CPDs) and 6-4 photoproducts (6-4PPs) comprise major UV-induced photolesions. If left unrepaired, these lesions can induce mutations and skin cancer, which is facilitated by UV-induced immunosuppression. Yet the contribution of lesion and cell type

  7. Modulation of the androgenetic response in diverse skin cell types: the pilosebaceous unit

    International Nuclear Information System (INIS)

    Zurvarra, F.; Kerner, N.; Hagelin, K.

    2009-01-01

    Androgens play a central role in diverse morphogenetic processes of the skin. Hair growth and follicular cycle are regulated in part by androgens. Androgens also play a key function, together with other receptors such as the PPARs receptors family, on the proliferation and differentiation of the sebaceous gland that forms part of the pilosebaceous unit and influences hair growth and skin well-being. UV radiation may affect androgens regulation of skin homeostasis. Objectives: to study the modulation of androgenetic response related to UV radiation on the pilosebaceous unit, in two skin conditions: androgenetic alopecia and acne, both affecting skin and constituting major concerns for affected individuals. Methods: primary cultures of cells and established cell lines from the pilosebaceous unit: dermal papillae cells, keratinocytes and sebocytes. Analysis of lipid content, inflammatory response and proliferation of cells under the influence of androgens, PPARs ligands and UVR. Results: sebocytes primary cultures were obtained from human sebaceous glands. Proliferation and differentiation, as well as the expression of proinflammatory molecules (IL-1, TNF alpha, iNOs) and lipogenic enzymes (FASN) under androgens and UV treatment were assessed. The response to androgens under UV exposure was also analyzed in dermal papillae cells in culture. (authors)

  8. Differential responses of cells from human skin keratinocyte and bovine mammary epithelium to attack by pore-forming Staphylococcus aureus alpha-toxin.

    Science.gov (United States)

    Suriyaphol, Gunnaporn; Sarikaputi, Meena; Suriyaphol, Prapat

    2009-11-01

    Human skin keratinocytes HaCat attacked by Staphylococcus aureus alpha-toxin showed a transient drop of cellular ATP levels whereas in toxin-perforated bovine mammary epithelial cells (BMEC), the ATP levels dropped more slowly. Morphologically, during the ATP level depletion, HaCat cell developed a spacious intracellular vacuole together with the transient influx of trypan blue. WST-1 signal, which tested the function of mitochondrial enzyme in viable cells, also decreased concomitantly. On the other hand, BMEC excluded trypan blue and vacuolation was not observed throughout the experiment. We conclude that mammary epithelial cells resist the toxin better than keratinocytes. This is the first report showing that alpha-toxin enhances transient membrane permeability to large molecules, temporary vacuole formation and the transient defect of mitochondrial enzyme in viable cells without cell lysis.

  9. Varying the morphology of silver nanoparticles results in differential toxicity against micro-organisms, HaCaT keratinocytes and affects skin deposition.

    Science.gov (United States)

    Holmes, Amy M; Lim, Julian; Studier, Hauke; Roberts, Michael S

    2016-12-01

    The use of silver nanoparticles (Ag NPs) within the healthcare sector and consumer products is rapidly increasing. There are now a range of diverse-shaped Ag NPs that are commercially available and many of the products containing nanosilver are topically applied to human skin. Currently, there is limited data on the extent to which the antimicrobial efficacy and cytotoxicity of Ag NPs is related to their shape and how the shape of the Ag NPs affects their distribution in both intact and burn wounded human skin after topical application. In this study, we related the relative Ag NP cytotoxicity to potential skin pathogens and HaCaT keratinocytes in vitro with the shape of the Ag NPs. We employed multiphoton fluorescence lifetime imaging to map the distribution of the native and unlabeled Ag NPs after topical application to both intact and burn wounded human skin using the localized surface plasmon resonance signal of the Ag NPs. Truncated plate shaped Ag NPs led to the highest cytotoxicity against both bacteria (IC 50 ranges from 31.25 to 125 μg/mL depending on the bacterial species) and HaCaT keratinocytes (IC 50 78.65 μg/mL [95%CI 63.88, 96.83]) thus both with similar orders of magnitude. All Ag NPs were less cytotoxic than solutions of silver nitrate (IC 50 of 7.85 μg/mL [95%CI 1.49, 14.69]). Plate-shaped Ag NPs displayed the highest substantivity within the superficial layers of the stratum corneum when topically applied to intact skin and the highest deposition into the wound bed when applied to burned ex vivo human skin relative to other Ag NP shapes.

  10. Radical Scavenging Activity-Based and AP-1-Targeted Anti-Inflammatory Effects of Lutein in Macrophage-Like and Skin Keratinocytic Cells

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2013-01-01

    Full Text Available Lutein is a naturally occurring carotenoid with antioxidative, antitumorigenic, antiangiogenic, photoprotective, hepatoprotective, and neuroprotective properties. Although the anti-inflammatory effects of lutein have previously been described, the mechanism of its anti-inflammatory action has not been fully elucidated. Therefore, in the present study, we aimed to investigate the regulatory activity of lutein in the inflammatory responses of skin-derived keratinocytes or macrophages and to elucidate the mechanism of its inhibitory action. Lutein significantly reduced several skin inflammatory responses, including increased expression of interleukin-(IL- 6 from LPS-treated macrophages, upregulation of cyclooxygenase-(COX- 2 from interferon-γ/tumor necrosis-factor-(TNF- α-treated HaCaT cells, and the enhancement of matrix-metallopeptidase-(MMP- 9 level in UV-irradiated keratinocytes. By evaluating the intracellular signaling pathway and the nuclear transcription factor levels, we determined that lutein inhibited the activation of redox-sensitive AP-1 pathway by suppressing the activation of p38 and c-Jun-N-terminal kinase (JNK. Evaluation of the radical and ROS scavenging activities further revealed that lutein was able to act as a strong anti-oxidant. Taken together, our findings strongly suggest that lutein-mediated AP-1 suppression and anti-inflammatory activity are the result of its strong antioxidative and p38/JNK inhibitory activities. These findings can be applied for the preparation of anti-inflammatory and cosmetic remedies for inflammatory diseases of the skin.

  11. Two-tiered keratinocyte assay: IL-18 production by NCTC2544 cells to determine the skin sensitizing capacity and an epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2012-01-01

    the use of animals. The aim of the EU FP6 Integrated Project Sens-it-iv was to develop and optimize an integrated testing strategy consisting of in vitro, human cell based assays which will closely mimic sensitization mechanisms in vivo. These assays should be an alternative approach to the LLNA. The NCTC...... method to the LLNA. Both assays are based on the use of human keratinocytes, which have been shown, over the last two decades, to play a key role in all phases of skin sensitization. First, 4 known chemicals were tested during a transferability study in which 6 laboratories participated. Three...

  12. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  13. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  14. Red Light Combined with Blue Light Irradiation Regulates Proliferation and Apoptosis in Skin Keratinocytes in Combination with Low Concentrations of Curcumin

    Science.gov (United States)

    Cai, Qing; Ren, Qu; Wei, Lizhao

    2015-01-01

    Curcumin is a widely known natural phytochemical from plant Curcuma longa. In recent years, curcumin has received increasing attention because of its capability to induce apoptosis and inhibit cell proliferation as well as its anti-inflammatory properties in different cancer cells. However, the therapeutic benefits of curcumin are severely hampered due to its particularly low absorption via trans-dermal or oral bioavailability. Phototherapy with visible light is gaining more and more support in dermatological therapy. Red light is part of the visible light spectrum, which is able to deeply penetrate the skin to about 6 mm, and directly affect the fibroblast of the skin dermis. Blue light is UV-free irradiation which is fit for treating chronic inflammation diseases. In this study, we show that curcumin at low concentrations (1.25–3.12 μM) has a strong anti-proliferative effect on TNF-α-induced psoriasis-like inflammation when applied in combination with light-emitting-diode devices. The treatment was especially effective when LED blue light at 405 nm was combined with red light at 630 or 660 nm, which markedly amplified the anti-proliferative and apoptosis-inducing effects of curcumin. The experimental results demonstrated that this treatment reduced the viability of human skin keratinocytes, decreased cell proliferation, induced apoptosis, inhibited NF-κB activity and activated caspase-8 and caspase-9 while preserving the cell membrane integrity. Moreover, the combined treatment also down-regulated the phosphorylation level of Akt and ERK. Taken together, our results indicated that the combination of curcumin with LED blue light united red light irradiation can attain a higher efficiency of regulating proliferation and apoptosis in skin keratinocytes. PMID:26382065

  15. Red Light Combined with Blue Light Irradiation Regulates Proliferation and Apoptosis in Skin Keratinocytes in Combination with Low Concentrations of Curcumin.

    Directory of Open Access Journals (Sweden)

    Tianhui Niu

    Full Text Available Curcumin is a widely known natural phytochemical from plant Curcuma longa. In recent years, curcumin has received increasing attention because of its capability to induce apoptosis and inhibit cell proliferation as well as its anti-inflammatory properties in different cancer cells. However, the therapeutic benefits of curcumin are severely hampered due to its particularly low absorption via trans-dermal or oral bioavailability. Phototherapy with visible light is gaining more and more support in dermatological therapy. Red light is part of the visible light spectrum, which is able to deeply penetrate the skin to about 6 mm, and directly affect the fibroblast of the skin dermis. Blue light is UV-free irradiation which is fit for treating chronic inflammation diseases. In this study, we show that curcumin at low concentrations (1.25-3.12 μM has a strong anti-proliferative effect on TNF-α-induced psoriasis-like inflammation when applied in combination with light-emitting-diode devices. The treatment was especially effective when LED blue light at 405 nm was combined with red light at 630 or 660 nm, which markedly amplified the anti-proliferative and apoptosis-inducing effects of curcumin. The experimental results demonstrated that this treatment reduced the viability of human skin keratinocytes, decreased cell proliferation, induced apoptosis, inhibited NF-κB activity and activated caspase-8 and caspase-9 while preserving the cell membrane integrity. Moreover, the combined treatment also down-regulated the phosphorylation level of Akt and ERK. Taken together, our results indicated that the combination of curcumin with LED blue light united red light irradiation can attain a higher efficiency of regulating proliferation and apoptosis in skin keratinocytes.

  16. Portulaca oleracea L. aids calcipotriol in reversing keratinocyte differentiation and skin barrier dysfunction in psoriasis through inhibition of the nuclear factor κB signaling pathway

    Science.gov (United States)

    ZHAO, HENGGUANG; LI, SHUANG; LUO, FULING; TAN, QIAN; LI, HUI; ZHOU, WEIKANG

    2015-01-01

    Psoriasis affects 2–4% of the population worldwide and its treatment is currently far from satisfactory. Calcipotriol and Portulaca oleracea have been reported to exhibit the capacity to inhibit inflammation in psoriatic patients and improve their clinical condition. However, the efficacy of a combination regimen of these two components remains unknown. The aim of the present study was to explore the therapeutic efficacy of P. oleracea extract combined with calcipotriol on plaque psoriasis and its potential mechanism. Eleven patients with plaque psoriasis were treated with humectant containing the active ingredients of P. oleracea extract, with or without 0.005% calcipotriol ointment in a right-left bilateral lesion self-control study. Differences were evaluated by investigation of the clinical efficacy, adverse effects, skin barrier function, histological structure, expression and proliferation of keratinocytes, differentiation markers (cytokeratin 10, filaggrin and loricrin), inflammatory factors [tumor necrosis factor (TNF)-α and interleukin (IL)-8], as well as the status of the nuclear factor κB (NF-κB) pathway. The combination of P. oleracea and calcipotriol was revealed to decrease adverse effects, reduce transepidermal water loss, potently reverse keratinocyte differentiation dysfunction, and inhibit the expression of TNF-α and IL-8 and the phosphorylation of the NF-κB inhibitor IκBα. This treatment is therefore anticipated to be suitable for use as a novel adjuvant therapy for psoriatic patients. PMID:25574190

  17. Humanized Mouse Model of Skin Inflammation Is Characterized by Disturbed Keratinocyte Differentiation and Influx of IL-17A Producing T Cells

    Science.gov (United States)

    de Oliveira, Vivian L.; Keijsers, Romy R. M. C.; van de Kerkhof, Peter C. M.; Seyger, Marieke M. B.; Fasse, Esther; Svensson, Lars; Latta, Markus; Norsgaard, Hanne; Labuda, Tord; Hupkens, Pieter; van Erp, Piet E. J.; Joosten, Irma; Koenen, Hans J. P. M.

    2012-01-01

    Humanized mouse models offer a challenging possibility to study human cell function in vivo. In the huPBL-SCID-huSkin allograft model human skin is transplanted onto immunodeficient mice and allowed to heal. Thereafter allogeneic human peripheral blood mononuclear cells are infused intra peritoneally to induce T cell mediated inflammation and microvessel destruction of the human skin. This model has great potential for in vivo study of human immune cells in (skin) inflammatory processes and for preclinical screening of systemically administered immunomodulating agents. Here we studied the inflammatory skin response of human keratinocytes and human T cells and the concomitant systemic human T cell response. As new findings in the inflamed human skin of the huPBL-SCID-huSkin model we here identified: 1. Parameters of dermal pathology that enable precise quantification of the local skin inflammatory response exemplified by acanthosis, increased expression of human β-defensin-2, Elafin, K16, Ki67 and reduced expression of K10 by microscopy and immunohistochemistry. 2. Induction of human cytokines and chemokines using quantitative real-time PCR. 3. Influx of inflammation associated IL-17A-producing human CD4+ and CD8+ T cells as well as immunoregulatory CD4+Foxp3+ cells using immunohistochemistry and -fluorescence, suggesting that active immune regulation is taking place locally in the inflamed skin. 4. Systemic responses that revealed activated and proliferating human CD4+ and CD8+ T cells that acquired homing marker expression of CD62L and CLA. Finally, we demonstrated the value of the newly identified parameters by showing significant changes upon systemic treatment with the T cell inhibitory agents cyclosporine-A and rapamycin. In summary, here we equipped the huPBL-SCID-huSkin humanized mouse model with relevant tools not only to quantify the inflammatory dermal response, but also to monitor the peripheral immune status. This combined approach will gain our

  18. Biochemical mechanisms of skin radiation burns inhibition and healing by the volumetric autotransplantation of fibroblasts and of keratinocytes with fibroblasts composition

    Directory of Open Access Journals (Sweden)

    L. V. Altukhova

    2015-09-01

    Full Text Available Mechanisms of influence of volumetric autotransplantation of fibroblasts and of the mixture of fibroblasts and keratinocytes on the development of the local 3rd degree X-ray burn and the radiation skin ulcer in guinea pigs were investigated. We used deepadministration into the irradiation zone on its perimeter of 6 doses, which contained (150–160×103 fibroblasts and (130–140×103 keratinocytes in 100 µl. It is shown that this autotransplantation carried out 1 hour after the irradiation, and then every 24 hours, reduces the area of burn on the 35th day, compared to the control by 63%. Radiation ulcer appears on the 10th day after irradiation and is completely healed on the 25th day. With the same regimen of administration of only fibroblasts containing (200–210×103 cells in 100 µl, these parameters of treatment were equal to 31% on 4th and 35th day, respectively. It is shown that as a result of radiation in the area of burn the level of gene expression of collagen types I and III, elastin, fibronectin, vinculin, decorin, hyaluronansynthases 1, 2, 3, matrix metalloproteinases 1, 2, 3, 7, 9 and hyaluronidase is reduced. Besides, in the burn area the level of gene expression of transforming growth factor α, fibroblast growth factors 1, 2, 8 and anti-inflammatory cytokines – interleukin 10 and transforming growth factor-β1 – is reduced, while the level of gene expression of proinflammatory cytokine (interleykin1β increases. Both types of autotransplantation cause the growth of the expression level of all the structural genes and regulatory proteins of biopolymers and decrease in the expression level of interleukin 1β, which leads to activation of tissue regeneration and healing of the burn wound. Reasonsfor the higher efficiency of autotransplantation using the mixture of fibroblasts and keratinocytes compared to autotransplantation by fibroblasts only are both the larger total number of live cells regularly replacing dead cells in

  19. Staphylococcus aureus α-toxin modulates skin host response to viral infection.

    Science.gov (United States)

    Bin, Lianghua; Kim, Byung Eui; Brauweiler, Anne; Goleva, Elena; Streib, Joanne; Ji, Yinduo; Schlievert, Patrick M; Leung, Donald Y M

    2012-09-01

    Patients with atopic dermatitis (AD) with a history of eczema herpeticum have increased staphylococcal colonization and infections. However, whether Staphylococcus aureus alters the outcome of skin viral infection has not been determined. We investigated whether S aureus toxins modulated host response to herpes simplex virus (HSV) 1 and vaccinia virus (VV) infections in normal human keratinocytes (NHKs) and in murine infection models. NHKs were treated with S aureus toxins before incubation of viruses. BALB/c mice were inoculated with S aureus 2 days before VV scarification. Viral loads of HSV-1 and VV were evaluated by using real-time PCR, a viral plaque-forming assay, and immunofluorescence staining. Small interfering RNA duplexes were used to knockdown the gene expression of the cellular receptor of α-toxin, a disintegrin and metalloprotease 10 (ADAM10). ADAM10 protein and α-toxin heptamers were detected by using Western blot assays. We demonstrate that sublytic staphylococcal α-toxin increases viral loads of HSV-1 and VV in NHKs. Furthermore, we demonstrate in vivo that the VV load is significantly greater (P skin inoculated with an α-toxin-producing S aureus strain compared with murine skin inoculated with the isogenic α-toxin-deleted strain. The viral enhancing effect of α-toxin is mediated by ADAM10 and is associated with its pore-forming property. Moreover, we demonstrate that α-toxin promotes viral entry in NHKs. The current study introduces the novel concept that staphylococcal α-toxin promotes viral skin infection and provides a mechanism by which S aureus infection might predispose the host toward disseminated viral infections. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  20. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  1. Effect of Nanodiamond and Nanoplatinum Liquid, DPV576, on Human Primary Keratinocytes.

    Science.gov (United States)

    Ghoneum, Mamdooh H; Katano, Hideki; Agrawal, Sudhanshu; Ganguly, Sreerupa; Agrawal, Anshu

    2017-01-01

    Nanofabrics are now being used in a wide range of products that come into direct contact with skin, including carpet, clothing, and medical fabrics. In the current study, we examined the effect of a dispersed aqueous mixture of nanodiamond (ND) and nanoplatinum (NP) (DPV576) on human primary keratinocytes with respect to transient receptor potential vanilloid (TRPV) channel expression, secretion of cytokines and production of nerve growth factor (NGF). Keratinocytes were treated with DPV576 at concentrations of 1:10 and 1:100 dilutions for 24 hours in vitro, and their activation of was determined by production of cytokines TNF-α, IL-1β, and prostaglandin (PGE2), and by production of NGF. Inhibitor experiments were carried out by incubating keratinocytes with the TRPV4-selective antagonist HC-067047. TRPV receptor expression (TRPV1, TRPV3 and TRPV4) on keratinocytes as well as changes in Ca2+ potential were examined by flow cytometry. DPV576 treatment of keratinocytes resulted in the following effects: (1) stimulation of keratinocytes as indicated by the significant secretion of cytokines IL-1β, TNF-α, and PGE2, an effect noted only at higher concentration (1:10); (2) significant decrease in the expression of TRPV4 on keratinocytes with a spike in the calcium flux, but no change in the expression of TRPV1 and TRPV3; (3) induction of cytokine secretion independent of TRPV4, as the addition of TRPV4 inhibitor had no significant effect on the cytokine production from keratinocytes; (4) induction of NGF secretion by keratinocytes. These results demonstrate that DPV576 activates keratinocytes via multiple signaling pathways which may reduce stress associated with inflammation, pain, and circadian rhythms. ND/NP-coated fabrics that target the modulation of local inflammation, pain, and circadian rhythms could potentially be of benefit to humans.

  2. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    Goebel, C.; Hewitt, N.J.; Kunze, G.; Wenker, M.; Hein, D.W.; Beck, H.; Skare, J.

    2009-01-01

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for K m and V max . In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  3. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm 2 ) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  4. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  5. Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

    Science.gov (United States)

    Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

    2012-05-01

    Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  6. Direct biological effects of fractional ultrapulsed CO2 laser irradiation on keratinocytes and fibroblasts in human organotypic full-thickness 3D skin models.

    Science.gov (United States)

    Schmitt, L; Huth, S; Amann, P M; Marquardt, Y; Heise, R; Fietkau, K; Huth, L; Steiner, T; Hölzle, F; Baron, J M

    2018-05-01

    Molecular effects of various ablative and non-ablative laser treatments on human skin cells-especially primary effects on epidermal keratinocytes and dermal fibroblasts-are not yet fully understood. We present the first study addressing molecular effects of fractional non-sequential ultrapulsed CO 2 laser treatment using a 3D skin model that allows standardized investigations of time-dependent molecular changes ex vivo. While histological examination was performed to assess morphological changes, we utilized gene expression profiling using microarray and qRT-PCR analyses to identify molecular effects of laser treatment. Irradiated models exhibited dose-dependent morphological changes resulting in an almost complete recovery of the epidermis 5 days after irradiation. On day 5 after laser injury with a laser fluence of 100 mJ/cm 2 , gene array analysis identified an upregulation of genes associated with tissue remodeling and wound healing (e.g., COL12A1 and FGF7), genes that are involved in the immune response (e.g., CXCL12 and CCL8) as well as members of the heat shock protein family (e.g., HSPB3). On the other hand, we detected a downregulation of matrix metalloproteinases (e.g., MMP3), differentiation markers (e.g., LOR and S100A7), and the pro-inflammatory cytokine IL1α.Overall, our findings substantiate the understanding of time-dependent molecular changes after CO 2 laser treatment. The utilized 3D skin model system proved to be a reliable, accurate, and reproducible tool to explore the effects of various laser settings both on skin morphology and gene expression during wound healing.

  7. Bathing in carbon dioxide-enriched water alters protein expression in keratinocytes of skin tissue in rats

    Science.gov (United States)

    Kälsch, Julia; Pott, Leona L.; Takeda, Atsushi; Kumamoto, Hideo; Möllmann, Dorothe; Canbay, Ali; Sitek, Barbara; Baba, Hideo A.

    2017-04-01

    Beneficial effects of balneotherapy using naturally occurring carbonated water (CO2 enriched) have been known since the Middle Ages. Although this therapy is clinically applied for peripheral artery disease and skin disorder, the underlying mechanisms are not fully elucidated.

  8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  9. A comparative study of spray keratinocytes and autologous meshed split-thickness skin graft in the treatment of acute burn injuries.

    Science.gov (United States)

    Sood, Rajiv; Roggy, David Edward; Zieger, Madeline Jane; Nazim, Muhammad; Hartman, Brett Colby; Gibbs, Jeff Thomas

    2015-02-01

    ReCell (Avita Medical, Northridge, CA) is an autologous cell harvesting (ACH) device that enables a thin split-thickness skin biopsy to be processed to produce a cell population that includes a mixed population of keratinocytes, melanocytes, Langerhans cells, and papillary dermal fibroblasts for immediate delivery via a spray applicator onto a prepared skin surface. In this Institutional Review Board-approved US Food and Drug Administration phase 2 study, the authors prospectively evaluated the treatment of partial-thickness burns in patients with two 320 cm2 areas, 1 area treated with the ACH device and the other with a meshed split-thickness skin graft (MSTSG) as a control. The authors compared the treatment areas for graft take, pigmentation, and color match to surrounding healthy tissue, scarring, and pain. In this preliminary study, 10 patients were treated with this protocol. Eight patients had 100% take to both treatment areas and 2 patients had significant non-take and graft loss attributable to underexcised wound beds and difficulty with the spray applicator. Pigmentation and color match ratings were identical at week 52 and the Modified Vancouver Scar Scale scores were comparable. One subject rated the autologous cell harvesting site as having a better appearance, while the remaining subjects rated their ACH and MSTSG sites' appearances as being comparable. In early follow-up visits, pain ratings were slightly elevated in the ACH group due to graft healing; however, in visits following week 2, pain ratings at the ACH and MSTSG sites were rated similarly by all patients. This preliminary report describes an early experience with the ACH device and the treatment of partial-thickness burn injuries. In this 10-patient series, patients benefitted from having a decreased donor site size and comparable outcomes with MSTSG treatment. While this preliminary underpowered study has provided positive results, there is a learning curve with choosing the proper wound

  10. Chromium III histidinate exposure modulates antioxidant gene expression in HaCaT human keratinocytes exposed to oxidative stress

    Science.gov (United States)

    While the toxicity of hexavalent chromium is well established, trivalent Cr (Cr(III)) is an essential nutrient involved in insulin and glucose homeostasis. Recently, antioxidant effects of chromium (III) histidinate (Cr(III)His) were reported in HaCaT human keratinocytes exposed to oxidative stress...

  11. Drug diffusion across skin with diffusivity spatially modulated

    Science.gov (United States)

    Montoya Arroyave, Isabel

    2014-05-01

    A diffusion and delivery model of a drug across the skin with diffusivity spatially modulated is formulated and solved analytically using computer algebra. The model is developed using one-dimensional diffusion equation with a diffusivity which is a function of position in the skin; with an initial condition which is describing that the drug is initially contained inside a therapeutic patch; with a boundary condition according to which the change in concentration in the patch is minimal, such that assumption of zero flux at the patch-skin interface is valid; and with other boundary condition according to which the microcirculation in the capillaries just below the dermis carries the drug molecules away from the site at a very fast rate, maintaining the inner concentration at 0. The model is solved analytically by the method of the Laplace transform, with Bromwich integral and residue theorem. The concentration profile of the drug in the skin is expressed as an infinite series of Bessel functions. The corresponding total amount of delivered drug is expressed as an infinite series of decreasing exponentials. Also, the corresponding effective time for the therapeutic patch is determined. All computations were performed using computer algebra software, specifically Maple. The analytical results obtained are important for understanding and improving currentapplications of therapeutic patches. For future research it is interesting to consider more general models of spatial modulation of the diffusivity and the possible application of other computer algebra software such as Mathematica and Maxima.

  12. Alkylglycerol Derivatives, a New Class of Skin Penetration Modulators

    Directory of Open Access Journals (Sweden)

    Sergio Alberto Bernal-Chávez

    2017-01-01

    Full Text Available The absorption modulating activity of two alkylglycerol derivatives (batyl and chimyl alcohol on skin barrier properties was evaluated. Biophysical tests such as transepidermal water loss (TEWL and attenuated total reflectance–Fourier transform infrared (ATR-FTIR spectroscopy, as well as in vitro skin permeation studies, were performed in order to determine the effect of these compounds as chemical absorption modulators. Four drugs were used as models: three NSAIDS (diclofenac, naproxen, and piroxicam and glycyrrhizic acid. The results showed that treatment of the skin with alkylglycerols caused (i a reduction on the amount of drug permeated; (ii a reduction in TEWL; and (iii changes in the ATR-FTIR peaks of stratum corneum lipids, indicative of a more ordered structure. All of these findings confirm that alkyl glycerols have an absorption retarding effect on the drugs tested. Such effects are expected to give rise to important applications in the pharmaceutical and cosmetic sectors, in cases where it is desirable for the drug to remain in the superficial layers of the skin to achieve a local effect.

  13. RhoA is dispensable for skin development, but crucial for contraction and directed migration of keratinocytes

    DEFF Research Database (Denmark)

    Jackson, Ben; Peyrollier, Karine; Pedersen, Esben

    2011-01-01

    RhoA is a small guanosine-5'-triphosphatase (GTPase) suggested to be essential for cytokinesis, stress fiber formation, and epithelial cell-cell contacts. In skin, loss of RhoA was suggested to underlie pemphigus skin blistering. To analyze RhoA function in vivo, we generated mice with a keratino......RhoA is a small guanosine-5'-triphosphatase (GTPase) suggested to be essential for cytokinesis, stress fiber formation, and epithelial cell-cell contacts. In skin, loss of RhoA was suggested to underlie pemphigus skin blistering. To analyze RhoA function in vivo, we generated mice......-cell contacts. Furthermore we observed increased cell spreading due to impaired RhoA-ROCK (Rho-associated protein kinase)-MLC phosphatase-MLC-mediated cell contraction, independent of Rac1. Rho-inhibiting toxins further increased multinucleation of RhoA-null cells but had no significant effect on spreading......, suggesting that RhoB and RhoC have partially overlapping functions with RhoA. Loss of RhoA decreased directed cell migration in vitro caused by reduced migration speed and directional persistence. These defects were not related to the decreased cell contraction and were independent of ROCK, as ROCK...

  14. Barrier abnormalities and keratinocyte-derived cytokine cascade after cessation of long-term topical glucocorticosteroid on hairless mouse skin

    Directory of Open Access Journals (Sweden)

    Tzu-Kai Lin

    2015-06-01

    Conclusion: An epidermis-derived cytokine cascade was observed following TCS-induced barrier disruption, which is similar to that from permeability barrier insults by acetone or tape stripping. The study suggests that concurrent application of skin care products during TCS treatment improves barrier homeostasis, and should become a standard practice to alleviate TCS-induced WD.

  15. Modulation of mitochondrial activity in HaCaT keratinocytes by the cell penetrating peptide Z-Gly-RGD(DPhe)-mitoparan.

    Science.gov (United States)

    Richardson, Adam; Muir, Lewis; Mousdell, Sasha; Sexton, Darren; Jones, Sarah; Howl, John; Ross, Kehinde

    2018-01-30

    Biologically active cell penetrating peptides (CPPs) are an emerging class of therapeutic agent. The wasp venom peptide mastoparan is an established CPP that modulates mitochondrial activity and triggers caspase-dependent apoptosis in cancer cells, as does the mastoparan analogue mitoparan (mitP). Mitochondrial depolarisation and activation of the caspase cascade also underpins the action of dithranol, a topical agent for treatment of psoriasis. The effects of a potent mitP analogue on mitochondrial activity were therefore examined to assess its potential as a novel approach for targeting mitochondria for the treatment of psoriasis. In HaCaT keratinocytes treated with the mitP analogue Z-Gly-RGD(DPhe)-mitP for 24 h, a dose-dependent loss of mitochondrial activity was observed using the methyl-thiazolyl-tetrazolium (MTT) assay. At 10 μmol L -1 , MTT activity was less than 30% that observed in untreated cells. Staining with the cationic dye JC-1 suggested that Z-Gly-RGD(DPhe)-mitP also dissipated the mitochondrial membrane potential, with a threefold increase in mitochondrial depolarisation levels. However, caspase activity appeared to be reduced by 24 h exposure to Z-Gly-RGD(DPhe)-mitP treatment. Furthermore, Z-Gly-RGD(DPhe)-mitP treatment had little effect on overall cell viability. Our findings suggest Z-Gly-RGD(DPhe)-mitP promotes the loss of mitochondrial activity but does not appear to evoke apoptosis in HaCaT keratinocytes.

  16. Treatment of burn injuries with keratinocyte cultures

    International Nuclear Information System (INIS)

    Syring, C.; Maenig, H.J.; Von Versen, R.; Bruck, J.

    1999-01-01

    The German Institute for Cell and Tissue Replacement (DIZG) provides burned patients with skin and amnion for a temporary wound closure. Severely burned patients (>60% BSA for adults, >40% BSA for children) were supplied with autologous and allogenic grafts from cultured keratinocytes. The keratinocyte culture is done under GMP-conditions using the method of Rheinwald and Green. The 3T3 fibroblasts were irradiated with 60 Gy and used as feeder cells to produce keratinocyte sheets within 3 weeks. In this time up to 6.000 cm are available. The sheets were harvested by detachment with dispase (1,2 U/ml), fixed to gauze and transported to the hospital. The DIZG has a 3 years experience in the treatment of burns with keratinocyte sheets. The sheets were transplanted to patients in different hospitals, the total transplanted area is about 30.000 cm. This paper describes the experiences with ten severely burned patients treated with keratinocyte sheet

  17. Modulation of accelerated repopulation in mouse skin during daily irradiation

    International Nuclear Information System (INIS)

    Trott, K.-R.; Shirazi, A.; Heasman, F.

    1999-01-01

    Background and purpose: The timing of acceleration of repopulation in the epidermis during daily irradiation is related to the development of skin erythema and epidermal hypoplasia. Therefore, the relationship between impairment of the epidermal barrier function, the dermal inflammatory response and epidermal hypoplasia with the acceleration of repopulation was investigated.Materials and purpose: Skin fields of approximately 1 cm 2 on the thighs of TUC mice were given five daily fractions of 3 Gy in each week followed by top-up doses at the end of the first, the second, or the third week to determine residual epidermal tolerance and to calculate repopulation rates in weeks 1, 2, or 3. Systemic modulation of repopulation was attempted by daily indomethacine during fractionated irradiation whereas tape stripping or UV-B exposure before the start of fractionated irradiation attempted local modulation. In parallel experiments, the water permeability coefficient of the epidermis was determined ex vivo by studying transepidermal transport of tritiated water.Results: Without modulation, no repopulation was found in the first week of daily fractionation but repopulation compensated 30% of the dose given in week two and 70% of the dose given in week three. Only tape stripping before the start of fractionated irradiation accelerated repopulation in week one. UV-B had no effect on repopulation although it stimulated proliferation as much as tape stripping. Indomethacin did not suppress acceleration of repopulation. A significant increase in transepidermal water loss was found but only after repopulation had already accelerated.Conclusions: Acceleration of repopulation in mouse epidermis during daily-fractionated irradiation is not related to the simultaneous development of an inflammatory response. Also, the loss of the epidermal barrier function is not involved in the development of the acceleration response, which rather seems to be triggered directly by the decreased

  18. Modulation of gene expression as a new skin anti-aging strategy.

    Science.gov (United States)

    Talbourdet, Sylvie; Sadick, Neil S; Lazou, Kristell; Bonnet-Duquennoy, Mathilde; Kurfurst, Robin; Neveu, Michele; Heusèle, Catherine; André, Patrice; Schnebert, Sylvianne; Draelos, Zoe D; Perrier, Eric

    2007-06-01

    [corrected] The signs of aging may originate from natural processes or from exposure to the sun, wind, or other environmental factors. To evaluate the anti-aging effects of potential agents researchers must first identify and be able to quantify epidermal markers that change with aging. This paper summarizes the results of studies conducted to evaluate the transcriptional effects of an Aframomum angustifolium seed extract and Malva Sylvestris extract, and the antiaging efficacy of a skin care product containing the Aframomum angustifolium seed extract. The transcriptional effect of an Aframomum angustifolium seed extract on normal human keratinocytes (NHKs) and normal human fibroblasts (NHF) was evaluated in vitro with the use of a low-density DNA array technology. The Malva Sylvestris extract was studied with a commercial DNA macroarray and by a real-time quantitative reverse transcriptase-polymerase chain reaction. The in vitro anti-aging activities of the Malva sylvestris extract were compared with those of all-trans retinoic acid (RA), a well-established topical therapy for photodamage and wrinkles. The genes studied were known to be modified by RA. The anti-aging efficacy of a facial skin care product containing Aframomum angustifolium seed extract was evaluated in a single-center study using image processing analysis and in a 2-center study by evaluation of the photographs by the investigator, independent evaluators, and subjects. In general, the Aframomum angustifolium seed extract strongly modified the gene expression profiles of NHKs and weakly modified the gene expression profiles of NHFs. After incubation with Aframomum angustifolium seed extract, the expressions of 3 antioxidant genes (metallothionein 1, metallothionein 2, and thioredoxin) were increased in NHKs, while expressions of 1 antioxidant gene (glutathione peroxidase) was increased in NHFs. Concerning the Malva sylvestris extract, a cDNA macro-array technology experiment with the reconstructed

  19. Upregulation of cathepsin S in psoriatic keratinocytes.

    Science.gov (United States)

    Schönefuss, Alexander; Wendt, Wiebke; Schattling, Benjamin; Schulten, Roxane; Hoffmann, Klaus; Stuecker, Markus; Tigges, Christian; Lübbert, Hermann; Stichel, Christine

    2010-08-01

    Cathepsin S (CATS) is a cysteine protease, well known for its role in MHC class II-mediated antigen presentation and extracellular matrix degradation. Disturbance of the expression or metabolism of this protease is a concomitant feature of several diseases. Given this importance we studied the localization and regulation of CATS expression in normal and pathological human/mouse skin. In normal human skin CATS-immunostaining is mainly present in the dermis and is localized in macrophages, Langerhans, T- and endothelial cells, but absent in keratinocytes. In all analyzed pathological skin biopsies, i.e. atopic dermatitis, actinic keratosis and psoriasis, CATS staining is strongly increased in the dermis. But only in psoriasis, CATS-immunostaining is also detectable in keratinocytes. We show that cocultivation with T-cells as well as treatment with cytokines can trigger expression and secretion of CATS, which is involved in MHC II processing in keratinocytes. Our data provide first evidence that CATS expression (i) is selectively induced in psoriatic keratinocytes, (ii) is triggered by T-cells and (iii) might be involved in keratinocytic MHC class II expression, the processing of the MHC class II-associated invariant chain and remodeling of the extracellular matrix. This paper expands our knowledge on the important role of keratinocytes in dermatological disease.

  20. The human keratinocyte two-dimensional protein database (update 1994): towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Olsen, E

    1994-01-01

    The master two-dimensional (2-D) gel database of human keratinocytes currently lists 3087 cellular proteins (2168 isoelectric focusing, IEF; and 919 none-quilibrium pH gradient electrophoresis, NEPHGE), many of which correspond to posttranslational modifications, 890 polypeptides have been...... in the database. We also report a database of proteins recovered from the medium of noncultured, unfractionated keratinocytes. This database lists 398 polypeptides (309 IEF; 89 NEPHGE) of which 76 have been identified. The aim of the comprehensive databases is to gather, through a systematic study...

  1. Concentration-dependent effect of platelet-rich plasma on keratinocyte and fibroblast wound healing.

    Science.gov (United States)

    Xian, Law Jia; Chowdhury, Shiplu Roy; Bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

    2015-03-01

    Platelet-rich plasma (PRP) has been found to contain a high concentration of growth factors that are present during the process of healing. Studies conducted found that application of PRP accelerates wound healing. In this study, we characterized the skin cell suspension harvested using the co-isolation technique and evaluated the effects of PRP (10% and 20%, v/v) on co-cultured keratinocytes and fibroblasts in terms of wound healing. Human keratinocytes and fibroblasts were harvested via co-isolation technique and separated via differential trypsinization. These cells were then indirectly co-cultured in medium supplemented with 10% or 20% PRP for 3 days without medium change for analysis of wound-healing potential. The wound-healing potential of keratinocytes and fibroblasts was evaluated in terms of growth property, migratory property, extracellular matrix gene expression and soluble factor secretion. The co-isolation technique yielded a skin cell population dominated by fibroblasts and keratinocytes, with a small amount of melanocytes. Comparison between the 10% and 20% PRP cultures showed that the 10% PRP culture exhibited higher keratinocyte apparent specific growth rate, and secretion of hepatocyte growth factor, monocyte chemoattractant protein-1, epithelial-derived neutrophil-activating protein 78 and vascular endothelial growth factor A, whereas the 20% PRP culture has significantly higher collagen type 1 and collagen type 3 expressions and produced more granulocyte-macrophage colony-stimulating factor. PRP concentration modulates keratinocyte and fibroblast wound healing potential, whereby the 10% PRP promotes wound remodeling, whereas the 20% PRP enhances inflammation and collagen deposition. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  2. Y chromosome and vimentin used to trace the fate of allogeneic keratinocytes delivered to the wound by the recombined human/pig skin

    Czech Academy of Sciences Publication Activity Database

    Pokorná, Eva; Brož, L.; Veselý, Pavel; Matoušková, Eva

    2001-01-01

    Roč. 47, č. 4 (2001), s. 128-134 ISSN 0015-5500 R&D Projects: GA MZd IZ4368; GA MZd NK6126 Keywords : allogeneic keratinocytes * xenodermis * Y-chromosome FISH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.519, year: 2001

  3. A novel DLX3-PKC integrated signaling network drives keratinocyte differentiation.

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-Wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-04-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  4. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    National Research Council Canada - National Science Library

    McCormack-Brown, Stephanie

    2008-01-01

    .... There is no published data on AL NP toxicity effects on human skin. This research used in vitro techniques to determine the cytotoxicity of AL NPs, sized 50, 80, and 120 nm, on human keratinocytes...

  5. Interaction of Mycobacterium leprae with the HaCaT human keratinocyte cell line: new frontiers in the cellular immunology of leprosy.

    Science.gov (United States)

    Lyrio, Eloah C D; Campos-Souza, Ivy C; Corrêa, Luiz C D; Lechuga, Guilherme C; Verícimo, Maurício; Castro, Helena C; Bourguignon, Saulo C; Côrte-Real, Suzana; Ratcliffe, Norman; Declercq, Wim; Santos, Dilvani O

    2015-07-01

    Leprosy is a chronic granulomatous disease caused by Mycobacterium leprae affecting the skin and peripheral nerves. Despite M. leprae invasion of the skin and keratinocytes importance in innate immunity, the interaction of these cells in vitro during M. leprae infection is poorly understood. Conventional and fluorescence optical microscopy, transmission electronic microscopy, flow cytometry and ELISA were used to study the in vitro interaction of M. leprae with the HaCaT human keratinocyte cell line. Keratinocytes uptake of M. leprae is described, and modulation of the surface expression of CD80 and CD209, cathelicidin expression and TNF-α and IL-1β production of human keratinocytes are compared with dendritic cells and macrophages during M. leprae interaction. This study demonstrated that M. leprae interaction with human keratinocytes enhanced expression of cathelicidin and greatly increased TNF-α production. The highest spontaneous expression of cathelicidin was by dendritic cells which are less susceptible to M. leprae infection. In contrast, keratinocytes displayed low spontaneous cathelicidin expression and were more susceptible to M. leprae infection than dendritic cells. The results show, for the first time, an active role for keratinocytes during infection by irradiated whole cells of M. leprae and the effect of vitamin D on this process. They also suggest that therapies which target cathelicidin modulation may provide novel approaches for treatment of leprosy. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Shining a Light on Black Holes in Keratinocytes.

    Science.gov (United States)

    Bowman, Shanna L; Marks, Michael S

    2018-03-01

    The mechanisms by which melanins are transferred from melanocytes and stored within keratinocytes to generate skin pigmentation are hotly debated. Correia et al. and Hurbain et al. provide evidence that melanin cores of melanosomes are secreted from melanocytes and taken up and stored within non-degradative membranous organelles in keratinocytes in the basal epidermis of human skin. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  7. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  8. CDH1 regulates E2F1 degradation in response to differentiation signals in keratinocytes.

    Science.gov (United States)

    Singh, Randeep K; Dagnino, Lina

    2017-01-17

    The E2F1 transcription factor plays key roles in skin homeostasis. In the epidermis, E2F1 expression is essential for normal proliferation of undifferentiated keratinocytes, regeneration after injury and DNA repair following UV radiation-induced photodamage. Abnormal E2F1 expression promotes nonmelanoma skin carcinoma. In addition, E2F1 must be downregulated for proper keratinocyte differentiation, but the relevant mechanisms involved remain poorly understood. We show that differentiation signals induce a series of post-translational modifications in E2F1 that are jointly required for its downregulation. Analysis of the structural determinants that govern these processes revealed a central role for S403 and T433. In particular, substitution of these two amino acid residues with non-phosphorylatable alanine (E2F1 ST/A) interferes with E2F1 nuclear export, K11- and K48-linked polyubiquitylation and degradation in differentiated keratinocytes. In contrast, replacement of S403 and T433 with phosphomimetic aspartic acid to generate a pseudophosphorylated E2F1 mutant protein (E2F1 ST/D) generates a protein that is regulated in a manner indistinguishable from that of wild type E2F1. Cdh1 is an activating cofactor that interacts with the anaphase-promoting complex/cyclosome (APC/C) ubiquitin E3 ligase, promoting proteasomal degradation of various substrates. We found that Cdh1 associates with E2F1 in keratinocytes. Inhibition or RNAi-mediated silencing of Cdh1 prevents E2F1 degradation in response to differentiation signals. Our results reveal novel regulatory mechanisms that jointly modulate post-translational modifications and downregulation of E2F1, which are necessary for proper epidermal keratinocyte differentiation.

  9. In vivo relative quantitative proteomics reveals HMGB1 as a downstream mediator of oestrogen-stimulated keratinocyte migration.

    Science.gov (United States)

    Shin, Jung U; Noh, Ji Yeon; Lee, Ju Hee; Lee, Won Jai; Yoo, Jong Shin; Kim, Jin Young; Kim, Hyeran; Jung, Inhee; Jin, Shan; Lee, Kwang Hoon

    2015-06-01

    It is known that oestrogen influences skin wound healing by modulating the inflammatory response, cytokine expression and extracellular matrix deposition; accelerating re-epithelialization; and stimulating angiogenesis. To identify novel proteins associated with effects of oestrogen on keratinocyte, stable isotope labelling by amino acids in cell culture (SILAC)-based mass spectrometry was performed. Using SILAC, quantification of 1085 proteins was achieved. Among these proteins, 60 proteins were upregulated and 32 proteins were downregulated. Among significantly upregulated proteins, high-mobility group protein B1 (HMGB1) has been further evaluated for its role in the effect of oestrogen on keratinocytes. HMGB1 expression was strongly induced in oestrogen-treated keratinocytes in dose- and time-dependent manner. Further, HMGB1 was able to significantly accelerate the rate of HaCaT cell migration. To determine whether HMGB1 is involved in E2-induced HaCaT cell migration, cells were transfected with HMGB1 siRNA. Knockdown of HMGB1 blocked oestrogen-induced keratinocyte migration. Collectively, these experiments demonstrate that HMGB1 is a novel downstream mediator of oestrogen-stimulated keratinocyte migration. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Novel 11β-hydroxysteroid dehydrogenase 1 inhibitors reduce cortisol levels in keratinocytes and improve dermal collagen content in human ex vivo skin after exposure to cortisone and UV.

    Directory of Open Access Journals (Sweden)

    Stéphanie M Boudon

    Full Text Available Activity and selectivity assessment of new bi-aryl amide 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1 inhibitors, prepared in a modular manner via Suzuki cross-coupling, are described. Several compounds inhibiting 11β-HSD1 at nanomolar concentrations were identified. Compounds 2b, 3e, 7b and 12e were shown to selectively inhibit 11β-HSD1 over 11β-HSD2, 17β-HSD1 and 17β-HSD2. These inhibitors also potently inhibited 11β-HSD1 activity in intact HEK-293 cells expressing the recombinant enzyme and in intact primary human keratinocytes expressing endogenous 11β-HSD1. Moreover, compounds 2b, 3e and 12e were tested for their activity in human skin biopsies. They were able to prevent, at least in part, both the cortisone- and the UV-mediated decreases in collagen content. Thus, inhibition of 11β-HSD1 by these compounds can be further investigated to delay or prevent UV-mediated skin damage and skin aging.

  11. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  12. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  13. Modulation of interferon-gamma-induced HLA-DR expression on the human keratinocyte cell line SCC-13 by ultraviolet radiation

    International Nuclear Information System (INIS)

    Khan, I.U.; Boehm, K.D.; Elmets, C.A.

    1993-01-01

    Cell surface expression of major histocompatibility determinants on epidermal keratinocytes is a characteristic feature of a number of inflammatory dermatoses and in all likelihood is caused by diffusion of human leukocyte antigen (HLA)-DR-inducing cytokines from cells present in the dermal mononuclear cell infiltrate. Many of these same disorders respond to ultraviolet (UV) radiation phototherapy. Using the human SCC-13 keratinocyte cell line as a model, UV radiation was found to inhibit interferon-gamma-induced HLA-DR expression. Inhibition correlated closely with decreased steady-state levels of HLA-DR mRNA. These findings provide evidence that the therapeutic effect of UV radiation phototherapy may be mediated by its capacity to down-regulate cytokine-induced keratinocyte HLA-DR expression. (Author)

  14. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    International Nuclear Information System (INIS)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-01-01

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  15. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  16. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  17. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  18. Green tea polyphenols provide photoprotection, increase microcirculation, and modulate skin properties of women.

    Science.gov (United States)

    Heinrich, Ulrike; Moore, Carolyn E; De Spirt, Silke; Tronnier, Hagen; Stahl, Wilhelm

    2011-06-01

    Dietary constituents including polyphenols and carotenoids contribute to endogenous photoprotection and modulate skin characteristics related to structure and function of the tissue. Animal and in-vitro studies indicate that green tea polyphenols affect skin properties. In a 12-wk, double-blind, placebo-controlled study, 60 female volunteers were randomized to an intervention or control group. Participants consumed either a beverage with green tea polyphenols providing 1402 mg total catechins/d or a control beverage. Skin photoprotection, structure, and function were measured at baseline (wk 0), wk 6, and wk 12. Following exposure of the skin areas to 1.25 minimal erythemal dose of radiation from a solar simulator, UV-induced erythema decreased significantly in the intervention group by 16 and 25% after 6 and 12 wk, respectively. Skin structural characteristics that were positively affected included elasticity, roughness, scaling, density, and water homeostasis. Intake of the green tea polyphenol beverage for 12 wk increased blood flow and oxygen delivery to the skin. Likewise, in a separate, randomized, double-blind, single-dose (0.5, 1.0, and 2.0 g) study of green tea polyphenols, blood flow was maximized at 30 min after ingestion. In summary, green tea polyphenols delivered in a beverage were shown to protect skin against harmful UV radiation and helped to improve overall skin quality of women.

  19. Vibro-Acoustic modulation based damage identification in a composite skin-stiffener structure

    NARCIS (Netherlands)

    Ooijevaar, T.H.; Loendersloot, Richard; Rogge, M.D.; Akkerman, Remko; Tinga, Tiedo; Le Cam, V.; Mevel, L.; Schoefs, F.

    2014-01-01

    The vibro-acoustic modulation method is applied to a composite skin-stiffener structure to investigate the possibilities to utilise this method for damage identification in terms of detection, localisation and damage quantification. The research comprises a theoretical part and an experimental part.

  20. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

    Science.gov (United States)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  2. UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes

    Science.gov (United States)

    Kraemer, Anne; Chen, I-Peng; Henning, Stefan; Faust, Alexandra; Volkmer, Beate; Atkinson, Michael J.; Moertl, Simone; Greinert, Ruediger

    2013-01-01

    MicroRNA (miRNA)-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2), which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis. PMID:24391759

  3. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA......-FABP as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... with epidermal growth factor (EGF), pituitary extract, and 10% fetal calf serum] revealed a strong up-regulation of PA-FABP, psoriasin, calgranulins A and B, and a few other proteins that are highly expressed in psoriatic skin. The levels of these proteins exceeded by far those observed in non-cultured normal...

  4. The herpes simplex virus-induced demise of keratinocytes is associated with a dysregulated pattern of p63 expression.

    Science.gov (United States)

    Megyeri, Klára; Orosz, László; Kormos, Bernadett; Pásztor, Katalin; Seprényi, György; Ocsovszki, Imre; Mándi, Yvette; Bata-Csörgo, Zsuzsanna; Kemény, Lajos

    2009-01-01

    p63 plays a pivotal role in the development and maintenance of stratified epithelial tissues. In an effort to gain insight into the pathogenic mechanisms of skin infections caused by HSV-1 and HSV-2, we determined the patterns of p63 expression in primary keratinocytes and in the HaCaT cell line. The levels of DeltaNp63alpha and a 50kDa p73 isoform were decreased, Bax-alpha remained unaffected, while the expressions of the Bax-beta, TAp63gamma and a 44.5kDa p73 isoform were highly increased in both HSV-1-infected HaCaT cells and primary keratinocytes. In contrast, in response to HSV-2 infection the levels of DeltaNp63alpha, a 50kDa p73 isoform and a 44.5kDa p73 protein were decreased, Bax-alpha and TAp63gamma remained unaffected, while the expression of Bax-beta was slightly increased. The knockdown of TAp63 expression enhanced the viability of HSV-1-infected cells. Thus, HSV-1 and HSV-2 modulate the patterns of p63 and Bax expression in a serotype-specific manner. The dysregulated pattern of p63 expression observed in HSV-infected keratinocytes may comprise part of a mechanism by which these viruses perturb the functions of keratinocytes and lead to their demise.

  5. RAC1 in keratinocytes regulates crosstalk to immune cells by Arp2/3-dependent control of STAT1

    DEFF Research Database (Denmark)

    Pedersen, Esben Ditlev Kølle; Wang, Zhipeng; Stanley, Alanna

    2012-01-01

    Crosstalk between keratinocytes and immune cells is crucial for the immunological barrier function of the skin, and aberrant crosstalk contributes to inflammatory skin diseases. Using mice with a keratinocyte-restricted deletion of the RAC1 gene we found that RAC1 in keratinocytes plays...... hypersensitive to inflammatory stimuli both in vitro and in vivo, suggesting a major role for RAC1 in regulating the crosstalk between the epidermis and the immune system....

  6. Integrin β4 Regulates Migratory Behavior of Keratinocytes by Determining Laminin-332 Organization*s

    Science.gov (United States)

    Sehgal, Bernd U.; DeBiase, Phillip J.; Matzno, Sumio; Chew, Teng-Leong; Claiborne, Jessica N.; Hopkinson, Susan B.; Russell, Alan; Marinkovich, M. Peter; Jones, Jonathan C. R.

    2010-01-01

    Whether α6β4 integrin regulates migration remains controversial. β4 integrin-deficient (JEB) keratinocytes display aberrant migration in that they move in circles, a behavior that mirrors the circular arrays of laminin (LM)-332 in their matrix. In contrast, wild-type keratinocytes and JEB keratinocytes, induced to express β4 integrin, assemble laminin-332 in linear tracks over which they migrate. Moreover, laminin-332-dependent migration of JEB keratinocytes along linear tracks is restored when cells are plated on wild-type keratinocyte matrix, whereas wild-type keratinocytes show rotation over circular arrays of laminn-332 in JEB keratinocyte matrix. The activities of Rac1 and the actin cytoskeleton-severing protein cofilin are low in JEB keratinocytes compared with wild-type cells but are rescued following expression of wild-type β4 integrin in JEB cells. Additionally, in wild-type keratinocytes Rac1 is complexed with α6β4 integrin. Moreover, Rac1 or cofilin inactivation induces wild-type keratinocytes to move in circles over rings of laminin-332 in their matrix. Together these data indicate that laminin-332 matrix organization is determined by the α6β4 integrin/actin cytoskeleton via Rac1/cofilin signaling. Furthermore, our results imply that the organizational state of laminin-332 is a key determinant of the motility behavior of keratinocytes, an essential element of skin wound healing and the successful invasion of epidermal-derived tumor cells. PMID:16973601

  7. A novel DLX3–PKC integrated signaling network drives keratinocyte differentiation

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-01-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  8. Design and Characterization of a Human Monoclonal Antibody that Modulates Mutant Connexin 26 Hemichannels Implicated in Deafness and Skin Disorders

    Directory of Open Access Journals (Sweden)

    Liang Xu

    2017-09-01

    Full Text Available Background: Mutations leading to changes in properties, regulation, or expression of connexin-made channels have been implicated in 28 distinct human hereditary diseases. Eight of these result from variants of connexin 26 (Cx26, a protein critically involved in cell-cell signaling in the inner ear and skin. Lack of non-toxic drugs with defined mechanisms of action poses a serious obstacle to therapeutic interventions for diseases caused by mutant connexins. In particular, molecules that specifically modulate connexin hemichannel function without affecting gap junction channels are considered of primary importance for the study of connexin hemichannel role in physiological as well as pathological conditions. Monoclonal antibodies developed in the last three decades have become the most important class of therapeutic biologicals. Recombinant methods permit rapid selection and improvement of monoclonal antibodies from libraries with large diversity.Methods: By screening a combinatorial library of human single-chain fragment variable (scFv antibodies expressed in phage, we identified a candidate that binds an extracellular epitope of Cx26. We characterized antibody action using a variety of biochemical and biophysical assays in HeLa cells, organotypic cultures of mouse cochlea and human keratinocyte-derived cells.Results: We determined that the antibody is a remarkably efficient, non-toxic, and completely reversible inhibitor of hemichannels formed by connexin 26 and does not affect direct cell-cell communication via gap junction channels. Importantly, we also demonstrate that the antibody efficiently inhibits hyperative mutant Cx26 hemichannels implicated in autosomal dominant non-syndromic hearing impairment accompanied by keratitis and hystrix-like ichthyosis-deafness (KID/HID syndrome. We solved the crystal structure of the antibody, identified residues that are critical for binding and used molecular dynamics to uncover its mechanism of action

  9. Mitogen activated protein kinases selectively regulate palytoxin-stimulated gene expression in mouse keratinocytes

    International Nuclear Information System (INIS)

    Zeliadt, Nicholette A.; Warmka, Janel K.; Wattenberg, Elizabeth V.

    2003-01-01

    We have been investigating how the novel skin tumor promoter palytoxin transmits signals through mitogen activated protein kinases (MAPKs). Palytoxin activates three major MAPKs, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, in a keratinocyte cell line derived from initiated mouse skin (308). We previously showed that palytoxin requires ERK to increase matrix metalloproteinase-13 (MMP-13) gene expression, an enzyme implicated in carcinogenesis. Diverse stimuli require JNK and p38 to increase MMP-13 gene expression, however. We therefore used the JNK and p38 inhibitors SP 600125 and SB 202190, respectively, to investigate the role of these MAPKs in palytoxin-induced MMP-13 gene expression. Surprisingly, palytoxin does not require JNK and p38 to increase MMP-13 gene expression. Accordingly, ERK activation, independent of palytoxin and in the absence of JNK and p38 activation, is sufficient to induce MMP-13 gene expression in 308 keratinocytes. Dexamethasone, a synthetic glucocorticoid that inhibits activator protein-1 (AP-1), blocked palytoxin-stimulated MMP-13 gene expression. Therefore, the AP-1 site present in the promoter of the MMP-13 gene appears to be functional and to play a key role in palytoxin-stimulated gene expression. Previous studies showed that palytoxin simulates an ERK-dependent selective increase in the c-Fos content of AP-1 complexes that bind to the promoter of the MMP-13 gene. JNK and p38 can also modulate c-Fos. Palytoxin does not require JNK or p38 to increase c-Fos binding, however. Altogether, these studies indicate that ERK plays a distinctly essential role in transmitting palytoxin-stimulated signals to specific nuclear targets in keratinocytes derived from initiated mouse skin

  10. Controlled delivery of ropinirole hydrochloride through skin using modulated iontophoresis and microneedles.

    Science.gov (United States)

    Singh, Neha D; Banga, Ajay K

    2013-05-01

    The objective of this study was to investigate the effect of modulated current application using iontophoresis- and microneedle-mediated delivery on transdermal permeation of ropinirole hydrochloride. AdminPatch® microneedles and microchannels formed by them were characterized by scanning electron microscopy, dye staining and confocal microscopy. In vitro permeation studies were carried out using Franz diffusion cells, and skin extraction was used to quantify drug in underlying skin. Effect of microneedle pore density and ions in donor formulation was studied. Active enhancement techniques, continuous iontophoresis (74.13 ± 2.20 µg/cm(2)) and microneedles (66.97 ± 10.39 µg/cm(2)), significantly increased the permeation of drug with respect to passive delivery (8.25 ± 2.41 µg/cm(2)). Modulated iontophoresis could control the amount of drug delivered at a given time point with the highest flux being 5.12 ± 1.70 µg/cm(2)/h (5-7 h) and 5.99 ± 0.81 µg/cm(2)/h (20-22 h). Combination of modulated iontophoresis and microneedles (46.50 ± 6.46 µg/cm(2)) showed significantly higher delivery of ropinirole hydrochloride compared to modulated iontophoresis alone (84.91 ± 9.21 µg/cm(2)). Modulated iontophoresis can help in maintaining precise control over ropinirole hydrochloride delivery for dose titration in Parkinson's disease therapy and deliver therapeutic amounts over a suitable patch area and time.

  11. Chemosensory Information Processing between Keratinocytes and Trigeminal Neurons

    Science.gov (United States)

    Sondersorg, Anna Christina; Busse, Daniela; Kyereme, Jessica; Rothermel, Markus; Neufang, Gitta; Gisselmann, Günter; Hatt, Hanns; Conrad, Heike

    2014-01-01

    Trigeminal fibers terminate within the facial mucosa and skin and transmit tactile, proprioceptive, chemical, and nociceptive sensations. Trigeminal sensations can arise from the direct stimulation of intraepithelial free nerve endings or indirectly through information transmission from adjacent cells at the peripheral innervation area. For mechanical and thermal cues, communication processes between skin cells and somatosensory neurons have already been suggested. High concentrations of most odors typically provoke trigeminal sensations in vivo but surprisingly fail to activate trigeminal neuron monocultures. This fact favors the hypothesis that epithelial cells may participate in chemodetection and subsequently transmit signals to neighboring trigeminal fibers. Keratinocytes, the major cell type of the epidermis, express various receptors that enable reactions to multiple environmental stimuli. Here, using a co-culture approach, we show for the first time that exposure to the odorant chemicals induces a chemical communication between human HaCaT keratinocytes and mouse trigeminal neurons. Moreover, a supernatant analysis of stimulated keratinocytes and subsequent blocking experiments with pyrodoxalphosphate-6-azophenyl-2′,4′-disulfonate revealed that ATP serves as the mediating transmitter molecule released from skin cells after odor stimulation. We show that the ATP release resulting from Javanol® stimulation of keratinocytes was mediated by pannexins. Consequently, keratinocytes act as chemosensors linking the environment and the trigeminal system via ATP signaling. PMID:24790106

  12. Temperature modulation of the visible and near infrared absorption and scattering coefficients of human skin.

    Science.gov (United States)

    Khalil, Omar S; Yeh, Shu-Jen; Lowery, Michael G; Wu, Xiaomao; Hanna, Charles F; Kantor, Stanislaw; Jeng, Tzyy-Wen; Kanger, Johannes S; Bolt, Rene A; de Mul, Frits F

    2003-04-01

    We determine temperature effect on the absorption and reduced scattering coefficients (mu(a) and mu(s)(')) of human forearm skin. Optical and thermal simulation data suggest that mu( a) and mu(s)(') are determined within a temperature-controlled depth of approximately 2 mm. Cutaneous mu(s)(') change linearly with temperature. Change in mu(a) was complex and irreversible above body normal temperatures. Light penetration depth (delta) in skin increased on cooling, with considerable person-to-person variations. We attribute the effect of temperature on mu(s)(') to change in refractive index mismatch, and its effect on mu(a) to perfusion changes. The reversible temperature effect on mu (s)(' ) was maintained during more than 90 min. contact between skin and the measuring probe, where temperature was modulated between 38 and 22 degrees C for multiple cycles While temperature modulated mu(s)(' ) instantaneously and reversibly, mu(a) exhibited slower response time and consistent drift. There was a statistically significant upward drift in mu(a) and a mostly downward drift in mu( s)(') over the contact period. The drift in temperature-induced fractional change in mu(s)(') was less statistically significant than the drift in mu(s)('). Deltamu( s)(') values determined under temperature modulation conditions may have less nonspecific drift than mu(s)(') which may have significance for noninvasive determination of analytes in human tissue.

  13. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  14. Differentiation and injury-repair signals modulate the interaction of E2F and pRB proteins with novel target genes in keratinocytes.

    Science.gov (United States)

    Chang, Wing Y; Andrews, Joseph; Carter, David E; Dagnino, Lina

    2006-08-01

    E2F transcription factors are central to epidermal morphogenesis and regeneration after injury. The precise nature of E2F target genes involved in epidermal formation and repair has yet to be determined. Identification of these genes is essential to understand how E2F proteins regulate fundamental aspects of epidermal homeostasis and transformation. We have conducted a genome-wide screen using CpG island microarray analysis to identify novel promoters bound by E2F3 and E2F5 in human keratinocytes. We further characterized several of these genes, and determined that multiple E2F and retinoblastoma (pRb) family proteins associate with them in exponentially proliferating cells. We also assessed the effect on E2F and pRb binding to those genes in response to differentiation induced by bone morphogenetic protein-6 (BMP-6), or to activation of repair mechanisms induced by transforming growth factor-beta (TGF-beta). These studies demonstrate promoter- and cytokine-specific changes in binding profiles of E2F and/or pRb family proteins. For example, E2F1, 3, 4 and p107 were recruited to the N-myc promoter in cells treated with BMP-6, whereas E2F1, 3, 4, 5, p107 and p130 were bound to this promoter in the presence of TGF-beta. Functionally, these different interactions resulted in transcriptional repression by BMP-6 and TGF-beta of the N-myc gene, via mechanisms that involved E2F binding to the promoter and association with pRb-family proteins. Thus, multiple combinations of E2F and pRb family proteins may associate with and transcriptionally regulate a given target promoter in response to differentiation and injury-repair stimuli in epidermal keratinocytes.

  15. Prevention of burn wound conversion by allogeneic keratinocytes cultured on acellular xenodermis

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Brož, L.; Pokorná, Eva; Königová, R.

    2002-01-01

    Roč. 3, č. 1 (2002), s. 29-35 ISSN 1389-9333 Institutional research plan: CEZ:AV0Z5052915 Keywords : human keratinocytes * tissue engineered skin * dried porcine dermis Subject RIV: EB - Genetics ; Molecular Biology

  16. Multifractional microablative laser combined with spacially modulated ablative (SMA) technology for facial skin rejuvenation.

    Science.gov (United States)

    Hersant, Barbara; SidAhmed-Mezi, Mounia; Chossat, Adrien; Meningaud, Jean Paul

    2017-01-01

    Due to the increasing demand for aesthetic procedures, especially facial aesthetic surgery, a new laser technology has been developed for facial skin rejuvenation and wrinkle treatment. The aim of this study was to objectively and subjectively assess the clinical efficacy and safety of Erbium:YAG laser combined with Spatially Modulated Ablation (Er:YAG + SMA) on facial skin rejuvenation. Patients with Fitzpatrick skin type's I-IV were prospectively included. Inclusion criteria consisted of having wrinkles and irregular skin texture. All patients underwent two Er:YAG + SMA sessions (1 month apart) to stimulate tissue regeneration. Er:YAG laser emits wavelength at 2,940 nm and when combined with SMA, a resonance effect is produced in the dermis to promote tissue regeneration. Facial skin elasticity and firmness were objectively assessed by Cutometer at baseline and month 6 (M6). Aesthetic improvement was qualitatively assessed using digital photographs. Patient satisfaction with regard to their facial appearance was self-assessed using the validated FACE-Q scale and the patient-perceived age VAS scale at baseline, M1, and M6. Side effects were investigated after each session. Thirty-four patients were included, 50% (18 patients) had Fitzpatrick skin type III and 41% (14 patients) were smokers. Skin elasticity indices were significantly improved: from 0.335 ± 0.015 at baseline to 0.387 ± 0.021 at M6 (P = 0.05*) for R5 (net elasticity). Skin firmness was assessed through R7 (biological elasticity) and R6 (viscoelastic ratio) at baseline and M6: a significant increase from 0.235 ± 0.01 to 0.2709 ± 0.009 (P technology offers an effective and safe treatment alternative for facial skin rejuvenation. It reduces the recovery time compared to conventional lasers such as carbon dioxide laser. Lasers Surg. Med. 49:78-83, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  17. The Modulatory Effect of Ellagic Acid and Rosmarinic Acid on Ultraviolet-B-Induced Cytokine/Chemokine Gene Expression in Skin Keratinocyte (HaCaT Cells

    Directory of Open Access Journals (Sweden)

    Serena Lembo

    2014-01-01

    Full Text Available Ultraviolet radiation (UV induces an increase in multiple cutaneous inflammatory mediators. Ellagic acid (EA and rosmarinic acid (RA are natural anti-inflammatory and immunomodulatory compounds found in many plants, fruits, and nuts. We assessed the ability of EA and RA to modulate IL-1β, IL-6, IL-8, IL-10, MCP-1, and TNF-α gene expression in HaCaT cells after UVB irradiation. Cells were treated with UVB (100 mJ/cm2 and simultaneously with EA (5 μM in 0.1% DMSO or RA (2.7 μM in 0.5% DMSO. Moreover, these substances were added to the UVB-irradiated cells 1 h or 6 h before harvesting, depending on the established UVB-induced cytokine expression peak. Cytokine gene expression was examined using quantitative real time polymerase chain reaction. RA produced a significant reduction in UVB-induced expression of IL-6, IL-8, MCP-1, and TNF-α when applied at the same time as irradiation. EA showed milder effects compared with RA, except for TNF-α. Both substances decreased IL-6 expression, also when applied 5 h after irradiation, and always produced a significant increase in UVB-induced IL-10 expression. Our findings suggest that EA and RA are able to prevent and/or limit the UVB-induced inflammatory cascade, through a reduction in proinflammatory mediators and the enhancement of IL-10, with its protective function.

  18. SIRT1 regulates MAPK pathways in vitiligo skin: insight into the molecular pathways of cell survival

    Science.gov (United States)

    Becatti, Matteo; Fiorillo, Claudia; Barygina, Victoria; Cecchi, Cristina; Lotti, Torello; Prignano, Francesca; Silvestro, Agrippino; Nassi, Paolo; Taddei, Niccolò

    2014-01-01

    Vitiligo is an acquired and progressive hypomelanotic disease that manifests as circumscribed depigmented patches on the skin. The aetiology of vitiligo remains unclear, but recent experimental data underline the interactions between melanocytes and other typical skin cells, particularly keratinocytes. Our previous results indicate that keratinocytes from perilesional skin show the features of damaged cells. Sirtuins (silent mating type information regulation 2 homolog) 1, well-known modulators of lifespan in many species, have a role in gene repression, metabolic control, apoptosis and cell survival, DNA repair, development, inflammation, neuroprotection and healthy ageing. In the literature there is no evidence for SIRT1 signalling in vitiligo and its possible involvement in disease progression. Here, biopsies were taken from the perilesional skin of 16 patients suffering from non-segmental vitiligo and SIRT1 signalling was investigated in these cells. For the first time, a new SIRT1/Akt, also known as Protein Kinase B (PKB)/mitogen-activated protein kinase (MAPK) signalling has been revealed in vitiligo. SIRT1 regulates MAPK pathway via Akt-apoptosis signal-regulating kinase-1 and down-regulates pro-apoptotic molecules, leading to decreased oxidative stress and apoptotic cell death in perilesional vitiligo keratinocytes. We therefore propose SIRT1 activation as a novel way of protecting perilesional vitiligo keratinocytes from damage. PMID:24410795

  19. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  20. TIG3 - AN IMPORTANT REGULATOR OF KERATINOCYTE PROLIFERATION AND SURVIVAL

    OpenAIRE

    Scharadin, Tiffany M.; Eckert, Richard L.

    2014-01-01

    Tazarotene induced gene 3 (TIG3) is a tumor suppressor protein. In normal human epidermis, TIG3 is present in the differentiated, suprabasal layers and regulates terminal differentiation. TIG3 level is reduced in hyperproliferative diseases, including psoriasis and skin cancer, suggesting that loss of TIG3 is associated with enhanced cell proliferation. Moreover, transient expression of TIG3 leads to terminal differentiation in normal keratinocytes and apoptosis in skin cancer cells. In both ...

  1. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  2. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  3. S100A8 and S100A9 are messengers in the crosstalk between epidermis and dermis modulating a psoriatic milieu in human skin

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Young; Jang, Sunhyae [Department of Dermatology, College of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Min, Jeong-Ki; Lee, Kyungmin [Immunotherapy Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon (Korea, Republic of); Department of Biomolecular Science, University of Science and Technology, Daejeon (Korea, Republic of); Sohn, Kyung-Cheol [Department of Dermatology, College of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Lim, Jong-Soon [College of Oriental Medicine, Daejeon University, Daejeon (Korea, Republic of); Im, Myung; Lee, Hae-Eul; Seo, Young-Joon; Kim, Chang-Deok [Department of Dermatology, College of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Lee, Jeung-Hoon, E-mail: jhoon@cnu.ac.kr [Department of Dermatology, College of Medicine, Chungnam National University, Daejeon (Korea, Republic of)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce cytokine production. Black-Right-Pointing-Pointer Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce migration of immune cells. Black-Right-Pointing-Pointer Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce angiogenesis. Black-Right-Pointing-Pointer S100A8 and/or S100A9 may play a role in the crosstalk between epidermis and dermis in psoriasis. -- Abstract: S100A8 and S100A9 are members of the S100A8 protein family that exist as homodimers and heterodimers in neutrophils, monocytes, and macrophages. Recent studies have shown the pivotal roles of S100A8 and S100A9 in the propagation of inflammation and keratinocyte proliferation in psoriasis. We found significant up-regulation of S100A8 and S100A9 secretion from keratinocytes in psoriatic lesions. To mimic the in vivo secretory conditions of S100A8 and S100A9 from psoriatic epidermal keratinocytes, we used the culture medium (CM) of S100A8 and S100A8/A9 adenovirus-transduced keratinocytes to investigate the functions of S100A8 and S100A9. We detected increased levels of various pro-inflammatory cytokines in the CM, including IL-8 and TNF-{alpha}, which are involved in aggravating psoriatic skin lesions, and IL-6 and members of the CXCL family of pro-angiogenic cytokines. The CM increased immune cell migration and increased angiogenesis in human umbilical vein endothelial cells. In conclusion, we found that the upregulated production of S100A8 and S100A9 by psoriatic epidermal keratinocytes activated adjacent keratinocytes to produce several cytokines. Moreover, S100A8 and S100A9 themselves function as pro-angiogenic and chemotactic factors, generating a psoriatic milieu in skin.

  4. S100A8 and S100A9 are messengers in the crosstalk between epidermis and dermis modulating a psoriatic milieu in human skin

    International Nuclear Information System (INIS)

    Lee, Young; Jang, Sunhyae; Min, Jeong-Ki; Lee, Kyungmin; Sohn, Kyung-Cheol; Lim, Jong-Soon; Im, Myung; Lee, Hae-Eul; Seo, Young-Joon; Kim, Chang-Deok; Lee, Jeung-Hoon

    2012-01-01

    Highlights: ► Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce cytokine production. ► Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce migration of immune cells. ► Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce angiogenesis. ► S100A8 and/or S100A9 may play a role in the crosstalk between epidermis and dermis in psoriasis. -- Abstract: S100A8 and S100A9 are members of the S100A8 protein family that exist as homodimers and heterodimers in neutrophils, monocytes, and macrophages. Recent studies have shown the pivotal roles of S100A8 and S100A9 in the propagation of inflammation and keratinocyte proliferation in psoriasis. We found significant up-regulation of S100A8 and S100A9 secretion from keratinocytes in psoriatic lesions. To mimic the in vivo secretory conditions of S100A8 and S100A9 from psoriatic epidermal keratinocytes, we used the culture medium (CM) of S100A8 and S100A8/A9 adenovirus-transduced keratinocytes to investigate the functions of S100A8 and S100A9. We detected increased levels of various pro-inflammatory cytokines in the CM, including IL-8 and TNF-α, which are involved in aggravating psoriatic skin lesions, and IL-6 and members of the CXCL family of pro-angiogenic cytokines. The CM increased immune cell migration and increased angiogenesis in human umbilical vein endothelial cells. In conclusion, we found that the upregulated production of S100A8 and S100A9 by psoriatic epidermal keratinocytes activated adjacent keratinocytes to produce several cytokines. Moreover, S100A8 and S100A9 themselves function as pro-angiogenic and chemotactic factors, generating a psoriatic milieu in skin.

  5. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  6. Filaggrin-dependent secretion of sphingomyelinase protects against staphylococcal α-toxin-induced keratinocyte death.

    Science.gov (United States)

    Brauweiler, Anne M; Bin, Lianghua; Kim, Byung Eui; Oyoshi, Michiko K; Geha, Raif S; Goleva, Elena; Leung, Donald Y M

    2013-02-01

    The skin of patients with atopic dermatitis (AD) has defects in keratinocyte differentiation, particularly in expression of the epidermal barrier protein filaggrin. AD skin lesions are often exacerbated by Staphylococcus aureus-mediated secretion of the virulence factor α-toxin. It is unknown whether lack of keratinocyte differentiation predisposes to enhanced lethality from staphylococcal toxins. We investigated whether keratinocyte differentiation and filaggrin expression protect against cell death induced by staphylococcal α-toxin. Filaggrin-deficient primary keratinocytes were generated through small interfering RNA gene knockdown. RNA expression was determined by using real-time PCR. Cell death was determined by using the lactate dehydrogenase assay. Keratinocyte cell survival in filaggrin-deficient (ft/ft) mouse skin biopsies was determined based on Keratin 5 staining. α-Toxin heptamer formation and acid sphingomyelinase expression were determined by means of immunoblotting. We found that filaggrin expression, occurring as the result of keratinocyte differentiation, significantly inhibits staphylococcal α-toxin-mediated pathogenicity. Furthermore, filaggrin plays a crucial role in protecting cells by mediating the secretion of sphingomyelinase, an enzyme that reduces the number of α-toxin binding sites on the keratinocyte surface. Finally, we determined that sphingomyelinase enzymatic activity directly prevents α-toxin binding and protects keratinocytes against α-toxin-induced cytotoxicity. The current study introduces the novel concept that S aureus α-toxin preferentially targets and destroys filaggrin-deficient keratinocytes. It also provides a mechanism to explain the increased propensity for S aureus-mediated exacerbation of AD skin disease. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  7. Re-appraisal of keratinocytes' role in vitiligo pathogenesis

    Directory of Open Access Journals (Sweden)

    Ola Ahmed Bakry

    2018-01-01

    Full Text Available Background: Vitiligo is a common pigmentary disorder. Studies on its pathogenesis extensively investigated melanocytes' abnormalities and few studies searched for keratinocytes' role in disease development. Liver X receptor-α (LXR-α is a member of nuclear hormone receptors that acts as a transcription factor. Its target genes are the main regulators of melanocyte functions. Aim: The aim of this study is to investigate keratinocytes' role in vitiligo pathogenesis through immunohistochemical expression of LXR-α in lesional, perilesional, and distant nonlesional vitiligo skin. Materials and Methods: This case–control study was carried out on 44 participants. These included 24 patients with vitiligo and 20 age- and sex-matched normal individuals as a control group. Biopsies, from cases, were taken from lesional, perilesional, and distant nonlesional areas. Evaluation was done using immunohistochemical technique. Results: Keratinocyte LXR-α expression was upregulated in the lesional and perilesional skin (follicular and interfollicular epidermis compared with control skin (P<0.001 for all. There was significant association between higher histoscore (H-score in lesional epidermis (P<0.001 and in hair follicle (P=0.001 and the presence of angiogenesis. There was significant association between higher H-score in lesional epidermis and suprabasal vacuolization (P=0.02. No significant association was found between H-score or expression percentage and clinical data of selected cases. Conclusion: LXR-α upregulation is associated with keratinocyte damage in vitiligo lesional skin that leads to decreased keratinocyte-derived mediators and growth factors supporting the growth and/or melanization of surrounding melanocytes. Therefore, melanocyte function and survival are affected.

  8. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    International Nuclear Information System (INIS)

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  9. Development of Transgenic Cloned Pig Models of Skin Inflammation by DNA Transposon-Directed Ectopic Expression of Human β1 and α2 Integrin

    Science.gov (United States)

    Staunstrup, Nicklas Heine; Madsen, Johannes; Primo, Maria Nascimento; Li, Juan; Liu, Ying; Kragh, Peter M.; Li, Rong; Schmidt, Mette; Purup, Stig; Dagnæs-Hansen, Frederik; Svensson, Lars; Petersen, Thomas K.; Callesen, Henrik; Bolund, Lars; Mikkelsen, Jacob Giehm

    2012-01-01

    Integrins constitute a superfamily of transmembrane signaling receptors that play pivotal roles in cutaneous homeostasis by modulating cell growth and differentiation as well as inflammatory responses in the skin. Subrabasal expression of integrins α2 and/or β1 entails hyperproliferation and aberrant differentiation of keratinocytes and leads to dermal and epidermal influx of activated T-cells. The anatomical and physiological similarities between porcine and human skin make the pig a suitable model for human skin diseases. In efforts to generate a porcine model of cutaneous inflammation, we employed the Sleeping Beauty DNA transposon system for production of transgenic cloned Göttingen minipigs expressing human β1 or α2 integrin under the control of a promoter specific for subrabasal keratinocytes. Using pools of transgenic donor fibroblasts, cloning by somatic cell nuclear transfer was utilized to produce reconstructed embryos that were subsequently transferred to surrogate sows. The resulting pigs were all transgenic and harbored from one to six transgene integrants. Molecular analyses on skin biopsies and cultured keratinocytes showed ectopic expression of the human integrins and localization within the keratinocyte plasma membrane. Markers of perturbed skin homeostasis, including activation of the MAPK pathway, increased expression of the pro-inflammatory cytokine IL-1α, and enhanced expression of the transcription factor c-Fos, were identified in keratinocytes from β1 and α2 integrin-transgenic minipigs, suggesting the induction of a chronic inflammatory phenotype in the skin. Notably, cellular dysregulation obtained by overexpression of either β1 or α2 integrin occurred through different cellular signaling pathways. Our findings mark the creation of the first cloned pig models with molecular markers of skin inflammation. Despite the absence of an overt psoriatic phenotype, these animals may possess increased susceptibility to severe skin damage

  10. Methotrexate treatment provokes apoptosis of proliferating keratinocyte in psoriasis patients.

    Science.gov (United States)

    Elango, Tamilselvi; Thirupathi, Anand; Subramanian, Swapna; Ethiraj, Purushoth; Dayalan, Haripriya; Gnanaraj, Pushpa

    2017-08-01

    Psoriasis is a chronic inflammatory skin disease characterized by hyper proliferation of keratinocytes. Recent data show that the epidermis thickening in psoriasis may be related to imbalance of homeostasis caused by abnormal apoptotic process. Maintenance of keratinocyte apoptotic process is very important in psoriasis. Methotrexate (MTX) has been used for many years to restore the normal skin in psoriasis condition. However, the exact mechanism of MTX in psoriasis condition is poorly understood. The aim of this study was to examine the role of MTX on keratinocyte apoptosis pathway in psoriasis patients. A total of 58 psoriasis vulgaris patients were recruited for this study. Nonlesional skin biopsies served as control. Skin biopsies of psoriatic patients were collected and analyzed for cytosolic, mitochondria and total cytochrome c by ELISA. Expression of caspase-9, NFκBp65, pAkt1 by western blot, real-time PCR and immunohistochemical analysis of c-FLIP protein was analyzed in nonlesional and lesional skin biopsies before (day 0) and after (at the end of 6 and 12 weeks) MTX treatment. After MTX treatment, a significant increase in cytochrome c was observed when compared with before MTX treatment in psoriasis patients (p psoriasis by controlling the acanthosis.

  11. The incidence and multiplicity rates of keratinocyte cancers in Australia.

    Science.gov (United States)

    Pandeya, Nirmala; Olsen, Catherine M; Whiteman, David C

    2017-10-16

    To assess the incidence and multiplicity of keratinocyte cancers (basal cell carcinoma [BCC] and squamous cell carcinoma [SCC]) excised in Australia, and to examine variations by age, sex, state, and prior skin cancer history. Analysis of individual-level Medicare data for keratinocyte cancer treatments (identified by eight specific MBS item codes) during 2011-2014. Histological data from the QSkin prospective cohort study were analysed to estimate BCC and SCC incidence. A 10% systematic random sample of all people registered with Medicare during 1997-2014. People aged at least 20 years in 2011 who made at least one claim for any MBS medical service during 2011-2014 (1 704 193 individuals). Age-standardised incidence rates (ASRs) and standardised incidence ratios (SIRs). The person-based incidence of keratinocyte cancer excisions in Australia was 1531 per 100 000 person-years; incidence increased with age, and was higher for men than women (SIR, 1.43; 95% CI, 1.42-1.45). Lesion-based incidence was 3154 per 100 000 person-years. The estimated ASRs for BCC and SCC were 770 per 100 000 and 270 per 100 000 person-years respectively. During 2011-2014, 3.9% of Australians had one keratinocyte cancer excised, 2.7% had more than one excised; 74% of skin cancers were excised from patients who had two or more lesions removed. Multiplicity was strongly correlated with age; most male patients over 70 were treated for multiple lesions. Keratinocyte cancer incidence was eight times as high among people with a prior history of excisions as among those without. The incidence and multiplicity of keratinocyte cancer in Australia are very high, causing a large disease burden that has not previously been quantified.

  12. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

  13. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  14. Rab11b mediates melanin transfer between donor melanocytes and acceptor keratinocytes via coupled exo/endocytosis.

    Science.gov (United States)

    Tarafder, Abul K; Bolasco, Giulia; Correia, Maria S; Pereira, Francisco J C; Iannone, Lucio; Hume, Alistair N; Kirkpatrick, Niall; Picardo, Mauro; Torrisi, Maria R; Rodrigues, Inês P; Ramalho, José S; Futter, Clare E; Barral, Duarte C; Seabra, Miguel C

    2014-04-01

    The transfer of melanin from melanocytes to keratinocytes is a crucial process underlying maintenance of skin pigmentation and photoprotection against UV damage. Here, we present evidence supporting coupled exocytosis of the melanin core, or melanocore, by melanocytes and subsequent endocytosis by keratinocytes as a predominant mechanism of melanin transfer. Electron microscopy analysis of human skin samples revealed three lines of evidence supporting this: (1) the presence of melanocores in the extracellular space; (2) within keratinocytes, melanin was surrounded by a single membrane; and (3) this membrane lacked the melanosomal membrane protein tyrosinase-related protein 1 (TYRP1). Moreover, co-culture of melanocytes and keratinocytes suggests that melanin exocytosis is specifically induced by keratinocytes. Furthermore, depletion of Rab11b, but not Rab27a, caused a marked decrease in both keratinocyte-stimulated melanin exocytosis and transfer to keratinocytes. Thus, we propose that the predominant mechanism of melanin transfer is keratinocyte-induced exocytosis, mediated by Rab11b through remodeling of the melanosome membrane, followed by subsequent endocytosis by keratinocytes.

  15. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  16. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  17. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  18. Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

    Science.gov (United States)

    Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2017-10-19

    Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

  19. Proteomics unveil corticoid-induced S100A11 shuttling in keratinocyte differentiation

    International Nuclear Information System (INIS)

    Dezitter, Xavier; Hammoudi, Fatma; Belverge, Nicolas; Deloulme, Jean-Christophe; Drobecq, Herve; Masselot, Bernadette; Formstecher, Pierre; Mendy, Denise; Idziorek, Thierry

    2007-01-01

    Unlike classical protein extraction techniques, proteomic mapping using a selective subcellular extraction kit revealed S100A11 as a new member of the S100 protein family modulated by glucocorticoids in keratinocytes. Glucocorticoids (GC)-induced S100A11 redistribution in the 'organelles and membranes' compartment. Microscopic examination indicated that glucocorticoids specifically routed cytoplasmic S100A11 toward perinuclear compartment. Calcium, a key component of skin terminal differentiation, directed S100A11 to the plasma membrane as previously reported. When calcium was added to glucocorticoids, minor change was observed at the proteomic level while confocal microscopy revealed a rapid and dramatic translocation of S100A11 toward plasma membrane. This effect was accompanied by strong nuclear condensation, loss of mitochondrial potential and DNA content, and increased high molecular weight S100A11 immunoreactivity, suggesting corticoids accelerate calcium-induced terminal differentiation. Finally, our results suggest GC-induced S100A11 relocalization could be a key step in both keratinocyte homeostasis and glucocorticoids side effects in human epidermis

  20. Saponins from Tribulus terrestris L. protect human keratinocytes from UVB-induced damage.

    Science.gov (United States)

    Sisto, Margherita; Lisi, Sabrina; D'Amore, Massimo; De Lucro, Raffaella; Carati, Davide; Castellana, Donatello; La Pesa, Velia; Zuccarello, Vincenzo; Lofrumento, Dario D

    2012-12-05

    Chronic exposure to solar UVB radiation damages skin, increasing the risk to develop cancer. Hence the identification of compounds with a photoprotective efficacy is essential. This study examined the role of saponins derived from Tribulus terrestris L. (TT) on the modulation of apoptosis in normal human keratinocytes (NHEK) exposed to physiological doses of UVB and to evaluate their antitumoral properties. In NHEK, TT saponins attenuate UVB-induced programmed cell death through inhibition of intrinsic apoptotic pathway. In squamous cell carcinomas (SCC) TT saponins do not make the malignant keratinocytes more resistant to UVB and determine an enhanced apoptotic response. The photoprotective effect of TT saponins is tightly correlated to the enhancement of NER genes expression and the block of UVB-mediated NF-κB activation. Collectively, our study shows experimental evidence that TT has a preventive efficacy against UVB-induced carcinogenesis and the molecular knowledge on the mechanisms through which TT saponins regulate cell death suggests great potential for TT to be developed into a new medicine for cancer patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    International Nuclear Information System (INIS)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming

    2016-01-01

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  2. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming, E-mail: lizm_1001@sina.com

    2016-02-26

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  3. Impaired Skin Barrier Due to Sebaceous Gland Atrophy in the Latent Stage of Radiation-Induced Skin Injury: Application of Non-Invasive Diagnostic Methods

    Directory of Open Access Journals (Sweden)

    Hyosun Jang

    2018-01-01

    Full Text Available Radiation-induced skin injury can take the form of serious cutaneous damage and have specific characteristics. Asymptomatic periods are classified as the latent stage. The skin barrier plays a critical role in the modulation of skin permeability and hydration and protects the body against a harsh external environment. However, an analysis on skin barrier dysfunction against radiation exposure in the latent stage has not been conducted. Thus, we investigated whether the skin barrier is impaired by irradiation in the latent stage and aimed to identify the molecules involved in skin barrier dysfunction. We analyzed skin barrier function and its components in SKH1 mice that received 20 and 40 Gy local irradiation. Increased transepidermal water loss and skin pH were observed in the latent stage of the irradiated skin. Skin barrier components, such as structural proteins and lipid synthesis enzymes in keratinocyte, increased in the irradiated group. Interestingly, we noted sebaceous gland atrophy and increased serine protease and inflammatory cytokines in the irradiated skin during the latent period. This finding indicates that the main factor of skin barrier dysfunction in the latent stage of radiation-induced skin injury is sebaceous gland deficiency, which could be an intervention target for skin barrier impairment.

  4. Essential role of RAB27A in determining constitutive human skin color.

    Directory of Open Access Journals (Sweden)

    Yasuko Yoshida-Amano

    Full Text Available Human skin color is predominantly determined by melanin produced in melanosomes within melanocytes and subsequently distributed to keratinocytes. There are many studies that have proposed mechanisms underlying ethnic skin color variations, whereas the processes involved from melanin synthesis in melanocytes to the transfer of melanosomes to keratinocytes are common among humans. Apart from the activities in the melanogenic rate-limiting enzyme, tyrosinase, in melanocytes and the amounts and distribution patterns of melanosomes in keratinocytes, the abilities of the actin-associated factors in charge of melanosome transport within melanocytes also regulate pigmentation. Mutations in genes encoding melanosome transport-related molecules, such as MYO5A, RAB27A and SLAC-2A, have been reported to cause a human pigmentary disease known as Griscelli syndrome, which is associated with diluted skin and hair color. Thus we hypothesized that process might play a role in modulating skin color variations. To address that hypothesis, the correlations of expression of RAB27A and its specific effector, SLAC2-A, to melanogenic ability were evaluated in comparison with tyrosinase, using human melanocytes derived from 19 individuals of varying skin types. Following the finding of the highest correlation in RAB27A expression to the melanogenic ability, darkly-pigmented melanocytes with significantly higher RAB27A expression were found to transfer significantly more melanosomes to keratinocytes than lightly-pigmented melanocytes in co-culture and in human skin substitutes (HSSs in vivo, resulting in darker skin color in concert with the difference observed in African-descent and Caucasian skins. Additionally, RAB27A knockdown by a lentivirus-derived shRNA in melanocytes concomitantly demonstrated a significantly reduced number of transferred melanosomes to keratinocytes in co-culture and a significantly diminished epidermal melanin content skin color intensity (

  5. Comparative studies of types 1 and 2 herpes simplex virus infection of cultured normal keratinocytes.

    OpenAIRE

    Su, S J; Wu, H H; Lin, Y H; Lin, H Y

    1995-01-01

    AIMS--To investigate the differences in biological properties, multiplication patterns, and cytopathic effects between type 1 and type 2 herpes simplex virus (HSV) through the replication of HSV in cultured normal human keratinocytes. METHODS--Keratinocytes were obtained from surgical specimens of normal gingiva, cervix, trunk skin, and newborn foreskin. They were cultured in serum free, chemically defined, culture medium and infected with a pool of HSV collected from clinical specimens. RESU...

  6. Scleroderma keratinocytes promote fibroblast activation independent of transforming growth factor beta.

    Science.gov (United States)

    McCoy, Sara S; Reed, Tamra J; Berthier, Celine C; Tsou, Pei-Suen; Liu, Jianhua; Gudjonsson, Johann E; Khanna, Dinesh; Kahlenberg, J Michelle

    2017-11-01

    SSc is a devastating disease that results in fibrosis of the skin and other organs. Fibroblasts are a key driver of the fibrotic process through deposition of extracellular matrix. The mechanisms by which fibroblasts are induced to become pro-fibrotic remain unclear. Thus, we examined the ability of SSc keratinocytes to promote fibroblast activation and the source of this effect. Keratinocytes were isolated from skin biopsies of 9 lcSSc, 10 dcSSc and 13 control patients. Conditioned media was saved from the cultures. Normal fresh primary fibroblasts were exposed to healthy control and SSc keratinocyte conditioned media in the presence or absence of neutralizing antibodies for TGF-β. Gene expression was assessed by microarrays and real-time PCR. Immunocytochemistry was performed for α-smooth muscle actin (α-SMA), collagen type 1 (COL1A1) and CCL5 expression. SSc keratinocyte conditioned media promoted fibroblast activation, characterized by increased α-SMA and COL1A1 mRNA and protein expression. This effect was independent of TGF-β. Microarray analysis identified upregulation of nuclear factor κB (NF-κB) and downregulation of peroxisome proliferator-activated receptor γ (PPAR-γ) pathways in both SSc subtypes. Scleroderma keratinocytes exhibited increased expression of NF-κB-regulated cytokines and chemokines and lesional skin staining confirmed upregulation of CCL5 in basal keratinocytes. Scleroderma keratinocytes promote the activation of fibroblasts in a TGF-β-independent manner and demonstrate an imbalance in NF-κB1 and PPAR-γ expression leading to increased cytokine and CCL5 production. Further study of keratinocyte mediators of fibrosis, including CCL5, may provide novel targets for skin fibrosis therapy. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  7. Laser capture microdissection-based in vivo genomic profiling of wound keratinocytes identifies similarities and differences to squamous cell carcinoma

    DEFF Research Database (Denmark)

    Pedersen, Tanja Xenia; Leethanakul, Chidchanop; Patel, Vyomesh

    2003-01-01

    keratinocytes from incisional mouse skin wounds and adjacent normal skin keratinocytes. Changes in gene expression were determined by comparative cDNA array analyses, and the approach was validated by in situ hybridization. The analyses identified 48 candidate genes not previously associated with wound...... reepithelialization. Furthermore, the analyses revealed that the phenotypic resemblance of wound keratinocytes to squamous cell carcinoma is mimicked at the level of gene expression, but notable differences between the two tissue-remodeling processes were also observed. The combination of laser capture...

  8. Establishment of a transgenic zebrafish line for superficial skin ablation and functional validation of apoptosis modulators in vivo.

    Directory of Open Access Journals (Sweden)

    Chi-Fang Chen

    Full Text Available BACKGROUND: Zebrafish skin is composed of enveloping and basal layers which form a first-line defense system against pathogens. Zebrafish epidermis contains ionocytes and mucous cells that aid secretion of acid/ions or mucous through skin. Previous studies demonstrated that fish skin is extremely sensitive to external stimuli. However, little is known about the molecular mechanisms that modulate skin cell apoptosis in zebrafish. METHODOLOGY/PRINCIPAL FINDINGS: This study aimed to create a platform to conduct conditional skin ablation and determine if it is possible to attenuate apoptotic stimuli by overexpressing potential apoptosis modulating genes in the skin of live animals. A transgenic zebrafish line of Tg(krt4:NTR-hKikGR(cy17 (killer line, which can conditionally trigger apoptosis in superficial skin cells, was first established. When the killer line was incubated with the prodrug metrodinazole, the superficial skin displayed extensive apoptosis as judged by detection of massive TUNEL- and active caspase 3-positive signals. Great reductions in NTR-hKikGR(+ fluorescent signals accompanied epidermal cell apoptosis. This indicated that NTR-hKikGR(+ signal fluorescence can be utilized to evaluate apoptotic events in vivo. After removal of metrodinazole, the skin integrity progressively recovered and NTR-hKikGR(+ fluorescent signals gradually restored. In contrast, either crossing the killer line with testing lines or transiently injecting the killer line with testing vectors that expressed human constitutive active Akt1, mouse constitutive active Stat3, or HPV16 E6 element displayed apoptosis-resistant phenotypes to cytotoxic metrodinazole as judged by the loss of reduction in NTR-hKikGR(+ fluorescent signaling. CONCLUSION/SIGNIFICANCE: The killer/testing line binary system established in the current study demonstrates a nitroreductase/metrodinazole system that can be utilized to conditionally perform skin ablation in a real-time manner, and

  9. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Itoi, Saori; Terao, Mika, E-mail: mterao@derma.med.osaka-u.ac.jp; Murota, Hiroyuki; Katayama, Ichiro

    2013-10-18

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10{sup −13} M cortisol, whereas 1 × 10{sup −5} M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol

  10. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    International Nuclear Information System (INIS)

    Itoi, Saori; Terao, Mika; Murota, Hiroyuki; Katayama, Ichiro

    2013-01-01

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10 −13 M cortisol, whereas 1 × 10 −5 M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol concentrations

  11. Asymmetric migration of human keratinocytes under mechanical stretch and cocultured fibroblasts in a wound repair model.

    Directory of Open Access Journals (Sweden)

    Dongyuan Lü

    Full Text Available Keratinocyte migration during re-epithelization is crucial in wound healing under biochemical and biomechanical microenvironment. However, little is known about the underlying mechanisms whereby mechanical tension and cocultured fibroblasts or keratinocytes modulate the migration of keratinocytes or fibroblasts. Here we applied a tensile device together with a modified transwell assay to determine the lateral and transmembrane migration dynamics of human HaCaT keratinocytes or HF fibroblasts. A novel pattern of asymmetric migration was observed for keratinocytes when they were cocultured with non-contact fibroblasts, i.e., the accumulative distance of HaCaT cells was significantly higher when moving away from HF cells or migrating from down to up cross the membrane than that when moving close to HF cells or when migrating from up to down, whereas HF migration was symmetric. This asymmetric migration was mainly regulated by EGF derived from fibroblasts, but not transforming growth factor α or β1 production. Mechanical stretch subjected to fibroblasts fostered keratinocyte asymmetric migration by increasing EGF secretion, while no role of mechanical stretch was found for EGF secretion by keratinocytes. These results provided a new insight into understanding the regulating mechanisms of two- or three-dimensional migration of keratinocytes or fibroblasts along or across dermis and epidermis under biomechanical microenvironment.

  12. Modulation of tenascin Genes expression in pig skin and muscular fibrosis after ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Geffrotin, C.; Tricaud, Y.; Castelli, M.; Crechet, F.; Lefaix, J.L.; Vaiman, M. [Institut National de Recherches Agronomiques (INRA-CEA-DSV-DRR) Laboratoire de Radiologie Appliquee, 78 - Jouy-en-Josas (France)

    1997-03-01

    To study mechanisms leading to radiation-induced fibrosis, a complication which may occur after radiotherapy or radiation accidents, a model of local irradiation of skin in pig has been set up. It is characterized by the development of a cutaneous and muscular fibrosis within 5 months following a single dose of at least 140 Grays at the point of application of a collimated {sup 192}Ir source (2 cm in diameter). Accumulation of myo-fibroblasts, increased synthesis and deposition of components of the extra cellular matrix (ECM), such as collagens, fibronectin and hyaluronan were described in this model. We present here a study of the expression of the tenascin C and X (TN-C and TN-X) molecules which belong to a new family of glycoproteins of the ECM that has never been analysed in this context. A single dose of 160 Grays (0,6 Gy/mn) at the point of application of the {sup 192}Ir source was delivered on the right thigh of 4 Large While pigs. The animals were killed 9 to 11 months after irradiation and samples from unirradiated skin, repaired fibrotic skin and underlying muscular fibrotic tissue were recovered. TN-C and TN-X RNAs were analysed by the RNase protection and Northern blot methods using porcine cDNA probes. Analysis of TN-C protein was performed by Western blot technique using a polyclonal antibody raised against human TN-C. RNAs and proteins were quantified with the PhosphorImager SI and the Imaging Densitometer GS-700 from Biorad respectively. In conclusion, these data confirmed our previous observations about the independence of the regulatory mechanisms involved in the level of TN-X and TN-C mRNAs. As the TN-C gene is highly expressed both at the RNA and the protein levels, its products might play an important role both in the initiation and the chronic extension of radiation-induced fibrosis by modulating mechanism such as adhesion, migration or proliferation of cells. (authors)

  13. Response of Human Skin Equivalents to Sarcoptes scabiei

    Science.gov (United States)

    MORGAN, MARJORIE S.; ARLIAN, LARRY G.

    2010-01-01

    Studies have shown that molecules in an extract made from bodies of the ectoparasitic mite, Sarcoptes scabiei De Geer, modulate cytokine secretion from cultured human keratinocytes and fibroblasts. In vivo, in the parasitized skin, these cells interact with each other by contact and cytokine mediators and with the matrix in which they reside. Therefore, these cell types may function differently together than they do separately. In this study, we used a human skin equivalent (HSE) model to investigate the influence of cellular interactions between keratinocytes and fibroblasts when the cells were exposed to active/burrowing scabies mites, mite products, and mite extracts. The HSE consisted of an epidermis of stratified stratum corneum, living keratinocytes, and basal cells above a dermis of fibroblasts in a collagen matrix. HSEs were inoculated on the surface or in the culture medium, and their cytokine secretions on the skin surface and into the culture medium were determined by enzyme-linked immunosorbent assay. Active mites on the surface of the HSE induced secretion of cutaneous T cell-attracting chemokine, thymic stromal lymphopoietin, interleukin (IL)-1α, IL-1β, IL-1 receptor antagonist (IL-1ra), IL-6, IL-8, monocyte chemoattractant protein-1, granulocyte/macrophage colony-stimulating factor, and macrophage colony-stimulating factor. The main difference between HSEs and monocultured cells was that the HSEs produced the proinflammatory cytokines IL-1α and IL-1β and their competitive inhibitor IL-1ra, whereas very little of these mediators was previously found for cultured keratinocytes and fibroblasts. It is not clear how the balance between these cytokines influences the overall host response. However, IL-1ra may contribute to the depression of an early cutaneous inflammatory response to scabies in humans. These contrasting results illustrate that cell interactions are important in the host’s response to burrowing scabies mites. PMID:20939384

  14. Application of low level laser on skin cell lines

    CSIR Research Space (South Africa)

    Ndhundhuma, IM

    2010-01-01

    Full Text Available Lasers have emerged as powerful tools for tissue engineering. To examine cellular growth, and cell to cell interactions, in vitro skin models have been developed combining two major cell types of skin, keratinocytes and fibroblasts. The main...

  15. Schisandra chinensis Protects the Skin from Global Pollution by Inflammatory and Redox Balance Pathway Modulations: An In Vitro Study

    Directory of Open Access Journals (Sweden)

    Edwige Ranouille

    2018-06-01

    Full Text Available Epidemiological results show that airborne particulate matter (PM induces health alterations in line with pulmonary and cardiovascular pathologies. Deleterious effects of PM on the skin have also been investigated. A possible approach to prevent Reactive Oxygen Species (ROS-mediated disorders for both preventive and treatment means is based on the use of substances, which can be found in plants. These can act as secondary metabolites, and lignans are a promising candidate. Thus, the objective of this study was firstly to identify reconstructed human epidermis, using a transcriptomic approach, and also to identify the effects of Urban Dust and of Urban Dust and Schisandra chinensis (S.C. extract on the expression of genes that are involved in the response to cellular protection mechanisms. Secondly, we examined the effect of an active extract from S.C. on the protection of human keratinocytes damages that were caused by pollution, through the evaluation of Nrf2 and AhR pathways, NF-kB, and DJ-1. Urban Dust included the over-expression of metalloproteinases MMP-1 and MMP-9 and an increase in Glutathione peroxidase 2 (GPX2. In the presence of Urban Dust, S.C. extract activated the over-expression of several genes that are involved in the antioxidant response and in the detoxification pathway, including Ferritin light chain (FTL and GPX2. Exposure to urban dust activated the cytoplasmic expression of NF-kB and AhR, when compared to the control. Co-treatment of Urban Dust and S.C. extract increased DJ-1 protein levels, Nrf2 expression, and decreased AhR and NF-kB in the cytoplasm. At the same time, this co-treatment increased SOD2 expression (50%: p < 0.001 and catalase activity (120%: p < 0.05, when compared to Urban Dust alone. Thus, S.C. might be able to protect the Normal Human Epidermal Keratinocytes (NHEK from environmental aggression, by fighting the harmful effects of urban pollution.

  16. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA-FABP...... as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... acid sequence revealed 48%, 52%, and 56% identity to known low-molecular-weight fatty acid-binding proteins belonging to the FABP family. Northern blot analysis showed that PA-FABP mRNA is indeed highly up-regulated in psoriatic keratinocytes. The transcript is present in human cell lines of epithelial...

  17. Differential Activation of Human Keratinocytes by Leishmania Species Causing Localized or Disseminated Disease.

    Science.gov (United States)

    Scorza, Breanna M; Wacker, Mark A; Messingham, Kelly; Kim, Peter; Klingelhutz, Aloysius; Fairley, Janet; Wilson, Mary E

    2017-10-01

    All Leishmania species parasites are introduced into mammalian skin through a sand fly bite, but different species cause distinct clinical outcomes. Mouse studies suggest that early responses are critical determinants of subsequent adaptive immunity in leishmaniasis, yet few studies address the role of keratinocytes, the most abundant cell in the epidermis. We hypothesized that Leishmania infection causes keratinocytes to produce immunomodulatory factors that influence the outcome of infection. Incubation of primary or immortalized human keratinocytes with Leishmania infantum or Leishmania major, which cause visceral or cutaneous leishmaniasis, respectively, elicited dramatically different responses. Keratinocytes incubated with L. infantum significantly increased expression of proinflammatory genes for IL-6, IL-8, tumor necrosis factor, and IL-1B, whereas keratinocytes exposed to several L. major isolates did not. Furthermore, keratinocyte-monocyte co-incubation studies across a 4 µM semipermeable membrane suggested that L. infantum-exposed keratinocytes release soluble factors that enhance monocyte control of intracellular L. infantum replication (P Leishmania species that may affect the course of disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. [Cultivated keratinocytes on micro-carriers: in vitro studies of a new carrier system].

    Science.gov (United States)

    Hecht, J; Hoefter, E A; Hecht, J; Haraida, S; Nerlich, A; Hartinger, A; Mühlbauer, W; Dimoudis, N

    1997-03-01

    Epidermal grafts from confluently cultivated keratinocytes have been used since the early eighties for the treatment of severe burns, where the shortage of donor sites for split-thickness skin grafts did not allow for adequate wound coverage. The difficult handling of these grafts as well as the advanced differentiation of their epithelial cells into a multilayer sheet poses a problem for their clinical application. The aim of the study was to characterize cultivated keratinocytes, as well as to observe their migration and proliferation from the MC onto a surface. Keratinocytes were isolated from human foreskin and cultivated in serum-free and serum-containing medium according to a modified method by Rheinwald and Green. Collagen-coated Dextran beads were used as MC. The MC were colonized with keratinocytes using the Spinner culture technique. After seeding the colonized MC into culture flasks, their migration and proliferation was monitored regularly through immunohistochemical studies and measurement of the metabolic cell activity. Immunohistological staining proved that the cells isolated from human foreskin represent keratinocytes of the basal type. Keratinocytes, cultivated with serum-containing and serum free medium, both adhered to the surface of the MC, then migrated onto the surface of the flasks and proliferated to form a multilayer of epithelial cells. In the long-term, a flexible epithelial graft consisting of poorly differentiated keratinocytes should be available, which is simple to produce and easy to handle. This would be an alternative method for treating wounds, where the conventional multilayer epithelial graft (ET) is insufficient.

  19. Mycosporine-Like Amino Acids Promote Wound Healing through Focal Adhesion Kinase (FAK and Mitogen-Activated Protein Kinases (MAP Kinases Signaling Pathway in Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yun-Hee Choi

    2015-11-01

    Full Text Available Mycosporine-like amino acids (MAAs are secondary metabolites found in diverse marine, freshwater, and terrestrial organisms. Evidence suggests that MAAs have several beneficial effects on skin homeostasis such as protection against UV radiation and reactive oxygen species (ROS. In addition, MAAs are also involved in the modulation of skin fibroblasts proliferation. However, the regulatory function of MAAs on wound repair in human skin is not yet clearly elucidated. To investigate the roles of MAAs on the wound healing process in human keratinocytes, three MAAs, Shinorine (SH, Mycosporine-glycine (M-Gly, and Porphyra (P334 were purified from Chlamydomonas hedlyei and Porphyra yezoensis. We found that SH, M-Gly, and P334 have significant effects on the wound healing process in human keratinocytes and these effects were mediated by activation of focal adhesion kinases (FAK, extracellular signal-regulated kinases (ERK, and c-Jun N-terminal kinases (JNK. These results suggest that MAAs accelerate wound repair by activating the FAK-MAPK signaling pathways. This study also indicates that MAAs can act as a new wound healing agent and further suggests that MAAs might be a novel biomaterial for wound healing therapies.

  20. Mycosporine-Like Amino Acids Promote Wound Healing through Focal Adhesion Kinase (FAK) and Mitogen-Activated Protein Kinases (MAP Kinases) Signaling Pathway in Keratinocytes

    Science.gov (United States)

    Choi, Yun-Hee; Yang, Dong Joo; Kulkarni, Atul; Moh, Sang Hyun; Kim, Ki Woo

    2015-01-01

    Mycosporine-like amino acids (MAAs) are secondary metabolites found in diverse marine, freshwater, and terrestrial organisms. Evidence suggests that MAAs have several beneficial effects on skin homeostasis such as protection against UV radiation and reactive oxygen species (ROS). In addition, MAAs are also involved in the modulation of skin fibroblasts proliferation. However, the regulatory function of MAAs on wound repair in human skin is not yet clearly elucidated. To investigate the roles of MAAs on the wound healing process in human keratinocytes, three MAAs, Shinorine (SH), Mycosporine-glycine (M-Gly), and Porphyra (P334) were purified from Chlamydomonas hedlyei and Porphyra yezoensis. We found that SH, M-Gly, and P334 have significant effects on the wound healing process in human keratinocytes and these effects were mediated by activation of focal adhesion kinases (FAK), extracellular signal-regulated kinases (ERK), and c-Jun N-terminal kinases (JNK). These results suggest that MAAs accelerate wound repair by activating the FAK-MAPK signaling pathways. This study also indicates that MAAs can act as a new wound healing agent and further suggests that MAAs might be a novel biomaterial for wound healing therapies. PMID:26703626

  1. Extracellular Matrix Modulates Morphology, Growth, Oxidative Stress Response and Functionality of Human Skin Fibroblasts during Aging In Vitro

    DEFF Research Database (Denmark)

    Jørgensen, Peter; Rattan, Suresh

    2014-01-01

    recent observations indicate that replicative lifespan, senescence and functionality of cells in vitro can be significantly affected by the quality of the extra cellular matrix (ECM). Following up on those reports, here we show that using the ECM prepared from early passage young cells, partial...... rejuvenation of serially passaged human facial skin fibroblasts was possible in pre-senescent middle-aged cells, but not in fully senescent late passage cells. ECM from young cells improved the appearance, viability, stress tolerance and wound healing ability of skin fibroblasts. Furthermore, young ECM...... modulated the oxidative stress response transcription factor Nrf-2 and its downstream effector haem-oxygenase (HO-1), possibly through the amelioration of the environmental stress induced by the plastic surface of the culturing flasks. Therefore, it is important to consider the role of ECM in modulating...

  2. MicroRNA-17-92 cluster promotes the proliferation and the chemokine production of keratinocytes: implication for the pathogenesis of psoriasis.

    Science.gov (United States)

    Zhang, Weigang; Yi, Xiuli; An, Yawen; Guo, Sen; Li, Shuli; Song, Pu; Chang, Yuqian; Zhang, Shaolong; Gao, Tianwen; Wang, Gang; Li, Chunying

    2018-05-11

    Keratinocytes are the main epidermal cell type that constitutes the skin barrier against environmental damages, which emphasizes the balance between the growth and the death of keratinocytes in maintaining skin homeostasis. Aberrant proliferation of keratinocytes and the secretion of inflammatory factors from keratinocytes are related to the formation of chronic inflammatory skin diseases like psoriasis. MicroRNA-17-92 (miRNA-17-92 or miR-17-92) is a miRNA cluster that regulates cell growth and immunity, but the role of miR-17-92 cluster in keratinocytes and its relation to skin diseases have not been well investigated. In the present study, we initially found that miR-17-92 cluster promoted the proliferation and the cell-cycle progression of keratinocytes via suppressing cyclin-dependent kinase inhibitor 2B (CDKN2B). Furthermore, miR-17-92 cluster facilitated the secretion of C-X-C motif chemokine ligand 9 (CXCL9) and C-X-C motif chemokine ligand 10 (CXCL10) from keratinocytes by inhibiting suppressor of cytokine signaling 1 (SOCS1), which enhanced the chemotaxis for T lymphocytes formed by keratinocytes. In addition, we detected increased expression of miR-17-92 cluster in psoriatic lesions and the level of lesional miR-17-92 cluster was positively correlated with the disease severity in psoriasis patients. At last, miR-17-92 cluster was increased in keratinocytes by cytokines through the activation of signal transducers and activators of transcription 1 (STAT1) signaling pathway. Our findings demonstrate that cytokine-induced overexpression of miR-17-92 cluster can promote the proliferation and the immune function of keratinocytes, and thus may contribute to the development of inflammatory skin diseases like psoriasis, which implicates miR-17-92 cluster as a potential therapeutic target for psoriasis and other skin diseases with similar inflammatory pathogenesis.

  3. CD44 antibody stimulates adhesion of peripheral blood T cells to keratinocytes through the leukocyte function-associated antigen-1/intercellular adhesion molecule-1 pathway

    NARCIS (Netherlands)

    Bruynzeel, I.; Koopman, G.; van der Raaij, L. M.; Pals, S. T.; Willemze, R.

    1993-01-01

    Close contact between T lymphocytes and keratinocytes is an important feature of many inflammatory skin diseases. In vitro studies showed that stimulation of keratinocytes with interferon-gamma or tumor necrosis factor-alpha and of T cells with phorbol esters results in a leukocyte

  4. Modulation of telomere binding proteins: a future area of research for skin protection and anti-aging target.

    Science.gov (United States)

    Imbert, Isabelle; Botto, Jean-Marie; Farra, Claude D; Domloge, Nouha

    2012-06-01

    Telomere shortening is considered as one of the main characteristics of cellular aging by limiting cellular division. Besides the fundamental advances through the discoveries of telomere and telomerase, which were recognized by a Nobel Prize, telomere protection remains an essential area of research. Recently, it was evidenced that studying the cross-talks between the proteins associated with telomere should provide a better understanding of the mechanistic basis for telomere-associated aging phenotypes. In this review, we discuss the current knowledge on telomere shortening, telomerase activity, and the essential role of telomere binding proteins in telomere stabilization and telomere-end protection. This review highlights the capacity of telomere binding proteins to limit cellular senescence and to maintain skin tissue homeostasis, which is of key importance to reduce accelerated tissue aging. Future studies addressing telomere protection and limitation of DNA damage response in human skin should include investigations on telomere binding proteins. As little is known about the expression of telomere binding proteins in human skin and modulation of their expression with aging, it remains an interesting field of skin research and a key area for future skin protection and anti-aging developments. © 2012 Wiley Periodicals, Inc.

  5. Message in a Bottle: Dialog between Intestine and Skin Modulated by Probiotics.

    Science.gov (United States)

    Friedrich, Adrián D; Paz, Mariela L; Leoni, Juliana; González Maglio, Daniel H

    2017-06-09

    At the beginning, probiotics were used exclusively for gastrointestinal conditions. However, over the years, evidence has shown that probiotics exert systemic effects. In this review article, we will summarize recent reports that postulate probiotic treatment as an efficient one against skin pathologies, such as cancer, allergy, photoaging and skin infections. The focus will be restricted to oral probiotics that could potentially counteract the ultraviolet irradiation-induced skin alterations. Moreover, the possible underlying mechanisms by which probiotics can impact on the gut and exert their skin effects will be reviewed. Furthermore, how the local and systemic immune system is involved in the intestine-cutaneous crosstalk will be analyzed. In conclusion, this article will be divided into three core ideas: (a) probiotics regulate gut homeostasis; (b) gut and skin homeostasis are connected; (c) probiotics are a potentially effective treatment against skin conditions.

  6. Message in a Bottle: Dialog between Intestine and Skin Modulated by Probiotics

    Directory of Open Access Journals (Sweden)

    Adrián D. Friedrich

    2017-06-01

    Full Text Available At the beginning, probiotics were used exclusively for gastrointestinal conditions. However, over the years, evidence has shown that probiotics exert systemic effects. In this review article, we will summarize recent reports that postulate probiotic treatment as an efficient one against skin pathologies, such as cancer, allergy, photoaging and skin infections. The focus will be restricted to oral probiotics that could potentially counteract the ultraviolet irradiation-induced skin alterations. Moreover, the possible underlying mechanisms by which probiotics can impact on the gut and exert their skin effects will be reviewed. Furthermore, how the local and systemic immune system is involved in the intestine-cutaneous crosstalk will be analyzed. In conclusion, this article will be divided into three core ideas: (a probiotics regulate gut homeostasis; (b gut and skin homeostasis are connected; (c probiotics are a potentially effective treatment against skin conditions.

  7. Thermally modulated nano-trampoline material as smart skin for gas molecular mass detection

    Science.gov (United States)

    Xia, Hua

    2012-06-01

    Conventional multi-component gas analysis is based either on laser spectroscopy, laser and photoacoustic absorption at specific wavelengths, or on gas chromatography by separating the components of a gas mixture primarily due to boiling point (or vapor pressure) differences. This paper will present a new gas molecular mass detection method based on thermally modulated nano-trampoline material as smart skin for gas molecular mass detection by fiber Bragg grating-based gas sensors. Such a nanomaterial and fiber Bragg grating integrated sensing device has been designed to be operated either at high-energy level (highly thermal strained status) or at low-energy level (low thermal strained status). Thermal energy absorption of gas molecular trigs the sensing device transition from high-thermal-energy status to low-thermal- energy status. Experiment has shown that thermal energy variation due to gas molecular thermal energy absorption is dependent upon the gas molecular mass, and can be detected by fiber Bragg resonant wavelength shift with a linear function from 17 kg/kmol to 32 kg/kmol and a sensitivity of 0.025 kg/kmol for a 5 micron-thick nano-trampoline structure and fiber Bragg grating integrated gas sensing device. The laboratory and field validation data have further demonstrated its fast response characteristics and reliability to be online gas analysis instrument for measuring effective gas molecular mass from single-component gas, binary-component gas mixture, and multi-gas mixture. The potential industrial applications include fouling and surge control for gas charge centrifugal compressor ethylene production, gas purity for hydrogen-cooled generator, gasification for syngas production, gasoline/diesel and natural gas fuel quality monitoring for consumer market.

  8. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  9. Staphylococcus aureus keratinocyte invasion is mediated by integrin-linked kinase and Rac1.

    Science.gov (United States)

    Sayedyahossein, Samar; Xu, Stacey X; Rudkouskaya, Alena; McGavin, Martin J; McCormick, John K; Dagnino, Lina

    2015-02-01

    Staphylococcus aureus is a major component of the skin microbiota and causes a large number of serious infections. S. aureus first interacts with epidermal keratinocytes to breach the epidermal barrier through mechanisms not fully understood. By use of primary keratinocytes from mice with epidermis-restricted Ilk gene inactivation and control integrin-linked kinase (ILK)-expressing littermates, we investigated the role of ILK in epidermal S. aureus invasion. Heat-killed, but not live, bacteria were internalized to Rab5- and Rab7-positive phagosomes, and incubation with keratinocyte growth factor increased their uptake 2.5-fold. ILK-deficient mouse keratinocytes internalized bacteria 2- to 4-fold less efficiently than normal cells. The reduced invasion by live S. aureus of ILK-deficient cells was restored in the presence of exogenous, constitutively active Rac1. Thus, Rac1 functions downstream from ILK during invasion. Further, invasion by S. aureus of Rac1-deficient cells was 2.5-fold lower than in normal cells. Paradoxically, staphylococcal cutaneous penetration of mouse skin explants with ILK-deficient epidermis was 35-fold higher than that of normal skin, indicating defects in epidermal barrier function in the absence of ILK. Thus, we identified an ILK-Rac1 pathway essential for bacterial invasion of keratinocytes, and established ILK as a key contributor to prevent invasive staphylococcal cutaneous infection. © FASEB.

  10. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Bernard, Eric; Hamel, Rodolphe; Neyret, Aymeric; Ekchariyawat, Peeraya; Molès, Jean-Pierre; Simmons, Graham; Chazal, Nathalie; Desprès, Philippe

    2015-01-01

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  11. The effects of Sophora angustifolia and other natural plant extracts on melanogenesis and melanin transfer in human skin cells.

    Science.gov (United States)

    Singh, Suman K; Baker, Richard; Wibawa, Judata I D; Bell, Mike; Tobin, Desmond J

    2013-01-01

    Skin pigmentation is a multistep process of melanin synthesis by melanocytes, its transfer to recipient keratinocytes and its degradation. As dyspigmentation is a prominent marker of skin ageing, novel effective agents that modulate pigmentation safely are being sought for both clinical and cosmetic use. Here, a number of plant extracts were examined for their effect on melanogenesis (by melanin assay and Western blotting) and melanin transfer (by confocal immunomicroscopy of gp100-positive melanin granules in cocultures and by SEM analysis of filopodia), in human melanocytes and in cocultures with phototype-matched normal adult epidermal keratinocytes. Mulberry, Kiwi and Sophora extracts were assessed against isobutylmethylxanthine, hydroquinone, vitamin C and niacinamide. Compared with unstimulated control, all extracts significantly reduced melanogenesis in human melanoma cells and normal adult epidermal melanocytes. These extracts also reduced melanin transfer and reduced filopodia expression on melanocytes, similar to hydroquinone and niacinamide, indicating their effectiveness as multimode pigmentation actives. © 2013 John Wiley & Sons A/S.

  12. Brassica rapa hairy root extracts promote skin depigmentation by modulating melanin production and distribution

    NARCIS (Netherlands)

    Sena, Luigi Michele; Zappelli, Claudia; Apone, Fabio; Barbulova, Ani; Tito, Annalisa; Leone, Antonella; Oliviero, Teresa; Ferracane, Rosalia; Fogliano, Vincenzo; Colucci, Gabriella

    2018-01-01

    Background: Skin whitening products, used for ages by Asian people for cultural and esthetic purposes, are very popular nowadays in Western countries as well, where the need to inhibit skin spots after sun exposure has become not only a cosmetic but also a health-related issue. Thus, the

  13. Modulating the skin barrier function by DMSO: molecular dynamics simulations of hydrophilic and hydrophobic transmembrane pores

    NARCIS (Netherlands)

    den Otter, Wouter K.; Notman, R.; Anwar, J.; Noro, M.G.; Briels, Willem J.

    2008-01-01

    The dense lipid bilayers at the outer surface of the skin represent the primary barrier to molecules penetrating the human skin. One approach to overcome this barrier, with promising applications in administering medicinal drugs to the body, is to employ chemical permeability enhancers. How these

  14. Changes in dermal matrix in the absence of Rac1 in keratinocytes

    DEFF Research Database (Denmark)

    Stanley, Alanna; Pedersen, Esben Ditlev Kølle; Brakebusch, Cord

    2016-01-01

    Keratinocytes, in response to irritants, secrete pro-inflammatory mediators which recruit and activate immune and mesenchymal cells, including fibroblasts, to repair the skin. Fibroblasts respond by synthesising collagen and promoting the crosslinking extracellular matrix (ECM). We recently showed....... As inflammation is intimately linked with fibrotic disease in the skin, this raised the question as to whether this deletion may also affect the deposition and arrangement of the dermal ECM. This study assessed the effects of Rac1 deletion in keratinocytes and of the heightened inflammatory status by induction...... that this increase in the diameter of collagen fibrils due to inflammation may serve as pre-fibrotic marker enabling earlier determination of fibrosis and earlier treatment. This study has revealed previously unknown effects on the ECM due to the deletion of Rac1 in keratinocytes....

  15. T-plastin expression downstream to the calcineurin/NFAT pathway is involved in keratinocyte migration.

    Directory of Open Access Journals (Sweden)

    Cécilia Brun

    Full Text Available Cutaneous wound healing requires keratinocyte proliferation, migration and differentiation to restore the barrier function of the skin. The calcineurin/nuclear factor of activated-T-cell (NFAT signaling pathway has been recently shown to be involved in keratinocyte growth, differentiation and migration. It is induced by an increased intracellular calcium rate and its inhibition results in decreased capacities of keratinocytes to migrate. Nevertheless, the link between calcineurin activation and keratinocyte migration remains unknown. Recently, Orai1, a pore subunit of a store-operated calcium channel that favors calcium influx, was shown to play a critical role to control proliferation and migration of basal keratinocytes. Of interest, the actin-bundling T-plastin is crucial in cell motility through cross-linking to actin filament and its synthesis was shown to be induced by calcium influx and regulated by the calcineurin/NFAT pathway in tumor Sezary cells. We investigated herein the role of the calcineurin/NFAT pathway-dependent T-plastin in keratinocyte migration, by quantifying T-plastin expression in keratinocytes and by analyzing their migration under calcineurin inhibition or knockdown of NFAT2 or T-plastin. We did confirm the role of the calcineurin/NFAT pathway in keratinocyte migration as shown by their decreased capacities to migrate after FK506 treatment or siNFAT2 transfection in both scratching and Boyden assays. The expression of NFAT2 and T-plastin in keratinocytes was decreased under FK506 treatment, suggesting that T-plastin plays a role in keratinocyte migration downstream to the calcineurin/NFAT pathway. Accordingly, siRNA knockdown of T-plastin expression also decreased their migration capacities. Actin lamellipodia formation as well as FAK and β6-integrin expression were also significantly decreased after treatment with FK506 or siRNA, reinforcing that NFAT2-dependent T-plastin expression plays a role in keratinocyte

  16. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  17. Skin-Sparing Radiation Using Intensity-Modulated Radiotherapy After Conservative Surgery in Early-Stage Breast Cancer: A Planning Study

    International Nuclear Information System (INIS)

    Saibishkumar, Elantholi P.; MacKenzie, Marc A.; Severin, Diane; Mihai, Alina; Hanson, John M.Sc.; Daly, Helene; Fallone, Gino; Parliament, Matthew B.; Abdulkarim, Bassam S.

    2008-01-01

    Purpose: To evaluate the feasibility of skin-sparing by configuring it as an organ-at-risk (OAR) while delivering whole-breast intensity-modulated radiotherapy (IMRT) in early breast cancer. Methods and Materials: Archival computed tomography scan images of 14 left-sided early-breast tumor patients who had undergone lumpectomy were selected for this study. Skin was contoured as a 4- to 5-mm strip extending from the patient outline to anterior margin of the breast planning target volume (PTV). Two IMRT plans were generated by the helical tomotherapy approach to deliver 50 Gy in 25 fractions to the breast alone: one with skin dose constraints (skin-sparing plan) and the other without (non-skin-sparing plan). Comparison of the plans was done using a two-sided paired Student t test. Results: The mean skin dose and volume of skin receiving 50 Gy were significantly less with the skin-sparing plan compared with non-skin-sparing plan (42.3 Gy vs. 47.7 Gy and 12.2% vs. 57.8% respectively; p < 0.001). The reduction in skin dose was confirmed by TLD measurements in anthropomorphic phantom using the same plans. Dose-volume analyses for other OARs were similar in both plans. Conclusions: By configuring the skin as an OAR, it is possible to achieve skin dose reduction while delivering whole-breast IMRT without compromising dose profiles to PTV and OARs

  18. Essential role of integrin-linked kinase in regulation of phagocytosis in keratinocytes.

    Science.gov (United States)

    Sayedyahossein, Samar; Nini, Lylia; Irvine, Timothy S; Dagnino, Lina

    2012-10-01

    Phagocytic melanosome uptake by epidermal keratinocytes is a central protective mechanism against damage induced by ultraviolet radiation. Phagocytosis requires formation of pseudopodia via actin cytoskeleton rearrangements. Integrin-linked kinase (ILK) is an important modulator of actin cytoskeletal dynamics. We have examined the role of ILK in regulation of phagocytosis, using epidermal keratinocytes isolated from mice with epidermis-restricted Ilk gene inactivation. ILK-deficient cells exhibited severely impaired capacity to engulf fluorescent microspheres in response to stimulation of the keratinocyte growth factor (KGF) receptor or the protease-activated receptor-2. KGF induced ERK phosphorylation in ILK-expressing and ILK-deficient cells, suggesting that ILK is not essential for KGF receptor signaling. In contrast, KGF promoted activation of Rac1 and formation of pseudopodia in ILK-expressing, but not in ILK-deficient cells. Rac1-deficient keratinocytes also showed substantially impaired phagocytic ability, underlining the importance of ILK-dependent Rac1 function for particle engulfment. Finally, cross-modulation of KGF receptors by integrins may be another important element, as integrin β1-deficient keratinocytes also fail to show significant phagocytosis in response to KGF. Thus, we have identified a novel signaling pathway essential for phagocytosis in keratinocytes, which involves ILK-dependent activation of Rac1 in response to KGF, resulting in the formation of pseudopodia and particle uptake.

  19. Skin dose for head and neck cancer patients treated with intensity-modulated radiation therapy(IMRT)

    Science.gov (United States)

    Fu, Hsiao-Ju; Li, Chi-Wei; Tsai, Wei-Ta; Chang, Chih-Chia; Tsang, Yuk-Wah

    2017-11-01

    The reliability of thermoluminescent dosimeters (ultrathin TLD) and ISP Gafchromic EBT2 film to measure the surface dose in phantom and the skin dose in head-and-neck patients treated with intensity-modulated radiation therapy technique(IMRT) is the research focus. Seven-field treatment plans with prescribed dose of 180 cGy were performed on Eclipse treatment planning system which utilized pencil beam calculation algorithm(PBC). In calibration tests, the variance coefficient of the ultrathin TLDs were within 3%. The points on the calibration curve of the Gafchromic film was within 1% variation. Five measurements were taken on phantom using ultrathin TLD and EBT2 film respectively. The measured mean surface doses between ultrathin TLD or EBT2 film were within 5% deviation. Skin doses of 6 patients were measured for initial 5 fractions and the mean dose per-fraction was calculated. If the extrapolated doses for 30 fractions were below 4000 cGy, the skin reaction grading observed according to Radiation Therapy Oncology Group (RTOG) was either grade 1 or grade 2. If surface dose exceeded 5000 cGy in 32 fractions, then grade 3 skin reactions were observed.

  20. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  1. Smad4 disruption accelerates keratinocyte reepithelialization in murine cutaneous wound repair.

    Science.gov (United States)

    Yang, Leilei; Li, Wenlong; Wang, Shaoxia; Wang, Lijuan; Li, Yang; Yang, Xiao; Peng, Ruiyun

    2012-10-01

    Keratinocyte reepithelialization is a rate-limiting event in cutaneous wound repair, which involves the migration and proliferation of keratinocytes to cover the denuded dermal surface. Transforming growth factor-β1 (TGF-β1) has the ability to induce epithelial cell migration while inhibiting proliferation, and controversial results have been generated regarding the effect of TGF-β signaling on reepithelialization. In this study, full-thickness skin wounds were made in keratinocyte-specific Smad4 knockout and the control mice. The wound closure, reepithelialization, keratinocyte proliferation, myofibroblast numbers and collagen deposition of were assessed. The results showed that the proliferation of keratinocytes increased, which accelerated the reepithelialization, and led to faster wound repair in the epidermis of Smad4 mutant mice. Upregulation of keratin 17, 14-3-3 sigma and phosphorylated AKT in the hyperproliferative epidermis may be correlated with the accelerated reepithelialization. We conclude that Smad4 plays an inhibitory role in the keratinocyte-mediated reepithelialization of wound healing.

  2. Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo

    International Nuclear Information System (INIS)

    Kioka, Noriyuki; Ito, Takuya; Yamashita, Hiroshi; Uekawa, Natsuko; Umemoto, Tsutomu; Motoyoshi, Soh; Imai, Hiroshi; Takahashi, Kenzo; Watanabe, Hideto; Yamada, Masayasu; Ueda, Kazumitsu

    2010-01-01

    In the process of tissue injury and repair, epithelial cells rapidly migrate and form epithelial sheets. Vinexin is a cytoplasmic molecule of the integrin-containing cell adhesion complex localized at focal contacts in vitro. Here, we investigated the roles of vinexin in keratinocyte migration in vitro and wound healing in vivo. Vinexin knockdown using siRNA delayed migration of both HaCaT human keratinocytes and A431 epidermoid carcinoma cells in scratch assay but did not affect cell proliferation. Induction of cell migration by scratching the confluent monolayer culture of these cells activated both EGFR and ERK, and their inhibitors AG1478 and U0126 substantially suppressed scratch-induced keratinocyte migration. Vinexin knockdown in these cells inhibited the scratch-induced activation of EGFR, but not that of ERK, suggesting that vinexin promotes cell migration via activation of EGFR. We further generated vinexin (-/-) mice and isolated their keratinocytes. They similarly showed slow migration in scratch assay. Furthermore, vinexin (-/-) mice exhibited a delay in cutaneous wound healing in both the back skin and tail without affecting the proliferation of keratinocytes. Together, these results strongly suggest a crucial role of vinexin in keratinocyte migration in vitro and cutaneous wound healing in vivo.

  3. Galectin-7 overexpression is associated with the apoptotic process in UVB-induced sunburn keratinocytes

    Science.gov (United States)

    Bernerd, Francoise; Sarasin, Alain; Magnaldo, Thierry

    1999-01-01

    Galectin-7 is a β-galactoside binding protein specifically expressed in stratified epithelia and notably in epidermis, but barely detectable in epidermal tumors and absent from squamous carcinoma cell lines. Galectin-7 gene is an early transcriptional target of the tumor suppressor protein P53 [Polyak, K., Xia, Y., Zweier, J., Kinzler, K. & Vogelstein, B. (1997) Nature (London) 389, 300–305]. Because p53 transcriptional activity is increased by genotoxic stresses we have examined the possible effects of ultraviolet radiations (UVB) on galectin-7 expression in epidermal keratinocytes. The amounts of galectin-7 mRNA and protein are increased rapidly after UVB irradiation of epidermal keratinocytes. The increase of galectin-7 is parallel to P53 stabilization. UVB irradiation of skin reconstructed in vitro and of human skin ex vivo demonstrates that galectin-7 overexpression is associated with sunburn/apoptotic keratinocytes. Transfection of a galectin-7 expression vector results in a significant increase in terminal deoxynucleotidyltransferase-mediated UTP end labeling-positive keratinocytes. The present findings demonstrate a keratinocyte-specific protein involved in the UV-induced apoptosis, an essential process in the maintenance of epidermal homeostasis. PMID:10500176

  4. Ecklonia cava Extract and Dieckol Attenuate Cellular Lipid Peroxidation in Keratinocytes Exposed to PM10.

    Science.gov (United States)

    Lee, Jeong-Won; Seok, Jin Kyung; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter can cause oxidative stress, inflammation, and premature skin aging. Marine plants such as Ecklonia cava Kjellman contain high amounts of polyphenolic antioxidants. The purpose of this study was to examine the antioxidative effects of E. cava extract in cultured keratinocytes exposed to airborne particulate matter with a diameter of <10  μ m (PM10). After the exposure of cultured HaCaT keratinocytes to PM10 in the absence and presence of E. cava extract and its constituents, cell viability and cellular lipid peroxidation were assessed. The effects of eckol and dieckol on cellular lipid peroxidation and cytokine expression were examined in human epidermal keratinocytes exposed to PM10. The total phenolic content of E. cava extract was the highest among the 50 marine plant extracts examined. The exposure of HaCaT cells to PM10 decreased cell viability and increased lipid peroxidation. The PM10-induced cellular lipid peroxidation was attenuated by E. cava extract and its ethyl acetate fraction. Dieckol more effectively attenuated cellular lipid peroxidation than eckol in both HaCaT cells and human epidermal keratinocytes. Dieckol and eckol attenuated the expression of inflammatory cytokines such as tumor necrosis factor- (TNF-) α , interleukin- (IL-) 1 β , IL-6, and IL-8 in human epidermal keratinocytes stimulated with PM10. This study suggested that the polyphenolic constituents of E. cava , such as dieckol, attenuated the oxidative and inflammatory reactions in skin cells exposed to airborne particulate matter.

  5. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  6. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-01-01

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  7. UK-based prospective cohort study to anglicise and validate the FACE-Q Skin Cancer Module in patients with facial skin cancer undergoing surgical reconstruction: the PROMISCR (Patient-Reported Outcome Measure in Skin Cancer Reconstruction) study.

    Science.gov (United States)

    Dobbs, Thomas; Hutchings, Hayley A; Whitaker, Iain S

    2017-09-24

    Skin cancer is the most common malignancy worldwide, often occurring on the face, where the cosmetic outcome of treatment is paramount. A number of skin cancer-specific patient-reported outcome measures (PROMs) exist, however none adequately consider the difference in type of reconstruction from a patient's point of view. It is the aim of this study to 'anglicise' (to UK English) a recently developed US PROM for facial skin cancer (the FACE-Q Skin Cancer Module) and to validate this UK version of the PROM. The validation will also involve an assessment of the items for relevance to facial reconstruction patients. This will either validate this new measure for the use in clinical care and research of various facial reconstructive options, or provide evidence that a more specific PROM is required. This is a prospective validation study of the FACE-Q Skin Cancer Module in a UK facial skin cancer population with a specific focus on the difference between types of reconstruction. The face and content validity of the FACE-Q questionnaire will initially be assessed by a review process involving patients, skin cancer specialists and methodologists. An assessment of whether questions are relevant and any missing questions will be made. Initial validation will then be carried out by recruiting a cohort of 100 study participants with skin cancer of the face pre-operatively. All eligible patients will be invited to complete the questionnaire preoperatively and postoperatively. Psychometric analysis will be performed to test validity, reliability and responsiveness to change. Subgroup analysis will be performed on patients undergoing different forms of reconstruction postexcision of their skin cancer. This study has been approved by the West Midlands, Edgbaston Research Ethics Committee (Ref 16/WM/0445). All personal data collected will be anonymised and patient-specific data will only be reported in terms of group demographics. Identifiable data collected will include the

  8. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi; Kotani, Eiji; Hirano, Tomoko; Nakajima, Yumiko; Matsumoto, Goichi; Mori, Hajime

    2014-01-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  9. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  10. Neurohumoral mechanisms of keratinocytes regulation in diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Ekaterina Viktorovna Artemova

    2016-12-01

    Full Text Available The extent of damage to the nervous, vascular and microcirculatory systems in diabetic patients determine the regulation of physiological events that lead to the formation of chronic wounds, reduction of patient quality of life and increase of the financial value of medical care. Successful physiological repair is impossible without the successive phases of inflammation, proliferation and wound healing. Keratinocytes are the major cellular barrier components of the epidermis. These cells play an important role in physiological repair, as suggested by recent research, with many cells able to secrete steroid hormones de novo. Damage to the integrity of the skin leads to keratinocyte activation, triggering a cascade of reactions that contribute to changes in epidermal cell phenotype and lead to their proliferation and migration, analogous to changes in cellular adhesion and configuration of the cytoskeleton. An open question remains as to how the keratinocyte cell cycle, which is altered under conditions of hyperglycemia, and neurotransmitter metabolism during different stages of physiological repair are regulated. Understanding these processes will provide a scientific basis for the development of new targets for pharmacotherapies.

  11. Platelets Regulate the Migration of Keratinocytes via Podoplanin/CLEC-2 Signaling during Cutaneous Wound Healing in Mice.

    Science.gov (United States)

    Asai, Jun; Hirakawa, Satoshi; Sakabe, Jun-ichi; Kishida, Tsunao; Wada, Makoto; Nakamura, Naomi; Takenaka, Hideya; Mazda, Osam; Urano, Tetsumei; Suzuki-Inoue, Katsue; Tokura, Yoshiki; Katoh, Norito

    2016-01-01

    Podoplanin is an endogenous ligand for C-type lectin-like receptor 2 (CLEC-2), which is expressed on platelets. Recent evidence indicates that this specific marker of lymphatic endothelial cells is also expressed by keratinocytes at the edge of wounds. However, whether podoplanin or platelets play a role in keratinocyte activity during wound healing remains unknown. We evaluated the effect of podoplanin expression levels on keratinocyte motility using cultured primary normal human epidermal keratinocytes (NHEKs). Down-regulation of podoplanin in NHEKs via transfection with podoplanin siRNA inhibited their migration, indicating that podoplanin plays a mandatory role in this process. In addition, down-regulation of podoplanin was correlated with up-regulation of E-cadherin, suggesting that podoplanin-mediated stimulation of keratinocyte migration is associated with a loss of E-cadherin. Both the addition of platelets and treatment with CLEC-2 inhibited the migration of NHEKs. The down-regulation of RhoA activity and the up-regulation of E-cadherin in keratinocytes were also induced by CLEC-2. In conclusion, these results suggest that podoplanin/CLEC-2 signaling regulates keratinocyte migration via modulating E-cadherin expression through RhoA signaling. Altering the regulation of keratinocyte migration by podoplanin might be a novel therapeutic approach to improve wound healing. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  12. Cryopreservation of dermal fibroblasts and keratinocytes in hydroxyethyl starch-based cryoprotectants.

    Science.gov (United States)

    Naaldijk, Yahaira; Johnson, Adiv A; Friedrich-Stöckigt, Annett; Stolzing, Alexandra

    2016-12-01

    Preservation of human skin fibroblasts and keratinocytes is essential for the creation of skin tissue banks. For successful cryopreservation of cells, selection of an appropriate cryoprotectant agent (CPA) is imperative. The aim of this study was to identify CPAs that minimize toxic effects and allow for the preservation of human fibroblasts and keratinocytes in suspension and in monolayers. We cryopreserved human fibroblasts and keratinocytes with different CPAs and compared them to fresh, unfrozen cells. Cells were frozen in the presence and absence of hydroxyethyl starch (HES) or dimethyl sulfoxide (DMSO), the latter of which is a commonly used CPA known to exert toxic effects on cells. Cell numbers were counted immediately post-thaw as well as three days after thawing. Cellular structures were analyzed and counted by labeling nuclei, mitochondria, and actin filaments. We found that successful cryopreservation of suspended or adherent keratinocytes can be accomplished with a 10% HES or a 5% HES, 5% DMSO solution. Cell viability of fibroblasts cryopreserved in suspension was maintained with 10% HES or 5% HES, 5% DMSO solutions. Adherent, cryopreserved fibroblasts were successfully maintained with a 5% HES, 5% DMSO solution. We conclude that skin tissue cells can be effectively cryopreserved by substituting all or a portion of DMSO with HES. Given that DMSO is the most commonly used CPA and is believed to be more toxic than HES, these findings are of clinical significance for tissue-based replacement therapies. Therapies that require the use of keratinocyte and fibroblast cells, such as those aimed at treating skin wounds or skin burns, may be optimized by substituting a portion or all of DMSO with HES during cryopreservation protocols.

  13. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  14. N-Acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191): an anti-inflammatory molecule that increases the expression of the aquaglyceroporin, aquaporin-3, in human keratinocytes.

    Science.gov (United States)

    Fernández, José R; Webb, Corey; Rouzard, Karl; Voronkov, Michael; Huber, Kristen L; Stock, Jeffry B; Stock, Maxwell; Gordon, Joel S; Perez, Eduardo

    2017-03-01

    Isoprenylcysteine (IPC) small molecules were discovered as signal transduction modulating compounds ~25 years ago. More recently, IPC molecules have demonstrated antioxidant and anti-inflammatory properties in a variety of dermal cells as well as antimicrobial activity, representing a novel class of compounds to ameliorate skin conditions and disease. Here, we demonstrate a new IPC compound, N-acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191), which inhibits UVB-induced inflammation blocking pro-inflammatory cytokine interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) production. To investigate further the previously reported hydrating potential of IPC compounds, SIG-1191 was tested for its ability to modulate aquaporin expression. Specifically, aquaporin 3 (AQP3) the most abundant aquaporin found in skin has been reported to play a key role in skin hydration, elasticity and barrier repair. Results show here for the first time that SIG-1191 increases AQP3 expression in both cultured normal human epidermal keratinocytes as well as when applied topically in a three-dimensional (3D) reconstructed human skin equivalent. Additionally, SIG-1191 dose dependently increased AQP3 protein levels, as determined by specific antibody staining, in the epidermis of the 3D skin equivalents. To begin to elucidate which signaling pathways SIG-1191 may be modulating to increase AQP3 levels, we used several pharmacological pathway inhibitors and determined that AQP3 expression is mediated by the Mitogen-activated protein kinase/Extracellular signal-regulated kinase kinase (MEK) pathway. Altogether, these data suggest SIG-1191 represents a new IPC derivative with anti-inflammatory activity that may also promote increased skin hydration based on its ability to increase AQP3 levels.

  15. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W. [Kaohsiung Medical College (Taiwan). Dept. of Dermatology; Chiang, L.-C. [Kaohsiung Medical College (Taiwan). Dept. of Microbiology and Immunology; Yu, C.-L. [National Yang-Ming University School of Medicine (Taiwan). Veterans General Hospital-Taipei

    1996-08-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm{sup 2} UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author).

  16. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W.; Chiang, L.-C.; Yu, C.-L.

    1996-01-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm 2 UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author)

  17. Deletion of epidermal Rac1 inhibits HPV-8 induced skin papilloma formation and facilitates HPV-8- and UV-light induced skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Pfister, Herbert; Haase, Ingo

    2016-09-06

    Overexpression and increased activity of the small Rho GTPase Rac1 has been linked to squamous cell carcinoma of the epidermis and mucosa in humans. Targeted deletion of Rac1 or inhibition of Rac1 activity in epidermal keratinocytes reduced papilloma formation in a chemical skin carcinogenesis mouse model. However, a potential role of Rac1 in HPV- and UV-light induced skin carcinogenesis has not been investigated so far, solar UV radiation being an important carcinogen to the skin.To investigate this, we deleted Rac1 or modulated its activity in mice with transgenic expression of Human papilloma virus type-8 (HPV-8) in epidermal keratinocytes. Our data show that inhibition or deletion of Rac1 results in reduced papilloma formation upon UV-irradiation with a single dose, whereas constitutive activation of Rac1 strongly increases papilloma frequency in these mice. Surprisingly, we observed that, upon chronic UV-irradiation, the majority of mice with transgenic expression of HPV-8 and epidermis specific Rac1 deletion developed squamous cell carcinomas. Taken together, our data show that Rac1 exerts a dual role in skin carcinogenesis: its activation is, on one hand, required for HPV-8- and UV-light induced papilloma formation but, on the other, suppresses the development of squamous cell carcinomas.

  18. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  19. Posidonia oceanica (L. Delile Ethanolic Extract Modulates Cell Activities with Skin Health Applications

    Directory of Open Access Journals (Sweden)

    Laura Cornara

    2018-01-01

    Full Text Available Seagrasses are high plants sharing adaptive metabolic features with both terrestrial plants and marine algae, resulting in a phytocomplex possibly endowed with interesting biological properties. The aim of this study is to evaluate the in vitro activities on skin cells of an ethanolic extract obtained from the leaves of Posidonia oceanica (L. Delile, family Potamogetonaceae, herein named Posidonia ethanolic extract (PEE. PEE showed high radical scavenging activity, high phenolic content, and resulted rich in chicoric acid, as determined through HPLC-MS analysis. The use of MTT assay on fibroblasts showed a PEE cytotoxicity threshold (IC05 of 50 µg/mL at 48 h, while a sub-toxic dose of 20 µg/mL induced a significant increase of fibroblast growth rate after 10 days. In addition, an ELISA assay revealed that PEE doses of 5 and 10 µg/mL induced collagen production in fibroblasts. PEE induced dose-dependent mushroom tyrosinase inhibition, up to about 45% inhibition at 1000 µg/mL, while 50% reduction of melanin was observed in melanoma cells exposed to 50 µg/mL PEE. Finally, PEE lipolytic activity was assessed by measuring glycerol release from adipocytes following triglyceride degradation. In conclusion, we have collected new data about the biological activities of the phytocomplex of P. oceanica seagrass on skin cells. Our findings indicate that PEE could be profitably used in the development of products for skin aging, undesired hyperpigmentation, and cellulite.

  20. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  1. A Patient with Multiple Keratinocytic Cancers (MKC: Uncommon Presentation in a Bulgarian Patient

    Directory of Open Access Journals (Sweden)

    Georgi Tchernev

    2018-01-01

    Full Text Available Keratinocyte skin cancers, including basal cell carcinoma (BCC and squamous cell carcinoma (SCC, are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not.  Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  2. A Patient with Multiple Keratinocytic Cancers (MKC): Uncommon Presentation in a Bulgarian Patient.

    Science.gov (United States)

    Tchernev, Georgi; Philipov, Stanislav; Chokoeva, Anastasiya Atanasova; Wollina, Uwe; Lotti, Torello; Lozev, Ilia; Yungareva, Irina; Maximov, Georgi Konstantinov

    2018-01-25

    Keratinocyte skin cancers, including basal cell carcinoma (BCC) and squamous cell carcinoma (SCC), are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not. Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  3. Podoplanin expression in peritumoral keratinocytes predicts aggressive behavior in extramammary Paget's disease.

    Science.gov (United States)

    Cho, Zaigen; Konishi, Eiichi; Kanemaru, Mai; Isohisa, Taro; Arita, Takahiro; Kawai, Minako; Tsutsumi, Miho; Mizutani, Hiromi; Takenaka, Hideya; Ozawa, Toshiyuki; Tsuruta, Daisuke; Katoh, Norito; Asai, Jun

    2017-07-01

    Recent studies have demonstrated podoplanin expression in several tumors, which has been associated with lymph node metastasis and poor prognosis. Podoplanin expression in peritumoral cells such as cancer-associated fibroblasts also correlates with tumor progression in several cancers. However, podoplanin expression and its association with extramammary Paget's disease (EMPD) remain unclear. In this study, we examined whether the presence of podoplanin expression in tumor cells or peritumoral basal keratinocytes correlated with aggressive behavior in patients with EMPD and investigated the mechanisms of podoplanin-mediated tumor invasion in this disorder. Skin samples of 37 patients with EMPD were investigated by immunohistochemical analysis. The functions of podoplanin in keratinocytes were examined in vitro by RT-PCR and with invadopodia gelatin-degradation assays using HaCaT cells. Podoplanin was not identified in tumor cells in all cases. Podoplanin expression in peritumoral basal keratinocytes was observed in 25 patients (67.6%). In in situ EMPD, 50% of cases (9 in 18) exhibited podoplanin-positive keratinocytes, whereas 84.2% (16 in 19) demonstrated positive staining in invasive EMPD (P<0.05). Podoplanin expression in peritumoral keratinocytes was also associated with tumor thickness (P<0.005). By immunohistochemical analysis, podoplanin-positive peritumoral keratinocytes were found to be negative for E-cadherin, one of the major adhesion molecules of keratinocytes, which might contribute to tumor invasion into the dermis through a crack in the basal cell layer induced by down-regulation of cell adhesion therein. We further found that podoplanin-positive keratinocytes exhibited invadopodia, which are thought to function in the migration of cancer cells through tissue barriers, indicating that podoplanin-positive peritumoral basal keratinocytes might assist tumor invasion by degrading the extracellular matrix. The presence of podoplanin expression in

  4. Studies in human skin epithelial cell carcinogenesis

    International Nuclear Information System (INIS)

    Lehman, T.A.

    1987-01-01

    Metabolism and DNA adduct formation of benzo[a]pyrene (BP) by human epidermal keratinocytes pretreated with inhibitors or inducer of cytochrame P450 was studied. To study DNA adduct analysis, cultures were pretreated as described above, and then treated with non-radiolabeled BP. DNA was prepared from these cultures, digested to the nucleotide level, and 32 P-postlabeled for adduct analysis. Cultures pretreated with BHA, 7,8-BF or disulfiralm formed significantly fewer BPDE I-dB adducts than non-pretreated cultures, while cultures pretreated with MeBHA formed more BPDE-I-dG adducts. MeBHA increased BP activation and adduct formation inhuman keratinocyte in cultures by inducing a specific isoenzyme of cytochrome P450 which preferentially increases the oxidative metabolism of BP to 7,8 diol BP and 7,8 diol BP to BPDE I. To approximate an in vivo human system, metabolism of BPDE I by human skin xenografts treated with cell cycles modulators was studied. When treated with BPDE I, specific carcinogen-DNA adducts were formed. Separation and identification of these adducts by the 32 P-postlabeling technique indicated that the 7R- and 7S-BPDE I-dG adducts were the major adducts

  5. Direct 3D cell-printing of human skin with functional transwell system.

    Science.gov (United States)

    Kim, Byoung Soo; Lee, Jung-Seob; Gao, Ge; Cho, Dong-Woo

    2017-06-06

    Three-dimensional (3D) cell-printing has been emerging as a promising technology with which to build up human skin models by enabling rapid and versatile design. Despite the technological advances, challenges remain in the development of fully functional models that recapitulate complexities in the native tissue. Moreover, although several approaches have been explored for the development of biomimetic human skin models, the present skin models based on multistep fabrication methods using polydimethylsiloxane chips and commercial transwell inserts could be tackled by leveraging 3D cell-printing technology. In this paper, we present a new 3D cell-printing strategy for engineering a 3D human skin model with a functional transwell system in a single-step process. A hybrid 3D cell-printing system was developed, allowing for the use of extrusion and inkjet modules at the same time. We began by revealing the significance of each module in engineering human skin models; by using the extrusion-dispensing module, we engineered a collagen-based construct with polycaprolactone (PCL) mesh that prevented the contraction of collagen during tissue maturation; the inkjet-based dispensing module was used to uniformly distribute keratinocytes. Taking these features together, we engineered a human skin model with a functional transwell system; the transwell system and fibroblast-populated dermis were consecutively fabricated by using the extrusion modules. Following this process, keratinocytes were uniformly distributed onto the engineered dermis by the inkjet module. Our transwell system indicates a supportive 3D construct composed of PCL, enabling the maturation of a skin model without the aid of commercial transwell inserts. This skin model revealed favorable biological characteristics that included a stabilized fibroblast-stretched dermis and stratified epidermis layers after 14 days. It was also observed that a 50 times reduction in cost was achieved and 10 times less medium was

  6. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  7. Rapid adhesion and proliferation of keratinocytes on the gold colloid/chitosan film scaffold

    International Nuclear Information System (INIS)

    Zhang Yi; He Hong; Gao Wenjuan; Lu Shuangyun; Liu Yang; Gu Haiying

    2009-01-01

    The gold colloid/chitosan film scaffold, which could enhance the attached ratio and accelerate proliferation of newborn mice keratinocytes, was fabricated by nanotechnology and self-assembly technology. This nanometer scaffold was characterized by atomic force microscopy (AFM) and scanning electron microscopy (SEM). The keratinocytes were cultured and observed on three different extracellular matrices (ECM): gold colloid/chitosan film scaffold, chitosan film and cell culture plastic (control groups). 6 h, 12 h, 24 h after inoculation, the cell attached ratios were calculated respectively. In comparison to control groups, this scaffold could significantly (P < 0.01) increase the attached ratio of keratinocytes and promote their growth. Meanwhile, there were not any fusiform fibroblasts growing on this scaffold. The rapidly proliferating keratinocytes were indentified and characterized by immunohistochemistry and transmissive electron microscope (TEM), which showed the cells maintain their biological activity well. The results indicated that gold colloid/chitosan film scaffold was nontoxic to keratinocytes, and was a good candidate for wound dressing in skin tissue engineering.

  8. Intracellular calcium modulates basolateral K(+)-permeability in frog skin epithelium

    DEFF Research Database (Denmark)

    Brodin, Birger; Rytved, K A; Nielsen, R

    1994-01-01

    Cytosolic calcium ([Ca2+]i) has been suggested as a key modulator in the regulation of active sodium transport across electrically "tight" (high resistance) epithelia. In this study we investigated the effects of calcium on cellular electrophysiological parameters in a classical model tissue, the...

  9. Equalization of Skin Effect Loss Dominated Channels using Pulse-Width Modulation (PWM) Pre-Emphasis

    NARCIS (Netherlands)

    Schrader, J.H.R.; Klumperink, Eric A.M.; Visschers, J.L.; Nauta, Bram

    2005-01-01

    A digital transmitter pre-emphasis technique is presented that is based on pulse-width modulation, instead of finite impulse response (FIR) filtering. The technique fits well to future high-speed low-voltage CMOS processes. A 0.13μm CMOS transmitter achieves more than 5Gb/s (2-PAM) over 25m of

  10. In vivo skin leptin modulation after 14 MeV neutron irradiation: a molecular and FT-IR spectroscopic study

    Energy Technology Data Exchange (ETDEWEB)

    Cestelli Guidi, M.; Mirri, C.; Marcelli, A. [Laboratori Nazionali di Frascati - INFN, Frascati, Rome (Italy); Fratini, E.; Amendola, R. [ENEA, UT BIORAD-RAB, Rome (Italy); Licursi, V.; Negri, R. [Universita La Sapienza, Dip. Biologia e Biotecnologie ' ' Charles Darwin' ' , Rome (Italy)

    2012-09-15

    This paper discusses gene expression changes in the skin of mice treated by monoenergetic 14 MeV neutron irradiation and the possibility of monitoring the resultant lipid depletion (cross-validated by functional genomic analysis) as a marker of radiation exposure by high-resolution FT-IR (Fourier transform infrared) imaging spectroscopy. The irradiation was performed at the ENEA Frascati Neutron Generator (FNG), which is specifically dedicated to biological samples. FNG is a linear electrostatic accelerator that produces up to 1.0 x 10{sup 11} 14-MeV neutrons per second via the D-T nuclear reaction. The functional genomic approach was applied to four animals for each experimental condition (unirradiated, 0.2 Gy irradiation, or 1 Gy irradiation) 6 hours or 24 hours after exposure. Coregulation of a subclass of keratin and keratin-associated protein genes that are physically clustered in the mouse genome and functionally related to skin and hair follicle proliferation and differentiation was observed. Most of these genes are transiently upregulated at 6 h after the delivery of the lower dose delivered, and drastically downregulated at 24 h after the delivery of the dose of 1 Gy. In contrast, the gene coding for the leptin protein was consistently upregulated upon irradiation with both doses. Leptin is a key protein that regulates lipid accumulation in tissues, and its absence provokes obesity. The tissue analysis was performed by monitoring the accumulation and the distribution of skin lipids using FT-IR imaging spectroscopy. The overall picture indicates the differential modulation of key genes during epidermis homeostasis that leads to the activation of a self-renewal process at low doses of irradiation. (orig.)

  11. In vivo skin leptin modulation after 14 MeV neutron irradiation: a molecular and FT-IR spectroscopic study.

    Science.gov (United States)

    Cestelli Guidi, M; Mirri, C; Fratini, E; Licursi, V; Negri, R; Marcelli, A; Amendola, R

    2012-09-01

    This paper discusses gene expression changes in the skin of mice treated by monoenergetic 14 MeV neutron irradiation and the possibility of monitoring the resultant lipid depletion (cross-validated by functional genomic analysis) as a marker of radiation exposure by high-resolution FT-IR (Fourier transform infrared) imaging spectroscopy. The irradiation was performed at the ENEA Frascati Neutron Generator (FNG), which is specifically dedicated to biological samples. FNG is a linear electrostatic accelerator that produces up to 1.0 × 10(11) 14-MeV neutrons per second via the D-T nuclear reaction. The functional genomic approach was applied to four animals for each experimental condition (unirradiated, 0.2 Gy irradiation, or 1 Gy irradiation) 6 hours or 24 hours after exposure. Coregulation of a subclass of keratin and keratin-associated protein genes that are physically clustered in the mouse genome and functionally related to skin and hair follicle proliferation and differentiation was observed. Most of these genes are transiently upregulated at 6 h after the delivery of the lower dose delivered, and drastically downregulated at 24 h after the delivery of the dose of 1 Gy. In contrast, the gene coding for the leptin protein was consistently upregulated upon irradiation with both doses. Leptin is a key protein that regulates lipid accumulation in tissues, and its absence provokes obesity. The tissue analysis was performed by monitoring the accumulation and the distribution of skin lipids using FT-IR imaging spectroscopy. The overall picture indicates the differential modulation of key genes during epidermis homeostasis that leads to the activation of a self-renewal process at low doses of irradiation.

  12. Evaluation of skin surface dose for head and neck cancer patients treated with intensity-modulated radiation therapy using in vivo dosimetry

    International Nuclear Information System (INIS)

    Kim, Yeon Sil; Lee, Dong Soo; Yoo, Mi Na; Hong, Joo Young; Yoon, Se Chul; Jang, Hong Suk

    2011-01-01

    Use of intensity-modulated radiation therapy (IMRT) for head and neck cancer is gradually increasing, because it could facilitate more sophsticated treatment of target volumes and reduction of acute and late sequelae. However, theoretically, there is a potential risk of increased skin surface dose resulting from multiple obliquity effects caused by multiple tangential beams. Moreover, we sometimes confronted with more skin reactions in the patients treated with IMRT than conventional techniques. In this study, we evaluated skin surface dose adjacent to the target volumes to verify whether the use of IMRT would increase the skin dose more than we predicted. This study had shown that the use of IMRT did not increase the skin surface hot point dose. The measured skin surface dose was 20 to 40 percent of the adjacent target prescription dose, and was within acceptable dose range. Our study had some limitations with small number of experimental patients and methodological problems. Potential risk of increasing skin dose with bolus effect of aquaplaster should be examined in the future trials. In addition, the accurate set-up verification should be maintained because of steep dose gradient between skin surface and target volumes within a short distance in the head and neck cancer patients.

  13. Melanosomes are transferred from melanocytes to keratinocytes through the processes of packaging, release, uptake, and dispersion.

    Science.gov (United States)

    Ando, Hideya; Niki, Yoko; Ito, Masaaki; Akiyama, Kaoru; Matsui, Mary S; Yarosh, Daniel B; Ichihashi, Masamitsu

    2012-04-01

    Recent studies have described the role of shedding vesicles as physiological conveyers of intracellular components between neighboring cells. Here we report that melanosomes are one example of shedding vesicle cargo, but are processed by a previously unreported mechanism. Pigment globules were observed to be connected to the filopodia of melanocyte dendrites, which have previously been shown to be conduits for melanosomes. Pigment globules containing multiple melanosomes were released from various areas of the dendrites of normal human melanocytes derived from darkly pigmented skin. The globules were then captured by the microvilli of normal human keratinocytes, also derived from darkly pigmented skin, which incorporated them in a protease-activated receptor-2 (PAR-2)-dependent manner. After the pigment globules were ingested by the keratinocytes, the membrane that surrounded each melanosome cluster was gradually degraded, and the individual melanosomes then spread into the cytosol and were distributed primarily in the perinuclear area of each keratinocyte. These results suggest a melanosome transfer pathway wherein melanosomes are transferred from melanocytes to keratinocytes via the shedding vesicle system. This packaging system generates pigment globules containing multiple melanosomes in a unique manner.

  14. Acrolein, an I-κBα-independent downregulator of NF-κB activity, causes the decrease in nitric oxide production in human malignant keratinocytes.

    Science.gov (United States)

    Moon, Ki-Young

    2011-05-01

    Acrolein, a reactive electrophilic α, β-unsaturated aldehyde, is known to be an alkylating chemical carcinogen. The effect of acrolein on the activation of NF-κB in human malignant epidermal keratinocytes was examined to elucidate the molecular mechanism associated with this NF-κB-acrolein regulation and its consecutive sequence, nitric oxide (NO) production. Acrolein significantly downregulated the cellular NF-κB activity up to 60% compared with control as well as the lipopolysaccharide (LPS)-induced NO production in a dose response manner at concentrations of 10~30 μM. To investigate the regulatory mechanism associated with this NF-κB-acrolein downregulation, the relative level of phosphorylation of I-κBα (serines-32 and -36), a principle regulator of NF-κB activation, represented by acrolein, was quantified. Acrolein inhibited NF-κB activity without altering cellular levels of the phosphorylated and nonphosphorylated forms of I-κBα, implying that the downregulatory effect of acrolein on cellular NF-κB activity in human skin cells is an I-κBα-independent activation pathway. The results suggests that acrolein causes the decrease in nitric oxide production as an I-κBα-independent downregulator of NF-κB activity in human malignant keratinocytes, and acrolein-induced carcinogenesis may be associated with the modulation of cellular NF-κB activity.

  15. Tofacitinib Represses the Janus Kinase-Signal Transducer and Activators of Transcription Signalling Pathway in Keratinocytes.

    Science.gov (United States)

    Srivastava, Ankit; Ståhle, Mona; Pivarcsi, Andor; Sonkoly, Enikö

    2018-05-08

    Tofacitinib is a Janus kinase (JAK) inhibitor, which has shown efficacy in treating psoriasis. The mode of action of tofacitinib is not completely understood but it has been thought to be mediated by the inhibition of CD4+ T-cell activation. Here, we investigated whether the molecular targets of tofacitinib are expressed in keratinocytes, and whether tofacitinib can modulate the activity of the JAK/Signal Transducer and Activators of Transcription (STAT)-pathway in keratinocytes. Transcriptomic profiling of human keratinocytes treated with IL-22 in combination with tofacitinib revealed that tofacitinib could prevent the majority of IL-22-mediated gene expression changes. Pathway analysis of tofacitinib-regulated genes in keratinocytes revealed enrichment of genes involved in the JAK/STAT signalling pathway. Quantitative real-time-PCR confirmed the upregulation of S100A7 and downregulation of EGR1 expression by IL-22, which was prevented by tofacitinib pre-treatment. These results indicate a direct effect of tofacinitib on keratinocytes, which can have relevance for systemic as well as for topical treatment of psoriasis with tofacitinib.

  16. Resveratrol Modulation of Protein Expression in parkin-Mutant Human Skin Fibroblasts: A Proteomic Approach

    Directory of Open Access Journals (Sweden)

    Daniele Vergara

    2017-01-01

    Full Text Available In this study, we investigated by two-dimensional gel electrophoresis (2-DE and mass spectrometry (MS analysis the effects of resveratrol treatment on skin primary fibroblasts from a healthy subject and from a parkin-mutant early onset Parkinson’s disease patient. Parkin, an E3 ubiquitin ligase, is the most frequently mutated gene in hereditary Parkinson’s disease. Functional alteration of parkin leads to impairment of the ubiquitin-proteasome system, resulting in the accumulation of misfolded or aggregated proteins accountable for the neurodegenerative process. The identification of proteins differentially expressed revealed that resveratrol treatment can act on deregulated specific biological process and molecular function such as cellular redox balance and protein homeostasis. In particular, resveratrol was highly effective at restoring the heat-shock protein network and the protein degradation systems. Moreover, resveratrol treatment led to a significant increase in GSH level, reduction of GSSG/GSH ratio, and decrease of reduced free thiol content in patient cells compared to normal fibroblasts. Thus, our findings provide an experimental evidence of the beneficial effects by which resveratrol could contribute to preserve the cellular homeostasis in parkin-mutant fibroblasts.

  17. Resveratrol Modulation of Protein Expression in parkin-Mutant Human Skin Fibroblasts: A Proteomic Approach

    Science.gov (United States)

    Gaballo, Antonio; Signorile, Anna; Tanzarella, Paola; Pacelli, Consiglia; Di Paola, Marco

    2017-01-01

    In this study, we investigated by two-dimensional gel electrophoresis (2-DE) and mass spectrometry (MS) analysis the effects of resveratrol treatment on skin primary fibroblasts from a healthy subject and from a parkin-mutant early onset Parkinson's disease patient. Parkin, an E3 ubiquitin ligase, is the most frequently mutated gene in hereditary Parkinson's disease. Functional alteration of parkin leads to impairment of the ubiquitin-proteasome system, resulting in the accumulation of misfolded or aggregated proteins accountable for the neurodegenerative process. The identification of proteins differentially expressed revealed that resveratrol treatment can act on deregulated specific biological process and molecular function such as cellular redox balance and protein homeostasis. In particular, resveratrol was highly effective at restoring the heat-shock protein network and the protein degradation systems. Moreover, resveratrol treatment led to a significant increase in GSH level, reduction of GSSG/GSH ratio, and decrease of reduced free thiol content in patient cells compared to normal fibroblasts. Thus, our findings provide an experimental evidence of the beneficial effects by which resveratrol could contribute to preserve the cellular homeostasis in parkin-mutant fibroblasts. PMID:29138676

  18. Mathematical modeling of calcium waves induced by mechanical stimulation in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuaki Kobayashi

    Full Text Available Recent studies have shown that the behavior of calcium in the epidermis is closely related to the conditions of the skin, especially the differentiation of the epidermal keratinocytes and the permeability barrier function, and therefore a correct understanding of the calcium dynamics is important in explaining epidermal homeostasis. Here we report on experimental observations of in vitro calcium waves in keratinocytes induced by mechanical stimulation, and present a mathematical model that can describe the experimentally observed wave behavior that includes finite-range wave propagation and a ring-shaped pattern. A mechanism of the ring formation hypothesized by our model may be related to similar calcium propagation patterns observed during the wound healing process in the epidermis. We discuss a possible extension of our model that may serve as a tool for investigating the mechanisms of various skin diseases.

  19. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  20. The stress caused by nitrite with titanium dioxide nanoparticles under UVA irradiation in human keratinocyte cell

    International Nuclear Information System (INIS)

    Tu, Min; Huang, Yi; Li, Hai-Ling; Gao, Zhong-Hong

    2012-01-01

    Highlights: ► Nitrite increased photo-toxicity of nano-TiO 2 on human keratinocyte cells in a dose-dependant manner. ► Morphological study suggested the cell death may be mediated by apoptosis inducing factor. ► Protein nitration was generated in the cells, and the most abundant nitrated protein was identified as cystatin-A. ► Tyr35 was the most likely site to be nitrated in cystatin-A. -- Abstract: Our previous work found that in the presence of nitrite, titanium dioxide nanoparticles can cause protein tyrosine nitration under UVA irradiation in vivo. In this paper, the human keratinocyte cells was used as a skin cell model to further study the photo-toxicity of titanium dioxide nanoparticles when nitrite was present. The results showed that nitrite increased the photo-toxicity of titanium dioxide in a dose-dependant manner, and generated protein tyrosine nitration in keratinocyte cells. Morphological study of keratinocyte cells suggested a specific apoptosis mediated by apoptosis inducing factor. It was also found the main target nitrated in cells was cystatin-A, which expressed abundantly in cytoplasm and functioned as a cysteine protease inhibitor. The stress induced by titanium dioxide with nitrite under UVA irradiation in human keratinocyte cells appeared to trigger the apoptosis inducing factor mediated cell death and lose the inhibition of active caspase by cystatin-A. We conclude that nitrite can bring new damage and stress to human keratinocyte cells with titanium dioxide nanoparticles under UVA irradiation.

  1. Abnormalities in the basement membrane structure promote basal keratinocytes in the epidermis of hypertrophic scars to adopt a proliferative phenotype.

    Science.gov (United States)

    Yang, Shaowei; Sun, Yexiao; Geng, Zhijun; Ma, Kui; Sun, Xiaoyan; Fu, Xiaobing

    2016-05-01

    The majority of studies on scar formation have mainly focused on the dermis and little is known of the involvement of the epidermis. Previous research has demonstrated that the scar tissue-derived keratinocytes are different from normal cells at both the genetic and cell biological levels; however, the mechanisms responsible for the fundamental abnormalities in keratinocytes during scar development remain elusive. For this purpose, in this study, we used normal, wound edge and hypertrophic scar tissue to examine the morphological changes which occur during epidermal regeneration as part of the wound healing process and found that the histological structure of hypertrophic scar tissues differed from that of normal skin, with a significant increase in epidermal thickness. Notably, staining of the basement membrane (BM) appeared to be absent in the scar tissues. Moreover, immunofluorescence staining for cytokeratin (CK)10, CK14, CK5, CK19 and integrin-β1 indicated the differential expression of cell markers in the epidermal keratinocytes among the normal, wound edge and hypertrophic scar tissues, which corresponded with the altered BM structures. By using a panel of proteins associated with BM components, we validated our hypothesis that the BM plays a significant role in regulating the cell fate decision of epidermal keratinocytes during skin wound healing. Alterations in the structure of the BM promote basal keratinocytes to adopt a proliferative phenotype both in vivo and in vitro.

  2. Image enhancement of optical images for binary system of melanocytes and keratinocytes

    Science.gov (United States)

    Takanezawa, S.; Baba, A.; Sako, Y.; Ozaki, Y.; Date, A.; Toyama, K.; Morita, S.

    2013-05-01

    Automatic determination of the cell shapes of large numbers of melanocytes based on optical images of human skin models have been largely unsuccessful (the complexities introduced by dendrites and the melanin pigmentation over the keratinocytes to give unclear outlines). Here, we present an image enhancement procedure for enhancing the contrast of images with removing the non-uniformity of background. The brightness is normalized also for the non-uniform population density of melanocytes.

  3. Natural Modulators of Endosomal Toll-Like Receptor-Mediated Psoriatic Skin Inflammation

    Directory of Open Access Journals (Sweden)

    Chao-Yang Lai

    2017-01-01

    Full Text Available Psoriasis is a chronic inflammatory autoimmune disease that can be initiated by excessive activation of endosomal toll-like receptors (TLRs, particularly TLR7, TLR8, and TLR9. Therefore, inhibitors of endosomal TLR activation are being investigated for their ability to treat this disease. The currently approved biological drugs adalimumab, etanercept, infliximab, ustekinumab, ixekizumab, and secukizumab are antibodies against effector cytokines that participate in the initiation and development of psoriasis. Several immune modulatory oligonucleotides and small molecular weight compounds, including IMO-3100, IMO-8400, and CPG-52364, that block the interaction between endosomal TLRs and their ligands are under clinical investigation for their effectiveness in the treatment of psoriasis. In addition, several chemical compounds, including AS-2444697, PF-05387252, PF-05388169, PF-06650833, ML120B, and PHA-408, can inhibit TLR signaling. Although these compounds have demonstrated anti-inflammatory activity in animal models, their therapeutic potential for the treatment of psoriasis has not yet been tested. Recent studies demonstrated that natural compounds derived from plants, fungi, and bacteria, including mustard seed, Antrodia cinnamomea extract, curcumin, resveratrol, thiostrepton, azithromycin, and andrographolide, inhibited psoriasis-like inflammation induced by the TLR7 agonist imiquimod in animal models. These natural modulators employ different mechanisms to inhibit endosomal TLR activation and are administered via different routes. Therefore, they represent candidate psoriasis drugs and might lead to the development of new treatment options.

  4. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Hydrogen-enriched water restoration of impaired calcium propagation by arsenic in primary keratinocytes

    Science.gov (United States)

    Yu, Wei-Tai; Chiu, Yi-Ching; Lee, Chih-Hung; Yoshioka, Tohru; Yu, Hsin-Su

    2013-11-01

    Endemic contamination of artesian water for drinking by arsenic is known to cause several human cancers, including cancers of the skin, bladder, and lungs. In skin, multiple arsenic-induced Bowen's disease (As-BD) can develop into invasive cancers after decades of arsenic exposure. The characteristic histological features of As-BD include full-layer epidermal dysplasia, apoptosis, and abnormal proliferation. Calcium propagation is an essential cellular event contributing to keratinocyte differentiation, proliferation, and apoptosis, all of which occur in As-BD. This study investigated how arsenic interferes calcium propagation of skin keratinocytes through ROS production and whether hydrogen-enriched water would restore arsenic-impaired calcium propagation. Arsenic was found to induce oxidative stress and inhibit ATP- and thapsigaragin-induced calcium propagation. Pretreatment of arsenic-treated keratinocytes by hydrogen-enriched water or beta-mercaptoethanol with potent anti-oxidative effects partially restored the propagation of calcium by ATP and by thapsigaragin. It was concluded that arsenic may impair calcium propagation, likely through oxidative stress and interactions with thiol groups in membrane proteins.

  6. Experimental model of cultured keratinocytes Modelo experimental de cultura de queratinócitos

    Directory of Open Access Journals (Sweden)

    Alfredo Gragnani

    2003-01-01

    Full Text Available The bioengineering research is essential in the development of ideal combination of biomaterials and cultured cells to produce the permanent wound coverage. The experimental model of cultured keratinocytes presents all steps of the culture, since the isolation of the keratinocytes, preparation of the human acellular dermis, preparation of the composite skin graft and their elevation to the air-liquid interface. The research in cultured keratinocytes model advances in two main ways: 1. optimization of the methods in vitro to the skin cells culture and proliferation and 2. developing biomaterials that present similar skin properties.A pesquisa em bioengenharia é primordial no desenvolvimento da combinação ideal de biomateriais e células cultivadas para produzir a cobertura definitiva das lesões. O modelo experimental da cultura de queratinócitos apresenta toda as etapas do cultivo, desde o isolamento dos queratinócitos, preparação da derme acelular humana, do enxerto composto e da sua elevação à interface ar-líquido. A pesquisa em modelo de cultura de queratinócitos desenvolve-se em duas vias principais: 1. otimização dos métodos in vitro para cultivo e proliferação de células da pele e 2. desenvolvimento de biomateriais que mimetizem as propriedades da pele.

  7. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  8. Psoriasiform skin disease in transgenic pigs with high-copy ectopic expression of human integrins α2 and β1

    Science.gov (United States)

    Staunstrup, Nicklas Heine; Stenderup, Karin; Mortensen, Sidsel; Primo, Maria Nascimento; Steiniche, Torben; Liu, Ying; Li, Rong; Schmidt, Mette; Purup, Stig; Dagnæs-Hansen, Frederik; Schrøder, Lisbeth Dahl; Svensson, Lars; Petersen, Thomas Kongstad; Callesen, Henrik; Bolund, Lars

    2017-01-01

    ABSTRACT Psoriasis is a complex human-specific disease characterized by perturbed keratinocyte proliferation and a pro-inflammatory environment in the skin. Porcine skin architecture and immunity are very similar to that in humans, rendering the pig a suitable animal model for studying the biology and treatment of psoriasis. Expression of integrins, which is normally confined to the basal layer of the epidermis, is maintained in suprabasal keratinocytes in psoriatic skin, modulating proliferation and differentiation as well as leukocyte infiltration. Here, we generated minipigs co-expressing integrins α2 and β1 in suprabasal epidermal layers. Integrin-transgenic minipigs born into the project displayed skin phenotypes that correlated with the number of inserted transgenes. Molecular analyses were in good concordance with histological observations of psoriatic hallmarks, including hypogranulosis and T-lymphocyte infiltration. These findings mark the first creation of minipigs with a psoriasiform phenotype resembling human psoriasis and demonstrate that integrin signaling plays a key role in psoriasis pathology. PMID:28679670

  9. Development of a co-culture of keratinocytes and immune cells for in vitro investigation of cutaneous sulfur mustard toxicity.

    Science.gov (United States)

    Balszuweit, Frank; Menacher, Georg; Bloemeke, Brunhilde; Schmidt, Annette; Worek, Franz; Thiermann, Horst; Steinritz, Dirk

    2014-11-05

    Sulfur mustard (SM) is a chemical warfare agent causing skin blistering, ulceration and delayed wound healing. Inflammation and extrinsic apoptosis are known to have an important role in SM-induced cytotoxicity. As immune cells are involved in those processes, they may significantly modulate SM toxicity, but the extent of those effects is unknown. We adapted a co-culture model of immortalized keratinocytes (HaCaT) and immune cells (THP-1) and exposed this model to SM. Changes in necrosis, apoptosis and inflammation, depending on SM challenge, absence or presence and number of THP-1 cells were investigated. THP-1 were co-cultured for 24h prior to SM exposure in order to model SM effects on immune cells continuously present in the skin. Our results indicate that the presence of THP-1 strongly increased necrosis, apoptosis and inflammation. This effect was already significant when the ratio of THP-1 and HaCaT cells was similar to the ratio of Langerhans immune cells and keratinocytes in vivo. Any further increases in the number of THP-1 had only slight additional effects on SM-induced cytotoxicity. In order to assess the effects of immune cells migrating into skin areas damaged by SM, we added non-exposed THP-1 to SM-exposed HaCaT. Those THP-1 had only slight effects on SM-induced cytotoxicity. Notably, in HaCaT exposed to 300μM SM, necrosis and inflammation were slightly reduced by adding intact THP-1. This effect was dependent on the number of immune cells, steadily increasing with the number of unexposed THP-1 added. In summary, we have demonstrated that (a) the presented co-culture is a robust model to assess SM toxicity and can be used to test the efficacy of potential antidotes in vitro; (b) immune cells, damaged by SM strongly amplified cytotoxicity, (c) in contrast, unexposed THP-1 (simulating migration of immune cells into affected areas after exposure in vivo) had no pronounced adverse, but exhibited some protective effects. Thus, protecting immune cells

  10. EGFR Activation and Ultraviolet Light‐Induced Skin Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Taghrid B. El-Abaseri

    2007-01-01

    Full Text Available The epidermal growth factor receptor (EGFR regulates the proliferation of keratinocytes through multiple mechanisms that differ depending on the localization of the cell within the skin. Ultraviolet (UV irradiation, the main etiologic factor in the development of skin cancer, also activates the receptor. In this review, we discuss how the UV-induced activation of EGFR regulates the response of the skin to UV. UV-induced EGFR activation increases keratinocyte proliferation, suppresses apoptosis, and augments and accelerates epidermal hyperplasia in response to UV. Pharmacological inhibition of the UV-induced activation of EGFR in a genetically initiated mouse skin tumorigenesis model suppresses tumorigenesis and the activation of mitogen-activated protein (MAP kinases and phosphatidyl inositol-3-kinase (PI3K/AKT signaling pathways. EGFR has pleiotropic, complex, and cell-type-specific functions in cutaneous keratinocytes; suggesting that the receptor is an appropriate target for the development of molecularly targeted therapies for skin cancer and other pathologies.

  11. Pimecrolimus enhances TLR2/6-induced expression of antimicrobial peptides in keratinocytes.

    Science.gov (United States)

    Büchau, Amanda S; Schauber, Jürgen; Hultsch, Thomas; Stuetz, Anton; Gallo, Richard L

    2008-11-01

    Calcineurin inhibitors are potent inhibitors of T-cell-receptor mediated activation of the adaptive immune system. The effects of this class of drug on the innate immune response system are not known. Keratinocytes are essential to innate immunity in skin and rely on toll-like receptors (TLRs) and antimicrobial peptides to appropriately recognize and respond to injury or microbes. In this study we examined the response of cultured human keratinocytes to pimecrolimus. We observed that pimecrolimus enhances distinct expression of cathelicidin, CD14, and human beta-defensin-2 and beta-defensin-3 in response to TLR2/6 ligands. Some of these responses were further enhanced by 1,25 vitamin D3. Pimecrolimus also increased the functional capacity of keratinocytes to inhibit growth of Staphylococcus aureus and decreased TLR2/6-induced expression of IL-10 and IL-1beta. Furthermore, pimecrolimus inhibited nuclear translocation of NFAT and NF-kappaB in keratinocytes. These observations uncover a previously unreported function for pimecrolimus in cutaneous innate host defense.

  12. Keratinocytes express fibrillin and assemble microfibrils: implications for dermal matrix organization.

    Science.gov (United States)

    Haynes, S L; Shuttleworth, C A; Kielty, C M

    1997-07-01

    Fibrillin-containing microfibrils are key architectural structures of the upper dermis and integral components of the dermal elastic fibre network. Microfibril bundles intercalate into the dermal-epithelial junction and provide an elastic connection between the dermal elastic fibre network and the epidermis. Immunohistochemical studies have suggested that they are laid down both at the dermal-epithelial junction and in the deep dermis. While dermal fibroblasts are responsible for deposition of the elastin and microfibrillar components that comprise the elastic fibres of the deep dermis, the cellular origin of the microfibril bundles that extrude from the dermal-epithelial junction is not well defined. We have used fresh tissues, freshly isolated epidermis and primary human and porcine keratinocyte cultures to investigate the possibility that keratinocytes are responsible for deposition of these microfibrils. We have shown that keratinocytes in vivo and in vitro synthesize both fibrillin-1 and fibrillin-2, and assemble beaded microfibrils concurrently with expression of basement membrane collagen. These observations suggest that keratinocytes co-ordinate the secretion, deposition and assembly of these distinct structural elements of the dermal matrix, and have important implications for skin remodelling.

  13. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  14. on skin keratinocytes by nuclear factor-kappa B

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-21

    Jun 21, 2012 ... Effects of advanced glycation end-products (AGEs) on ... AGE levels, nuclear factor-kappa B (NF-κB) localization and cell viability were measured in vivo. ..... and related alteration in NF-κB activity, we treated normal cells by ...

  15. Skin immune sentinels in health and disease.

    Science.gov (United States)

    Nestle, Frank O; Di Meglio, Paola; Qin, Jian-Zhong; Nickoloff, Brian J

    2009-10-01

    Human skin and its immune cells provide essential protection of the human body from injury and infection. Recent studies reinforce the importance of keratinocytes as sensors of danger through alert systems such as the inflammasome. In addition, newly identified CD103(+) dendritic cells are strategically positioned for cross-presentation of skin-tropic pathogens and accumulating data highlight a key role of tissue-resident rather than circulating T cells in skin homeostasis and pathology. This Review focuses on recent progress in dissecting the functional role of skin immune cells in skin disease.

  16. Salt water and skin interactions: new lines of evidence

    Science.gov (United States)

    Carbajo, Jose Manuel; Maraver, Francisco

    2018-04-01

    In Health Resort Medicine, both balneotherapy and thalassotherapy, salt waters and their peloids, or mud products are mainly used to treat rheumatic and skin disorders. These therapeutic agents act jointly via numerous mechanical, thermal, and chemical mechanisms. In this review, we examine a new mechanism of action specific to saline waters. When topically administered, this water rich in sodium and chloride penetrates the skin where it is able to modify cellular osmotic pressure and stimulate nerve receptors in the skin via cell membrane ion channels known as "Piezo" proteins. We describe several models of cutaneous adsorption/desorption and penetration of dissolved ions in mineral waters through the skin (osmosis and cell volume mechanisms in keratinocytes) and examine the role of these resources in stimulating cutaneous nerve receptors. The actions of salt mineral waters are mediated by a mechanism conditioned by the concentration and quality of their salts involving cellular osmosis-mediated activation/inhibition of cell apoptotic or necrotic processes. In turn, this osmotic mechanism modulates the recently described mechanosensitive piezoelectric channels.

  17. Modified methods for growing 3-D skin equivalents: an update.

    Science.gov (United States)

    Lamb, Rebecca; Ambler, Carrie A

    2014-01-01

    Artificial epidermis can be reconstituted in vitro by seeding primary epidermal cells (keratinocytes) onto a supportive substrate and then growing the developing skin equivalent at the air-liquid interface. In vitro skin models are widely used to study skin biology and for industrial drug and cosmetic testing. Here, we describe updated methods for growing 3-dimensional skin equivalents using de-vitalized, de-epidermalized dermis (DED) substrates including methods for DED substrate preparation, cell seeding, growth conditions, and fixation procedures.

  18. Skin Photoaging and the Role of Antioxidants in Its Prevention

    OpenAIRE

    Pandel, Ruža; Poljšak, Borut; Godic, Aleksandar; Dahmane, Raja

    2013-01-01

    Photoaging of the skin depends primarily on the degree of ultraviolet radiation (UVR) and on an amount of melanin in the skin (skin phototype). In addition to direct or indirect DNA damage, UVR activates cell surface receptors of keratinocytes and fibroblasts in the skin, which leads to a breakdown of collagen in the extracellular matrix and a shutdown of new collagen synthesis. It is hypothesized that dermal collagen breakdown is followed by imperfect repair that yields a deficit in the stru...

  19. Evaluation of the effect of radiation levels and dose rates in irradiation of murine fibroblasts used as a feeder layer in the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Almeida, Tiago L.; Santin, Stefany Plumeri; Somessari, Elizabeth S.R.; Silveira, Carlos G. da; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2009-01-01

    In 1975, Rheinwald and Green published an effective methodology for obtaining and cultivating human keratinocytes. This methodology consisted of seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate of which is then controlled through the action of ionizing radiation. The presence of the feeder layer encourages the development of keratinocyte colonies and their propagation in similar cultures, becoming possible several clinical applications as skin substitutes or wound dressings in situations such as post burn extensive skin loss and other skin disorders. However, good development of these keratinocytes depends on a high quality feeder layer among other factors. In the present work, we evaluated the relationship between radiation levels and dose rates applied to fibroblasts used in construction of feeder layers and the radiation effect on keratinocytes colonies forming efficiency. Results indicate 3T3 lineage murine fibroblasts irradiated with doses varying between 60 and 100 Gy can be used as a feeder layer immediately after irradiation or storage of the irradiated cells in suspension at 4 g C for 24 hours with similar results. The exception is when the irradiation dose rate is 2.75 Gyh -1 ; in this case, results suggested that the fibroblasts should be used immediately after irradiation. (author)

  20. Molecular and Cellular Profiling of Scalp Psoriasis Reveals Differences and Similarities Compared to Skin Psoriasis

    Science.gov (United States)

    Ruano, Juan; Suárez-Fariñas, Mayte; Shemer, Avner; Oliva, Margeaux

    2016-01-01

    Scalp psoriasis shows a variable clinical spectrum and in many cases poses a great therapeutic challenge. However, it remains unknown whether the immune response of scalp psoriasis differs from understood pathomechanisms of psoriasis in other skin areas. We sought to determine the cellular and molecular phenotype of scalp psoriasis by performing a comparative analysis of scalp and skin using lesional and nonlesional samples from 20 Caucasian subjects with untreated moderate to severe psoriasis and significant scalp involvement and 10 control subjects without psoriasis. Our results suggest that even in the scalp, psoriasis is a disease of the inter-follicular skin. The immune mechanisms that mediate scalp psoriasis were found to be similar to those involved in skin psoriasis. However, the magnitude of dysregulation, number of differentially expressed genes, and enrichment of the psoriatic genomic fingerprint were more prominent in skin lesions. Furthermore, the scalp transcriptome showed increased modulation of several gene-sets, particularly those induced by interferon-gamma, compared with that of skin psoriasis, which was mainly associated with activation of TNFα/L-17/IL-22-induced keratinocyte response genes. We also detected differences in expression of gene-sets involving negative regulation, epigenetic regulation, epidermal differentiation, and dendritic cell or Th1/Th17/Th22-related T-cell processes. PMID:26849645

  1. Leptin promotes wound healing in the skin.

    Directory of Open Access Journals (Sweden)

    Susumu Tadokoro

    Full Text Available Leptin, a 16 kDa anti-obesity hormone, exhibits various physiological properties. Interestingly, skin wound healing was proven to delay in leptin-deficient ob/ob mice. However, little is known on the mechanisms of this phenomenon. In this study, we attempted to elucidate a role of leptin in wound healing of skin.Immunohistochemical analysis was performed to confirm the expression of the leptin receptor (Ob-R in human and mouse skin. Leptin was topically administered to chemical wounds created in mouse back skin along with sustained-release absorbable hydrogel. The process of wound repair was histologically observed and the area of ulceration was measured over time. The effect of leptin on the proliferation, differentiation and migration of human epidermal keratinocytes was investigated.Ob-R was expressed in epidermal cells of human and mouse skin. Topical administration of leptin significantly promoted wound healing. Histological analysis showed more blood vessels in the dermal connective tissues in the leptin-treated group. The proliferation, differentiation/function and migration of human epidermal keratinocytes were enhanced by exogenous leptin.Topically administered leptin was proven to promote wound healing in the skin by accelerating proliferation, differentiation/function and migration of epidermal keratinocytes and enhancing angiogenesis around the wounded area. These results strongly suggest that topical administration of leptin may be useful as a treatment to promote wound healing in the skin.

  2. Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuo Ido

    Full Text Available The aging process is perceived as resulting from a combination of intrinsic factors such as changes in intracellular signaling and extrinsic factors, most notably environmental stressors. In skin, the relationship between intrinsic changes and keratinocyte function is not clearly understood. Previously, we found that increasing the activity of AMP-activated protein kinase (AMPK suppressed senescence in hydrogen peroxide (H2O2-treated human primary keratinocytes, a model of oxidative stress-induced cellular aging. Using this model in the present study, we observed that resveratrol, an agent that increases the activities of both AMPK and sirtuins, ameliorated two age-associated phenotypes: cellular senescence and proliferative dysfunction. In addition, we found that treatment of keratinocytes with Ex527, a specific inhibitor of sirtuin 1 (SIRT1, attenuated the ability of resveratrol to suppress senescence. In keeping with the latter observation, we noted that compared to non-senescent keratinocytes, senescent cells lacked SIRT1. In addition to these effects on H2O2-induced senescence, resveratrol also prevented the H2O2-induced decrease in proliferation (as indicated by 3H-thymidine incorporation in the presence of insulin. This effect was abrogated by inhibition of AMPK but not SIRT1. Compared to endothelium, we found that human keratinocytes expressed relatively high levels of Forkhead box O3 (FOXO3, a downstream target of both AMPK and SIRT1. Treatment of keratinocytes with resveratrol transactivated FOXO3 and increased the expression of its target genes including catalase. Resveratrol's effects on both senescence and proliferation disappeared when FOXO3 was knocked down. Finally, we performed an exploratory study which showed that skin from humans over 50 years old had lower AMPK activity than skin from individuals under age 20. Collectively, these findings suggest that the effects of resveratrol on keratinocyte senescence and proliferation

  3. Aqueous extract from Vitis vinifera tendrils is able to enrich keratinocyte antioxidant defences.

    Science.gov (United States)

    Fraternale, Daniele; De Bellis, Roberta; Calcabrini, Cinzia; Potenza, Lucia; Cucchiarini, Luigi; Mancini, Umberto; Dachà, Marina; Ricci, Donata

    2011-09-01

    An aqueous extract of V. vinifera L. tendrils was evaluated for its ability to enrich the antioxidant capacity of cultured cells. The long-time antioxidant capability of the extract was measured by in vitro chemical methods, and its influence on reduced glutathione levels and plasma membrane oxido reductase activity was determined in cultured human keratinocytes (NCTC 2544). Keratinocytes are cells normally exposed to oxidative stress, and for this reason adequately equipped with antioxidant defences. However, it has long been suggested that exogenous antioxidants may play an important role in minimizing the adverse effects of oxidative stress on skin.We demonstrated that V. vinifera tendril aqueous extract was able to increase, in a time- and dose-dependent manner, the reduced glutathione concentration and activity of trans plasma membrane oxido reductase as an indirect evaluation of the intracellular redox status of the cells demonstrating a relevant antioxidant activity of this phytocomplex.

  4. Markedly diminished epidermal keratinocyte expression of intercellular adhesion molecule-1 (ICAM-1) in Sezary syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Nickoloff, B.J.; Griffiths, E.M.; Baadsgaard, O.; Voorhees, J.J.; Hanson, C.A.; Cooper, K.D. (Univ. of Michigan Medical Center, Ann Arbor (USA))

    1989-04-21

    In mucosis fungoides the malignant T cells express lymphocyte function-associated antigen-1, which allows them to bind to epidermal keratinocytes expressing the gamma interferon-inducible intercellular adhesion molecule-1. In this report, a patient with leukemic-stage mucosis fungoides (Sezary syndrome) had widespread erythematous dermal infiltrates containing malignant T cells, but without any epidermotropism. The authors discovered that the T cells expressed normal amounts of functional lymphocyte function-associated antigen-1, but the keratinocytes did not express significant levels of intercellular adhesion molecule-1, which was probably due to the inability of the malignant T cells to produce gamma interferon. These results support the concept that the inability of malignant T cells to enter the epidermis may contribute to emergence of more clinically aggressive T-cell clones that are no longer confined to the skin, but infiltrate the blood, lymph nodes, and viscera, as is seen in Sezary syndrome.

  5. Keratinocyte growth factor mRNA expression in periodontal ligament fibroblasts

    DEFF Research Database (Denmark)

    Dabelsteen, S; Wandall, H H; Grøn, B

    1997-01-01

    Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF mRNA is expres......Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF m......RNA is expressed in periodontal ligament fibroblasts, and that the expression is increased upon serum stimulation. Fibroblasts from human periodontal ligament, from buccal mucosa, from gingiva, and from skin were established from explants. Alkaline phosphatase activity was used as an indicator of the periodontal...

  6. Skin dose differences between intensity-modulated radiation therapy and volumetric-modulated arc therapy and between boost and integrated treatment regimens for treating head and neck and other cancer sites in patients

    International Nuclear Information System (INIS)

    Penoncello, Gregory P.; Ding, George X.

    2016-01-01

    The purpose of this study was (1) to evaluate dose to skin between volumetric-modulated arc therapy (VMAT) and intensity-modulated radiation therapy (IMRT) treatment techniques for target sites in the head and neck, pelvis, and brain and (2) to determine if the treatment dose and fractionation regimen affect the skin dose between traditional sequential boost and integrated boost regimens for patients with head and neck cancer. A total of 19 patients and 48 plans were evaluated. The Eclipse (v11) treatment planning system was used to plan therapy in 9 patients with head and neck cancer, 5 patients with prostate cancer, and 5 patients with brain cancer with VMAT and static-field IMRT. The mean skin dose and the maximum dose to a contiguous volume of 2 cm"3 for head and neck plans and brain plans and a contiguous volume of 5 cm"3 for pelvis plans were compared for each treatment technique. Of the 9 patients with head and neck cancer, 3 underwent an integrated boost regimen. One integrated boost plan was replanned with IMRT and VMAT using a traditional boost regimen. For target sites located in the head and neck, VMAT reduced the mean dose and contiguous hot spot most noticeably in the shoulder region by 5.6% and 5.4%, respectively. When using an integrated boost regimen, the contiguous hot spot skin dose in the shoulder was larger on average than a traditional boost pattern by 26.5% and the mean skin dose was larger by 1.7%. VMAT techniques largely decrease the contiguous hot spot in the skin in the pelvis by an average of 36% compared with IMRT. For the same target coverage, VMAT can reduce the skin dose in all the regions of the body, but more noticeably in the shoulders in patients with head and neck and pelvis cancer. We also found that using integrated boost regimens in patients with head and neck cancer leads to higher shoulder skin doses compared with traditional boost regimens.

  7. Skin dose differences between intensity-modulated radiation therapy and volumetric-modulated arc therapy and between boost and integrated treatment regimens for treating head and neck and other cancer sites in patients.

    Science.gov (United States)

    Penoncello, Gregory P; Ding, George X

    2016-01-01

    The purpose of this study was (1) to evaluate dose to skin between volumetric-modulated arc therapy (VMAT) and intensity-modulated radiation therapy (IMRT) treatment techniques for target sites in the head and neck, pelvis, and brain and (2) to determine if the treatment dose and fractionation regimen affect the skin dose between traditional sequential boost and integrated boost regimens for patients with head and neck cancer. A total of 19 patients and 48 plans were evaluated. The Eclipse (v11) treatment planning system was used to plan therapy in 9 patients with head and neck cancer, 5 patients with prostate cancer, and 5 patients with brain cancer with VMAT and static-field IMRT. The mean skin dose and the maximum dose to a contiguous volume of 2cm(3) for head and neck plans and brain plans and a contiguous volume of 5cm(3) for pelvis plans were compared for each treatment technique. Of the 9 patients with head and neck cancer, 3 underwent an integrated boost regimen. One integrated boost plan was replanned with IMRT and VMAT using a traditional boost regimen. For target sites located in the head and neck, VMAT reduced the mean dose and contiguous hot spot most noticeably in the shoulder region by 5.6% and 5.4%, respectively. When using an integrated boost regimen, the contiguous hot spot skin dose in the shoulder was larger on average than a traditional boost pattern by 26.5% and the mean skin dose was larger by 1.7%. VMAT techniques largely decrease the contiguous hot spot in the skin in the pelvis by an average of 36% compared with IMRT. For the same target coverage, VMAT can reduce the skin dose in all the regions of the body, but more noticeably in the shoulders in patients with head and neck and pelvis cancer. We also found that using integrated boost regimens in patients with head and neck cancer leads to higher shoulder skin doses compared with traditional boost regimens. Copyright © 2016 American Association of Medical Dosimetrists. Published by

  8. Proteomic profiling and post-translational modifications in human keratinocytes treated with Mucuna pruriens leaf extract.

    Science.gov (United States)

    Cortelazzo, Alessio; Lampariello, Raffaella L; Sticozzi, Claudia; Guerranti, Roberto; Mirasole, Cristiana; Zolla, Lello; Sacchetti, Gianni; Hajek, Joussef; Valacchi, Giuseppe

    2014-02-03

    Mucuna pruriens (Mp) is a plant belonging to the Fabaceae family, with several medicinal properties among which its potential to treat diseases where reactive oxygen species (ROS) play an important role in the pathogeneses. The aim was to investigate the effects of Mp leaf methanolic extract (MPME) on human keratinocytes protein expression and its role in preventing proteins oxidation after oxidative stress (OS) exposure. The effects of MPME on HaCaT cells protein expression were evaluated treating cells with different concentrations of MPME, with glucose oxidase (GO, source of OS) and with MPME subsequently treated with GO. The protein patterns of treated HaCaT cells are analyzed by two-dimensional gel electrophoresis (2-DE) and compared with that of untreated HaCaT. Immunoblotting was then used to evaluate the role of MPME in preventing the 4-hydroxynonenal protein adducts (4-HNE PAs) formation (marker of OS). Eighteen proteins, identified by mass spectrometry (LC-ESI-CID-MS/MS), were modulated distinctly by MPME in HaCaT. Overall, MPME counteract GO effect, reducing the GO-induced overexpression of several proteins involved in stress response (T-complex protein 1, Protein disulfide-isomerase A3, Protein DJ-1, and Stress-induced-phosphoprotein 1), in cell energy methabolism (Inorganic pyrophosphatase, Triosephosphate isomerase isoform 1, 2-phosphopyruvate-hydratase alpha-enolase, and Fructose-bisphosphate aldolase A isoform 1), in cytoskeletal organization (Cytokeratins 18, 9, 2, Cofilin-1, Annexin A2 and F-actin-capping protein subunit beta isoform 1) and in cell cycle progression (Eukaryotic translation initiation factor 5A-1 isoform B). In addition, MPME decreased the 4-HNE PAs levels, in particular on 2-phosphopyruvate-hydratase alpha-enolase and Cytokeratin 9. Our findings show that MPME might be helpful in the treatment of OS-related skin diseases by preventing protein post-translational modifications (4-HNE PAs). © 2013 Published by Elsevier Ireland Ltd.

  9. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  10. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  11. Sustained phenotypic reversion of junctional epidermolysis bullosa dog keratinocytes: Establishment of an immunocompetent animal model for cutaneous gene therapy

    International Nuclear Information System (INIS)

    Spirito, Flavia; Capt, Annabelle; Rio, Marcela Del; Larcher, Fernando; Guaguere, Eric; Danos, Olivier; Meneguzzi, Guerrino

    2006-01-01

    Gene transfer represents the unique therapeutic issue for a number of inherited skin disorders including junctional epidermolysis bullosa (JEB), an untreatable genodermatose caused by mutations in the adhesion ligand laminin 5 (α3β3γ2) that is secreted in the extracellular matrix by the epidermal basal keratinocytes. Because gene therapy protocols require validation in animal models, we have phenotypically reverted by oncoretroviral transfer of the curative gene the keratinocytes isolated from dogs with a spontaneous form of JEB associated with a genetic mutation in the α3 chain of laminin 5. We show that the transduced dog JEB keratinocytes: (1) display a sustained secretion of laminin 5 in the extracellular matrix; (2) recover the adhesion, proliferation, and clonogenic capacity of wild-type keratinocytes; (3) generate fully differentiated stratified epithelia that after grafting on immunocompromised mice produce phenotypically normal skin and sustain permanent expression of the transgene. We validate an animal model that appears particularly suitable to demonstrate feasibility, efficacy, and safety of genetic therapeutic strategies for cutaneous disorders before undertaking human clinical trials

  12. Ultrasonic modulation of tissue optical properties in ex vivo porcine skin to improve transmitted transdermal laser intensity.

    Science.gov (United States)

    Whiteside, Paul J D; Qian, Chenxi; Golda, Nicholas; Hunt, Heather K

    2017-09-01

    Applications of light-based energy devices involving optical targets within the dermis frequently experience negative side-effects resultant from surface scattering and excess optical absorption by epidermal melanin. As a broadband optical absorber, melanin decreases the efficacy of light-based treatments throughout the ultraviolet, visible, and near-infrared spectra while also generating additional heat within the surface tissue that can lead to inflammation or tissue damage. Consequently, procedures may be performed using greater energy densities to ensure that the target receives a clinically relevant dose of light; however, such practices are limited, as doing so tends to exacerbate the detrimental complications resulting from melanin absorption of treatment light. The technique presented herein represents an alternative method of operation aimed at increasing epidermal energy fluence while mitigating excess absorption by unintended chromophores. The approach involves the application of continuously pulsed ultrasound to modulate the tissue's optical properties and thereby improve light transmission through the epidermis. To demonstrate the change in optical properties, pulsed light at a wavelength of 532 nm from a Q-switched Nd:YAG laser was transmitted into 4 mm thick samples of porcine skin, comprised of both epidermal and dermal tissue. The light was transmitted using an optical waveguide, which allowed for an ultrasonic transducer to be incorporated for simultaneous paraxial pulsation in parallel with laser operation. Light transmitted through the tissue was measured by a photodiode attached to an integrating sphere. Increasing the driving voltage of ultrasonic pulsation resulted in an increase in mean transmitted optical power of up to a factor of 1.742 ± 0.0526 times the control, wherein no ultrasound was applied, after which the optical power increase plateaued to an average amplification factor of 1.733 ± 0.549 times the control. The

  13. Redistribution of melanosomal complexes within keratinocytes following UV-A irradiation

    International Nuclear Information System (INIS)

    Lavker, R.M.; Kaidbey, K.H.

    1982-01-01

    In contrast to other ultraviolet (UV) wavelengths, UV-A can induce long-term or 'true' pigmentation rapidly with little or no latency. The response cannot be clearly separated from immediate pigment darkening and is too rapid in onset to be explained by neomelanogenesis. In order to investigate possible mechanisms for this phenomenon, UV-irradiated skin was examined microscopically and ultrastructurally 18 h postirradiation. Specimens from skin sites tanned by exposure to melanogenic doses of UV-A showed a paradoxical reduction in the degree of basal melanization by light microscopy compared to unirradiated skin. Ultrastructurally, there was migration and dispersion of packaged melanosomes within keratinocytes from their normal, aggregated location around the nucleus towards the periphery of the cell. These changes were not observed in specimens exposed to melanogenic doses of UV-B. We propose that UV-A wavelengths can selectively cause redistribution of melanin-laden organelles within human keratinocytes in vivo and that this phenomenon accounts for the visually observed hyperpigmentation that develops soon after single exposures to these wavelengths. Dispersion of melanosomal complexes may be another mechanism by which UV-radiation (UVR) can induce tanning in human skin. (orig.)

  14. Redistribution of melanosomal complexes within keratinocytes following UV-A irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Lavker, R.M.; Kaidbey, K.H.

    1982-03-01

    In contrast to other ultraviolet (UV) wavelengths, UV-A can induce long-term or 'true' pigmentation rapidly with little or no latency. The response cannot be clearly separated from immediate pigment darkening and is too rapid in onset to be explained by neomelanogenesis. In order to investigate possible mechanisms for this phenomenon, UV-irradiated skin was examined microscopically and ultrastructurally 18 h postirradiation. Specimens from skin sites tanned by exposure to melanogenic doses of UV-A showed a paradoxical reduction in the degree of basal melanization by light microscopy compared to unirradiated skin. Ultrastructurally, there was migration and dispersion of packaged melanosomes within keratinocytes from their normal, aggregated location around the nucleus towards the periphery of the cell. These changes were not observed in specimens exposed to melanogenic doses of UV-B. We propose that UV-A wavelengths can selectively cause redistribution of melanin-laden organelles within human keratinocytes in vivo and that this phenomenon accounts for the visually observed hyperpigmentation that develops soon after single exposures to these wavelengths. Dispersion of melanosomal complexes may be another mechanism by which UV-radiation (UVR) can induce tanning in human skin.

  15. Ultraviolet Radiation Increases the Toxicity of Pyrene, 1-Aminopyrene and 1-Hydroxypyrene to Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Huey-Min Hwang

    2005-04-01

    Full Text Available Over the past several years, a great deal of interest has been focused on the harmful effects of ultraviolet (UV radiation to human skin. UV light has been implicated in aging, sunburn and skin cancer. Few studies, however, have been done to determine the effects that UV light, in conjunction with other environmental contaminants, may have on human skin. Polycyclic Aromatic Hydrocarbons (PAHs are a class of compounds that have been reported to be toxic, mutagenic and carcinogenic to many eukaryotic organisms. UV light is also known to increase the toxicity of PAHs through photo-activation and photo-modification. The purpose of this study was to assess the effects of UV-A irradiated pyrene (Pyr, 1-aminopyrene (1-AP and 1-hydroxypyrene (1-HP on human keratinocytes, the skin primary site of UV irradiated PAH exposure. Our findings indicate that simultaneous treatment of human keratinocyte cell line, HaCaT, with 1.0μg/ml pyrene, 1-AP or 1-HP and 3.9 J/cm2/min UV-A light resulted in significant inhibition of cell proliferation. Approximately 100% of the cells died in the case of UV-A irradiated 1-AP and 1-HP. In the case of UV-A irradiated pyrene, more than 70% of the cells died, indicating that UV-A is able to transform these PAHs into more harmful intermediates.

  16. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  17. Aplicação de substituto de pele em oncologia cutânea: estudo experimental com derme acelular e ceratinócitos cultivados Application of skin substitutes in skin oncology: experimental study using acellular dermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    José Anselmo Lofêgo Filho

    2008-02-01

    Full Text Available FUNDAMENTOS: As neoplasias malignas da pele de grandes dimensões apresentam dificuldades de reconstrução após a excisão. OBJETIVO: O objetivo deste estudo foi avaliar a exeqüibilidade de uma nova proposta de cobertura para feridas cirúrgicas criadas após a ressecção de grandes tumores cutâneos, a combinação da derme acelular humana com epitélio autólogo cultivado. MÉTODOS: A aplicação dos substitutos de pele foi feita em quatro pacientes com área de implante variando de 33 a 120 cm2. Além da observação dos resultados clínicos, realizou-se estudo morfológico para avaliação da integração dos implantes. RESULTADOS: Ceratinócitos autólogos cultivados foram enxertados em dois pacientes e não demonstraram integração. A derme acelular foi aplicada em quatro pacientes, sendo que em um deles foram feitas duas aplicações. Dos cinco implantes de derme acelular realizados, dois não apresentaram integração, em dois a integração foi de 70%, e de 50% no último. CONCLUSÃO: A cobertura imediata e definitiva de defeitos cirúrgicos através da aplicação de derme acelular humana combinada com epitélio autólogo cultivado é exeqüível. Em oncologia cutânea apenas em situações especiais o uso de substitutos de pele pode ser conveniente no sentido de evitar reconstruções mais complexas.BACKGROUND: Reconstruction difficulties may arise after excision of large malignant skin neoplasms.a OBJECTIVE: The objective of this study was to assess the feasibility of a new coverage for surgical wounds following resection of large skin tumors: a combination of human acellular dermis with cultured autologous epithelium. METHODS: The skin substitute was implanted in four patients, one of them received two implants and the area ranged from 33 to 120 cm2. Clinical results and morphologic studies were assessed as to implant integration. RESULTS: Cultured autologous epithelium was grafted in two patients and no integration was

  18. Modulation of Signal Proteins: A Plausible Mechanism to Explain How a Potentized Drug Secale Cor 30C Diluted beyond Avogadro's Limit Combats Skin Papilloma in Mice.

    Science.gov (United States)

    Khuda-Bukhsh, Anisur Rahman; Bhattacharyya, Soumya Sundar; Paul, Saili; Dutta, Suman; Boujedaini, Naoual; Belon, Philippe

    2011-01-01

    In homeopathy, ability of ultra-high diluted drugs at or above potency 12C (diluted beyond Avogadro's limit) in ameliorating/curing various diseases is often questioned, particularly because the mechanism of action is not precisely known. We tested the hypothesis if suitable modulations of signal proteins could be one of the possible pathways of action of a highly diluted homeopathic drug, Secale cornutum 30C (diluted 10(60) times; Sec cor 30). It could successfully combat DMBA + croton oil-induced skin papilloma in mice as evidenced by histological, cytogenetical, immunofluorescence, ELISA and immunoblot findings. Critical analysis of several signal proteins like AhR, PCNA, Akt, Bcl-2, Bcl-xL, NF-κB and IL-6 and of pro-apoptotic proteins like cytochrome c, Bax, Bad, Apaf, caspase-3 and -9 revealed that Sec cor 30 suitably modulated their expression levels along with amelioration of skin papilloma. FACS data also suggested an increase of cell population at S and G2 phases and decrease in sub-G1 and G1 phages in carcinogen-treated drug-unfed mice, but these were found to be near normal in the Sec cor 30-fed mice. There was reduction in genotoxic and DNA damages in bone marrow cells of Sec Cor 30-fed mice, as revealed from cytogenetic and Comet assays. Changes in histological features of skin papilloma were noted. Immunofluorescence studies of AhR and PCNA also suggested reduced expression of these proteins in Sec cor 30-fed mice, thereby showing its anti-cancer potentials against skin papilloma. Furthermore, this study also supports the hypothesis that potentized homeopathic drugs act at gene regulatory level.

  19. Modulation of Signal Proteins: A Plausible Mechanism to Explain How a Potentized Drug Secale Cor 30C Diluted beyond Avogadro's Limit Combats Skin Papilloma in Mice

    Directory of Open Access Journals (Sweden)

    Anisur Rahman Khuda-Bukhsh

    2011-01-01

    Full Text Available In homeopathy, ability of ultra-high diluted drugs at or above potency 12C (diluted beyond Avogadro's limit in ameliorating/curing various diseases is often questioned, particularly because the mechanism of action is not precisely known. We tested the hypothesis if suitable modulations of signal proteins could be one of the possible pathways of action of a highly diluted homeopathic drug, Secale cornutum 30C (diluted 1060 times; Sec cor 30. It could successfully combat DMBA + croton oil-induced skin papilloma in mice as evidenced by histological, cytogenetical, immunofluorescence, ELISA and immunoblot findings. Critical analysis of several signal proteins like AhR, PCNA, Akt, Bcl-2, Bcl-xL, NF-κB and IL-6 and of pro-apoptotic proteins like cytochrome c, Bax, Bad, Apaf, caspase-3 and -9 revealed that Sec cor 30 suitably modulated their expression levels along with amelioration of skin papilloma. FACS data also suggested an increase of cell population at S and G2 phases and decrease in sub-G1 and G1 phages in carcinogen-treated drug-unfed mice, but these were found to be near normal in the Sec cor 30-fed mice. There was reduction in genotoxic and DNA damages in bone marrow cells of Sec Cor 30-fed mice, as revealed from cytogenetic and Comet assays. Changes in histological features of skin papilloma were noted. Immunofluorescence studies of AhR and PCNA also suggested reduced expression of these proteins in Sec cor 30-fed mice, thereby showing its anti-cancer potentials against skin papilloma. Furthermore, this study also supports the hypothesis that potentized homeopathic drugs act at gene regulatory level.

  20. 5-fluorouracil Toxicity Mechanism Determination in Human Keratinocytes: in vitro Study on HaCaT

    Directory of Open Access Journals (Sweden)

    Jan Hartinger

    2018-01-01

    Full Text Available 5-fluorouracil (5-FU and capecitabine therapy is often accompanied by palmar-plantar erythrodysesthesia (PPE which is manifestation of 5-FU toxicity in keratinocytes. The main mechanisms of 5-FU action are thymidylate synthase (TS inhibition which can be abrogated by thymidine and strengthened by calciumfolinate (CF and incorporation of fluorouridinetriphosphate into RNA which can be abrogated by uridine. For proper PPE treatment 5-FU mechanism of action in keratinocytes needs to be elucidated. We used the 5-FU toxicity modulators uridine, thymidine and CF to discover the mechanism of 5-FU action in human keratinocyte cell line HaCaT. To measure the cellular viability, we used MTT test and RTCA test. CF did not augment 5-FU toxicity and 5-FU toxicity was weakened by uridine. Therefore, the primary mechanism of 5-FU toxicity in keratinocytes is 5-FU incorporation into RNA. The uridine protective effect cannot fully develop in the presence of CF. Thymidine addition to 5-FU and uridine treated cells not only prevents the toxicity-augmenting CF effect but it also prolongs the 5-FU treated cells survival in comparison to uridine only. Therefore, it can be assumed that in the presence of uridine the 5-FU toxicity mechanism is switched from RNA incorporation to TS inhibition. Although particular 5-FU toxicity mechanisms were previously described in various cell types, this is the first time when various combinations of pyrimidine nucleosides and CF were used for 5-FU toxicity mechanism elucidation in human keratinocytes. We suggest that for PPE treatment ointment containing uridine and thymidine should be further clinically tested.

  1. SU-E-T-632: Preliminary Study On Treating Nose Skin Using Energy and Intensity Modulated Electron Beams with Monte Carlo Based Dose Calculations

    International Nuclear Information System (INIS)

    Jin, L; Eldib, A; Li, J; Price, R; Ma, C

    2015-01-01

    Purpose: Uneven nose surfaces and air cavities underneath and the use of bolus present complexity and dose uncertainty when using a single electron energy beam to plan treatments of nose skin with a pencil beam-based planning system. This work demonstrates more accurate dose calculation and more optimal planning using energy and intensity modulated electron radiotherapy (MERT) delivered with a pMLC. Methods: An in-house developed Monte Carlo (MC)-based dose calculation/optimization planning system was employed for treatment planning. Phase space data (6, 9, 12 and 15 MeV) were used as an input source for MC dose calculations for the linac. To reduce the scatter-caused penumbra, a short SSD (61 cm) was used. Our previous work demonstrates good agreement in percentage depth dose and off-axis dose between calculations and film measurement for various field sizes. A MERT plan was generated for treating the nose skin using a patient geometry and a dose volume histogram (DVH) was obtained. The work also shows the comparison of 2D dose distributions between a clinically used conventional single electron energy plan and the MERT plan. Results: The MERT plan resulted in improved target dose coverage as compared to the conventional plan, which demonstrated a target dose deficit at the field edge. The conventional plan showed higher dose normal tissue irradiation underneath the nose skin while the MERT plan resulted in improved conformity and thus reduces normal tissue dose. Conclusion: This preliminary work illustrates that MC-based MERT planning is a promising technique in treating nose skin, not only providing more accurate dose calculation, but also offering an improved target dose coverage and conformity. In addition, this technique may eliminate the necessity of bolus, which often produces dose delivery uncertainty due to the air gaps that may exist between the bolus and skin

  2. SU-F-T-81: Treating Nose Skin Using Energy and Intensity Modulated Electron Beams with Monte Carlo Based Dose Calculation

    Energy Technology Data Exchange (ETDEWEB)

    Jin, L; Fan, J; Eldib, A; Price, R; Ma, C [Fox Chase Cancer Center, Philadelphia, PA (United States)

    2016-06-15

    Purpose: Treating nose skin with an electron beam is of a substantial challenge due to uneven nose surfaces and tissue heterogeneity, and consequently could have a great uncertainty of dose accuracy on the target. This work explored the method using Monte Carlo (MC)-based energy and intensity modulated electron radiotherapy (MERT), which would be delivered with a photon MLC in a standard medical linac (Artiste). Methods: The traditional treatment on the nose skin involves the usage of a bolus, often with a single energy electron beam. This work avoided using the bolus, and utilized mixed energies of electron beams. An in-house developed Monte Carlo (MC)-based dose calculation/optimization planning system was employed for treatment planning. Phase space data (6, 9, 12 and 15 MeV) were used as an input source for MC dose calculations for the linac. To reduce the scatter-caused penumbra, a short SSD (61 cm) was used. A clinical case of the nose skin, which was previously treated with a single 9 MeV electron beam, was replanned with the MERT method. The resultant dose distributions were compared with the plan previously clinically used. The dose volume histogram of the MERT plan is calculated to examine the coverage of the planning target volume (PTV) and critical structure doses. Results: The target coverage and conformality in the MERT plan are improved as compared to the conventional plan. The MERT can provide more sufficient target coverage and less normal tissue dose underneath the nose skin. Conclusion: Compared to the conventional treatment technique, using MERT for the nose skin treatment has shown the dosimetric advantages in the PTV coverage and conformality. In addition, this technique eliminates the necessity of the cutout and bolus, which makes the treatment more efficient and accurate.

  3. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  4. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  5. Effects of 25-hydroxyvitamin D3 on cathelicidin production and antibacterial function of human oral keratinocytes.

    Science.gov (United States)

    Wang, Qi; Zhang, Wu; Li, Hao; Aprecio, Raydolf; Wu, Wan; Lin, Yiqiao; Li, Yiming

    2013-01-01

    Vitamin D and its metabolites have been recognized as key determinants in innate immune modulation. In this study, we investigated the regulation of antibacterial functions of oral keratinocyte cells by 25-hydroxyvitamin D3 (25VD3). OKF6/TERT2 cells, an immortalized human oral keratinocyte cell line, were transfected with or without 24-hydroxylase small interfering RNA (siRNA) and incubated with different amounts of 25VD3. These epithelial cells expressed high levels of inactivating 24-hydroxylase (CYP24A1) and relatively low levels of activating 1α-hydroxylase (CYP27B1) in the presence of 25VD3. 25VD3 influenced the expression of vitamin D-driven genes and cathelicidin in a dose-related manner. SiRNA specific to 24-hydroxylase augmented the cathelicidin production and subseqently influenced the antibacterial activity on multispecies of oral pathogens. These observations suggest that 25VD3 is capable of stimulating cathelicidin production and modulating antibacterial function upon CYP24A1 knochdown in oral epithelial cells, and indicate novel mechanisms that 25VD3 may enhance antibacterial ability in oral keratinocytes. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Piperine attenuates UV-R induced cell damage in human keratinocytes via NF-kB, Bax/Bcl-2 pathway: An application for photoprotection.

    Science.gov (United States)

    Verma, Ankit; Kushwaha, Hari N; Srivastava, Ajeet K; Srivastava, Saumya; Jamal, Naseem; Srivastava, Kriti; Ray, Ratan Singh

    2017-07-01

    Chronic ultraviolet radiation (UV-R) exposure causes skin disorders like erythema, edema, hyperpigmentation, photoaging and photocarcinogenesis. Recent research trends of researchers have focused more attention on the identification and use of photo stable natural agents with photoprotective properties. Piperine (PIP), as a plant alkaloid, is an important constituent present in black pepper (Piper nigrum), used widely in ayurvedic and other traditional medicines and has broad pharmacological properties. The study was planned to photoprotective efficacy of PIP in human keratinocyte (HaCaT) cell line. We have assessed the UV-R induced activation of transcription factor NF-κB in coordination with cell death modulators (Bax/Bcl-2 and p21). The LC-MS/MS analysis revealed that PIP was photostable under UV-A/UV-B exposure. PIP (10μg/ml) attenuates the UV-R (A and B) induced phototoxicity of keratinocyte cell line through the restoration of cell viability, inhibition of ROS, and malondialdehyde generation. Further, PIP inhibited UV-R mediated DNA damage, prevented micronuclei formation, and reduced sub-G1 phase in cell cycle, which supported against photogenotoxicity. This study revealed that PIP pretreatment strongly suppressed UV-R induced photodamages. Molecular docking studies suggest that PIP binds at the active site of NF-κB, and thus, preventing its translocation to nucleus. In addition, transcriptional and translational analysis advocate the increased expression of NF-κB and concomitant decrease in IkB-α expression under UV-R exposed cells, favouring the apoptosis via Bax/Bcl-2 and p21 pathways. However, PIP induced expression of IkB-α suppress the NF-κB activity which resulted in suppression of apoptotic marker genes and proteins that involved in photoprotection. Therefore, we suggest the applicability of photostable PIP as photoprotective agent for human use. Copyright © 2017. Published by Elsevier B.V.

  7. Ultraviolet radiation induction of ornithine decarboxylase in rat keratinocytes

    International Nuclear Information System (INIS)

    Rosen, C.F.; Gajic, D.; Drucker, D.J.

    1990-01-01

    UV radiation plays an important role in the induction of cutaneous malignancy, including basal cell and squamous cell carcinomas and malignant melanoma. In addition to its effects on DNA damage and repair mechanisms, UV radiation has been shown to modulate the expression of specific genes, altering the levels of their mRNAs and the synthesis of their corresponding proteins. In order to gain further information about the molecular effects of UV radiation, we have studied the regulation of ornithine decarboxylase (ODC) gene expression in response to UVB radiation. ODC is the rate-limiting enzyme in polyamine biosynthesis, is involved in growth and differentiation, and has been implicated in carcinogenesis. Keratinocytes grown in culture were either sham-irradiated or exposed to increasing doses of UVB (1-5 mJ/cm2). Northern blot analysis of keratinocyte RNA under basal conditions demonstrated the presence of two ODC mRNA transcripts. Increasing exposure to UVB resulted in a dose-dependent increase in the levels of both ODC mRNA transcripts. The induction of ODC gene expression following UVB was noted 2 h after UVB exposure, and ODC mRNA levels continued to increase up to 24 h after UVB exposure. The UVB-induced increase in ODC gene expression was not serum dependent, despite the ability of serum alone to induce ODC gene expression. The mRNA transcripts for actin and hexosaminidase A were not induced after UVB exposure. These studies show that the UVB-induced increase in ODC activity is due, at least in part, to an increase in ODC gene expression and they provide a useful model for the analysis of the molecular effects of UVB radiation

  8. Ultraviolet radiation induction of ornithine decarboxylase in rat keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Rosen, C.F.; Gajic, D.; Drucker, D.J. (Women' s College Hospital, Toronto, Ontario (Canada))

    1990-05-01

    UV radiation plays an important role in the induction of cutaneous malignancy, including basal cell and squamous cell carcinomas and malignant melanoma. In addition to its effects on DNA damage and repair mechanisms, UV radiation has been shown to modulate the expression of specific genes, altering the levels of their mRNAs and the synthesis of their corresponding proteins. In order to gain further information about the molecular effects of UV radiation, we have studied the regulation of ornithine decarboxylase (ODC) gene expression in response to UVB radiation. ODC is the rate-limiting enzyme in polyamine biosynthesis, is involved in growth and differentiation, and has been implicated in carcinogenesis. Keratinocytes grown in culture were either sham-irradiated or exposed to increasing doses of UVB (1-5 mJ/cm2). Northern blot analysis of keratinocyte RNA under basal conditions demonstrated the presence of two ODC mRNA transcripts. Increasing exposure to UVB resulted in a dose-dependent increase in the levels of both ODC mRNA transcripts. The induction of ODC gene expression following UVB was noted 2 h after UVB exposure, and ODC mRNA levels continued to increase up to 24 h after UVB exposure. The UVB-induced increase in ODC gene expression was not serum dependent, despite the ability of serum alone to induce ODC gene expression. The mRNA transcripts for actin and hexosaminidase A were not induced after UVB exposure. These studies show that the UVB-induced increase in ODC activity is due, at least in part, to an increase in ODC gene expression and they provide a useful model for the analysis of the molecular effects of UVB radiation.

  9. Role of the Slug Transcription Factor in Chemically-Induced Skin Cancer

    Directory of Open Access Journals (Sweden)

    Kristine von Maltzan

    2016-02-01

    Full Text Available The Slug transcription factor plays an important role in ultraviolet radiation (UVR-induced skin carcinogenesis, particularly in the epithelial-mesenchymal transition (EMT occurring during tumor progression. In the present studies, we investigated the role of Slug in two-stage chemical skin carcinogenesis. Slug and the related transcription factor Snail were expressed at high levels in skin tumors induced by 7,12-dimethylbenz[α]anthracene application followed by 12-O-tetradecanoylphorbol-13-acetate (TPA treatment. TPA-induced transient elevation of Slug and Snail proteins in normal mouse epidermis and studies in Slug transgenic mice indicated that Slug modulates TPA-induced epidermal hyperplasia and cutaneous inflammation. Although Snail family factors have been linked to inflammation via interactions with the cyclooxygenase-2 (COX-2 pathway, a pathway that also plays an important role in skin carcinogenesis, transient TPA induction of Slug and Snail appeared unrelated to COX-2 expression. In cultured human keratinocytes, TPA induced Snail mRNA expression while suppressing Slug expression, and this differential regulation was due specifically to activation of the TPA receptor. These studies show that Slug and Snail exhibit similar patterns of expression during both UVR and chemical skin carcinogenesis, that Slug and Snail can be differentially regulated under some conditions and that in vitro findings may not recapitulate in vivo results.

  10. Increased oxidative stress and antioxidant expression in mouse keratinocytes following exposure to paraquat

    International Nuclear Information System (INIS)

    Black, Adrienne T.; Gray, Joshua P.; Shakarjian, Michael P.; Laskin, Debra L.; Heck, Diane E.; Laskin, Jeffrey D.

    2008-01-01

    Paraquat (1,1'-dimethyl-4,4'-bipyridinium) is a widely used herbicide known to induce skin toxicity. This is thought to be due to oxidative stress resulting from the generation of cytotoxic reactive oxygen intermediates (ROI) during paraquat redox cycling. The skin contains a diverse array of antioxidant enzymes which protect against oxidative stress including superoxide dismutase (SOD), catalase, glutathione peroxidase-1 (GPx-1), heme oxygenase-1 (HO-1), metallothionein-2 (MT-2), and glutathione-S-transferases (GST). In the present studies we compared paraquat redox cycling in primary cultures of undifferentiated and differentiated mouse keratinocytes and determined if this was associated with oxidative stress and altered expression of antioxidant enzymes. We found that paraquat readily undergoes redox cycling in both undifferentiated and differentiated keratinocytes, generating superoxide anion and hydrogen peroxide as well as increased protein oxidation which was greater in differentiated cells. Paraquat treatment also resulted in increased expression of HO-1, Cu,Zn-SOD, catalase, GSTP1, GSTA3 and GSTA4. However, no major differences in expression of these enzymes were evident between undifferentiated and differentiated cells. In contrast, expression of GSTA1-2 was significantly greater in differentiated relative to undifferentiated cells after paraquat treatment. No changes in expression of MT-2, Mn-SOD, GPx-1, GSTM1 or the microsomal GST's mGST1, mGST2 and mGST3, were observed in response to paraquat. These data demonstrate that paraquat induces oxidative stress in keratinocytes leading to increased expression of antioxidant genes. These intracellular proteins may be important in protecting the skin from paraquat-mediated cytotoxicity

  11. A comparison of the direct medical costs for individuals with or without basal or squamous cell skin cancer: A study from Australia

    Directory of Open Access Journals (Sweden)

    David Rowell

    2016-05-01

    Full Text Available Objectives: The composition of the medical costs incurred by people treated for basal cell and squamous cell carcinomas (hereafter keratinocyte cancers is not adequately understood. We sought to compare the medical costs of individuals with or without keratinocyte cancers. Methods: We used national health insurance data to analyze the direct medical costs of 2000 cases and 2000 controls nested within the QSkin prospective cohort study (n = 43,794 conducted in Australia. We reconstructed the medical history of patients using medical and pharmaceutical item codes and then compared the health service costs of individuals treated for keratinocyte cancers with those not treated for keratinocyte cancers. Results: Individuals treated for keratinocyte cancers consumed on average AUD$1320 per annum more in medical services than those without keratinocyte cancers. Only 23.2% of costs were attributed to the explicit treatment of keratinocyte cancers. The principal drivers of the residual costs were medical attendances, surgical procedures on the skin, and histopathology services. We found significant positive associations between history of treatment for keratinocyte cancers with treatments for other health conditions, including melanoma, cardiovascular disease, lipidemia, osteoporosis, rheumatoid arthritis, colorectal cancer, prostate cancer, and tuberculosis. Conclusion: Individuals treated for keratinocyte cancers have substantially higher medical costs overall than individuals without keratinocyte cancers. The direct costs of skin cancer excision account for only one-fifth of this difference.

  12. Keratinocyte Motility Is Affected by UVA Radiation—A Comparison between Normal and Dysplastic Cells

    Directory of Open Access Journals (Sweden)

    Cristina M. Niculiţe

    2018-06-01

    Full Text Available UVA radiation induces multiple and complex changes in the skin, affecting epidermal cell behavior. This study reports the effects of UVA exposure on normal (HaCaT and dysplastic (DOK keratinocytes. The adherence, spreading and proliferation were investigated by time-lapse measurement of cell layer impedance on different matrix proteins. Prior to UVA exposure, the time required for adherence and spreading did not differ significantly for HaCaT and DOK cells, while spreading areas were larger for HaCaT cells. Under UVA exposure, HaCaT and DOK cells behavior differed in terms of movement and proliferation. The cells’ ability to cover the denuded surface and individual cell trajectories were recorded by time-lapse videomicroscopy, during wound healing experiments. Dysplastic keratinocytes showed more sensitivity to UVA, exhibiting transient deficiencies in directionality of movement and a delay in re-coating the denuded area. The actin cytoskeleton displayed a cortical organization immediately after irradiation, in both cell lines, similar to mock-irradiated cells. Post-irradiation, DOK cells displayed a better organization of stress fibers, persistent filopodia, and new, stronger focal contacts. In conclusion, after UVA exposure HaCaT and DOK cells showed a different behavior in terms of adherence, spreading, motility, proliferation, and actin cytoskeleton dynamics, with the dyplastic keratinocytes being more sensitive.

  13. Increased keratinocyte proliferation initiated through downregulation of desmoplakin by RNA interference

    International Nuclear Information System (INIS)

    Wan Hong; South, Andrew P.; Hart, Ian R.

    2007-01-01

    The intercellular adhesive junction desmosomes are essential for the maintenance of tissue structure and integrity in skin. Desmoplakin (Dp) is a major obligate plaque protein which plays a fundamental role in anchoring intermediate filaments to desmosomal cadherins. Evidence from hereditary human disease caused by mutations in the gene encoding Dp, e.g. Dp haploinsufficiency, suggests that alterations in Dp expression result not only in the disruption of tissue structure and integrity but also could evoke changes in keratinocyte proliferation. We have used transient RNA interference (RNAi) to downregulate Dp specifically in HaCaT keratinocytes. We showed that this Dp downregulation also caused reduced expression of several other desmosomal proteins. Increased cell proliferation and enhanced G 1 -to-S-phase entry in the cell cycle, as monitored by colonial cellular density and BrdU incorporation, were seen in Dp RNAi-treated cells. These proliferative changes were associated with elevated phospho-ERK1/2 and phospho-Akt levels. Furthermore, this increase in phospho-ERK/1/2 and phospho-Akt levels was sustained in Dp RNAi-treated cells at confluence whereas in control cells there was a significant reduction in phosphorylation of ERK1/2. This study indicates that Dp may participate in the regulation of keratinocyte cell proliferation by, in part at least, regulating cell cycle progression

  14. Design and characterization of a 32P-patch for the treatment of skin diseases. Studies of its application as a betatherapeutic agent for modulated brachytherapy

    International Nuclear Information System (INIS)

    Salgueiro, M. J.

    2010-01-01

    The purpose of this work was to design and evaluate a 32 P-patch for contact brachytherapy of skin diseases. [ 32 P]-chromic phosphate in combination with silicone was employed to produce the designed 32 P patch. Radiopharmaceutical production was carried out in accordance with radiological safety issues. To verify the safety of the 32 P-patch, stability studies in vitro and in vivo were carried out to evaluate the leakage of radioactivity and autoradiographic studies were performed to evaluate the dose homogeneity and shielding. Therapeutic efficacy in animal models of skin cancer as well as in cats with squamous cell carcinoma was evaluated. These results showed that independently of the considered model, tumor growth was arrested and complete regressions were achieved in some other cases. Radiation doses were estimated with equations derived from the MIRD DOSE scheme and compared with Monte Carlo β doses. Some advantages of the designed 32 P-patch allow its use for conformal and modulated radiotherapy such as the possibility of modifying the activity concentration of the patch, the limited range of β- radiation, dose deep distribution and combination with bolus. This 32 P-patch which is easy to prepare and control may be used in the treatment of skin diseases alone or in combination with other treatment modalities. (author)

  15. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  16. Protective effect of different antioxidant agents in UVB-irradiated keratinocytes

    Directory of Open Access Journals (Sweden)

    Sara Salucci

    2017-09-01

    Full Text Available Skin cells can respond to UVB-induced damage either by tolerating it, or restoring it through antioxidant activation and DNA repair mechanisms or, ultimately, undergoing programmed cell death, when damage is massive. Nutritional factors, in particular, food antioxidants, have attracted much interest because of their potential use in new preventive, protective, and therapeutic strategies for chronic degenerative diseases, including skin inflammation and cancer. Some polyphenols, present in virgin olive oil, well tolerated by organism after oral administration, show a variety of pharmacological and clinical benefits such as anti-oxidant, anti-cancer, anti-inflammatory, and neuro-protective activities. Here, the protective effects of antioxidant compounds against UV-induced apoptosis have been described in HaCat cell line. Human keratinocytes were pre-treated with antioxidants before UVB exposure and their effects have been evaluated by means of ultrastructural analyses. After UVB radiation, a known cell death trigger, typical apoptotic features, absent in control condition and in antioxidant alone-treated cells, appear. An evident numerical decrease of ultrastructural apoptotic patterns and TUNEL positive nuclei can be observed when natural antioxidants were supplied before cell death induction. These data have been confirmed by molecular investigation of caspase activity. In conclusion, this paper highlights antioxidant compound ability to prevent apoptotic cell death in human keratinocytes exposed to UVB, suggesting, for these molecules, a potential role in preventing skin damage. 

  17. Resveratrol-Sensitized UVA Induced Apoptosis in Human Keratinocytes through Mitochondrial Oxidative Stress and Pore Opening

    Science.gov (United States)

    Boyer, Jean Z; Jandova, Jana; Janda, Jaroslav; Vleugels, Frank R; Elliott, David; Sligh, James E

    2012-01-01

    Resveratrol (3, 5, 4′-trihydroxy- trans- stilbene), a polyphenol compound, is derived from natural products such as the skin of red grapes, blueberries and cranberries. Resveratrol not only exhibits antioxidant, cardioprotection, and anti-aging properties, but can also inhibit cancer cell growth and induce apoptosis. It has been shown that resveratrol inhibits the activation of Nf-kB and subsequently down regulates the expression of Nf-kB regulated genes such as interleukin-2 and Bcl-2, leading to cell cycle arrest and increased apoptosis in multiple myeloma cells. In the skin, resveratrol has been reported to sensitize keratinocytes to UVA induced apoptosis. However, the effect of resveratrol on opening of the mitochondrial permeability transition pore has not been previously examined. Our data show that UVA (14J/cm2) along with resveratrol causes massive oxidative stress in mitochondria. As a consequence of oxidative stress, the mitochondrial membrane potential decreases which results in opening of the mitochondrial pores ultimately leading to apoptosis in human keratinocytes. These results may have clinical implications for development of future chemotherapeutic treatment for tumors of the skin. PMID:22673012

  18. Skin moisturization mechanisms: new data.

    Science.gov (United States)

    Bonté, F

    2011-05-01

    The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  19. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  20. Monitoring UV-induced signalling pathways in an ex vivo skin organ culture model using phospho-antibody array.

    Science.gov (United States)

    Lenain, Christelle; Gamboa, Bastien; Perrin, Agnes; Séraïdaris, Alexia; Bertino, Béatrice; Rival, Yves; Bernardi, Mathieu; Piwnica, David; Méhul, Bruno

    2018-05-01

    We investigated UV-induced signalling in an ex vivo skin organ culture model using phospho-antibody array. Phosphorylation modulations were analysed in time-course experiments following exposure to solar-simulated UV and validated by Western blot analyses. We found that UV induced P-p38 and its substrates, P-ERK1/2 and P-AKT, which were previously shown to be upregulated by UV in cultured keratinocytes and in vivo human skin. This indicates that phospho-antibody array applied to ex vivo skin organ culture is a relevant experimental system to investigate signalling events following perturbations. As the identified proteins are components of pathways implicated in skin tumorigenesis, UV-exposed skin organ culture model could be used to investigate the effect on these pathways of NMSC cancer drug candidates. In addition, we found that phospho-HCK is induced upon UV exposure, producing a new candidate for future studies investigating its role in the skin response to UV and UV-induced carcinogenesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Induction of PDGF-B in TCA-treated epidermal keratinocytes.

    Science.gov (United States)

    Yonei, Nozomi; Kanazawa, Nobuo; Ohtani, Toshio; Furukawa, Fukumi; Yamamoto, Yuki

    2007-11-01

    Trichloroacetic acid (TCA) is one of the most widely used peeling agents, and induces full necrosis of the whole epidermis, followed by reconstitution of the epidermis and the matrix of the papillary dermis. The cytotoxic effects of TCA, such as suppressing proliferation of keratinocytes and fibroblasts and protein synthesis by fibroblasts, have already been reported. However, the entire biological mechanism responsible for TCA peeling has yet to be determined. Hypothetical activation effects of TCA treatment on epidermal cells to induce production of growth factors and cytokines are examined, and are compared with its cytotoxic effects in terms of time course and applied TCA concentrations. After various periods of incubation with TCA, viability of Pam212 murine keratinocytes was investigated with MTT assay and dye exclusion assay, and production of growth factors and cytokines with reverse transcription-polymerase chain reaction (RT-PCR). Changes in platelet-derived growth factor (PDGF)-B mRNA expression and protein production in the human skin specimens after TCA application were then examined by RT-PCR and immunohistochemistry, respectively. Incubation with TCA showed cytotoxicity and induced death of Pam212 cells, depending on the incubation period and the TCA concentration. In addition, expressions of PDGF-B, tumor growth factor (TGF)-alpha, TGF- beta1 and vascular endothelial growth factor, which are the growth factors reportedly secreted from keratinocytes during wound healing, were all detected in Pam212 cells after short-term treatment with TCA. Expressions of inflammatory cytokines such as interleukin (IL)-1 and IL-10 were also induced. In TCA-treated NIH-3T3 fibroblasts, in contrast, observed was upregulation of only keratinocyte growth factor, which is reportedly secreted from fibroblasts, as well as the similar cytotoxic effect. In human skin, PDGF-B mRNA expression became significantly upregulated after TCA application, and then immediately

  2. Interleukin 1 gene expression in cultured human keratinocytes is augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.

    1987-01-01

    Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure

  3. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  4. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    International Nuclear Information System (INIS)

    Hasegawa, Tatsuya; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-01-01

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE_2. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  5. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Tatsuya, E-mail: tatsuya.hasegawa@to.shiseido.co.jp; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-08-26

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE{sub 2}. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  6. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2011-01-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  7. Impaired hair follicle morphogenesis and polarized keratinocyte movement upon conditional inactivation of integrin-linked kinase in the epidermis.

    Science.gov (United States)

    Nakrieko, Kerry-Ann; Welch, Ian; Dupuis, Holly; Bryce, Dawn; Pajak, Agnieszka; St Arnaud, René; Dedhar, Shoukat; D'Souza, Sudhir J A; Dagnino, Lina

    2008-04-01

    Integrin-linked kinase (ILK) is key for cell survival, migration, and adhesion, but little is known about its role in epidermal development and homeostasis in vivo. We generated mice with conditional inactivation of the Ilk gene in squamous epithelia. These mice die perinatally and exhibit skin blistering and severe defects in hair follicle morphogenesis, including greatly reduced follicle numbers, failure to progress beyond very early developmental stages, and pronounced defects in follicular keratinocyte proliferation. ILK-deficient epidermis shows abnormalities in adhesion to the basement membrane and in differentiation. ILK-deficient cultured keratinocytes fail to attach and spread efficiently and exhibit multiple abnormalities in actin cytoskeletal organization. Ilk gene inactivation in cultured keratinocytes causes impaired ability to form stable lamellipodia, to directionally migrate, and to polarize. These defects are accompanied by abnormal distribution of active Cdc42 to cell protrusions, as well as reduced activation of Rac1 upon induction of cell migration in scraped keratinocyte monolayers. Significantly, alterations in cell spreading and forward movement in single cells can be rescued by expression of constitutively active Rac1 or RhoG. Our studies underscore a central and distinct role for ILK in hair follicle development and in polarized cell movements, two key aspects of epithelial morphogenesis and function.

  8. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  9. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  10. Platelet-rich plasma with keratinocytes and fibroblasts enhance healing of full-thickness wounds.

    Science.gov (United States)

    Law, Jia Xian; Chowdhury, Shiplu Roy; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj

    2017-08-01

    Advances in tissue engineering led to the development of various tissue-engineered skin substitutes (TESS) for the treatment of skin injuries. The majority of the autologous TESS required lengthy and costly cell expansion process to fabricate. In this study, we determine the possibility of using a low density of human skin cells suspended in platelet-rich plasma (PRP)-enriched medium to promote the healing of full-thickness skin wounds. To achieve this, full-thickness wounds of size 1.767 cm 2 were created at the dorsum part of nude mice and treated with keratinocytes (2 × 10 4  cells/cm 2 ) and fibroblasts (3 × 10 4  cells/cm 2 ) suspended in 10% PRP-enriched medium. Wound examination was conducted weekly and the animals were euthanized after 2 weeks. Gross examination showed that re-epithelialization was fastest in the PRP+cells group at both day 7 and 14, followed by the PRP group and NT group receiving no treatment. Only the PRP+cells group achieved complete wound closure by 2 weeks. Epidermal layer was presence in the central region of the wound of the PRP+cells and PRP groups but absence in the NT group. Comparison between the PRP+cells and PRP groups showed that the PRP+cells-treated wound was more mature as indicated by the presence of thinner epidermis with single cell layer thick basal keratinocytes and less cellular dermis. In summary, the combination of low cell density and diluted PRP creates a synergistic effect which expedites the healing of full-thickness wounds. This combination has the potential to be developed as a rapid wound therapy via the direct application of freshly harvested skin cells in diluted PRP. Copyright © 2017 Tissue Viability Society. Published by Elsevier Ltd. All rights reserved.

  11. Protection against 2-chloroethyl ethyl sulfide (CEES) - induced cytotoxicity in human keratinocytes by an inducer of the glutathione detoxification pathway

    International Nuclear Information System (INIS)

    Abel, Erika L.; Bubel, Jennifer D.; Simper, Melissa S.; Powell, Leslie; McClellan, S. Alex; Andreeff, Michael; MacLeod, Michael C.; DiGiovanni, John

    2011-01-01

    Sulfur mustard (SM or mustard gas) was first used as a chemical warfare agent almost 100 years ago. Due to its toxic effects on the eyes, lungs, and skin, and the relative ease with which it may be synthesized, mustard gas remains a potential chemical threat to the present day. SM exposed skin develops fluid filled bullae resulting from potent cytotoxicity of cells lining the basement membrane of the epidermis. Currently, there are no antidotes for SM exposure; therefore, chemopreventive measures for first responders following an SM attack are needed. Glutathione (GSH) is known to have a protective effect against SM toxicity, and detoxification of SM is believed to occur, in part, via GSH conjugation. Therefore, we screened 6 potential chemopreventive agents for ability to induce GSH synthesis and protect cultured human keratinocytes against the SM analog, 2-chloroethyl ethyl sulfide (CEES). Using NCTC2544 human keratinocytes, we found that both sulforaphane and methyl-2-cyano-3,12-dioxooleana-1,9-dien-28-oate (CDDO-Me) stimulated nuclear localization of Nrf2 and induced expression of the GSH synthesis gene, GCLM. Additionally, we found that treatment with CDDO-Me elevated reduced GSH content of NCTC2544 cells and preserved their viability by ∼ 3-fold following exposure to CEES. Our data also suggested that CDDO-Me may act additively with 2,6-dithiopurine (DTP), a nucleophilic scavenging agent, to increase the viability of keratinocytes exposed to CEES. These results suggest that CDDO-Me is a promising chemopreventive agent for SM toxicity in the skin. - Highlights: → CDDO-Me treatment increased intracellular GSH in human keratinocytes. → CDDO-Me increased cell viability following exposure to the half-mustard, CEES. → The cytoprotective effect of CDDO-Me was likely due to scavenging with endogenous GSH.

  12. Differentiation of human scalp hair follicle keratinocytes in culture.

    Science.gov (United States)

    Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J

    1984-01-01

    The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.

  13. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  14. Proliferation of Keratinocytes Induced by Adipose-Derived Stem Cells on a Chitosan Scaffold and Its Role in Wound Healing, a Review

    Directory of Open Access Journals (Sweden)

    Sankaralakshmi Gomathysankar

    2014-09-01

    Full Text Available In the field of tissue engineering and reconstruction, the development of efficient biomaterial is in high demand to achieve uncomplicated wound healing. Chronic wounds and excessive scarring are the major complications of tissue repair and, as this inadequate healing continues to increase, novel therapies and treatments for dysfunctional skin repair and reconstruction are important. This paper reviews the various aspects of the complications related to wound healing and focuses on chitosan because of its unique function in accelerating wound healing. The proliferation of keratinocytes is essential for wound closure, and adipose-derived stem cells play a significant role in wound healing. Thus, chitosan in combination with keratinocytes and adipose-derived stem cells may act as a vehicle for delivering cells, which would increase the proliferation of keratinocytes and help complete recovery from injuries.

  15. Release by ultraviolet B (u.v.B) radiation of nitric oxide (NO) from human keratinocytes: a potential role for nitric oxide in erythema production

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stravrides, J.C.

    1995-01-01

    The mechanism of human sunburn is poorly understood but its characteristic features include the development of erythema. In this study we attempted to determine whether human keratinocytes possess a nitric oxide (NO) synthase (NOS), if this enzyme could be activated to release NO following exposure to ultraviolet B (u.v.B) and to define whether this photo-induced response could be involved in the pathogenesis of sunburn erythema. The present results indicate that u.v.B radiation acts as a potent stimulator of NOS in keratinocytes. NO is lipophilic and may diffuse out of the keratinocytes, activating sGC in endothelial cells and neighbouring smooth muscle cells. This may be a major part of the integrated response of the skin leading to vasodilatation and erythema. (author)

  16. Chronologic and actinically induced aging in human facial skin

    International Nuclear Information System (INIS)

    Gilchrest, B.A.; Szabo, G.; Flynn, E.; Goldwyn, R.M.

    1983-01-01

    Clinical and histologic stigmata of aging are much more prominent in habitually sun-exposed skin than in sun-protected skin, but other possible manifestations of actinically induced aging are almost unexplored. We have examined the interrelation of chronologic and actinic aging using paired preauricular (sun-exposed) and postauricular (sun-protected) skin specimens. Keratinocyte cultures derived from sun-exposed skin consistently had a shorter in vitro lifespan but increased plating efficiency compared with cultures derived from adjacent sun-protected skin of the same individual, confirming a previous study of different paired body sites. Electron microscopic histologic sections revealed focal abnormalities of keratinocyte proliferation and alignment in vitro especially in those cultures derived from sun-exposed skin and decreased intercellular contact in stratified colonies at late passage, regardless of donor site. One-micron histologic sections of the original biopsy specimens revealed no striking site-related keratinocyte alterations, but sun-exposed specimens had fewer epidermal Langerhans cells (p less than 0.001), averaging approximately 50 percent the number in sun-protected skin, a possible exaggeration of the previously reported age-associated decrease in this cell population. These data suggest that sun exposure indeed accelerates aging by several criteria and that, regardless of mechanism, environmental factors may adversely affect the appearance and function of aging skin in ways amenable to experimental quantitation

  17. ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

    Science.gov (United States)

    Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

    2013-01-01

    ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

  18. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  19. A comparative in vitro study of the viability of human keratinocytes grown on irradiated human amnion membrane and fibrin glue scaffolds

    International Nuclear Information System (INIS)

    Dorai, A.A.; Lim, C.K.; Azman, W.S.; Halim, A.S.

    2008-01-01

    Full text: The dried irradiated human amnion membrane has been used as a biological dressing for various clinical conditions. Being another biological membrane its potential as a scaffold to grow human keratinocytes is not known yet. To compare the growth patterns and cell viability of keratinocytes using fibrin glue and air dried amnion membrane as a scaffold. Keratinocytes were obtained from skin samples of six patients undergoing elective surgery. Fibrin glue (Tisseel, Baxter ) was diluted and used to coat the wells. Human dried amnion membrane was obtained and placed into the 24 well plates. Keratinocytes were seeded into the fibrin and amnion scaffold. Cell viability assay (MTT) was performed after 24, 48 and 72 hours. Finally the measurements were done by the Enzyme-Linked Immunosorbent Assay (ELISA) reader at 570 nm. Six patients consented for the study. The cells growing on the amnion scaffold showed a decreasing trend (20.67%, 17.94% and 16.78% respectively for 24, 48 and 72 hours). The cells growing on the fibrin scaffold showed a steady increase in number at 24, 48 and 72 hours (73.03%, 74.12% and 79.66%). The percentage of growth of normal human keratinocytes were significantly greater in the fibrin scaffold group (Mann - Whitney p = 0.002) for 24, 48 and 72 hours. The air dried irradiated human amnion membrane can be used as a scaffold to grow keratinocytes but however the growth pattern does not sustain with time. Fibrin glue supports the growth of human keratinocytes and shows an increasing pattern of growth with time. (Author)

  20. Black rice (Oryza sativa L.) extract modulates ultraviolet-induced expression of matrix metalloproteinases and procollagen in a skin cell model.

    Science.gov (United States)

    Han, Mira; Bae, Jung-Soo; Ban, Jae-Jun; Shin, Hee Soon; Lee, Dong Hun; Chung, Jin Ho

    2018-05-01

    Exposure of the skin to ultraviolet (UV) radiation causes extracellular matrix (ECM) collapse in the dermis, owing to an increase in matrix metalloproteinase (MMP) production in both the epidermis and dermis, and a decrease in type I collagen expression in the dermis. Recently, black rice (Oryza sativa L.) was reported to have a wide range of pharmacological effects in various settings. However, the effects of black rice extract (BRE) on UV‑irradiated skin cells have not yet been characterized. BRE treatment did not affect cell morphology and viability of HaCaT and human dermal fibroblasts (HDF). We demonstrated that BRE downregulated basal and UV‑induced MMP‑1 expression in HaCaT cells. Furthermore, BRE significantly increased type I procollagen expression, and decreased MMP‑1 and MMP‑3 expression in UV‑irradiated HDF. The underlying mechanisms of these results involve a decrease in p38 and c‑Jun N‑terminal kinase activity, and suppression of UV‑induced activation of activator protein‑1 (AP‑1). BRE reduced UV‑induced reactive oxygen species production in HaCaT cells in a dose‑dependent manner. Indeed, mass spectrometry revealed that BRE contained antioxidative flavonoid components such as cyanidin‑3‑O‑β‑D‑glycoside and taxifolin‑7‑O‑glucoside. These findings suggest that BRE attenuates UV‑induced ECM damage by modulating mitogen‑activated protein kinase and AP‑1 signaling, and could be used as an active ingredient for preventing photoaging of the skin.

  1. Reconstruction of epidermis by grafting of keratinocytes cultured on polymer support--clinical study.

    Science.gov (United States)

    Dvoránková, Barbora; Holíková, Zuzana; Vacík, Jirí; Königová, Radana; Kapounková, Zuzana; Michálek, Jirí; Prádn, Martin; Smetana, Karel

    2003-03-01

    Extensive wound coverage still represents a challenge for contemporary medicine. We demonstrate the results of a clinical trial of the grafting of cultured keratinocytes directly on a polymer cultivation support in the treatment of skin defects in seriously burned patients and in patients with trophic ulcers. Wound closure was evaluated clinically. The morphology and phenotypic pattern of the reconstructed epidermis, including the basal lamina, as well as the presence of Langerhans cells, were evaluated immunocytochemically using a panel of monoclonal antibodies. All layers of the reconstructed epidermis were normally differentiated (cytokeratin immunocytochemistry). The basal lamina contained collagen type IV and laminin. The reconstructed epidermis was extensively colonized by Langerhans cells. The results of the described technology are encouraging, especially in patients after a burn injury. The described procedure is suitable for the treatment of skin defects in clinical practice.

  2. Inhibition of inflammatory and proliferative responses of human keratinocytes exposed to the sesquiterpene lactones dehydrocostuslactone and costunolide.

    Directory of Open Access Journals (Sweden)

    Claudia Scarponi

    Full Text Available The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE and costunolide (CS, two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit

  3. Skin toxicity of jet fuels: ultrastructural studies and the effects of substance P

    International Nuclear Information System (INIS)

    Monteiro-Riviere, Nancy A.; Inman, Alfred O.; Riviere, Jim E.

    2004-01-01

    Topical exposure to jet fuel is a significant occupational hazard. Recent studies have focused on dermal absorption of fuel and its components, or alternatively, on the biochemical or immunotoxicological sequelae to exposure. Surprisingly, morphological and ultrastructural analyses have not been systematically conducted. Similarly, few studies have compared responses in skin to that of the primary target organ, the lung. The focus of the present investigation was 2-fold: first, to characterize the ultrastructural changes seen after topical exposure to moderate doses (335 or 67 μl/cm 2 ) of jet fuels [Jet A, Jet Propellant (JP)-8, JP-8+100] for up to 4 days in pigs, and secondly, to determine if co-administration of substance P (SP) with JP-8 jet fuel in human epidermal keratinocyte cell cultures modulates toxicity as it does to pulmonary toxicity in laboratory animal studies. The primary change seen after exposure to all fuels was low-level inflammation accompanied by formation of lipid droplets in various skin layers, mitochondrial and nucleolar changes, cleft formation in the intercellular lipid lamellar bilayers, as well as disorganization in the stratum granulosum-stratum corneum interface. An increased number of Langerhans cells were also noted in jet fuel-treated skin. These changes suggest that the primary effect of jet fuel exposure is damage to the stratum corneum barrier. SP administration decreased the release of interleukin (IL)-8 normally seen in keratinocytes after JP-8 exposure, a response similar to that reported for SP's effect on JP-8 pulmonary toxicity. These studies provide a base upon which biochemical and immunological data collected in other model systems can be compared

  4. Integrins as Modulators of Transforming Growth Factor Beta Signaling in Dermal Fibroblasts During Skin Regeneration After Injury.

    Science.gov (United States)

    Boo, Stellar; Dagnino, Lina

    2013-06-01

    Abnormal wound repair results from disorders in granulation tissue remodeling, and can lead to hypertrophic scarring and fibrosis. Excessive scarring can compromise tissue function and decrease tissue resistance to additional injuries. The development of potential therapies to minimize scarring is, thus, necessary to address an important clinical problem. It has been clearly established that multiple cytokines and growth factors participate in the regulation of cutaneous wound healing. More recently, it has become apparent that these factors do not necessarily activate isolated signaling pathways. Rather, in some cases, there is cross-modulation of several cellular pathways involved in this process. Two of the key pathways that modulate each other during wound healing are activated by transforming growth factor-β and by extracellular matrix proteins acting through integrins. The pathogenesis of excessive scarring upon wound healing is not fully understood, as a result of the complexity of this process. However, the fact that many pathways combine to produce fibrosis provides multiple potential therapeutic targets. Some of them have been identified, such as focal adhesion kinase and integrin-linked kinase. Currently, a major challenge is to develop pharmacological inhibitors of these proteins with therapeutic value to promote efficient wound repair. The ability to better understand how different pathways crosstalk during wound repair and to identify and pharmacologically modulate key factors that contribute to the regulation of multiple wound-healing pathways could potentially provide effective therapeutic targets to decrease or prevent excessive scar formation and/or development of fibrosis.

  5. Skin Stem Cell Hypotheses and Long Term Clone Survival - Explored Using Agent-based Modelling

    OpenAIRE

    Li, X.; Upadhyay, A.K.; Bullock, A.J.; Dicolandrea, T.; Xu, J.; Binder, R.L.; Robinson, M.K.; Finlay, D.R.; Mills, K.J.; Bascom, C.C.; Kelling, C.K.; Isfort, R.J.; Haycock, J.W.; MacNeil, S.; Smallwood, R.H.

    2013-01-01

    Epithelial renewal in skin is achieved by the constant turnover and differentiation of keratinocytes. Three popular hypotheses have been proposed to explain basal keratinocyte regeneration and epidermal homeostasis: 1) asymmetric division (stem-transit amplifying cell); 2) populational asymmetry (progenitor cell with stochastic fate); and 3) populational asymmetry with stem cells. In this study, we investigated lineage dynamics using these hypotheses with a 3D agent-based model of the epiderm...

  6. Ectodermal Dysplasia Skin Fragility Syndrome

    Directory of Open Access Journals (Sweden)

    Ayça Alan Atalay

    2014-06-01

    Full Text Available Ectodermal dysplasia-skin fragility syndrome (EDSFS is a rare autosomal recessive genodermatosis first described in 1997 by Mc Grath. EDSFS results from loss of function mutations in plakophilin-1 (PKP1. PKP1 is a structural component of desmosomes, cellcell adhesion complexes. It is also found as a nuclear protein in several cell types that are lack of desmosomes. In skin, however, PKP1 expression is confined mainly to suprabasal keratinocytes and the outer root sheath of hair follicules. Loss of function mutation in PKP1 leads to extensive skin fragility, bullae and erosions following minor trauma, focal keratoderma with painful fissures, alopecia, and nail dystrophy. In some patients hypohidrosis may also be seen. EDSFS is now considered as a specific suprabasal form of epidermolysis bullosa simplex. In this report we describe a 20 year old EDSFS case.

  7. Stereotyped distribution of proliferating keratinocytes in disorders affecting the epidermis

    International Nuclear Information System (INIS)

    Pierard-Franchimont, C.; Pierard, G.E.

    1989-01-01

    We used the technique of autoradiography after incorporation of tritiated thymidine ( 3 H-TdR) to evaluate keratinocyte proliferation in basal, epibasal, and other epidermal layers in 30 diseases affecting the epidermis. The number and proportion of 3 H-TdR-labeled keratinocytes were counted in the different layers of the epidermis. Significant correlations were found between the proliferative indices of the different epidermal layers. Such links indicate that the epidermis responds in a rather stereotyped way to various pathological conditions. There exists some regulation in the distribution, number, and proportion of 3 H-TdR-labeled keratinocytes in the various layers of the epidermis

  8. Effects of advanced glycation end-products (AGEs) on skin ...

    African Journals Online (AJOL)

    kappa B (NF-κB) localization and cell viability were measured in vivo. Keratinocytes from normal skin were cultured in AGE-enriched conditional media, and the cell viability, apoptosis, adhesion and migration were detected in order to find the ...

  9. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  10. Metabolic activation of pyrrolizidine alkaloids leading to phototoxicity and photogenotoxicity in human HaCaT keratinocytes.

    Science.gov (United States)

    Wang, Chia-Chi; Xia, Qingsu; Li, Meng; Wang, Shuguang; Zhao, Yuewei; Tolleson, William H; Yin, Jun-Jie; Fu, Peter P

    2014-01-01

    Pyrrolizidine alkaloids, produced by a large number of poisonous plants with wide global distribution, are associated with genotoxicity, tumorigenicity, and hepatotoxicity in animals and humans. Mammalian metabolism converts pyrrolizidine alkaloids to reactive pyrrolic metabolites (dehydropyrrolizidine alkaloids) that form covalent protein and DNA adducts. Although a mechanistic understanding is currently unclear, pyrrolizidine alkaloids can cause secondary (hepatogenous) photosensitization and induce skin cancer. In this study, the phototoxicity of monocrotaline, riddelliine, dehydromonocrotaline, dehydroriddelliine, and dehydroretronecine (DHR) in human HaCaT keratinocytes under ultraviolet A (UVA) irradiation was determined. UVA irradiation of HaCaT cells treated with dehydromonocrotaline, dehydroriddelline, and DHR resulted in increased release of lactate dehydrogenase and enhanced photocytotoxicity proportional to the UVA doses. UVA-induced photochemical DNA damage also increased proportionally with dehydromonocrotaline and dehydroriddelline. UVA treatment potentiated the formation of 8-hydroxy-2'-deoxyguanosine DNA adducts induced by dehydromonocrotaline in HaCaT skin keratinocytes. Using electron spin resistance trapping, we found that UVA irradiation of dehydromonocrotaline and dehydroriddelliine generates reactive oxygen species (ROS), including hydroxyl radical, singlet oxygen, and superoxide, and electron transfer reactions, indicating that cytotoxicity and genotoxicity of these compounds could be mediated by ROS. Our results suggest that dehydropyrrolizidine alkaloids formed or delivered to the skin cause pyrrolizidine alkaloid-induced secondary photosensitization and possible skin cancer.

  11. Scanning Ion Conductance Microscopy of Live Keratinocytes

    International Nuclear Information System (INIS)

    Hegde, V; Mason, A; Saliev, T; Smith, F J D; McLean, W H I; Campbell, P A

    2012-01-01

    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (< nN), could not routinely image microvilli: rather, an apparently convolved image of the underlying cytoskeleton was instead prevalent. We note that the present incarnation of the commercial instrument falls some way behind the market leading SPMs in terms of technical prowess and scanning speed, however, the intrinsic non-obtrusive nature of

  12. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  13. The Pseudomonas aeruginosa quorum sensing signal molecule N-(3-oxododecanoyl) homoserine lactone enhances keratinocyte migration and induces Mmp13 gene expression in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Paes, Camila, E-mail: camilaquinetti@gmail.com [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Nakagami, Gojiro, E-mail: gojiron-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Minematsu, Takeo, E-mail: tminematsu-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Nagase, Takashi, E-mail: tnagase@fb3.so-net.ne.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Huang, Lijuan, E-mail: koureikenhlj@gmail.com [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sari, Yunita, E-mail: yunita-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sanada, Hiromi, E-mail: hsanada-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan)

    2012-10-19

    Highlights: Black-Right-Pointing-Pointer An evidence of the positive effect of AHL on epithelialization process is provided. Black-Right-Pointing-Pointer AHL enhances keratinocyte's ability to migrate in an in vitro scratch wound model. Black-Right-Pointing-Pointer AHL induces the expression of Mmp13. Black-Right-Pointing-Pointer Topical application of AHL represents a possible strategy to treat chronic wounds. -- Abstract: Re-epithelialization is an essential step of wound healing involving three overlapping keratinocyte functions: migration, proliferation and differentiation. While quorum sensing (QS) is a cell density-dependent signaling system that enables bacteria to regulate the expression of certain genes, the QS molecule N-(3-oxododecanoyl) homoserine lactone (AHL) exerts effects also on mammalian cells in a process called inter-kingdom signaling. Recent studies have shown that AHL improves epithelialization in in vivo wound healing models but detailed understanding of the molecular and cellular mechanisms are needed. The present study focused on the AHL as a candidate reagent to improve wound healing through direct modulation of keratinocyte's activity in the re-epithelialization process. Results indicated that AHL enhances the keratinocyte's ability to migrate in an in vitro scratch wound healing model probably due to the high Mmp13 gene expression analysis after AHL treatment that was revealed by real-time RT-PCR. Inhibition of activator protein 1 (AP-1) signaling pathway completely prevented the migration of keratinocytes, and also resulted in a diminished Mmp13 gene expression, suggesting that AP-1 might be essential in the AHL-induced migration. Taken together, these results imply that AHL is a promising candidate molecule to improve re-epithelialization through the induction of migration of keratinocytes. Further investigation is needed to clarify the mechanism of action and molecular pathway of AHL on the keratinocyte migration

  14. Modulation of Wound Healing and Scar Formation by MG53 Protein-mediated Cell Membrane Repair*

    Science.gov (United States)

    Li, Haichang; Duann, Pu; Lin, Pei-Hui; Zhao, Li; Fan, Zhaobo; Tan, Tao; Zhou, Xinyu; Sun, Mingzhai; Fu, Minghuan; Orange, Matthew; Sermersheim, Matthew; Ma, Hanley; He, Duofen; Steinberg, Steven M.; Higgins, Robert; Zhu, Hua; John, Elizabeth; Zeng, Chunyu; Guan, Jianjun; Ma, Jianjie

    2015-01-01

    Cell membrane repair is an important aspect of physiology, and disruption of this process can result in pathophysiology in a number of different tissues, including wound healing, chronic ulcer and scarring. We have previously identified a novel tripartite motif family protein, MG53, as an essential component of the cell membrane repair machinery. Here we report the functional role of MG53 in the modulation of wound healing and scarring. Although MG53 is absent from keratinocytes and fibroblasts, remarkable defects in skin architecture and collagen overproduction are observed in mg53−/− mice, and these animals display delayed wound healing and abnormal scarring. Recombinant human MG53 (rhMG53) protein, encapsulated in a hydrogel formulation, facilitates wound healing and prevents scarring in rodent models of dermal injuries. An in vitro study shows that rhMG53 protects against acute injury to keratinocytes and facilitates the migration of fibroblasts in response to scratch wounding. During fibrotic remodeling, rhMG53 interferes with TGF-β-dependent activation of myofibroblast differentiation. The resulting down-regulation of α smooth muscle actin and extracellular matrix proteins contributes to reduced scarring. Overall, these studies establish a trifunctional role for MG53 as a facilitator of rapid injury repair, a mediator of cell migration, and a modulator of myofibroblast differentiation during wound healing. Targeting the functional interaction between MG53 and TGF-β signaling may present a potentially effective means for promoting scarless wound healing. PMID:26306047

  15. Effects of titanium dioxide nanoparticles on human keratinocytes.

    Science.gov (United States)

    Wright, Clayton; Iyer, Anand Krishnan V; Wang, Liying; Wu, Nianqiang; Yakisich, Juan S; Rojanasakul, Yon; Azad, Neelam

    2017-01-01

    Titanium dioxide (TiO 2 ) is a ubiquitous whitening compound widely used in topical products such as sunscreens, lotions and facial creams. The damaging health effects of TiO 2 inhalation has been widely studied in rats, mice and humans showing oxidative stress increase, DNA damage, cell death and inflammatory gene upregulation in lung and throat cells; however, the effects on skin cells from long-term topical use of various products remain largely unknown. In this study, we assessed the effect of specific TiO 2 nanoparticles (H 2 TiO 7 ) on a human keratinocyte cell line (HaCaT). We performed a comparative analysis using three TiO 2 particles varying in size (Fine, Ultrafine and H 2 TiO 7 ) and analyzed their effects on HaCaTs. There is a clear dose-dependent increase in superoxide production, caspase 8 and 9 activity, and apoptosis in HaCaTs after treatment with all three forms of TiO 2 ; however, there is no consistent effect on cell viability and proliferation with either of these TiO 2 particles. While there is data suggesting UV exposure can enhance the carcinogenic effects of TiO 2 , we did not observe any significant effect of UV-C exposure combined with TiO 2 treatment on HaCaTs. Furthermore, TiO 2 -treated cells showed minimal effects on VEGF upregulation and Wnt signaling pathway thereby showing no potential effect on angiogenesis and malignant transformation. Overall, we report here an increase in apoptosis, which may be caspase 8/Fas-dependent, and that the H 2 TiO 7 nanoparticles, despite their smaller particle size, had no significant enhanced effect on HaCaT cells as compared to Fine and Ultrafine forms of TiO 2 .

  16. Serial cultivation of human scalp hair follicle keratinocytes.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Vermorken, A J; Bloemendal, H

    1983-01-01

    A method is described for the serial cultivation of adult human hair follicle keratinocytes. Plucked scalp hair follicles, placed on bovine eye lens capsules as a growth substrate, give rise to quickly expanding colonies within a few days. After trypsinization, the cells are replated with irradiated 3T3 cells as 'feeders'. Using this combination of techniques the keratinocytes can be subcultured up to four times. In this way about 10(7) keratinocytes can be generated from one single hair follicle. Moreover, the technique enables cryogenic storage of the cells, allowing for instance, convenient transportation. Subcultured hair follicle keratinocytes can be plated on glass coverslips. This allows immunofluorescence studies. The keratin cytoskeletons visualized using an antiserum against human keratin.

  17. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  18. Interactions of mean body and local skin temperatures in the modulation of human forearm and calf blood flows: a three-dimensional description.

    Science.gov (United States)

    Caldwell, Joanne N; Matsuda-Nakamura, Mayumi; Taylor, Nigel A S

    2016-02-01

    The inter-relationships between mean body and local skin temperatures have previously been established for controlling hand and foot blood flows. Since glabrous skin contains many arteriovenous anastomoses, it was important to repeat those experiments on non-glabrous regions using the same sample and experimental conditions. Mild hypothermia (mean body temperature 31.4 °C), normothermia (control: 36.0 °C) and moderate hyperthermia (38.3 °C) were induced and clamped (climate chamber and water-perfusion garment) in eight males. Within each condition, five localised thermal treatments (5, 15, 25, 33, 40 °C) were applied to the left forearm and right calf. Steady-state forearm and calf blood flows were measured (venous occlusion plethysmography) for each of the resulting 15 combinations of clamped mean body and local skin temperatures. Under the normothermic clamp, cutaneous blood flows averaged 4.2 mL 100 mL(-1) min(-1) (±0.28: forearm) and 5.4 mL 100 mL(-1) min(-1) (±0.27: calf). When mildly hypothermic, these segments were unresponsive to localised thermal stimuli, but tracked those changes when normothermic and moderately hyperthermic. For deep-body (oesophageal) temperature elevations, forearm blood flow increased by 5.1 mL 100 mL(-1) min(-1) °C(-1) (±0.9) relative to normothermia, while the calf was much less responsive: 3.3 mL 100 mL(-1) min(-1) °C(-1) (±1.5). Three-dimensional surfaces revealed a qualitative divergence in the control of calf blood flow, with vasoconstrictor tone apparently being released more gradually. These descriptions reinforce the importance of deep-tissue temperatures in controlling cutaneous perfusion, with this modulation being non-linear at the forearm and appearing linear for the calf.

  19. Rat embryonic fibroblasts improve reprogramming of human keratinocytes into induced pluripotent stem cells.

    Science.gov (United States)

    Linta, Leonhard; Stockmann, Marianne; Kleinhans, Karin N; Böckers, Anja; Storch, Alexander; Zaehres, Holm; Lin, Qiong; Barbi, Gotthold; Böckers, Tobias M; Kleger, Alexander; Liebau, Stefan

    2012-04-10

    Patient-specific human induced pluripotent stem (hiPS) cells not only provide a promising tool for cellular disease models in general, but also open up the opportunity to establish cell-type-specific systems for personalized medicine. One of the crucial prerequisites for these strategies, however, is a fast and efficient reprogramming strategy from easy accessible somatic cell populations. Keratinocytes from plucked human hair had been introduced as a superior cell source for reprogramming purposes compared with the widely used skin fibroblasts. The starting cell population is, however, limited and thereby further optimization in terms of time, efficiency, and quality is inevitable. Here we show that rat embryonic fibroblasts (REFs) should replace mouse embryonic fibroblasts as feeder cells in the reprogramming process. REFs enable a significantly more efficient reprogramming procedure as shown by colony number and total amount of SSEA4-positive cells. We successfully produced keratinocyte-derived hiPS (k-hiPS) cells from various donors. The arising k-hiPS cells display the hallmarks of pluripotency such as expression of stem cell markers and differentiation into all 3 germ layers. The increased reprogramming efficiency using REFs as a feeder layer occurred independent of the proliferation rate in the parental keratinocytes and acts, at least in part, in a non-cell autonomous way by secreting factors known to facilitate pluripotency such as Tgfb1, Inhba and Grem1. Hence, we provide an easy to use and highly efficient reprogramming system that could be very useful for a broad application to generate human iPS cells. © Mary Ann Liebert, Inc.

  20. The effect of 'allergenic' and 'nonallergenic' antibiotics on dog keratinocyte viability in vitro.

    Science.gov (United States)

    Voie, Katrine L; Lucas, Benjamin E; Schaeffer, David; Kim, Dewey; Campbell, Karen L; Lavergne, Sidonie N

    2013-10-01

    Immune-mediated adverse drug reactions (drug hypersensitivity) are relatively common in veterinary medicine, but their pathogenesis is not well understood. For an unknown reason, delayed drug hypersensitivity often targets the skin. Antibiotics, especially β-lactams and sulfonamides, are commonly associated with these adverse events. The 'danger theory' hypothesizes that 'danger' signals, such as drug-induced cell death, might be part of the pathogenesis of drug hypersensitivity reactions. The goal of this study was to determine whether antibiotics that are commonly associated with cutaneous drug hypersensitivity (allergenic) decrease canine keratinocyte viability in vitro more than antibiotics that rarely cause such reactions (nonallergenic). Immortalized canine keratinocytes (CPEK cells) were exposed to a therapeutic range of drug concentrations of four 'allergenic' antibiotics (two β-lactams, i.e. amoxicillin and cefalexin, and two sulfonamides, i.e. sulfamethoxazole and sulfadimethoxine) or two 'nonallergenic' antibiotics (enrofloxacin and amikacin) over 48 h (2, 4, 8, 24 and 48 h). The reactive nitroso metabolite of sulfamethoxazole was also tested. Cefalexin (2 mmol/L) significantly decreased cell viability after 48 h (28 ± 7%; P = 0.035). The nitroso metabolite of sulfamethoxazole (100 μmol/L) decreased cell viability after 2 h (21 ± 7%; P = 0.049), but cell numbers were increased after 8 h (22 ± 6%; P = 0.018). In addition, enrofloxacin (500 μmol/L) also significantly decreased cell viability by 37% (±6%; P = 0.0035) at 24 h and by 70% (±8%; P good predictor of the 'allergenic' potential of an antibiotic. Further work is required to investigate other drug-induced 'danger' signals in dog keratinocytes exposed to 'allergenic' antibiotics in vitro. © 2013 ESVD and ACVD.

  1. Vitamin D receptor-mediated control of Soggy, Wise, and Hairless gene expression in keratinocytes.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Estess, Rudolf C; Kaneko, Ichiro; Whitfield, G Kerr; Jurutka, Peter W; Haussler, Mark R

    2014-02-01

    The vitamin D receptor (VDR), but not its hormonal ligand, 1,25-dihydroxyvitamin D3 (1,25D), is required for the progression of the mammalian hair cycle. We studied three genes relevant to hair cycle signaling, DKKL1 (Soggy), SOSTDC1 (Wise), and HR (Hairless), to determine whether their expression is regulated by VDR and/or its 1,25D ligand. DKKL1 mRNA was repressed 49-72% by 1,25D in primary human and CCD-1106 KERTr keratinocytes; a functional vitamin D responsive element (VDRE) was identified at -9590 bp in murine Soggy. Similarly, SOSTDC1 mRNA was repressed 41-59% by 1,25D in KERTr and primary human keratinocytes; a functional VDRE was located at -6215 bp in human Wise. In contrast, HR mRNA was upregulated 1.56- to 2.77-fold by 1,25D in primary human and KERTr keratinocytes; a VDRE (TGGTGAgtgAGGACA) consisting of an imperfect direct repeat separated by three nucleotides (DR3) was identified at -7269 bp in the human Hairless gene that mediated dramatic induction, even in the absence of 1,25D ligand. In parallel, a DR4 thyroid hormone responsive element, TGGTGAggccAGGACA, was identified at +1304 bp in the human HR gene that conferred tri-iodothyronine (T3)-independent transcriptional activation. Because the thyroid hormone receptor controls HR expression in the CNS, whereas VDR functions in concert with the HR corepressor specifically in skin, a model is proposed wherein unliganded VDR upregulates the expression of HR, the gene product of which acts as a downstream comodulator to feedback-repress DKKL1 and SOSTDC1, resulting in integration of bone morphogenic protein and Wnt signaling to drive the mammalian hair cycle and/or influencing epidermal function.

  2. Effects of 12-O-tetradecanoyl-phorbol-13-acetate [corrected] and sodium lauryl sulfate on the production and expression of cytokines and proto-oncogenes in photoaged and intrinsically aged human keratinocytes.

    Science.gov (United States)

    Suh, D H; Youn, J I; Eun, H C

    2001-11-01

    Skin aging may be divided into photoaging and intrinsic aging. The purpose of this study was to investigate the effects of 12-O-tetradecanoyl-phorbol-13-acetate and sodium lauryl sulfate on the production and expression of cytokines and proto-oncogenes in photoaged and intrinsically aged skin, compared with young skin. Keratinocytes were taken from newborns, young adults in their twenties, and from the forearm and thigh of volunteers in their fifties and seventies. Interleukin-1alpha and -6, and interleukin-1 receptor antagonist, c-fos and c-myc were measured after cultured keratinocytes had been treated with 12-O-tetradecanoyl-phorbol-13-acetate and sodium lauryl sulfate. There has been no report concerning the dependence of cytokine production by sodium lauryl sulfate upon photoaging and intrinsic aging. This study also involves the first investigation of the effects of aging on c-myc expression by 12-O-tetradecanoyl-phorbol-13-acetate treatment. Cytokine production decreased markedly with age. These results suggest the progressive decline of cellular function with age. The ratio of cytokine production in the irritant-treated group compared with that in the control group showed a different pattern in photoaging and intrinsic aging. With the significant difference between photoaging and intrinsic aging, T/C ratio decreased in interleukin-1alpha and interleukin-1 receptor antagonist upon aging, whereas it increased in interleukin-6. S/C ratio was uniquely elevated on photoaged skin in the 50 y age group. It is suggested that photoaged skin shows an exaggerated reaction to surfactant. Compared with the control, c-fos expression in 12-O-tetradecanoyl-phorbol-13-acetate-treated keratinocytes decreased with age in the thigh, but increased in the photoaged skin of forearm. The increased c-fos expression in 12-O-tetradecanoyl-phorbol-13-acetate-treated keratinocytes could be relevant for the predisposition of photoaged keratinocytes to malignant transformation.

  3. Genetic reversion of inherited skin disorders

    Energy Technology Data Exchange (ETDEWEB)

    Magnaldo, Thierry; Sarasin, Alain

    2002-11-30

    Human epidermis is a squamous stratified epithelium whose integrity relies on balanced processes of cell attachment, proliferation, and differentiation. In monogenic skin dermatoses, such as mecano-bullous diseases, or DNA repair deficiencies such as the xeroderma pigmentosum (XP), alterations of skin integrity may have devastating consequences as illustrated by the extremely high epidermal cancer proneness of XP patients. The lack of efficient pharmacological treatments, the easy accessibility of skin, and the possibility of long term culture and genetic manipulations ex vivo of epidermal keratinocytes, have encouraged approaches toward gene transfer and skin therapy prospects. We review here some of the human genetic disorders that exhibit major traits in skin, as well as requirements and difficulties inherent to approaches aimed at stable phenotypic correction.

  4. The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.

    Science.gov (United States)

    Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J

    2014-04-01

    Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.

  5. The oncogenic action of ionizing radiation on rat skin

    International Nuclear Information System (INIS)

    Burns, F.J.

    1991-01-01

    Progress has occurred in several areas corresponding to the specific aims of the proposal: (1) Progression and multiple events in radiation carcinogenesis of rat skin as a function of LET; (2) cell cycle kinetics of irradiated rat epidermis as determined by double labeling and double emulsion autoradiography; (3) oncogene activation detected by in situ hybridization in radiation-induced rat skin tumors; (4) amplification of the c-myc oncogene in radiation-induced rat skin tumors as a function of LET; and (5) transformation of rat skin keratinocytes by ionizing radiation in combination with c-Ki-ras and c-myc oncogenes. 111 refs., 13 figs., 12 tabs

  6. Changes in localization of human discs large (hDlg) during keratinocyte differentiation is associated with expression of alternatively spliced hDlg variants

    International Nuclear Information System (INIS)

    Roberts, S.; Calautti, E.; Vanderweil, S.; Nguyen, H.O.; Foley, A.; Baden, H.P.; Viel, A.

    2007-01-01

    Alternative spliced variants of the human discs large (hDlg) tumour suppressor are characterized by combinations of insertions. Here, using insertions I2- and I3-specific antibodies, we show that I2 and I3 variants have distinct distributions in epidermal and cervical epithelia. In skin and cervix, I3 variants are found in the cytoplasm. Cytoplasmic localization of I3 variants decreases as cervical keratinocytes differentiate, concomitant with relocalization to the cell periphery. I2 variants are found at the cell periphery of differentiated epidermal and cervical keratinocytes. Nuclear localization of I2 variants was evident in both tissues, with concentration of nuclear I2 variants in basal and parabasal cervical keratinocytes. A prominent nuclear localization of hDlg in cells of hyperproliferative layers of psoriatic lesions, but not in mature differentiated keratinocytes, together with I2 redistribution in differentiating keratinocytes, suggests that nuclear hDlg functions may be pertinent to growth of undifferentiated cells. Supporting our findings in squamous tissues, a decrease of nuclear hDlg and an increase of membrane-bound and cytoplasmic hDlg upon calcium-induced keratinocyte differentiation were not concomitant processes. Furthermore, we confirm that the exit of I2 variants from the nucleus is linked to stimulation of epithelial differentiation. The dynamic redistribution of hDlg also correlated with a marked increase in the expression of I3 variants while the level of I2 variants showed only a moderate decrease. Because changes in the intracellular distribution of hDlg splice variants, and in their expression levels, correlate with changes in differentiation state we hypothesize that the different hDlg isoforms play distinct roles at various stages of epithelial differentiation

  7. Effect of Absolute From Hibiscus syriacus L. Flower on Wound Healing in Keratinocytes

    Science.gov (United States)

    Yoon, Seok Won; Lee, Kang Pa; Kim, Do-Yoon; Hwang, Dae Il; Won, Kyung-Jong; Lee, Dae Won; Lee, Hwan Myung

    2017-01-01

    Background: Proliferation and migration of keratinocytes are essential for the repair of cutaneous wounds. Hibiscus syriacus L. has been used in Asian medicine; however, research on keratinocytes is inadequate. Objective: To establish the dermatological properties of absolute from Hibiscus syriacus L. flower (HSF) and to provide fundamental research for alternative medicine. Materials and Methods: We identified the composition of HSF absolute using gas chromatography-mass spectrometry analysis. We also examined the effect of HSF absolute in HaCaT cells using the XTT assay, Boyden chamber assay, sprout-out growth assay, and western blotting. We conducted an in-vivo wound healing assay in rat tail-skin. Results: Ten major active compounds were identified from HSF absolute. As determined by the XTT assay, Boyden chamber assay, and sprout-out growth assay results, HSF absolute exhibited similar effects as that of epidermal growth factor on the proliferation and migration patterns of keratinocytes (HaCaT cells), which were significantly increased after HSF absolute treatment. The expression levels of the phosphorylated signaling proteins relevant to proliferation, including extracellular signal-regulated kinase 1/2 (Erk 1/2) and Akt, were also determined by western blot analysis. Conclusion: These results of our in-vitro and ex-vivo studies indicate that HSF absolute induced cell growth and migration of HaCaT cells by phosphorylating both Erk 1/2 and Akt. Moreover, we confirmed the wound-healing effect of HSF on injury of the rat tail-skin. Therefore, our results suggest that HSF absolute is promising for use in cosmetics and alternative medicine. SUMMARY Hisbiscus syriacus L. flower absolute increases HaCaT cell migration and proliferation.Hisbiscus syriacus L. flower absolute regulates phosphorylation of ERK 1/2 and Akt in HaCaT cell.Treatment with Hisbiscus syriacus L. flower induced sprout outgrowth.The wound in the tail-skin of rat was reduced by Hisbiscus syriacus

  8. Preparation and Characterization of a Novel Skin Substitute

    Directory of Open Access Journals (Sweden)

    Carlotta Castagnoli

    2010-01-01

    This study aimed at producing and evaluating a new cutaneous biosubstitute made up of alloplastic acellular glycerolized dermis (AAGD and CEA to overcome these difficulties. A procedure that maintained an intact basement membrane was developed, so as to promote adhesion and growth of CEA on AAGD. Keratinocytes were seeded onto AAGD and cultured up to 21 days. Viability tests and immunohistochemical analysis with specific markers were carried out at 7, 14, and 21 days, to evaluate keratinocyte adhesion, growth, and maturation. Our results support the hypothesis that this newly formed skin substitute could allow its permanent engraftment in clinical application.

  9. Tuberculin skin testing and treatment modulates interferon-gamma release assay results for latent tuberculosis in migrants.

    Directory of Open Access Journals (Sweden)

    Matthew K O'Shea

    Full Text Available Identifying latent tuberculosis infection (LTBI in people migrating from TB endemic regions to low incidence countries is an important control measure. However, no prospective longitudinal comparisons between diagnostic tests used in such migrant populations are available.To compare commercial interferon (IFN-gamma release assays (IGRAs and the tuberculin skin test (TST for diagnosing LTBI in a migrant population, and the influence of antecedent TST and LTBI treatment on IGRA performance.This cohort study, performed from February to September 2012, assessed longitudinal IGRA and TST responses in Nepalese military recruits recently arrived in the UK. Concomitant T-SPOT.TB, QFT-GIT and TST were performed on day 0, with IGRAs repeated 7 and 200 days later, following treatment for LTBI if necessary.166 Nepalese recruits were prospectively assessed. At entry, 21 individuals were positive by T-SPOT.TB and 8 individuals by QFT-GIT. There was substantial agreement between TST and T-SPOT.TB positives at baseline (71.4% agreement; κ = 0.62; 95% CI:0.44-0.79, but only moderate concordance between positive IGRAs (38.1% agreement; κ = 0.46; 95% CI:0.25-0.67. When reassessed 7 days following TST, numbers of IGRA-positive individuals changed from 8 to 23 for QFT-GIT (p = 0.0074 and from 21 to 23 for T-SPOT.TB (p = 0.87. This resulted in an increase in IGRA concordance to substantial (64.3% agreement; κ = 0.73; 95% CI:0.58-0.88. Thus, in total on day 0 and day 7 after testing, 29 out of 166 participants (17.5% provided a positive IGRA and of these 13 were TST negative. Two hundred days after the study commenced and three months after treatment for LTBI was completed by those who were given chemoprophylaxis, 23 and 21 participants were positive by T-SPOT.TB or QFT-GIT respectively. When individual responses were examined longitudinally within this population 35% of the day 7 QFT-GIT-positive, and 19% T-SPOT.TB-positive individuals, were

  10. Cyr61/CCN1 induces CCL20 production by keratinocyte via activating p38 and JNK/AP-1 pathway in psoriasis.

    Science.gov (United States)

    Li, Huidan; Li, Haichuan; Huo, Rongfen; Wu, Pinru; Shen, Zhengyu; Xu, Hui; Shen, Baihua; Li, Ningli

    2017-10-01

    Psoriasis is a common chronic skin disease characterized by epidermal hyperplasia and inflammation. Cysteine-rich angiogenic inducer 61 (Cyr61/CCN1) has recently been implicated in psoriasis pathogenesis by promoting keratinocyte activation. However, the mechanisms by which CCN1 enhances cutaneous inflammation are not fully understood. In this study, we investigated the role of CCN1 on the expression of CCL20 in human keratinocyte. By double-label immunofluorescence staining, we first identified that the expression of CCN1 colocalized well with CCL20 production in the epidermis of psoriasis skin lesion. Furthermore, in vivo, blocking or knockdown CCN1 expression ameliorated skin inflammation and reduced the expression of CCL20 in both imiquimod and IL-23-induced psoriasis-like mouse models, which indicated that CCN1 might be involved in the regulation of CCL20 production in psoriasis. Next, in vitro, we stimulated primary normal human epidermal keratinocyte (NHEK) with exogenous protein CCN1 and found that CCN1 directly upregulated CCL20 production independent of TNF-α, IL-22 and IL-17 pathway. Lastly, the signaling pathway study showed that CCN1 enhanced the binding of AP-1 to the CCL20 promoter via crosstalk with p38 and JNK. Our study demonstrates that CCN1 stimulates CCL20 production in vitro and in vivo, and thus supports the notion that overexpressed CCN1 in hyperproliferating keratinocyte is functionally involved in the recruitment of inflammatory cells to skin lesions affected by psoriasis. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  11. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    Science.gov (United States)

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2016-01-01

    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  12. Analyses of the Secondary Particle Radiation and the DNA Damage it Causes to Human Keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lebel E. A.; Tafrov S.; Rusek, A.; Sivertz, M. B.; Yip, K.; Thompson, K. H.

    2011-11-01

    High-energy protons, and high mass and energy ions, along with the secondary particles they produce, are the main contributors to the radiation hazard during space explorations. Skin, particularly the epidermis, consisting mainly of keratinocytes with potential for proliferation and malignant transformation, absorbs the majority of the radiation dose. Therefore, we used normal human keratinocytes to investigate and quantify the DNA damage caused by secondary radiation. Its manifestation depends on the presence of retinol in the serum-free media, and is regulated by phosphatidylinositol 3-kinases. We simulated the generation of secondary radiation after the impact of protons and iron ions on an aluminum shield. We also measured the intensity and the type of the resulting secondary particles at two sample locations; our findings agreed well with our predictions. We showed that secondary particles inflict DNA damage to different extents, depending on the type of primary radiation. Low-energy protons produce fewer secondary particles and cause less DNA damage than do high-energy protons. However, both generate fewer secondary particles and inflict less DNA damage than do high mass and energy ions. The majority of cells repaired the initial damage, as denoted by the presence of 53BPI foci, within the first 24 hours after exposure, but some cells maintained the 53BP1 foci longer.

  13. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  14. Influence of acidic pH on keratinocyte function and re-epithelialisation of human in vitro wounds.

    Science.gov (United States)

    Lönnqvist, Susanna; Emanuelsson, Peter; Kratz, Gunnar

    2015-01-01

    Chronic wounds are one of the greatest challenges for the healthcare system. Today, a plethora of dressings are used in the treatment of these wounds, each with specific influence on the wound environment. Due to differences in the permeability of the dressings the use will result in differences in the pH balance in the wound bed. However, little is known about how changes in the pH in the wound environment affect the different phases of the healing process. The aim of the present study was to investigate the effects of acidic pH on the regeneration phase by studying keratinocyte function in vitro and re-epithelialisation in an in vitro model of human skin. In vitro assays showed reduced viability and migration rates in human keratinocytes when pH was lowered. Real time PCR revealed differential expression of genes related to wound healing and environmental impairment. Tissue culture showed no re-epithelialisation of wounds subjected to pH 5.0 and moderate re-epithelialisation at pH 6.0, compared to controls at pH 7.4. The results indicate that lowering pH down to pH 5.0 in wounds is counterproductive in aspect of keratinocyte function which is crucial for successful wound healing.

  15. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Platelet-released growth factors (PRGF and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF® contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3 is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR. In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds.

  16. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Science.gov (United States)

    Lammel, Justus; Tohidnezhad, Mersedeh; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Cremer, Jochen; Jahr, Holger; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF®)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR). In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds. PMID:28811680

  17. 3-Amino-1,2,4-triazole Limits the Oxidative Damage in UVA-Irradiated Dysplastic Keratinocytes

    Directory of Open Access Journals (Sweden)

    Marina Tamara Nechifor

    2017-01-01

    Full Text Available Reactive oxygen species (ROS generated by UVA irradiation affect the keratinocyte cell membrane, DNA, and proteins and may cause serious injury to the skin. Treating human dysplastic keratinocytes (DOK with 3-amino-1,2,4-triazole (AMT, a common catalase inhibitor, induced a compensatory mechanism for the hydrogen peroxide detoxification, which included a rise in glutathione peroxidase and glutathione reductase activities. Here, we examined a possible role of AMT in protecting a human DOK cell line against UVA-induced damage. In DOK cells exposed to UVA irradiation, we observed a substantial decrease in antioxidant enzymatic activities, such as catalase, glutathione peroxidase, glutathione reductase, and glutathione-S-transferase and an increase in lipid peroxidation and protein oxidation levels. Treating DOK cells with AMT prior to UVA exposure enhanced the activities of glutathione peroxidase, glutathione reductase, and glutathione-S-transferase, relative to nontreated cells. The enhanced antioxidant activities were correlated with decreased protein oxidation levels. Based on these results, we suggest that AMT may protect dysplastic keratinocytes against the harmful effects of UVA radiation.

  18. Comparative transcriptomic profiling of hydrogen peroxide signaling networks in zebrafish and human keratinocytes: Implications toward conservation, migration and wound healing.

    Science.gov (United States)

    Lisse, Thomas S; King, Benjamin L; Rieger, Sandra

    2016-02-05

    Skin wounds need to be repaired rapidly after injury to restore proper skin barrier function. Hydrogen peroxide (H2O2) is a conserved signaling factor that has been shown to promote a variety of skin wound repair processes, including immune cell migration, angiogenesis and sensory axon repair. Despite growing research on H2O2 functions in wound repair, the downstream signaling pathways activated by this reactive oxygen species in the context of injury remain largely unknown. The goal of this study was to provide a comprehensive analysis of gene expression changes in the epidermis upon exposure to H2O2 concentrations known to promote wound repair. Comparative transcriptome analysis using RNA-seq data from larval zebrafish and previously reported microarray data from a human epidermal keratinocyte line shows that H2O2 activates conserved cell migration, adhesion, cytoprotective and anti-apoptotic programs in both zebrafish and human keratinocytes. Further assessment of expression characteristics and signaling pathways revealed the activation of three major H2O2-dependent pathways, EGF, FOXO1, and IKKα. This study expands on our current understanding of the clinical potential of low-level H2O2 for the promotion of epidermal wound repair and provides potential candidates in the treatment of wound healing deficits.

  19. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  20. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  1. Cultivation and grafting of human keratinocytes on a poly(hydroxyethyl methacrylate) support to the wound bed: a clinical study.

    Science.gov (United States)

    Dvoránková, B; Smetana, K; Königová, R; Singerová, H; Vacík, J; Jelínková, M; Kapounková, Z; Zahradník, M

    1998-01-01

    Cultured epithelial sheets on a textile support are used for the treatment of seriously burned patients. In this study we demonstrate a new procedure for the grafting of keratinocytes directly on a polymer cultivation support. This procedure is much easier in comparison with classical techniques, and encouraging results of clinical trials demonstrate the improved healing of the wound bed after the use of this procedure. There is no difference in the cytokeratine pattern (LP-34, cytokeratin-10) of the reconstructed epidermis and normal human skin.

  2. AP-2α Inhibits c-MYC Induced Oxidative Stress and Apoptosis in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Lei Yu

    2009-01-01

    AP-2 may have a direct effect on the c-myc gene. Chromatin immunoprecipitation assays demonstrated that AP-2 proteins bound to a cluster of AP-2 binding sites located within a 2 kb upstream regulatory region of c-myc These results suggest that the negative regulation of AP-2 on c-MYC activity was achieved through binding of AP-2 protein to the c-myc gene. The effects of AP-2 on c-MYC induced ROS accumulation and apoptosis in epidermal keratinocytes are likely to play an important role in cell growth, differentiation and carcinogenesis of the skin.

  3. AMPK regulation of the growth of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Saha, Asish K.; Persons, Kelly; Safer, Joshua D.; Luo Zhijun; Holick, Michael F.; Ruderman, Neil B.

    2006-01-01

    AMP kinase (AMPK) is a fuel sensing enzyme that responds to cellular energy depletion by increasing processes that generate ATP and inhibiting others that require ATP but are not acutely necessary for survival. In the present study, we examined the relationship between AMPK activation and the growth (proliferation) of cultured human keratinocytes and assessed whether the inhibition of keratinocyte growth by vitamin D involves AMPK activation. In addition, we explored whether the inhibition of keratinocyte proliferation as they approach confluence could be AMPK-related. Keratinocytes were incubated for 12 h with the AMPK activator, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR). At concentrations of 10 -4 and 10 -3 M, AICAR inhibited keratinocyte growth by 50% and 95%, respectively, based on measurements of thymidine incorporation into DNA. It also increased AMPK and acetyl CoA carboxylase phosphorylation (P-AMPK and P-ACC) and decreased the concentration of malonyl CoA confirming that AMPK activation had occurred. Incubation with the thiazolidinedione, troglitazone (10 -6 M) caused similar alterations in P-AMPK, P-ACC, and cell growth. In contrast, the well known inhibition of keratinocyte growth by 1,25-dihydroxyvitamin D 3 (10 -7 and 10 -6 M) was not associated with changes in P-AMPK or P-ACC. Like most cells, the growth of keratinocytes diminished as they approached confluence. Thus, it was of note that we found a progressive increase in P-AMPK (1.5- to 2-fold, p 3 is AMPK-independent

  4. Tissue engineered skin substitutes created by laser-assisted bioprinting form skin-like structures in the dorsal skin fold chamber in mice.

    Directory of Open Access Journals (Sweden)

    Stefanie Michael

    Full Text Available Tissue engineering plays an important role in the production of skin equivalents for the therapy of chronic and especially burn wounds. Actually, there exists no (cellularized skin equivalent which might be able to satisfactorily mimic native skin. Here, we utilized a laser-assisted bioprinting (LaBP technique to create a fully cellularized skin substitute. The unique feature of LaBP is the possibility to position different cell types in an exact three-dimensional (3D spatial pattern. For the creation of the skin substitutes, we positioned fibroblasts and keratinocytes on top of a stabilizing matrix (Matriderm®. These skin constructs were subsequently tested in vivo, employing the dorsal skin fold chamber in nude mice. The transplants were placed into full-thickness skin wounds and were fully connected to the surrounding tissue when explanted after 11 days. The printed keratinocytes formed a multi-layered epidermis with beginning differentiation and stratum corneum. Proliferation of the keratinocytes was mainly detected in the suprabasal layers. In vitro controls, which were cultivated at the air-liquid-interface, also exhibited proliferative cells, but they were rather located in the whole epidermis. E-cadherin as a hint for adherens junctions and therefore tissue formation could be found in the epidermis in vivo as well as in vitro. In both conditions, the printed fibroblasts partly stayed on top of the underlying Matriderm® where they produced collagen, while part of them migrated into the Matriderm®. In the mice, some blood vessels could be found to grow from the wound bed and the wound edges in direction of the printed cells. In conclusion, we could show the successful 3D printing of a cell construct via LaBP and the subsequent tissue formation in vivo. These findings represent the prerequisite for the creation of a complex tissue like skin, consisting of different cell types in an intricate 3D pattern.

  5. Skin manifestations of growth hormone-induced diseases.

    Science.gov (United States)

    Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P

    2016-09-01

    The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.

  6. Deletion of the N-terminus of IKKγ induces apoptosis in keratinocytes and impairs the AKT/PTEN signaling pathway

    International Nuclear Information System (INIS)

    Leis, Hugo; Sanchis, Ana; Perez, Paloma

    2007-01-01

    The regulatory subunit IKKγ/NEMO is crucial for skin development and function and although devoid of kinase activity, loss of IKKγ function completely abolishes the activation of NF-κB by all pro-inflammatory cytokines. To inhibit the IκB kinase (IKK) complex in keratinocytes, we have used a dominant negative approach by generating stable transfectants of an N-terminal deletion of IKKγ (IKKγ-DN97) that uncouples formation of the IKK complex. Expression of this mutant in PB keratinocytes (PB-IKKγ-DN97) delayed growth kinetics, caused morphological changes and dramatically augmented apoptosis even in the absence of pro-apoptotic stimuli, as determined by cell morphology, TUNEL and caspase-3 cleavage. Moreover, in PB-IKKγ-DN97 cells, TNF-α and IL-1 treatment failed to induce degradation of IκBα, phosphorylation of p65 on Ser 536 and nuclear translocation which, consequently, reduced κB-binding activity. In PB-IKKγ-DN97 cells, accumulation of IκBα correlated with a downregulation of AKT activity and an increase of PTEN protein levels whereas pro-apoptotic p53 target genes Bax and Puma were upregulated. These effects were most likely mediated through IKK since coexpression of the wild-type form of IKKγ in keratinocytes partially reversed apoptosis and reduced PTEN expression. Thus, our data suggest a negative cross-talk mechanism involving PTEN and NF-κB, critical for the anti-apoptotic role of NF-κB in keratinocytes

  7. Keratinocyte secretion of cyclophilin B via the constitutive pathway is regulated through its cyclosporin-binding site.

    Science.gov (United States)

    Fearon, Paula; Lonsdale-Eccles, Ann A; Ross, O Kehinde; Todd, Carole; Sinha, Aparna; Allain, Fabrice; Reynolds, Nick J

    2011-05-01

    Cyclophilin B (CypB) is an endoplasmic reticulum (ER)-resident member of the cyclophilin family of proteins that bind cyclosporin A (CsA). We report that as in other cell types, CypB trafficked from the ER and was secreted by keratinocytes into the media in response to CsA. Concentrations as low as 1 pM of CsA induced secretion of CypB. Using brefeldin A, we showed that CypB is secreted from keratinocytes via the constitutive secretory pathway. We defined that substitution of tryptophan residue 128 in the CsA-binding site of CypB with alanine resulted in dissociation of CypB(W128A)-green fluorescent protein (GFP) from the ER. Photobleaching studies revealed a significant reduction in the diffusible mobility of CypB(W128A)-GFP compared with CypB(WT)-GFP, consistent with redistribution of CypB(W128A)-GFP into secretory vesicles disconnected from the ER/Golgi network. Furthermore, CsA significantly decreased the mobility of CypB(WT)-GFP but not CypB(W128A)-GFP. These studies demonstrate that therapeutically relevant concentrations of CsA regulate secretion of CypB by keratinocytes, and that a key residue within the CsA-binding site of CypB controls retention of CypB within the ER and regulates entry into the secretory pathway. As keratinocytes express CypB receptors (CD147) and CypB exhibits chemotactic properties, these data have implications for the therapeutic effects of CsA in inflammatory skin disease.

  8. Effect of gamma-hydroxybutyrate on keratinocytes proliferation: A preliminary prospective controlled study in severe burn patients

    Science.gov (United States)

    Rousseau, Anne-Françoise; Bargues, Laurent; Bever, Hervé Le; Vest, Philippe; Cavalier, Etienne; Ledoux, Didier; Piérard, Gérald E.; Damas, Pierre

    2014-01-01

    Background: Hypermetabolism and hyposomatotropism related to severe burns lead to impaired wound healing. Growth hormone (GH) boosts wound healing notably following stimulation of the production of insulin-like growth factor-1 (IGF1), a mitogen factor for keratinocytes. Gamma-hydroxybutyrate (GHB) stimulates endogenous GH secretion. Aim: To assess effects of GHB sedation on keratinocytes proliferation (based on immunohistochemical techniques). Design: Monocentric, prospective, controlled trial. Materials and Methods: Patients (aging 18-65 years, burn surface area >30%, expected to be sedated for at least one month) were alternately allocated, at the 5th day following injury, in three groups according to the intravenous GHB dose administered for 21 days: Evening bolus of 50 mg/kg (Group B), continuous infusion at the rate of 10 mg/kg/h (Group C), or absence of GHB (Group P). They all received local standard cares. Immunohistochemistry (Ki67/MIB-1, Ulex europaeus agglutinin-1 and Mac 387 antibodies) was performed at D21 on adjacent unburned skin sample for assessing any keratinocyte activation. Serum IGF1 levels were measured at initiation and completion of the protocol. Statistical Analysis: Categorical variables were compared with Chi-square test. Comparisons of medians were made using Kruskal-Wallis test. Post hoc analyses were performed using Mann-Whitney test with Bonferroni correction for multiple comparisons. A P study (Group B: n = 5, Group C: n = 5, Group P: n = 4). Continuous administration of GHB was associated with a significant higher Ki67 immunolabeling at D21 (P = 0.049) and with a significant higher increase in the IGF1 concentrations at D21 (P = 0.024). No adverse effects were disclosed. Conclusions: Our preliminary data support a positive effect of GHB on keratinocyte proliferation and are encouraging enough to warrant large prospective studies. PMID:25024938

  9. UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

    International Nuclear Information System (INIS)

    Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

    1996-01-01

    Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

  10. The skin microbiome: impact of modern environments on skin ecology, barrier integrity, and systemic immune programming.

    Science.gov (United States)

    Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E

    2017-01-01

    Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.

  11. Evaluation of Permacol as a cultured skin equivalent.

    Science.gov (United States)

    MacLeod, T M; Cambrey, A; Williams, G; Sanders, R; Green, C J

    2008-12-01

    Skin loss following severe burn requires prompt wound closure to avoid such complications as fluid and electrolyte imbalance, infection, immune suppression, and pain. In clinical situations in which insufficient donor skin is available, the development of cultured skin equivalents (dermal matrices seeded with keratinocytes and fibroblasts) may provide a useful alternative. The aim of this study was to assess the suitability of a porcine-derived dermal collagen matrix (Permacol) to function as a cultured skin equivalent in supporting the growth of keratinocytes in vitro and providing cover to full thickness wounds in the BALB C/nude mouse model. A histological comparison was against Glycerol treated-Ethylene Oxide Sterilised Porcine Dermis (Gly-EO Dermis) which has successfully been used as a cultured skin equivalent in previous studies. Both Gly-EO Dermis and to a lesser extent Permacol were able to support the growth of cultured keratinocytes following a 16-day period of cell culture, however, this study was only able to demonstrate the presence of an epidermal layer on Gly-EO dermis 2 weeks after grafting onto full-thickness wounds in the BALB C/nude mouse model.

  12. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  13. Effects of bee venom against Propionibacterium acnes-induced inflammation in human keratinocytes and monocytes.

    Science.gov (United States)

    Kim, Jung-Yeon; Lee, Woo-Ram; Kim, Kyung-Hyun; An, Hyun-Jin; Chang, Young-Chae; Han, Sang-Mi; Park, Yoon-Yub; Pak, Sok Cheon; Park, Kwan-Kyu

    2015-06-01

    Propionibacterium acnes (P. acnes) cause inflammatory acne and play an important role in the pathogenesis of acne by inducing inflammatory mediators. P. acnes contributes to the inflammatory responses of acne by activating inflammatory cells, keratinocytes and sebocytes to secrete pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-8. Bee venom has traditionally been used in the treatment of certain immune-related diseases. However, there has not yet been a robust trial to prove the therapeutic effect of bee venom in skin inflammation. The aim of the present study was to investigate anti-inflammatory properties of bee venom in skin inflammation induced by P. acnes using keratinocytes (HaCaT) and monocytes (THP-1). P. acnes is known to stimulate the production of pro-inflammatory cytokines such as IL-1, IL-8, IL-12 and TNF-α. In the present study, the production of interferon-γ (IFN-γ), IL-1β, IL-8 and TNF-α was increased by P. acnes treatment in HaCaT and THP-1 cells. By contrast, bee venom effectively inhibited the secretion of IFN-γ, IL-1β, IL-8 and TNF-α. Furthermore, P. acnes treatment activated the expression of IL-8 and toll-like receptor 2 (TLR2) in HaCaT cells. However, bee venom inhibited the expression of IL-8 and TLR2 in heat-killed P. acnes. Based on these results, it is concluded that bee venom has an effective anti-inflammatory activity against P. acnes in HaCaT and THP-1 cells. Therefore, we suggest that bee venom is an alternative treatment to antibiotic therapy of acne.

  14. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  15. The caspase-1 inhibitor CARD18 is specifically expressed during late differentiation of keratinocytes and its expression is lost in lichen planus.

    Science.gov (United States)

    Qin, Haihong; Jin, Jiang; Fischer, Heinz; Mildner, Michael; Gschwandtner, Maria; Mlitz, Veronika; Eckhart, Leopold; Tschachler, Erwin

    2017-08-01

    CARD18 contains a caspase recruitment domain (CARD) via which it binds to caspase-1 and thereby inhibits caspase-1-mediated activation of the pro-inflammatory cytokine interleukin (IL)-1β. To determine the expression profile and the role of CARD18 during differentiation of keratinocytes and to compare the expression of CARD18 in normal skin and in inflammatory skin diseases. Human keratinocytes were induced to differentiate in monolayer and in 3D skin equivalent cultures. In some experiments, CARD18-specific siRNAs were used to knock down expression of CARD18. CARD18 mRNA levels were determined by quantitative real-time PCR, and CARD18 protein was detected by Western blot and immunofluorescence analyses. In situ expression was analyzed in skin biopsies obtained from healthy donors and patients with psoriasis and lichen planus. CARD18 mRNA was expressed in the epidermis at more than 100-fold higher levels than in any other human tissue. Within the epidermis, CARD18 was specifically expressed in the granular layer. In vitro CARD18 was strongly upregulated at both mRNA and protein levels in keratinocytes undergoing terminal differentiation. In skin equivalent cultures the expression of CARD18 was efficiently suppressed by siRNAs without impairing stratum corneum formation. Epidermal expression of CARD18 was increased after ultraviolet (UV)B irradiation of skin explants. In skin biopsies of patients with psoriasis no consistent regulation of CARD18 expression was observed, however, in lesional epidermis of patients with lichen planus, CARD18 expression was either greatly diminished or entirely absent whereas in non-lesional areas expression was comparable to normal skin. Our results identify CARD18 as a differentiation-associated keratinocyte protein that is altered in abundance by UV stress. Its downregulation in lichen planus indicates a potential role in inflammatory reactions of the epidermis in this disease. Copyright © 2017 Japanese Society for Investigative

  16. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  17. Antibody-dependent cellular cytotoxicity and skin disease

    International Nuclear Information System (INIS)

    Norris, D.A.; Lee, L.A.

    1985-01-01

    Antibody dependent cellular cytotoxicity (ADCC) is a recently described mechanism of immunologic lysis in which cellular targets sensitized by specific antibodies are efficiently and selectively lysed by Fc receptor (FcR) bearing nonspecific effectors. Immunoglobulins of various classes (IgG, IgM, IgA, IgE) and various cellular effectors (large granular lymphocytes, monocyte/macrophages, T lymphocytes, neutrophils, and eosinophils) can induce ADCC in vitro, and the importance of ADCC in vivo is being tested experimentally in resistance to viral, bacterial, and parasitic infection, in tumor surveillance, in allograft rejection, and in inflammatory diseases. There is much indirect evidence that ADCC may be the mechanism of damage of different cellular targets in skin diseases, but the best direct evidence concerns immunologic keratinocyte damage, especially in cutaneous lupus erythematosus (LE). The authors have shown that keratinocytes of several species are highly susceptible to lymphocyte and monocyte-mediated ADCC, but not to neutrophil or eosinophil ADCC in vitro using two different cytotoxicity assays. In contrast, complement was a relatively ineffective mediator of lysis of metabolically intact keratinocyte targets. Patients with certain cutaneous lupus syndromes have serum antibodies capable of inducing monocyte and lymphocyte ADCC of targets coated with extractable nuclear antigens. The authors have shown that these antigens apparently move to the cell membrane of keratinocytes in vitro following ultraviolet irradiation. In an animal model, they have shown that antibodies to SSA/Ro bind to human keratinocytes in vivo, especially after ultraviolet irradiation

  18. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  19. Development of a keratinocyte-based screening model for antipsoriatic drugs using green fluorescent protein under the control of an endogenous promoter.

    Science.gov (United States)

    Pol, Arno; van Ruissen, Fred; Schalkwijk, Joost

    2002-08-01

    Inflamed epidermis (psoriasis, wound healing, ultraviolet-irradiated skin) harbors keratinocytes that are hyperproliferative and display an abnormal differentiation program. A distinct feature of this so-called regenerative maturation pathway is the expression of proteins such as the cytokeratins CK6, CK16, and CK17 and the antiinflammatory protein SKALP/elafin. These proteins are absent in normal skin but highly induced in lesional psoriatic skin. Expression of these genes can be used as a surrogate marker for psoriasis in drug-screening procedures of large compound libraries. The aim of this study was to develop a keratinocyte cell line that contained a reporter gene under the control of a psoriasis-associated endogenous promoter and demonstrate its use in an assay suitable for screening. We generated a stably transfected keratinocyte cell line that expresses enhanced green fluorescent protein (EGFP), under the control of a 0.8-kb fragment derived from the promoter of the SKALP/elafin gene, which confers high levels of tissue-specific expression at the mRNA level. Induction of the SKALP promoter by tumor necrosis factor-alpha resulted in increased expression levels of the secreted SKALP-EGFP fusion protein as assessed by direct readout of fluorescence and fluorescence polarization in 96-well cell culture plates. The fold stimulation of the reporter gene was comparable to that of the endogenous SKALP gene as assessed by enzyme-linked immunosorbent assay. Although the dynamic range of the screening system is limited, the small standard deviation yields a Z factor of 0.49. This indicates that the assay is suitable as a high-throughput screen, and provides proof of the concept that a secreted EGFP fusion protein under the control of a physiologically relevant endogenous promoter can be used as a fluorescence-based high-throughput screen for differentiation-modifying or antiinflammatory compounds that act via the keratinocyte.

  20. In vitro psoriasis models with focus on reconstructed skin models as promising tools in psoriasis research.

    Science.gov (United States)

    Desmet, Eline; Ramadhas, Anesh; Lambert, Jo; Van Gele, Mireille

    2017-06-01

    Psoriasis is a complex chronic immune-mediated inflammatory cutaneous disease associated with the development of inflammatory plaques on the skin. Studies proved that the disease results from a deregulated interplay between skin keratinocytes, immune cells and the environment leading to a persisting inflammatory process modulated by pro-inflammatory cytokines and activation of T cells. However, a major hindrance to study the pathogenesis of psoriasis more in depth and subsequent development of novel therapies is the lack of suitable pre-clinical models mimicking the complex phenotype of this skin disorder. Recent advances in and optimization of three-dimensional skin equivalent models have made them attractive and promising alternatives to the simplistic monolayer cultures, immunological different in vivo models and scarce ex vivo skin explants. Moreover, human skin equivalents are increasing in complexity level to match human biology as closely as possible. Here, we critically review the different types of three-dimensional skin models of psoriasis with relevance to their application potential and advantages over other models. This will guide researchers in choosing the most suitable psoriasis skin model for therapeutic drug testing (including gene therapy via siRNA molecules), or to examine biological features contributing to the pathology of psoriasis. However, the addition of T cells (as recently applied to a de-epidermized dermis-based psoriatic skin model) or other immune cells would make them even more attractive models and broaden their application potential. Eventually, the ultimate goal would be to substitute animal models by three-dimensional psoriatic skin models in the pre-clinical phases of anti-psoriasis candidate drugs. Impact statement The continuous development of novel in vitro models mimicking the psoriasis phenotype is important in the field of psoriasis research, as currently no model exists that completely matches the in vivo psoriasis

  1. Micronucleus formation in cultured human keratinocytes: Involvement of intercellular bioactivation.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Weterings, P J

    1991-01-01

    Micronucleus formation in cultured human keratinocytes was studied after exposure to benzo[a]pyrene, cyclophosphamide and 12-O-tetradecanoylphorbol-13-acetate without the addition of an exogenous metabolizing system. The first two agents need bioactivation by specific isoenzymes of cytochrome P-450 to form genotoxic intermediates. Benzo[a]pyrene induced the micronucleus formation in both uninduced and Aroclor 1254-pretreated cultures. Clastogenic effects of cyclophosphamide were observed only in Aroclor 1254-pretreated cells. The tumour promotor 12-O-tetradecanoylphorbol-13-acetate did not affect the frequency of micronuclei in human keratinocytes. The data indicate that cultured human keratinocytes can be used to study the tissue-specific response to genotoxic agents as well as interindividual variation in biotransformation capacity.

  2. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  3. Atypical Diabetic Foot Ulcer Keratinocyte Protein Signaling Correlates with Impaired Wound Healing

    Science.gov (United States)

    Hoke, Glenn D.; Ramos, Corrine; Hoke, Nicholas N.; Crossland, Mary C.; Shawler, Lisa G.

    2016-01-01

    Diabetes mellitus is associated with chronic diabetic foot ulcers (DFUs) and wound infections often resulting in lower extremity amputations. The protein signaling architecture of the mechanisms responsible for impaired DFU healing has not been characterized. In this preliminary clinical study, the intracellular levels of proteins involved in signal transduction networks relevant to wound healing were non-biasedly measured using reverse-phase protein arrays (RPPA) in keratinocytes isolated from DFU wound biopsies. RPPA allows for the simultaneous documentation and assessment of the signaling pathways active in each DFU. Thus, RPPA provides for the accurate mapping of wound healing pathways associated with apoptosis, proliferation, senescence, survival, and angiogenesis. From the study data, we have identified potential diagnostic, or predictive, biomarkers for DFU wound healing derived from the ratios of quantified signaling protein expressions within interconnected pathways. These biomarkers may allow physicians to personalize therapeutic strategies for DFU management on an individual basis based upon the signaling architecture present in each wound. Additionally, we have identified altered, interconnected signaling pathways within DFU keratinocytes that may help guide the development of therapeutics to modulate these dysregulated pathways, many of which parallel the therapeutic targets which are the hallmarks of molecular therapies for treating cancer. PMID:27840833

  4. Atypical Diabetic Foot Ulcer Keratinocyte Protein Signaling Correlates with Impaired Wound Healing.

    Science.gov (United States)

    Hoke, Glenn D; Ramos, Corrine; Hoke, Nicholas N; Crossland, Mary C; Shawler, Lisa G; Boykin, Joseph V

    2016-01-01

    Diabetes mellitus is associated with chronic diabetic foot ulcers (DFUs) and wound infections often resulting in lower extremity amputations. The protein signaling architecture of the mechanisms responsible for impaired DFU healing has not been characterized. In this preliminary clinical study, the intracellular levels of proteins involved in signal transduction networks relevant to wound healing were non-biasedly measured using reverse-phase protein arrays (RPPA) in keratinocytes isolated from DFU wound biopsies. RPPA allows for the simultaneous documentation and assessment of the signaling pathways active in each DFU. Thus, RPPA provides for the accurate mapping of wound healing pathways associated with apoptosis, proliferation, senescence, survival, and angiogenesis. From the study data, we have identified potential diagnostic, or predictive, biomarkers for DFU wound healing derived from the ratios of quantified signaling protein expressions within interconnected pathways. These biomarkers may allow physicians to personalize therapeutic strategies for DFU management on an individual basis based upon the signaling architecture present in each wound. Additionally, we have identified altered, interconnected signaling pathways within DFU keratinocytes that may help guide the development of therapeutics to modulate these dysregulated pathways, many of which parallel the therapeutic targets which are the hallmarks of molecular therapies for treating cancer.

  5. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    International Nuclear Information System (INIS)

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  6. Intermittent pressure decreases human keratinocyte proliferation in vitro.

    Science.gov (United States)

    Nasca, Maria R; Shih, Alan T; West, Dennis P; Martinez, Wanda M; Micali, Giuseppe; Landsman, Adam S

    2007-01-01

    The aim of this study was to investigate the correlation between pressure changes and keratinocyte proliferation by determining whether keratinocytes exposed to altered mechanical pressures would proliferate at different rates compared to control cells not subjected to pressure changes. Tissue culture flasks of human keratinocytes plated at an approximate density of 15,000 cells/cm(2) undergoing an intermittent cyclic pressure of 362 mm Hg at a frequency of 2.28 or 5.16 cycles/min (0.038 or 0.086 Hz) for 8 h were compared to control flasks grown at ambient room pressure. An in-line pressure transducer was used to monitor and adjust pressure within the cell chambers, using a solenoid valve. A thymidine incorporation assay assessed the amount of cell proliferation in each set of experiments. Differences in proliferation between keratinocytes subjected to cyclic pressure changes and control cells were found to be statistically significant (p < 0.05) in 4 out of 5 proliferation assays. Also, a higher frequency of pressure changes consistently generated a reduced proliferation rate compared to that seen in cells exposed to a lower frequency of pressure changes. These data indicate that keratinocytes undergoing intermittent pressure changes exhibit decreased proliferation rates compared to controls. Furthermore, an increased frequency rate seems to have a greater effect on proliferation than low-frequency rate pressure changes, suggesting that the stress caused by frequently changed pressure may play a greater role in reducing keratinocyte proliferation than the actual magnitude of load applied to the cells. Our results support the current treatment protocol of reducing speed and duration of walking on the site of the wound to promote healing of foot ulcers. (c) 2007 S. Karger AG, Basel.

  7. Ultra-violet B (UVB)-induced skin cell death occurs through a cyclophilin D intrinsic signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Chao [Department of Dermatology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210024, Jiangsu (China); Yang, Bo [Department of Dermatology, Huashan Hospital, Fudan University, Shanghai 200040 (China); Yang, Zhi; Tu, Ying [Department of Dermatology, The First Affiliated Hospital of Kunming Medical University, Yunnan Provincial Institute of Dermatology, Kunming 650032, Yunnan (China); Yang, Yan-li [Department of Otorhinolaryngology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210024, Jiangsu (China); He, Li, E-mail: heli2662@yahoo.com.cn [Department of Otorhinolaryngology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210024, Jiangsu (China); Bi, Zhi-Gang, E-mail: eltonbibenqhospital@yahoo.com.cn [Department of Dermatology, BenQ Medical Center, Nanjing Medical University, Nanjing 210019, Jiangsu (China)

    2012-09-07

    Highlights: Black-Right-Pointing-Pointer UVB radiated skin keratinocytes show cyclophilin D (Cyp-D) upregulation. Black-Right-Pointing-Pointer NAC inhibits UVB induced Cyp-D expression, while H{sub 2}O{sub 2} facilitates it. Black-Right-Pointing-Pointer Cyp-D-deficient cells are significantly less susceptible to UVB induced cell death. Black-Right-Pointing-Pointer Over-expression of Cyp-D causes spontaneous keratinocytes cell death. -- Abstract: UVB-induced skin cell damage involves the opening of mitochondrial permeability transition pore (mPTP), which leads to both apoptotic and necrotic cell death. Cyclophilin D (Cyp-D) translocation to the inner membrane of mitochondrion acts as a key component to open the mPTP. Our Western-Blot results in primary cultured human skin keratinocytes and in HaCaT cell line demonstrated that UVB radiation and hydrogen peroxide (H{sub 2}O{sub 2}) induced Cyp-D expression, which was inhibited by anti-oxidant N-acetyl cysteine (NAC). We created a stable Cyp-D deficiency skin keratinocytes by expressing Cyp-D-shRNA through lentiviral infection. Cyp-D-deficient cells were significantly less susceptible than their counterparts to UVB- or H{sub 2}O{sub 2}-induced cell death. Further, cyclosporine A (Cs-A), a Cyp-D inhibitor, inhibited UVB- or H{sub 2}O{sub 2}-induced keratinocytes cell death. Reversely, over-expression of Cyp-D in primary keratinocytes caused spontaneous keratinocytes cell death. These results suggest Cyp-D's critical role in UVB/oxidative stress-induced skin cell death.

  8. Ultra-violet B (UVB)-induced skin cell death occurs through a cyclophilin D intrinsic signaling pathway

    International Nuclear Information System (INIS)

    Ji, Chao; Yang, Bo; Yang, Zhi; Tu, Ying; Yang, Yan-li; He, Li; Bi, Zhi-Gang

    2012-01-01

    Highlights: ► UVB radiated skin keratinocytes show cyclophilin D (Cyp-D) upregulation. ► NAC inhibits UVB induced Cyp-D expression, while H 2 O 2 facilitates it. ► Cyp-D-deficient cells are significantly less susceptible to UVB induced cell death. ► Over-expression of Cyp-D causes spontaneous keratinocytes cell death. -- Abstract: UVB-induced skin cell damage involves the opening of mitochondrial permeability transition pore (mPTP), which leads to both apoptotic and necrotic cell death. Cyclophilin D (Cyp-D) translocation to the inner membrane of mitochondrion acts as a key component to open the mPTP. Our Western-Blot results in primary cultured human skin keratinocytes and in HaCaT cell line demonstrated that UVB radiation and hydrogen peroxide (H 2 O 2 ) induced Cyp-D expression, which was inhibited by anti-oxidant N-acetyl cysteine (NAC). We created a stable Cyp-D deficiency skin keratinocytes by expressing Cyp-D-shRNA through lentiviral infection. Cyp-D-deficient cells were significantly less susceptible than their counterparts to UVB- or H 2 O 2 -induced cell death. Further, cyclosporine A (Cs-A), a Cyp-D inhibitor, inhibited UVB- or H 2 O 2 -induced keratinocytes cell death. Reversely, over-expression of Cyp-D in primary keratinocytes caused spontaneous keratinocytes cell death. These results suggest Cyp-D’s critical role in UVB/oxidative stress-induced skin cell death.

  9. Construction of synthetic dermis and skin based on a self-assembled peptide hydrogel scaffold.

    Science.gov (United States)

    Kao, Bunsho; Kadomatsu, Koichi; Hosaka, Yoshiaki

    2009-09-01

    Using biocompatible peptide hydrogel as a scaffold, we prepared three-dimensional synthetic skin that does not contain animal-derived materials or pathogens. The present study investigated preparation methods, proliferation, and functional expression of fibroblasts in the synthetic dermis and differentiation of keratinocytes in the epidermis. Synthetic dermis was prepared by mixing fibroblasts with peptide hydrogel, and synthetic skin was prepared by forming an epidermal layer using keratinocytes on the synthetic dermis. A fibroblast-rich foamy layer consisting of homogeneous peptide hydrogel subsequently formed in the synthetic dermis, with fibroblasts aggregating in clusters within the septum. The epidermis consisted of three to five keratinocyte layers. Immunohistochemical staining showed human type I collagen, indicating functional expression around fibroblasts in the synthetic dermis, keratinocyte differentiation in the epidermis, and expression of basement membrane proteins. The number of fibroblasts tended to increase until the second week and was maintained until the fourth week, but rapidly decreased in the fifth week. In the synthetic dermis medium, the human type I collagen concentration increased after the second week to the fifth week. These findings suggest that peptide hydrogel acts as a synthetic skin scaffold that offers a platform for the proliferation and functional expression of fibroblasts and keratinocytes.

  10. Blue light-induced oxidative stress in live skin.

    Science.gov (United States)

    Nakashima, Yuya; Ohta, Shigeo; Wolf, Alexander M

    2017-07-01

    Skin damage from exposure to sunlight induces aging-like changes in appearance and is attributed to the ultraviolet (UV) component of light. Photosensitized production of reactive oxygen species (ROS) by UVA light is widely accepted to contribute to skin damage and carcinogenesis, but visible light is thought not to do so. Using mice expressing redox-sensitive GFP to detect ROS, blue light could produce oxidative stress in live skin. Blue light induced oxidative stress preferentially in mitochondria, but green, red, far red or infrared light did not. Blue light-induced oxidative stress was also detected in cultured human keratinocytes, but the per photon efficacy was only 25% of UVA in human keratinocyte mitochondria, compared to 68% of UVA in mouse skin. Skin autofluorescence was reduced by blue light, suggesting flavins are the photosensitizer. Exposing human skin to the blue light contained in sunlight depressed flavin autofluorescence, demonstrating that the visible component of sunlight has a physiologically significant effect on human skin. The ROS produced by blue light is probably superoxide, but not singlet oxygen. These results suggest that blue light contributes to skin aging similar to UVA. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Amniotic Membrane Modifies the Genetic Program Induced by TGFß, Stimulating Keratinocyte Proliferation and Migration in Chronic Wounds.

    Directory of Open Access Journals (Sweden)

    Antonia Alcaraz

    Full Text Available Post-traumatic large-surface or deep wounds often cannot progress to reepithelialisation because they become irresponsive in the inflammatory stage, so intervention is necessary to provide the final sealing epidermis. Previously we have shown that Amniotic Membrane (AM induced a robust epithelialisation in deep traumatic wounds.To better understand this phenomenon, we used keratinocytes to investigate the effect of AM on chronic wounds. Using keratinocytes, we saw that AM treatment is able to exert an attenuating effect upon Smad2 and Smad3 TGFß-induced phosphorylation while triggering the activation of several MAPK signalling pathways, including ERK and JNK1, 2. This also has a consequence for TGFß-induced regulation on cell cycle control key players CDK1A (p21 and CDK2B (p15. The study of a wider set of TGFß regulated genes showed that the effect of AM was not wide but very concrete for some genes. TGFß exerted a powerful cell cycle arrest; the presence of AM however prevented TGFß-induced cell cycle arrest. Moreover, AM induced a powerful cell migration response that correlates well with the expression of c-Jun protein at the border of the healing assay. Consistently, the treatment with AM of human chronic wounds induced a robust expression of c-Jun at the wound border.The effect of AM on the modulation of TGFß responses in keratinocytes that favours proliferation together with AM-induced keratinocyte migration is the perfect match that allows chronic wounds to move on from their non-healing state and progress into epithelialization. Our results may explain why the application of AM on chronic wounds is able to promote epithelialisation.

  12. Identification of p63+ keratinocyte progenitor cells in circulation and their matrix-directed differentiation to epithelial cells.

    Science.gov (United States)

    Nair, Renjith P; Krishnan, Lissy K

    2013-04-11

    In the event of chronic diabetes or burn wounds, accomplishing skin regeneration is a major concern. Autologous skin grafting is the most effective remedy, but the tissue harvest may create more nonhealing wounds. Currently available skin substitutes have a limited clinical outcome because of immune reactions arising from the xenobiotic scaffold or allogenous cells. Autologous stem cells that can be collected without an additional injury may be a viable option for skin-tissue engineering. Presence of a low number of keratinocyte progenitor cells (KPCs) within the peripheral blood mononuclear cell (PBMNC) population has been indicated. Identification, isolation, expansion, and differentiation of KPCs is necessary before they are considered for skin regeneration, which is the focus of this study. Culture of isolated human PBMNCs on a cell-specific matrix was carried out to induce differentiation of KPCs. Flow cytometry and reverse transcriptase polymerase chain reaction were done for epithelial stem cell marker p63 and lineage markers cytokeratin 5 and cytokeratin 14, to track differentiation. Proliferation was confirmed by quantifying the proliferating cell nuclear antigen-expressing cells. Immunostaining with epithelial cell markers, involucrin and filaggrin, was carried out to establish terminal differentiation. Microscopic analysis confirmed growth and survival of KPCs on the dermal fibroblast monolayer and on a transplantable fibrin sheet. We demonstrated that KPCs are p63(+) and CD34-. The specifically designed composition of the extracellular matrix was found to support selective adhesion, proliferation, and differentiation of p63(+) KPCs. The PBMNC culture for 12 days under controlled conditions resulted in a homogenous population that expressed cytokeratins, and >90% of the cells were found to proliferate. Subculture for 5 days resulted in expression of filaggrin and involucrin, suggesting terminal differentiation. Transfer of matrix-selected KPCs to a

  13. Age-related changes in expression and function of Toll-like receptors in human skin

    Science.gov (United States)

    Iram, Nousheen; Mildner, Michael; Prior, Marion; Petzelbauer, Peter; Fiala, Christian; Hacker, Stefan; Schöppl, Alice; Tschachler, Erwin; Elbe-Bürger, Adelheid

    2012-01-01

    Toll-like receptors (TLRs) initiate innate immune responses and direct subsequent adaptive immunity. They play a major role in cutaneous host defense against micro-organisms and in the pathophysiology of several inflammatory skin diseases. To understand the role of TLRs in the acquisition of immunological competence, we conducted a comprehensive study to evaluate TLR expression and function in the developing human skin before and after birth and compared it with adults. We found that prenatal skin already expresses the same spectrum of TLRs as adult skin. Strikingly, many TLRs were significantly higher expressed in prenatal (TLRs 1-5) and infant and child (TLRs 1 and 3) skin than in adult skin. Surprisingly, neither dendritic cell precursors in prenatal skin nor epidermal Langerhans cells and dermal dendritic cells in adult skin expressed TLRs 3 and 6, whereas the staining pattern and intensity of both TLRs in fetal basal keratinocytes was almost comparable to those of adults. Stimulation of primary human keratinocytes from fetal, neonatal and adult donors with selected TLR agonists revealed that the synthetic TLR3 ligand poly (I:C) specifically, mimicking viral double-stranded RNA, induced a significantly enhanced secretion of CXCL8/IL8, CXCL10/IP-10 and TNFα in fetal and neonatal keratinocytes compared with adult keratinocytes. This study demonstrates quantitative age-specific modifications in TLR expression and innate skin immune reactivity in response to TLR activation. Thus, antiviral innate immunity already in prenatal skin may contribute to protect the developing human body from viral infections in utero in a scenario where the adaptive immune system is not yet fully functional. PMID:23034637

  14. Defective channels lead to an impaired skin barrier.

    Science.gov (United States)

    Blaydon, Diana C; Kelsell, David P

    2014-10-15

    Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

  15. Skin Cancer.

    Science.gov (United States)

    Linares, Miguel A; Zakaria, Alan; Nizran, Parminder

    2015-12-01

    Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Expression of intercellular adhesion molecule-1 in UVA-irradiated human skin cells in vitro and in vivo

    International Nuclear Information System (INIS)

    Treina, G.; Scaletta, C.; Frenk, E.; Applegate, L.A.; Fourtanier, A.; Seite, S.

    1996-01-01

    Ultraviolet A (UVA) radiation represents an important oxidative stress to human skin and certain forms of oxidative stress have been shown to modulate intercellular adhesion molecule-1 (ICAM-1) expression. ICAM-1 has been shown to play an important part in many immune reactions and the perturbations of this molecule by ultraviolet radiation could have implications in many inflammatory responses. An enhancement immunohistochemical method with avidin/biotin was used for analysing the early effects of UVA radiation on human cell cultures and human skin (340-400 nm). Both in vitro and in vivo data show that ICAM-1 staining in epidermal keratinocytes, which was expressed constitutively, decreased in a UVA dose-dependent manner. The decrease was most noted at 3-6 h following UVA radiation with some ICAM-1 staining returning by 48 h post-UVA. ICAM-1 positive staining in the dermis was specific for vascular structures and was increased 24 h after UVA radiation. Cultured dermal fibroblasts exhibited ICAM-1 staining which increased slightly within 6-48 h post-UVA radiation. As epidermal ICAM-1 expression is depleted following UVA radiation and dermal expression increases due to an increase in the vascular structures, ICAM-1 provides a valuable marker following UVA radiation in human skin that can be readily measured in situ. (author)

  17. Skin tightening.

    Science.gov (United States)

    Woolery-Lloyd, Heather; Kammer, Jenna N

    2011-01-01

    Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

  18. Enhanced unscheduled DNA synthesis in UV-irradiated human skin explants treated with T4N5 liposomes

    International Nuclear Information System (INIS)

    Yarosh, D.B.; Kibitel, J.T.; Green, L.A.; Spinowitz, A.

    1991-01-01

    Epidermal keratinocytes cultured from explants of skin cancer patients, including biopsies from xeroderma pigmentosum patients, were ultraviolet light-irradiated and DNA repair synthesis was measured. Repair capacity was much lower in xeroderma pigmentosum patients than in normal patients. The extent of DNA repair replication did not decline with the age of the normal patient. Treatment with T4N5 liposomes containing a DNA repair enzyme enhanced repair synthesis in both normal and xeroderma pigmentosum keratinocytes in an irradiation- and liposome-dose dependent manner. These results provide no evidence that aging people or skin cancer patients are predisposed to cutaneous malignancy by a DNA repair deficiency, but do demonstrate that T4N5 liposomes enhance DNA repair in the keratinocytes of the susceptible xeroderma pigmentosum and skin cancer population

  19. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  20. Ultra-violet B (UVB)-induced skin cell death occurs through a cyclophilin D intrinsic signaling pathway.

    Science.gov (United States)

    Ji, Chao; Yang, Bo; Yang, Zhi; Tu, Ying; Yang, Yan-li; He, Li; Bi, Zhi-Gang

    2012-09-07

    UVB-induced skin cell damage involves the opening of mitochondrial permeability transition pore (mPTP), which leads to both apoptotic and necrotic cell death. Cyclophilin D (Cyp-D) translocation to the inner membrane of mitochondrion acts as a key component to open the mPTP. Our Western-Blot results in primary cultured human skin keratinocytes and in HaCaT cell line demonstrated that UVB radiation and hydrogen peroxide (H(2)O(2)) induced Cyp-D expression, which was inhibited by anti-oxidant N-acetyl cysteine (NAC). We created a stable Cyp-D deficiency skin keratinocytes by expressing Cyp-D-shRNA through lentiviral infection. Cyp-D-deficient cells were significantly less susceptible than their counterparts to UVB- or H(2)O(2)-induced cell death. Further, cyclosporine A (Cs-A), a Cyp-D inhibitor, inhibited UVB- or H(2)O(2)-induced keratinocytes cell death. Reversely, over-expression of Cyp-D in primary keratinocytes caused spontaneous keratinocytes cell death. These results suggest Cyp-D's critical role in UVB/oxidative stress-induced skin cell death. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. FOXO1 expression in keratinocytes promotes connective tissue healing

    Science.gov (United States)

    Zhang, Chenying; Lim, Jason; Liu, Jian; Ponugoti, Bhaskar; Alsadun, Sarah; Tian, Chen; Vafa, Rameen; Graves, Dana T.

    2017-01-01

    Wound healing is complex and highly orchestrated. It is well appreciated that leukocytes, particularly macrophages, are essential for inducing the formation of new connective tissue, which requires the generation of signals that stimulate mesenchymal stem cells (MSC), myofibroblasts and fibroblasts. A key role for keratinocytes in this complex process has yet to be established. To this end, we investigated possible involvement of keratinocytes in connective tissue healing. By lineage-specific deletion of the forkhead box-O 1 (FOXO1) transcription factor, we demonstrate for the first time that keratinocytes regulate proliferation of fibroblasts and MSCs, formation of myofibroblasts and production of collagen matrix in wound healing. This stimulation is mediated by a FOXO1 induced TGFβ1/CTGF axis. The results provide direct evidence that epithelial cells play a key role in stimulating connective tissue healing through a FOXO1-dependent mechanism. Thus, FOXO1 and keratinocytes may be an important therapeutic target where healing is deficient or compromised by a fibrotic outcome. PMID:28220813

  2. Photodynamic toxicity of hematoporphyrin derivatives to human keratinocytes in culture.

    Science.gov (United States)

    Kappus, H; Reinhold, C; Artuc, M

    Human keratinocytes in culture were able to take up hematoporphyrin derivatives (HPDs) used during photodynamic chemotherapy of tumors. In the absence of light, HPDs showed no cytotoxic effects to keratinocytes. However, after irradiation with visible light, HPDs induced immediate cytotoxicity as measured by the neutral red uptake assay. On the other hand, cell attachment as measured by protein estimation was not affected. When the cells treated with HPDs and irradiated with light were cultured for a further 72 h, they partially lost their ability to attach to the collagen surface. Most of the cells remaining attached after 72 h were no longer viable following treatment with HPDs and light. All parameters measured depended on the intracellular concentration of HPDs used (7-50 ng/10(5) cells) and the time of irradiation (0-30 min). These results suggest that human keratinocytes are a good model to study cytotoxic effects of photodynamically active drugs. Further, keratinocytes were unable to recover after damage caused by HPDs and light.

  3. Hyaluronan minimizes effects of UV irradiation on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Hašová, M.; Crhák, Tomáš; Šafaříková, Barbora; Dvořáková, J.; Muthný, T.; Velebný, V.; Kubala, Lukáš

    2011-01-01

    Roč. 303, č. 4 (2011), s. 277-284 ISSN 0340-3696 R&D Projects: GA ČR(CZ) GA305/08/1704 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : hyaluronan * keratinocyte * ultraviolet light Subject RIV: BO - Biophysics Impact factor: 2.279, year: 2011

  4. Exploratory Study on the Stability Characteristics of Commercial Human Keratinocytes

    Science.gov (United States)

    1990-04-01

    Invest. Dermatol. 75:176- 182; 1980. 16. Hayflick , L. The limited in vitro lifetime of huiran diploid strains. Exp. Cell Res. 37:614-636; 1965. 17...culture keratinocytes were considered by some investigators to have limited proliferative potential, so they used third and fourth passage commercial

  5. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  6. Appraisal of alternative skin model for the study of epidermal restoration following exposure to various environmental stress agents: ionising radiation and UV B

    International Nuclear Information System (INIS)

    Isoir, M.

    2006-06-01

    Human skin is a major target tissue for ionising radiation (IR) and UV B. We developed a skin explant model and used 2 types of keratinocytes to study survival and oxidative stress induced by these radiations. We examined oxidative damages by measuring R.O.S. produced and cellular anti-oxidant defenses induced. We observed into skin exposed to IR a modulation of genes expression implied in the control of oxidative stress, confirmed by the decrease of catalase, glutathione peroxidase and superoxide dismutase enzymatic activities. The imbalance observed between anti- and pro-apoptotic genes expression shows that keratinocytes apoptosis may be partly dependent on radio-induced R.O.S. production. We showed the difference of radiosensitivity between N.H.E.K. and Ha Ca.T., which may be linked to their differential oxidative responses. In addition, during re-epithelialising, we demonstrated that activated N.H.E.K. after IR express keratin 6, release pro-inflammatory cytokines and proliferate, without modification of their differentiation. Treatment of N.H.E.K. with geranyl geranylacetone (G.G.A.) has a beneficial effect on their radio-induced activation by increasing IL-1 release, their migration in scrapped area and their survival. G.G.A. has an anti apoptotic ability (induction of Hsp70- caspase-3 pathway) and migratory properties (P38/RhoA activation) on N.H.E.K., but after IR, only caspase-3 pathway is induced. This work thus contributes to the understanding of cutaneous damages after IR and G.G.A. mechanism of action which accelerates re-epithelialising. (author)

  7. Proof-of-concept: 3D bioprinting of pigmented human skin constructs.

    Science.gov (United States)

    Ng, Wei Long; Qi, Jovina Tan Zhi; Yeong, Wai Yee; Naing, May Win

    2018-01-23

    Three-dimensional (3D) pigmented human skin constructs have been fabricated using a 3D bioprinting approach. The 3D pigmented human skin constructs are obtained from using three different types of skin cells (keratinocytes, melanocytes and fibroblasts from three different skin donors) and they exhibit similar constitutive pigmentation (pale pigmentation) as the skin donors. A two-step drop-on-demand bioprinting strategy facilitates the deposition of cell droplets to emulate the epidermal melanin units (pre-defined patterning of keratinocytes and melanocytes at the desired positions) and manipulation of the microenvironment to fabricate 3D biomimetic hierarchical porous structures found in native skin tissue. The 3D bioprinted pigmented skin constructs are compared to the pigmented skin constructs fabricated by conventional a manual-casting approach; in-depth characterization of both the 3D pigmented skin constructs has indicated that the 3D bioprinted skin constructs have a higher degree of resemblance to native skin tissue in term of the presence of well-developed stratified epidermal layers and the presence of a continuous layer of basement membrane proteins as compared to the manually-cast samples. The 3D bioprinting approach facilitates the development of 3D in vitro pigmented human skin constructs for potential toxicology testing and fundamental cell biology research.

  8. Bioactive Dietary VDR Ligands Regulate Genes Encoding Biomarkers of Skin Repair That Are Associated with Risk for Psoriasis

    Directory of Open Access Journals (Sweden)

    Amitis Karrys

    2018-02-01

    Full Text Available Treatment with 1,25-dihydroxyvitamin D3 (1,25D improves psoriasis symptoms, possibly by inducing the expression of late cornified envelope (LCE3 genes involved in skin repair. In psoriasis patients, the majority of whom harbor genomic deletion of LCE3B and LCE3C (LCE3C_LCE3B-del, we propose that certain dietary analogues of 1,25D activate the expression of residual LCE3A/LCE3D/LCE3E genes to compensate for the loss of LCE3B/LCE3C in the deletant genotype. Herein, human keratinocytes (HEKn homozygous for LCE3C_LCE3B-del were treated with docosahexaenoic acid (DHA and curcumin, two low-affinity, nutrient ligands for the vitamin D receptor (VDR. DHA and curcumin induce the expression of LCE3A/LCE3D/LCE3E mRNAs at concentrations corresponding to their affinity for VDR. Moreover, immunohistochemical quantitation revealed that the treatment of keratinocytes with DHA or curcumin stimulates LCE3 protein expression, while simultaneously opposing the tumor necrosis factor-alpha (TNFα-signaled phosphorylation of mitogen activated protein (MAP kinases, p38 and Jun amino-terminal kinase (JNK, thereby overcoming inflammation biomarkers elicited by TNFα challenge. Finally, DHA and curcumin modulate two transcription factors relevant to psoriatic inflammation, the activator protein-1 factor Jun B and the nuclear receptor NR4A2/NURR1, that is implicated as a mediator of VDR ligand-triggered gene control. These findings provide insights into the mechanism(s whereby dietary VDR ligands alter inflammatory and barrier functions relevant to skin repair, and may provide a molecular basis for improved treatments for mild/moderate psoriasis.

  9. Dysregulated ΔNp63α inhibits expression of Ink4a/arf, blocks senescence, and promotes malignant conversion of keratinocytes.

    Directory of Open Access Journals (Sweden)

    Linan Ha

    Full Text Available p63 is critical for squamous epithelial development, and elevated levels of the ΔNp63α isoform are seen in squamous cell cancers of various organ sites. However, significant controversy exists regarding the role of p63 isoforms as oncoproteins or tumor suppressors. Here, lentiviruses were developed to drive long-term overexpression of ΔNp63α in primary keratinocytes. Elevated levels of ΔNp63α in vitro promote long-term survival and block both replicative and oncogene-induced senescence in primary keratinocytes, as evidenced by the expression of SA-β-gal and the presence of nuclear foci of heterochromatin protein 1γ. The contribution of ΔNp63α to cancer development was assessed using an in vivo grafting model of experimental skin tumorigenesis that allows distinction between benign and malignant tumors. Grafted lenti-ΔNp63α keratinocytes do not form tumors, whereas lenti-GFP/v-ras(Ha keratinocytes develop well-differentiated papillomas. Lenti-ΔNp63α/v-ras(Ha keratinocytes form undifferentiated carcinomas. The average volume of lenti-ΔNp63α/v-ras(Ha tumors was significantly higher than those in the lenti-GFP/v-ras(Ha group, consistent with increased BrdU incorporation detected by immunohistochemistry. The block in oncogene-induced senescence corresponds to sustained levels of E2F1 and phosphorylated AKT, and is associated with loss of induction of p16(ink4a/p19(arf. The relevance of p16(ink4a/p19(arf loss was demonstrated in grafting studies of p19(arf-null keratinocytes, which develop malignant carcinomas in the presence of v-ras(Ha similar to those arising in wildtype keratinocytes that express lenti-ΔNp63α and v-ras(Ha. Our findings establish that ΔNp63α has oncogenic activity and its overexpression in human squamous cell carcinomas contributes to the malignant phenotype, and implicate its ability to regulate p16(ink4a/p19(arf in the process.

  10. The role of alpha3beta1 integrin in determining the supramolecular organization of laminin-5 in the extracellular matrix of keratinocytes.

    Science.gov (United States)

    deHart, Gregory W; Healy, Kevin E; Jones, Jonathan C R

    2003-02-01

    Analyses of mice with targeted deletions in the genes for alpha3 and beta1 integrin suggest that the alpha3beta1 integrin heterodimer likely determines the organization of the extracellular matrix within the basement membrane of skin. Here we tested this hypothesis using keratinocytes derived from alpha3 integrin-null mice. We have compared the organizational state of laminin-5, a ligand of alpha3beta1 integrin, in the matrix of wild-type keratinocytes with that of laminin-5 in the matrix of alpha3 integrin-null cells. Laminin-5 distributes diffusely in arc structures in the matrix of wild-type mouse keratinocytes, whereas laminin-5 is organized into linear, spike-like arrays by the alpha3 integrin-null cells. The fact that alpha3 integrin-null cells are deficient in their ability to assemble a proper laminin-5 matrix is also shown by their failure to remodel laminin-5 when plated onto surfaces coated with purified laminin-5 protein. In sharp contrast, wild-type keratinocytes organize exogenously added laminin-5 into discrete ring-like organizations. These findings led us next to assess whether differences in laminin-5 organization in the matrix of the wild-type and alpha3 integrin-null cells impact cell behavior. Our results indicate that alpha3 integrin-null cells are more motile than their wild-type counterparts and leave extensive trails of laminin-5 over the surface on which they move. Moreover, HEK 293 cells migrate significantly more on the laminin-5-rich matrix derived from the alpha3 integrin-null cells than on the wild-type keratinocyte laminin-5 matrix. In addition, alpha3 integrin-null cells show low strength of adhesion to surfaces coated with purified laminin-5 compared to wild-type cells although both the wild type and the alpha3 integrin-null keratinocytes adhere equally strongly to laminin-5 that has been organized into arrays by other epithelial cells. These data suggest: (1) that alpha3beta1 integrin plays an important role in determining the

  11. Eupafolin nanoparticles protect HaCaT keratinocytes from particulate matter-induced inflammation and oxidative stress

    Science.gov (United States)

    Lin, Zih-Chan; Lee, Chiang-Wen; Tsai, Ming-Horng; Ko, Horng-Huey; Fang, Jia-You; Chiang, Yao-Chang; Liang, Chan-Jung; Hsu, Lee-Fen; Hu, Stephen Chu-Sung; Yen, Feng-Lin

    2016-01-01

    Exposure to particulate matter (PM), a major form of air pollution, can induce oxidative stress and inflammation and may lead to many diseases in various organ systems including the skin. Eupafolin, a flavonoid compound derived from Phyla nodiflora, has been previously shown to exhibit various pharmacological activities, including antioxidant and anti-inflammatory effects. Unfortunately, eupafolin is characterized by poor water solubility and skin penetration, which limits its clinical applications. To address these issues, we successfully synthesized a eupafolin nanoparticle delivery system (ENDS). Our findings showed that ENDS could overcome the physicochemical drawbacks of raw eupafolin with respect to water solubility and skin penetration, through reduction of particle size and formation of an amorphous state with hydrogen bonding. Moreover, ENDS was superior to raw eupafolin in attenuating PM-induced oxidative stress and inflammation in HaCaT keratinocytes, by mediating the antioxidant pathway (decreased reactive oxygen species production and nicotinamide adenine dinucleotide phosphate oxidase activity) and anti-inflammation pathway (decreased cyclooxygenase-2 expression and prostaglandin E2 production through downregulation of mitogen-activated protein kinase and nuclear factor-κB signaling). In summary, ENDS shows better antioxidant and anti-inflammatory activities than raw eupa