WorldWideScience

Sample records for skin keratinocyte proliferation

  1. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  2. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  3. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  4. Red Light Combined with Blue Light Irradiation Regulates Proliferation and Apoptosis in Skin Keratinocytes in Combination with Low Concentrations of Curcumin

    Science.gov (United States)

    Cai, Qing; Ren, Qu; Wei, Lizhao

    2015-01-01

    Curcumin is a widely known natural phytochemical from plant Curcuma longa. In recent years, curcumin has received increasing attention because of its capability to induce apoptosis and inhibit cell proliferation as well as its anti-inflammatory properties in different cancer cells. However, the therapeutic benefits of curcumin are severely hampered due to its particularly low absorption via trans-dermal or oral bioavailability. Phototherapy with visible light is gaining more and more support in dermatological therapy. Red light is part of the visible light spectrum, which is able to deeply penetrate the skin to about 6 mm, and directly affect the fibroblast of the skin dermis. Blue light is UV-free irradiation which is fit for treating chronic inflammation diseases. In this study, we show that curcumin at low concentrations (1.25–3.12 μM) has a strong anti-proliferative effect on TNF-α-induced psoriasis-like inflammation when applied in combination with light-emitting-diode devices. The treatment was especially effective when LED blue light at 405 nm was combined with red light at 630 or 660 nm, which markedly amplified the anti-proliferative and apoptosis-inducing effects of curcumin. The experimental results demonstrated that this treatment reduced the viability of human skin keratinocytes, decreased cell proliferation, induced apoptosis, inhibited NF-κB activity and activated caspase-8 and caspase-9 while preserving the cell membrane integrity. Moreover, the combined treatment also down-regulated the phosphorylation level of Akt and ERK. Taken together, our results indicated that the combination of curcumin with LED blue light united red light irradiation can attain a higher efficiency of regulating proliferation and apoptosis in skin keratinocytes. PMID:26382065

  5. Red Light Combined with Blue Light Irradiation Regulates Proliferation and Apoptosis in Skin Keratinocytes in Combination with Low Concentrations of Curcumin.

    Directory of Open Access Journals (Sweden)

    Tianhui Niu

    Full Text Available Curcumin is a widely known natural phytochemical from plant Curcuma longa. In recent years, curcumin has received increasing attention because of its capability to induce apoptosis and inhibit cell proliferation as well as its anti-inflammatory properties in different cancer cells. However, the therapeutic benefits of curcumin are severely hampered due to its particularly low absorption via trans-dermal or oral bioavailability. Phototherapy with visible light is gaining more and more support in dermatological therapy. Red light is part of the visible light spectrum, which is able to deeply penetrate the skin to about 6 mm, and directly affect the fibroblast of the skin dermis. Blue light is UV-free irradiation which is fit for treating chronic inflammation diseases. In this study, we show that curcumin at low concentrations (1.25-3.12 μM has a strong anti-proliferative effect on TNF-α-induced psoriasis-like inflammation when applied in combination with light-emitting-diode devices. The treatment was especially effective when LED blue light at 405 nm was combined with red light at 630 or 660 nm, which markedly amplified the anti-proliferative and apoptosis-inducing effects of curcumin. The experimental results demonstrated that this treatment reduced the viability of human skin keratinocytes, decreased cell proliferation, induced apoptosis, inhibited NF-κB activity and activated caspase-8 and caspase-9 while preserving the cell membrane integrity. Moreover, the combined treatment also down-regulated the phosphorylation level of Akt and ERK. Taken together, our results indicated that the combination of curcumin with LED blue light united red light irradiation can attain a higher efficiency of regulating proliferation and apoptosis in skin keratinocytes.

  6. TIG3 - AN IMPORTANT REGULATOR OF KERATINOCYTE PROLIFERATION AND SURVIVAL

    OpenAIRE

    Scharadin, Tiffany M.; Eckert, Richard L.

    2014-01-01

    Tazarotene induced gene 3 (TIG3) is a tumor suppressor protein. In normal human epidermis, TIG3 is present in the differentiated, suprabasal layers and regulates terminal differentiation. TIG3 level is reduced in hyperproliferative diseases, including psoriasis and skin cancer, suggesting that loss of TIG3 is associated with enhanced cell proliferation. Moreover, transient expression of TIG3 leads to terminal differentiation in normal keratinocytes and apoptosis in skin cancer cells. In both ...

  7. Methotrexate treatment provokes apoptosis of proliferating keratinocyte in psoriasis patients.

    Science.gov (United States)

    Elango, Tamilselvi; Thirupathi, Anand; Subramanian, Swapna; Ethiraj, Purushoth; Dayalan, Haripriya; Gnanaraj, Pushpa

    2017-08-01

    Psoriasis is a chronic inflammatory skin disease characterized by hyper proliferation of keratinocytes. Recent data show that the epidermis thickening in psoriasis may be related to imbalance of homeostasis caused by abnormal apoptotic process. Maintenance of keratinocyte apoptotic process is very important in psoriasis. Methotrexate (MTX) has been used for many years to restore the normal skin in psoriasis condition. However, the exact mechanism of MTX in psoriasis condition is poorly understood. The aim of this study was to examine the role of MTX on keratinocyte apoptosis pathway in psoriasis patients. A total of 58 psoriasis vulgaris patients were recruited for this study. Nonlesional skin biopsies served as control. Skin biopsies of psoriatic patients were collected and analyzed for cytosolic, mitochondria and total cytochrome c by ELISA. Expression of caspase-9, NFκBp65, pAkt1 by western blot, real-time PCR and immunohistochemical analysis of c-FLIP protein was analyzed in nonlesional and lesional skin biopsies before (day 0) and after (at the end of 6 and 12 weeks) MTX treatment. After MTX treatment, a significant increase in cytochrome c was observed when compared with before MTX treatment in psoriasis patients (p psoriasis by controlling the acanthosis.

  8. Intermittent pressure decreases human keratinocyte proliferation in vitro.

    Science.gov (United States)

    Nasca, Maria R; Shih, Alan T; West, Dennis P; Martinez, Wanda M; Micali, Giuseppe; Landsman, Adam S

    2007-01-01

    The aim of this study was to investigate the correlation between pressure changes and keratinocyte proliferation by determining whether keratinocytes exposed to altered mechanical pressures would proliferate at different rates compared to control cells not subjected to pressure changes. Tissue culture flasks of human keratinocytes plated at an approximate density of 15,000 cells/cm(2) undergoing an intermittent cyclic pressure of 362 mm Hg at a frequency of 2.28 or 5.16 cycles/min (0.038 or 0.086 Hz) for 8 h were compared to control flasks grown at ambient room pressure. An in-line pressure transducer was used to monitor and adjust pressure within the cell chambers, using a solenoid valve. A thymidine incorporation assay assessed the amount of cell proliferation in each set of experiments. Differences in proliferation between keratinocytes subjected to cyclic pressure changes and control cells were found to be statistically significant (p < 0.05) in 4 out of 5 proliferation assays. Also, a higher frequency of pressure changes consistently generated a reduced proliferation rate compared to that seen in cells exposed to a lower frequency of pressure changes. These data indicate that keratinocytes undergoing intermittent pressure changes exhibit decreased proliferation rates compared to controls. Furthermore, an increased frequency rate seems to have a greater effect on proliferation than low-frequency rate pressure changes, suggesting that the stress caused by frequently changed pressure may play a greater role in reducing keratinocyte proliferation than the actual magnitude of load applied to the cells. Our results support the current treatment protocol of reducing speed and duration of walking on the site of the wound to promote healing of foot ulcers. (c) 2007 S. Karger AG, Basel.

  9. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    International Nuclear Information System (INIS)

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  10. Stereotyped distribution of proliferating keratinocytes in disorders affecting the epidermis

    International Nuclear Information System (INIS)

    Pierard-Franchimont, C.; Pierard, G.E.

    1989-01-01

    We used the technique of autoradiography after incorporation of tritiated thymidine ( 3 H-TdR) to evaluate keratinocyte proliferation in basal, epibasal, and other epidermal layers in 30 diseases affecting the epidermis. The number and proportion of 3 H-TdR-labeled keratinocytes were counted in the different layers of the epidermis. Significant correlations were found between the proliferative indices of the different epidermal layers. Such links indicate that the epidermis responds in a rather stereotyped way to various pathological conditions. There exists some regulation in the distribution, number, and proportion of 3 H-TdR-labeled keratinocytes in the various layers of the epidermis

  11. The human keratinocyte two-dimensional protein database (update 1994): towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Olsen, E

    1994-01-01

    The master two-dimensional (2-D) gel database of human keratinocytes currently lists 3087 cellular proteins (2168 isoelectric focusing, IEF; and 919 none-quilibrium pH gradient electrophoresis, NEPHGE), many of which correspond to posttranslational modifications, 890 polypeptides have been...... in the database. We also report a database of proteins recovered from the medium of noncultured, unfractionated keratinocytes. This database lists 398 polypeptides (309 IEF; 89 NEPHGE) of which 76 have been identified. The aim of the comprehensive databases is to gather, through a systematic study...

  12. Rapid adhesion and proliferation of keratinocytes on the gold colloid/chitosan film scaffold

    International Nuclear Information System (INIS)

    Zhang Yi; He Hong; Gao Wenjuan; Lu Shuangyun; Liu Yang; Gu Haiying

    2009-01-01

    The gold colloid/chitosan film scaffold, which could enhance the attached ratio and accelerate proliferation of newborn mice keratinocytes, was fabricated by nanotechnology and self-assembly technology. This nanometer scaffold was characterized by atomic force microscopy (AFM) and scanning electron microscopy (SEM). The keratinocytes were cultured and observed on three different extracellular matrices (ECM): gold colloid/chitosan film scaffold, chitosan film and cell culture plastic (control groups). 6 h, 12 h, 24 h after inoculation, the cell attached ratios were calculated respectively. In comparison to control groups, this scaffold could significantly (P < 0.01) increase the attached ratio of keratinocytes and promote their growth. Meanwhile, there were not any fusiform fibroblasts growing on this scaffold. The rapidly proliferating keratinocytes were indentified and characterized by immunohistochemistry and transmissive electron microscope (TEM), which showed the cells maintain their biological activity well. The results indicated that gold colloid/chitosan film scaffold was nontoxic to keratinocytes, and was a good candidate for wound dressing in skin tissue engineering.

  13. MicroRNA-17-92 cluster promotes the proliferation and the chemokine production of keratinocytes: implication for the pathogenesis of psoriasis.

    Science.gov (United States)

    Zhang, Weigang; Yi, Xiuli; An, Yawen; Guo, Sen; Li, Shuli; Song, Pu; Chang, Yuqian; Zhang, Shaolong; Gao, Tianwen; Wang, Gang; Li, Chunying

    2018-05-11

    Keratinocytes are the main epidermal cell type that constitutes the skin barrier against environmental damages, which emphasizes the balance between the growth and the death of keratinocytes in maintaining skin homeostasis. Aberrant proliferation of keratinocytes and the secretion of inflammatory factors from keratinocytes are related to the formation of chronic inflammatory skin diseases like psoriasis. MicroRNA-17-92 (miRNA-17-92 or miR-17-92) is a miRNA cluster that regulates cell growth and immunity, but the role of miR-17-92 cluster in keratinocytes and its relation to skin diseases have not been well investigated. In the present study, we initially found that miR-17-92 cluster promoted the proliferation and the cell-cycle progression of keratinocytes via suppressing cyclin-dependent kinase inhibitor 2B (CDKN2B). Furthermore, miR-17-92 cluster facilitated the secretion of C-X-C motif chemokine ligand 9 (CXCL9) and C-X-C motif chemokine ligand 10 (CXCL10) from keratinocytes by inhibiting suppressor of cytokine signaling 1 (SOCS1), which enhanced the chemotaxis for T lymphocytes formed by keratinocytes. In addition, we detected increased expression of miR-17-92 cluster in psoriatic lesions and the level of lesional miR-17-92 cluster was positively correlated with the disease severity in psoriasis patients. At last, miR-17-92 cluster was increased in keratinocytes by cytokines through the activation of signal transducers and activators of transcription 1 (STAT1) signaling pathway. Our findings demonstrate that cytokine-induced overexpression of miR-17-92 cluster can promote the proliferation and the immune function of keratinocytes, and thus may contribute to the development of inflammatory skin diseases like psoriasis, which implicates miR-17-92 cluster as a potential therapeutic target for psoriasis and other skin diseases with similar inflammatory pathogenesis.

  14. Increased keratinocyte proliferation initiated through downregulation of desmoplakin by RNA interference

    International Nuclear Information System (INIS)

    Wan Hong; South, Andrew P.; Hart, Ian R.

    2007-01-01

    The intercellular adhesive junction desmosomes are essential for the maintenance of tissue structure and integrity in skin. Desmoplakin (Dp) is a major obligate plaque protein which plays a fundamental role in anchoring intermediate filaments to desmosomal cadherins. Evidence from hereditary human disease caused by mutations in the gene encoding Dp, e.g. Dp haploinsufficiency, suggests that alterations in Dp expression result not only in the disruption of tissue structure and integrity but also could evoke changes in keratinocyte proliferation. We have used transient RNA interference (RNAi) to downregulate Dp specifically in HaCaT keratinocytes. We showed that this Dp downregulation also caused reduced expression of several other desmosomal proteins. Increased cell proliferation and enhanced G 1 -to-S-phase entry in the cell cycle, as monitored by colonial cellular density and BrdU incorporation, were seen in Dp RNAi-treated cells. These proliferative changes were associated with elevated phospho-ERK1/2 and phospho-Akt levels. Furthermore, this increase in phospho-ERK/1/2 and phospho-Akt levels was sustained in Dp RNAi-treated cells at confluence whereas in control cells there was a significant reduction in phosphorylation of ERK1/2. This study indicates that Dp may participate in the regulation of keratinocyte cell proliferation by, in part at least, regulating cell cycle progression

  15. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    2010-08-01

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  16. Characterization of Fetal Keratinocytes, Showing Enhanced Stem Cell-Like Properties: A Potential Source of Cells for Skin Reconstruction

    Directory of Open Access Journals (Sweden)

    Kenneth K.B. Tan

    2014-08-01

    Full Text Available Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  17. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    International Nuclear Information System (INIS)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-01-01

    The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.

  18. Enhancement of keratinocyte performance in the production of tissue-engineered skin using a low-calcium medium.

    Science.gov (United States)

    Hernon, Catherine A; Harrison, Caroline A; Thornton, Daniel J A; MacNeil, Sheila

    2007-01-01

    The success of laboratory-expanded autologous keratinocytes for the treatment of severe burn injuries is often compromised by their lack of dermal remnants and failure to establish a secure dermo-epidermal junction on the wound bed. We have developed a tissue-engineered skin substitute for in vivo use, based on a sterilized donor human dermis seeded with autologous keratinocytes and fibroblasts. However, culture rates are currently too slow for clinical use in acute burns. Our aim in this study was to increase the rate of production of tissue-engineered skin. Two approaches were explored: one using a commercial low-calcium media and the other supplementing well-established media for keratinocyte culture with the calcium-chelating agent ethylene glutamine tetra-acetic acid (EGTA). Using commercial low-calcium media for both the initial cell culture and subsequent culture of tissue-engineered skin did not produce tissue suitable for clinical use. However, it was possible to enhance the initial proliferation of keratinocytes and to increase their horizontal migration in tissue-engineered skin by supplementing established culture medium with 0.04 mM EGTA without sacrificing epidermal attachment and differentiation. Enhancement of keratinocyte migration with EGTA was also maximal in the absence of fibroblasts or basement membrane.

  19. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  20. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  1. Skin and hair follicle integrity is crucially dependent on beta 1 integrin expression on keratinocytes

    DEFF Research Database (Denmark)

    Brakebusch, C; Grose, R; Quondamatteo, F

    2000-01-01

    developed severe hair loss due to a reduced proliferation of hair matrix cells and severe hair follicle abnormalities. Eventually, the malformed hair follicles were removed by infiltrating macrophages. The epidermis of the back skin became hyperthickened, the basal keratinocytes showed reduced expression......, the integrity of the basement membrane surrounding the beta 1-deficient hair follicle was not affected. Finally, the dermis became fibrotic. These results demonstrate an important role of beta 1 integrins in hair follicle morphogenesis, in the processing of basement membrane components, in the maintenance...

  2. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  3. Platelet-released growth factors inhibit proliferation of primary keratinocytes in vitro.

    Science.gov (United States)

    Bayer, Andreas; Tohidnezhad, Mersedeh; Berndt, Rouven; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Simanski, Maren; Gläser, Regine; Harder, Jürgen

    2018-01-01

    Autologous thrombocyte concentrate lysates as platelet-released growth factors (PRGF) or Vivostat Platelet Rich Fibrin (PRF ® ) represent important tools in modern wound therapy, especially in the treatment of chronic, hard-to-heal or infected wounds. Nevertheless, underlying cellular and molecular mechanisms of the beneficial clinical effects of a local wound therapy with autologous thrombocyte concentrate lysates are poorly understood. Recently, we have demonstrated that PRGF induces antimicrobial peptides in primary keratinocytes and accelerates keratinocytes' differentiation. In the present study we analyzed the influence of PRGF on primary human keratinocytes' proliferation. Using the molecular proliferation marker Ki-67 we observed a concentration- and time dependent inhibition of Ki-67 gene expression in PRGF treated primary keratinocytes. These effects were independent from the EGFR- and the IL-6-R pathway. Inhibition of primary keratinocytes' proliferation by PRGF treatment was confirmed in colorimetric cell proliferation assays. Together, these data indicate that the clinically observed positive effects of autologous thrombocytes concentrates in the treatment of chronic, hard-to-heal wounds are not based on an increased keratinocytes proliferation. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. CRISPR-assisted receptor deletion reveals distinct roles for ERBB2 and ERBB3 in skin keratinocytes.

    Science.gov (United States)

    Dahlhoff, Maik; Gaborit, Nadège; Bultmann, Sebastian; Leonhardt, Heinrich; Yarden, Yosef; Schneider, Marlon R

    2017-10-01

    While the epidermal growth factor receptor (EGFR) is an established regulator of skin development and homeostasis, the functions of the related tyrosine kinase receptors ERBB2 and ERBB3 in this tissue have only recently been examined. Previously reported, skin-specific deletion of each of these receptors in mice resulted in similar defects in keratinocyte proliferation and migration, resulting in impaired wound healing and tumorigenesis. Because both ERBB2 and ERBB3 are targets for treating an array of cancer types, it is important to examine the consequences of receptor inhibition in human keratinocytes. Here, we employed the CRISPR/Cas9 technology to generate HaCaT cells (an established human keratinocyte cell line) lacking ERBB2 or ERBB3. HaCaT clones lacking ERBB2 or ERBB3 showed comparable reductions in cell proliferation as assessed by BrdU staining. Apoptosis, in contrast, was reduced in ERBB3-deficient HaCaT cells only. Assessment of cell migration using a wound healing (scratch) assay showed that the closure of the wound gaps was completed by 48 h in mock and in ERBB3 knockout clones. In contrast, this process was considerably delayed in ERBB2 knockout clones, and a complete closure of the gap in the latter cells did not occur before 72 h. In conclusion, both ERBB2 and ERBB3 are essential for normal proliferation of skin keratinocytes, but in contrast to ERBB3, ERBB2 is essential for migration of human keratinocytes. These observations might bear significance to patient adverse effects of therapeutic agents targeting ERBB2 and ERBB3. © 2017 Federation of European Biochemical Societies.

  5. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)

    2016-04-08

    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  6. SOCS3 inhibits the pathological effects of IL-22 in non-melanoma skin tumor-derived keratinocytes.

    Science.gov (United States)

    Madonna, Stefania; Scarponi, Claudia; Morelli, Martina; Sestito, Rosanna; Scognamiglio, Pasqualina Liana; Marasco, Daniela; Albanesi, Cristina

    2017-04-11

    Basal cell carcinomas (BCC) and squamous-cell carcinomas (SCC) are common malignancies in humans, caused by neoplastic transformation of keratinocytes of the basal or suprabasal layers of epidermis, respectively. Tumor-infiltrating lymphocytes (TILs) are frequently found in BCC and SCC, and functionally promote epithelial carcinogenesis. TILs secreting IL-22, in particular, participate to BCC and SCC growth by inducing keratinocyte proliferation and migration, as well as the expression of inflammatory, anti-apoptotic and pro-angiogenic genes.In this study, we identified SOCS3 as a valid candidate to be manipulated for suppressing tumorigenic functions in BCC and SCC. We found that SOCS3 and SOCS1 expression was reduced in vivo, in tumor lesions of BCC and SCC, as compared to other skin inflammatory conditions such as psoriasis, despite the high number of IL-22-secreting TILs. Moreover, IL-22 was not able to induce in vitro the transcriptional expression of SOCS3 in BCC-or SCC-derived keratinocytes, contrarily to healthy cells. Aimed at rescuing SOCS3 activity in these tumor contexts, a SOCS3-derived peptide, named KIR-ESS, was synthesized, and its ability in suppressing IL-22-induced responses was evaluated in healthy and transformed keratinocytes. We found that KIR-ESS peptide efficiently suppressed the IL-22 molecular signaling in keratinocytes, by acting on STAT3 and Erk1/2 cascade, as well as on the expression of STAT3-dependent downstream genes. Interestingly, after treatment with peptide, both healthy and transformed keratinocytes could no longer aberrantly proliferate and migrate in response to IL-22. Finally, treatment of athymic nude mice bearing SCC xenografts with KIR-ESS peptide concomitantly reduced tumor growth and activated STAT3 levels. As a whole, these data provides the rationale for the use in BCC and SCC skin tumors of SOCS3 mimetics, being able to inhibit the deleterious effects of IL-22 in these contexts.

  7. Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma.

    Science.gov (United States)

    Hasse, S; Duong Tran, T; Hahn, O; Kindler, S; Metelmann, H-R; von Woedtke, T; Masur, K

    2016-03-01

    Over the past few decades, new cold plasma sources have been developed that have the great advantage of operating at atmospheric pressure and at temperatures tolerable by biological material. New applications for these have emerged, especially in the field of dermatology. Recently it was demonstrated that cold atmospheric-pressure plasma positively influences healing of chronic wounds. The potential of cold plasma lies in its capacity to reduce bacterial load in the wound while at the same time stimulating skin cells and therefore promoting wound closure. In recent years, there have been great advances in the understanding of the molecular mechanisms triggered by cold plasma involving signalling pathways and gene regulation in cell culture. To investigate cold plasma-induced effects in ex vivo treated human skin biopsies. Human skin tissue was exposed to cold plasma for different lengths of time, and analysed by immunofluorescence with respect to DNA damage, apoptosis, proliferation and differentiation markers. After cold plasma treatment, the epidermal integrity and keratin expression pattern remained unchanged. As expected, the results revealed an increase in apoptotic cells after 3 and 5 min of treatment. Strikingly, an induction of proliferating basal keratinocytes was detected after cold plasma exposure for 1 and 3 min. As these are the cells that regenerate the epidermis, this could indeed be beneficial for wound closure. We investigated the effect of cold plasma on human skin by detecting molecules for growth and apoptosis, and found that both processes are dependent on treatment time. Therefore, this approach offers promising results for further applications of cold plasma in clinical dermatology. © 2015 British Association of Dermatologists.

  8. Gelatin for purification and proliferation of primary keratinocyte culture for use in chronic wounds and burns.

    Science.gov (United States)

    Rahsaz, Marjan; Geramizadeh, Bita; Kaviani, Maryam; Marzban, Saeed

    2015-04-01

    Human epidermal keratinocytes are currently established as a treatment for burns and wounds and have laboratory applications. Keratinocyte culture contamination by unwanted cells and inhibition of cell proliferation are barriers in primary keratinocyte culture. According to the recent literature, these cells are hard to culture. The present study was conducted to evaluate the efficacy of gelatin-coated surfaces in keratinocyte cultures. After enzymatic isolation of keratinocytes from normal epidermis by trypsin, the cells were cultured on gelatin-coated flasks in serum-free medium. Another group of cells were cultured as a control group without gelatin coating. We showed positive effects of surface coating with gelatin on the primary culture of keratinocytes. Culture of these cells on a gelatincoated surface showed better proliferation with suitable morphology. By using gelatin, adhesion of these cells to the surface was more efficient and without contamination by small round cells. Successful primary culture of keratinocytes on a gelatin-coated surface may provide better yield and optimal number of cells for research and clinical applications.

  9. Mesenchymal stem cell-conditioned medium accelerates skin wound healing: An in vitro study of fibroblast and keratinocyte scratch assays

    International Nuclear Information System (INIS)

    Walter, M.N.M.; Wright, K.T.; Fuller, H.R.; MacNeil, S.; Johnson, W.E.B.

    2010-01-01

    We have used in vitro scratch assays to examine the relative contribution of dermal fibroblasts and keratinocytes in the wound repair process and to test the influence of mesenchymal stem cell (MSC) secreted factors on both skin cell types. Scratch assays were established using single cell and co-cultures of L929 fibroblasts and HaCaT keratinocytes, with wound closure monitored via time-lapse microscopy. Both in serum supplemented and serum free conditions, wound closure was faster in L929 fibroblast than HaCaT keratinocyte scratch assays, and in co-culture the L929 fibroblasts lead the way in closing the scratches. MSC-CM generated under serum free conditions significantly enhanced the wound closure rate of both skin cell types separately and in co-culture, whereas conditioned medium from L929 or HaCaT cultures had no significant effect. This enhancement of wound closure in the presence of MSC-CM was due to accelerated cell migration rather than increased cell proliferation. A number of wound healing mediators were identified in MSC-CM, including TGF-β1, the chemokines IL-6, IL-8, MCP-1 and RANTES, and collagen type I, fibronectin, SPARC and IGFBP-7. This study suggests that the trophic activity of MSC may play a role in skin wound closure by affecting both dermal fibroblast and keratinocyte migration, along with a contribution to the formation of extracellular matrix.

  10. Proliferation of Keratinocytes Induced by Adipose-Derived Stem Cells on a Chitosan Scaffold and Its Role in Wound Healing, a Review

    Directory of Open Access Journals (Sweden)

    Sankaralakshmi Gomathysankar

    2014-09-01

    Full Text Available In the field of tissue engineering and reconstruction, the development of efficient biomaterial is in high demand to achieve uncomplicated wound healing. Chronic wounds and excessive scarring are the major complications of tissue repair and, as this inadequate healing continues to increase, novel therapies and treatments for dysfunctional skin repair and reconstruction are important. This paper reviews the various aspects of the complications related to wound healing and focuses on chitosan because of its unique function in accelerating wound healing. The proliferation of keratinocytes is essential for wound closure, and adipose-derived stem cells play a significant role in wound healing. Thus, chitosan in combination with keratinocytes and adipose-derived stem cells may act as a vehicle for delivering cells, which would increase the proliferation of keratinocytes and help complete recovery from injuries.

  11. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration.

    Science.gov (United States)

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther

    2016-08-11

    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections.

  12. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  13. Electrospun tilapia collagen nanofibers accelerating wound healing via inducing keratinocytes proliferation and differentiation.

    Science.gov (United States)

    Zhou, Tian; Wang, Nanping; Xue, Yang; Ding, Tingting; Liu, Xin; Mo, Xiumei; Sun, Jiao

    2016-07-01

    The development of biomaterials with the ability to induce skin wound healing is a great challenge in biomedicine. In this study, tilapia skin collagen sponge and electrospun nanofibers were developed for wound dressing. The collagen sponge was composed of at least two α-peptides. It did not change the number of spleen-derived lymphocytes in BALB/c mice, the ratio of CD4(+)/CD8(+) lymphocytes, and the level of IgG or IgM in Sprague-Dawley rats. The tensile strength and contact angle of collagen nanofibers were 6.72±0.44MPa and 26.71±4.88°, respectively. They also had good thermal stability and swelling property. Furthermore, the nanofibers could significantly promote the proliferation of human keratinocytes (HaCaTs) and stimulate epidermal differentiation through the up-regulated gene expression of involucrin, filaggrin, and type I transglutaminase in HaCaTs. The collagen nanofibers could also facilitate rat skin regeneration. In the present study, electrospun biomimetic tilapia skin collagen nanofibers were succesfully prepared, were proved to have good bioactivity and could accelerate rat wound healing rapidly and effectively. These biological effects might be attributed to the biomimic extracellular matrix structure and the multiple amino acids of the collagen nanofibers. Therefore, the cost-efficient tilapia collagen nanofibers could be used as novel wound dressing, meanwhile effectively avoiding the risk of transmitting animal disease in the future clinical apllication. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Effect of gamma-hydroxybutyrate on keratinocytes proliferation: A preliminary prospective controlled study in severe burn patients

    Science.gov (United States)

    Rousseau, Anne-Françoise; Bargues, Laurent; Bever, Hervé Le; Vest, Philippe; Cavalier, Etienne; Ledoux, Didier; Piérard, Gérald E.; Damas, Pierre

    2014-01-01

    Background: Hypermetabolism and hyposomatotropism related to severe burns lead to impaired wound healing. Growth hormone (GH) boosts wound healing notably following stimulation of the production of insulin-like growth factor-1 (IGF1), a mitogen factor for keratinocytes. Gamma-hydroxybutyrate (GHB) stimulates endogenous GH secretion. Aim: To assess effects of GHB sedation on keratinocytes proliferation (based on immunohistochemical techniques). Design: Monocentric, prospective, controlled trial. Materials and Methods: Patients (aging 18-65 years, burn surface area >30%, expected to be sedated for at least one month) were alternately allocated, at the 5th day following injury, in three groups according to the intravenous GHB dose administered for 21 days: Evening bolus of 50 mg/kg (Group B), continuous infusion at the rate of 10 mg/kg/h (Group C), or absence of GHB (Group P). They all received local standard cares. Immunohistochemistry (Ki67/MIB-1, Ulex europaeus agglutinin-1 and Mac 387 antibodies) was performed at D21 on adjacent unburned skin sample for assessing any keratinocyte activation. Serum IGF1 levels were measured at initiation and completion of the protocol. Statistical Analysis: Categorical variables were compared with Chi-square test. Comparisons of medians were made using Kruskal-Wallis test. Post hoc analyses were performed using Mann-Whitney test with Bonferroni correction for multiple comparisons. A P study (Group B: n = 5, Group C: n = 5, Group P: n = 4). Continuous administration of GHB was associated with a significant higher Ki67 immunolabeling at D21 (P = 0.049) and with a significant higher increase in the IGF1 concentrations at D21 (P = 0.024). No adverse effects were disclosed. Conclusions: Our preliminary data support a positive effect of GHB on keratinocyte proliferation and are encouraging enough to warrant large prospective studies. PMID:25024938

  15. Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

    Science.gov (United States)

    Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

    2012-04-01

    For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

  16. Cdc42 expression in keratinocytes is required for the maintenance of the basement membrane in skin

    DEFF Research Database (Denmark)

    Wu, Xunwei; Quondamatteo, Fabio; Brakebusch, Cord

    2006-01-01

    , structure and number of hemidesomosomes were not significantly changed in the Cdc42 mutant skin compared with the control mice and no blister formation was observed in mutant skin. These data indicate that Cdc42 in keratinocytes is important for maintenance of the basement membrane of skin....... process, which requires directed secretion, deposition and organization of basement membrane components at the basal side of epithelial cells. In the current study, we analyzed the maintenance of skin basement membrane in mice with a keratinocyte-restricted deletion of the Cdc42 gene. In the absence...

  17. Low levels of glutathione are sufficient for survival of keratinocytes after UV irradiation and for healing of mouse skin wounds.

    Science.gov (United States)

    Telorack, Michèle; Abplanalp, Jeannette; Werner, Sabine

    2016-08-01

    Reduced levels of the cellular antioxidant glutathione are associated with premature skin aging, cancer and impaired wound healing, but the in vivo functions of glutathione in the skin remain largely unknown. Therefore, we analyzed mice lacking the modifier subunit of the glutamate cysteine ligase (Gclm), the enzyme that catalyzes the rate-limiting step of glutathione biosynthesis. Glutathione levels in the skin of these mice were reduced by 70 %. However, neither skin development and homeostasis, nor UVA- or UVB-induced apoptosis in the epidermis were affected. Histomorphometric analysis of excisional wounds did not reveal wound healing abnormalities in young Gclm-deficient mice, while the area of hyperproliferative epithelium as well as keratinocyte proliferation were affected in aged mice. These findings suggest that low levels of glutathione are sufficient for wound repair in young mice, but become rate-limiting upon aging.

  18. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  19. RIP2: A novel player in the regulation of keratinocyte proliferation and cutaneous wound repair?

    International Nuclear Information System (INIS)

    Adams, Stephanie; Valchanova, Ralitsa S.; Munz, Barbara

    2010-01-01

    We could recently demonstrate an important role of receptor interacting protein 4 (RIP4) in the regulation of keratinocyte differentiation. Now, we analyzed a potential role of the RIP4 homolog RIP2 in keratinocytes. Specifically, we demonstrate here that rip2 expression is induced by scratch-wounding and after the induction of differentiation in these cells. Furthermore, serum growth factors and cytokines can induce rip2, with TNF-α-dependent induction being dependent on p38 MAPK. In addition, we demonstrate that scratch-induced upregulation of rip2 expression is completely blocked by the steroid dexamethasone. Since we also show that RIP2 is an important player in the regulation of keratinocyte proliferation, these data suggest that inhibition of rip2 upregulation after wounding might contribute to the reduced and delayed wound re-epithelialization phenotype seen in glucocorticoid-treated patients.

  20. Synthesis and biological activity of M6-P and M6-P analogs on fibroblast and keratinocyte proliferation.

    Science.gov (United States)

    Clavel, Caroline; Barragan-Montero, Véronique; Garric, Xavier; Molès, Jean-Pierre; Montero, Jean-Louis

    2005-09-01

    A new synthetic route to obtain the carboxylate analog of mannose 6-phosphate (M6-P) is presented. The effects of the M6-P, the carboxylate and two other analogs (the phosphonate and the alpha,beta ethylenic carboxylate) on the proliferation of human keratinocytes and dermal fibroblasts as well as on the proliferation of a murine fibroblast cell line, 3T3-J2 are tested. We observed that M6-P is a potent inhibitor of proliferation of both fibroblasts and keratinocytes. Among its analogs, the phosphonate showed a similar effect on human dermal fibroblasts but not on keratinocytes.

  1. Aldefluor protocol to sort keratinocytes stem cells from skin

    OpenAIRE

    Noronha, Samuel Marcos Ribeiro; Gragnani, Alfredo; Pereira, Thiago Antônio Calado; Correa, Silvana Aparecida Alves; Bonucci, Jessica; Ferreira, Lydia Masako

    2017-01-01

    Abstract Purpose: To investigate the use Aldefluor® and N, N - Dimethylaminobenzaldehyde (DEAB) to design a protocol to sort keratinocyte stem cells from cultured keratinocytes from burned patients. Methods: Activated Aldefluor® aliquots were prepared and maintained at temperature between 2 to 8°C, or stored at -20°C. Next, the cells were collected following the standard protocol of sample preparation. Results: Best results were obtained with Aldefluor® 1.5µl and DEAB 15 µl for 1 x 106 c...

  2. Isolation, identification, and pathological effects of beach sand bacterial extract on human skin keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Fazli Subhan

    2018-01-01

    Full Text Available Background Beaches are recreational spots for people. However, beach sand contains harmful microbes that affect human health, and there are no established methods for either sampling and identifying beach-borne pathogens or managing the quality of beach sand. Method This study was conducted with the aim of improving human safety at beaches and augmenting the quality of the beach experience. Beach sand was used as a resource to isolate bacteria due to its distinctive features and the biodiversity of the beach sand biota. A selected bacterial isolate termed FSRS was identified as Pseudomonas stutzeri using 16S rRNA sequencing and phylogenetic analysis, and the sequence was deposited in the NCBI GenBank database under the accession number MF599548. The isolated P. stutzeri bacterium was cultured in Luria–Bertani growth medium, and a crude extract was prepared using ethyl acetate to examine the potential pathogenic effect of P. stutzeri on human skin. A human skin keratinocyte cell line (HaCaT was used to assess cell adhesion, cell viability, and cell proliferation using a morphological analysis and a WST-1 assay. Result The crude P. stutzeri extract inhibited cell adhesion and decreased cell viability in HaCaT cells. We concluded that the crude extract of P. stutzeri FSRS had a strong pathological effect on human skin cells. Discussion Beach visitors frequently get skin infections, but the exact cause of the infections is yet to be determined. The beach sand bacterium P. stutzeri may, therefore, be responsible for some of the dermatological problems experienced by people visiting the beach.

  3. Allogeneic cultured keratinocytes vs. cadaveric skin to cover wide-mesh autogenous split-thickness skin grafts.

    Science.gov (United States)

    Monstrey, S; Beele, H; Kettler, M; Van Landuyt, K; Blondeel, P; Matton, G; Naeyaert, J M

    1999-09-01

    Improved shock therapy has extended the limits of survival in patients with massive burns, and nowadays skin coverage has become the major problem in burn management. The use of mesh skin grafts is still the simplest technique to expand the amount of available donor skin. However, very wide-mesh skin grafts take a very long time to heal, often resulting in unaesthetic scar formation. On the other hand, allogeneic cultured keratinocytes have been reported as a natural source of growth factors and thus could be useful to improve wound healing of these wide-mesh grafts. A clinical study was performed to compare the use of cryopreserved allogeneic cultured keratinocytes vs. the traditional cadaveric skin as a double layer over widely expanded autogenous skin grafts. This procedure was performed in 18 pairs of full-thickness burn wounds (with similar depth and location) in 11 severely burned patients. Early clinical evaluation was made at 2, 3, and 4 to 5 weeks. Parameters such as epithelialization, granulation tissue formation, infection, and scar formation were evaluated. Biopsies were taken to compare the histological characteristics of the epidermis, the epidermal-dermal junction, and the dermis. Late evaluations were performed at 6 and 12 months regarding color, softness, thickness, and subjective feeling of the scar tissue. Aside from a faster (p keratinocyte group at 2 weeks, there were no statistically different results in any of the early evaluated parameters, neither clinically nor histologically. At long-term follow-up, clinical results and scar characteristics were not significantly different in the two compared groups. It is concluded from the results of this study that, during the early phase, epithelialization was faster with allogeneic cultured keratinocytes compared with cadaveric skin. However, taking into account the substantial difference in costs, the described use of cryopreserved allogeneic cultured keratinocytes as a double layer on meshed

  4. Platelet-rich plasma (PRP) and adipose-derived mesenchymal stem cells: stimulatory effects on proliferation and migration of fibroblasts and keratinocytes in vitro.

    Science.gov (United States)

    Stessuk, Talita; Puzzi, Maria Beatriz; Chaim, Elinton Adami; Alves, Paulo César Martins; de Paula, Erich Vinicius; Forte, Andresa; Izumizawa, Juliana Massae; Oliveira, Carolina Caliári; Frei, Fernando; Ribeiro-Paes, João Tadeu

    2016-09-01

    The clinical use of tissue engineering associated with cell therapy is considered a new alternative therapy for the repair of chronic lesions with potential application in different medical areas, mostly in orthopedic and dermatological diseases. Platelet-rich plasma (PRP) is a rich source of growth factors and cytokines important for wound healing. Adipose-derived mesenchymal stem cells (ADSCs) have shown potential to accelerate the resolution of ulcers, to stimulate cell proliferation, and to benefit the quality of skin repair. This study aims to determine the effect of PRP and conditioned medium (CM) from ADSC on fibroblast and keratinocyte proliferation in vitro. Migration and proliferation assays were performed to evaluate the growth of fibroblasts and keratinocytes in the presence of PRP, CM, and CM + PRP. Significant proliferative stimulation was observed after 48 h of culture (p PRP, 100 % CM, and 25 % PRP + 25 % CM, if compared with control. Keratinocyte proliferation was stimulated after 48 h in cultures with 25, 50, and 100 % CM, and growth was compared with controls. The migration assay detected a significant migratory stimulus in fibroblasts cultured with 10 % PRP + 10 % CM after 48 h. These in vitro results suggest that PRP and ADSC have therapeutic potential for healing and re-epithelialization of chronic wounds in vivo.

  5. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  6. Keratinocyte proliferation, differentiation, and apoptosis-Differential mechanisms of regulation by curcumin, EGCG and apigenin

    International Nuclear Information System (INIS)

    Balasubramanian, Sivaprakasam; Eckert, Richard L.

    2007-01-01

    We have proposed that it is important to examine the impact of chemopreventive agents on the function of normal human epidermal keratinocytes since these cells comprise the barrier that protects the body from a range of environmental insults. In this context, it is widely appreciated that cancer may be retarded by consumption or topical application of naturally occurring food-derived chemopreventive agents. Our studies show that (-)-epigallocatechin-3-gallate (EGCG), a green tea-derived polyphenol, acts to enhance the differentiation of normal human keratinocytes as evidenced by its ability to increase involucrin (hINV), transglutaminase type 1 (TG1) and caspase-14 gene expression. EGCG also stimulates keratinocyte morphological differentiation. These actions of EGCG are mediated via activation of a nPKC, Ras, MEKK1, MEK3, p38δ-ERK1/2 signaling cascade which leads to increased activator protein 1 (AP1) and CAATT enhancer binding protein (C/EBP) transcription factor expression, increased binding of these factors to DNA, and increased gene transcription. In contrast, apigenin, a dietary flavonoid derived from plants and vegetables, and curcumin, an agent derived from turmeric, inhibit differentiation by suppressing MAPK signal transduction and reducing API transcription factor level. Curcumin also acts to enhance apoptosis, although EGCG and apigenin do not stimulate apoptosis. In addition, all of these agents inhibit keratinocyte proliferation. These findings indicate that each of these diet-derived chemopreventive agents has a profound impact on normal human keratinocyte function and that they operate via distinct and sometimes opposing mechanisms. However, all are expected to act as chemopreventive agents

  7. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  8. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Science.gov (United States)

    Noguchi, Fumihito; Nakajima, Takeshi; Inui, Shigeki; Reddy, Janardan K; Itami, Satoshi

    2014-01-01

    MED1 (Mediator complex subunit 1) is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/-)) that develop epidermal hyperplasia. Herein, to investigate the function(s) of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/-) and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/-) mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/-) mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/-) keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/-) keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/-) keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/-) keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/-) mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/-) mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/-) mice, indicating a decreased contribution of hair

  9. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Directory of Open Access Journals (Sweden)

    Fumihito Noguchi

    Full Text Available MED1 (Mediator complex subunit 1 is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/- that develop epidermal hyperplasia. Herein, to investigate the function(s of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/- and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/- mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/- mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/- keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/- keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/- keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/- keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/- mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/- mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/- mice, indicating a decreased contribution of hair

  10. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  11. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  12. Elevated YAP and its downstream targets CCN1 and CCN2 in basal cell carcinoma: impact on keratinocyte proliferation and stromal cell activation.

    Science.gov (United States)

    Quan, Taihao; Xu, Yiru; Qin, Zhaoping; Robichaud, Patrick; Betcher, Stephanie; Calderone, Ken; He, Tianyuan; Johnson, Timothy M; Voorhees, John J; Fisher, Gary J

    2014-04-01

    Yes-associated protein (YAP) is a transcriptional co-activator of hippo signaling pathway, which plays an important role in organ size control and tumorigenesis. Here we report that YAP and its downstream transcriptional targets CCN1 and CCN2 are markedly elevated in keratinocytes in human skin basal cell carcinoma tumor islands. In human keratinocytes, knockdown of YAP significantly reduced expression of CCN1 and CCN2, and repressed proliferation and survival. This inhibition of proliferation and survival was rescued by restoration of CCN1 expression, but not by CCN2 expression. In basal cell carcinoma stroma, CCN2-regulated genes type I collagen, fibronectin, and α-smooth muscle actin were highly expressed. Furthermore, atomic force microscopy revealed increased tissue stiffness in basal cell carcinoma stroma compared to normal dermis. These data provide evidence that up-regulation of YAP in basal cell carcinoma impacts both aberrant keratinocyte proliferation, via CCN1, and tumor stroma cell activation and stroma remodeling, via CCN2. Targeting YAP and/or CCN1 and CCN2 may provide clinical benefit in basal cell carcinoma. Copyright © 2014 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  13. Low-level laser irradiation promotes the proliferation and maturation of keratinocytes during epithelial wound repair

    Science.gov (United States)

    Sperandio, Felipe F.; Simões, Alyne; Corrêa, Luciana; Aranha, Ana Cecília C.; Giudice, Fernanda S.; Hamblin, Michael R.; Sousa, Suzana C.O.M.

    2015-01-01

    Low-level laser therapy (LLLT) has been extensively employed to improve epithelial wound healing, though the exact response of epithelium maturation and stratification after LLLT is unknown. Thus, this study aimed to assess the in vitro growth and differentiation of keratinocytes (KCs) and in vivo wound healing response when treated with LLLT. Human KCs (HaCaT cells) showed an enhanced proliferation with all the employed laser energy densities (3, 6 and 12 J/cm2, 660nm, 100mW), together with an increased expression of Cyclin D1. Moreover, the immunoexpression of proteins related to epithelial proliferation and maturation (p63, CK10, CK14) all indicated a faster maturation of the migrating KCs in the LLLT-treated wounds. In that way, an improved epithelial healing was promoted by LLLT with the employed parameters; this improvement was confirmed by changes in the expression of several proteins related to epithelial proliferation and maturation. PMID:25411997

  14. The effect of keratinocytes on the biomechanical characteristics and pore microstructure of tissue engineered skin using deep dermal fibroblasts.

    Science.gov (United States)

    Varkey, Mathew; Ding, Jie; Tredget, Edward E

    2014-12-01

    Fibrosis affects most organs, it results in replacement of normal parenchymal tissue with collagen-rich extracellular matrix, which compromises tissue architecture and ultimately causes loss of function of the affected organ. Biochemical pathways that contribute to fibrosis have been extensively studied, but the role of biomechanical signaling in fibrosis is not clearly understood. In this study, we assessed the effect keratinocytes have on the biomechanical characteristics and pore microstructure of tissue engineered skin made with superficial or deep dermal fibroblasts in order to determine any biomaterial-mediated anti-fibrotic influences on tissue engineered skin. Tissue engineered skin with deep dermal fibroblasts and keratinocytes were found to be less stiff and contracted and had reduced number of myofibroblasts and lower expression of matrix crosslinking factors compared to matrices with deep fibroblasts alone. However, there were no such differences between tissue engineered skin with superficial fibroblasts and keratinocytes and matrices with superficial fibroblasts alone. Also, tissue engineered skin with deep fibroblasts and keratinocytes had smaller pores compared to those with superficial fibroblasts and keratinocytes; pore size of tissue engineered skin with deep fibroblasts and keratinocytes were not different from those matrices with deep fibroblasts alone. A better understanding of biomechanical characteristics and pore microstructure of tissue engineered skin may prove beneficial in promoting normal wound healing over pathologic healing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Influence of extracellular matrix proteins on human keratinocyte attachment, proliferation and transfer to a dermal wound model.

    Science.gov (United States)

    Dawson, R A; Goberdhan, N J; Freedlander, E; MacNeil, S

    1996-03-01

    The aim of this study was to investigate whether prior culture of cells on ECM proteins might positively influence the performance of keratinocytes when cells are transferred to a dermal in vitro wound bed model. Keratinocytes were cultured using a method for producing cultured epithelial autografts for severely burned patients (essentially using Green's medium, a mitogen-rich medium containing fetal calf serum, cholera toxin, EGF, insulin, transferrin and triiodothyronine). Cells were cultured either on irradiated 3T3 fibroblasts (as in the standard Rheinwald and Green technique) or, alternatively, on collagen I, collagen IV, matrigel, RGD, vitronectin or fibronectin. Under these conditions matrigel, collagen I and IV enhanced initial attachment, RGD, vitronectin, fibronectin and irradiated 3T3 fibroblasts did not. Proliferation of cells was positively influenced by matrigel, collagen I and IV and irradiated 3T3 fibroblasts; of these, however, only matrigel and 3T3 fibroblasts had sustained significant effects on keratinocyte proliferation over 4 days. Cells on fibronectin showed significantly reduced proliferation. An acellular non-viable dermis was then used to mimic the homograft allodermis onto which cultured epithelial autograft sheets are grafted clinically and cells cultured on the various ECM proteins for 96 h were transferred to this in vitro wound model. None of the substrates enhanced keratinocyte performance on this model. It was concluded that under these conditions some ECM proteins can significantly affect keratinocyte attachment and, to a lesser extent, proliferation but that the culture of keratinocytes on these ECM proteins does not appear to confer any lasting benefit to the attachment of these keratinocytes to an in vitro wound-bed model.

  16. Astragaloside IV Downregulates β-Catenin in Rat Keratinocytes to Counter LiCl-Induced Inhibition of Proliferation and Migration

    Directory of Open Access Journals (Sweden)

    Fu-Lun Li

    2012-01-01

    Full Text Available Re-epithelialization is a crucial step towards wound healing. The traditional Chinese medicine, Astragalus membranaceus (Fisch Bge, has been used for hundreds of years for many kinds of ulcerated wounds. Recent research has identified the active compound in this drug as astragaloside IV (AS-IV, but the underlying molecular mechanisms of its therapeutic action on keratinocytes remain poorly understood. In this study, we used an in vitro model of ulcer-like wound processes, lithium chloride (LiCl-induced cultured mouse keratinocytes, to investigate the effects of AS-IV treatment. The effects on cell proliferation were evaluated by the MTS/PMS colorimetric assay, effects on cell migration were determined by a wound-healing scratch experiment, effects on the cell cycle were analyzed by flow cytometry, and effects on protein expression were analyzed by immunoblotting and immunofluorescence. LiCl strongly inhibited cell proliferation and migration, up-regulated β-catenin expression, and down-regulated proliferating cell nuclear antigen (PCNA expression. AS-IV treatment attenuat the inhibition of proliferation and migration, significantly reducing the enhanced β-catenin expression, and recovering PCNA and β-tubulin expression. Thus, AS-IV mediates mouse keratinocyte proliferation and migration via regulation of the Wnt signaling pathway. Down-regulating β-catenin to increase keratinocyte migration and proliferation is one mechanism by which AS-IV can promote ulcerated wound healing.

  17. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice

    2015-01-01

    . In comparison, blood -derived in vitro differentiated Th2 cells only induced a weak response in a few of the mice. Thus, we conclude that human AD skin-derived T cells can induce a reaction in mouse skin through induction of a proliferative response in the mouse keratinocytes. This article is protected......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  18. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    International Nuclear Information System (INIS)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao

    1996-01-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0 o C for 20 min and at 5 o C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0 o C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0 o C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author)

  19. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao [Hirosaki Univ., Aomori (Japan). School of Medicine

    1996-12-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0{sup o}C for 20 min and at 5{sup o}C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0{sup o}C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0{sup o}C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author).

  20. Keratinocytes from APP/APLP2-deficient mice are impaired in proliferation, adhesion and migration in vitro

    International Nuclear Information System (INIS)

    Siemes, Christina; Quast, Thomas; Kummer, Christiane; Wehner, Sven; Kirfel, Gregor; Mueller, Ulrike; Herzog, Volker

    2006-01-01

    Growing evidence shows that the soluble N-terminal form (sAPPα) of the amyloid precursor protein (APP) represents an epidermal growth factor fostering keratinocyte proliferation, migration and adhesion. APP is a member of a protein family including the two mammalian amyloid precursor-like proteins APLP1 and APLP2. In the mammalian epidermis, only APP and APLP2 are expressed. APP and APLP2-deficient mice die shortly after birth but do not display a specific epidermal phenotype. In this report, we investigated the epidermis of APP and/or APLP2 knockout mice. Basal keratinocytes showed reduced proliferation in vivo by about 40%. Likewise, isolated keratinocytes exhibited reduced proliferation rates in vitro, which could be completely rescued by either exogenously added recombinant sAPPα, or by co-culture with dermal fibroblasts derived from APP knockout mice. Moreover, APP-knockout keratinocytes revealed reduced migration velocity resulting from severely compromised cell substrate adhesion. Keratinocytes from double knockout mice died within the first week of culture, indicating essential functions of APP-family members for survival in vitro. Our data indicate that sAPPα has to be considered as an essential epidermal growth factor which, however, in vivo can be functionally compensated to a certain extent by other growth factors, e.g., factors released from dermal fibroblasts

  1. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  2. Human lactoferrin stimulates skin keratinocyte function and wound re-epithelialization.

    Science.gov (United States)

    Tang, L; Wu, J J; Ma, Q; Cui, T; Andreopoulos, F M; Gil, J; Valdes, J; Davis, S C; Li, J

    2010-07-01

    Human lactoferrin (hLF), a member of the transferrin family, is known for its antimicrobial and anti-inflammatory effects. Recent studies on various nonskin cell lines indicate that hLF may have a stimulatory effect on cell proliferation. To study the potential role of hLF in wound re-epithelialization. The effects of hLF on cell growth, migration, attachment and survival were assessed, with a rice-derived recombinant hLF (holo-rhLF), using proliferation analysis, scratch migration assay, calcein-AM/propidium iodide staining and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) method, respectively. The mechanisms of hLF on cell proliferation and migration were explored using specific pathway inhibitors. The involvement of lactoferrin receptor low-density lipoprotein receptor-related protein 1 (LRP1) was examined with RNA interference technique. An in vivo swine second-degree burn wound model was also used to assess wound re-epithelialization. Studies revealed that holo-rhLF significantly stimulated keratinocyte proliferation which could be blocked by mitogen-activated protein kinase (MAPK) kinase 1 inhibitor. Holo-rhLF also showed strong promoting effects on keratinocyte migration, which could be blocked by either inhibition of the MAPK, Src and Rho/ROCK pathways, or downregulation of the LRP1 receptor. With cells under starving or 12-O-tetradecanoylphorbol-13-acetate exposure, the addition of holo-rhLF was found greatly to increase cell viability and inhibit cell apoptosis. Additionally, holo-rhLF significantly increased the rate of wound re-epithelialization in swine second-degree burn wounds. Our studies demonstrate the direct effects of holo-rhLF on wound re-epithelialization including the enhancement of keratinocyte proliferation and migration as well as the protection of cells from apoptosis. The data strongly indicate its potential therapeutic applications in wound healing.

  3. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  4. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert

    2012-01-01

    Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by a...

  5. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...... cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...

  6. Indian Hedgehog Controls Proliferation and Differentiation in Skin Tumorigenesis and Protects against Malignant Progression

    Directory of Open Access Journals (Sweden)

    Parisa Kakanj

    2013-07-01

    Full Text Available Mutations in the hedgehog pathway drive the formation of tumors in many different organs, including the development of basal cell carcinoma in the skin. However, little is known about the role of epidermal Indian hedgehog (Ihh in skin physiology. Using mouse genetics, we identified overlapping and distinct functions of Ihh in different models of epidermal tumorigenesis. Epidermal deletion of Ihh resulted in increased formation of benign squamous papilloma. Strikingly, Ihh-deficient mice showed an increase in malignant squamous cell carcinoma and developed lung and lymph node metastases. In a sebaceous gland tumor model, Ihh deficiency inhibited tumor cell differentiation. More mechanistically, IHH stimulated cell proliferation by activating the transcription factor GLI2 in human keratinocytes and human tumors. Thus, our results uncover important functions for Ihh signaling in controlling proliferation, differentiation, malignant progression, and metastasis of epithelial cancer, establishing Ihh as a gatekeeper for controlling the grade of tumor malignancy.

  7. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  8. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  9. Growth of various cell types in the presence of lactic and glycolic acids: the adverse effect of glycolic acid released from PLAGA copolymer on keratinocyte proliferation.

    Science.gov (United States)

    Garric, Xavier; Molès, Jean-Pierre; Garreau, Henri; Braud, Christian; Guilhou, Jean-Jacques; Vert, Michel

    2002-01-01

    Poly(alpha-hydroxy-acid)s derived from lactic acid (LA) and glycolic acid (GA) are bioresorbable polymers that are currently used in human surgery and in pharmacology to make temporary therapeutic devices. Nowadays, increasing attention is paid to these polymers in the field of tissue engineering. However, the literature shows that a large number of factors can affect many of their properties and the responses of biological systems. As part of our investigation of the biocompatibility of degradable aliphatic polyesters, the effects of LA and GA on the proliferation of various cells under in vitro cell culture conditions were studied. The release of LA and GA from films made of a copolymer synthesized by the zinc lactate method and composed of 37.5% L-lactyl, 37.5% D-lactyl, and 25% glycolyl repeating units was first investigated over a period of 30 days under abiotic conditions in a cell culture medium in order to identify a range of acid concentrations consistent with releases to be expected in real cell cultures. Four cell lines, namely 3T3-J2, C3H10(1/2), A431, and HaCat, and three primary cell cultures, namely rat endothelial cells, rat smooth muscle cells, and human dermal fibroblasts, were then allowed to grow in the presence of LA and GA at various concentrations taken within the selected 10-1000 mg/cm3 range. Little or no effect was observed on the proliferation of all cells except human keratinocytes, whose growth was dramatically inhibited by GA at concentrations as low as 10 mg/cm3. The inhibiting effect of GA was confirmed by considering the growth of keratinocytes on films made of the same copolymer, in comparison with poly(DL-lactic acid) and polystyrene taken as references. This work shows that GA-releasing degradable matrices are not adapted to the culture of keratinocytes with the aim of making skin grafts.

  10. Sacha Inchi Oil (Plukenetia volubilis L.), effect on adherence of Staphylococus aureus to human skin explant and keratinocytes in vitro.

    Science.gov (United States)

    Gonzalez-Aspajo, German; Belkhelfa, Haouaria; Haddioui-Hbabi, Laïla; Bourdy, Geneviève; Deharo, Eric

    2015-08-02

    Plukenetia volubilis L. (Euphorbiaceae) is a domesticated vine distributed from the high-altitude Andean rain forest to the lowlands of the Peruvian Amazon. Oil from the cold-pressed seeds, sold under the commercial name of Sacha Inchi Oil (SIO) is actually much in favour because it contains a high percentage of omega 3 and omega 6, and is hence used as a dietary supplement. SIO is also used traditionally for skin care, in order to maintain skin softness, and for the treatment of wounds, insect bites and skin infections, in a tropical context where the skin is frequently damaged. This study was designed in order to verify whether the traditional use of SIO for skin care would have any impact on Staphylococcus aureus growth and skin adherence, as S. aureus is involved in many skin pathologies (impetigo, folliculitis, furuncles and subcutaneous abscesses) being one if the main pathogens that can be found on the skin. Therefore, our objective was to assess SIO bactericidal activity and interference with adherence to human skin explants and the keratinocyte cell line. Cytotoxicity on that cells was also determined. The activity of SIO was compared to coconut oil (CocO), which is widely used for skin care but has different unsaturated fatty acids contents. Laboratory testing with certified oil, determined antibacterial activity against radio labelled S. aureus. Cytotoxic effects were measured with XTT on keratinocyte cells and with neutral red on human skin explants; phenol was used as cytotoxic control. Adherence assays were carried out by mixing H3-labelled S. aureus bacteria with keratinocyte cells and human skin explants, incubated with oils 2h before (to determine the inhibition of adherence, assimilated to a preventive effect) or 2h after the contact of the biological material with S. aureus (to assess the detachment of the bacteria, assimilated to a curative effect). Residual radioactivity measured after washings made it possible to determine the adherence

  11. Dysregulation of suppressor of cytokine signaling 3 in keratinocytes causes skin inflammation mediated by interleukin-20 receptor-related cytokines.

    Directory of Open Access Journals (Sweden)

    Ayako Uto-Konomi

    Full Text Available Homeostatic regulation of epidermal keratinocytes is controlled by the local cytokine milieu. However, a role for suppressor of cytokine signaling (SOCS, a negative feedback regulator of cytokine networks, in skin homeostasis remains unclear. Keratinocyte specific deletion of Socs3 (Socs3 cKO caused severe skin inflammation with hyper-production of IgE, epidermal hyperplasia, and S100A8/9 expression, although Socs1 deletion caused no inflammation. The inflamed skin showed constitutive STAT3 activation and up-regulation of IL-6 and IL-20 receptor (IL-20R related cytokines, IL-19, IL-20 and IL-24. Disease development was rescued by deletion of the Il6 gene, but not by the deletion of Il23, Il4r, or Rag1 genes. The expression of IL-6 in Socs3 cKO keratinocytes increased expression of IL-20R-related cytokines that further facilitated STAT3 hyperactivation, epidermal hyperplasia and neutrophilia. These results demonstrate that skin homeostasis is strictly regulated by the IL-6-STAT3-SOCS3 axis. Moreover, the SOCS3-mediated negative feedback loop in keratinocytes has a critical mechanistic role in the prevention of skin inflammation caused by hyperactivation of STAT3.

  12. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  13. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  14. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    Science.gov (United States)

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  15. Performance of a novel keratinocyte-based reporter cell line to screen skin sensitizers in vitro

    International Nuclear Information System (INIS)

    Emter, Roger; Ellis, Graham; Natsch, Andreas

    2010-01-01

    In vitro tests are needed to replace animal tests to screen for the skin sensitization potential of chemicals. Skin sensitizers are electrophilic molecules and the Nrf2-electrophile-sensing pathway comprising the repressor protein Keap1, the transcription factor Nrf2 and the antioxidant response element (ARE) is emerging as a toxicity pathway induced by skin sensitizers. Previously, we screened a large set of chemicals in the reporter cell line AREc32, which contains an eight-fold repeat of the rat GSTA2 ARE-sequence upstream of a luciferase reporter gene in the human breast cancer cell line MCF7. This approach was now further developed to bring it closer to the conditions in the human skin and to propose a fully standardized assay. To this end, a luciferase reporter gene under control of a single copy of the ARE-element of the human AKR1C2 gene was stably inserted into HaCaT keratinocytes. A standard operating procedure was developed whereby chemicals are routinely tested at 12 concentrations in triplicate for significant induction of gene activity. We report results from this novel assay on (i) a list of reference chemicals published by ECVAM, (ii) the ICCVAM list of chemicals for validation of alternative endpoints in the LLNA and (iii) on a more general list of 67 chemicals derived from the ICCVAM database. For comparison, peptide reactivity data are presented for the same chemicals. The results indicate a good predictive value of this approach for hazard identification. Its technical simplicity, the high-throughput format and the good predictivity may make this assay a candidate for rapid validation to meet the tight deadline to replace animal tests for skin sensitization by 2013 set by the European authorities.

  16. The Benefit of Microskin in Combination With Autologous Keratinocyte Suspension to Treat Full Skin Loss In Vivo.

    Science.gov (United States)

    Yuru, Shang; Dawei, Li; Chuanan, Shen; Kai, Yin; Li, Ma; Longzhu, Li; Dongxu, Zhao; Wenfeng, Cheng

    Patients with extensive deep burns often lack enough autologous skin to cover the wounds. This study explores a new method using microskin in combination with autologous keratinocytes in the treatment of extensive deep burn. Wounds in the combination group were treated with automicroskin at an area expansion ratio of 20:1 (wound area to automicroskin area) and autologous keratinocyte suspension, which were compared with the following treatments: no autotransplant, only allografts (control group); autologous keratinocyte suspension only (keratinocyte only group); automicroskin at an area expansion ratio of 20:1 (20:1 group); and automicroskin at an area expansion ratio of 10:1 (10:1 group, positive control). The authors used epithelialization rate (epithelialized area on day 21 divided by original wound area), hematoxylin and eosin staining, laminin, and type IV collagen immunohistochemistry to assess wound healing. The epithelialization rate of combination group (74.2% ± 8.0%) was similar to that of 10: 1 group (84.3% ± 11.9%, P = .085) and significantly (P < .05) higher than that of 20:1 group (59.2% ± 10.8%), keratinocyte only group (53.8% ± 11.5%), and control group (22.7% ± 5.5%). The hematoxylin and eosin staining and immunohistochemistry showed the epithelialization in the combination group was better than that in the keratinocyte only group and control group. Microskin in combination with autologous keratinocyte suspension can promote the reepithelialization of full-thickness wounds and reduce the requirements for automircoskin, and it is a useful option in the treatment of extensive deep burns.

  17. Full-thickness skin wound healing using autologous keratinocytes and dermal fibroblasts with fibrin: bilayered versus single-layered substitute.

    Science.gov (United States)

    Idrus, Ruszymah Bt Hj; Rameli, Mohd Adha bin P; Low, Kiat Cheong; Law, Jia Xian; Chua, Kien Hui; Latiff, Mazlyzam Bin Abdul; Saim, Aminuddin Bin

    2014-04-01

    Split-skin grafting (SSG) is the gold standard treatment for full-thickness skin defects. For certain patients, however, an extensive skin lesion resulted in inadequacies of the donor site. Tissue engineering offers an alternative approach by using a very small portion of an individual's skin to harvest cells for propagation and biomaterials to support the cells for implantation. The objective of this study was to determine the effectiveness of autologous bilayered tissue-engineered skin (BTES) and single-layer tissue-engineered skin composed of only keratinocytes (SLTES-K) or fibroblasts (SLTES-F) as alternatives for full-thickness wound healing in a sheep model. Full-thickness skin biopsies were harvested from adult sheep. Isolated fibroblasts were cultured using medium Ham's F12: Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum, whereas the keratinocytes were cultured using Define Keratinocytes Serum Free Medium. The BTES, SLTES-K, and SLTES-F were constructed using autologous fibrin as a biomaterial. Eight full-thickness wounds were created on the dorsum of the body of the sheep. On 4 wounds, polyvinyl chloride rings were used as chambers to prevent cell migration at the edge. The wounds were observed at days 7, 14, and 21. After 3 weeks of implantation, the sheep were euthanized and the skins were harvested. The excised tissues were fixed in formalin for histological examination via hematoxylin-eosin, Masson trichrome, and elastin van Gieson staining. The results showed that BTES, SLTES-K, and SLTES-F promote wound healing in nonchambered and chambered wounds, and BTES demonstrated the best healing potential. In conclusion, BTES proved to be an effective tissue-engineered construct that can promote the healing of full-thickness skin lesions. With the support of further clinical trials, this procedure could be an alternative to SSG for patients with partial- and full-thickness burns.

  18. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  19. Amniotic Membrane Modifies the Genetic Program Induced by TGFß, Stimulating Keratinocyte Proliferation and Migration in Chronic Wounds.

    Directory of Open Access Journals (Sweden)

    Antonia Alcaraz

    Full Text Available Post-traumatic large-surface or deep wounds often cannot progress to reepithelialisation because they become irresponsive in the inflammatory stage, so intervention is necessary to provide the final sealing epidermis. Previously we have shown that Amniotic Membrane (AM induced a robust epithelialisation in deep traumatic wounds.To better understand this phenomenon, we used keratinocytes to investigate the effect of AM on chronic wounds. Using keratinocytes, we saw that AM treatment is able to exert an attenuating effect upon Smad2 and Smad3 TGFß-induced phosphorylation while triggering the activation of several MAPK signalling pathways, including ERK and JNK1, 2. This also has a consequence for TGFß-induced regulation on cell cycle control key players CDK1A (p21 and CDK2B (p15. The study of a wider set of TGFß regulated genes showed that the effect of AM was not wide but very concrete for some genes. TGFß exerted a powerful cell cycle arrest; the presence of AM however prevented TGFß-induced cell cycle arrest. Moreover, AM induced a powerful cell migration response that correlates well with the expression of c-Jun protein at the border of the healing assay. Consistently, the treatment with AM of human chronic wounds induced a robust expression of c-Jun at the wound border.The effect of AM on the modulation of TGFß responses in keratinocytes that favours proliferation together with AM-induced keratinocyte migration is the perfect match that allows chronic wounds to move on from their non-healing state and progress into epithelialization. Our results may explain why the application of AM on chronic wounds is able to promote epithelialisation.

  20. Interleukin-1α Induction in Human Keratinocytes (HaCaT: An In Vitro Model for Chemoprevention in Skin

    Directory of Open Access Journals (Sweden)

    T. Magcwebeba

    2012-01-01

    Full Text Available Long-term exposure to UV irradiation and toxic chemicals is associated with chronic inflammation that contributes to skin cancer development with interleukin-1 alpha (IL-1α, constitutively produced by keratinocytes, playing a pivotal role in skin inflammation. The aim of this study was to investigate the modulation of IL-1α production in the HaCaT keratinocyte cell line. Phorbol 12-myristate 13-acetate failed to induce IL-1α in HaCaT cells, and this might be associated with the specific deficiency known to affect downstream signalling of the MEK/ERK pathway in these cells. The calcium ionophore, ionomycin, slightly enhanced the production of intracellular (icIL-1α, but this resulted in a necrotic release at higher concentrations. UV-B exposure significantly increased the production of icIL-1α in a dose-dependent manner with a maximal induction exhibited at 24 h with minimal necrotic and apoptotic effects. Validation of the HaCaT cell model indicated that the nonsteroidal anti-inflammatory drug (NSAID, ibuprofen, and the glucocorticoid, dexamethasone, inhibited icIL-1α production, and this was associated with a slight inhibition of cell viability. The UV-B-induced keratinocyte cell model provides an in vitro system that could, apart from phorbol ester-like compounds, be utilised as a screening assay in identifying skin irritants and/or therapeutic topical agents via the modulation of IL-1α production.

  1. Tamarind Seed Xyloglucans Promote Proliferation and Migration of Human Skin Cells through Internalization via Stimulation of Proproliferative Signal Transduction Pathways

    Directory of Open Access Journals (Sweden)

    W. Nie

    2013-01-01

    Full Text Available Xyloglucans (XGs of Tamarindus indica L. Fabaceae are used as drug vehicles or as ingredients of cosmetics. Two xyloglucans were extracted from T. indica seed with cold water (TSw and copper complex precipitation (TSc. Both were analyzed in regard to composition and influence on cell viability, proliferation, cell cycle progression, migration, MAPK phosphorylation, and gene expression of human skin keratinocytes (NHEK and HaCaT and fibroblasts (NHDF in vitro. TSw and TSc differed in molecular weight, rhamnose content, and ratios of xylose, arabinose, galactose, and glucose. Both XGs improved keratinocytes and fibroblast proliferation, promoted the cell cycle, and stimulated migration and intracellular enzyme activity of NHDF after endosomal uptake. Only TSw significantly enhanced HaCaT migration and extracellular enzyme activity of NHDF and HaCaT. TSw and TSc predominantly enhanced the phosphorylation of molecules that referred to Erk signaling in NHEK. In NHDF parts of the integrin signaling and SAPK/JNK pathway were affected. Independent of cell type TSw marginally regulated the expression of genes, which referred to membrane proteins, cytoskeleton, cytokine signaling, and ECM as well as to processes of metabolism and transcription. Results show that T. indica xyloglucans promote skin regeneration by a direct influence on cell proliferation and migration.

  2. Portulaca oleracea L. aids calcipotriol in reversing keratinocyte differentiation and skin barrier dysfunction in psoriasis through inhibition of the nuclear factor κB signaling pathway

    Science.gov (United States)

    ZHAO, HENGGUANG; LI, SHUANG; LUO, FULING; TAN, QIAN; LI, HUI; ZHOU, WEIKANG

    2015-01-01

    Psoriasis affects 2–4% of the population worldwide and its treatment is currently far from satisfactory. Calcipotriol and Portulaca oleracea have been reported to exhibit the capacity to inhibit inflammation in psoriatic patients and improve their clinical condition. However, the efficacy of a combination regimen of these two components remains unknown. The aim of the present study was to explore the therapeutic efficacy of P. oleracea extract combined with calcipotriol on plaque psoriasis and its potential mechanism. Eleven patients with plaque psoriasis were treated with humectant containing the active ingredients of P. oleracea extract, with or without 0.005% calcipotriol ointment in a right-left bilateral lesion self-control study. Differences were evaluated by investigation of the clinical efficacy, adverse effects, skin barrier function, histological structure, expression and proliferation of keratinocytes, differentiation markers (cytokeratin 10, filaggrin and loricrin), inflammatory factors [tumor necrosis factor (TNF)-α and interleukin (IL)-8], as well as the status of the nuclear factor κB (NF-κB) pathway. The combination of P. oleracea and calcipotriol was revealed to decrease adverse effects, reduce transepidermal water loss, potently reverse keratinocyte differentiation dysfunction, and inhibit the expression of TNF-α and IL-8 and the phosphorylation of the NF-κB inhibitor IκBα. This treatment is therefore anticipated to be suitable for use as a novel adjuvant therapy for psoriatic patients. PMID:25574190

  3. Ultraviolet-evoked prostaglandin biosynthesis in varying stages of keratinocyte differentiation in guinea pig skin

    Energy Technology Data Exchange (ETDEWEB)

    Karmali, R A; Safai, B

    1984-09-01

    Prostaglandin (PG) production by guinea pig epidermal cells was evaluated at various incubation intervals in normal and UV-exposed cultures. Prostaglandins have been implicated as mediators of the early phase of erythema in skin exposed to sunlight or UV-radiation. Using a density gradient centrifugation procedure, the epidermal cells were fractionated according to the various maturation stages of epidermal keratinocytes: high-density epidermal cells (HDEC) consisting of round, less mature cells; low-density epidermal cells (LDEC) consisting of polygonal keratinized cells; and intermediate-density epidermal cells (IDEC) consisting of both HDEC and LDEC. When cultures of 1 X 10(6) cells were incubated at 37 degrees C in 5% CO/sub 2/ the highest concentrations of five PG moieties measured were present in supernatants from the LDEC cultures as compared to those of IDEC or HDEC. Levels of PGF 2 alpha were much higher than the rest, which were found in the order PGF2 alpha greater than PGE2 greater than PGE1 greater than 6-keto-PGF1 alpha greater than thromboxane (TX)B2. UV-irradiation induced increases in all but TXA2 production. These results identify and quantitate five compounds produced as a result of exaggerated activity of the cyclooxygenase induced by UV-irradiation.

  4. miR-125b inhibits keratinocyte proliferation and promotes keratinocyte apoptosis in oral lichen planus by targeting MMP-2 expression through PI3K/Akt/mTOR pathway.

    Science.gov (United States)

    Wang, Jing; Luo, Hong; Xiao, Yan; Wang, Luyao

    2016-05-01

    Oral lichen planus (OLP) is a chronic inflammatory mucosal disease that involves the degeneration of keratinocytes. However, the etiology and mechanisms of OLP pathogenesis have not been fully elucidated. In this study, we used keratinocytes HaCaT stimulated with lipopolysaccharide (LPS) to mimic a local OLP immune environment, and investigated the regulatory role of miR-125b in keratinocyte proliferation and apoptosis under OLP conditions. Immunohistochemical analysis and quantitative real-time PCR (qRT-PCR) assay showed that MMP-2 expression was up-regulated and miR-125b expression was down-regulated in both OLP mucosa tissues and LPS-incubated HaCaT cells. Western blot analysis indicated that miR-125b overexpression suppressed LPS-induced MMP-2 expression in HaCaT cells. Molecularly, our results confirmed that MMP-2 is a target gene of miR-125b in HaCaT cells. The effect of miR-125b on cell proliferation was revealed by CCK-8 assay, BrdU assay and cell cycle analysis, which illustrated that miR-125b overexpression impeded LPS-induced HaCaT cell proliferation. Flow cytometry analysis further demonstrated that miR-125b overexpression promoted HaCaT cell apoptosis. Moreover, these effects were involved in PI3K/Akt/mTOR activation, as miR-125b overexpression inhibited LPS-enhanced expression of p-Akt and p-mTOR proteins. Taken together, these data confirm that miR-125b might inhibit keratinocyte proliferation and promote keratinocyte apoptosis in OLP pathogenesis by targeting MMP-2 through PI3K/Akt/mTOR pathway. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  5. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

    Science.gov (United States)

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-09-19

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

  6. UVB-induced nuclear translocation of TC-PTP by AKT/14-3-3σ axis inhibits keratinocyte survival and proliferation.

    Science.gov (United States)

    Kim, Mihwa; Morales, Liza D; Baek, Minwoo; Slaga, Thomas J; DiGiovanni, John; Kim, Dae Joon

    2017-10-31

    Understanding protein subcellular localization is important to determining the functional role of specific proteins. T-cell protein tyrosine phosphatase (TC-PTP) contains bipartite nuclear localization signals (NLSI and NLSII) in its C-terminus. We previously have demonstrated that the nuclear form of TC-PTP (TC45) is mainly localized to the cytoplasm in keratinocytes and it is translocated to the nucleus following UVB irradiation. Here, we report that TC45 is translocated by an AKT/14-3-3σ-mediated mechanism in response to UVB exposure, resulting in increased apoptosis and decreased keratinocyte proliferation. We demonstrate that UVB irradiation increased phosphorylation of AKT and induced nuclear translocation of 14-3-3σ and TC45. However, inhibition of AKT blocked nuclear translocation of TC45 and 14-3-3σ. Site-directed mutagenesis of 14-3-3σ binding sites within TC45 showed that a substitution at Threonine 179 (TC45/T179A) effectively blocked UVB-induced nuclear translocation of ectopic TC45 due to the disruption of the direct binding between TC45 and 14-3-3σ. Overexpression of TC45/T179A in keratinocytes resulted in a decrease of UVB-induced apoptosis which corresponded to an increase in nuclear phosphorylated STAT3, and cell proliferation was higher in TC45/T179A-overexpressing keratinocytes compared to control keratinocytes following UVB irradiation. Furthermore, deletion of TC45 NLSII blocked its UVB-induced nuclear translocation, indicating that both T179 and NLSII are required. Taken together, our findings suggest that AKT and 14-3-3σ cooperatively regulate TC45 nuclear translocation in a critical step of an early protective mechanism against UVB exposure that signals the deactivation of STAT3 in order to promote keratinocyte cell death and inhibit keratinocyte proliferation.

  7. Comparative study of human-induced pluripotent stem cells derived from bone marrow cells, hair keratinocytes, and skin fibroblasts.

    Science.gov (United States)

    Streckfuss-Bömeke, Katrin; Wolf, Frieder; Azizian, Azadeh; Stauske, Michael; Tiburcy, Malte; Wagner, Stefan; Hübscher, Daniela; Dressel, Ralf; Chen, Simin; Jende, Jörg; Wulf, Gerald; Lorenz, Verena; Schön, Michael P; Maier, Lars S; Zimmermann, Wolfram H; Hasenfuss, Gerd; Guan, Kaomei

    2013-09-01

    Induced pluripotent stem cells (iPSCs) provide a unique opportunity for the generation of patient-specific cells for use in disease modelling, drug screening, and regenerative medicine. The aim of this study was to compare human-induced pluripotent stem cells (hiPSCs) derived from different somatic cell sources regarding their generation efficiency and cardiac differentiation potential, and functionalities of cardiomyocytes. We generated hiPSCs from hair keratinocytes, bone marrow mesenchymal stem cells (MSCs), and skin fibroblasts by using two different virus systems. We show that MSCs and fibroblasts are more easily reprogrammed than keratinocytes. This corresponds to higher methylation levels of minimal promoter regions of the OCT4 and NANOG genes in keratinocytes than in MSCs and fibroblasts. The success rate and reprogramming efficiency was significantly higher by using the STEMCCA system than the OSNL system. All analysed hiPSCs are pluripotent and show phenotypical characteristics similar to human embryonic stem cells. We studied the cardiac differentiation efficiency of generated hiPSC lines (n = 24) and found that MSC-derived hiPSCs exhibited a significantly higher efficiency to spontaneously differentiate into beating cardiomyocytes when compared with keratinocyte-, and fibroblast-derived hiPSCs. There was no significant difference in the functionalities of the cardiomyocytes derived from hiPSCs with different origins, showing the presence of pacemaker-, atrial-, ventricular- and Purkinje-like cardiomyocytes, and exhibiting rhythmic Ca2+ transients and Ca2+ sparks in hiPSC-derived cardiomyocytes. Furthermore, spontaneously and synchronously beating and force-developing engineered heart tissues were generated. Human-induced pluripotent stem cells can be reprogrammed from all three somatic cell types, but with different efficiency. All analysed iPSCs can differentiate into cardiomyocytes, and the functionalities of cardiomyocytes derived from different cell

  8. Suppression of skin inflammation in keratinocytes and acute/chronic disease models by caffeic acid phenethyl ester.

    Science.gov (United States)

    Lim, Kyung-Min; Bae, SeungJin; Koo, Jung Eun; Kim, Eun-Sun; Bae, Ok-Nam; Lee, Joo Young

    2015-04-01

    Skin inflammation plays a central role in the pathophysiology and symptoms of diverse chronic skin diseases including atopic dermatitis (AD). In this study, we examined if caffeic acid phenethyl ester (CAPE), a skin-permeable bioactive compound from propolis, was protective against skin inflammation using in vitro cell system and in vivo animal disease models. CAPE suppressed TNF-α-induced NF-κB activation and expression of inflammatory cytokines in human keratinocytes (HaCaT). The potency and efficacy of CAPE were superior to those of a non-phenethyl derivative, caffeic acid. Consistently, topical treatment of CAPE (0.5 %) attenuated 12-O-tetradecanoylphorbol-13-acetate(TPA)-induced skin inflammation on mouse ear as CAPE reduced ear swelling and histologic inflammation scores. CAPE suppressed increased expression of pro-inflammatory molecules such as TNF-α, cyclooxygenase-2 and inducible NO synthase in TPA-stimulated skin. TPA-induced phosphorylation of IκB and ERK was blocked by CAPE suggesting that protective effects of CAPE on skin inflammation is attributed to inhibition of NF-κB activation. Most importantly, in an oxazolone-induced chronic dermatitis model, topical application of CAPE (0.5 and 1 %) was effective in alleviating AD-like symptoms such as increases of trans-epidermal water loss, skin thickening and serum IgE as well as histologic inflammation assessment. Collectively, our results propose CAPE as a promising candidate for a novel topical drug for skin inflammatory diseases.

  9. Fibre optic confocal imaging (FOCI) of keratinocytes, blood vessels and nerves in hairless mouse skin in vivo

    Science.gov (United States)

    BUSSAU, L. J.; VO, L. T.; DELANEY, P. M.; PAPWORTH, G. D.; BARKLA, D. H.; KING, R. G.

    1998-01-01

    Fibre optic confocal imaging (FOCI) enabled subsurface fluorescence microscopy of the skin of hairless mice in vivo. Application of acridine orange enabled imaging of the layers of the epidermis. The corneocytes of the stratum corneum, the keratinocytes in the basal layers and redundant hair follicles were visualised at depths greater than 100 μm. Cellular and nuclear membranes of keratinocytes of the skin were visualised by the use of acridine orange and DIOC5(3). Imaging of the skin after injection of FITC-dextran revealed an extensive network of blood vessels with a size range up to 20 μm. Blood cells could be seen moving through dermal vessels and the blood circulation through the dermal vascular bed was video-taped. The fluorescent dye 4-di-2-ASP showed the presence of nerves fibres around the hair follicles and subsurface blood vessels. Comparison was made between images obtained in vivo using FOCI and in vitro scanning electron microscopy and conventional histology. FOCI offers the potential to study dynamic events in vivo, such as blood flow, skin growth, nerve regeneration and many pathological processes, in ways which have not previously been possible. PMID:9643419

  10. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    International Nuclear Information System (INIS)

    Senthilkumar, P.K.; Robertson, L.W.; Ludewig, G.

    2012-01-01

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  11. Humanized Mouse Model of Skin Inflammation Is Characterized by Disturbed Keratinocyte Differentiation and Influx of IL-17A Producing T Cells

    Science.gov (United States)

    de Oliveira, Vivian L.; Keijsers, Romy R. M. C.; van de Kerkhof, Peter C. M.; Seyger, Marieke M. B.; Fasse, Esther; Svensson, Lars; Latta, Markus; Norsgaard, Hanne; Labuda, Tord; Hupkens, Pieter; van Erp, Piet E. J.; Joosten, Irma; Koenen, Hans J. P. M.

    2012-01-01

    Humanized mouse models offer a challenging possibility to study human cell function in vivo. In the huPBL-SCID-huSkin allograft model human skin is transplanted onto immunodeficient mice and allowed to heal. Thereafter allogeneic human peripheral blood mononuclear cells are infused intra peritoneally to induce T cell mediated inflammation and microvessel destruction of the human skin. This model has great potential for in vivo study of human immune cells in (skin) inflammatory processes and for preclinical screening of systemically administered immunomodulating agents. Here we studied the inflammatory skin response of human keratinocytes and human T cells and the concomitant systemic human T cell response. As new findings in the inflamed human skin of the huPBL-SCID-huSkin model we here identified: 1. Parameters of dermal pathology that enable precise quantification of the local skin inflammatory response exemplified by acanthosis, increased expression of human β-defensin-2, Elafin, K16, Ki67 and reduced expression of K10 by microscopy and immunohistochemistry. 2. Induction of human cytokines and chemokines using quantitative real-time PCR. 3. Influx of inflammation associated IL-17A-producing human CD4+ and CD8+ T cells as well as immunoregulatory CD4+Foxp3+ cells using immunohistochemistry and -fluorescence, suggesting that active immune regulation is taking place locally in the inflamed skin. 4. Systemic responses that revealed activated and proliferating human CD4+ and CD8+ T cells that acquired homing marker expression of CD62L and CLA. Finally, we demonstrated the value of the newly identified parameters by showing significant changes upon systemic treatment with the T cell inhibitory agents cyclosporine-A and rapamycin. In summary, here we equipped the huPBL-SCID-huSkin humanized mouse model with relevant tools not only to quantify the inflammatory dermal response, but also to monitor the peripheral immune status. This combined approach will gain our

  12. Biochemical mechanisms of skin radiation burns inhibition and healing by the volumetric autotransplantation of fibroblasts and of keratinocytes with fibroblasts composition

    Directory of Open Access Journals (Sweden)

    L. V. Altukhova

    2015-09-01

    Full Text Available Mechanisms of influence of volumetric autotransplantation of fibroblasts and of the mixture of fibroblasts and keratinocytes on the development of the local 3rd degree X-ray burn and the radiation skin ulcer in guinea pigs were investigated. We used deepadministration into the irradiation zone on its perimeter of 6 doses, which contained (150–160×103 fibroblasts and (130–140×103 keratinocytes in 100 µl. It is shown that this autotransplantation carried out 1 hour after the irradiation, and then every 24 hours, reduces the area of burn on the 35th day, compared to the control by 63%. Radiation ulcer appears on the 10th day after irradiation and is completely healed on the 25th day. With the same regimen of administration of only fibroblasts containing (200–210×103 cells in 100 µl, these parameters of treatment were equal to 31% on 4th and 35th day, respectively. It is shown that as a result of radiation in the area of burn the level of gene expression of collagen types I and III, elastin, fibronectin, vinculin, decorin, hyaluronansynthases 1, 2, 3, matrix metalloproteinases 1, 2, 3, 7, 9 and hyaluronidase is reduced. Besides, in the burn area the level of gene expression of transforming growth factor α, fibroblast growth factors 1, 2, 8 and anti-inflammatory cytokines – interleukin 10 and transforming growth factor-β1 – is reduced, while the level of gene expression of proinflammatory cytokine (interleykin1β increases. Both types of autotransplantation cause the growth of the expression level of all the structural genes and regulatory proteins of biopolymers and decrease in the expression level of interleukin 1β, which leads to activation of tissue regeneration and healing of the burn wound. Reasonsfor the higher efficiency of autotransplantation using the mixture of fibroblasts and keratinocytes compared to autotransplantation by fibroblasts only are both the larger total number of live cells regularly replacing dead cells in

  13. Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia.

    Science.gov (United States)

    Foster, K Wade; Liu, Zhaoli; Nail, Clinton D; Li, Xingnan; Fitzgerald, Thomas J; Bailey, Sarah K; Frost, Andra R; Louro, Iuri D; Townes, Tim M; Paterson, Andrew J; Kudlow, Jeffrey E; Lobo-Ruppert, Susan M; Ruppert, J Michael

    2005-02-24

    KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes, KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions.

  14. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm 2 ) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  15. How Does Chronic Cigarette Smoke Exposure Affect Human Skin? A Global Proteomics Study in Primary Human Keratinocytes.

    Science.gov (United States)

    Rajagopalan, Pavithra; Nanjappa, Vishalakshi; Raja, Remya; Jain, Ankit P; Mangalaparthi, Kiran K; Sathe, Gajanan J; Babu, Niraj; Patel, Krishna; Cavusoglu, Nükhet; Soeur, Jeremie; Pandey, Akhilesh; Roy, Nita; Breton, Lionel; Chatterjee, Aditi; Misra, Namita; Gowda, Harsha

    2016-11-01

    Cigarette smoking has been associated with multiple negative effects on human skin. Long-term physiological effects of cigarette smoke are through chronic and not acute exposure. Molecular alterations due to chronic exposure to cigarette smoke remain unclear. Primary human skin keratinocytes chronically exposed to cigarette smoke condensate (CSC) showed a decreased wound-healing capacity with an increased expression of NRF2 and MMP9. Using quantitative proteomics, we identified 4728 proteins, of which 105 proteins were overexpressed (≥2-fold) and 41 proteins were downregulated (≤2-fold) in primary skin keratinocytes chronically exposed to CSC. We observed an alteration in the expression of several proteins involved in maintenance of epithelial barrier integrity, including keratin 80 (5.3 fold, p value 2.5 × 10 -7 ), cystatin A (3.6-fold, p value 3.2 × 10 -3 ), and periplakin (2.4-fold, p value 1.2 × 10 -8 ). Increased expression of proteins associated with skin hydration, including caspase 14 (2.2-fold, p value 4.7 × 10 -2 ) and filaggrin (3.6-fold, p value 5.4 × 10 -7 ), was also observed. In addition, we report differential expression of several proteins, including adipogenesis regulatory factor (2.5-fold, p value 1.3 × 10 -3 ) and histone H1.0 (2.5-fold, p value 6.3 × 10 -3 ) that have not been reported earlier. Bioinformatics analyses demonstrated that proteins differentially expressed in response to CSC are largely related to oxidative stress, maintenance of skin integrity, and anti-inflammatory responses. Importantly, treatment with vitamin E, a widely used antioxidant, could partially rescue adverse effects of CSC exposure in primary skin keratinocytes. The utility of antioxidant-based new dermatological formulations in delaying or preventing skin aging and oxidative damages caused by chronic cigarette smoke exposure warrants further clinical investigations and multi-omics research.

  16. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  17. Interactive effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and retinoids on proliferation and differentiation in cultured human keratinocytes: quantification of cross-linked envelope formation

    International Nuclear Information System (INIS)

    Berkers, J.A.M.; Hassing, I.; Spenkelink, B.; Brouwer, A.; Blaauboer, B.J.

    1995-01-01

    Dioxins are potent inducers of chloracne in humans. This skin aberration can be interpreted as an altered differentiation pattern of acinar sebaceous base cells and a change in the rate of terminal differentiation of the keratinocytes. We measured this rate induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in primary cultures of human keratinocytes. As parameters for differentiation, we quantified the 35 S-methionine incorporation into cross-linked envelopes (revealing the total CLE biomass), as well as the number of microscopically visible CLEs. It was shown that TCDD is a very potent inducer of both CLE biomass and number with a half-maximal effect concentration (EC 50 ) of 1.4 nM. CLE biomass was maximally increased 10-fold and the number of cells in culture producing a CLE was increased from 15% in control cultures to maximally 75% of the cells in TCDD-treated cultures. Both effects were Ca 2+ -dependent and increased with elevated cell density, being optimal in post-confluent cultures. Retinoic acid dose-dependently decreased the effect of 10 -8 M TCDD, 10 -6 M having a nearly complete antagonistic action. This interaction of retinoic acid with TCDD-induced differentiation was non-competitive. Retinol was equally potent as an antagonist of the TCDD-induced elevation of CLE formation as compared with retinoic acid. Retinyl palmitate and etretinate were not very effective as TCDD antagonists. Supplementation of hydrocortisone suppressed the TCDD-induced keratinocyte differentiation. It was concluded that CLE biomass quantification provides a reliable and sensitive parameter for keratinocyte differentiation. In this in vitro system it is shown that TCDD strongly induces a switch from proliferation to terminal differentiation and that this effect can be antagonized effectively by retinoic acid and retinol. (orig.)

  18. Should dermal scald burns in children be covered with autologous skin grafts or with allogeneic cultivated keratinocytes?--"The Viennese concept".

    Science.gov (United States)

    Rab, Matthias; Koller, Rupert; Ruzicka, Margot; Burda, Gudrun; Kamolz, Lars Peter; Bierochs, Bettina; Meissl, Guenther; Frey, Manfred

    2005-08-01

    The treatment of scald burns in children is still under discussion. The aim of the present study was to evaluate an optimised treatment regime for scald burns in children. Between 1997 and 2002, 124 children underwent surgical intervention due to burn injuries. Thirty-six out of these 124 children were enrolled into the evaluation of our recent treatment protocol. Twenty-two children with scald burns covering an average body surface area (TBSA) of 18.5% were treated by early excision and coverage with allogeneic keratinocytes in case of partial thickness lesions (keratinocyte group). Fourteen children with a TBSA of 17.2% were treated with autologous skin grafts alone (skin graft group). Both groups were comparable according to age, burn depth and affected TBSA. The complete clinical follow-up examination of at least 17 months was performed in 12 out of 22 children of the keratinocyte group and in 9 out of 14 patients of the comparative group. Visible scar formations were classified according to the Vancouver Scar Scale (VSS) in each patient. The use of allogeneic keratinocytes led to complete epithelialisation within 12 days in 20 of the 22 cases. No secondary skin grafting procedures had to be done. Skin take rate at the sixth postoperative day was 100% in the skin graft group. Blood transfusions were administered intraoperatively according to the clinical need of the patients by the responsible anaesthesiologist. The mean volume of blood, which had to be transfused was 63.9 ml in the keratinocyte group and significantly lower than the volume of 151.4 ml, which was administered in the skin graft group (p=0.04). At follow up the VSS observed in areas covered by keratinocytes was 2.33 on the average and therefore, significantly lower than the VSS of 5.22 in skin grafted areas of the comparative group (p=0.04). In children the use of cultivated keratinocytes in partial thickness scald burns is a procedure, which renders constantly reliable results. It minimizes the

  19. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  20. The extracellular adherence protein (Eap) of Staphylococcus aureus acts as a proliferation and migration repressing factor that alters the cell morphology of keratinocytes.

    Science.gov (United States)

    Eisenbeis, Janina; Peisker, Henrik; Backes, Christian S; Bur, Stephanie; Hölters, Sebastian; Thewes, Nicolas; Greiner, Markus; Junker, Christian; Schwarz, Eva C; Hoth, Markus; Junker, Kerstin; Preissner, Klaus T; Jacobs, Karin; Herrmann, Mathias; Bischoff, Markus

    2017-02-01

    Staphyloccocus aureus is a major human pathogen and a common cause for superficial and deep seated wound infections. The pathogen is equipped with a large arsenal of virulence factors, which facilitate attachment to various eukaryotic cell structures and modulate the host immune response. One of these factors is the extracellular adherence protein Eap, a member of the "secretable expanded repertoire adhesive molecules" (SERAM) protein family that possesses adhesive and immune modulatory properties. The secreted protein was previously shown to impair wound healing by interfering with host defense and neovascularization. However, its impact on keratinocyte proliferation and migration, two major steps in the re-epithelialization process of wounds, is not known. Here, we report that Eap affects the proliferation and migration capacities of keratinocytes by altering their morphology and adhesive properties. In particular, treatment of non-confluent HaCaT cell cultures with Eap resulted in cell morphology changes as well as a significant reduction in cell proliferation and migration. Eap-treated HaCaT cells changed their appearance from an oblong via a trapezoid to an astral-like shape, accompanied by decreases in cell volume and cell stiffness, and exhibited significantly increased cell adhesion. Eap had a similar influence on endothelial and cancer cells, indicative for a general effect of Eap on eukaryotic cell morphology and functions. Specifically, Eap was found to interfere with growth factor-stimulated activation of the mitogen-activated protein kinase (MAPK) pathway that is known to be responsible for cell shape modulation, induction of proliferation and migration of epithelial cells. Western blot analyses revealed that Eap blocked the phosphorylation of extracellular signal-regulated kinase 1 and 2 (Erk1/2) in keratinocyte growth factor (KGF)-stimulated HaCaT cells. Together, these data add another antagonistic mechanism of Eap in wound healing, whereby the

  1. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  2. Significance of Ubiad1 for Epidermal Keratinocytes Involves More Than CoQ10 Synthesis: Implications for Skin Aging

    Directory of Open Access Journals (Sweden)

    Florian Labarrade

    2018-01-01

    Full Text Available The significance of Coenzyme Q10 (CoQ10 as an anti-oxidant barrier of the skin, as well as a key component in anti-aging strategies for skin care products, has been firmly established. Biosynthesis of CoQ10 in the mitochondria is well known, but there is only limited information on the non-mitochondrial synthesis of CoQ10 in the skin. Recent findings in zebrafish identified that a tumor suppressor, Ubiad1, is also a key enzyme in the non-mitochondrial synthesis of CoQ10. The purpose of this study was to investigate expression of Ubiad1 in human skin, and its implication in the skin’s cutaneous response to oxidative stress. We observed Ubiad1 localization in the epidermis, particularly a subcellular localization in the Golgi apparatus. Ubiad1 modulation by a pentapeptide was associated with an observed reduction in ROS/RNS stresses (−44%/−19% respectively, lipid peroxidation (−25% and preservation of membrane fluidity under stress conditions. Electron microscopy of keratinocytes revealed a significant degree of stimulation of the Golgi complex, as well as significantly improved mitochondrial morphology. Given the importance of CoQ10 in mitigating the visible signs of skin aging, our findings identify Ubiad1 as an essential component of the defensive barriers of the epidermis.

  3. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  4. Keratinocytes propagated in serum-free, feeder-free culture conditions fail to form stratified epidermis in a reconstituted skin model.

    Directory of Open Access Journals (Sweden)

    Rebecca Lamb

    Full Text Available Primary human epidermal stem cells isolated from skin tissues and subsequently expanded in tissue culture are used for human therapeutic use to reconstitute skin on patients and to generate artificial skin in culture for academic and commercial research. Classically, epidermal cells, known as keratinocytes, required fibroblast feeder support and serum-containing media for serial propagation. In alignment with global efforts to remove potential animal contaminants, many serum-free, feeder-free culture methods have been developed that support derivation and growth of these cells in 2-dimensional culture. Here we show that keratinocytes grown continually in serum-free and feeder-free conditions were unable to form into a stratified, mature epidermis in a skin equivalent model. This is not due to loss of cell potential as keratinocytes propagated in serum-free, feeder-free conditions retain their ability to form stratified epidermis when re-introduced to classic serum-containing media. Extracellular calcium supplementation failed to improve epidermis development. In contrast, the addition of serum to commercial, growth media developed for serum-free expansion of keratinocytes facilitated 3-dimensional stratification in our skin equivalent model. Moreover, the addition of heat-inactivated serum improved the epidermis structure and thickness, suggesting that serum contains factors that both aid and inhibit stratification.

  5. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  6. Transfer of a two-tiered keratinocyte assay: IL-18 production by NCTC2544 to determine the skin sensitizing capacity and epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2013-01-01

    . The two tiered approach may offer an unique opportunity to provide an alternative method to the Local Lymph Node Assay (LLNA). These assays are both based on the use of human keratinocytes, which have been shown over the last two decades, to play a key role in all phases of skin sensitization....

  7. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

    Science.gov (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  8. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    International Nuclear Information System (INIS)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming

    2016-01-01

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  9. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming, E-mail: lizm_1001@sina.com

    2016-02-26

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  10. Correlation of initiating potency of skin carcinogens with potency to induce resistance to terminal differentiation in cultured mouse keratinocytes

    International Nuclear Information System (INIS)

    Kilkenny, A.E.; Morgan, D.; Spangler, E.F.; Yuspa, S.H.

    1985-01-01

    The induction by chemical carcinogens of resistance to terminal differentiation in cultured mouse keratinocytes has been proposed to represent a cellular change associated with the initiation phase of skin carcinogenesis. Previous results with this culture model indicated that the number of differentiation-resistant foci was correlated with the dose and known potency for several chemical carcinogens. Assay conditions were optimized to provide quantitative results for screening a variety of carcinogens for their potency as inducers of foci resistant to terminal differentiation. Eight skin initiators of varying potency and from different chemical classes and ultraviolet light were studied for their activity to induce this alteration in cultured epidermal cells from newborn BALB/c mice. There was an excellent positive correlation for the potency of these agents as initiators in vivo and as inducers of altered differentiation in vitro. The induction of resistant foci was independent of the relative cytotoxic effects of each agent except where cytotoxicity was extensive and reduced the number of foci. The results support the hypothesis that initiation of carcinogenesis in skin results in an alteration in the program of epidermal cell differentiation. The results also suggest that the assay is useful for identifying relative potency classes (strong, moderate, weak) of initiating agents

  11. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  12. Ibuprofen loaded PLA nanofibrous scaffolds increase proliferation of human skin cells in vitro and promote healing of full thickness incision wounds in vivo.

    Science.gov (United States)

    Mohiti-Asli, M; Saha, S; Murphy, S V; Gracz, H; Pourdeyhimi, B; Atala, A; Loboa, E G

    2017-02-01

    This article presents successful incorporation of ibuprofen in polylactic acid (PLA) nanofibers to create scaffolds for the treatment of both acute and chronic wounds. Nanofibrous PLA scaffolds containing 10, 20, or 30 wt % ibuprofen were created and ibuprofen release profiles quantified. In vitro cytotoxicity to human epidermal keratinocytes (HEK) and human dermal fibroblasts (HDF) of the three scaffolds with varying ibuprofen concentrations were evaluated and compared to pure PLA nanofibrous scaffolds. Thereafter, scaffolds loaded with ibuprofen at the concentration that promoted human skin cell viability and proliferation (20 wt %) were evaluated in vivo in nude mice using a full thickness skin incision model to determine the ability of these scaffolds to promote skin regeneration and/or assist with scarless healing. Both acellular and HEK and HDF cell-seeded 20 wt % ibuprofen loaded nanofibrous bandages reduced wound contraction compared with wounds treated with Tegaderm™ and sterile gauze. Newly regenerated skin on wounds treated with cell-seeded 20 wt % ibuprofen bandages exhibited significantly greater blood vessel formation relative to acellular ibuprofen bandages. We have found that degradable anti-inflammatory scaffolds containing 20 wt % ibuprofen promote human skin cell viability and proliferation in vitro, reduce wound contraction in vivo, and when seeded with skin cells, also enhance new blood vessel formation. The approaches and results reported here hold promise for multiple skin tissue engineering and wound healing applications. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 327-339, 2017. © 2015 Wiley Periodicals, Inc.

  13. Expression and Localization of Peroxisome Proliferator-Activated Receptors and Nuclear Factor κB in Normal and Lesional Psoriatic Skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...

  14. Protective effect of indole-3-pyruvate against ultraviolet b-induced damage to cultured HaCaT keratinocytes and the skin of hairless mice.

    Directory of Open Access Journals (Sweden)

    Reiji Aoki

    Full Text Available Previous investigations demonstrated that pyruvate protects human keratinocytes against cell damage stemming from exposure to ultraviolet B (UVB radiation. This study endeavoured to elucidate the protective capacity of aromatic pyruvates (e.g., phenylpyruvate (PPyr, 4-hydroxyphenylpyruvate (HPPyr, and indole-3-pyruvate (IPyr against UVB-induced injury to skin cells, both in vitro and in vivo. Cultured human HaCaT keratinocytes were irradiated with UVB light (60 mJ/cm2 and maintained with or without test compounds (1-25 mM.In addition, the dorsal skin of hairless mice (HR-1 was treated with test compounds (10 μmol and exposed to UVB light (1 J/cm2 twice [corrected]. The ability of the test compounds to ameliorate UVB-induced cytotoxicity and inflammation was then assessed. Aromatic pyruvates reduced cytotoxicity in UVB-irradiated HaCaT keratinocytes, and also diminished the expression of interleukin 1β (IL-1β and interleukin 6 (IL-6. IPyr was more efficacious than either PPyr or HPPyr. Furthermore, only IPyr inhibited cyclooxygenase-2 (Cox-2 expression at both the mRNA and the protein level in UVB-treated keratinocytes. Topical application of IPyr to the dorsal skin of hairless mice reduced the severity of UVB-induced skin lesions, the augmentation of dermal thickness, and transepithelial water loss. Overproduction of IL-1β and IL-6 in response to UVB radiation was also suppressed in vivo by the topical administration of IPyr. These data strongly suggest that IPyr might find utility as a UVB-blocking reagent in therapeutic strategies to lessen UVB-induced inflammatory skin damage.

  15. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  16. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    Energy Technology Data Exchange (ETDEWEB)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C. [Athens Univ. (Greece). School of Medicine

    1996-06-28

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 {+-} 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK).

  17. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C.

    1996-01-01

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 ± 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK)

  18. Assessment of the potential skin irritation of lysine-derivative anionic surfactants using mouse fibroblast and human keratinocytes as an alternative to animal testing

    OpenAIRE

    Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar

    2004-01-01

    Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...

  19. cFLIP Regulates Skin Homeostasis and Protects against TNF-Induced Keratinocyte Apoptosis

    Directory of Open Access Journals (Sweden)

    Diana Panayotova-Dimitrova

    2013-10-01

    Full Text Available FADD, caspase-8, and cFLIP regulate the outcome of cell death signaling. Mice that constitutively lack these molecules die at an early embryonic age, whereas tissue-specific constitutive deletion of FADD or caspase-8 results in inflammatory skin disease caused by increased necroptosis. The function of cFLIP in the skin in vivo is unknown. In contrast to tissue-specific caspase-8 knockout, we show that mice constitutively lacking cFLIP in the epidermis die around embryonic days 10 and 11. When cFLIP expression was abrogated in adult skin of cFLIPfl/fl-K14CreERtam mice, severe inflammation of the skin with concomitant caspase activation and apoptotic, but not necroptotic, cell death developed. Apoptosis was dependent of autocrine tumor necrosis factor production triggered by loss of cFLIP. In addition, epidermal cFLIP protein was lost in patients with severe drug reactions associated with epidermal apoptosis. Our data demonstrate the importance of cFLIP for the integrity of the epidermis and for silencing of spontaneous skin inflammation.

  20. Oxidative stress drives CD8+ T-cell skin trafficking in patients with vitiligo through CXCL16 upregulation by activating the unfolded protein response in keratinocytes.

    Science.gov (United States)

    Li, Shuli; Zhu, Guannan; Yang, Yuqi; Jian, Zhe; Guo, Sen; Dai, Wei; Shi, Qiong; Ge, Rui; Ma, Jingjing; Liu, Ling; Li, Kai; Luan, Qi; Wang, Gang; Gao, Tianwen; Li, Chunying

    2017-07-01

    In patients with vitiligo, an increased reactive oxygen species (ROS) level has been proved to be a key player during disease initiation and progression in melanocytes. Nevertheless, little is known about the effects of ROS on other cells involved in the aberrant microenvironment, such as keratinocytes and the following immune events. CXCL16 is constitutively expressed in keratinocytes and was recently found to mediate homing of CD8 + T cells in human skin. We sought to explicate the effect of oxidative stress on human keratinocytes and its capacity to drive CD8 + T-cell trafficking through CXCL16 regulation. We first detected putative T-cell skin-homing chemokines and ROS in serum and lesions of patients with vitiligo. The production of candidate chemokines was detected by using quantitative real-time PCR and ELISA in keratinocytes exposed to H 2 O 2 . Furthermore, the involved mediators were analyzed by using quantitative real-time PCR, Western blotting, ELISA, and immunofluorescence. Next, we tested the chemotactic migration of CD8 + T cells from patients with vitiligo mediated by the CXCL16-CXCR6 pair using the transwell assay. CXCL16 expression increased and showed a positive correlation with oxidative stress levels in serum and lesions of patients with vitiligo. The H 2 O 2 -induced CXCL16 expression was due to the activation of 2 unfolded protein response pathways: kinase RNA (PKR)-like ER kinase-eukaryotic initiation factor 2α and inositol-requiring enzyme 1α-X-box binding protein 1. CXCL16 produced by stressed keratinocytes induced migration of CXCR6 + CD8 + T cells derived from patients with vitiligo. CXCR6 + CD8 + T-cell skin infiltration is accompanied by melanocyte loss in lesions of patients with vitiligo. Our study demonstrated that CXCL16-CXCR6 mediates CD8 + T-cell skin trafficking under oxidative stress in patients with vitiligo. The CXCL16 expression in human keratinocytes induced by ROS is, at least in part, caused by unfolded protein response

  1. Mesenchymal stem cells ameliorate impaired wound healing through enhancing keratinocyte functions in diabetic foot ulcerations on the plantar skin of rats.

    Science.gov (United States)

    Kato, Jiro; Kamiya, Hideki; Himeno, Tatsuhito; Shibata, Taiga; Kondo, Masaki; Okawa, Tetsuji; Fujiya, Atsushi; Fukami, Ayako; Uenishi, Eita; Seino, Yusuke; Tsunekawa, Shin; Hamada, Yoji; Naruse, Keiko; Oiso, Yutaka; Nakamura, Jiro

    2014-01-01

    Although the initial healing stage involves a re-epithelialization in humans, diabetic foot ulceration (DFU) has been investigated using rodent models with wounds on the thigh skin, in which a wound contraction is initiated. In this study, we established a rodent model of DFU on the plantar skin and evaluated the therapeutic efficacy of bone-marrow-derived mesenchymal stem cells (BM-MSCs) in this model. The wounds made on the hind paws or thighs of streptozotocin induced diabetic or control rats were treated with BM-MSCs. Expression levels of phosphorylated focal adhesion kinase (pFAK), matrix metaroprotease (MMP)-2, EGF, and IGF-1, were evaluated in human keratinocytes, which were cultured in conditioned media of BM-MSCs (MSC-CM) with high glucose levels. Re-epithelialization initiated the healing process on the plantar, but not on the thigh, skin. The therapy utilizing BM-MSCs ameliorated the delayed healing in diabetic rats. In the keratinocytes cultured with MSC-CM, the decreased pFAK levels in the high glucose condition were restored, and the MMP2, EGF, and IGF-1 levels increased. Our study established a novel rat DFU model. The impaired healing process in diabetic rats was ameliorated by transplantation of BM-MSCs. This amelioration might be accounted for by the modification of keratinocyte functions. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  3. Differential role of basal keratinocytes in UV-induced immunosuppression and skin cancer

    NARCIS (Netherlands)

    J. Jans (Judith); G.A. Garinis (George); W. Schul; A. van Oudenaren (Adri); M.J. Moorhouse (Michael); M. Smid (Marcel); Y.-G. Sert (Yurda-Gul); A. van der Velde (Albertina); Y.M. Rijksen (Yvonne); F.R. de Gruijl (Frank); P.J. van der Spek (Peter); A. Yasui (Akira); J.H.J. Hoeijmakers (Jan); P.J. Leenen (Pieter); G.T.J. van der Horst (Gijsbertus)

    2006-01-01

    textabstractCyclobutane pyrimidine dimers (CPDs) and 6-4 photoproducts (6-4PPs) comprise major UV-induced photolesions. If left unrepaired, these lesions can induce mutations and skin cancer, which is facilitated by UV-induced immunosuppression. Yet the contribution of lesion and cell type

  4. [Cultivated keratinocytes on micro-carriers: in vitro studies of a new carrier system].

    Science.gov (United States)

    Hecht, J; Hoefter, E A; Hecht, J; Haraida, S; Nerlich, A; Hartinger, A; Mühlbauer, W; Dimoudis, N

    1997-03-01

    Epidermal grafts from confluently cultivated keratinocytes have been used since the early eighties for the treatment of severe burns, where the shortage of donor sites for split-thickness skin grafts did not allow for adequate wound coverage. The difficult handling of these grafts as well as the advanced differentiation of their epithelial cells into a multilayer sheet poses a problem for their clinical application. The aim of the study was to characterize cultivated keratinocytes, as well as to observe their migration and proliferation from the MC onto a surface. Keratinocytes were isolated from human foreskin and cultivated in serum-free and serum-containing medium according to a modified method by Rheinwald and Green. Collagen-coated Dextran beads were used as MC. The MC were colonized with keratinocytes using the Spinner culture technique. After seeding the colonized MC into culture flasks, their migration and proliferation was monitored regularly through immunohistochemical studies and measurement of the metabolic cell activity. Immunohistological staining proved that the cells isolated from human foreskin represent keratinocytes of the basal type. Keratinocytes, cultivated with serum-containing and serum free medium, both adhered to the surface of the MC, then migrated onto the surface of the flasks and proliferated to form a multilayer of epithelial cells. In the long-term, a flexible epithelial graft consisting of poorly differentiated keratinocytes should be available, which is simple to produce and easy to handle. This would be an alternative method for treating wounds, where the conventional multilayer epithelial graft (ET) is insufficient.

  5. Differential responses of cells from human skin keratinocyte and bovine mammary epithelium to attack by pore-forming Staphylococcus aureus alpha-toxin.

    Science.gov (United States)

    Suriyaphol, Gunnaporn; Sarikaputi, Meena; Suriyaphol, Prapat

    2009-11-01

    Human skin keratinocytes HaCat attacked by Staphylococcus aureus alpha-toxin showed a transient drop of cellular ATP levels whereas in toxin-perforated bovine mammary epithelial cells (BMEC), the ATP levels dropped more slowly. Morphologically, during the ATP level depletion, HaCat cell developed a spacious intracellular vacuole together with the transient influx of trypan blue. WST-1 signal, which tested the function of mitochondrial enzyme in viable cells, also decreased concomitantly. On the other hand, BMEC excluded trypan blue and vacuolation was not observed throughout the experiment. We conclude that mammary epithelial cells resist the toxin better than keratinocytes. This is the first report showing that alpha-toxin enhances transient membrane permeability to large molecules, temporary vacuole formation and the transient defect of mitochondrial enzyme in viable cells without cell lysis.

  6. Smad4 disruption accelerates keratinocyte reepithelialization in murine cutaneous wound repair.

    Science.gov (United States)

    Yang, Leilei; Li, Wenlong; Wang, Shaoxia; Wang, Lijuan; Li, Yang; Yang, Xiao; Peng, Ruiyun

    2012-10-01

    Keratinocyte reepithelialization is a rate-limiting event in cutaneous wound repair, which involves the migration and proliferation of keratinocytes to cover the denuded dermal surface. Transforming growth factor-β1 (TGF-β1) has the ability to induce epithelial cell migration while inhibiting proliferation, and controversial results have been generated regarding the effect of TGF-β signaling on reepithelialization. In this study, full-thickness skin wounds were made in keratinocyte-specific Smad4 knockout and the control mice. The wound closure, reepithelialization, keratinocyte proliferation, myofibroblast numbers and collagen deposition of were assessed. The results showed that the proliferation of keratinocytes increased, which accelerated the reepithelialization, and led to faster wound repair in the epidermis of Smad4 mutant mice. Upregulation of keratin 17, 14-3-3 sigma and phosphorylated AKT in the hyperproliferative epidermis may be correlated with the accelerated reepithelialization. We conclude that Smad4 plays an inhibitory role in the keratinocyte-mediated reepithelialization of wound healing.

  7. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Constituents from the roots of Taraxacum platycarpum and their effect on proliferation of human skin fibroblasts.

    Science.gov (United States)

    Warashina, Tsutomu; Umehara, Kaoru; Miyase, Toshio

    2012-01-01

    A MeOH extract from the roots of Taraxacum platycarpum has shown significant effects on the proliferation of normal human skin fibroblasts. Chemical analysis of the extract resulted in the isolation of 26 compounds, including eight new triterpenes, one new sesquiterpene glycoside, and seventeen known compounds. The structure of each new compound was established using NMR spectroscopy. Some triterpenes had a significant effect on the proliferation of normal human skin fibroblasts.

  9. Nerve signaling regulates basal keratinocyte proliferation in the blastema apical epithelial cap in the axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Satoh, Akira; Bryant, Susan V; Gardiner, David M

    2012-06-15

    The ability of adult vertebrates to repair tissue damage is widespread and impressive; however, the ability to regenerate structurally complex organs such as the limb is limited largely to the salamanders. The fact that most of the tissues of the limb can regenerate has led investigators to question and identify the barriers to organ regeneration. From studies in the salamander, it is known that one of the earliest steps required for successful regeneration involves signaling between nerves and the wound epithelium/apical epithelial cap (AEC). In this study we confirm an earlier report that the keratinocytes of the AEC acquire their function coincident with exiting the cell cycle. We have discovered that this unique, coordinated behavior is regulated by nerve signaling and is associated with the presence of gap junctions between the basal keratinocytes of the AEC. Disruption of nerve signaling results in a loss of gap junction protein, the reentry of the cells into the cell cycle, and regenerative failure. Finally, coordinated exit from the cell cycle appears to be a conserved behavior of populations of cells that function as signaling centers during both development and regeneration. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Varying the morphology of silver nanoparticles results in differential toxicity against micro-organisms, HaCaT keratinocytes and affects skin deposition.

    Science.gov (United States)

    Holmes, Amy M; Lim, Julian; Studier, Hauke; Roberts, Michael S

    2016-12-01

    The use of silver nanoparticles (Ag NPs) within the healthcare sector and consumer products is rapidly increasing. There are now a range of diverse-shaped Ag NPs that are commercially available and many of the products containing nanosilver are topically applied to human skin. Currently, there is limited data on the extent to which the antimicrobial efficacy and cytotoxicity of Ag NPs is related to their shape and how the shape of the Ag NPs affects their distribution in both intact and burn wounded human skin after topical application. In this study, we related the relative Ag NP cytotoxicity to potential skin pathogens and HaCaT keratinocytes in vitro with the shape of the Ag NPs. We employed multiphoton fluorescence lifetime imaging to map the distribution of the native and unlabeled Ag NPs after topical application to both intact and burn wounded human skin using the localized surface plasmon resonance signal of the Ag NPs. Truncated plate shaped Ag NPs led to the highest cytotoxicity against both bacteria (IC 50 ranges from 31.25 to 125 μg/mL depending on the bacterial species) and HaCaT keratinocytes (IC 50 78.65 μg/mL [95%CI 63.88, 96.83]) thus both with similar orders of magnitude. All Ag NPs were less cytotoxic than solutions of silver nitrate (IC 50 of 7.85 μg/mL [95%CI 1.49, 14.69]). Plate-shaped Ag NPs displayed the highest substantivity within the superficial layers of the stratum corneum when topically applied to intact skin and the highest deposition into the wound bed when applied to burned ex vivo human skin relative to other Ag NP shapes.

  11. Radical Scavenging Activity-Based and AP-1-Targeted Anti-Inflammatory Effects of Lutein in Macrophage-Like and Skin Keratinocytic Cells

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2013-01-01

    Full Text Available Lutein is a naturally occurring carotenoid with antioxidative, antitumorigenic, antiangiogenic, photoprotective, hepatoprotective, and neuroprotective properties. Although the anti-inflammatory effects of lutein have previously been described, the mechanism of its anti-inflammatory action has not been fully elucidated. Therefore, in the present study, we aimed to investigate the regulatory activity of lutein in the inflammatory responses of skin-derived keratinocytes or macrophages and to elucidate the mechanism of its inhibitory action. Lutein significantly reduced several skin inflammatory responses, including increased expression of interleukin-(IL- 6 from LPS-treated macrophages, upregulation of cyclooxygenase-(COX- 2 from interferon-γ/tumor necrosis-factor-(TNF- α-treated HaCaT cells, and the enhancement of matrix-metallopeptidase-(MMP- 9 level in UV-irradiated keratinocytes. By evaluating the intracellular signaling pathway and the nuclear transcription factor levels, we determined that lutein inhibited the activation of redox-sensitive AP-1 pathway by suppressing the activation of p38 and c-Jun-N-terminal kinase (JNK. Evaluation of the radical and ROS scavenging activities further revealed that lutein was able to act as a strong anti-oxidant. Taken together, our findings strongly suggest that lutein-mediated AP-1 suppression and anti-inflammatory activity are the result of its strong antioxidative and p38/JNK inhibitory activities. These findings can be applied for the preparation of anti-inflammatory and cosmetic remedies for inflammatory diseases of the skin.

  12. Two-tiered keratinocyte assay: IL-18 production by NCTC2544 cells to determine the skin sensitizing capacity and an epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2012-01-01

    the use of animals. The aim of the EU FP6 Integrated Project Sens-it-iv was to develop and optimize an integrated testing strategy consisting of in vitro, human cell based assays which will closely mimic sensitization mechanisms in vivo. These assays should be an alternative approach to the LLNA. The NCTC...... method to the LLNA. Both assays are based on the use of human keratinocytes, which have been shown, over the last two decades, to play a key role in all phases of skin sensitization. First, 4 known chemicals were tested during a transferability study in which 6 laboratories participated. Three...

  13. Elastin hydrolysate derived from fish enhances proliferation of human skin fibroblasts and elastin synthesis in human skin fibroblasts and improves the skin conditions.

    Science.gov (United States)

    Shiratsuchi, Eri; Nakaba, Misako; Yamada, Michio

    2016-03-30

    Recent studies have shown that certain peptides significantly improve skin conditions, such as skin elasticity and the moisture content of the skin of healthy woman. This study aimed to investigate the effects of elastin hydrolysate on human skin. Proliferation and elastin synthesis were evaluated in human skin fibroblasts exposed to elastin hydrolysate and proryl-glycine (Pro-Gly), which is present in human blood after elastin hydrolysate ingestion. We also performed an ingestion test with elastin hydrolysate in humans and evaluated skin condition. Elastin hydrolysate and Pro-Gly enhanced the proliferation of fibroblasts and elastin synthesis. Maximal proliferation response was observed at 25 ng mL(-1) Pro-Gly. Ingestion of elastin hydrolysate improved skin condition, such as elasticity, number of wrinkles, and blood flow. Elasticity improved by 4% in the elastin hydrolysate group compared with 2% in the placebo group. Therefore, elastin hydrolysate activates human skin fibroblasts and has beneficial effects on skin conditions. © 2015 Society of Chemical Industry.

  14. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  15. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  16. Scleroderma keratinocytes promote fibroblast activation independent of transforming growth factor beta.

    Science.gov (United States)

    McCoy, Sara S; Reed, Tamra J; Berthier, Celine C; Tsou, Pei-Suen; Liu, Jianhua; Gudjonsson, Johann E; Khanna, Dinesh; Kahlenberg, J Michelle

    2017-11-01

    SSc is a devastating disease that results in fibrosis of the skin and other organs. Fibroblasts are a key driver of the fibrotic process through deposition of extracellular matrix. The mechanisms by which fibroblasts are induced to become pro-fibrotic remain unclear. Thus, we examined the ability of SSc keratinocytes to promote fibroblast activation and the source of this effect. Keratinocytes were isolated from skin biopsies of 9 lcSSc, 10 dcSSc and 13 control patients. Conditioned media was saved from the cultures. Normal fresh primary fibroblasts were exposed to healthy control and SSc keratinocyte conditioned media in the presence or absence of neutralizing antibodies for TGF-β. Gene expression was assessed by microarrays and real-time PCR. Immunocytochemistry was performed for α-smooth muscle actin (α-SMA), collagen type 1 (COL1A1) and CCL5 expression. SSc keratinocyte conditioned media promoted fibroblast activation, characterized by increased α-SMA and COL1A1 mRNA and protein expression. This effect was independent of TGF-β. Microarray analysis identified upregulation of nuclear factor κB (NF-κB) and downregulation of peroxisome proliferator-activated receptor γ (PPAR-γ) pathways in both SSc subtypes. Scleroderma keratinocytes exhibited increased expression of NF-κB-regulated cytokines and chemokines and lesional skin staining confirmed upregulation of CCL5 in basal keratinocytes. Scleroderma keratinocytes promote the activation of fibroblasts in a TGF-β-independent manner and demonstrate an imbalance in NF-κB1 and PPAR-γ expression leading to increased cytokine and CCL5 production. Further study of keratinocyte mediators of fibrosis, including CCL5, may provide novel targets for skin fibrosis therapy. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  17. EGFR Activation and Ultraviolet Light‐Induced Skin Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Taghrid B. El-Abaseri

    2007-01-01

    Full Text Available The epidermal growth factor receptor (EGFR regulates the proliferation of keratinocytes through multiple mechanisms that differ depending on the localization of the cell within the skin. Ultraviolet (UV irradiation, the main etiologic factor in the development of skin cancer, also activates the receptor. In this review, we discuss how the UV-induced activation of EGFR regulates the response of the skin to UV. UV-induced EGFR activation increases keratinocyte proliferation, suppresses apoptosis, and augments and accelerates epidermal hyperplasia in response to UV. Pharmacological inhibition of the UV-induced activation of EGFR in a genetically initiated mouse skin tumorigenesis model suppresses tumorigenesis and the activation of mitogen-activated protein (MAP kinases and phosphatidyl inositol-3-kinase (PI3K/AKT signaling pathways. EGFR has pleiotropic, complex, and cell-type-specific functions in cutaneous keratinocytes; suggesting that the receptor is an appropriate target for the development of molecularly targeted therapies for skin cancer and other pathologies.

  18. Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo

    International Nuclear Information System (INIS)

    Kioka, Noriyuki; Ito, Takuya; Yamashita, Hiroshi; Uekawa, Natsuko; Umemoto, Tsutomu; Motoyoshi, Soh; Imai, Hiroshi; Takahashi, Kenzo; Watanabe, Hideto; Yamada, Masayasu; Ueda, Kazumitsu

    2010-01-01

    In the process of tissue injury and repair, epithelial cells rapidly migrate and form epithelial sheets. Vinexin is a cytoplasmic molecule of the integrin-containing cell adhesion complex localized at focal contacts in vitro. Here, we investigated the roles of vinexin in keratinocyte migration in vitro and wound healing in vivo. Vinexin knockdown using siRNA delayed migration of both HaCaT human keratinocytes and A431 epidermoid carcinoma cells in scratch assay but did not affect cell proliferation. Induction of cell migration by scratching the confluent monolayer culture of these cells activated both EGFR and ERK, and their inhibitors AG1478 and U0126 substantially suppressed scratch-induced keratinocyte migration. Vinexin knockdown in these cells inhibited the scratch-induced activation of EGFR, but not that of ERK, suggesting that vinexin promotes cell migration via activation of EGFR. We further generated vinexin (-/-) mice and isolated their keratinocytes. They similarly showed slow migration in scratch assay. Furthermore, vinexin (-/-) mice exhibited a delay in cutaneous wound healing in both the back skin and tail without affecting the proliferation of keratinocytes. Together, these results strongly suggest a crucial role of vinexin in keratinocyte migration in vitro and cutaneous wound healing in vivo.

  19. ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

    Science.gov (United States)

    Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

    2013-01-01

    ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

  20. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  1. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    Goebel, C.; Hewitt, N.J.; Kunze, G.; Wenker, M.; Hein, D.W.; Beck, H.; Skare, J.

    2009-01-01

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for K m and V max . In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  2. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  3. T-plastin expression downstream to the calcineurin/NFAT pathway is involved in keratinocyte migration.

    Directory of Open Access Journals (Sweden)

    Cécilia Brun

    Full Text Available Cutaneous wound healing requires keratinocyte proliferation, migration and differentiation to restore the barrier function of the skin. The calcineurin/nuclear factor of activated-T-cell (NFAT signaling pathway has been recently shown to be involved in keratinocyte growth, differentiation and migration. It is induced by an increased intracellular calcium rate and its inhibition results in decreased capacities of keratinocytes to migrate. Nevertheless, the link between calcineurin activation and keratinocyte migration remains unknown. Recently, Orai1, a pore subunit of a store-operated calcium channel that favors calcium influx, was shown to play a critical role to control proliferation and migration of basal keratinocytes. Of interest, the actin-bundling T-plastin is crucial in cell motility through cross-linking to actin filament and its synthesis was shown to be induced by calcium influx and regulated by the calcineurin/NFAT pathway in tumor Sezary cells. We investigated herein the role of the calcineurin/NFAT pathway-dependent T-plastin in keratinocyte migration, by quantifying T-plastin expression in keratinocytes and by analyzing their migration under calcineurin inhibition or knockdown of NFAT2 or T-plastin. We did confirm the role of the calcineurin/NFAT pathway in keratinocyte migration as shown by their decreased capacities to migrate after FK506 treatment or siNFAT2 transfection in both scratching and Boyden assays. The expression of NFAT2 and T-plastin in keratinocytes was decreased under FK506 treatment, suggesting that T-plastin plays a role in keratinocyte migration downstream to the calcineurin/NFAT pathway. Accordingly, siRNA knockdown of T-plastin expression also decreased their migration capacities. Actin lamellipodia formation as well as FAK and β6-integrin expression were also significantly decreased after treatment with FK506 or siRNA, reinforcing that NFAT2-dependent T-plastin expression plays a role in keratinocyte

  4. Direct biological effects of fractional ultrapulsed CO2 laser irradiation on keratinocytes and fibroblasts in human organotypic full-thickness 3D skin models.

    Science.gov (United States)

    Schmitt, L; Huth, S; Amann, P M; Marquardt, Y; Heise, R; Fietkau, K; Huth, L; Steiner, T; Hölzle, F; Baron, J M

    2018-05-01

    Molecular effects of various ablative and non-ablative laser treatments on human skin cells-especially primary effects on epidermal keratinocytes and dermal fibroblasts-are not yet fully understood. We present the first study addressing molecular effects of fractional non-sequential ultrapulsed CO 2 laser treatment using a 3D skin model that allows standardized investigations of time-dependent molecular changes ex vivo. While histological examination was performed to assess morphological changes, we utilized gene expression profiling using microarray and qRT-PCR analyses to identify molecular effects of laser treatment. Irradiated models exhibited dose-dependent morphological changes resulting in an almost complete recovery of the epidermis 5 days after irradiation. On day 5 after laser injury with a laser fluence of 100 mJ/cm 2 , gene array analysis identified an upregulation of genes associated with tissue remodeling and wound healing (e.g., COL12A1 and FGF7), genes that are involved in the immune response (e.g., CXCL12 and CCL8) as well as members of the heat shock protein family (e.g., HSPB3). On the other hand, we detected a downregulation of matrix metalloproteinases (e.g., MMP3), differentiation markers (e.g., LOR and S100A7), and the pro-inflammatory cytokine IL1α.Overall, our findings substantiate the understanding of time-dependent molecular changes after CO 2 laser treatment. The utilized 3D skin model system proved to be a reliable, accurate, and reproducible tool to explore the effects of various laser settings both on skin morphology and gene expression during wound healing.

  5. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  6. Bathing in carbon dioxide-enriched water alters protein expression in keratinocytes of skin tissue in rats

    Science.gov (United States)

    Kälsch, Julia; Pott, Leona L.; Takeda, Atsushi; Kumamoto, Hideo; Möllmann, Dorothe; Canbay, Ali; Sitek, Barbara; Baba, Hideo A.

    2017-04-01

    Beneficial effects of balneotherapy using naturally occurring carbonated water (CO2 enriched) have been known since the Middle Ages. Although this therapy is clinically applied for peripheral artery disease and skin disorder, the underlying mechanisms are not fully elucidated.

  7. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  8. A comparative study of spray keratinocytes and autologous meshed split-thickness skin graft in the treatment of acute burn injuries.

    Science.gov (United States)

    Sood, Rajiv; Roggy, David Edward; Zieger, Madeline Jane; Nazim, Muhammad; Hartman, Brett Colby; Gibbs, Jeff Thomas

    2015-02-01

    ReCell (Avita Medical, Northridge, CA) is an autologous cell harvesting (ACH) device that enables a thin split-thickness skin biopsy to be processed to produce a cell population that includes a mixed population of keratinocytes, melanocytes, Langerhans cells, and papillary dermal fibroblasts for immediate delivery via a spray applicator onto a prepared skin surface. In this Institutional Review Board-approved US Food and Drug Administration phase 2 study, the authors prospectively evaluated the treatment of partial-thickness burns in patients with two 320 cm2 areas, 1 area treated with the ACH device and the other with a meshed split-thickness skin graft (MSTSG) as a control. The authors compared the treatment areas for graft take, pigmentation, and color match to surrounding healthy tissue, scarring, and pain. In this preliminary study, 10 patients were treated with this protocol. Eight patients had 100% take to both treatment areas and 2 patients had significant non-take and graft loss attributable to underexcised wound beds and difficulty with the spray applicator. Pigmentation and color match ratings were identical at week 52 and the Modified Vancouver Scar Scale scores were comparable. One subject rated the autologous cell harvesting site as having a better appearance, while the remaining subjects rated their ACH and MSTSG sites' appearances as being comparable. In early follow-up visits, pain ratings were slightly elevated in the ACH group due to graft healing; however, in visits following week 2, pain ratings at the ACH and MSTSG sites were rated similarly by all patients. This preliminary report describes an early experience with the ACH device and the treatment of partial-thickness burn injuries. In this 10-patient series, patients benefitted from having a decreased donor site size and comparable outcomes with MSTSG treatment. While this preliminary underpowered study has provided positive results, there is a learning curve with choosing the proper wound

  9. Leptin promotes wound healing in the skin.

    Directory of Open Access Journals (Sweden)

    Susumu Tadokoro

    Full Text Available Leptin, a 16 kDa anti-obesity hormone, exhibits various physiological properties. Interestingly, skin wound healing was proven to delay in leptin-deficient ob/ob mice. However, little is known on the mechanisms of this phenomenon. In this study, we attempted to elucidate a role of leptin in wound healing of skin.Immunohistochemical analysis was performed to confirm the expression of the leptin receptor (Ob-R in human and mouse skin. Leptin was topically administered to chemical wounds created in mouse back skin along with sustained-release absorbable hydrogel. The process of wound repair was histologically observed and the area of ulceration was measured over time. The effect of leptin on the proliferation, differentiation and migration of human epidermal keratinocytes was investigated.Ob-R was expressed in epidermal cells of human and mouse skin. Topical administration of leptin significantly promoted wound healing. Histological analysis showed more blood vessels in the dermal connective tissues in the leptin-treated group. The proliferation, differentiation/function and migration of human epidermal keratinocytes were enhanced by exogenous leptin.Topically administered leptin was proven to promote wound healing in the skin by accelerating proliferation, differentiation/function and migration of epidermal keratinocytes and enhancing angiogenesis around the wounded area. These results strongly suggest that topical administration of leptin may be useful as a treatment to promote wound healing in the skin.

  10. Deoxynivalenol induced mouse skin cell proliferation and inflammation via MAPK pathway

    International Nuclear Information System (INIS)

    Mishra, Sakshi; Tripathi, Anurag; Chaudhari, Bhushan P.; Dwivedi, Premendra D.; Pandey, Haushila P.; Das, Mukul

    2014-01-01

    Several toxicological manifestations of deoxynivalenol (DON), a mycotoxin, are well documented; however, dermal toxicity is not yet explored. The effect of topical application of DON to mice was studied using markers of skin proliferation, inflammation and tumor promotion. Single topical application of DON (84–672 nmol/mouse) significantly enhanced dermal hyperplasia and skin edema. DON (336 and 672 nmol) caused significant enhancement in [ 3 H]-thymidine uptake in DNA along with increased myeloperoxidase and ornithine decarboxylase activities, suggesting tissue inflammation and cell proliferation. Furthermore, DON (168 nmol) caused enhanced expression of RAS, and phosphorylation of PI3K/Akt, ERK, JNK and p38 MAPKs. DON exposure also showed activation of transcription factors, c-fos, c-jun and NF-κB along with phosphorylation of IkBα. Enhanced phosphorylation of NF-κB by DON caused over expression of target proteins, COX-2, cyclin D1 and iNOS in skin. Though a single topical application of DMBA followed by twice weekly application of DON (84 and 168 nmol) showed no tumorigenesis after 24 weeks, however, histopathological studies suggested hyperplasia of the epidermis and hypertrophy of hair follicles. Interestingly, intestine was also found to be affected as enlarged Peyer's patches were observed, suggesting inflammatory effects which were supported by elevation of inflammatory cytokines after 24 weeks of topical application of DON. These results suggest that DON induced cell proliferation in mouse skin is through the activation of MAPK signaling pathway involving transcription factors NFκB and AP-1, further leading to transcriptional activation of downstream target proteins c-fos, c-jun, cyclin D1, iNOS and COX-2 which might be responsible for its inflammatory potential. - Highlights: • Topical application of DON enhanced epidermal inflammation and cell proliferation. • DON follows PI3K/Akt/MAPK signaling cascade, with activation of AP-1 and NF

  11. Neurohumoral mechanisms of keratinocytes regulation in diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Ekaterina Viktorovna Artemova

    2016-12-01

    Full Text Available The extent of damage to the nervous, vascular and microcirculatory systems in diabetic patients determine the regulation of physiological events that lead to the formation of chronic wounds, reduction of patient quality of life and increase of the financial value of medical care. Successful physiological repair is impossible without the successive phases of inflammation, proliferation and wound healing. Keratinocytes are the major cellular barrier components of the epidermis. These cells play an important role in physiological repair, as suggested by recent research, with many cells able to secrete steroid hormones de novo. Damage to the integrity of the skin leads to keratinocyte activation, triggering a cascade of reactions that contribute to changes in epidermal cell phenotype and lead to their proliferation and migration, analogous to changes in cellular adhesion and configuration of the cytoskeleton. An open question remains as to how the keratinocyte cell cycle, which is altered under conditions of hyperglycemia, and neurotransmitter metabolism during different stages of physiological repair are regulated. Understanding these processes will provide a scientific basis for the development of new targets for pharmacotherapies.

  12. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi; Kotani, Eiji; Hirano, Tomoko; Nakajima, Yumiko; Matsumoto, Goichi; Mori, Hajime

    2014-01-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  13. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  14. RhoA is dispensable for skin development, but crucial for contraction and directed migration of keratinocytes

    DEFF Research Database (Denmark)

    Jackson, Ben; Peyrollier, Karine; Pedersen, Esben

    2011-01-01

    RhoA is a small guanosine-5'-triphosphatase (GTPase) suggested to be essential for cytokinesis, stress fiber formation, and epithelial cell-cell contacts. In skin, loss of RhoA was suggested to underlie pemphigus skin blistering. To analyze RhoA function in vivo, we generated mice with a keratino......RhoA is a small guanosine-5'-triphosphatase (GTPase) suggested to be essential for cytokinesis, stress fiber formation, and epithelial cell-cell contacts. In skin, loss of RhoA was suggested to underlie pemphigus skin blistering. To analyze RhoA function in vivo, we generated mice......-cell contacts. Furthermore we observed increased cell spreading due to impaired RhoA-ROCK (Rho-associated protein kinase)-MLC phosphatase-MLC-mediated cell contraction, independent of Rac1. Rho-inhibiting toxins further increased multinucleation of RhoA-null cells but had no significant effect on spreading......, suggesting that RhoB and RhoC have partially overlapping functions with RhoA. Loss of RhoA decreased directed cell migration in vitro caused by reduced migration speed and directional persistence. These defects were not related to the decreased cell contraction and were independent of ROCK, as ROCK...

  15. Barrier abnormalities and keratinocyte-derived cytokine cascade after cessation of long-term topical glucocorticosteroid on hairless mouse skin

    Directory of Open Access Journals (Sweden)

    Tzu-Kai Lin

    2015-06-01

    Conclusion: An epidermis-derived cytokine cascade was observed following TCS-induced barrier disruption, which is similar to that from permeability barrier insults by acetone or tape stripping. The study suggests that concurrent application of skin care products during TCS treatment improves barrier homeostasis, and should become a standard practice to alleviate TCS-induced WD.

  16. Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuo Ido

    Full Text Available The aging process is perceived as resulting from a combination of intrinsic factors such as changes in intracellular signaling and extrinsic factors, most notably environmental stressors. In skin, the relationship between intrinsic changes and keratinocyte function is not clearly understood. Previously, we found that increasing the activity of AMP-activated protein kinase (AMPK suppressed senescence in hydrogen peroxide (H2O2-treated human primary keratinocytes, a model of oxidative stress-induced cellular aging. Using this model in the present study, we observed that resveratrol, an agent that increases the activities of both AMPK and sirtuins, ameliorated two age-associated phenotypes: cellular senescence and proliferative dysfunction. In addition, we found that treatment of keratinocytes with Ex527, a specific inhibitor of sirtuin 1 (SIRT1, attenuated the ability of resveratrol to suppress senescence. In keeping with the latter observation, we noted that compared to non-senescent keratinocytes, senescent cells lacked SIRT1. In addition to these effects on H2O2-induced senescence, resveratrol also prevented the H2O2-induced decrease in proliferation (as indicated by 3H-thymidine incorporation in the presence of insulin. This effect was abrogated by inhibition of AMPK but not SIRT1. Compared to endothelium, we found that human keratinocytes expressed relatively high levels of Forkhead box O3 (FOXO3, a downstream target of both AMPK and SIRT1. Treatment of keratinocytes with resveratrol transactivated FOXO3 and increased the expression of its target genes including catalase. Resveratrol's effects on both senescence and proliferation disappeared when FOXO3 was knocked down. Finally, we performed an exploratory study which showed that skin from humans over 50 years old had lower AMPK activity than skin from individuals under age 20. Collectively, these findings suggest that the effects of resveratrol on keratinocyte senescence and proliferation

  17. Enzymatic hydrolysis of Grass Carp fish skin hydrolysates able to promote the proliferation of Streptococcus thermophilus.

    Science.gov (United States)

    Wang, Xiao-Nan; Qin, Mei; Feng, Yu-Ying; Chen, Jian-Kang; Song, Yi-Shan

    2017-09-01

    The promotion effect on proliferation of Streptococcus thermophilus by enzymatic hydrolysates of aquatic products was firstly studied. The effect of influencing factors of the hydrolysis on the growth of S. thermophilus was investigated. Grass Carp fish skin was hydrolysed to peptides by enzymatic hydrolysis using protease ProteAX, and for the S. thermophilus growth, the optimal enzymatic hydrolysis conditions were temperature of 60 °C, initial pH of 9.0, enzyme concentration of 10 g kg -1 , hydrolysis time of 80 min, and ratio of material to liquid of 1:2. The Grass Carp fish skin hydrolysate (GCFSH) prepared under the optimum conditions was fractionated to five fragments (GCFSH 1, GCFSH 2, GCFSH 3, GCFSH 4, GCFSH 5) according to molecular weight sizes, in which the fragments GCFSH 4 and GCFSH 5, with molecular weights of less than 1000 Da, significantly promoted the growth of S. thermophilus. The hydrolysis process of Grass Carp fish skin can be simplified, and the peptides with molecular weights below 1000 Da in the hydrolysates are the best nitrogen source for proliferation of S. thermophilus. This work can provide a fundamental theoretical basis for the production of multi-component functional foods, especially in milk drinks or yogurt. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  18. Extracorporal Shock Waves Activate Migration, Proliferation and Inflammatory Pathways in Fibroblasts and Keratinocytes, and Improve Wound Healing in an Open-Label, Single-Arm Study in Patients with Therapy-Refractory Chronic Leg Ulcers.

    Science.gov (United States)

    Aschermann, Ilknur; Noor, Seema; Venturelli, Sascha; Sinnberg, Tobias; Mnich, Christian D; Busch, Christian

    2017-01-01

    Chronic leg ulcers (CLUs) are globally a major cause of morbidity and mortality with increasing prevalence. Their treatment is highly challenging, and many conservative, surgical or advanced therapies have been suggested, but with little overall efficacy. Since the 1980s extracorporal shock wave therapy (ESWT) has gained interest as treatment for specific indications. Here, we report that patients with CLU showed wound healing after ESWT and investigated the underlying molecular mechanisms. We performed cell proliferation and migration assays, FACS- and Western blot analyses, RT-PCR, and Affymetrix gene expression analyses on human keratinocytes and fibroblasts, and a tube formation assay on human microvascular endothelial cells to assess the impact of shock waves in vitro. In vivo, chronic therapy-refractory leg ulcers were treated with ESWT, and wound healing was assessed. Upon ESWT, we observed morphological changes and increased cell migration of keratinocytes. Cell-cycle regulatory genes were upregulated, and proliferation induced in fibroblasts. This was accompanied by secretion of pro-inflammatory cytokines from keratinocytes, which are known to drive wound healing, and a pro-angiogenic activity of endothelial cells. These observations were transferred "from bench to bedside", and 60 consecutive patients with 75 CLUs with different pathophysiologies (e.g. venous, mixed arterial-venous, arterial) were treated with ESWT. In this setting, 41% of ESWT-treated CLUs showed complete healing, 16% significant improvement, 35% improvement, and 8% of the ulcers did not respond to ESWT. The induction of healing was independent of patient age, duration or size of the ulcer, and the underlying pathophysiology. The efficacy of ESWT needs to be confirmed in controlled trials to implement ESWT as an adjunct to standard therapy or as a stand-alone treatment. Our results suggest that EWST may advance the treatment of chronic, therapy-refractory ulcers. © 2017 The Author

  19. Extracorporal Shock Waves Activate Migration, Proliferation and Inflammatory Pathways in Fibroblasts and Keratinocytes, and Improve Wound Healing in an Open-Label, Single-Arm Study in Patients with Therapy-Refractory Chronic Leg Ulcers

    Directory of Open Access Journals (Sweden)

    Ilknur Aschermann

    2017-02-01

    Full Text Available Background/Aims: Chronic leg ulcers (CLUs are globally a major cause of morbidity and mortality with increasing prevalence. Their treatment is highly challenging, and many conservative, surgical or advanced therapies have been suggested, but with little overall efficacy. Since the 1980s extracorporal shock wave therapy (ESWT has gained interest as treatment for specific indications. Here, we report that patients with CLU showed wound healing after ESWT and investigated the underlying molecular mechanisms. Methods: We performed cell proliferation and migration assays, FACS- and Western blot analyses, RT-PCR, and Affymetrix gene expression analyses on human keratinocytes and fibroblasts, and a tube formation assay on human microvascular endothelial cells to assess the impact of shock waves in vitro. In vivo, chronic therapy-refractory leg ulcers were treated with ESWT, and wound healing was assessed. Results: Upon ESWT, we observed morphological changes and increased cell migration of keratinocytes. Cell-cycle regulatory genes were upregulated, and proliferation induced in fibroblasts. This was accompanied by secretion of pro-inflammatory cytokines from keratinocytes, which are known to drive wound healing, and a pro-angiogenic activity of endothelial cells. These observations were transferred “from bench to bedside”, and 60 consecutive patients with 75 CLUs with different pathophysiologies (e.g. venous, mixed arterial-venous, arterial were treated with ESWT. In this setting, 41% of ESWT-treated CLUs showed complete healing, 16% significant improvement, 35% improvement, and 8% of the ulcers did not respond to ESWT. The induction of healing was independent of patient age, duration or size of the ulcer, and the underlying pathophysiology. Conclusions: The efficacy of ESWT needs to be confirmed in controlled trials to implement ESWT as an adjunct to standard therapy or as a stand-alone treatment. Our results suggest that EWST may advance the

  20. A novel DLX3-PKC integrated signaling network drives keratinocyte differentiation.

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-Wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-04-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  1. Diffuse colonies of human skin fibroblasts in relation to cellular senescence and proliferation.

    Science.gov (United States)

    Zorin, Vadim; Zorina, Alla; Smetanina, Nadezhda; Kopnin, Pavel; Ozerov, Ivan V; Leonov, Sergey; Isaev, Artur; Klokov, Dmitry; Osipov, Andreyan N

    2017-05-16

    Development of personalized skin treatment in medicine and skin care may benefit from simple and accurate evaluation of the fraction of senescent skin fibroblasts that lost their proliferative capacity. We examined whether enriched analysis of colonies formed by primary human skin fibroblasts, a simple and widely available cellular assay, could reveal correlations with the fraction of senescent cells in heterogenic cell population. We measured fractions of senescence associated β-galactosidase (SA-βgal) positive cells in either mass cultures or colonies of various morphological types (dense, mixed and diffuse) formed by skin fibroblasts from 10 human donors. Although the donors were chosen to be within the same age group (33-54 years), the colony forming efficiency of their fibroblasts (ECO-f) and the percentage of dense, mixed and diffuse colonies varied greatly among the donors. We showed, for the first time, that the SA-βgal positive fraction was the largest in diffuse colonies, confirming that they originated from cells with the least proliferative capacity. The percentage of diffuse colonies was also found to correlate with the SA-βgal positive cells in mass culture. Using Ki67 as a cell proliferation marker, we further demonstrated a strong inverse correlation (r=-0.85, p=0.02) between the percentage of diffuse colonies and the fraction of Ki67+ cells. Moreover, a significant inverse correlation (r=-0.94, p=0.0001) between the percentage of diffuse colonies and ECO-f was found. Our data indicate that quantification of a fraction of diffuse colonies may provide a simple and useful method to evaluate the extent of cellular senescence in human skin fibroblasts.

  2. Hydrogen-enriched water restoration of impaired calcium propagation by arsenic in primary keratinocytes

    Science.gov (United States)

    Yu, Wei-Tai; Chiu, Yi-Ching; Lee, Chih-Hung; Yoshioka, Tohru; Yu, Hsin-Su

    2013-11-01

    Endemic contamination of artesian water for drinking by arsenic is known to cause several human cancers, including cancers of the skin, bladder, and lungs. In skin, multiple arsenic-induced Bowen's disease (As-BD) can develop into invasive cancers after decades of arsenic exposure. The characteristic histological features of As-BD include full-layer epidermal dysplasia, apoptosis, and abnormal proliferation. Calcium propagation is an essential cellular event contributing to keratinocyte differentiation, proliferation, and apoptosis, all of which occur in As-BD. This study investigated how arsenic interferes calcium propagation of skin keratinocytes through ROS production and whether hydrogen-enriched water would restore arsenic-impaired calcium propagation. Arsenic was found to induce oxidative stress and inhibit ATP- and thapsigaragin-induced calcium propagation. Pretreatment of arsenic-treated keratinocytes by hydrogen-enriched water or beta-mercaptoethanol with potent anti-oxidative effects partially restored the propagation of calcium by ATP and by thapsigaragin. It was concluded that arsenic may impair calcium propagation, likely through oxidative stress and interactions with thiol groups in membrane proteins.

  3. Treatment of burn injuries with keratinocyte cultures

    International Nuclear Information System (INIS)

    Syring, C.; Maenig, H.J.; Von Versen, R.; Bruck, J.

    1999-01-01

    The German Institute for Cell and Tissue Replacement (DIZG) provides burned patients with skin and amnion for a temporary wound closure. Severely burned patients (>60% BSA for adults, >40% BSA for children) were supplied with autologous and allogenic grafts from cultured keratinocytes. The keratinocyte culture is done under GMP-conditions using the method of Rheinwald and Green. The 3T3 fibroblasts were irradiated with 60 Gy and used as feeder cells to produce keratinocyte sheets within 3 weeks. In this time up to 6.000 cm are available. The sheets were harvested by detachment with dispase (1,2 U/ml), fixed to gauze and transported to the hospital. The DIZG has a 3 years experience in the treatment of burns with keratinocyte sheets. The sheets were transplanted to patients in different hospitals, the total transplanted area is about 30.000 cm. This paper describes the experiences with ten severely burned patients treated with keratinocyte sheet

  4. Alterations of epidermal proliferation and cytokeratin expression in skin biopsies from heavy draught horses with chronic pastern dermatitis.

    Science.gov (United States)

    Geburek, Florian; Ohnesorge, Bernhard; Deegen, Eckehard; Doeleke, Renate; Hewicker-Trautwein, Marion

    2005-12-01

    We report the historical, clinical and histopathological characteristics of skin lesions in biopsies from 37 heavy draught horses with chronic pastern dermatitis. The skin lesions were divided into four macroscopic groups: scaling (group I, n=5), hyperkeratotic and hyperplastic plaque-like lesions (group II, n=14), nodular skin masses (group III, n=16) and verrucous skin lesions (group IV, n=2). The principal histological findings were hyperkeratosis and epidermal hyperplasia. There was a gradual increase in epidermal hyperplasia from groups I to IV, suggesting that the lesions represent different stages of disease. In all cases, there was perivascular dermatitis dominated by T lymphocytes with an increase in MHC class II-positive dendritic-like cells. Immunohistochemical labelling for cytokeratins CK5/6(4), CK10 and CK14 indicated a change in their expression pattern. This correlated with the degree of epidermal hyperplasia, indicating abnormal differentiation of keratinocytes. There was a statistically significant correlation between the severity of skin lesions and several other factors including increasing age, increasing cannon circumference, prominence of anatomical structures such as fetlock tufts of hairs, ergots and chestnuts, and bulges in the fetlock region.

  5. Upregulation of cathepsin S in psoriatic keratinocytes.

    Science.gov (United States)

    Schönefuss, Alexander; Wendt, Wiebke; Schattling, Benjamin; Schulten, Roxane; Hoffmann, Klaus; Stuecker, Markus; Tigges, Christian; Lübbert, Hermann; Stichel, Christine

    2010-08-01

    Cathepsin S (CATS) is a cysteine protease, well known for its role in MHC class II-mediated antigen presentation and extracellular matrix degradation. Disturbance of the expression or metabolism of this protease is a concomitant feature of several diseases. Given this importance we studied the localization and regulation of CATS expression in normal and pathological human/mouse skin. In normal human skin CATS-immunostaining is mainly present in the dermis and is localized in macrophages, Langerhans, T- and endothelial cells, but absent in keratinocytes. In all analyzed pathological skin biopsies, i.e. atopic dermatitis, actinic keratosis and psoriasis, CATS staining is strongly increased in the dermis. But only in psoriasis, CATS-immunostaining is also detectable in keratinocytes. We show that cocultivation with T-cells as well as treatment with cytokines can trigger expression and secretion of CATS, which is involved in MHC II processing in keratinocytes. Our data provide first evidence that CATS expression (i) is selectively induced in psoriatic keratinocytes, (ii) is triggered by T-cells and (iii) might be involved in keratinocytic MHC class II expression, the processing of the MHC class II-associated invariant chain and remodeling of the extracellular matrix. This paper expands our knowledge on the important role of keratinocytes in dermatological disease.

  6. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  7. Evaluation of the effect of radiation levels and dose rates in irradiation of murine fibroblasts used as a feeder layer in the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Almeida, Tiago L.; Santin, Stefany Plumeri; Somessari, Elizabeth S.R.; Silveira, Carlos G. da; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2009-01-01

    In 1975, Rheinwald and Green published an effective methodology for obtaining and cultivating human keratinocytes. This methodology consisted of seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate of which is then controlled through the action of ionizing radiation. The presence of the feeder layer encourages the development of keratinocyte colonies and their propagation in similar cultures, becoming possible several clinical applications as skin substitutes or wound dressings in situations such as post burn extensive skin loss and other skin disorders. However, good development of these keratinocytes depends on a high quality feeder layer among other factors. In the present work, we evaluated the relationship between radiation levels and dose rates applied to fibroblasts used in construction of feeder layers and the radiation effect on keratinocytes colonies forming efficiency. Results indicate 3T3 lineage murine fibroblasts irradiated with doses varying between 60 and 100 Gy can be used as a feeder layer immediately after irradiation or storage of the irradiated cells in suspension at 4 g C for 24 hours with similar results. The exception is when the irradiation dose rate is 2.75 Gyh -1 ; in this case, results suggested that the fibroblasts should be used immediately after irradiation. (author)

  8. Keratinocyte Motility Is Affected by UVA Radiation—A Comparison between Normal and Dysplastic Cells

    Directory of Open Access Journals (Sweden)

    Cristina M. Niculiţe

    2018-06-01

    Full Text Available UVA radiation induces multiple and complex changes in the skin, affecting epidermal cell behavior. This study reports the effects of UVA exposure on normal (HaCaT and dysplastic (DOK keratinocytes. The adherence, spreading and proliferation were investigated by time-lapse measurement of cell layer impedance on different matrix proteins. Prior to UVA exposure, the time required for adherence and spreading did not differ significantly for HaCaT and DOK cells, while spreading areas were larger for HaCaT cells. Under UVA exposure, HaCaT and DOK cells behavior differed in terms of movement and proliferation. The cells’ ability to cover the denuded surface and individual cell trajectories were recorded by time-lapse videomicroscopy, during wound healing experiments. Dysplastic keratinocytes showed more sensitivity to UVA, exhibiting transient deficiencies in directionality of movement and a delay in re-coating the denuded area. The actin cytoskeleton displayed a cortical organization immediately after irradiation, in both cell lines, similar to mock-irradiated cells. Post-irradiation, DOK cells displayed a better organization of stress fibers, persistent filopodia, and new, stronger focal contacts. In conclusion, after UVA exposure HaCaT and DOK cells showed a different behavior in terms of adherence, spreading, motility, proliferation, and actin cytoskeleton dynamics, with the dyplastic keratinocytes being more sensitive.

  9. Experimental model of cultured keratinocytes Modelo experimental de cultura de queratinócitos

    Directory of Open Access Journals (Sweden)

    Alfredo Gragnani

    2003-01-01

    Full Text Available The bioengineering research is essential in the development of ideal combination of biomaterials and cultured cells to produce the permanent wound coverage. The experimental model of cultured keratinocytes presents all steps of the culture, since the isolation of the keratinocytes, preparation of the human acellular dermis, preparation of the composite skin graft and their elevation to the air-liquid interface. The research in cultured keratinocytes model advances in two main ways: 1. optimization of the methods in vitro to the skin cells culture and proliferation and 2. developing biomaterials that present similar skin properties.A pesquisa em bioengenharia é primordial no desenvolvimento da combinação ideal de biomateriais e células cultivadas para produzir a cobertura definitiva das lesões. O modelo experimental da cultura de queratinócitos apresenta toda as etapas do cultivo, desde o isolamento dos queratinócitos, preparação da derme acelular humana, do enxerto composto e da sua elevação à interface ar-líquido. A pesquisa em modelo de cultura de queratinócitos desenvolve-se em duas vias principais: 1. otimização dos métodos in vitro para cultivo e proliferação de células da pele e 2. desenvolvimento de biomateriais que mimetizem as propriedades da pele.

  10. Y chromosome and vimentin used to trace the fate of allogeneic keratinocytes delivered to the wound by the recombined human/pig skin

    Czech Academy of Sciences Publication Activity Database

    Pokorná, Eva; Brož, L.; Veselý, Pavel; Matoušková, Eva

    2001-01-01

    Roč. 47, č. 4 (2001), s. 128-134 ISSN 0015-5500 R&D Projects: GA MZd IZ4368; GA MZd NK6126 Keywords : allogeneic keratinocytes * xenodermis * Y-chromosome FISH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.519, year: 2001

  11. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  12. CDH1 regulates E2F1 degradation in response to differentiation signals in keratinocytes.

    Science.gov (United States)

    Singh, Randeep K; Dagnino, Lina

    2017-01-17

    The E2F1 transcription factor plays key roles in skin homeostasis. In the epidermis, E2F1 expression is essential for normal proliferation of undifferentiated keratinocytes, regeneration after injury and DNA repair following UV radiation-induced photodamage. Abnormal E2F1 expression promotes nonmelanoma skin carcinoma. In addition, E2F1 must be downregulated for proper keratinocyte differentiation, but the relevant mechanisms involved remain poorly understood. We show that differentiation signals induce a series of post-translational modifications in E2F1 that are jointly required for its downregulation. Analysis of the structural determinants that govern these processes revealed a central role for S403 and T433. In particular, substitution of these two amino acid residues with non-phosphorylatable alanine (E2F1 ST/A) interferes with E2F1 nuclear export, K11- and K48-linked polyubiquitylation and degradation in differentiated keratinocytes. In contrast, replacement of S403 and T433 with phosphomimetic aspartic acid to generate a pseudophosphorylated E2F1 mutant protein (E2F1 ST/D) generates a protein that is regulated in a manner indistinguishable from that of wild type E2F1. Cdh1 is an activating cofactor that interacts with the anaphase-promoting complex/cyclosome (APC/C) ubiquitin E3 ligase, promoting proteasomal degradation of various substrates. We found that Cdh1 associates with E2F1 in keratinocytes. Inhibition or RNAi-mediated silencing of Cdh1 prevents E2F1 degradation in response to differentiation signals. Our results reveal novel regulatory mechanisms that jointly modulate post-translational modifications and downregulation of E2F1, which are necessary for proper epidermal keratinocyte differentiation.

  13. Sustained phenotypic reversion of junctional epidermolysis bullosa dog keratinocytes: Establishment of an immunocompetent animal model for cutaneous gene therapy

    International Nuclear Information System (INIS)

    Spirito, Flavia; Capt, Annabelle; Rio, Marcela Del; Larcher, Fernando; Guaguere, Eric; Danos, Olivier; Meneguzzi, Guerrino

    2006-01-01

    Gene transfer represents the unique therapeutic issue for a number of inherited skin disorders including junctional epidermolysis bullosa (JEB), an untreatable genodermatose caused by mutations in the adhesion ligand laminin 5 (α3β3γ2) that is secreted in the extracellular matrix by the epidermal basal keratinocytes. Because gene therapy protocols require validation in animal models, we have phenotypically reverted by oncoretroviral transfer of the curative gene the keratinocytes isolated from dogs with a spontaneous form of JEB associated with a genetic mutation in the α3 chain of laminin 5. We show that the transduced dog JEB keratinocytes: (1) display a sustained secretion of laminin 5 in the extracellular matrix; (2) recover the adhesion, proliferation, and clonogenic capacity of wild-type keratinocytes; (3) generate fully differentiated stratified epithelia that after grafting on immunocompromised mice produce phenotypically normal skin and sustain permanent expression of the transgene. We validate an animal model that appears particularly suitable to demonstrate feasibility, efficacy, and safety of genetic therapeutic strategies for cutaneous disorders before undertaking human clinical trials

  14. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    National Research Council Canada - National Science Library

    McCormack-Brown, Stephanie

    2008-01-01

    .... There is no published data on AL NP toxicity effects on human skin. This research used in vitro techniques to determine the cytotoxicity of AL NPs, sized 50, 80, and 120 nm, on human keratinocytes...

  15. Shining a Light on Black Holes in Keratinocytes.

    Science.gov (United States)

    Bowman, Shanna L; Marks, Michael S

    2018-03-01

    The mechanisms by which melanins are transferred from melanocytes and stored within keratinocytes to generate skin pigmentation are hotly debated. Correia et al. and Hurbain et al. provide evidence that melanin cores of melanosomes are secreted from melanocytes and taken up and stored within non-degradative membranous organelles in keratinocytes in the basal epidermis of human skin. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Chronologic and actinically induced aging in human facial skin

    International Nuclear Information System (INIS)

    Gilchrest, B.A.; Szabo, G.; Flynn, E.; Goldwyn, R.M.

    1983-01-01

    Clinical and histologic stigmata of aging are much more prominent in habitually sun-exposed skin than in sun-protected skin, but other possible manifestations of actinically induced aging are almost unexplored. We have examined the interrelation of chronologic and actinic aging using paired preauricular (sun-exposed) and postauricular (sun-protected) skin specimens. Keratinocyte cultures derived from sun-exposed skin consistently had a shorter in vitro lifespan but increased plating efficiency compared with cultures derived from adjacent sun-protected skin of the same individual, confirming a previous study of different paired body sites. Electron microscopic histologic sections revealed focal abnormalities of keratinocyte proliferation and alignment in vitro especially in those cultures derived from sun-exposed skin and decreased intercellular contact in stratified colonies at late passage, regardless of donor site. One-micron histologic sections of the original biopsy specimens revealed no striking site-related keratinocyte alterations, but sun-exposed specimens had fewer epidermal Langerhans cells (p less than 0.001), averaging approximately 50 percent the number in sun-protected skin, a possible exaggeration of the previously reported age-associated decrease in this cell population. These data suggest that sun exposure indeed accelerates aging by several criteria and that, regardless of mechanism, environmental factors may adversely affect the appearance and function of aging skin in ways amenable to experimental quantitation

  17. Construction of synthetic dermis and skin based on a self-assembled peptide hydrogel scaffold.

    Science.gov (United States)

    Kao, Bunsho; Kadomatsu, Koichi; Hosaka, Yoshiaki

    2009-09-01

    Using biocompatible peptide hydrogel as a scaffold, we prepared three-dimensional synthetic skin that does not contain animal-derived materials or pathogens. The present study investigated preparation methods, proliferation, and functional expression of fibroblasts in the synthetic dermis and differentiation of keratinocytes in the epidermis. Synthetic dermis was prepared by mixing fibroblasts with peptide hydrogel, and synthetic skin was prepared by forming an epidermal layer using keratinocytes on the synthetic dermis. A fibroblast-rich foamy layer consisting of homogeneous peptide hydrogel subsequently formed in the synthetic dermis, with fibroblasts aggregating in clusters within the septum. The epidermis consisted of three to five keratinocyte layers. Immunohistochemical staining showed human type I collagen, indicating functional expression around fibroblasts in the synthetic dermis, keratinocyte differentiation in the epidermis, and expression of basement membrane proteins. The number of fibroblasts tended to increase until the second week and was maintained until the fourth week, but rapidly decreased in the fifth week. In the synthetic dermis medium, the human type I collagen concentration increased after the second week to the fifth week. These findings suggest that peptide hydrogel acts as a synthetic skin scaffold that offers a platform for the proliferation and functional expression of fibroblasts and keratinocytes.

  18. Activation of Peroxisome Proliferator-Activated Receptor Alpha Improves Aged and UV-Irradiated Skin by Catalase Induction.

    Science.gov (United States)

    Shin, Mi Hee; Lee, Se-Rah; Kim, Min-Kyoung; Shin, Chang-Yup; Lee, Dong Hun; Chung, Jin Ho

    2016-01-01

    Peroxisome proliferator-activated receptor alpha (PPARα) is a nuclear hormone receptor involved in the transcriptional regulation of lipid metabolism, fatty acid oxidation, and glucose homeostasis. Its activation stimulates antioxidant enzymes such as catalase, whose expression is decreased in aged human skin. Here we investigated the expression of PPARα in aged and ultraviolet (UV)-irradiated skin, and whether PPARα activation can modulate expressions of matrix metalloproteinase (MMP)-1 and procollagen through catalase regulation. We found that PPARα mRNA level was significantly decreased in intrinsically aged and photoaged human skin as well as in UV-irradiated skin. A PPARα activator, Wy14643, inhibited UV-induced increase of MMP-1 and decrease of procollagen expression and caused marked increase in catalase expression. Furthermore, production of reactive oxygen species (ROS) was suppressed by Wy14643 in UV-irradiated and aged dermal fibroblasts, suggesting that the PPARα activation-induced upregulation of catalase leads to scavenging of ROS produced due to UV irradiation or aging. PPARα knockdown decreased catalase expression and abolished the beneficial effects of Wy14643. Topical application of Wy14643 on hairless mice restored catalase activity and prevented MMP-13 and inflammatory responses in skin. Our findings indicate that PPARα activation triggers catalase expression and ROS scavenging, thereby protecting skin from UV-induced damage and intrinsic aging.

  19. FLAX OIL FROM TRANSGENIC LINUM USITATISSIMUM SELECTIVELY INHIBITS IN VITRO PROLIFERATION OF HUMAN CANCER CELL LINES.

    Science.gov (United States)

    Gebarowski, Tomasz; Gebczak, Katarzyna; Wiatrak, Benita; Kulma, Anna; Pelc, Katarzyna; Czuj, Tadeusz; Szopa, Jan; Gasiorowski, Kazimierz

    2017-03-01

    Emulsions made of oils from transgenic flaxseeds significantly decreased in vitro proliferation of six tested human cancer cell lines in 48-h cultures, as assessed with the standard sulforhodamine assay. However, the emulsions also increased proliferation rate of normal human dermal fibroblasts and, to a lower extend, of keratinocytes. Both inhibition of in vitro proliferation of human cancer cell lines and stimulation of proliferation of normal dermal fibroblasts and keratinocytes were especially strong with the emulsion type B and with emulsion type M. Oils from seeds of transgenic flax type B and M should be considered as valuable adjunct to standard cytostatic therapy of human cancers and also could be applied to improve the treatment of skin lesions in wound healing.

  20. Novel 11β-hydroxysteroid dehydrogenase 1 inhibitors reduce cortisol levels in keratinocytes and improve dermal collagen content in human ex vivo skin after exposure to cortisone and UV.

    Directory of Open Access Journals (Sweden)

    Stéphanie M Boudon

    Full Text Available Activity and selectivity assessment of new bi-aryl amide 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1 inhibitors, prepared in a modular manner via Suzuki cross-coupling, are described. Several compounds inhibiting 11β-HSD1 at nanomolar concentrations were identified. Compounds 2b, 3e, 7b and 12e were shown to selectively inhibit 11β-HSD1 over 11β-HSD2, 17β-HSD1 and 17β-HSD2. These inhibitors also potently inhibited 11β-HSD1 activity in intact HEK-293 cells expressing the recombinant enzyme and in intact primary human keratinocytes expressing endogenous 11β-HSD1. Moreover, compounds 2b, 3e and 12e were tested for their activity in human skin biopsies. They were able to prevent, at least in part, both the cortisone- and the UV-mediated decreases in collagen content. Thus, inhibition of 11β-HSD1 by these compounds can be further investigated to delay or prevent UV-mediated skin damage and skin aging.

  1. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  2. Ultraviolet Radiation Increases the Toxicity of Pyrene, 1-Aminopyrene and 1-Hydroxypyrene to Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Huey-Min Hwang

    2005-04-01

    Full Text Available Over the past several years, a great deal of interest has been focused on the harmful effects of ultraviolet (UV radiation to human skin. UV light has been implicated in aging, sunburn and skin cancer. Few studies, however, have been done to determine the effects that UV light, in conjunction with other environmental contaminants, may have on human skin. Polycyclic Aromatic Hydrocarbons (PAHs are a class of compounds that have been reported to be toxic, mutagenic and carcinogenic to many eukaryotic organisms. UV light is also known to increase the toxicity of PAHs through photo-activation and photo-modification. The purpose of this study was to assess the effects of UV-A irradiated pyrene (Pyr, 1-aminopyrene (1-AP and 1-hydroxypyrene (1-HP on human keratinocytes, the skin primary site of UV irradiated PAH exposure. Our findings indicate that simultaneous treatment of human keratinocyte cell line, HaCaT, with 1.0μg/ml pyrene, 1-AP or 1-HP and 3.9 J/cm2/min UV-A light resulted in significant inhibition of cell proliferation. Approximately 100% of the cells died in the case of UV-A irradiated 1-AP and 1-HP. In the case of UV-A irradiated pyrene, more than 70% of the cells died, indicating that UV-A is able to transform these PAHs into more harmful intermediates.

  3. A novel DLX3–PKC integrated signaling network drives keratinocyte differentiation

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-01-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  4. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  5. Calcipotriol inhibits the proliferation of hyperproliferative CD29 positive keratinocytes in psoriatic epidermis in the absence of an effect on the function and number of antigen-presenting cells

    DEFF Research Database (Denmark)

    Jensen, A.M.; Llado, Minna Fyhn Lykke; Skov, L.

    1998-01-01

    The aim of this study was to elucidate some of the possible mechanisms of action of the vitamin D analogue calcipotriol in vivo. Calcipotriol is finding increasing use in the treatment of psoriasis, but the primary target cell in vivo has not yet been identified. We treated psoriatic patients...... psoriatic and normal skin, calcipotriol treatment did not alter the capacity of epidermal antigen-presenting cells to stimulate the proliferation of autologous T cells, either in the absence or in the presence of exogenous antigen. Epidermal cell suspensions were analysed further by staining...... for infiltrating leucocytes (CD45+) and Langerhans cells (CD1a+). Flow cytometric analysis showed that calcipotriol did not alter the number of CD45+ cells or Langerhans cells in psoriatic skin. These results indicate that calcipotriol does not alter either the number of the function of epidermal antigen...

  6. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  7. UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes

    Science.gov (United States)

    Kraemer, Anne; Chen, I-Peng; Henning, Stefan; Faust, Alexandra; Volkmer, Beate; Atkinson, Michael J.; Moertl, Simone; Greinert, Ruediger

    2013-01-01

    MicroRNA (miRNA)-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2), which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis. PMID:24391759

  8. Hyaluronate fragments reverse skin atrophy by a CD44-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Gürkan Kaya

    2006-12-01

    Full Text Available BACKGROUND: Skin atrophy is a common manifestation of aging and is frequently accompanied by ulceration and delayed wound healing. With an increasingly aging patient population, management of skin atrophy is becoming a major challenge in the clinic, particularly in light of the fact that there are no effective therapeutic options at present. METHODS AND FINDINGS: Atrophic skin displays a decreased hyaluronate (HA content and expression of the major cell-surface hyaluronate receptor, CD44. In an effort to develop a therapeutic strategy for skin atrophy, we addressed the effect of topical administration of defined-size HA fragments (HAF on skin trophicity. Treatment of primary keratinocyte cultures with intermediate-size HAF (HAFi; 50,000-400,000 Da but not with small-size HAF (HAFs; 400,000 Da induced wild-type (wt but not CD44-deficient (CD44-/- keratinocyte proliferation. Topical application of HAFi caused marked epidermal hyperplasia in wt but not in CD44-/- mice, and significant skin thickening in patients with age- or corticosteroid-related skin atrophy. The effect of HAFi on keratinocyte proliferation was abrogated by antibodies against heparin-binding epidermal growth factor (HB-EGF and its receptor, erbB1, which form a complex with a particular isoform of CD44 (CD44v3, and by tissue inhibitor of metalloproteinase-3 (TIMP-3. CONCLUSIONS: Our observations provide a novel CD44-dependent mechanism for HA oligosaccharide-induced keratinocyte proliferation and suggest that topical HAFi application may provide an attractive therapeutic option in human skin atrophy.

  9. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2011-01-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  10. Impaired hair follicle morphogenesis and polarized keratinocyte movement upon conditional inactivation of integrin-linked kinase in the epidermis.

    Science.gov (United States)

    Nakrieko, Kerry-Ann; Welch, Ian; Dupuis, Holly; Bryce, Dawn; Pajak, Agnieszka; St Arnaud, René; Dedhar, Shoukat; D'Souza, Sudhir J A; Dagnino, Lina

    2008-04-01

    Integrin-linked kinase (ILK) is key for cell survival, migration, and adhesion, but little is known about its role in epidermal development and homeostasis in vivo. We generated mice with conditional inactivation of the Ilk gene in squamous epithelia. These mice die perinatally and exhibit skin blistering and severe defects in hair follicle morphogenesis, including greatly reduced follicle numbers, failure to progress beyond very early developmental stages, and pronounced defects in follicular keratinocyte proliferation. ILK-deficient epidermis shows abnormalities in adhesion to the basement membrane and in differentiation. ILK-deficient cultured keratinocytes fail to attach and spread efficiently and exhibit multiple abnormalities in actin cytoskeletal organization. Ilk gene inactivation in cultured keratinocytes causes impaired ability to form stable lamellipodia, to directionally migrate, and to polarize. These defects are accompanied by abnormal distribution of active Cdc42 to cell protrusions, as well as reduced activation of Rac1 upon induction of cell migration in scraped keratinocyte monolayers. Significantly, alterations in cell spreading and forward movement in single cells can be rescued by expression of constitutively active Rac1 or RhoG. Our studies underscore a central and distinct role for ILK in hair follicle development and in polarized cell movements, two key aspects of epithelial morphogenesis and function.

  11. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  12. Genetic reversion of inherited skin disorders

    Energy Technology Data Exchange (ETDEWEB)

    Magnaldo, Thierry; Sarasin, Alain

    2002-11-30

    Human epidermis is a squamous stratified epithelium whose integrity relies on balanced processes of cell attachment, proliferation, and differentiation. In monogenic skin dermatoses, such as mecano-bullous diseases, or DNA repair deficiencies such as the xeroderma pigmentosum (XP), alterations of skin integrity may have devastating consequences as illustrated by the extremely high epidermal cancer proneness of XP patients. The lack of efficient pharmacological treatments, the easy accessibility of skin, and the possibility of long term culture and genetic manipulations ex vivo of epidermal keratinocytes, have encouraged approaches toward gene transfer and skin therapy prospects. We review here some of the human genetic disorders that exhibit major traits in skin, as well as requirements and difficulties inherent to approaches aimed at stable phenotypic correction.

  13. Defective channels lead to an impaired skin barrier.

    Science.gov (United States)

    Blaydon, Diana C; Kelsell, David P

    2014-10-15

    Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

  14. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  15. Mustard vesicants alter expression of the endocannabinoid system in mouse skin

    International Nuclear Information System (INIS)

    Wohlman, Irene M.; Composto, Gabriella M.; Heck, Diane E.; Heindel, Ned D.; Lacey, C. Jeffrey; Guillon, Christophe D.; Casillas, Robert P.; Croutch, Claire R.; Gerecke, Donald R.; Laskin, Debra L.; Joseph, Laurie B.; Laskin, Jeffrey D.

    2016-01-01

    Vesicants including sulfur mustard (SM) and nitrogen mustard (NM) are bifunctional alkylating agents that cause skin inflammation, edema and blistering. This is associated with alterations in keratinocyte growth and differentiation. Endogenous cannabinoids, including N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoyl glycerol (2-AG), are important in regulating inflammation, keratinocyte proliferation and wound healing. Their activity is mediated by binding to cannabinoid receptors 1 and 2 (CB1 and CB2), as well as peroxisome proliferator-activated receptor alpha (PPARα). Levels of endocannabinoids are regulated by fatty acid amide hydrolase (FAAH). We found that CB1, CB2, PPARα and FAAH were all constitutively expressed in mouse epidermis and dermal appendages. Topical administration of NM or SM, at concentrations that induce tissue injury, resulted in upregulation of FAAH, CB1, CB2 and PPARα, a response that persisted throughout the wound healing process. Inhibitors of FAAH including a novel class of vanillyl alcohol carbamates were found to be highly effective in suppressing vesicant-induced inflammation in mouse skin. Taken together, these data indicate that the endocannabinoid system is important in regulating skin homeostasis and that inhibitors of FAAH may be useful as medical countermeasures against vesicants. - Highlights: • Sulfur mustard and nitrogen mustard are potent skin vesicants. • The endocannabinoid system regulates keratinocyte growth and differentiation. • Vesicants are potent inducers of the endocannabinoid system in mouse skin. • Endocannabinoid proteins upregulated are FAAH, CB1, CB2 and PPARα. • FAAH inhibitors suppress vesicant-induced inflammation in mouse skin.

  16. Mustard vesicants alter expression of the endocannabinoid system in mouse skin

    Energy Technology Data Exchange (ETDEWEB)

    Wohlman, Irene M.; Composto, Gabriella M. [Department of Pharmacology and Toxicology, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Heck, Diane E. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Heindel, Ned D.; Lacey, C. Jeffrey; Guillon, Christophe D. [Department of Chemistry, Lehigh University, Bethlehem, PA (United States); Casillas, Robert P.; Croutch, Claire R. [MRIGlobal, Kansas City, MO (United States); Gerecke, Donald R.; Laskin, Debra L.; Joseph, Laurie B. [Department of Pharmacology and Toxicology, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Laskin, Jeffrey D., E-mail: jlaskin@eohsi.rutgers.edu [Environmental and Occupational Health, Rutgers University School of Public Health, Piscataway, NJ (United States)

    2016-07-15

    Vesicants including sulfur mustard (SM) and nitrogen mustard (NM) are bifunctional alkylating agents that cause skin inflammation, edema and blistering. This is associated with alterations in keratinocyte growth and differentiation. Endogenous cannabinoids, including N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoyl glycerol (2-AG), are important in regulating inflammation, keratinocyte proliferation and wound healing. Their activity is mediated by binding to cannabinoid receptors 1 and 2 (CB1 and CB2), as well as peroxisome proliferator-activated receptor alpha (PPARα). Levels of endocannabinoids are regulated by fatty acid amide hydrolase (FAAH). We found that CB1, CB2, PPARα and FAAH were all constitutively expressed in mouse epidermis and dermal appendages. Topical administration of NM or SM, at concentrations that induce tissue injury, resulted in upregulation of FAAH, CB1, CB2 and PPARα, a response that persisted throughout the wound healing process. Inhibitors of FAAH including a novel class of vanillyl alcohol carbamates were found to be highly effective in suppressing vesicant-induced inflammation in mouse skin. Taken together, these data indicate that the endocannabinoid system is important in regulating skin homeostasis and that inhibitors of FAAH may be useful as medical countermeasures against vesicants. - Highlights: • Sulfur mustard and nitrogen mustard are potent skin vesicants. • The endocannabinoid system regulates keratinocyte growth and differentiation. • Vesicants are potent inducers of the endocannabinoid system in mouse skin. • Endocannabinoid proteins upregulated are FAAH, CB1, CB2 and PPARα. • FAAH inhibitors suppress vesicant-induced inflammation in mouse skin.

  17. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  18. Identification of p63+ keratinocyte progenitor cells in circulation and their matrix-directed differentiation to epithelial cells.

    Science.gov (United States)

    Nair, Renjith P; Krishnan, Lissy K

    2013-04-11

    In the event of chronic diabetes or burn wounds, accomplishing skin regeneration is a major concern. Autologous skin grafting is the most effective remedy, but the tissue harvest may create more nonhealing wounds. Currently available skin substitutes have a limited clinical outcome because of immune reactions arising from the xenobiotic scaffold or allogenous cells. Autologous stem cells that can be collected without an additional injury may be a viable option for skin-tissue engineering. Presence of a low number of keratinocyte progenitor cells (KPCs) within the peripheral blood mononuclear cell (PBMNC) population has been indicated. Identification, isolation, expansion, and differentiation of KPCs is necessary before they are considered for skin regeneration, which is the focus of this study. Culture of isolated human PBMNCs on a cell-specific matrix was carried out to induce differentiation of KPCs. Flow cytometry and reverse transcriptase polymerase chain reaction were done for epithelial stem cell marker p63 and lineage markers cytokeratin 5 and cytokeratin 14, to track differentiation. Proliferation was confirmed by quantifying the proliferating cell nuclear antigen-expressing cells. Immunostaining with epithelial cell markers, involucrin and filaggrin, was carried out to establish terminal differentiation. Microscopic analysis confirmed growth and survival of KPCs on the dermal fibroblast monolayer and on a transplantable fibrin sheet. We demonstrated that KPCs are p63(+) and CD34-. The specifically designed composition of the extracellular matrix was found to support selective adhesion, proliferation, and differentiation of p63(+) KPCs. The PBMNC culture for 12 days under controlled conditions resulted in a homogenous population that expressed cytokeratins, and >90% of the cells were found to proliferate. Subculture for 5 days resulted in expression of filaggrin and involucrin, suggesting terminal differentiation. Transfer of matrix-selected KPCs to a

  19. The Protective Role of Vitamin D Signaling in Non-Melanoma Skin Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Bikle, Daniel D., E-mail: daniel.bikle@ucsf.edu; Jiang, Yan [Department of Medicine and Endocrine, Research Unit and Department of Dermatology, VA Medical Center, University of California San Francisco, 4150 Clement St (111N), San Francisco, CA 94121 (United States)

    2013-11-05

    Although the epidemiologic evidence that adequate vitamin D nutrition protects against non-melanoma skin cancer (NMSC) is limited, recent evidence that the vitamin D receptor (VDR) is protective is compelling. The role of vitamin D signaling in limiting the proliferation while promoting the differentiation of keratinocytes, the major cell in the epidermis from which NMSC are derived, is well known. However, recent findings that mice lacking the VDR are predisposed to skin cancer has brought to the fore the question of how the VDR is protective. In this review we will look first at the role of vitamin D signaling in regulating the proliferation and differentiation of keratinocytes. We will examine two pathways, β-catenin (CTNNB) and hedgehog (HH), that are regulated by vitamin D signaling and may contribute to the dysregulated proliferation and differentiation in the absence of VDR. We will then examine the failure of VDR deficient keratinocytes to repair DNA damaged by UVB. Finally we will examine the change in long non-coding RNA (LncRNA) expression in VDR null keratinocytes that in other cells is associated with malignant transformation, a potential newly appreciated mechanism by which vitamin D signaling is protective against NMSC.

  20. The Protective Role of Vitamin D Signaling in Non-Melanoma Skin Cancer

    International Nuclear Information System (INIS)

    Bikle, Daniel D.; Jiang, Yan

    2013-01-01

    Although the epidemiologic evidence that adequate vitamin D nutrition protects against non-melanoma skin cancer (NMSC) is limited, recent evidence that the vitamin D receptor (VDR) is protective is compelling. The role of vitamin D signaling in limiting the proliferation while promoting the differentiation of keratinocytes, the major cell in the epidermis from which NMSC are derived, is well known. However, recent findings that mice lacking the VDR are predisposed to skin cancer has brought to the fore the question of how the VDR is protective. In this review we will look first at the role of vitamin D signaling in regulating the proliferation and differentiation of keratinocytes. We will examine two pathways, β-catenin (CTNNB) and hedgehog (HH), that are regulated by vitamin D signaling and may contribute to the dysregulated proliferation and differentiation in the absence of VDR. We will then examine the failure of VDR deficient keratinocytes to repair DNA damaged by UVB. Finally we will examine the change in long non-coding RNA (LncRNA) expression in VDR null keratinocytes that in other cells is associated with malignant transformation, a potential newly appreciated mechanism by which vitamin D signaling is protective against NMSC

  1. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA......-FABP as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... with epidermal growth factor (EGF), pituitary extract, and 10% fetal calf serum] revealed a strong up-regulation of PA-FABP, psoriasin, calgranulins A and B, and a few other proteins that are highly expressed in psoriatic skin. The levels of these proteins exceeded by far those observed in non-cultured normal...

  2. Effect of Absolute From Hibiscus syriacus L. Flower on Wound Healing in Keratinocytes

    Science.gov (United States)

    Yoon, Seok Won; Lee, Kang Pa; Kim, Do-Yoon; Hwang, Dae Il; Won, Kyung-Jong; Lee, Dae Won; Lee, Hwan Myung

    2017-01-01

    Background: Proliferation and migration of keratinocytes are essential for the repair of cutaneous wounds. Hibiscus syriacus L. has been used in Asian medicine; however, research on keratinocytes is inadequate. Objective: To establish the dermatological properties of absolute from Hibiscus syriacus L. flower (HSF) and to provide fundamental research for alternative medicine. Materials and Methods: We identified the composition of HSF absolute using gas chromatography-mass spectrometry analysis. We also examined the effect of HSF absolute in HaCaT cells using the XTT assay, Boyden chamber assay, sprout-out growth assay, and western blotting. We conducted an in-vivo wound healing assay in rat tail-skin. Results: Ten major active compounds were identified from HSF absolute. As determined by the XTT assay, Boyden chamber assay, and sprout-out growth assay results, HSF absolute exhibited similar effects as that of epidermal growth factor on the proliferation and migration patterns of keratinocytes (HaCaT cells), which were significantly increased after HSF absolute treatment. The expression levels of the phosphorylated signaling proteins relevant to proliferation, including extracellular signal-regulated kinase 1/2 (Erk 1/2) and Akt, were also determined by western blot analysis. Conclusion: These results of our in-vitro and ex-vivo studies indicate that HSF absolute induced cell growth and migration of HaCaT cells by phosphorylating both Erk 1/2 and Akt. Moreover, we confirmed the wound-healing effect of HSF on injury of the rat tail-skin. Therefore, our results suggest that HSF absolute is promising for use in cosmetics and alternative medicine. SUMMARY Hisbiscus syriacus L. flower absolute increases HaCaT cell migration and proliferation.Hisbiscus syriacus L. flower absolute regulates phosphorylation of ERK 1/2 and Akt in HaCaT cell.Treatment with Hisbiscus syriacus L. flower induced sprout outgrowth.The wound in the tail-skin of rat was reduced by Hisbiscus syriacus

  3. Proliferation of protease-enriched mast cells in sarcoptic skin lesions of raccoon dogs.

    Science.gov (United States)

    Noviana, D; W Harjanti, D; Otsuka, Y; Horii, Y

    2004-07-01

    Skin sites, tongue, lung, liver, jejunum and rectum from two raccoon dogs with Sarcoptes scabiei infestation and five normal (control) raccoon dogs were examined in terms of the distribution, proteoglycan properties and protease activity of mast cells. Infestation with S. scabiei caused a significant increase in the number of dermal mast cells. While the number of mast cells (average +/- standard deviation) in specimens of skin from the dorsum, dorsal neck, dorsal hind foot and dorsal fore foot was 40.0 +/- 19.8/mm2 in control animals, it was 236.1 +/- 58.9/mm2 in the skin of mange-infested animals. Histochemical analysis revealed the glycosaminoglycan, heparin, within the mast cells of all organs examined in both control and affected animals. Enzyme-histochemical detection of serine proteases demonstrated an increase in mast-cell-specific protease activity (i.e., chymase and tryptase) in the skin of infested animals. The percentage of mast cells demonstrating chymase activity was 53.0 +/- 27.4% in control animals and 73.8 +/- 19.4% in mite-infested animals. The corresponding results for tryptase activity were 53.5 +/- 25.2% and 89.4 +/- 9.8%. Increases in mast cell chymase or tryptase activity, or both, were also observed within other organs of the infected animals, but the total number of mast cells found at such sites (with the exception of liver and ventrolateral pinna) did not differ from those of control animals. Copyright 2004 Elsevier Ltd.

  4. 8,12;8,20-diepoxy-8,14-secopregnane glycosides from roots of Asclepias tuberosa and their effect on proliferation of human skin fibroblasts.

    Science.gov (United States)

    Warashina, Tsutomu; Umehara, Kaoru; Miyase, Toshio; Noro, Tadataka

    2011-10-01

    A pregnane glycoside fraction from the roots of Asclepias tuberosa L. caused normal human skin fibroblasts to proliferate. This fraction contained 21 pregnane glycosides whose structures were established using NMR spectroscopic analysis and chemical evidence. The aglycones of most of these compounds were identified as 8,12;8,20-diepoxy-8,14-secopregnanes, such as tuberogenin or 5,6-didehydrotuberogenin, the same aglycones as constituents of the aerial parts of this plant. Some of these compounds also caused proliferation of skin fibroblasts. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. RAC1 in keratinocytes regulates crosstalk to immune cells by Arp2/3-dependent control of STAT1

    DEFF Research Database (Denmark)

    Pedersen, Esben Ditlev Kølle; Wang, Zhipeng; Stanley, Alanna

    2012-01-01

    Crosstalk between keratinocytes and immune cells is crucial for the immunological barrier function of the skin, and aberrant crosstalk contributes to inflammatory skin diseases. Using mice with a keratinocyte-restricted deletion of the RAC1 gene we found that RAC1 in keratinocytes plays...... hypersensitive to inflammatory stimuli both in vitro and in vivo, suggesting a major role for RAC1 in regulating the crosstalk between the epidermis and the immune system....

  6. Inhibition of inflammatory and proliferative responses of human keratinocytes exposed to the sesquiterpene lactones dehydrocostuslactone and costunolide.

    Directory of Open Access Journals (Sweden)

    Claudia Scarponi

    Full Text Available The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE and costunolide (CS, two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit

  7. Integrin β4 Regulates Migratory Behavior of Keratinocytes by Determining Laminin-332 Organization*s

    Science.gov (United States)

    Sehgal, Bernd U.; DeBiase, Phillip J.; Matzno, Sumio; Chew, Teng-Leong; Claiborne, Jessica N.; Hopkinson, Susan B.; Russell, Alan; Marinkovich, M. Peter; Jones, Jonathan C. R.

    2010-01-01

    Whether α6β4 integrin regulates migration remains controversial. β4 integrin-deficient (JEB) keratinocytes display aberrant migration in that they move in circles, a behavior that mirrors the circular arrays of laminin (LM)-332 in their matrix. In contrast, wild-type keratinocytes and JEB keratinocytes, induced to express β4 integrin, assemble laminin-332 in linear tracks over which they migrate. Moreover, laminin-332-dependent migration of JEB keratinocytes along linear tracks is restored when cells are plated on wild-type keratinocyte matrix, whereas wild-type keratinocytes show rotation over circular arrays of laminn-332 in JEB keratinocyte matrix. The activities of Rac1 and the actin cytoskeleton-severing protein cofilin are low in JEB keratinocytes compared with wild-type cells but are rescued following expression of wild-type β4 integrin in JEB cells. Additionally, in wild-type keratinocytes Rac1 is complexed with α6β4 integrin. Moreover, Rac1 or cofilin inactivation induces wild-type keratinocytes to move in circles over rings of laminin-332 in their matrix. Together these data indicate that laminin-332 matrix organization is determined by the α6β4 integrin/actin cytoskeleton via Rac1/cofilin signaling. Furthermore, our results imply that the organizational state of laminin-332 is a key determinant of the motility behavior of keratinocytes, an essential element of skin wound healing and the successful invasion of epidermal-derived tumor cells. PMID:16973601

  8. Objective Quantification of Immune Cell Infiltrates and Epidermal Proliferation in Psoriatic Skin

    DEFF Research Database (Denmark)

    Soendergaard, Christoffer; Nielsen, Ole H; Skak, Kresten

    2015-01-01

    assessments by pathologists with the interobserver and intraobserver variation this includes. Automated quantitative assessment of immunohistochemical staining has the potential to objectively extract numerical measures from cell and tissue structures, and allows efficient high throughput analysis in clinical...... research. Published data of manual cell counts in psoriatic skin samples were in this study reevaluated using the digital image analysis (DIA) software. Whole slides immunohistochemically stained for CD3, CD4, CD8, CD45R0, and Ki-67 were scanned and quantitatively evaluated using simple threshold analysis...

  9. Role of Stat in Skin Carcinogenesis: Insights Gained from Relevant Mouse Models

    International Nuclear Information System (INIS)

    Macias, E.; Rao, D.; DiGiovanni, J.; DiGiovanni, J.; DiGiovanni, J.

    2013-01-01

    Signal transducer and activator of transcription 3 (Stat) is a cytoplasmic protein that is activated in response to cytokines and growth factors and acts as a transcription factor. Stat plays critical roles in various biological activities including cell proliferation, migration, and survival. Studies using keratinocyte-specific Stat-deficient mice have revealed that Stat plays an important role in skin homeostasis including keratinocyte migration, wound healing, and hair follicle growth. Use of both constitutive and inducible keratinocyte-specific Stat-deficient mouse models has demonstrated that Stat is required for both the initiation and promotion stages of multistage skin carcinogenesis. Further studies using a transgenic mouse model with a gain of function mutant of Stat (Stat3C) expressed in the basal layer of the epidermis revealed a novel role for Stat in skin tumor progression. Studies using similar Stat-deficient and gain-of-function mouse models have indicated its similar roles in ultraviolet B (UVB) radiation-mediated skin carcinogenesis. This paper summarizes the use of these various mouse models for studying the role and underlying mechanisms for the function of Stat in skin carcinogenesis. Given its significant role throughout the skin carcinogenesis process, Stat is an attractive target for skin cancer prevention and treatment.

  10. Tissue engineered skin substitutes created by laser-assisted bioprinting form skin-like structures in the dorsal skin fold chamber in mice.

    Directory of Open Access Journals (Sweden)

    Stefanie Michael

    Full Text Available Tissue engineering plays an important role in the production of skin equivalents for the therapy of chronic and especially burn wounds. Actually, there exists no (cellularized skin equivalent which might be able to satisfactorily mimic native skin. Here, we utilized a laser-assisted bioprinting (LaBP technique to create a fully cellularized skin substitute. The unique feature of LaBP is the possibility to position different cell types in an exact three-dimensional (3D spatial pattern. For the creation of the skin substitutes, we positioned fibroblasts and keratinocytes on top of a stabilizing matrix (Matriderm®. These skin constructs were subsequently tested in vivo, employing the dorsal skin fold chamber in nude mice. The transplants were placed into full-thickness skin wounds and were fully connected to the surrounding tissue when explanted after 11 days. The printed keratinocytes formed a multi-layered epidermis with beginning differentiation and stratum corneum. Proliferation of the keratinocytes was mainly detected in the suprabasal layers. In vitro controls, which were cultivated at the air-liquid-interface, also exhibited proliferative cells, but they were rather located in the whole epidermis. E-cadherin as a hint for adherens junctions and therefore tissue formation could be found in the epidermis in vivo as well as in vitro. In both conditions, the printed fibroblasts partly stayed on top of the underlying Matriderm® where they produced collagen, while part of them migrated into the Matriderm®. In the mice, some blood vessels could be found to grow from the wound bed and the wound edges in direction of the printed cells. In conclusion, we could show the successful 3D printing of a cell construct via LaBP and the subsequent tissue formation in vivo. These findings represent the prerequisite for the creation of a complex tissue like skin, consisting of different cell types in an intricate 3D pattern.

  11. Induction of PDGF-B in TCA-treated epidermal keratinocytes.

    Science.gov (United States)

    Yonei, Nozomi; Kanazawa, Nobuo; Ohtani, Toshio; Furukawa, Fukumi; Yamamoto, Yuki

    2007-11-01

    Trichloroacetic acid (TCA) is one of the most widely used peeling agents, and induces full necrosis of the whole epidermis, followed by reconstitution of the epidermis and the matrix of the papillary dermis. The cytotoxic effects of TCA, such as suppressing proliferation of keratinocytes and fibroblasts and protein synthesis by fibroblasts, have already been reported. However, the entire biological mechanism responsible for TCA peeling has yet to be determined. Hypothetical activation effects of TCA treatment on epidermal cells to induce production of growth factors and cytokines are examined, and are compared with its cytotoxic effects in terms of time course and applied TCA concentrations. After various periods of incubation with TCA, viability of Pam212 murine keratinocytes was investigated with MTT assay and dye exclusion assay, and production of growth factors and cytokines with reverse transcription-polymerase chain reaction (RT-PCR). Changes in platelet-derived growth factor (PDGF)-B mRNA expression and protein production in the human skin specimens after TCA application were then examined by RT-PCR and immunohistochemistry, respectively. Incubation with TCA showed cytotoxicity and induced death of Pam212 cells, depending on the incubation period and the TCA concentration. In addition, expressions of PDGF-B, tumor growth factor (TGF)-alpha, TGF- beta1 and vascular endothelial growth factor, which are the growth factors reportedly secreted from keratinocytes during wound healing, were all detected in Pam212 cells after short-term treatment with TCA. Expressions of inflammatory cytokines such as interleukin (IL)-1 and IL-10 were also induced. In TCA-treated NIH-3T3 fibroblasts, in contrast, observed was upregulation of only keratinocyte growth factor, which is reportedly secreted from fibroblasts, as well as the similar cytotoxic effect. In human skin, PDGF-B mRNA expression became significantly upregulated after TCA application, and then immediately

  12. Modulation of LXR-α and the effector genes by Ascorbic acid and Statins in psoriatic keratinocytes.

    Science.gov (United States)

    Soodgupta, Deepti; Kaul, Deepak; Kanwar, A J; Parsad, Davinder

    2014-12-01

    Recent studies have revealed critical roles that nuclear receptors like LXR-α (Liver X Receptor- alpha) plays as a class of post-transcriptional gene regulator in skin development and diseases. Keeping in view the fact that LXR-α plays crucial role in keratinocyte proliferation and differentiation, it becomes imperative to dissect the pathways and role of LXR-α genomics in the pathogenesis of psoriasis with ultimate aim to explore novel preventive/therapeutic strategies as treatment options. To explore the effects of agonists and activators of LXR-α on its own gene expression and the putative targets in psoriatic keratinocytes. Identification of promoter sequences for (vitamin D receptor) VDR and Catalase were done using in silico analysis followed by β-galactosidase (β-gal) reporter plasmid assay in keratinocytes from clinically heathy subjects. Determination of relative levels of LXR-α,VDR and catalase in control versus treated cells upon activation of LXR-α with Atorvastatin + 22R hydroxycholestrol and Ascorbic acid + 22R hydroxycholestrol was done by PCR and Cell Proliferation Assay. The cells transfected with the reporter plasmid element for VDR and catalase showed more than 5 and 4 fold increase respectively in the β-gal activity compared to the control. An increase of 55% in LXR-α gene expression at RNA level was observed in Atorvastatin + 22-R hydroxycholestrol compared to 24% in Ascorbic acid + 22-ROH cholesterol. The expression of the VDR and Catalase was significantly increased in both treated keratinocytes compared to its normal counterpart.

  13. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  14. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  15. Chemosensory Information Processing between Keratinocytes and Trigeminal Neurons

    Science.gov (United States)

    Sondersorg, Anna Christina; Busse, Daniela; Kyereme, Jessica; Rothermel, Markus; Neufang, Gitta; Gisselmann, Günter; Hatt, Hanns; Conrad, Heike

    2014-01-01

    Trigeminal fibers terminate within the facial mucosa and skin and transmit tactile, proprioceptive, chemical, and nociceptive sensations. Trigeminal sensations can arise from the direct stimulation of intraepithelial free nerve endings or indirectly through information transmission from adjacent cells at the peripheral innervation area. For mechanical and thermal cues, communication processes between skin cells and somatosensory neurons have already been suggested. High concentrations of most odors typically provoke trigeminal sensations in vivo but surprisingly fail to activate trigeminal neuron monocultures. This fact favors the hypothesis that epithelial cells may participate in chemodetection and subsequently transmit signals to neighboring trigeminal fibers. Keratinocytes, the major cell type of the epidermis, express various receptors that enable reactions to multiple environmental stimuli. Here, using a co-culture approach, we show for the first time that exposure to the odorant chemicals induces a chemical communication between human HaCaT keratinocytes and mouse trigeminal neurons. Moreover, a supernatant analysis of stimulated keratinocytes and subsequent blocking experiments with pyrodoxalphosphate-6-azophenyl-2′,4′-disulfonate revealed that ATP serves as the mediating transmitter molecule released from skin cells after odor stimulation. We show that the ATP release resulting from Javanol® stimulation of keratinocytes was mediated by pannexins. Consequently, keratinocytes act as chemosensors linking the environment and the trigeminal system via ATP signaling. PMID:24790106

  16. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  17. Cellularized Bilayer Pullulan-Gelatin Hydrogel for Skin Regeneration.

    Science.gov (United States)

    Nicholas, Mathew N; Jeschke, Marc G; Amini-Nik, Saeid

    2016-05-01

    Skin substitutes significantly reduce the morbidity and mortality of patients with burn injuries and chronic wounds. However, current skin substitutes have disadvantages related to high costs and inadequate skin regeneration due to highly inflammatory wounds. Thus, new skin substitutes are needed. By combining two polymers, pullulan, an inexpensive polysaccharide with antioxidant properties, and gelatin, a derivative of collagen with high water absorbency, we created a novel inexpensive hydrogel-named PG-1 for "pullulan-gelatin first generation hydrogel"-suitable for skin substitutes. After incorporating human fibroblasts and keratinocytes onto PG-1 using centrifugation over 5 days, we created a cellularized bilayer skin substitute. Cellularized PG-1 was compared to acellular PG-1 and no hydrogel (control) in vivo in a mouse excisional skin biopsy model using newly developed dome inserts to house the skin substitutes and prevent mouse skin contraction during wound healing. PG-1 had an average pore size of 61.69 μm with an ideal elastic modulus, swelling behavior, and biodegradability for use as a hydrogel for skin substitutes. Excellent skin cell viability, proliferation, differentiation, and morphology were visualized through live/dead assays, 5-bromo-2'-deoxyuridine proliferation assays, and confocal microscopy. Trichrome and immunohistochemical staining of excisional wounds treated with the cellularized skin substitute revealed thicker newly formed skin with a higher proportion of actively proliferating cells and incorporation of human cells compared to acellular PG-1 or control. Excisional wounds treated with acellular or cellularized hydrogels showed significantly less macrophage infiltration and increased angiogenesis 14 days post skin biopsy compared to control. These results show that PG-1 has ideal mechanical characteristics and allows ideal cellular characteristics. In vivo evidence suggests that cellularized PG-1 promotes skin regeneration and may

  18. Keratinocyte-derived growth factors play a role in the formation of hypertrophic scars

    NARCIS (Netherlands)

    Niessen, FB; Andriessen, MP; Schalkwijk, J; Visser, L; Timens, W

    In predisposed individuals, wound healing can lead to hypertrophic scar or keloid formation, characterized by an overabundant extracellular matrix. It has recently been shown that hypertrophic scars are accompanied by abnormal keratinocyte differentiation and proliferation, and significantly

  19. Prevention of burn wound conversion by allogeneic keratinocytes cultured on acellular xenodermis

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Brož, L.; Pokorná, Eva; Königová, R.

    2002-01-01

    Roč. 3, č. 1 (2002), s. 29-35 ISSN 1389-9333 Institutional research plan: CEZ:AV0Z5052915 Keywords : human keratinocytes * tissue engineered skin * dried porcine dermis Subject RIV: EB - Genetics ; Molecular Biology

  20. The comparison of nuclear ubiquitous casein and cyclin-dependent kinases substrate (NUCKS) with Ki67 proliferation marker expression in common skin tumors.

    Science.gov (United States)

    Zduniak, Krzysztof; Agrawal, Siddarth; Symonowicz, Krzysztof; Jurczyszyn, Kamil; Ziółkowski, Piotr

    2014-03-01

    Nuclear ubiquitous casein and cyclin-dependent kinases substrate (NUCKS) is a chromosomal protein of unknown function. Its amino acid composition and structure of its DNA binding domain resemble those of high mobility group A (HMGA) proteins which are associated with various malignancies. Since changes in expression of HMGA are considered as a marker of tumor progression, it is possible that similar changes in expression of NUCKS could be a useful tool in diagnosis of malignant skin tumors. To investigate this assumption we used specific antibodies against NUCKS for immunohistochemistry of squamous (SCC) and basal cell carcinoma (BCC) as well as keratoacanthoma (KA). We found high expression of NUCKS in nuclei of SCC and BCC cells which exceeded expression of the well-known proliferation marker Ki67. Expression of NUCKS in benign KA was much below that of malignant tumors. With the present study and based on our previous experience we would like to suggest the NUCKS protein as a novel proliferation marker for immunohistochemical evaluation of formalin-fixed and paraffin-embedded skin tumor specimens. We would like to emphasize that NUCKS abundance in malignant skin tumors is higher than that of the well-known proliferation marker Ki67, thus allowing more precise assessment of tumor proliferation potential.

  1. Lactobacillus rhamnosus GG Lysate Increases Re-Epithelialization of Keratinocyte Scratch Assays by Promoting Migration.

    Science.gov (United States)

    Mohammedsaeed, Walaa; Cruickshank, Sheena; McBain, Andrew J; O'Neill, Catherine A

    2015-11-05

    A limited number of studies have investigated the potential of probiotics to promote wound healing in the digestive tract. The aim of the current investigation was to determine whether probiotic bacteria or their extracts could be beneficial in cutaneous wound healing. A keratinocyte monolayer scratch assay was used to assess re-epithelialization; which comprises keratinocyte proliferation and migration. Primary human keratinocyte monolayers were scratched then exposed to lysates of Lactobacillus (L) rhamnosus GG, L. reuteri, L. plantarum or L. fermentum. Re-epithelialization of treated monolayers was compared to that of untreated controls. Lysates of L. rhamnosus GG and L. reuteri significantly increased the rate of re-epithelialization, with L. rhamnosus GG being the most efficacious. L. reuteri increased keratinocyte proliferation while L. rhamnosus GG lysate significantly increased proliferation and migration. Microarray analysis of L. rhamnosus GG treated scratches showed increased expression of multiple genes including the chemokine CXCL2 and its receptor CXCR2. These are involved in normal wound healing where they stimulate keratinocyte proliferation and/or migration. Increased protein expression of both CXCL2 and CXCR2 were confirmed by ELISA and immunoblotting. These data demonstrate that L. rhamnosus GG lysate accelerates re-epithelialization of keratinocyte scratch assays, potentially via chemokine receptor pairs that induce keratinocyte migration.

  2. AMPK regulation of the growth of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Saha, Asish K.; Persons, Kelly; Safer, Joshua D.; Luo Zhijun; Holick, Michael F.; Ruderman, Neil B.

    2006-01-01

    AMP kinase (AMPK) is a fuel sensing enzyme that responds to cellular energy depletion by increasing processes that generate ATP and inhibiting others that require ATP but are not acutely necessary for survival. In the present study, we examined the relationship between AMPK activation and the growth (proliferation) of cultured human keratinocytes and assessed whether the inhibition of keratinocyte growth by vitamin D involves AMPK activation. In addition, we explored whether the inhibition of keratinocyte proliferation as they approach confluence could be AMPK-related. Keratinocytes were incubated for 12 h with the AMPK activator, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR). At concentrations of 10 -4 and 10 -3 M, AICAR inhibited keratinocyte growth by 50% and 95%, respectively, based on measurements of thymidine incorporation into DNA. It also increased AMPK and acetyl CoA carboxylase phosphorylation (P-AMPK and P-ACC) and decreased the concentration of malonyl CoA confirming that AMPK activation had occurred. Incubation with the thiazolidinedione, troglitazone (10 -6 M) caused similar alterations in P-AMPK, P-ACC, and cell growth. In contrast, the well known inhibition of keratinocyte growth by 1,25-dihydroxyvitamin D 3 (10 -7 and 10 -6 M) was not associated with changes in P-AMPK or P-ACC. Like most cells, the growth of keratinocytes diminished as they approached confluence. Thus, it was of note that we found a progressive increase in P-AMPK (1.5- to 2-fold, p 3 is AMPK-independent

  3. VEGF-A/NRP1 stimulates GIPC1 and Syx complex formation to promote RhoA activation and proliferation in skin cancer cells

    Directory of Open Access Journals (Sweden)

    Ayumi Yoshida

    2015-09-01

    Full Text Available Neuropilin-1 (NRP1 has been identified as a VEGF-A receptor. DJM-1, a human skin cancer cell line, expresses endogenous VEGF-A and NRP1. In the present study, the RNA interference of VEGF-A or NRP1 suppressed DJM-1 cell proliferation. Furthermore, the overexpression of the NRP1 wild type restored shNRP1-treated DJM-1 cell proliferation, whereas NRP1 cytoplasmic deletion mutants did not. A co-immunoprecipitation analysis revealed that VEGF-A induced interactions between NRP1 and GIPC1, a scaffold protein, and complex formation between GIPC1 and Syx, a RhoGEF. The knockdown of GIPC1 or Syx reduced active RhoA and DJM-1 cell proliferation without affecting the MAPK or Akt pathway. C3 exoenzyme or Y27632 inhibited the VEGF-A-induced proliferation of DJM-1 cells. Conversely, the overexpression of the constitutively active form of RhoA restored the proliferation of siVEGF-A-treated DJM-1 cells. Furthermore, the inhibition of VEGF-A/NRP1 signaling upregulated p27, a CDK inhibitor. A cell-penetrating oligopeptide that targeted GIPC1/Syx complex formation inhibited the VEGF-A-induced activation of RhoA and suppressed DJM-1 cell proliferation. In conclusion, this new signaling pathway of VEGF-A/NRP1 induced cancer cell proliferation by forming a GIPC1/Syx complex that activated RhoA to degrade the p27 protein.

  4. Psoriasiform skin disease in transgenic pigs with high-copy ectopic expression of human integrins α2 and β1

    DEFF Research Database (Denmark)

    Staunstrup, Nicklas Heine; Stenderup, Karin; Mortensen, Sidsel

    2017-01-01

    Psoriasis is a complex human-specific disease characterized by perturbed keratinocyte proliferation and a pro-inflammatory environment in the skin. Porcine skin architecture and immunity are very similar to that in humans, rendering the pig a suitable animal model for studying the biology...... and β1 in suprabasal epidermal layers. Integrin-transgenic minipigs born into the project displayed skin phenotypes that correlated with the number of inserted transgenes. Molecular analyses were in good concordance with histological observations of psoriatic hallmarks, including hypogranulosis and T...

  5. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  6. The effect of pH on cell viability, cell migration, cell proliferation, wound closure, and wound reepithelialization

    DEFF Research Database (Denmark)

    Kruse, Carla R; Singh, Mansher; Targosinski, Stefan

    2017-01-01

    primary keratinocyte and fibroblast function in vitro and on wound healing in vivo. In vitro, primary human keratinocytes and fibroblasts were cultured in different levels of pH (5.5-12.5) and the effect on cell viability, proliferation, and migration was studied. A rat full-thickness wound model was used...... to investigate the effect of pH (5.5-9.5) on wound healing in vivo. The effect of pH on inflammation was monitored by measuring IL-1 α concentrations from wounds and cell cultures exposed to different pH environments. Our results showed that both skin cell types tolerated wide range of pH very well. They further...... demonstrated that both acidic and alkaline environments decelerated cell migration in comparison to neutral environments and interestingly alkaline conditions significantly enhanced cell proliferation. Results from the in vivo experiments indicated that a prolonged, strongly acidic wound environment prevents...

  7. Photoprotection by pistachio bioactives in a 3-dimensional human skin equivalent tissue model.

    Science.gov (United States)

    Chen, C-Y Oliver; Smith, Avi; Liu, Yuntao; Du, Peng; Blumberg, Jeffrey B; Garlick, Jonathan

    2017-09-01

    Reactive oxygen species (ROS) generated during ultraviolet (UV) light exposure can induce skin damage and aging. Antioxidants can provide protection against oxidative injury to skin via "quenching" ROS. Using a validated 3-dimensional (3D) human skin equivalent (HSE) tissue model that closely mimics human skin, we examined whether pistachio antioxidants could protect HSE against UVA-induced damage. Lutein and γ-tocopherol are the predominant lipophilic antioxidants in pistachios; treatment with these compounds prior to UVA exposure protected against morphological changes to the epithelial and connective tissue compartments of HSE. Pistachio antioxidants preserved overall skin thickness and organization, as well as fibroblast morphology, in HSE exposed to UVA irradiation. However, this protection was not substantiated by the analysis of the proliferation of keratinocytes and apoptosis of fibroblasts. Additional studies are warranted to elucidate the basis of these discordant results and extend research into the potential role of pistachio bioactives promoting skin health.

  8. Analyses of the Secondary Particle Radiation and the DNA Damage it Causes to Human Keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lebel E. A.; Tafrov S.; Rusek, A.; Sivertz, M. B.; Yip, K.; Thompson, K. H.

    2011-11-01

    High-energy protons, and high mass and energy ions, along with the secondary particles they produce, are the main contributors to the radiation hazard during space explorations. Skin, particularly the epidermis, consisting mainly of keratinocytes with potential for proliferation and malignant transformation, absorbs the majority of the radiation dose. Therefore, we used normal human keratinocytes to investigate and quantify the DNA damage caused by secondary radiation. Its manifestation depends on the presence of retinol in the serum-free media, and is regulated by phosphatidylinositol 3-kinases. We simulated the generation of secondary radiation after the impact of protons and iron ions on an aluminum shield. We also measured the intensity and the type of the resulting secondary particles at two sample locations; our findings agreed well with our predictions. We showed that secondary particles inflict DNA damage to different extents, depending on the type of primary radiation. Low-energy protons produce fewer secondary particles and cause less DNA damage than do high-energy protons. However, both generate fewer secondary particles and inflict less DNA damage than do high mass and energy ions. The majority of cells repaired the initial damage, as denoted by the presence of 53BPI foci, within the first 24 hours after exposure, but some cells maintained the 53BP1 foci longer.

  9. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  10. Rat embryonic fibroblasts improve reprogramming of human keratinocytes into induced pluripotent stem cells.

    Science.gov (United States)

    Linta, Leonhard; Stockmann, Marianne; Kleinhans, Karin N; Böckers, Anja; Storch, Alexander; Zaehres, Holm; Lin, Qiong; Barbi, Gotthold; Böckers, Tobias M; Kleger, Alexander; Liebau, Stefan

    2012-04-10

    Patient-specific human induced pluripotent stem (hiPS) cells not only provide a promising tool for cellular disease models in general, but also open up the opportunity to establish cell-type-specific systems for personalized medicine. One of the crucial prerequisites for these strategies, however, is a fast and efficient reprogramming strategy from easy accessible somatic cell populations. Keratinocytes from plucked human hair had been introduced as a superior cell source for reprogramming purposes compared with the widely used skin fibroblasts. The starting cell population is, however, limited and thereby further optimization in terms of time, efficiency, and quality is inevitable. Here we show that rat embryonic fibroblasts (REFs) should replace mouse embryonic fibroblasts as feeder cells in the reprogramming process. REFs enable a significantly more efficient reprogramming procedure as shown by colony number and total amount of SSEA4-positive cells. We successfully produced keratinocyte-derived hiPS (k-hiPS) cells from various donors. The arising k-hiPS cells display the hallmarks of pluripotency such as expression of stem cell markers and differentiation into all 3 germ layers. The increased reprogramming efficiency using REFs as a feeder layer occurred independent of the proliferation rate in the parental keratinocytes and acts, at least in part, in a non-cell autonomous way by secreting factors known to facilitate pluripotency such as Tgfb1, Inhba and Grem1. Hence, we provide an easy to use and highly efficient reprogramming system that could be very useful for a broad application to generate human iPS cells. © Mary Ann Liebert, Inc.

  11. Inhibitory effect of cucurbitacin B on imiquimod-induced skin inflammation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zheng Jun; Shin, Jung-Min; Choi, Dae-Kyoung; Lim, Seul Ki [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Yoon, Tae-Jin [Department of Dermatology, School of Medicine, Gyeongsang National University, Jinju (Korea, Republic of); Lee, Young Ho [Department of Anatomy, School of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Sohn, Kyung-Cheol; Im, Myung; Lee, Young; Seo, Young-Joon; Kim, Chang Deok [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Lee, Jeung-Hoon, E-mail: jhoon@cnu.ac.kr [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Skin Med Company, Daejeon (Korea, Republic of)

    2015-04-17

    Psoriasis is a common skin disease, of which pathogenesis involves the increase of inflammatory reaction in epidermal cells. In an attempt to find therapeutics for psoriasis, we found that cucurbitacin B has an inhibitory potential on imiquimod-induced inflammation of keratinocytes. Cucurbitacin B significantly inhibited imiquimod-induced expression of crucial psoriatic cytokines, such as IL-8 and CCL20, via down-regulation of NF-κB and STAT3 signaling pathway in human keratinocytes. In addition, keratinocyte proliferation was markedly inhibited by cucurbitacin B. The potential beneficial effect of cucurbitacin B on psoriasis was further validated in imiquimod-induced psoriasiform dermatitis of experimental animal. Topical application of cucurbitacin B resulted in significant reduction of epidermal hyperplasia and inflammatory cytokines production, and ameliorated the psoriatic symptom. Taken together, these results suggest that cucurbitacin B may be a potential candidate for the treatment of psoriasis. - Highlights: • Cucurbitacin B has a potential for inhibiting the growth of keratinocytes. • Cucurbitacin B inhibits imiquimod-induced inflammatory reaction in keratinocytes. • Cucurbitacin B inhibits imiquimod-induced psoriasiform dermatitis in experimental animal.

  12. Inhibitory effect of cucurbitacin B on imiquimod-induced skin inflammation

    International Nuclear Information System (INIS)

    Li, Zheng Jun; Shin, Jung-Min; Choi, Dae-Kyoung; Lim, Seul Ki; Yoon, Tae-Jin; Lee, Young Ho; Sohn, Kyung-Cheol; Im, Myung; Lee, Young; Seo, Young-Joon; Kim, Chang Deok; Lee, Jeung-Hoon

    2015-01-01

    Psoriasis is a common skin disease, of which pathogenesis involves the increase of inflammatory reaction in epidermal cells. In an attempt to find therapeutics for psoriasis, we found that cucurbitacin B has an inhibitory potential on imiquimod-induced inflammation of keratinocytes. Cucurbitacin B significantly inhibited imiquimod-induced expression of crucial psoriatic cytokines, such as IL-8 and CCL20, via down-regulation of NF-κB and STAT3 signaling pathway in human keratinocytes. In addition, keratinocyte proliferation was markedly inhibited by cucurbitacin B. The potential beneficial effect of cucurbitacin B on psoriasis was further validated in imiquimod-induced psoriasiform dermatitis of experimental animal. Topical application of cucurbitacin B resulted in significant reduction of epidermal hyperplasia and inflammatory cytokines production, and ameliorated the psoriatic symptom. Taken together, these results suggest that cucurbitacin B may be a potential candidate for the treatment of psoriasis. - Highlights: • Cucurbitacin B has a potential for inhibiting the growth of keratinocytes. • Cucurbitacin B inhibits imiquimod-induced inflammatory reaction in keratinocytes. • Cucurbitacin B inhibits imiquimod-induced psoriasiform dermatitis in experimental animal

  13. Clinical application of a tissue-cultured skin autograft: an alternative for the treatment of non-healing or slowly healing wounds?

    Science.gov (United States)

    Zöller, Nadja; Valesky, Eva; Butting, Manuel; Hofmann, Matthias; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland

    2014-01-01

    The treatment regime of non-healing or slowly healing wounds is constantly improving. One aspect is surgical defect coverage whereby mesh grafts and keratinocyte suspension are applied. Tissue-cultured skin autografts may be an alternative for the treatment of full-thickness wounds and wounds that cover large areas of the body surface. Autologous epidermal and dermal cells were isolated, expanded in vitro and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically characterized and subsequently transplanted onto a facial chronic ulceration of a 71-year-old patient with vulnerable atrophic skin. Characterization of the skin equivalent revealed comparability to healthy human skin due to the epidermal strata, differentiation and proliferation markers. Within 138 days, the skin structure at the transplantation site closely correlated with the adjacent undisturbed skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and the versatility for clinical applications.

  14. Simultaneous Delivery of Highly Diverse Bioactive Compounds from Blend Electrospun Fibers for Skin Wound Healing.

    Science.gov (United States)

    Peh, Priscilla; Lim, Natalie Sheng Jie; Blocki, Anna; Chee, Stella Min Ling; Park, Heyjin Chris; Liao, Susan; Chan, Casey; Raghunath, Michael

    2015-07-15

    Blend emulsion electrospinning is widely perceived to destroy the bioactivity of proteins, and a blend emulsion of water-soluble and nonsoluble molecules is believed to be thermodynamically unstable to electrospin smoothly. Here we demonstrate a method to retain the bioactivity of disparate fragile biomolecules when electrospun. Using bovine serum albumin as a carrier protein; water-soluble vitamin C, fat soluble vitamin D3, steroid hormone hydrocortisone, peptide hormone insulin, thyroid hormone triiodothyronine (T3), and peptide epidermal growth factor (EGF) were simultaneously blend-spun into PLGA-collagen nanofibers. Upon release, vitamin C maintained the ability to facilitate Type I collagen secretion by fibroblasts, EGF stimulated skin fibroblast proliferation, and insulin potentiated adipogenic differentiation. Transgenic cell reporter assays confirmed the bioactivity of vitamin D3, T3, and hydrocortisone. These factors concertedly increased keratinocyte and fibroblast proliferation while maintaining keratinocyte basal state. This method presents an elegant solution to simultaneously deliver disparate bioactive biomolecules for wound healing applications.

  15. Filaggrin-dependent secretion of sphingomyelinase protects against staphylococcal α-toxin-induced keratinocyte death.

    Science.gov (United States)

    Brauweiler, Anne M; Bin, Lianghua; Kim, Byung Eui; Oyoshi, Michiko K; Geha, Raif S; Goleva, Elena; Leung, Donald Y M

    2013-02-01

    The skin of patients with atopic dermatitis (AD) has defects in keratinocyte differentiation, particularly in expression of the epidermal barrier protein filaggrin. AD skin lesions are often exacerbated by Staphylococcus aureus-mediated secretion of the virulence factor α-toxin. It is unknown whether lack of keratinocyte differentiation predisposes to enhanced lethality from staphylococcal toxins. We investigated whether keratinocyte differentiation and filaggrin expression protect against cell death induced by staphylococcal α-toxin. Filaggrin-deficient primary keratinocytes were generated through small interfering RNA gene knockdown. RNA expression was determined by using real-time PCR. Cell death was determined by using the lactate dehydrogenase assay. Keratinocyte cell survival in filaggrin-deficient (ft/ft) mouse skin biopsies was determined based on Keratin 5 staining. α-Toxin heptamer formation and acid sphingomyelinase expression were determined by means of immunoblotting. We found that filaggrin expression, occurring as the result of keratinocyte differentiation, significantly inhibits staphylococcal α-toxin-mediated pathogenicity. Furthermore, filaggrin plays a crucial role in protecting cells by mediating the secretion of sphingomyelinase, an enzyme that reduces the number of α-toxin binding sites on the keratinocyte surface. Finally, we determined that sphingomyelinase enzymatic activity directly prevents α-toxin binding and protects keratinocytes against α-toxin-induced cytotoxicity. The current study introduces the novel concept that S aureus α-toxin preferentially targets and destroys filaggrin-deficient keratinocytes. It also provides a mechanism to explain the increased propensity for S aureus-mediated exacerbation of AD skin disease. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  16. Re-appraisal of keratinocytes' role in vitiligo pathogenesis

    Directory of Open Access Journals (Sweden)

    Ola Ahmed Bakry

    2018-01-01

    Full Text Available Background: Vitiligo is a common pigmentary disorder. Studies on its pathogenesis extensively investigated melanocytes' abnormalities and few studies searched for keratinocytes' role in disease development. Liver X receptor-α (LXR-α is a member of nuclear hormone receptors that acts as a transcription factor. Its target genes are the main regulators of melanocyte functions. Aim: The aim of this study is to investigate keratinocytes' role in vitiligo pathogenesis through immunohistochemical expression of LXR-α in lesional, perilesional, and distant nonlesional vitiligo skin. Materials and Methods: This case–control study was carried out on 44 participants. These included 24 patients with vitiligo and 20 age- and sex-matched normal individuals as a control group. Biopsies, from cases, were taken from lesional, perilesional, and distant nonlesional areas. Evaluation was done using immunohistochemical technique. Results: Keratinocyte LXR-α expression was upregulated in the lesional and perilesional skin (follicular and interfollicular epidermis compared with control skin (P<0.001 for all. There was significant association between higher histoscore (H-score in lesional epidermis (P<0.001 and in hair follicle (P=0.001 and the presence of angiogenesis. There was significant association between higher H-score in lesional epidermis and suprabasal vacuolization (P=0.02. No significant association was found between H-score or expression percentage and clinical data of selected cases. Conclusion: LXR-α upregulation is associated with keratinocyte damage in vitiligo lesional skin that leads to decreased keratinocyte-derived mediators and growth factors supporting the growth and/or melanization of surrounding melanocytes. Therefore, melanocyte function and survival are affected.

  17. The incidence and multiplicity rates of keratinocyte cancers in Australia.

    Science.gov (United States)

    Pandeya, Nirmala; Olsen, Catherine M; Whiteman, David C

    2017-10-16

    To assess the incidence and multiplicity of keratinocyte cancers (basal cell carcinoma [BCC] and squamous cell carcinoma [SCC]) excised in Australia, and to examine variations by age, sex, state, and prior skin cancer history. Analysis of individual-level Medicare data for keratinocyte cancer treatments (identified by eight specific MBS item codes) during 2011-2014. Histological data from the QSkin prospective cohort study were analysed to estimate BCC and SCC incidence. A 10% systematic random sample of all people registered with Medicare during 1997-2014. People aged at least 20 years in 2011 who made at least one claim for any MBS medical service during 2011-2014 (1 704 193 individuals). Age-standardised incidence rates (ASRs) and standardised incidence ratios (SIRs). The person-based incidence of keratinocyte cancer excisions in Australia was 1531 per 100 000 person-years; incidence increased with age, and was higher for men than women (SIR, 1.43; 95% CI, 1.42-1.45). Lesion-based incidence was 3154 per 100 000 person-years. The estimated ASRs for BCC and SCC were 770 per 100 000 and 270 per 100 000 person-years respectively. During 2011-2014, 3.9% of Australians had one keratinocyte cancer excised, 2.7% had more than one excised; 74% of skin cancers were excised from patients who had two or more lesions removed. Multiplicity was strongly correlated with age; most male patients over 70 were treated for multiple lesions. Keratinocyte cancer incidence was eight times as high among people with a prior history of excisions as among those without. The incidence and multiplicity of keratinocyte cancer in Australia are very high, causing a large disease burden that has not previously been quantified.

  18. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

  19. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  20. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Itoi, Saori; Terao, Mika, E-mail: mterao@derma.med.osaka-u.ac.jp; Murota, Hiroyuki; Katayama, Ichiro

    2013-10-18

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10{sup −13} M cortisol, whereas 1 × 10{sup −5} M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol

  1. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    International Nuclear Information System (INIS)

    Itoi, Saori; Terao, Mika; Murota, Hiroyuki; Katayama, Ichiro

    2013-01-01

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10 −13 M cortisol, whereas 1 × 10 −5 M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol concentrations

  2. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  3. Rab11b mediates melanin transfer between donor melanocytes and acceptor keratinocytes via coupled exo/endocytosis.

    Science.gov (United States)

    Tarafder, Abul K; Bolasco, Giulia; Correia, Maria S; Pereira, Francisco J C; Iannone, Lucio; Hume, Alistair N; Kirkpatrick, Niall; Picardo, Mauro; Torrisi, Maria R; Rodrigues, Inês P; Ramalho, José S; Futter, Clare E; Barral, Duarte C; Seabra, Miguel C

    2014-04-01

    The transfer of melanin from melanocytes to keratinocytes is a crucial process underlying maintenance of skin pigmentation and photoprotection against UV damage. Here, we present evidence supporting coupled exocytosis of the melanin core, or melanocore, by melanocytes and subsequent endocytosis by keratinocytes as a predominant mechanism of melanin transfer. Electron microscopy analysis of human skin samples revealed three lines of evidence supporting this: (1) the presence of melanocores in the extracellular space; (2) within keratinocytes, melanin was surrounded by a single membrane; and (3) this membrane lacked the melanosomal membrane protein tyrosinase-related protein 1 (TYRP1). Moreover, co-culture of melanocytes and keratinocytes suggests that melanin exocytosis is specifically induced by keratinocytes. Furthermore, depletion of Rab11b, but not Rab27a, caused a marked decrease in both keratinocyte-stimulated melanin exocytosis and transfer to keratinocytes. Thus, we propose that the predominant mechanism of melanin transfer is keratinocyte-induced exocytosis, mediated by Rab11b through remodeling of the melanosome membrane, followed by subsequent endocytosis by keratinocytes.

  4. Keratinocyte Growth Factor Causes Cystic Dilation of the Mammary Glands of Mice: Interactions of Keratinocyte Growth Factor, Estrogen, and Progesterone In Vivo

    OpenAIRE

    Yi, Eunhee S.; Bedoya, Adriana A.; Lee, Hyesun; Kim, Seokhyun; Housley, Regina M.; Aukerman, Sharon L.; Tarpley, John E.; Starnes, Charles; Yin, Songmei; Pierce, Glenn F.; Ulich, Thomas R.

    1994-01-01

    Keratinocyte growth factor (KGF) is a paracrine mediator of epithelial cell proliferation that has been reported to induce marked proliferation of mammary epithelium in rats. In this study, systemic administration of KGF into naive and oophorectomized mice causes mammary gland proliferation, as evidenced histologically by the appearance of cysts lined by a single layer of epithelium and by hyperplastic epithelium. Whole mount preparations of the mammary glands reveal that the histologically n...

  5. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  6. Upregulation of adhesion complex proteins and fibronectin by human keratinocytes treated with an aqueous extract from the leaves of Chromolaena odorata (Eupolin).

    Science.gov (United States)

    Phan, T T; Allen, J; Hughes, M A; Cherry, G; Wojnarowska, F

    2000-01-01

    The fresh leaves and extract of the plant Chromolaena odorata are a traditional herbal treatment in developing countries for burns, soft tissue wounds and skin infections. We have previously shown that the extract had an effect on the growth and proliferation of keratinocytes and fibroblasts in culture. This study has demonstrated that Eupolin extract increased expression of several components of the adhesion complex and fibronectin by human keratinocytes. Using indirect immunofluorescence we found increased expression (dose-dependent) of laminin 5, laminin 1, collagen IV, and fibronectin. The expression of the b1 and b4 integrins was upregulated by the extract at low concentrations (0.1 and 1 microg/ml), but the expression was decreased at higher doses of Eupolin (10 microg-150 microg/ml). A number of clinical studies carried out by Vietnamese and international medical investigators have demonstrated the efficacy of this extract on the wound healing process. In this study we have shown that Eupolin stimulated the expression of many proteins of the adhesion complex and fibronectin by human keratinocytes. The adhesion complex proteins are essential to stabilise epithelium and this effect could contribute to the clinical efficacy of Eupolin in healing.

  7. Influence of ion implantation on the adhesion and grow of human keratinocytes

    International Nuclear Information System (INIS)

    Walachova, K.; Svorcik, V.; Dvorakova, B.; Vogtova, D.

    1999-01-01

    Interaction of keratinocytes with polymer modified by ion implantation was studied with the possibility of cultivate these cells for regeneration of dermal cover, for example, heavy burned persons. The modification on polyethylene (PE) with 100 μm thickness was processed by implantation the Ar + ions with the energy 63 keV and Xe + ions with the energy 156 keV. Some characteristics of superficial modified layers and influence of ion implantation on the adhesion and proliferation of keratinocytes were studied

  8. Mycosporine-Like Amino Acids Promote Wound Healing through Focal Adhesion Kinase (FAK and Mitogen-Activated Protein Kinases (MAP Kinases Signaling Pathway in Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yun-Hee Choi

    2015-11-01

    Full Text Available Mycosporine-like amino acids (MAAs are secondary metabolites found in diverse marine, freshwater, and terrestrial organisms. Evidence suggests that MAAs have several beneficial effects on skin homeostasis such as protection against UV radiation and reactive oxygen species (ROS. In addition, MAAs are also involved in the modulation of skin fibroblasts proliferation. However, the regulatory function of MAAs on wound repair in human skin is not yet clearly elucidated. To investigate the roles of MAAs on the wound healing process in human keratinocytes, three MAAs, Shinorine (SH, Mycosporine-glycine (M-Gly, and Porphyra (P334 were purified from Chlamydomonas hedlyei and Porphyra yezoensis. We found that SH, M-Gly, and P334 have significant effects on the wound healing process in human keratinocytes and these effects were mediated by activation of focal adhesion kinases (FAK, extracellular signal-regulated kinases (ERK, and c-Jun N-terminal kinases (JNK. These results suggest that MAAs accelerate wound repair by activating the FAK-MAPK signaling pathways. This study also indicates that MAAs can act as a new wound healing agent and further suggests that MAAs might be a novel biomaterial for wound healing therapies.

  9. Mycosporine-Like Amino Acids Promote Wound Healing through Focal Adhesion Kinase (FAK) and Mitogen-Activated Protein Kinases (MAP Kinases) Signaling Pathway in Keratinocytes

    Science.gov (United States)

    Choi, Yun-Hee; Yang, Dong Joo; Kulkarni, Atul; Moh, Sang Hyun; Kim, Ki Woo

    2015-01-01

    Mycosporine-like amino acids (MAAs) are secondary metabolites found in diverse marine, freshwater, and terrestrial organisms. Evidence suggests that MAAs have several beneficial effects on skin homeostasis such as protection against UV radiation and reactive oxygen species (ROS). In addition, MAAs are also involved in the modulation of skin fibroblasts proliferation. However, the regulatory function of MAAs on wound repair in human skin is not yet clearly elucidated. To investigate the roles of MAAs on the wound healing process in human keratinocytes, three MAAs, Shinorine (SH), Mycosporine-glycine (M-Gly), and Porphyra (P334) were purified from Chlamydomonas hedlyei and Porphyra yezoensis. We found that SH, M-Gly, and P334 have significant effects on the wound healing process in human keratinocytes and these effects were mediated by activation of focal adhesion kinases (FAK), extracellular signal-regulated kinases (ERK), and c-Jun N-terminal kinases (JNK). These results suggest that MAAs accelerate wound repair by activating the FAK-MAPK signaling pathways. This study also indicates that MAAs can act as a new wound healing agent and further suggests that MAAs might be a novel biomaterial for wound healing therapies. PMID:26703626

  10. Comparative studies of types 1 and 2 herpes simplex virus infection of cultured normal keratinocytes.

    OpenAIRE

    Su, S J; Wu, H H; Lin, Y H; Lin, H Y

    1995-01-01

    AIMS--To investigate the differences in biological properties, multiplication patterns, and cytopathic effects between type 1 and type 2 herpes simplex virus (HSV) through the replication of HSV in cultured normal human keratinocytes. METHODS--Keratinocytes were obtained from surgical specimens of normal gingiva, cervix, trunk skin, and newborn foreskin. They were cultured in serum free, chemically defined, culture medium and infected with a pool of HSV collected from clinical specimens. RESU...

  11. Src is activated by the nuclear receptor peroxisome proliferator-activated receptor β/δ in ultraviolet radiation-induced skin cancer.

    Science.gov (United States)

    Montagner, Alexandra; Delgado, Maria B; Tallichet-Blanc, Corinne; Chan, Jeremy S K; Sng, Ming K; Mottaz, Hélén; Degueurce, Gwendoline; Lippi, Yannick; Moret, Catherine; Baruchet, Michael; Antsiferova, Maria; Werner, Sabine; Hohl, Daniel; Saati, Talal Al; Farmer, Pierre J; Tan, Nguan S; Michalik, Liliane; Wahli, Walter

    2014-01-01

    Although non-melanoma skin cancer (NMSC) is the most common human cancer and its incidence continues to rise worldwide, the mechanisms underlying its development remain incompletely understood. Here, we unveil a cascade of events involving peroxisome proliferator-activated receptor (PPAR) β/δ and the oncogene Src, which promotes the development of ultraviolet (UV)-induced skin cancer in mice. UV-induced PPARβ/δ activity, which directly stimulated Src expression, increased Src kinase activity and enhanced the EGFR/Erk1/2 signalling pathway, resulting in increased epithelial-to-mesenchymal transition (EMT) marker expression. Consistent with these observations, PPARβ/δ-null mice developed fewer and smaller skin tumours, and a PPARβ/δ antagonist prevented UV-dependent Src stimulation. Furthermore, the expression of PPARβ/δ positively correlated with the expression of SRC and EMT markers in human skin squamous cell carcinoma (SCC), and critically, linear models applied to several human epithelial cancers revealed an interaction between PPARβ/δ and SRC and TGFβ1 transcriptional levels. Taken together, these observations motivate the future evaluation of PPARβ/δ modulators to attenuate the development of several epithelial cancers.

  12. Pre-clinical efficacy assessment of Malva sylvestris on chronic skin inflammation.

    Science.gov (United States)

    Prudente, Arthur S; Sponchiado, Graziela; Mendes, Daniel A G B; Soley, Bruna S; Cabrini, Daniela A; Otuki, Michel F

    2017-09-01

    In the search for improved quality of life, the treatment of skin diseases like psoriasis (hyperproliferative disease) is valid, since it causes huge social discomfort to the patient. In this context, earlier studies showed that Malva sylvestris L. has anti-inflammatory activity demonstrated by acute animal models of skin inflammation, becoming a promising target for further studies. The present investigation aimed to verify the effect of hydroalcoholic extract of M. sylvestris (HEMS) on the chronic inflammatory and hyperproliferative response caused by multiple applications of 12-O-tetradecanoylphorbol-13-acetate (TPA) on mouse ears. Topical application of HEMS reduced oedema, leukocyte migration (mono- and polymorphonuclear cells) and keratinocyte hyperproliferation, confirmed by histology and proliferating cell nuclear antigen (PCNA) immunostaining. It was found that the anti-inflammatory effects of the extract did not involve the glucocorticoid system, and its incubation with HaCaT keratinocytes caused low toxicity and reduced cell proliferation by apoptosis. Thus, HEMS proved to be effective as an anti-psoriatic therapy, with the ability to prevent keratinocyte hyperproliferation and with low toxicity by topical application. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  13. The E7 protein of the cottontail rabbit papillomavirus immortalizes normal rabbit keratinocytes and reduces pRb levels, while E6 cooperates in immortalization but neither degrades p53 nor binds E6AP

    International Nuclear Information System (INIS)

    Ganzenmueller, Tina; Matthaei, Markus; Muench, Peter; Scheible, Michael; Iftner, Angelika; Hiller, Thomas; Leiprecht, Natalie; Probst, Sonja; Stubenrauch, Frank; Iftner, Thomas

    2008-01-01

    Human papillomaviruses (HPVs) cause cervical cancer and are associated with the development of non-melanoma skin cancer. A suitable animal model for papillomavirus-associated skin carcinogenesis is the infection of domestic rabbits with the cottontail rabbit papillomavirus (CRPV). As the immortalizing activity of CRPV genes in the natural target cells remains unknown, we investigated the properties of CRPV E6 and E7 in rabbit keratinocytes (RK) and their influence on the cell cycle. Interestingly, CRPV E7 immortalized RK after a cellular crisis but showed no such activity in human keratinocytes. Co-expressed CRPV E6 prevented cellular crisis. The HPV16 or CRPV E7 protein reduced rabbit pRb levels thereby causing rabbit p19 ARF induction and accumulation of p53 without affecting cellular proliferation. Both CRPV E6 proteins failed to degrade rabbit p53 in vitro or to bind E6AP; however, p53 was still inducible by mitomycin C. In summary, CRPV E7 immortalizes rabbit keratinocytes in a species-specific manner and E6 contributes to immortalization without directly affecting p53

  14. Laser capture microdissection-based in vivo genomic profiling of wound keratinocytes identifies similarities and differences to squamous cell carcinoma

    DEFF Research Database (Denmark)

    Pedersen, Tanja Xenia; Leethanakul, Chidchanop; Patel, Vyomesh

    2003-01-01

    keratinocytes from incisional mouse skin wounds and adjacent normal skin keratinocytes. Changes in gene expression were determined by comparative cDNA array analyses, and the approach was validated by in situ hybridization. The analyses identified 48 candidate genes not previously associated with wound...... reepithelialization. Furthermore, the analyses revealed that the phenotypic resemblance of wound keratinocytes to squamous cell carcinoma is mimicked at the level of gene expression, but notable differences between the two tissue-remodeling processes were also observed. The combination of laser capture...

  15. Stem cell recovering effect of copper-free GHK in skin.

    Science.gov (United States)

    Choi, Hye-Ryung; Kang, Youn-A; Ryoo, Sun-Jong; Shin, Jung-Won; Na, Jung-Im; Huh, Chang-Hun; Park, Kyoung-Chan

    2012-11-01

    The peptide Gly-His-Lys (GHK) is a naturally occurring copper(II)-chelating motifs in human serum and cerebrospinal fluid. In industry, GHK (with or without copper) is used to make hair and skin care products. Copper-GHK plays a physiological role in the process of wound healing and tissue repair by stimulating collagen synthesis in fibroblasts. We also reported that copper-GHK promotes the survival of basal stem cells in the skin. However, the effects of copper-free GHK (GHK) have not been investigated well. In this study, the effects of GHK were studied using cultured normal human keratinocytes and skin equivalent (SE) models. In monolayer cultured keratinocytes, GHK increased the proliferation of keratinocytes. When GHK was added during the culture of SE models, the basal cells became more cuboidal than control model. In addition, there was linear and intense staining of α6 and β1 integrin along the basement membrane. The number of p63 and proliferating cell nuclear antigen positive cells was also significantly increased in GHK-treated SEs than in control SEs. Western blot and slide culture experiment showed that GHK increased the expression of integrin by keratinocytes. All these results showed that GHK increased the stemness and proliferative potential of epidermal basal cells, which is associated with increased expression of integrin. In conclusion, copper-free GHK showed similar effects with copper-GHK. Thus, it can be said that copper-free GHK can be used in industry to obtain the effects of copper-GHK in vivo. Further study is necessary to explore the relationship between copper-free GHK and copper-GHK. Copyright © 2012 European Peptide Society and John Wiley & Sons, Ltd.

  16. Effect of Nanodiamond and Nanoplatinum Liquid, DPV576, on Human Primary Keratinocytes.

    Science.gov (United States)

    Ghoneum, Mamdooh H; Katano, Hideki; Agrawal, Sudhanshu; Ganguly, Sreerupa; Agrawal, Anshu

    2017-01-01

    Nanofabrics are now being used in a wide range of products that come into direct contact with skin, including carpet, clothing, and medical fabrics. In the current study, we examined the effect of a dispersed aqueous mixture of nanodiamond (ND) and nanoplatinum (NP) (DPV576) on human primary keratinocytes with respect to transient receptor potential vanilloid (TRPV) channel expression, secretion of cytokines and production of nerve growth factor (NGF). Keratinocytes were treated with DPV576 at concentrations of 1:10 and 1:100 dilutions for 24 hours in vitro, and their activation of was determined by production of cytokines TNF-α, IL-1β, and prostaglandin (PGE2), and by production of NGF. Inhibitor experiments were carried out by incubating keratinocytes with the TRPV4-selective antagonist HC-067047. TRPV receptor expression (TRPV1, TRPV3 and TRPV4) on keratinocytes as well as changes in Ca2+ potential were examined by flow cytometry. DPV576 treatment of keratinocytes resulted in the following effects: (1) stimulation of keratinocytes as indicated by the significant secretion of cytokines IL-1β, TNF-α, and PGE2, an effect noted only at higher concentration (1:10); (2) significant decrease in the expression of TRPV4 on keratinocytes with a spike in the calcium flux, but no change in the expression of TRPV1 and TRPV3; (3) induction of cytokine secretion independent of TRPV4, as the addition of TRPV4 inhibitor had no significant effect on the cytokine production from keratinocytes; (4) induction of NGF secretion by keratinocytes. These results demonstrate that DPV576 activates keratinocytes via multiple signaling pathways which may reduce stress associated with inflammation, pain, and circadian rhythms. ND/NP-coated fabrics that target the modulation of local inflammation, pain, and circadian rhythms could potentially be of benefit to humans.

  17. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  18. Effects of titanium dioxide nanoparticles on human keratinocytes.

    Science.gov (United States)

    Wright, Clayton; Iyer, Anand Krishnan V; Wang, Liying; Wu, Nianqiang; Yakisich, Juan S; Rojanasakul, Yon; Azad, Neelam

    2017-01-01

    Titanium dioxide (TiO 2 ) is a ubiquitous whitening compound widely used in topical products such as sunscreens, lotions and facial creams. The damaging health effects of TiO 2 inhalation has been widely studied in rats, mice and humans showing oxidative stress increase, DNA damage, cell death and inflammatory gene upregulation in lung and throat cells; however, the effects on skin cells from long-term topical use of various products remain largely unknown. In this study, we assessed the effect of specific TiO 2 nanoparticles (H 2 TiO 7 ) on a human keratinocyte cell line (HaCaT). We performed a comparative analysis using three TiO 2 particles varying in size (Fine, Ultrafine and H 2 TiO 7 ) and analyzed their effects on HaCaTs. There is a clear dose-dependent increase in superoxide production, caspase 8 and 9 activity, and apoptosis in HaCaTs after treatment with all three forms of TiO 2 ; however, there is no consistent effect on cell viability and proliferation with either of these TiO 2 particles. While there is data suggesting UV exposure can enhance the carcinogenic effects of TiO 2 , we did not observe any significant effect of UV-C exposure combined with TiO 2 treatment on HaCaTs. Furthermore, TiO 2 -treated cells showed minimal effects on VEGF upregulation and Wnt signaling pathway thereby showing no potential effect on angiogenesis and malignant transformation. Overall, we report here an increase in apoptosis, which may be caspase 8/Fas-dependent, and that the H 2 TiO 7 nanoparticles, despite their smaller particle size, had no significant enhanced effect on HaCaT cells as compared to Fine and Ultrafine forms of TiO 2 .

  19. Application of low level laser on skin cell lines

    CSIR Research Space (South Africa)

    Ndhundhuma, IM

    2010-01-01

    Full Text Available Lasers have emerged as powerful tools for tissue engineering. To examine cellular growth, and cell to cell interactions, in vitro skin models have been developed combining two major cell types of skin, keratinocytes and fibroblasts. The main...

  20. Study of mast cell count in skin tags

    Directory of Open Access Journals (Sweden)

    Zaher Hesham

    2007-01-01

    Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.

  1. Response of Primary Human Bone Marrow Mesenchymal Stromal Cells and Dermal Keratinocytes to Thermal Printer Materials In Vitro.

    Science.gov (United States)

    Schmelzer, Eva; Over, Patrick; Gridelli, Bruno; Gerlach, Jörg C

    Advancement in thermal three-dimensional printing techniques has greatly increased the possible applications of various materials in medical applications and tissue engineering. Yet, potential toxic effects on primary human cells have been rarely investigated. Therefore, we compared four materials commonly used in thermal printing for bioengineering, namely thermally printed acrylonitrile butadiene styrene, MED610, polycarbonate, and polylactic acid, and investigated their effects on primary human adult skin epidermal keratinocytes and bone marrow mesenchymal stromal cells (BM-MSCs) in vitro. We investigated indirect effects on both cell types caused by potential liberation of soluble substances from the materials, and also analyzed BM-MSCs in direct contact with the materials. We found that even in culture without direct contact with the materials, the culture with MED610 (and to a lesser extent acrylonitrile butadiene styrene) significantly affected keratinocytes, reducing cell numbers and proliferation marker Ki67 expression, and increasing glucose consumption, lactate secretion, and expression of differentiation-associated genes. BM-MSCs had decreased metabolic activity, and exhibited increased cell death in direct culture on the materials. MED610 and acrylonitrile butadiene styrene induced the strongest expression of genes associated to differentiation and estrogen receptor activation. In conclusion, we found strong cell-type-specific effects of the materials, suggesting that materials for applications in regenerative medicine should be carefully selected not only based on their mechanical properties but also based on their cell-type-specific biological effects.

  2. FOXO1 expression in keratinocytes promotes connective tissue healing

    Science.gov (United States)

    Zhang, Chenying; Lim, Jason; Liu, Jian; Ponugoti, Bhaskar; Alsadun, Sarah; Tian, Chen; Vafa, Rameen; Graves, Dana T.

    2017-01-01

    Wound healing is complex and highly orchestrated. It is well appreciated that leukocytes, particularly macrophages, are essential for inducing the formation of new connective tissue, which requires the generation of signals that stimulate mesenchymal stem cells (MSC), myofibroblasts and fibroblasts. A key role for keratinocytes in this complex process has yet to be established. To this end, we investigated possible involvement of keratinocytes in connective tissue healing. By lineage-specific deletion of the forkhead box-O 1 (FOXO1) transcription factor, we demonstrate for the first time that keratinocytes regulate proliferation of fibroblasts and MSCs, formation of myofibroblasts and production of collagen matrix in wound healing. This stimulation is mediated by a FOXO1 induced TGFβ1/CTGF axis. The results provide direct evidence that epithelial cells play a key role in stimulating connective tissue healing through a FOXO1-dependent mechanism. Thus, FOXO1 and keratinocytes may be an important therapeutic target where healing is deficient or compromised by a fibrotic outcome. PMID:28220813

  3. Anti-ageing effects of a new synthetic sphingolipid (K6EAA-L12) on aged murine skin.

    Science.gov (United States)

    Jung, Minyoung; Lee, Sanghoon; Park, Hwa-young; Youm, Jong-Kyung; Jeong, Sekyoo; Bae, Jonghwan; Kwon, Mi Jung; Park, Byeong Deog; Lee, Seung Hun; Choi, Eung Ho

    2011-04-01

    Recently, we reported on the anti-ageing effects of K6PC-5. This compound induced keratinocyte differentiation and fibroblast proliferation by increasing sphingosine-1 phosphate synthesis. We performed this study to confirm the anti-ageing effects of new synthetic products (the K6EAA series) derived from K6PC-5 through an amino group induction. Cellular responses such as differentiation, proliferation and calcium mobilization were investigated using cultured human keratinocytes and fibroblasts. Also, we measured the expressions of collagen mRNA and protein using real time RT-PCR and ELISA, respectively. The K6EAA-L12 product, selected by in vitro screening, was evaluated for anti-ageing effects on intrinsically and extrinsically (photo) aged models of hairless mice. In the intrinsically aged murine skin, K6EAA-L12 showed anti-ageing effects by activating collagen synthesis, eventually causing dermal thickening. Also, in the photo-aged skin, the dermal collagen density and dermal thickness were increased. In photo-aged murine skin, K6EAA-L12 increased stratum corneum integrity by increasing corneodesmosome density and improved the barrier recovery rate. However, there were no changes in the expressions of epidermal differentiation maker proteins. In conclusion, topical K6EAA-L12, a new synthetic K6PC-5 derivative, improves intrinsically and extrinsically (photo) aged skin by increasing the collagen density and improving the skin barrier function. © 2011 John Wiley & Sons A/S.

  4. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA-FABP...... as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... acid sequence revealed 48%, 52%, and 56% identity to known low-molecular-weight fatty acid-binding proteins belonging to the FABP family. Northern blot analysis showed that PA-FABP mRNA is indeed highly up-regulated in psoriatic keratinocytes. The transcript is present in human cell lines of epithelial...

  5. Differential Activation of Human Keratinocytes by Leishmania Species Causing Localized or Disseminated Disease.

    Science.gov (United States)

    Scorza, Breanna M; Wacker, Mark A; Messingham, Kelly; Kim, Peter; Klingelhutz, Aloysius; Fairley, Janet; Wilson, Mary E

    2017-10-01

    All Leishmania species parasites are introduced into mammalian skin through a sand fly bite, but different species cause distinct clinical outcomes. Mouse studies suggest that early responses are critical determinants of subsequent adaptive immunity in leishmaniasis, yet few studies address the role of keratinocytes, the most abundant cell in the epidermis. We hypothesized that Leishmania infection causes keratinocytes to produce immunomodulatory factors that influence the outcome of infection. Incubation of primary or immortalized human keratinocytes with Leishmania infantum or Leishmania major, which cause visceral or cutaneous leishmaniasis, respectively, elicited dramatically different responses. Keratinocytes incubated with L. infantum significantly increased expression of proinflammatory genes for IL-6, IL-8, tumor necrosis factor, and IL-1B, whereas keratinocytes exposed to several L. major isolates did not. Furthermore, keratinocyte-monocyte co-incubation studies across a 4 µM semipermeable membrane suggested that L. infantum-exposed keratinocytes release soluble factors that enhance monocyte control of intracellular L. infantum replication (P Leishmania species that may affect the course of disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

    Science.gov (United States)

    Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

    2012-05-01

    Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  7. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    International Nuclear Information System (INIS)

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia

    2007-01-01

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10

  8. CD44 antibody stimulates adhesion of peripheral blood T cells to keratinocytes through the leukocyte function-associated antigen-1/intercellular adhesion molecule-1 pathway

    NARCIS (Netherlands)

    Bruynzeel, I.; Koopman, G.; van der Raaij, L. M.; Pals, S. T.; Willemze, R.

    1993-01-01

    Close contact between T lymphocytes and keratinocytes is an important feature of many inflammatory skin diseases. In vitro studies showed that stimulation of keratinocytes with interferon-gamma or tumor necrosis factor-alpha and of T cells with phorbol esters results in a leukocyte

  9. Characterization of A Three-Dimensional Organotypic Co-Culture Skin Model for Epidermal Differentiation of Rat Adipose-Derived Stem Cells.

    Science.gov (United States)

    Ghanavati, Zeinab; Orazizadeh, Mahmoud; Bayati, Vahid; Abbaspour, Mohammad Reza; Khorsandi, Layasadat; Mansouri, Esrafil; Neisi, Niloofar

    2016-01-01

    The organotypic co-culture is a well-known technique to examine cellular interactions and their roles in stem cell proliferation and differentiation. This study aims to evaluate the effects of dermal fibroblasts (DFs) on epidermal differentiation of adipose-derived stem cells (ASCs) using a three-dimensional (3D) organotypic co- culture technique. In this experimental research study, rat DFs and ASCs were isolated and cultured separately on electrospun polycaprolactone (PCL) matrices. The PCL matrices seeded by ASCs were superimposed on to the matrices seeded by DFs in order to create a 3D organotypic co-culture. In the control groups, PCL matrices seeded by ASCs were placed on matrices devoid of DFs. After 10 days, we assessed the expressions of keratinocyte-related genes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and expression of pan-cytokeratin protein by immunofluorescence in the differentiated keratinocyte-like cells from co- culture and control groups. Keratinocyte-like cell morphologies were also observed by scanning electron microscopy (SEM). The early, intermediate, and terminal differentiation keratinocyte markers-Cytokeratin14, Filaggrin, and Involucrin significantly expressed in the co-culture groups com- pared to the control ones (P<0.05). We observed pan-cytokeratin in keratinocyte-like cells of both groups by immunofluorescence. SEM observation of the co-culture groups showed that the differentiated keratinocyte-like cells developed a polygonal cobblestone shape, considered characteristic of keratinocytes. The 3D organotypic co-culture bilayered construct that consisted of DFs and ASCs was an effective technique for epidermal differentiation of ASCs. This co-culture might be useful for epidermal differentiation of stem cells for future applications in skin regeneration.

  10. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  11. Staphylococcus aureus keratinocyte invasion is mediated by integrin-linked kinase and Rac1.

    Science.gov (United States)

    Sayedyahossein, Samar; Xu, Stacey X; Rudkouskaya, Alena; McGavin, Martin J; McCormick, John K; Dagnino, Lina

    2015-02-01

    Staphylococcus aureus is a major component of the skin microbiota and causes a large number of serious infections. S. aureus first interacts with epidermal keratinocytes to breach the epidermal barrier through mechanisms not fully understood. By use of primary keratinocytes from mice with epidermis-restricted Ilk gene inactivation and control integrin-linked kinase (ILK)-expressing littermates, we investigated the role of ILK in epidermal S. aureus invasion. Heat-killed, but not live, bacteria were internalized to Rab5- and Rab7-positive phagosomes, and incubation with keratinocyte growth factor increased their uptake 2.5-fold. ILK-deficient mouse keratinocytes internalized bacteria 2- to 4-fold less efficiently than normal cells. The reduced invasion by live S. aureus of ILK-deficient cells was restored in the presence of exogenous, constitutively active Rac1. Thus, Rac1 functions downstream from ILK during invasion. Further, invasion by S. aureus of Rac1-deficient cells was 2.5-fold lower than in normal cells. Paradoxically, staphylococcal cutaneous penetration of mouse skin explants with ILK-deficient epidermis was 35-fold higher than that of normal skin, indicating defects in epidermal barrier function in the absence of ILK. Thus, we identified an ILK-Rac1 pathway essential for bacterial invasion of keratinocytes, and established ILK as a key contributor to prevent invasive staphylococcal cutaneous infection. © FASEB.

  12. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Bernard, Eric; Hamel, Rodolphe; Neyret, Aymeric; Ekchariyawat, Peeraya; Molès, Jean-Pierre; Simmons, Graham; Chazal, Nathalie; Desprès, Philippe

    2015-01-01

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  13. Artificial skin--culturing of different skin cell lines for generating an artificial skin substitute on cross-weaved spider silk fibres.

    Directory of Open Access Journals (Sweden)

    Hanna Wendt

    Full Text Available BACKGROUND: In the field of Plastic Reconstructive Surgery the development of new innovative matrices for skin repair is in urgent need. The ideal biomaterial should promote attachment, proliferation and growth of cells. Additionally, it should degrade in an appropriate time period without releasing harmful substances, but not exert a pathological immune response. Spider dragline silk from Nephila spp meets these demands to a large extent. METHODOLOGY/PRINCIPAL FINDINGS: Native spider dragline silk, harvested directly out of Nephila spp spiders, was woven on steel frames. Constructs were sterilized and seeded with fibroblasts. After two weeks of cultivating single fibroblasts, keratinocytes were added to generate a bilayered skin model, consisting of dermis and epidermis equivalents. For the next three weeks, constructs in co-culture were lifted on an originally designed setup for air/liquid interface cultivation. After the culturing period, constructs were embedded in paraffin with an especially developed program for spidersilk to avoid supercontraction. Paraffin cross-sections were stained in Haematoxylin & Eosin (H&E for microscopic analyses. CONCLUSION/SIGNIFICANCE: Native spider dragline silk woven on steel frames provides a suitable matrix for 3 dimensional skin cell culturing. Both fibroblasts and keratinocytes cell lines adhere to the spider silk fibres and proliferate. Guided by the spider silk fibres, they sprout into the meshes and reach confluence in at most one week. A well-balanced, bilayered cocultivation in two continuously separated strata can be achieved by serum reduction, changing the medium conditions and the cultivation period at the air/liquid interphase. Therefore spider silk appears to be a promising biomaterial for the enhancement of skin regeneration.

  14. The effect of x-ray irradiation on proliferation and differentiation of epithelial cells in mouse skin

    International Nuclear Information System (INIS)

    Tanabe, Akira

    1980-01-01

    To elucidate radiation injuries and the recovery mechanism of epithelial cells exposed to 150 R or 450 R of x-ray, the epidermal proliferative unit (EPU) in the backs of mice was analysed histologically and dynamically by measuring the labelled index of cells with 3 H-thymidine and measuring differentiation index of cells. EPU was normal for 6 days after irradiation with both 150 R and 450 R. However, partial hyperplasia and EPU disorders in a range consistent with hyperplasia appeared in segmented preparations 7 days after irradiation. Both doses inhibited cell differentiation for 5 days after irradiation. Cell proliferation, which was higher than the normal rate, peaked 7 days after irradiation with 150 R and 9 days after irradiation with 540 R. Cell proliferation returned to normal 10 days after irradiation. DNA synthesis was inhibited one day after irradiation with both 150 R and 450 R, but it returned to normal 3 days after irradiation. There was an overshoot of DNA synthesis, but synthesis returned to normal 9 days after irradiation with 150 R and 12 days after irradiation with 450 R. EPU disorders returned to normal according to normalization of cell differentiation and DNA synthesis. (Tsunoda, M.)

  15. TRB3 is elevated in psoriasis vulgaris lesions and mediates HaCaT cells proliferation in vitro.

    Science.gov (United States)

    Yu, Xiao-Jing; Song, Tie-Jun; Zhang, Lu-Wei; Su, Ying; Wang, Ke-Yu; Sun, Qing

    2017-10-01

    Psoriasis is a chronic skin disease characterized by abnormal keratinocyte proliferation and differentiation, inflammation, and angiogenesis. Overexpression of tribbles homolog3 (TRB3), which belongs to the tribbles family of pseudokinases, has been found in several human tumors and metabolic diseases, but its role in psoriasis has not been fully clarified. The aim of this study is to investigate the expression of TRB3 in psoriasis and explore its roles in the proliferation of keratinocytes. Twenty-four patients with psoriasis vulgaris were recruited for the study. Diagnosis of psoriasis was based on clinical and histologic examinations. Immunohistochemistry and real-time reverse transcription PCR (RT-PCR) were performed to determine protein and messenger RNA (mRNA) expression of TRB3 in psoriasis lesions. 5-Bromo-2-deoxyUridine (BrdU) incorporation assay were performed for cell proliferation. Cell cycle distribution was assessed by flow cytometry analysis. The levels of TRB3 is elevated in psoriatic lesions compared with psoriatic non-lesions. The HaCat cells expressed the TRB3 gene. We found TRB3 silencing to significantly inhibit HaCat cell proliferation. Furthermore, the specific knockdown of TRB3 slowed down the cell cycle at the gap 0/first gap phase. In conclusion, our data suggest that TRB3 is overexpressed in lesions of patients with psoriasis and may be involved in the abnormal proliferation of keratinocytes. Therefore, TRB3 may be a potential therapeutic target for psoriasis. © American Federation for Medical Research (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  16. Cellulose/poly-(m-phenylene isophthalamide) porous film as a tissue-engineered skin bioconstruct

    Science.gov (United States)

    Lee, Jae Woong; Han, Sung Soo; Zo, Sum Mi; Choi, Soon Mo

    2018-06-01

    Regarding the porous structure, coagulated cellulose may not provide sufficient voids for cell proliferation, resulting in tissue growth. For this reason, it was blended with poly(m-phenylene isophthalamide) (PMIA), which could produce a porous structure in the resulting construct. The aim of this study was to confirm the potential of a novel cellulose/PMIA porous film as a tissue-engineered bioconstruct for impaired skin. The films were fabricated by a coagulation process added with a peel-off method, and the structural, mechanical properties were characterized by Fourier transform infrared spectroscopy, thermogravimetric analysis, and capillary flow porometry. CRL-2310 human keratinocytes were used to determine the biocompatibility of the prepared films. The attachment and proliferation of cells were investigated by scanning electron microscopy, DAPI staining, and a cell viability assay. The results show that cellulose/PMIA porous films have potential use as wound matrices for skin tissue genesis.

  17. A co-cultured skin model based on cell support membranes

    International Nuclear Information System (INIS)

    Dai, N.-T.; Yeh, M.-K.; Liu, Demeral David; Adams, E.F.; Chiang, C.-H.; Yen, C.-Y.; Shih, C.-M.; Sytwu, H.-K.; Chen, Tim-Mo; Wang, H.-J.; Williamson, M.R.; Coombes, A.G.A.

    2005-01-01

    Tissue engineering of skin based on collagen: PCL biocomposites using a designed co-culture system is reported. The collagen: PCL biocomposites having collagen: PCL (w/w) ratios of 1:4, 1:8, and 1:20 have been proven to be biocompatible materials to support both adult normal human epidermal Keratinocyte (NHEK) and mouse 3T3 fibroblast growth in cell culture, respectively, by Dai, Coombes, et al. in 2004. Films of collagen: PCL biocomposites were prepared using non-crosslinking method by impregnation of lyophilized collagen mats with PCL/dichloromethane solutions followed by solvent evaporation. To mimic the dermal/epidermal structure of skin, the 1:20 collagen: PCL biocomposites were selected for a feasibility study of a designed co-culture technique that would subsequently be used for preparing fibroblast/biocomposite/keratinocyte skin models. A 55.3% increase in cell number was measured in the designed co-culture system when fibroblasts were seeded on both sides of a biocomposite film compared with cell culture on one surface of the biocomposite in the feasibility study. The co-culture of human keratinocytes and 3T3 fibroblasts on each side of the membrane was therefore studied using the same co-culture system by growing keratinocytes on the top surface of membrane for 3 days and 3T3 fibroblasts underneath the membrane for 6 days. Scanning electron microscopy (SEM) and immunohistochemistry assay revealed good cell attachment and proliferation of both human keratinocytes and 3T3 fibroblasts with these two types of cells isolated well on each side of the membrane. Using a modified co-culture technique, a co-cultured skin model presenting a confluent epidermal sheet on one side of the biocomposite film and fibroblasts populated on the other side of the film was developed successfully in co-culture system for 28 days under investigations by SEM and immunohistochemistry assay. Thus, the design of a co-culture system based on 1:20 (w/w) collagen: PCL biocomposite

  18. Modulation of keratinocyte expression of antioxidants by 4-hydroxynonenal, a lipid peroxidation end product

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Ruijin [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Heck, Diane E. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Mishin, Vladimir; Black, Adrienne T. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Shakarjian, Michael P. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Kong, Ah-Ng Tony; Laskin, Debra L. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Laskin, Jeffrey D., E-mail: jlaskin@eohsi.rutgers.edu [Environmental and Occupational Medicine, Rutgers University-Robert Wood Johnson Medical School, Piscataway, NJ (United States)

    2014-03-01

    4-Hydroxynonenal (4-HNE) is a lipid peroxidation end product generated in response to oxidative stress in the skin. Keratinocytes contain an array of antioxidant enzymes which protect against oxidative stress. In these studies, we characterized 4-HNE-induced changes in antioxidant expression in mouse keratinocytes. Treatment of primary mouse keratinocytes and PAM 212 keratinocytes with 4-HNE increased mRNA expression for heme oxygenase-1 (HO-1), catalase, NADPH:quinone oxidoreductase (NQO1) and glutathione S-transferase (GST) A1-2, GSTA3 and GSTA4. In both cell types, HO-1 was the most sensitive, increasing 86–98 fold within 6 h. Further characterization of the effects of 4-HNE on HO-1 demonstrated concentration- and time-dependent increases in mRNA and protein expression which were maximum after 6 h with 30 μM. 4-HNE stimulated keratinocyte Erk1/2, JNK and p38 MAP kinases, as well as PI3 kinase. Inhibition of these enzymes suppressed 4-HNE-induced HO-1 mRNA and protein expression. 4-HNE also activated Nrf2 by inducing its translocation to the nucleus. 4-HNE was markedly less effective in inducing HO-1 mRNA and protein in keratinocytes from Nrf2 −/− mice, when compared to wild type mice, indicating that Nrf2 also regulates 4-HNE-induced signaling. Western blot analysis of caveolar membrane fractions isolated by sucrose density centrifugation demonstrated that 4-HNE-induced HO-1 is localized in keratinocyte caveolae. Treatment of the cells with methyl-β-cyclodextrin, which disrupts caveolar structure, suppressed 4-HNE-induced HO-1. These findings indicate that 4-HNE modulates expression of antioxidant enzymes in keratinocytes, and that this can occur by different mechanisms. Changes in expression of keratinocyte antioxidants may be important in protecting the skin from oxidative stress. - Highlights: • Lipid peroxidation generates 4-hydroxynonenal, a reactive aldehyde. • 4-HNE induces antioxidant proteins in mouse keratinocytes. • Induction of

  19. Molecular basis of retinol anti-ageing properties in naturally aged human skin in vivo.

    Science.gov (United States)

    Shao, Y; He, T; Fisher, G J; Voorhees, J J; Quan, T

    2017-02-01

    Retinoic acid has been shown to improve the aged-appearing skin. However, less is known about the anti-ageing effects of retinol (ROL, vitamin A), a precursor of retinoic acid, in aged human skin in vivo. This study aimed to investigate the molecular basis of ROL anti-ageing properties in naturally aged human skin in vivo. Sun-protected buttock skin (76 ± 6 years old, n = 12) was topically treated with 0.4% ROL and its vehicle for 7 days. The effects of topical ROL on skin epidermis and dermis were evaluated by immunohistochemistry, in situ hybridization, Northern analysis, real-time RT-PCR and Western analysis. Collagen fibrils nanoscale structure and surface topology were analysed by atomic force microscopy. Topical ROL shows remarkable anti-ageing effects through three major types of skin cells: epidermal keratinocytes, dermal endothelial cells and fibroblasts. Topical ROL significantly increased epidermal thickness by stimulating keratinocytes proliferation and upregulation of c-Jun transcription factor. In addition to epidermal changes, topical ROL significantly improved dermal extracellular matrix (ECM) microenvironment; increasing dermal vascularity by stimulating endothelial cells proliferation and ECM production (type I collagen, fibronectin and elastin) by activating dermal fibroblasts. Topical ROL also stimulates TGF-β/CTGF pathway, the major regulator of ECM homeostasis, and thus enriched the deposition of ECM in aged human skin in vivo. 0.4% topical ROL achieved similar results as seen with topical retinoic acid, the biologically active form of ROL, without causing noticeable signs of retinoid side effects. 0.4% topical ROL shows remarkable anti-ageing effects through improvement of the homeostasis of epidermis and dermis by stimulating the proliferation of keratinocytes and endothelial cells, and activating dermal fibroblasts. These data provide evidence that 0.4% topical ROL is a promising and safe treatment to improve the naturally aged human skin

  20. Psoriasiform skin disease in transgenic pigs with high-copy ectopic expression of human integrins α2 and β1

    Science.gov (United States)

    Staunstrup, Nicklas Heine; Stenderup, Karin; Mortensen, Sidsel; Primo, Maria Nascimento; Steiniche, Torben; Liu, Ying; Li, Rong; Schmidt, Mette; Purup, Stig; Dagnæs-Hansen, Frederik; Schrøder, Lisbeth Dahl; Svensson, Lars; Petersen, Thomas Kongstad; Callesen, Henrik; Bolund, Lars

    2017-01-01

    ABSTRACT Psoriasis is a complex human-specific disease characterized by perturbed keratinocyte proliferation and a pro-inflammatory environment in the skin. Porcine skin architecture and immunity are very similar to that in humans, rendering the pig a suitable animal model for studying the biology and treatment of psoriasis. Expression of integrins, which is normally confined to the basal layer of the epidermis, is maintained in suprabasal keratinocytes in psoriatic skin, modulating proliferation and differentiation as well as leukocyte infiltration. Here, we generated minipigs co-expressing integrins α2 and β1 in suprabasal epidermal layers. Integrin-transgenic minipigs born into the project displayed skin phenotypes that correlated with the number of inserted transgenes. Molecular analyses were in good concordance with histological observations of psoriatic hallmarks, including hypogranulosis and T-lymphocyte infiltration. These findings mark the first creation of minipigs with a psoriasiform phenotype resembling human psoriasis and demonstrate that integrin signaling plays a key role in psoriasis pathology. PMID:28679670

  1. Platelet lysate as a serum replacement for skin cell culture on biomimetic PCL nanofibers.

    Science.gov (United States)

    Sovkova, Vera; Vocetkova, Karolina; Rampichova, Michala; Mickova, Andrea; Buzgo, Matej; Lukasova, Vera; Dankova, Jana; Filova, Eva; Necas, Alois; Amler, Evzen

    2018-06-01

    Platelets are a popular source of native growth factors for tissue engineering applications. The aim of the study was to verify the use of platelet lysate as a fetal bovine serum (FBS) replacement for skin cell culture. The cytokine content of the platelet lysate was characterized using the Bio-Plex system. The cells (fibroblasts, melanocytes, and keratinocytes) were cultured on PCL nanofibrous scaffolds to mimic their natural microenvironment. The cytokine content of the platelet lysate was determined, and to the cells, a medium containing platelet lysate or platelet lysate in combination with FBS was added. The results showed that 7% (v/v) platelet lysate was sufficient to supplement 10% (v/v) FBS in the culture of fibroblasts and keratinocytes. The combination of platelet lysate and FBS had a rather inhibitory effect on fibroblasts, in contrary to keratinocytes, where the effect was synergic. Platelet lysate did not sufficiently promote proliferation in melanocytes; however, the combination of FBS and platelet lysate yielded a better outcome and resulted in bipolar morphology of the cultured melanocytes. The data indicated that platelet lysate improved cell proliferation and metabolic activity and may be used as an additive to the cell culture media.

  2. Changes in dermal matrix in the absence of Rac1 in keratinocytes

    DEFF Research Database (Denmark)

    Stanley, Alanna; Pedersen, Esben Ditlev Kølle; Brakebusch, Cord

    2016-01-01

    Keratinocytes, in response to irritants, secrete pro-inflammatory mediators which recruit and activate immune and mesenchymal cells, including fibroblasts, to repair the skin. Fibroblasts respond by synthesising collagen and promoting the crosslinking extracellular matrix (ECM). We recently showed....... As inflammation is intimately linked with fibrotic disease in the skin, this raised the question as to whether this deletion may also affect the deposition and arrangement of the dermal ECM. This study assessed the effects of Rac1 deletion in keratinocytes and of the heightened inflammatory status by induction...... that this increase in the diameter of collagen fibrils due to inflammation may serve as pre-fibrotic marker enabling earlier determination of fibrosis and earlier treatment. This study has revealed previously unknown effects on the ECM due to the deletion of Rac1 in keratinocytes....

  3. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  4. Topical stabilized retinol treatment induces the expression of HAS genes and HA production in human skin in vitro and in vivo.

    Science.gov (United States)

    Li, Wen-Hwa; Wong, Heng-Kuan; Serrano, José; Randhawa, Manpreet; Kaur, Simarna; Southall, Michael D; Parsa, Ramine

    2017-05-01

    Skin Aging manifests primarily with wrinkles, dyspigmentations, texture changes, and loss of elasticity. During the skin aging process, there is a loss of moisture and elasticity in skin resulting in loss of firmness finally leading to skin sagging. The key molecule involved in skin moisture is hyaluronic acid (HA), which has a significant water-binding capacity. HA levels in skin decline with age resulting in decrease in skin moisture, which may contribute to loss of firmness. Clinical trials have shown that topically applied ROL effectively reduces wrinkles and helps retain youthful appearance. In the current study, ROL was shown to induce HA production and stimulates the gene expression of all three forms of hyaluronic acid synthases (HAS) in normal human epidermal keratinocytes monolayer cultures. Moreover, in human skin equivalent tissues and in human skin explants, topical treatment of tissues with a stabilized-ROL formulation significantly induced the gene expression of HAS mRNA concomitant with an increased HA production. Finally, in a vehicle-controlled human clinical study, histochemical analysis confirmed increased HA accumulation in the epidermis in ROL-treated human skin as compared to vehicle. These results show that ROL increases skin expression of HA, a significant contributing factor responsible for wrinkle formation and skin moisture, which decrease during aging. Taken together with the activity to increase collagen, elastin, and cell proliferation, these studies establish that retinol provides multi-functional activity for photodamaged skin.

  5. Ca2+-dependent localization of integrin-linked kinase to cell junctions in differentiating keratinocytes.

    Science.gov (United States)

    Vespa, Alisa; Darmon, Alison J; Turner, Christopher E; D'Souza, Sudhir J A; Dagnino, Lina

    2003-03-28

    Integrin complexes are necessary for proper proliferation and differentiation of epidermal keratinocytes. Differentiation of these cells is accompanied by down-regulation of integrins and focal adhesions as well as formation of intercellular adherens junctions through E-cadherin homodimerization. A central component of integrin adhesion complexes is integrin-linked kinase (ILK), which can induce loss of E-cadherin expression and epithelial-mesenchymal transformation when ectopically expressed in intestinal and mammary epithelia. In cultured primary mouse keratinocytes, we find that ILK protein levels are independent of integrin expression and signaling, since they remain constant during Ca(2+)-induced differentiation. In contrast, keratinocyte differentiation is accompanied by marked reduction in kinase activity in ILK immunoprecipitates and altered ILK subcellular distribution. Specifically, ILK distributes in close apposition to actin fibers along intercellular junctions in differentiated but not in undifferentiated keratinocytes. ILK localization to cell-cell borders occurs independently of integrin signaling and requires Ca(2+) as well as an intact actin cytoskeleton. Further, and in contrast to what is observed in other epithelial cells, ILK overexpression in differentiated keratinocytes does not promote E-cadherin down-regulation and epithelial-mesenchymal transition. Thus, novel tissue-specific mechanisms control the formation of ILK complexes associated with cell-cell junctions in differentiating murine epidermal keratinocytes.

  6. Extracellular calcium alters the effects of retinoic acid on DNA synthesis in cultured murine keratinocytes

    International Nuclear Information System (INIS)

    Tong, P.; Mayes, D.; Wheeler, L.

    1986-01-01

    The rate of proliferation of epidermal keratinocytes was manipulated by growing the cells in medium containing high or low concentrations of calcium. Keratinocytes cultured in high extracellular Ca ++ (1.4 mM and 2.8 mM) proliferated twice as fast as those grown in low Ca ++ medium (0.09 mM) as measured by incorporation of [ 3 H] thymidine into DNA. Exposure of high calcium keratinocytes to all-trans retinoic acid for 4 days caused a dose-related inhibition of DNA synthesis with an IC 50 of about 10 μM. In contrast, incubating low calcium keratinocytes with all-trans retinoic acid caused a dose-related stimulation of DNA synthesis with maximum increase of 278% over control at 10 μM. This increase was accompanied by increases in culture confluency with maximum increase of 109% in cell number of control at 10 μM. These results are of importance since they suggest Ca ++ may influence the effect of retinoids on keratinocytes

  7. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M

    2017-08-22

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema.

  8. Modulation of the androgenetic response in diverse skin cell types: the pilosebaceous unit

    International Nuclear Information System (INIS)

    Zurvarra, F.; Kerner, N.; Hagelin, K.

    2009-01-01

    Androgens play a central role in diverse morphogenetic processes of the skin. Hair growth and follicular cycle are regulated in part by androgens. Androgens also play a key function, together with other receptors such as the PPARs receptors family, on the proliferation and differentiation of the sebaceous gland that forms part of the pilosebaceous unit and influences hair growth and skin well-being. UV radiation may affect androgens regulation of skin homeostasis. Objectives: to study the modulation of androgenetic response related to UV radiation on the pilosebaceous unit, in two skin conditions: androgenetic alopecia and acne, both affecting skin and constituting major concerns for affected individuals. Methods: primary cultures of cells and established cell lines from the pilosebaceous unit: dermal papillae cells, keratinocytes and sebocytes. Analysis of lipid content, inflammatory response and proliferation of cells under the influence of androgens, PPARs ligands and UVR. Results: sebocytes primary cultures were obtained from human sebaceous glands. Proliferation and differentiation, as well as the expression of proinflammatory molecules (IL-1, TNF alpha, iNOs) and lipogenic enzymes (FASN) under androgens and UV treatment were assessed. The response to androgens under UV exposure was also analyzed in dermal papillae cells in culture. (authors)

  9. Galectin-7 overexpression is associated with the apoptotic process in UVB-induced sunburn keratinocytes

    Science.gov (United States)

    Bernerd, Francoise; Sarasin, Alain; Magnaldo, Thierry

    1999-01-01

    Galectin-7 is a β-galactoside binding protein specifically expressed in stratified epithelia and notably in epidermis, but barely detectable in epidermal tumors and absent from squamous carcinoma cell lines. Galectin-7 gene is an early transcriptional target of the tumor suppressor protein P53 [Polyak, K., Xia, Y., Zweier, J., Kinzler, K. & Vogelstein, B. (1997) Nature (London) 389, 300–305]. Because p53 transcriptional activity is increased by genotoxic stresses we have examined the possible effects of ultraviolet radiations (UVB) on galectin-7 expression in epidermal keratinocytes. The amounts of galectin-7 mRNA and protein are increased rapidly after UVB irradiation of epidermal keratinocytes. The increase of galectin-7 is parallel to P53 stabilization. UVB irradiation of skin reconstructed in vitro and of human skin ex vivo demonstrates that galectin-7 overexpression is associated with sunburn/apoptotic keratinocytes. Transfection of a galectin-7 expression vector results in a significant increase in terminal deoxynucleotidyltransferase-mediated UTP end labeling-positive keratinocytes. The present findings demonstrate a keratinocyte-specific protein involved in the UV-induced apoptosis, an essential process in the maintenance of epidermal homeostasis. PMID:10500176

  10. Ecklonia cava Extract and Dieckol Attenuate Cellular Lipid Peroxidation in Keratinocytes Exposed to PM10.

    Science.gov (United States)

    Lee, Jeong-Won; Seok, Jin Kyung; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter can cause oxidative stress, inflammation, and premature skin aging. Marine plants such as Ecklonia cava Kjellman contain high amounts of polyphenolic antioxidants. The purpose of this study was to examine the antioxidative effects of E. cava extract in cultured keratinocytes exposed to airborne particulate matter with a diameter of <10  μ m (PM10). After the exposure of cultured HaCaT keratinocytes to PM10 in the absence and presence of E. cava extract and its constituents, cell viability and cellular lipid peroxidation were assessed. The effects of eckol and dieckol on cellular lipid peroxidation and cytokine expression were examined in human epidermal keratinocytes exposed to PM10. The total phenolic content of E. cava extract was the highest among the 50 marine plant extracts examined. The exposure of HaCaT cells to PM10 decreased cell viability and increased lipid peroxidation. The PM10-induced cellular lipid peroxidation was attenuated by E. cava extract and its ethyl acetate fraction. Dieckol more effectively attenuated cellular lipid peroxidation than eckol in both HaCaT cells and human epidermal keratinocytes. Dieckol and eckol attenuated the expression of inflammatory cytokines such as tumor necrosis factor- (TNF-) α , interleukin- (IL-) 1 β , IL-6, and IL-8 in human epidermal keratinocytes stimulated with PM10. This study suggested that the polyphenolic constituents of E. cava , such as dieckol, attenuated the oxidative and inflammatory reactions in skin cells exposed to airborne particulate matter.

  11. Cryopreservation of dermal fibroblasts and keratinocytes in hydroxyethyl starch-based cryoprotectants.

    Science.gov (United States)

    Naaldijk, Yahaira; Johnson, Adiv A; Friedrich-Stöckigt, Annett; Stolzing, Alexandra

    2016-12-01

    Preservation of human skin fibroblasts and keratinocytes is essential for the creation of skin tissue banks. For successful cryopreservation of cells, selection of an appropriate cryoprotectant agent (CPA) is imperative. The aim of this study was to identify CPAs that minimize toxic effects and allow for the preservation of human fibroblasts and keratinocytes in suspension and in monolayers. We cryopreserved human fibroblasts and keratinocytes with different CPAs and compared them to fresh, unfrozen cells. Cells were frozen in the presence and absence of hydroxyethyl starch (HES) or dimethyl sulfoxide (DMSO), the latter of which is a commonly used CPA known to exert toxic effects on cells. Cell numbers were counted immediately post-thaw as well as three days after thawing. Cellular structures were analyzed and counted by labeling nuclei, mitochondria, and actin filaments. We found that successful cryopreservation of suspended or adherent keratinocytes can be accomplished with a 10% HES or a 5% HES, 5% DMSO solution. Cell viability of fibroblasts cryopreserved in suspension was maintained with 10% HES or 5% HES, 5% DMSO solutions. Adherent, cryopreserved fibroblasts were successfully maintained with a 5% HES, 5% DMSO solution. We conclude that skin tissue cells can be effectively cryopreserved by substituting all or a portion of DMSO with HES. Given that DMSO is the most commonly used CPA and is believed to be more toxic than HES, these findings are of clinical significance for tissue-based replacement therapies. Therapies that require the use of keratinocyte and fibroblast cells, such as those aimed at treating skin wounds or skin burns, may be optimized by substituting a portion or all of DMSO with HES during cryopreservation protocols.

  12. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  13. Use of Clotted Human Plasma and Aprotinin in Skin Tissue Engineering: A Novel Approach to Engineering Composite Skin on a Porous Scaffold.

    Science.gov (United States)

    Paul, Michelle; Kaur, Pritinder; Herson, Marisa; Cheshire, Perdita; Cleland, Heather; Akbarzadeh, Shiva

    2015-10-01

    Tissue-engineered composite skin is a promising therapy for the treatment of chronic and acute wounds, including burns. Providing the wound bed with a dermal scaffold populated by autologous dermal and epidermal cellular components can further entice host cell infiltration and vascularization to achieve permanent wound closure in a single stage. However, the high porosity and the lack of a supportive basement membrane in most commercially available dermal scaffolds hinders organized keratinocyte proliferation and stratification in vitro and may delay re-epithelization in vivo. The objective of this study was to develop a method to enable the in vitro production of a human skin equivalent (HSE) that included a porous scaffold and dermal and epidermal cells expanded ex vivo, with the potential to be used for definitive treatment of skin defects in a single procedure. A collagen-glycosaminoglycan dermal scaffold (Integra(®)) was populated with adult fibroblasts. A near-normal skin architecture was achieved by the addition of coagulated human plasma to the fibroblast-populated scaffold before seeding cultured keratinocytes. This resulted in reducing scaffold pore size and improving contact surfaces. Skin architecture and basement membrane formation was further improved by the addition of aprotinin (a serine protease inhibitor) to the culture media to inhibit premature clot digestion. Histological assessment of the novel HSE revealed expression of keratin 14 and keratin 10 similar to native skin, with a multilayered neoepidermis morphologically comparable to human skin. Furthermore, deposition of collagen IV and laminin-511 were detected by immunofluorescence, indicating the formation of a continuous basement membrane at the dermal-epidermal junction. The proposed method was efficient in producing an in vitro near native HSE using the chosen off-the-shelf porous scaffold (Integra). The same principles and promising outcomes should be applicable to other biodegradable

  14. Study of epithelial differentiation and protein expression of keratinocyte-mesenchyme stem cell co-cultivation on electrospun nylon/B. vulgaris extract composite scaffold

    Energy Technology Data Exchange (ETDEWEB)

    Hosseinzadeh, Simzar [School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran (Iran, Islamic Republic of); Soleimani, Masoud [Department of Hematology, Faculty of Medical Sciences, TarbiatModares University, Tehran (Iran, Islamic Republic of); Vossoughi, Manuchehr [Chemical and Petroleum Engineering Department, Sharif University of Technology, Tehran (Iran, Islamic Republic of); Ranjbarvan, Parviz [Department of Tissue Engineering, School of Advanced Medical Technologies, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Hamedi, Shokoh [Department of Persian Pharmacy, School of Persian and Complementary Medicine, Mashhad University of Medical Sciences, Mashhad (Iran, Islamic Republic of); Zamanlui, Soheila [Tissue Engineering and Regenerative Medicine Institute, Tehran Central Branch, Islamic Azad University, Tehran (Iran, Islamic Republic of); Mahmoudifard, Matin, E-mail: mahmodifard@mehr.sharif.edu [Institute for Nanoscience and Nanotechnology, Sharif University of Technology, Tehran (Iran, Islamic Republic of); Nanotechnology and Tissue Engineering Department, Stem Cell Technology Research Center, Tehran (Iran, Islamic Republic of)

    2017-06-01

    Employing of the composite electrospun scaffold containing herbal extract in conjugation with co-culturing of cells can open up new window to the design of efficient biomaterials for skin tissue regeneration. Here, we introduce the synergistic effect of composite electrospun nanofibrous scaffold of nylon66 loaded with Beta vulgaris (B. vulgaris) (extract of beet roots, a plants whose widely used in Iranian folk medicine as wound healing medicine) and co-culture of mesenchymal stem-cells (MSCs)-human keratinocyte (H-keratino) differentiation towards epithelial lineage. In vitro biocompatibility was examined through MTT assay and epithelial differentiation checked by real-time PCR and immunocytochemistry (ICC) assay after co-culturing of MSCs and H-keratino on proposed scaffold. Significant enhancement in cell proliferation was detected after cell culturing on the composite type of electrospun scaffold containing B. vulgaris. Moreover, after 14 days of co-culturing process, gene expression results revealed that both composite and non-composite nylon66 electrospun scaffold promote epithelial differentiation compared to mono-cell culturing of H-keratino in terms of several markers as Cytokeratin 10, Cytokeratin 14 and Involucrin and ICC of some dermal proteins like Cytokeratin 14 and Loricrin. To the best of our knowledge, findings of this study will introduce new way for the generation of novel biomaterials for the development of current skin tissue engineering. - Highlights: • New way for the generation of novel biomaterials for the development of current skin tissue engineering. • Fabrication of novel composite scaffold containing Beta vulgaris through electrospinning • Synergistic effect was found on epithelial differentiation through co-culture of keratinocyte and MSC on proposed composite NFM.

  15. Study of epithelial differentiation and protein expression of keratinocyte-mesenchyme stem cell co-cultivation on electrospun nylon/B. vulgaris extract composite scaffold

    International Nuclear Information System (INIS)

    Hosseinzadeh, Simzar; Soleimani, Masoud; Vossoughi, Manuchehr; Ranjbarvan, Parviz; Hamedi, Shokoh; Zamanlui, Soheila; Mahmoudifard, Matin

    2017-01-01

    Employing of the composite electrospun scaffold containing herbal extract in conjugation with co-culturing of cells can open up new window to the design of efficient biomaterials for skin tissue regeneration. Here, we introduce the synergistic effect of composite electrospun nanofibrous scaffold of nylon66 loaded with Beta vulgaris (B. vulgaris) (extract of beet roots, a plants whose widely used in Iranian folk medicine as wound healing medicine) and co-culture of mesenchymal stem-cells (MSCs)-human keratinocyte (H-keratino) differentiation towards epithelial lineage. In vitro biocompatibility was examined through MTT assay and epithelial differentiation checked by real-time PCR and immunocytochemistry (ICC) assay after co-culturing of MSCs and H-keratino on proposed scaffold. Significant enhancement in cell proliferation was detected after cell culturing on the composite type of electrospun scaffold containing B. vulgaris. Moreover, after 14 days of co-culturing process, gene expression results revealed that both composite and non-composite nylon66 electrospun scaffold promote epithelial differentiation compared to mono-cell culturing of H-keratino in terms of several markers as Cytokeratin 10, Cytokeratin 14 and Involucrin and ICC of some dermal proteins like Cytokeratin 14 and Loricrin. To the best of our knowledge, findings of this study will introduce new way for the generation of novel biomaterials for the development of current skin tissue engineering. - Highlights: • New way for the generation of novel biomaterials for the development of current skin tissue engineering. • Fabrication of novel composite scaffold containing Beta vulgaris through electrospinning • Synergistic effect was found on epithelial differentiation through co-culture of keratinocyte and MSC on proposed composite NFM

  16. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  17. A New Pharmacological Agent (AKB-4924) Stabilizes Hypoxia Inducible Factor (HIF) and Increases Skin Innate Defenses Against Bacterial Infection

    Science.gov (United States)

    Okumura, Cheryl Y.M.; Hollands, Andrew; Tran, Dan N.; Olson, Joshua; Dahesh, Samira; von Köckritz-Blickwede, Maren; Thienphrapa, Wdee; Corle, Courtney; Jeung, Seung Nam; Kotsakis, Anna; Shalwitz, Robert A.; Johnson, Randall S.; Nizet, Victor

    2013-01-01

    Hypoxia inducible factor-1 (HIF-1) is a transcription factor that is a major regulator of energy homeostasis and cellular adaptation to low oxygen stress. HIF-1 is also activated in response to bacterial pathogens and supports the innate immune response of both phagocytes and keratinocytes. In this work, we show that a new pharmacological compound AKB-4924 (Akebia Therapeutics) increases HIF-1α levels and enhances the antibacterial activity of phagocytes and keratinocytes against both methicillin-sensitive and -resistant strains of Staphylococcus aureus in vitro. AKB-4924 is also effective in stimulating the killing capacity of keratinocytes against the important opportunistic skin pathogens Pseudomonas aeruginosa and Acinitobacter baumanii. The effect of AKB-4924 is mediated through the activity of host cells, as the compound exerts no direct antimicrobial activity. Administered locally as a single agent, AKB-4924 limits S. aureus proliferation and lesion formation in a mouse skin abscess model. This approach to pharmacologically boost the innate immune response via HIF-1 stabilization may serve as a useful adjunctive treatment for antibiotic-resistant bacterial infections. PMID:22371073

  18. Fractionated laser resurfacing corrects the inappropriate UVB response in geriatric skin.

    Science.gov (United States)

    Spandau, Dan F; Lewis, Davina A; Somani, Ally-Khan; Travers, Jeffrey B

    2012-06-01

    Non-melanoma skin cancer is a disease primarily afflicting geriatric patients as evidenced by the fact that 80% of all non-melanoma skin cancers are diagnosed in patients over the age of 60 years. As such, geriatric skin responds to cancer-inducing UVB irradiation in a manner that allows the establishment of tumor cells. Currently, the only effective treatment for non-melanoma skin cancer is the removal of the tumors after they appear, indicating the need for a more cost-effective prophylactic therapy. Geriatric volunteers were treated with fractionated laser resurfacing therapy on either sun-protected (upper buttocks) or chronically sun-exposed (dorsal forearm) skin. Fractionated laser resurfacing therapy was shown to decrease the occurrence of senescent fibroblasts in geriatric dermis, increase the dermal expression of IGF-1, and correct the inappropriate UVB response observed in untreated geriatric skin. These responses to fractionated laser resurfacing were equal to the effects seen previously using the more aggressive wounding following dermabrasion. Furthermore, fractionated laser resurfacing was equally effective in both sun-protected and sun-exposed skin. The ability of fractionated laser resurfacing treatment to protect against the occurrence of UVB-damaged proliferating keratinocytes indicates the potential of fractionated laser resurfacing to reduce or prevent aging-associated non-melanoma skin cancer.

  19. Thyrotropin-releasing hormone (TRH promotes wound re-epithelialisation in frog and human skin.

    Directory of Open Access Journals (Sweden)

    Natalia T Meier

    Full Text Available There remains a critical need for new therapeutics that promote wound healing in patients suffering from chronic skin wounds. This is, in part, due to a shortage of simple, physiologically and clinically relevant test systems for investigating candidate agents. The skin of amphibians possesses a remarkable regenerative capacity, which remains insufficiently explored for clinical purposes. Combining comparative biology with a translational medicine approach, we report the development and application of a simple ex vivo frog (Xenopus tropicalis skin organ culture system that permits exploration of the effects of amphibian skin-derived agents on re-epithelialisation in both frog and human skin. Using this amphibian model, we identify thyrotropin-releasing hormone (TRH as a novel stimulant of epidermal regeneration. Moving to a complementary human ex vivo wounded skin assay, we demonstrate that the effects of TRH are conserved across the amphibian-mammalian divide: TRH stimulates wound closure and formation of neo-epidermis in organ-cultured human skin, accompanied by increased keratinocyte proliferation and wound healing-associated differentiation (cytokeratin 6 expression. Thus, TRH represents a novel, clinically relevant neuroendocrine wound repair promoter that deserves further exploration. These complementary frog and human skin ex vivo assays encourage a comparative biology approach in future wound healing research so as to facilitate the rapid identification and preclinical testing of novel, evolutionarily conserved, and clinically relevant wound healing promoters.

  20. Thyrotropin-Releasing Hormone (TRH) Promotes Wound Re-Epithelialisation in Frog and Human Skin

    Science.gov (United States)

    Zhang, Guo-You; Emelianov, Vladimir; Paredes, Roberto; Debus, Sebastian; Augustin, Matthias; Funk, Wolfgang; Amaya, Enrique; Kloepper, Jennifer E.; Hardman, Matthew J.; Paus, Ralf

    2013-01-01

    There remains a critical need for new therapeutics that promote wound healing in patients suffering from chronic skin wounds. This is, in part, due to a shortage of simple, physiologically and clinically relevant test systems for investigating candidate agents. The skin of amphibians possesses a remarkable regenerative capacity, which remains insufficiently explored for clinical purposes. Combining comparative biology with a translational medicine approach, we report the development and application of a simple ex vivo frog (Xenopus tropicalis) skin organ culture system that permits exploration of the effects of amphibian skin-derived agents on re-epithelialisation in both frog and human skin. Using this amphibian model, we identify thyrotropin-releasing hormone (TRH) as a novel stimulant of epidermal regeneration. Moving to a complementary human ex vivo wounded skin assay, we demonstrate that the effects of TRH are conserved across the amphibian-mammalian divide: TRH stimulates wound closure and formation of neo-epidermis in organ-cultured human skin, accompanied by increased keratinocyte proliferation and wound healing-associated differentiation (cytokeratin 6 expression). Thus, TRH represents a novel, clinically relevant neuroendocrine wound repair promoter that deserves further exploration. These complementary frog and human skin ex vivo assays encourage a comparative biology approach in future wound healing research so as to facilitate the rapid identification and preclinical testing of novel, evolutionarily conserved, and clinically relevant wound healing promoters. PMID:24023889

  1. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W. [Kaohsiung Medical College (Taiwan). Dept. of Dermatology; Chiang, L.-C. [Kaohsiung Medical College (Taiwan). Dept. of Microbiology and Immunology; Yu, C.-L. [National Yang-Ming University School of Medicine (Taiwan). Veterans General Hospital-Taipei

    1996-08-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm{sup 2} UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author).

  2. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W.; Chiang, L.-C.; Yu, C.-L.

    1996-01-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm 2 UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author)

  3. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  4. A Patient with Multiple Keratinocytic Cancers (MKC: Uncommon Presentation in a Bulgarian Patient

    Directory of Open Access Journals (Sweden)

    Georgi Tchernev

    2018-01-01

    Full Text Available Keratinocyte skin cancers, including basal cell carcinoma (BCC and squamous cell carcinoma (SCC, are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not.  Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  5. A Patient with Multiple Keratinocytic Cancers (MKC): Uncommon Presentation in a Bulgarian Patient.

    Science.gov (United States)

    Tchernev, Georgi; Philipov, Stanislav; Chokoeva, Anastasiya Atanasova; Wollina, Uwe; Lotti, Torello; Lozev, Ilia; Yungareva, Irina; Maximov, Georgi Konstantinov

    2018-01-25

    Keratinocyte skin cancers, including basal cell carcinoma (BCC) and squamous cell carcinoma (SCC), are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not. Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  6. Attachment and growth of human keratinocytes in a serum-free environment.

    Science.gov (United States)

    Gilchrest, B A; Calhoun, J K; Maciag, T

    1982-08-01

    Using a serum-free system, we have investigated the influence of human fibronectin (HFN) and selected growth factors (GF) on the attachment and growth of normal human keratinocytes in vitro. Single-cell suspensions of keratinocytes from near-confluent primary plates, plated on 5-10 microgram/cm2 HFN, showed approximately 30-40% attachment after 2-24 hours of incubation at 37 degrees C, compared with 4-6% attachment on uncoated platic plates. Percentage of attached cells was independent of seed density, tissue donor age, in vitro culture age, or medium composition, while subsequent cellular proliferation was strongly dependent on these factors. Keratinocytes grown on an adequate HFN matrix in a previously described hormone-supplemented medium (Maciag et al., 1981a) achieved four to eight population doubling over 7-12 days at densities greater than or equal to 104 cell/cm2. Removal of most GF individually from the medium had little or no effect on growth, while removal of epidermal growth factor (EGF) alone reduced growth by 30-35% and removal of bovine brain extract (BE) alone reduced growth by approximately 90%. Conversely, EGF alone in basal medium supported approximately 10% control growth, BE alone supported 30-40% control growth, and the combination of EGF and BE approximately 70%. In addition to its major effect on proliferation in this system, BE was necessary to preserve normal keratinocyte morphology and protein production. These findings expand earlier observations that HFN facilitates keratinocyte attachment in vitro and that a brain-derived extract can exert a major positive influence on cultured keratinocytes.

  7. Podoplanin expression in peritumoral keratinocytes predicts aggressive behavior in extramammary Paget's disease.

    Science.gov (United States)

    Cho, Zaigen; Konishi, Eiichi; Kanemaru, Mai; Isohisa, Taro; Arita, Takahiro; Kawai, Minako; Tsutsumi, Miho; Mizutani, Hiromi; Takenaka, Hideya; Ozawa, Toshiyuki; Tsuruta, Daisuke; Katoh, Norito; Asai, Jun

    2017-07-01

    Recent studies have demonstrated podoplanin expression in several tumors, which has been associated with lymph node metastasis and poor prognosis. Podoplanin expression in peritumoral cells such as cancer-associated fibroblasts also correlates with tumor progression in several cancers. However, podoplanin expression and its association with extramammary Paget's disease (EMPD) remain unclear. In this study, we examined whether the presence of podoplanin expression in tumor cells or peritumoral basal keratinocytes correlated with aggressive behavior in patients with EMPD and investigated the mechanisms of podoplanin-mediated tumor invasion in this disorder. Skin samples of 37 patients with EMPD were investigated by immunohistochemical analysis. The functions of podoplanin in keratinocytes were examined in vitro by RT-PCR and with invadopodia gelatin-degradation assays using HaCaT cells. Podoplanin was not identified in tumor cells in all cases. Podoplanin expression in peritumoral basal keratinocytes was observed in 25 patients (67.6%). In in situ EMPD, 50% of cases (9 in 18) exhibited podoplanin-positive keratinocytes, whereas 84.2% (16 in 19) demonstrated positive staining in invasive EMPD (P<0.05). Podoplanin expression in peritumoral keratinocytes was also associated with tumor thickness (P<0.005). By immunohistochemical analysis, podoplanin-positive peritumoral keratinocytes were found to be negative for E-cadherin, one of the major adhesion molecules of keratinocytes, which might contribute to tumor invasion into the dermis through a crack in the basal cell layer induced by down-regulation of cell adhesion therein. We further found that podoplanin-positive keratinocytes exhibited invadopodia, which are thought to function in the migration of cancer cells through tissue barriers, indicating that podoplanin-positive peritumoral basal keratinocytes might assist tumor invasion by degrading the extracellular matrix. The presence of podoplanin expression in

  8. Concentration-dependent effect of platelet-rich plasma on keratinocyte and fibroblast wound healing.

    Science.gov (United States)

    Xian, Law Jia; Chowdhury, Shiplu Roy; Bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

    2015-03-01

    Platelet-rich plasma (PRP) has been found to contain a high concentration of growth factors that are present during the process of healing. Studies conducted found that application of PRP accelerates wound healing. In this study, we characterized the skin cell suspension harvested using the co-isolation technique and evaluated the effects of PRP (10% and 20%, v/v) on co-cultured keratinocytes and fibroblasts in terms of wound healing. Human keratinocytes and fibroblasts were harvested via co-isolation technique and separated via differential trypsinization. These cells were then indirectly co-cultured in medium supplemented with 10% or 20% PRP for 3 days without medium change for analysis of wound-healing potential. The wound-healing potential of keratinocytes and fibroblasts was evaluated in terms of growth property, migratory property, extracellular matrix gene expression and soluble factor secretion. The co-isolation technique yielded a skin cell population dominated by fibroblasts and keratinocytes, with a small amount of melanocytes. Comparison between the 10% and 20% PRP cultures showed that the 10% PRP culture exhibited higher keratinocyte apparent specific growth rate, and secretion of hepatocyte growth factor, monocyte chemoattractant protein-1, epithelial-derived neutrophil-activating protein 78 and vascular endothelial growth factor A, whereas the 20% PRP culture has significantly higher collagen type 1 and collagen type 3 expressions and produced more granulocyte-macrophage colony-stimulating factor. PRP concentration modulates keratinocyte and fibroblast wound healing potential, whereby the 10% PRP promotes wound remodeling, whereas the 20% PRP enhances inflammation and collagen deposition. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  9. Quantifying rates of cell migration and cell proliferation in co-culture barrier assays reveals how skin and melanoma cells interact during melanoma spreading and invasion.

    Science.gov (United States)

    Haridas, Parvathi; Penington, Catherine J; McGovern, Jacqui A; McElwain, D L Sean; Simpson, Matthew J

    2017-06-21

    Malignant spreading involves the migration of cancer cells amongst other native cell types. For example, in vivo melanoma invasion involves individual melanoma cells migrating through native skin, which is composed of several distinct subpopulations of cells. Here, we aim to quantify how interactions between melanoma and fibroblast cells affect the collective spreading of a heterogeneous population of these cells in vitro. We perform a suite of circular barrier assays that includes: (i) monoculture assays with fibroblast cells; (ii) monoculture assays with SK-MEL-28 melanoma cells; and (iii) a series of co-culture assays initiated with three different ratios of SK-MEL-28 melanoma cells and fibroblast cells. Using immunostaining, detailed cell density histograms are constructed to illustrate how the two subpopulations of cells are spatially arranged within the spreading heterogeneous population. Calibrating the solution of a continuum partial differential equation to the experimental results from the monoculture assays allows us to estimate the cell diffusivity and the cell proliferation rate for the melanoma and the fibroblast cells, separately. Using the parameter estimates from the monoculture assays, we then make a prediction of the spatial spreading in the co-culture assays. Results show that the parameter estimates obtained from the monoculture assays lead to a reasonably accurate prediction of the spatial arrangement of the two subpopulations in the co-culture assays. Overall, the spatial pattern of spreading of the melanoma cells and the fibroblast cells is very similar in monoculture and co-culture conditions. Therefore, we find no clear evidence of any interactions other than cell-to-cell contact and crowding effects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  11. Hair follicle defects and squamous cell carcinoma formation in Smad4 conditional knockout mouse skin.

    Science.gov (United States)

    Qiao, W; Li, A G; Owens, P; Xu, X; Wang, X-J; Deng, C-X

    2006-01-12

    Smad4 is the common mediator for TGFbeta signals, which play important functions in many biological processes. To study the role of Smad4 in skin development and epidermal tumorigenesis, we disrupted this gene in skin using the Cre-loxP approach. We showed that absence of Smad4 blocked hair follicle differentiation and cycling, leading to a progressive hair loss of mutant (MT) mice. MT hair follicles exhibited diminished expression of Lef1, and increased proliferative cells in the outer root sheath. Additionally, the skin of MT mice exhibited increased proliferation of basal keratinocytes and epidermal hyperplasia. Furthermore, we provide evidence that the absence of Smad4 resulted in a block of both TGFbeta and bone morphogenetic protein (BMP) signaling pathways, including p21, a well-known cyclin-dependent kinase inhibitor. Consequently, all MT mice developed spontaneous malignant skin tumors from 3 months to 13 months of age. The majority of tumors are malignant squamous cell carcinomas. A most notable finding is that tumorigenesis is accompanied by inactivation of phosphatase and tensin homolog deleted on chromosome 10 (Pten), activation of AKT, fast proliferation and nuclear accumulation of cyclin D1. These observations revealed the essential functions of Smad4-mediated signals in repressing skin tumor formation through the TGFbeta/BMP pathway, which interacts with the Pten signaling pathway.

  12. The functional relevance of polyploidization in the skin.

    Science.gov (United States)

    Trakala, Marianna; Malumbres, Marcos

    2014-02-01

    Cell proliferation and differentiation are tightly coupled through the regulation of the cell division cycle. To preserve specific functional properties in differentiated cells, distinct variants of the basic mitotic cell cycle are used in various mammalian tissues, leading to the formation of polyploid cells. In this issue of Experimental Dermatology, Gandarillas and Freije discuss the evidences for polyploidization in keratinocytes, a process whose physiological relevance is now becoming evident. A better evaluation of these unconventional cell cycles is required not only to improve our understanding of the development and structure of the epidermis but also for future therapies against skin diseases. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Melanosomes are transferred from melanocytes to keratinocytes through the processes of packaging, release, uptake, and dispersion.

    Science.gov (United States)

    Ando, Hideya; Niki, Yoko; Ito, Masaaki; Akiyama, Kaoru; Matsui, Mary S; Yarosh, Daniel B; Ichihashi, Masamitsu

    2012-04-01

    Recent studies have described the role of shedding vesicles as physiological conveyers of intracellular components between neighboring cells. Here we report that melanosomes are one example of shedding vesicle cargo, but are processed by a previously unreported mechanism. Pigment globules were observed to be connected to the filopodia of melanocyte dendrites, which have previously been shown to be conduits for melanosomes. Pigment globules containing multiple melanosomes were released from various areas of the dendrites of normal human melanocytes derived from darkly pigmented skin. The globules were then captured by the microvilli of normal human keratinocytes, also derived from darkly pigmented skin, which incorporated them in a protease-activated receptor-2 (PAR-2)-dependent manner. After the pigment globules were ingested by the keratinocytes, the membrane that surrounded each melanosome cluster was gradually degraded, and the individual melanosomes then spread into the cytosol and were distributed primarily in the perinuclear area of each keratinocyte. These results suggest a melanosome transfer pathway wherein melanosomes are transferred from melanocytes to keratinocytes via the shedding vesicle system. This packaging system generates pigment globules containing multiple melanosomes in a unique manner.

  14. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    Energy Technology Data Exchange (ETDEWEB)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Elmets, Craig A. [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States)

    2014-08-29

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34{sup +}/K15{sup +}/p63{sup +} keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in

  15. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    International Nuclear Information System (INIS)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh; Elmets, Craig A.; Athar, Mohammad

    2014-01-01

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34 + /K15 + /p63 + keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in tumors induced

  16. Halting angiogenesis by non-viral somatic gene therapy alleviates psoriasis and murine psoriasiform skin lesions

    DEFF Research Database (Denmark)

    Zibert, John Robert; Wallbrecht, Katrin; Schön, Margarete

    2011-01-01

    Dysregulated angiogenesis is a hallmark of chronic inflammatory diseases, including psoriasis, a common skin disorder that affects approximately 2% of the population. Studying both human psoriasis in 2 complementary xenotransplantation models and psoriasis-like skin lesions in transgenic mice......-15) by in vivo electroporation reduced cutaneous angiogenesis and vascularization in all 3 models. As demonstrated using red fluorescent protein-coupled RDD, the treatment resulted in muscular expression of the gene product and its deposition within the cutaneous hyperangiogenic connective tissue....... High-resolution ultrasound revealed reduced cutaneous blood flow in vivo after electroporation with RDD but not with control plasmids. In addition, angiogenesis- and inflammation-related molecular markers, keratinocyte proliferation, epidermal thickness, and clinical disease scores were downregulated...

  17. A secretome analysis reveals that PPARα is upregulated by fractionated-dose γ-irradiation in three-dimensional keratinocyte cultures

    International Nuclear Information System (INIS)

    Lee, Jee Yong; Kim, Hyun Ji; Yi, Jae Youn

    2016-01-01

    A three-dimensional (3D) environment composed of properly interconnected and differentiated cells that allows communication and cooperation among cells via secreted molecules would be expected to more accurately reflect cellular responses. Here, we investigated γ-irradiation-induced changes in the secretome of 3D-cultured keratinocytes. An analysis of keratinocyte secretome profiles following fractionated-dose γ-irradiation revealed changes in genes involved in cell adhesion, angiogenesis, and the immune system. Notably, peroxisome proliferator-activated receptor-(PPARα) was upregulated in response to fractionated-dose γ-irradiation. This upregulation was associated with an increase in the transcription of known PPARα target genes, including angiopoietin-like protein 4, dermokine and kallikrein-related peptide 12, which were differentially regulated by fractionated-dose γ-irradiation. Collectively, our data imply a mechanism linking γ-irradiation and secretome changes, and suggest that these changes could play a significant role in the coordinated cellular responses to harmful ionizing radiation, such as those associated with radiation therapy. This extension of our understanding of γ-irradiation-induced secretome changes has the potential to improve radiation therapy strategies. Control of inflammatory waves, improved wound healing, and stabilization of the skin barrier are imperative for minimizing such injuries. Therefore, PPARα agonists and antagonists have the potential to become important therapeutic agents for the treatment of γ-irradiation induced skin damage. Specifically, our analysis suggests that the undesirable consequences of long-term exposure to ionizing radiation could be alleviated by PPARα agonists

  18. A secretome analysis reveals that PPARα is upregulated by fractionated-dose γ-irradiation in three-dimensional keratinocyte cultures

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jee Yong; Kim, Hyun Ji; Yi, Jae Youn [Korea Institute of Radiation and Medical Sciences, Daejeon (Korea, Republic of)

    2016-05-15

    A three-dimensional (3D) environment composed of properly interconnected and differentiated cells that allows communication and cooperation among cells via secreted molecules would be expected to more accurately reflect cellular responses. Here, we investigated γ-irradiation-induced changes in the secretome of 3D-cultured keratinocytes. An analysis of keratinocyte secretome profiles following fractionated-dose γ-irradiation revealed changes in genes involved in cell adhesion, angiogenesis, and the immune system. Notably, peroxisome proliferator-activated receptor-(PPARα) was upregulated in response to fractionated-dose γ-irradiation. This upregulation was associated with an increase in the transcription of known PPARα target genes, including angiopoietin-like protein 4, dermokine and kallikrein-related peptide 12, which were differentially regulated by fractionated-dose γ-irradiation. Collectively, our data imply a mechanism linking γ-irradiation and secretome changes, and suggest that these changes could play a significant role in the coordinated cellular responses to harmful ionizing radiation, such as those associated with radiation therapy. This extension of our understanding of γ-irradiation-induced secretome changes has the potential to improve radiation therapy strategies. Control of inflammatory waves, improved wound healing, and stabilization of the skin barrier are imperative for minimizing such injuries. Therefore, PPARα agonists and antagonists have the potential to become important therapeutic agents for the treatment of γ-irradiation induced skin damage. Specifically, our analysis suggests that the undesirable consequences of long-term exposure to ionizing radiation could be alleviated by PPARα agonists.

  19. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  20. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  1. A new pharmacological agent (AKB-4924) stabilizes hypoxia inducible factor-1 (HIF-1) and increases skin innate defenses against bacterial infection.

    Science.gov (United States)

    Okumura, Cheryl Y M; Hollands, Andrew; Tran, Dan N; Olson, Joshua; Dahesh, Samira; von Köckritz-Blickwede, Maren; Thienphrapa, Wdee; Corle, Courtney; Jeung, Seung Nam; Kotsakis, Anna; Shalwitz, Robert A; Johnson, Randall S; Nizet, Victor

    2012-09-01

    Hypoxia inducible factor-1 (HIF-1) is a transcription factor that is a major regulator of energy homeostasis and cellular adaptation to low oxygen stress. HIF-1 is also activated in response to bacterial pathogens and supports the innate immune response of both phagocytes and keratinocytes. In this work, we show that a new pharmacological compound AKB-4924 increases HIF-1 levels and enhances the antibacterial activity of phagocytes and keratinocytes against both methicillin-sensitive and methicillin-resistant strains of Staphylococcus aureus in vitro. AKB-4924 is also effective in stimulating the killing capacity of keratinocytes against the important opportunistic skin pathogens Pseudomonas aeruginosa and Acinetobacter baumanii. The effect of AKB-4924 is mediated through the activity of host cells, as the compound exerts no direct antimicrobial activity. Administered locally as a single agent, AKB-4924 limits S. aureus proliferation and lesion formation in a mouse skin abscess model. This approach to pharmacologically boost the innate immune response via HIF-1 stabilization may serve as a useful adjunctive treatment for antibiotic-resistant bacterial infections.

  2. HPV16-E7-Specific Activated CD8 T Cells in E7 Transgenic Skin and Skin Grafts

    Directory of Open Access Journals (Sweden)

    Seyed Davoud Jazayeri

    2017-05-01

    Full Text Available Human papillomavirus (HPV 16 E7 (E7 protein expression in skin promotes epithelial hyperproliferation and transformation to malignancy. Grafts of murine skin expressing E7 protein as a transgene in keratinocytes are not rejected from immunocompetent recipients, whereas grafts expressing ovalbumin (OVA, with or without coexpression of E7 protein, are promptly rejected, demonstrating that E7-associated non-antigen-specific local immunosuppression is not a major determinant of lack of rejection of E7 transgenic skin. To determine whether failure of rejection of E7 skin grafts is due to failure to attract E7-specific effector T cells, E7- and OVA-specific effector CD8+ T cells, activated in vitro, were transferred to animals bearing E7 transgenic skin grafts. Three days after T cell transfer, E7-specific T cells were present in significantly greater numbers than OVA-specific T cells in the grafted skin on animals bearing recently placed or healed E7 grafts, without graft rejection, and also in the ear skin of E7 transgenic animals, without obvious pathology. E7 and OVA-specific T cells were present in lesser numbers in healed E7 grafts than in recently placed grafts and in lesser numbers in recently placed E7 transgenic epidermal grafts without E7-associated hyperproliferation, derived from E7 transgenic mice with a mutated retinoblastoma gene. These data demonstrate that effector T cells are to some extent attracted to E7 transgenic skin specifically by E7 expression, but in large measure non-specifically by the epithelial proliferation associated with E7 expression, and by the local inflammation produced by grafting. Failure of E7 graft rejection was observed despite trafficking of E7-specific effector T cells to E7-expressing epithelium, a finding of consequence for immunotherapy of HPV 16 E7-associated human cancers.

  3. In vitro induction of matrix metalloproteinase-2 and matrix metalloproteinase-9 expression in keratinocytes by boron and manganese.

    Science.gov (United States)

    Chebassier, Nathalie; El Houssein, Ouijja; Viegas, Isabelle; Dréno, Brigitte

    2004-08-01

    Matrix metalloproteinase (MMP)-2 and MMP-9 are involved in keratinocyte migration and granulation tissue remodeling during wound healing. Thermal water cures are sometimes proposed as complementary treatment for accelerating healing of wounds resulting from burns and/or surgery, but their mechanisms of action remain unknown. Some thermal waters are rich in trace elements such as boron and manganese. Interestingly, clinical studies have shown the beneficial effects of trace elements such as boron and manganese for human wound healing. To try to specify the role of trace elements in cutaneous healing, the present study investigated the effects of these trace elements on the production of MMP-2 and MMP-9 by normal human keratinocytes cultured in vitro. Immunohistochemistry and Western blot showed that intracellular MMP-9 expression in keratinocytes was induced when incubated for 6 h with boron at 10 micro g/ml or manganese at 0.2 micro g/ml. Moreover, gelatin zymography on keratinocyte supernatants showed an increase of gelatinase secretion after 24 h of incubation of keratinocytes with boron or manganese, regardless of concentration. Gelatinase secretion was not associated with keratinocyte proliferation induced by trace elements. Thus, our results suggest that boron and manganese could play a role in the clinical efficiency of thermal water on wound healing.

  4. The influence of ions implantation on adhesion and growth of human keratinocytes

    International Nuclear Information System (INIS)

    Walachova, K.; Dvorankova, B.; Vogtova, D.; Svorcik, V.

    1999-01-01

    This work deals with the study of modification of surface of the polyethylene after ion implantation. For experiments were used the Ar + ions with energy 63 keV and Xe + ions with energy 156 keV. Some surface properties of modified layers (100 nm) and their influence on adhesion and proliferation of keratinocytes were studied. For the study of structural changes of polymer were used methods UV-VIS and FTIR spectrometry, atomic force spectroscopy

  5. Mathematical modeling of calcium waves induced by mechanical stimulation in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuaki Kobayashi

    Full Text Available Recent studies have shown that the behavior of calcium in the epidermis is closely related to the conditions of the skin, especially the differentiation of the epidermal keratinocytes and the permeability barrier function, and therefore a correct understanding of the calcium dynamics is important in explaining epidermal homeostasis. Here we report on experimental observations of in vitro calcium waves in keratinocytes induced by mechanical stimulation, and present a mathematical model that can describe the experimentally observed wave behavior that includes finite-range wave propagation and a ring-shaped pattern. A mechanism of the ring formation hypothesized by our model may be related to similar calcium propagation patterns observed during the wound healing process in the epidermis. We discuss a possible extension of our model that may serve as a tool for investigating the mechanisms of various skin diseases.

  6. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  7. Macrophage migration inhibitory factor triggers chemotaxis of CD74+CXCR2+ NKT cells in chemically induced IFN-γ-mediated skin inflammation.

    Science.gov (United States)

    Hsieh, Chia-Yuan; Chen, Chia-Ling; Lin, Yee-Shin; Yeh, Trai-Ming; Tsai, Tsung-Ting; Hong, Ming-Yuan; Lin, Chiou-Feng

    2014-10-01

    IFN-γ mediates chemically induced skin inflammation; however, the mechanism by which IFN-γ-producing cells are recruited to the sites of inflammation remains undefined. Secretion of macrophage migration inhibitory factor (MIF), a proinflammatory cytokine, from damaged cells may promote immune cell recruitment. We hypothesized that MIF triggers an initial step in the chemotaxis of IFN-γ-producing cells in chemically induced skin inflammation. Using acute and chronic models of 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced skin inflammation in mouse ears, MIF expression was examined, and its role in this process was investigated pharmacologically. The cell populations targeted by MIF, their receptor expression patterns, and the effects of MIF on cell migration were examined. TPA directly caused cytotoxicity accompanied by MIF release in mouse ear epidermal keratinocytes, as well as in human keratinocytic HaCaT cells. Treatment with the MIF antagonist (S,R)-3-(4-hydroxyphenyl)-4,5-dihydro-5-isoxazole acetic acid methyl ester considerably attenuated TPA-induced ear swelling, leukocyte infiltration, epidermal cell proliferation, and dermal angiogenesis. Inhibition of MIF greatly diminished the dermal infiltration of IFN-γ(+) NKT cells, whereas the addition of exogenous TPA and MIF to NKT cells promoted their IFN-γ production and migration, respectively. MIF specifically triggered the chemotaxis of NKT cells via CD74 and CXCR2, and the resulting depletion of NKT cells abolished TPA-induced skin inflammation. In TPA-induced skin inflammation, MIF is released from damaged keratinocytes and then triggers the chemotaxis of CD74(+)CXCR2(+) NKT cells for IFN-γ production. Copyright © 2014 by The American Association of Immunologists, Inc.

  8. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  9. The stress caused by nitrite with titanium dioxide nanoparticles under UVA irradiation in human keratinocyte cell

    International Nuclear Information System (INIS)

    Tu, Min; Huang, Yi; Li, Hai-Ling; Gao, Zhong-Hong

    2012-01-01

    Highlights: ► Nitrite increased photo-toxicity of nano-TiO 2 on human keratinocyte cells in a dose-dependant manner. ► Morphological study suggested the cell death may be mediated by apoptosis inducing factor. ► Protein nitration was generated in the cells, and the most abundant nitrated protein was identified as cystatin-A. ► Tyr35 was the most likely site to be nitrated in cystatin-A. -- Abstract: Our previous work found that in the presence of nitrite, titanium dioxide nanoparticles can cause protein tyrosine nitration under UVA irradiation in vivo. In this paper, the human keratinocyte cells was used as a skin cell model to further study the photo-toxicity of titanium dioxide nanoparticles when nitrite was present. The results showed that nitrite increased the photo-toxicity of titanium dioxide in a dose-dependant manner, and generated protein tyrosine nitration in keratinocyte cells. Morphological study of keratinocyte cells suggested a specific apoptosis mediated by apoptosis inducing factor. It was also found the main target nitrated in cells was cystatin-A, which expressed abundantly in cytoplasm and functioned as a cysteine protease inhibitor. The stress induced by titanium dioxide with nitrite under UVA irradiation in human keratinocyte cells appeared to trigger the apoptosis inducing factor mediated cell death and lose the inhibition of active caspase by cystatin-A. We conclude that nitrite can bring new damage and stress to human keratinocyte cells with titanium dioxide nanoparticles under UVA irradiation.

  10. Abnormalities in the basement membrane structure promote basal keratinocytes in the epidermis of hypertrophic scars to adopt a proliferative phenotype.

    Science.gov (United States)

    Yang, Shaowei; Sun, Yexiao; Geng, Zhijun; Ma, Kui; Sun, Xiaoyan; Fu, Xiaobing

    2016-05-01

    The majority of studies on scar formation have mainly focused on the dermis and little is known of the involvement of the epidermis. Previous research has demonstrated that the scar tissue-derived keratinocytes are different from normal cells at both the genetic and cell biological levels; however, the mechanisms responsible for the fundamental abnormalities in keratinocytes during scar development remain elusive. For this purpose, in this study, we used normal, wound edge and hypertrophic scar tissue to examine the morphological changes which occur during epidermal regeneration as part of the wound healing process and found that the histological structure of hypertrophic scar tissues differed from that of normal skin, with a significant increase in epidermal thickness. Notably, staining of the basement membrane (BM) appeared to be absent in the scar tissues. Moreover, immunofluorescence staining for cytokeratin (CK)10, CK14, CK5, CK19 and integrin-β1 indicated the differential expression of cell markers in the epidermal keratinocytes among the normal, wound edge and hypertrophic scar tissues, which corresponded with the altered BM structures. By using a panel of proteins associated with BM components, we validated our hypothesis that the BM plays a significant role in regulating the cell fate decision of epidermal keratinocytes during skin wound healing. Alterations in the structure of the BM promote basal keratinocytes to adopt a proliferative phenotype both in vivo and in vitro.

  11. Cultivating technique for human keratinocyte under laboratory condition%实验室条件下人角质形成细胞的培养技术

    Institute of Scientific and Technical Information of China (English)

    卢宁; 朱平; 刘玉峰; 王刚; 张海龙; 赵小东

    2006-01-01

    Two step digestion technique was used for the isolation of epidermal cells: Firstly the skin flap was digested with dispase of mass concentration of 2.5 g/L at 4 ℃ for overnight, followed by separating epidermis the next day; Secondly it was dipped in trypsin and EDTA mixture for subsequent digestion. ② Improved serum-free cultivating technology was applied to the culture of human keratinocytes. The culture medium is composed of human keratinocyte serum free culture medium +2.5 mg/L bovine pituitary lixivium +5 μg/L epidermal growth factor+438 mg/L glutamine, glutamine can promote the growth of the keratinocyte. ③Human keratinocyte in exponential phase were cryopreserved and rewarmed, then made into cell suspension with additional serum free medium, cells were incubated in culture bottle of 75 cm2 by density of 5×105/mL for subculture. Cell morphological changes were observed under microscope and transmission electron microscope.MAIN OUTCOME MEASURES: ① The growth of primary cells and passage cells. ② The cryopreservation and resuscitation of human keratinocyte from different passages. ③ Morphological observation of Keratinocytes RESULTS: ①The growing state of the primary cells and passage cells:cells suspended primarily and gradually adhered to bottom of the culture dish at about 6-24 hours, most of cells were round and gradually stretched to ellipse shape, at about day 3, some keratinocyte clones and clusters can be observed with satellite-like proliferating epidermal cells scattered around, most of them were polygon and cell homogeneity and transparency became strengthened. Cell fusion amount to 70% at around 5 days, reaching to 90% at day 9 and even completely fused into cell diaphragm at day 1 1. Keratinocyte cultured in vitro can survive 2-3 months without obvious changes in cell morphology and growth speed. ② The cryopreservation and resuscitation of human keratinocyte in different passages: Different passage keratinocytes were separately

  12. GHK Peptide as a Natural Modulator of Multiple Cellular Pathways in Skin Regeneration

    Directory of Open Access Journals (Sweden)

    Loren Pickart

    2015-01-01

    Full Text Available GHK (glycyl-L-histidyl-L-lysine is present in human plasma, saliva, and urine but declines with age. It is proposed that GHK functions as a complex with copper 2+ which accelerates wound healing and skin repair. GHK stimulates both synthesis and breakdown of collagen and glycosaminoglycans and modulates the activity of both metalloproteinases and their inhibitors. It stimulates collagen, dermatan sulfate, chondroitin sulfate, and the small proteoglycan, decorin. It also restores replicative vitality to fibroblasts after radiation therapy. The molecule attracts immune and endothelial cells to the site of an injury. It accelerates wound-healing of the skin, hair follicles, gastrointestinal tract, boney tissue, and foot pads of dogs. It also induces systemic wound healing in rats, mice, and pigs. In cosmetic products, it has been found to tighten loose skin and improve elasticity, skin density, and firmness, reduce fine lines and wrinkles, reduce photodamage, and hyperpigmentation, and increase keratinocyte proliferation. GHK has been proposed as a therapeutic agent for skin inflammation, chronic obstructive pulmonary disease, and metastatic colon cancer. It is capable of up- and downregulating at least 4,000 human genes, essentially resetting DNA to a healthier state. The present review revisits GHK’s role in skin regeneration in the light of recent discoveries.

  13. Image enhancement of optical images for binary system of melanocytes and keratinocytes

    Science.gov (United States)

    Takanezawa, S.; Baba, A.; Sako, Y.; Ozaki, Y.; Date, A.; Toyama, K.; Morita, S.

    2013-05-01

    Automatic determination of the cell shapes of large numbers of melanocytes based on optical images of human skin models have been largely unsuccessful (the complexities introduced by dendrites and the melanin pigmentation over the keratinocytes to give unclear outlines). Here, we present an image enhancement procedure for enhancing the contrast of images with removing the non-uniformity of background. The brightness is normalized also for the non-uniform population density of melanocytes.

  14. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. The effect of 648 nm diode laser irradiation on second messengers in senescent human keratinocytes

    Science.gov (United States)

    Hawkins Evans, D.; Abrahamse, H.

    2009-02-01

    Background/purpose: Stress induced premature senescence (SIPS) is defined as the long-term effect of subcytotoxic stress on proliferative cell types. Cells in SIPS display differences at the level of protein expression which affect energy metabolism, defense systems, redox potential, cell morphology and transduction pathways. This study aimed to determine the effect of laser irradiation on second messengers in senescent cells and to establish if that effect can be directly linked to changes in cellular function such as cell viability or proliferation. Materials and Methods: Human keratinocyte cell cultures were modified to induce premature senescence using repeated sub-lethal stresses of 200 uM H2O2 or 5% OH every day for four days with two days recovery. SIPS was confirmed by senescence-associated β-galactosidase staining. Control conditions included normal, repeated stress of 500 uM H2O2 to induce apoptosis and 200 uM PBN as an anti-oxidant or free radical scavenger. Cells were irradiated with 1.5 J/cm2 on day 1 and 4 using a 648 nm diode laser (3.3 mW/cm2) and cellular responses were measured 1 h post irradiation. The affect on second messengers was assessed by measuring cAMP, cGMP, nitric oxide and intracellular calcium (Ca2+) while functional changes were assessed using cell morphology, ATP cell viability, LDH membrane integrity and WST-1 cell proliferation. Results: Results indicate an increase in NO and a decrease in cGMP and Ca2+ in 200 uM H2O2 irradiated cells while PBN irradiated cells showed a decrease in cAMP and an increase in ATP viability and cell proliferation. Conclusion: Laser irradiation influences cell signaling which ultimately changes the biological function of senescent cells. If laser therapy can stimulate the biological function of senescent cells it may be beneficial to conditions such as immune senescence, skin ageing, muscle atrophy, premature ageing of arteries in patients with advanced heart disease, neurodegenerative disorders and

  16. A crucial role of beta 1 integrins for keratinocyte migration in vitro and during cutaneous wound repair

    DEFF Research Database (Denmark)

    Grose, Richard; Hutter, Caroline; Bloch, Wilhelm

    2002-01-01

    of beta 1 integrins in keratinocytes caused a severe defect in wound healing. beta 1-null keratinocytes showed impaired migration and were more densely packed in the hyperproliferative epithelium. Surprisingly, their proliferation rate was not reduced in early wounds and even increased in late wounds....... The failure in re-epithelialisation resulted in a prolonged inflammatory response, leading to dramatic alterations in the expression of important wound-regulated genes. Ultimately, beta 1-deficient epidermis did cover the wound bed, but the epithelial architecture was abnormal. These findings demonstrate...

  17. Photoprotective Properties of Isothiocyanate and Nitrile Glucosinolate Derivatives From Meadowfoam (Limnanthes alba Against UVB Irradiation in Human Skin Equivalent

    Directory of Open Access Journals (Sweden)

    Evan L. Carpenter

    2018-05-01

    Full Text Available Exposure to ultraviolet B (UVB irradiation of the skin leads to numerous dermatological concerns including skin cancer and accelerated aging. Natural product glucosinolate derivatives, like sulforaphane, have been shown to exhibit chemopreventive and photoprotective properties. In this study, we examined meadowfoam (Limnanthes alba glucosinolate derivatives, 3-methoxybenzyl isothiocyanate (MBITC and 3-methoxyphenyl acetonitrile (MPACN, for their activity in protecting against the consequences of UV exposure. To that end, we have exposed human primary epidermal keratinocytes (HPEKs and 3D human skin reconstructed in vitro (EpiDermTM FT-400 to UVB insult and investigated whether MBITC and MPACN treatment ameliorated the harmful effects of UVB damage. Activity was determined by the compounds’ efficacy in counteracting UVB-induced DNA damage, matrix-metalloproteinase (MMP expression, and proliferation. We found that in monolayer cultures of HPEK, MBITC and MPACN did not protect against a UVB-induced loss in proliferation and MBITC itself inhibited cell proliferation. However, in human reconstructed skin-equivalents, MBITC and MPACN decrease epidermal cyclobutane pyrimidine dimers (CPDs and significantly reduce total phosphorylated γH2A.X levels. Both MBITC and MPACN inhibit UVB-induced MMP-1 and MMP-3 expression indicating their role to prevent photoaging. Both compounds, and MPACN in particular, showed activity against UVB-induced proliferation as indicated by fewer epidermal PCNA+ cells and prevented UVB-induced hyperplasia as determined by a reduction in reconstructed skin epidermal thickness (ET. These data demonstrate that MBITC and MPACN exhibit promising anti-photocarcinogenic and anti-photoaging properties in the skin microenvironment and could be used for therapeutic interventions.

  18. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  19. Pimecrolimus enhances TLR2/6-induced expression of antimicrobial peptides in keratinocytes.

    Science.gov (United States)

    Büchau, Amanda S; Schauber, Jürgen; Hultsch, Thomas; Stuetz, Anton; Gallo, Richard L

    2008-11-01

    Calcineurin inhibitors are potent inhibitors of T-cell-receptor mediated activation of the adaptive immune system. The effects of this class of drug on the innate immune response system are not known. Keratinocytes are essential to innate immunity in skin and rely on toll-like receptors (TLRs) and antimicrobial peptides to appropriately recognize and respond to injury or microbes. In this study we examined the response of cultured human keratinocytes to pimecrolimus. We observed that pimecrolimus enhances distinct expression of cathelicidin, CD14, and human beta-defensin-2 and beta-defensin-3 in response to TLR2/6 ligands. Some of these responses were further enhanced by 1,25 vitamin D3. Pimecrolimus also increased the functional capacity of keratinocytes to inhibit growth of Staphylococcus aureus and decreased TLR2/6-induced expression of IL-10 and IL-1beta. Furthermore, pimecrolimus inhibited nuclear translocation of NFAT and NF-kappaB in keratinocytes. These observations uncover a previously unreported function for pimecrolimus in cutaneous innate host defense.

  20. Keratinocytes express fibrillin and assemble microfibrils: implications for dermal matrix organization.

    Science.gov (United States)

    Haynes, S L; Shuttleworth, C A; Kielty, C M

    1997-07-01

    Fibrillin-containing microfibrils are key architectural structures of the upper dermis and integral components of the dermal elastic fibre network. Microfibril bundles intercalate into the dermal-epithelial junction and provide an elastic connection between the dermal elastic fibre network and the epidermis. Immunohistochemical studies have suggested that they are laid down both at the dermal-epithelial junction and in the deep dermis. While dermal fibroblasts are responsible for deposition of the elastin and microfibrillar components that comprise the elastic fibres of the deep dermis, the cellular origin of the microfibril bundles that extrude from the dermal-epithelial junction is not well defined. We have used fresh tissues, freshly isolated epidermis and primary human and porcine keratinocyte cultures to investigate the possibility that keratinocytes are responsible for deposition of these microfibrils. We have shown that keratinocytes in vivo and in vitro synthesize both fibrillin-1 and fibrillin-2, and assemble beaded microfibrils concurrently with expression of basement membrane collagen. These observations suggest that keratinocytes co-ordinate the secretion, deposition and assembly of these distinct structural elements of the dermal matrix, and have important implications for skin remodelling.

  1. Targeting PI3K-AKT-mTOR by LY3023414 inhibits human skin squamous cell carcinoma cell growth in vitro and in vivo.

    Science.gov (United States)

    Zou, Ying; Ge, Minggai; Wang, Xuemin

    2017-08-19

    Abnormal activation of PI3K-AKT-mTOR signaling is detected in human skin squamous cell carcinoma (SCC). LY3023414 is a novel, potent, and orally bio-available PI3K-AKT-mTOR inhibitor. Its activity against human skin SCC cells was tested. We demonstrated that LY3023414 was cytotoxic when added to established (A431 line) and primary (patient-derived) human skin SCC cells. LY3023414 induced G0/1-S arrest and inhibited proliferation of skin SCC cells. Moreover, LY3023414 induced activation of caspase-3/-9 and apoptosis in skin SCC cells. Intriguingly, LY3023414 was yet non-cytotoxic nor pro-apoptotic to normal human skin cells (melanocytes, keratinocytes and fibroblasts). At the molecular level, LY3023414 blocked PI3K-AKT-mTOR activation in skin SCC cells, as it dephosphorylated PI3K-AKT-mTOR substrates: P85, AKT and S6K1. In vivo studies showed that oral administration of LY3023414 at well-tolerated doses inhibited A431 xenograft tumor growth in severe combined immunodeficiency (SCID) mice. AKT-mTOR activation in LY3023414-treated tumors was also largely inhibited. Together, these results suggest that targeting PI3K-AKT-mTOR by LY3023414 inhibits human skin SCC cell growth in vitro and in vivo, establishing the rationale for further clinical testing. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. In vitro evaluation of Spirulina platensis extract incorporated skin cream with its wound healing and antioxidant activities.

    Science.gov (United States)

    Gunes, Seda; Tamburaci, Sedef; Dalay, Meltem Conk; Deliloglu Gurhan, Ismet

    2017-12-01

    Algae have gained importance in cosmeceutical product development due to their beneficial effects on skin health and therapeutical value with bioactive compounds. Spirulina platensis Parachas (Phormidiaceae) is renowned as a potential source of high-value chemicals and recently used in skincare products. This study develops and evaluates skin creams incorporated with bioactive S. platensis extract. Spirulina platensis was cultivated, the aqueous crude extract was prepared and in vitro cytotoxicity of S. platensis extract in the range of 0.001-1% concentrations for 1, 3 and 7 d on HS2 keratinocyte cells was determined. Crude extracts were incorporated in skin cream formulation at 0.01% (w/w) concentration and in vitro wound healing and genotoxicity studies were performed. Immunohistochemical staining was performed to determine the collagen activity. 0.1% S. platensis extract exhibited higher proliferation activity compared with the control group with 198% of cell viability after 3 d. Skin cream including 1.125% S. platensis crude extract showed enhanced wound healing effect on HS2 keratinocyte cell line and the highest HS2 cell viability % was obtained with this concentration. The micronucleus (MN) assay results indicated that S. platensis extract incorporated creams had no genotoxic effect on human peripheral blood cells. Immunohistochemical analysis showed that collagen 1 immunoreactivity was improved by increased extract concentration and it was strongly positive in cells treated with 1.125% extract incorporated skin cream. The cell viability, wound healing activity and genotoxicity results showed that S. platensis incorporated skin cream could be of potential value in cosmeceutical and biomedical applications.

  3. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  4. on skin keratinocytes by nuclear factor-kappa B

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-21

    Jun 21, 2012 ... Effects of advanced glycation end-products (AGEs) on ... AGE levels, nuclear factor-kappa B (NF-κB) localization and cell viability were measured in vivo. ..... and related alteration in NF-κB activity, we treated normal cells by ...

  5. Skin immune sentinels in health and disease.

    Science.gov (United States)

    Nestle, Frank O; Di Meglio, Paola; Qin, Jian-Zhong; Nickoloff, Brian J

    2009-10-01

    Human skin and its immune cells provide essential protection of the human body from injury and infection. Recent studies reinforce the importance of keratinocytes as sensors of danger through alert systems such as the inflammasome. In addition, newly identified CD103(+) dendritic cells are strategically positioned for cross-presentation of skin-tropic pathogens and accumulating data highlight a key role of tissue-resident rather than circulating T cells in skin homeostasis and pathology. This Review focuses on recent progress in dissecting the functional role of skin immune cells in skin disease.

  6. Outcome of burns treated with autologous cultured proliferating epidermal cells: a prospective randomized multicenter intrapatient comparative trial

    NARCIS (Netherlands)

    Gardien, K.L.M.; Marck, R.E.; Bloemen, M.C.T.; Waaijman, T.; Gibbs, S.; Uhlrich, M.M.W.; Middelkoop, E.

    2016-01-01

    Standard treatment for large burns is transplantation with meshed split skin autografts (SSGs). A disadvantage of this treatment is that healing is accompanied by scar formation. Application of autologous epidermal cells (keratinocytes and melanocytes) may be a suitable therapeutic alternative,

  7. Inflammatory responses of a human keratinocyte cell line to 10 nm citrate- and PEG-coated silver nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Bastos, V. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal); Brown, D.; Johnston, H. [Heriot-Watt University, School of Life Sciences (United Kingdom); Daniel-da-Silva, A. L.; Duarte, I. F. [University of Aveiro, Department of Chemistry, CICECO – Aveiro Institute of Materials (Portugal); Santos, C., E-mail: csantos@fc.up.pt; Oliveira, H. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal)

    2016-07-15

    Silver nanoparticles (AgNPs) are among the most commonly used engineered NPs and various commercially available products are designed to come in direct contact with the skin (wound dressings, textiles, creams, among others). Currently, there is limited understanding of the influence of coatings on the toxicity of AgNPs and in particular their ability to impact on AgNP’s mediated inflammatory responses. As AgNPs are often stabilized by different coatings, including citrate and polyethyleneglycol (PEG), in this study we investigate the influence of citrate (Cit10) or PEG (PEG10) coatings to 10 nm AgNP on skin, using human HaCaT keratinocytes. AgNPs cytotoxicity and inflammatory response (nuclear factor (NF)-κB induction and cytokine production) of HaCaT were assessed after in vitro exposure to 10 and 40 µg/mL after 4, 24, and 48 h. Results showed that although both types of coated AgNPs decreased cell proliferation and viability, Cit10 AgNPs were more toxic. NF-κB inhibition was observed for the highest concentration (40 µg/mL) of PEG10 AgNPs, and the putative link to early apoptotic pathways observed in these cells is discussed. No production of IL-1β, IL-6, IL-10, and TNFα was stimulated by AgNPs. Furthermore, Cit10 and PEG10 AgNPs decreased the release of MCP-1 by HaCaT cells after 48 h of exposure. As cytokines are vital for the immunologic regulation in the human body, and it is demonstrated that they may interfere with NPs, more research is needed to understand how different AgNPs affect the immune system.

  8. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    Science.gov (United States)

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  9. 1,25-dihydroxyvitamin D3 induces LL-37 and HBD-2 production in keratinocytes from diabetic foot ulcers promoting wound healing: an in vitro model.

    Science.gov (United States)

    Gonzalez-Curiel, Irma; Trujillo, Valentin; Montoya-Rosales, Alejandra; Rincon, Kublai; Rivas-Calderon, Bruno; deHaro-Acosta, Jeny; Marin-Luevano, Paulina; Lozano-Lopez, Daniel; Enciso-Moreno, Jose A; Rivas-Santiago, Bruno

    2014-01-01

    Diabetic foot ulcers (DFU) are one of the most common diabetes-related cause of hospitalization and often lead to severe infections and poor healing. It has been recently reported that patients with DFU have lower levels of antimicrobial peptides (AMPs) at the lesion area, which contributes with the impairment of wound healing. The aim of this study was to determine whether 1,25-dihydroxyvitamin D3 (1,25 (OH)2 D3) and L-isoleucine induced HBD-2 and LL-37 in primary cultures from DFU. We developed primary cell cultures from skin biopsies from 15 patients with DFU and 15 from healthy donors. Cultures were treated with 1,25 (OH)2D3 or L-isoleucine for 18 h. Keratinocytes phenotype was identified by western blot and flow cytometry. Real time qPCR for DEFB4, CAMP and VDR gene expression was performed as well as an ELISA to measure HBD-2 and LL-37 in supernatant. Antimicrobial activity, in vitro, wound healing and proliferation assays were performed with conditioned supernatant. The results show that primary culture from DFU treated with 1,25(OH)2D3, increased DEFB4 and CAMP gene expression and increased the production of HBD-2 and LL-37 in the culture supernatant. These supernatants had antimicrobial activity over E. coli and induced remarkable keratinocyte migration. In conclusion the 1,25(OH)2D3 restored the production of AMPs in primary cell from DFU which were capable to improve the in vitro wound healing assays, suggesting their potential therapeutic use on the treatment of DFU.

  10. 1,25-dihydroxyvitamin D3 induces LL-37 and HBD-2 production in keratinocytes from diabetic foot ulcers promoting wound healing: an in vitro model.

    Directory of Open Access Journals (Sweden)

    Irma Gonzalez-Curiel

    Full Text Available Diabetic foot ulcers (DFU are one of the most common diabetes-related cause of hospitalization and often lead to severe infections and poor healing. It has been recently reported that patients with DFU have lower levels of antimicrobial peptides (AMPs at the lesion area, which contributes with the impairment of wound healing. The aim of this study was to determine whether 1,25-dihydroxyvitamin D3 (1,25 (OH2 D3 and L-isoleucine induced HBD-2 and LL-37 in primary cultures from DFU. We developed primary cell cultures from skin biopsies from 15 patients with DFU and 15 from healthy donors. Cultures were treated with 1,25 (OH2D3 or L-isoleucine for 18 h. Keratinocytes phenotype was identified by western blot and flow cytometry. Real time qPCR for DEFB4, CAMP and VDR gene expression was performed as well as an ELISA to measure HBD-2 and LL-37 in supernatant. Antimicrobial activity, in vitro, wound healing and proliferation assays were performed with conditioned supernatant. The results show that primary culture from DFU treated with 1,25(OH2D3, increased DEFB4 and CAMP gene expression and increased the production of HBD-2 and LL-37 in the culture supernatant. These supernatants had antimicrobial activity over E. coli and induced remarkable keratinocyte migration. In conclusion the 1,25(OH2D3 restored the production of AMPs in primary cell from DFU which were capable to improve the in vitro wound healing assays, suggesting their potential therapeutic use on the treatment of DFU.

  11. Modified methods for growing 3-D skin equivalents: an update.

    Science.gov (United States)

    Lamb, Rebecca; Ambler, Carrie A

    2014-01-01

    Artificial epidermis can be reconstituted in vitro by seeding primary epidermal cells (keratinocytes) onto a supportive substrate and then growing the developing skin equivalent at the air-liquid interface. In vitro skin models are widely used to study skin biology and for industrial drug and cosmetic testing. Here, we describe updated methods for growing 3-dimensional skin equivalents using de-vitalized, de-epidermalized dermis (DED) substrates including methods for DED substrate preparation, cell seeding, growth conditions, and fixation procedures.

  12. Skin Photoaging and the Role of Antioxidants in Its Prevention

    OpenAIRE

    Pandel, Ruža; Poljšak, Borut; Godic, Aleksandar; Dahmane, Raja

    2013-01-01

    Photoaging of the skin depends primarily on the degree of ultraviolet radiation (UVR) and on an amount of melanin in the skin (skin phototype). In addition to direct or indirect DNA damage, UVR activates cell surface receptors of keratinocytes and fibroblasts in the skin, which leads to a breakdown of collagen in the extracellular matrix and a shutdown of new collagen synthesis. It is hypothesized that dermal collagen breakdown is followed by imperfect repair that yields a deficit in the stru...

  13. Delineating miRNA profile induced by chewing tobacco in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Mohd Younis Bhat

    2017-10-01

    Full Text Available The major established etiologic risk factor for oral cancer is tobacco (chewed, smoked and snuffed forms. Chewing form of tobacco is predominantly used in India making it the leading cause of oral cancer. Despite being one of the leading causes of oral cancer, the molecular alterations induced by chewing tobacco remains largely unclear. Carcinogenic effect of chewing tobacco is through chronic and not acute exposure. To understand the molecular alterations induced by chewing tobacco, we developed a cell line model where non-neoplastic oral keratinocytes were chronically exposed to chewing tobacco for a period of 6 months. This resulted in increased cellular proliferation and invasive ability of normal oral keratinocytes. Using this cellular model we studied the differential expression of miRNAs associated with chewing tobacco and the altered signaling pathways through which the aberrantly expressed miRNAs affect tumorigenesis. miRNA sequencing  was carried out using Illumina HiSeq 2500 platform  which resulted in the identification of 427 annotated miRNAs of which 10 were significantly dysregulated (≥ 4 fold; p-value ≤ 0.05 in tobacco exposed cells compared to untreated parental cells. To study the altered signaling in oral keratinocytes chronically exposed to chewing tobacco, we employed quantitative proteomics to characterize the dysregulated proteins. Integration of miRNA sequencing data with proteomic data resulted in identification of 36 proven protein targets which (≥1.5 fold; p-value ≤ 0.05 showed expression correlation with the 10 significantly dysregulated miRNAs. Pathway analysis of the dysregulated targets revealed enrichment of interferon signaling and mRNA processing related pathways in the chewing tobacco exposed cells. In addition, we also identified 6 novel miRNA in oral keratinocytes chronically exposed to chewing tobacco extract. Our study provides a framework to understand the oncogenic transformation induced by

  14. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  15. S100A8 and S100A9 are messengers in the crosstalk between epidermis and dermis modulating a psoriatic milieu in human skin

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Young; Jang, Sunhyae [Department of Dermatology, College of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Min, Jeong-Ki; Lee, Kyungmin [Immunotherapy Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon (Korea, Republic of); Department of Biomolecular Science, University of Science and Technology, Daejeon (Korea, Republic of); Sohn, Kyung-Cheol [Department of Dermatology, College of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Lim, Jong-Soon [College of Oriental Medicine, Daejeon University, Daejeon (Korea, Republic of); Im, Myung; Lee, Hae-Eul; Seo, Young-Joon; Kim, Chang-Deok [Department of Dermatology, College of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Lee, Jeung-Hoon, E-mail: jhoon@cnu.ac.kr [Department of Dermatology, College of Medicine, Chungnam National University, Daejeon (Korea, Republic of)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce cytokine production. Black-Right-Pointing-Pointer Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce migration of immune cells. Black-Right-Pointing-Pointer Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce angiogenesis. Black-Right-Pointing-Pointer S100A8 and/or S100A9 may play a role in the crosstalk between epidermis and dermis in psoriasis. -- Abstract: S100A8 and S100A9 are members of the S100A8 protein family that exist as homodimers and heterodimers in neutrophils, monocytes, and macrophages. Recent studies have shown the pivotal roles of S100A8 and S100A9 in the propagation of inflammation and keratinocyte proliferation in psoriasis. We found significant up-regulation of S100A8 and S100A9 secretion from keratinocytes in psoriatic lesions. To mimic the in vivo secretory conditions of S100A8 and S100A9 from psoriatic epidermal keratinocytes, we used the culture medium (CM) of S100A8 and S100A8/A9 adenovirus-transduced keratinocytes to investigate the functions of S100A8 and S100A9. We detected increased levels of various pro-inflammatory cytokines in the CM, including IL-8 and TNF-{alpha}, which are involved in aggravating psoriatic skin lesions, and IL-6 and members of the CXCL family of pro-angiogenic cytokines. The CM increased immune cell migration and increased angiogenesis in human umbilical vein endothelial cells. In conclusion, we found that the upregulated production of S100A8 and S100A9 by psoriatic epidermal keratinocytes activated adjacent keratinocytes to produce several cytokines. Moreover, S100A8 and S100A9 themselves function as pro-angiogenic and chemotactic factors, generating a psoriatic milieu in skin.

  16. S100A8 and S100A9 are messengers in the crosstalk between epidermis and dermis modulating a psoriatic milieu in human skin

    International Nuclear Information System (INIS)

    Lee, Young; Jang, Sunhyae; Min, Jeong-Ki; Lee, Kyungmin; Sohn, Kyung-Cheol; Lim, Jong-Soon; Im, Myung; Lee, Hae-Eul; Seo, Young-Joon; Kim, Chang-Deok; Lee, Jeung-Hoon

    2012-01-01

    Highlights: ► Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce cytokine production. ► Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce migration of immune cells. ► Upregulated S100A8 and/or S100A9 in psoriasis epidermis induce angiogenesis. ► S100A8 and/or S100A9 may play a role in the crosstalk between epidermis and dermis in psoriasis. -- Abstract: S100A8 and S100A9 are members of the S100A8 protein family that exist as homodimers and heterodimers in neutrophils, monocytes, and macrophages. Recent studies have shown the pivotal roles of S100A8 and S100A9 in the propagation of inflammation and keratinocyte proliferation in psoriasis. We found significant up-regulation of S100A8 and S100A9 secretion from keratinocytes in psoriatic lesions. To mimic the in vivo secretory conditions of S100A8 and S100A9 from psoriatic epidermal keratinocytes, we used the culture medium (CM) of S100A8 and S100A8/A9 adenovirus-transduced keratinocytes to investigate the functions of S100A8 and S100A9. We detected increased levels of various pro-inflammatory cytokines in the CM, including IL-8 and TNF-α, which are involved in aggravating psoriatic skin lesions, and IL-6 and members of the CXCL family of pro-angiogenic cytokines. The CM increased immune cell migration and increased angiogenesis in human umbilical vein endothelial cells. In conclusion, we found that the upregulated production of S100A8 and S100A9 by psoriatic epidermal keratinocytes activated adjacent keratinocytes to produce several cytokines. Moreover, S100A8 and S100A9 themselves function as pro-angiogenic and chemotactic factors, generating a psoriatic milieu in skin.

  17. In vivo relative quantitative proteomics reveals HMGB1 as a downstream mediator of oestrogen-stimulated keratinocyte migration.

    Science.gov (United States)

    Shin, Jung U; Noh, Ji Yeon; Lee, Ju Hee; Lee, Won Jai; Yoo, Jong Shin; Kim, Jin Young; Kim, Hyeran; Jung, Inhee; Jin, Shan; Lee, Kwang Hoon

    2015-06-01

    It is known that oestrogen influences skin wound healing by modulating the inflammatory response, cytokine expression and extracellular matrix deposition; accelerating re-epithelialization; and stimulating angiogenesis. To identify novel proteins associated with effects of oestrogen on keratinocyte, stable isotope labelling by amino acids in cell culture (SILAC)-based mass spectrometry was performed. Using SILAC, quantification of 1085 proteins was achieved. Among these proteins, 60 proteins were upregulated and 32 proteins were downregulated. Among significantly upregulated proteins, high-mobility group protein B1 (HMGB1) has been further evaluated for its role in the effect of oestrogen on keratinocytes. HMGB1 expression was strongly induced in oestrogen-treated keratinocytes in dose- and time-dependent manner. Further, HMGB1 was able to significantly accelerate the rate of HaCaT cell migration. To determine whether HMGB1 is involved in E2-induced HaCaT cell migration, cells were transfected with HMGB1 siRNA. Knockdown of HMGB1 blocked oestrogen-induced keratinocyte migration. Collectively, these experiments demonstrate that HMGB1 is a novel downstream mediator of oestrogen-stimulated keratinocyte migration. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...... of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...... in deactivation of mammalian target of rapamycin, activation of FoxO3a, and increased sensitivity to apoptosis stimuli. Lipid raft disruption abrogated the binding of Akt and the major Akt kinase, phosphatidylinositol-dependent kinase 1, to the membrane by pleckstrin-homology domains. Thus, the integrity of lipid...

  19. Cell motility in models of wounded human skin is improved by Gap27 despite raised glucose, insulin and IGFBP-5

    Energy Technology Data Exchange (ETDEWEB)

    Wright, Catherine S.; Berends, Rebecca F. [Department of Life Sciences, School of Health and Life Sciences, Glasgow Caledonian University, 70 Cowcaddens Road, Glasgow G4 0BA (United Kingdom); Flint, David J. [Strathclyde Institute of Pharmacy and Biomedical Sciences, University of Strathclyde, 161 Cathedral Street, Glasgow G4 0RE (United Kingdom); Martin, Patricia E.M., E-mail: Patricia.Martin@gcu.ac.uk [Department of Life Sciences, School of Health and Life Sciences, Glasgow Caledonian University, 70 Cowcaddens Road, Glasgow G4 0BA (United Kingdom)

    2013-02-15

    Reducing Cx43 expression stimulates skin wound healing. This is mimicked in models when Cx43 function is blocked by the connexin mimetic peptide Gap27. IGF-I also stimulates wound healing with IGFBP-5 attenuating its actions. Further, the IGF-I to IGFBP-5 ratio is altered in diabetic skin, where wound closure is impaired. We investigated whether Gap27 remains effective in augmenting scrape-wound closure in human skin wound models simulating diabetes-induced changes, using culture conditions with raised glucose, insulin and IGFBP-5. Gap27 increased scrape-wound closure in normal glucose and insulin (NGI) and to a lesser extent in high glucose and insulin (HGI). IGF-I enhanced scrape-wound closure in keratinocytes whereas IGFBP-5 inhibited this response. Gap27 overcame the inhibitory effects of IGFBP-5 on IGF-I activity. Connexin-mediated communication (CMC) was reduced in HGI, despite raised Cx43, and Gap27 significantly decreased CMC in NGI and HGI. IGF-I and IGFBP-5 did not affect CMC. IGF-I increased keratinocyte proliferation in NGI, and Gap27 increased proliferation in NGI to a greater extent than in HGI. We conclude that IGF-I and Gap27 stimulate scrape-wound closure by independent mechanisms with Gap27 inhibiting Cx43 function. Gap27 can enhance wound closure in diabetic conditions, irrespective of the IGF-I:IGFBP-5 balance. - Highlights: ► Human organotypic and keratinocyte ‘diabetic’ skin models were used to demonstrate the ability of Gap27 to improve scrape-wound closure. ► Gap27 enhanced scrape-wound closure by reducing Cx43-mediated communication, whereas IGFBP-5 retarded cell migration. ► IGF-I and IGFBP-5 did not affect connexin-mediated pathways. ► Gap27 can override altered glucose, insulin, IGF-I, and IGFBP-5 in ‘diabetic’ skin models and thus has therapeutic potential.

  20. Mitochondria-Targeted Vitamin E Protects Skin from UVB-Irradiation.

    Science.gov (United States)

    Kim, Won-Serk; Kim, Ikyon; Kim, Wang-Kyun; Choi, Ju-Yeon; Kim, Doo Yeong; Moon, Sung-Guk; Min, Hyung-Keun; Song, Min-Kyu; Sung, Jong-Hyuk

    2016-05-01

    Mitochondria-targeted vitamin E (MVE) is designed to accumulate within mitochondria and is applied to decrease mitochondrial oxidative damage. However, the protective effects of MVE in skin cells have not been identified. We investigated the protective effect of MVE against UVB in dermal fibroblasts and immortalized human keratinocyte cell line (HaCaT). In addition, we studied the wound-healing effect of MVE in animal models. We found that MVE increased the proliferation and survival of fibroblasts at low concentration (i.e., nM ranges). In addition, MVE increased collagen production and downregulated matrix metalloproteinase1. MVE also increased the proliferation and survival of HaCaT cells. UVB increased reactive oxygen species (ROS) production in fibroblasts and HaCaT cells, while MVE decreased ROS production at low concentration. In an animal experiment, MVE accelerated wound healing from laser-induced skin damage. These results collectively suggest that low dose MVE protects skin from UVB irradiation. Therefore, MVE can be developed as a cosmetic raw material.

  1. RASopathic skin eruptions during vemurafenib therapy.

    Directory of Open Access Journals (Sweden)

    Jeannine D Rinderknecht

    Full Text Available Vemurafenib is a potent inhibitor of V600 mutant BRAF with significant impact on progression-free and overall survival in advanced melanoma. Cutaneous side effects are frequent. This single-center observational study investigates clinical and histological features of these class-specific cutaneous adverse reactions.Patients were all treated with Vemurafenib 960 mg b.i.d. within local ethic committees approved clinical trials. All skin reactions were collected and documented prospectively. Cutaneous reactions were classified by reaction pattern as phototoxic and inflammatory, hair and nail changes, keratinocytic proliferations and melanocytic disorders.Vemurafenib was well tolerated, only in two patients the dose had to be reduced to 720 mg due to arthralgia. 26/28 patients (93% experienced cutaneous side effects. Observed side effects included UVA dependent photosensitivity (n = 16, maculopapular exanthema (n = 14, pruritus (n = 8, folliculitis (n = 5, burning feet (n = 3, hair thinning (mild alopecia (n = 8, curly hair (n = 2 and nail changes (n = 2. Keratosis pilaris and acanthopapilloma were common skin reactions (n = 12/n = 13, as well as plantar hyperkeratosis (n = 4, keratoacanthoma (n = 5 and invasive squamous cell carcinoma (n = 4. One patient developed a second primary melanoma after more than 4 months of therapy (BRAF and RAS wild type.Vemurafenib has a broad and peculiar cutaneous side effect profile involving epidermis and adnexa overlapping with the cutaneous manifestations of genetic diseases characterized by activating germ line mutations of RAS (RASopathy. They must be distinguished from allergic drug reaction. Regular skin examination and management by experienced dermatologists as well as continuous prophylactic photo protection including an UVA optimized sun screen is mandatory.

  2. Aqueous extract from Vitis vinifera tendrils is able to enrich keratinocyte antioxidant defences.

    Science.gov (United States)

    Fraternale, Daniele; De Bellis, Roberta; Calcabrini, Cinzia; Potenza, Lucia; Cucchiarini, Luigi; Mancini, Umberto; Dachà, Marina; Ricci, Donata

    2011-09-01

    An aqueous extract of V. vinifera L. tendrils was evaluated for its ability to enrich the antioxidant capacity of cultured cells. The long-time antioxidant capability of the extract was measured by in vitro chemical methods, and its influence on reduced glutathione levels and plasma membrane oxido reductase activity was determined in cultured human keratinocytes (NCTC 2544). Keratinocytes are cells normally exposed to oxidative stress, and for this reason adequately equipped with antioxidant defences. However, it has long been suggested that exogenous antioxidants may play an important role in minimizing the adverse effects of oxidative stress on skin.We demonstrated that V. vinifera tendril aqueous extract was able to increase, in a time- and dose-dependent manner, the reduced glutathione concentration and activity of trans plasma membrane oxido reductase as an indirect evaluation of the intracellular redox status of the cells demonstrating a relevant antioxidant activity of this phytocomplex.

  3. Markedly diminished epidermal keratinocyte expression of intercellular adhesion molecule-1 (ICAM-1) in Sezary syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Nickoloff, B.J.; Griffiths, E.M.; Baadsgaard, O.; Voorhees, J.J.; Hanson, C.A.; Cooper, K.D. (Univ. of Michigan Medical Center, Ann Arbor (USA))

    1989-04-21

    In mucosis fungoides the malignant T cells express lymphocyte function-associated antigen-1, which allows them to bind to epidermal keratinocytes expressing the gamma interferon-inducible intercellular adhesion molecule-1. In this report, a patient with leukemic-stage mucosis fungoides (Sezary syndrome) had widespread erythematous dermal infiltrates containing malignant T cells, but without any epidermotropism. The authors discovered that the T cells expressed normal amounts of functional lymphocyte function-associated antigen-1, but the keratinocytes did not express significant levels of intercellular adhesion molecule-1, which was probably due to the inability of the malignant T cells to produce gamma interferon. These results support the concept that the inability of malignant T cells to enter the epidermis may contribute to emergence of more clinically aggressive T-cell clones that are no longer confined to the skin, but infiltrate the blood, lymph nodes, and viscera, as is seen in Sezary syndrome.

  4. Keratinocyte growth factor mRNA expression in periodontal ligament fibroblasts

    DEFF Research Database (Denmark)

    Dabelsteen, S; Wandall, H H; Grøn, B

    1997-01-01

    Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF mRNA is expres......Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF m......RNA is expressed in periodontal ligament fibroblasts, and that the expression is increased upon serum stimulation. Fibroblasts from human periodontal ligament, from buccal mucosa, from gingiva, and from skin were established from explants. Alkaline phosphatase activity was used as an indicator of the periodontal...

  5. Oral keratinocyte stem/progenitor cells: specific markers, molecular signaling pathways and potential uses.

    Science.gov (United States)

    Calenic, Bogdan; Greabu, Maria; Caruntu, Constantin; Tanase, Cristiana; Battino, Maurizio

    2015-10-01

    Oral keratinocyte stem cells reside in the basal layers of the oral epithelium, representing a minor population of cells with a great potential to self-renew and proliferate over the course of their lifetime. As a result of the potential uses of oral keratinocyte stem cells in regenerative medicine and the key roles they play in tissue homeostasis, inflammatory conditions, wound healing and tumor initiation and progression, intense scientific efforts are currently being undertaken to identify, separate and reprogram these cells. Although currently there is no specific marker that can characterize and isolate oral keratinocyte stem cells, several suggestions have been made. Thus, different stem/progenitor-cell subpopulations have been categorized based on combinations of positive and/or negative membrane-surface markers, which include integrins, clusters of differentiation and cytokeratins. Important advances have also been made in understanding the molecular pathways that govern processes such as self-renewal, differentiation, proliferation, wound healing and programmed cell death. A thorough understanding of stem-cell biology and the molecular players that govern cellular fate is paramount in the quest for using stem-cell-derived therapies in the treatment of various oral pathologies. The current review focuses on recent advances in understanding the molecular signaling pathways coordinating the behavior of these cells and in identifying suitable markers used for their isolation and characterization. Special emphasis will also be placed on the roles played by oral keratinocyte stem and progenitor cells in normal and diseased oral tissues and on their potential uses in the fields of general medicine and dentistry. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

    Science.gov (United States)

    Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

    2004-12-03

    The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

  7. Angiopoietin-related growth factor (AGF) supports adhesion, spreading, and migration of keratinocytes, fibroblasts, and endothelial cells through interaction with RGD-binding integrins

    International Nuclear Information System (INIS)

    Zhang Yueqing; Hu Xiaobo; Tian Ruiyang; Wei Wangui; Hu Wei; Chen Xia; Han Wei; Chen Huayou; Gong Yi

    2006-01-01

    Angiopoietin-related growth factor (AGF) is a newly identified member of angiopoietin-related proteins (ARPs)/angiopoietin-like proteins (Angptls). AGF has been considered as a novel growth factor in accelerating cutaneous wound healing, as it is capable of stimulating keratinocytes proliferation as well as angiogenesis. But in our paper, we demonstrate that AGF stimulates keratinocytes proliferation only at high protein concentration, however, it can potently promote adhesion, spreading, and migration of keratinocytes, fibroblasts, and endothelial cells. Furthermore, we confirm that the adhesion and migration cellular events are mediated by RGD-binding integrins, most possibly the α v -containing integrins, by in vitro inhibition assays using synthetic competitive peptides. Our results strongly suggest that AGF is an integrin ligand as well as a mitogenic growth factor and theoretically participates in cutaneous wound healing in a more complex mechanism

  8. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  9. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  10. Skin cell isolation and expansion for cell transplantation is limited in patients using tobacco, alcohol, or are exhibiting diabetes mellitus.

    Science.gov (United States)

    Johnen, Christa; Hartmann, Bernd; Steffen, Ingo; Bräutigam, Kirsten; Witascheck, Tom; Toman, Nidal; Küntscher, Markus V; Gerlach, Jörg C

    2006-03-01

    The aim of this exploratory study was to investigate the isolation and expansion of keratinocytes and fibroblasts from donors with certain medical histories. Biopsies were taken from donors (N=32) falling into one or more of the following categories: a history of heavy smoking and/or alcohol abuse, drug abuse, diabetes mellitus or steroid treatment. Cells from donors who did not fall into any of the above-mentioned categories were used as controls. Proliferation and growth behaviour of cells were analyzed by measurement of passage duration, absorbance (MTT-assay) and light microscopy. Donors with a specific medical history required larger biopsy areas than the control group for isolating a sufficient number of fibroblasts and keratinocytes. Times to confluence were significantly prolonged and absorbances (MTT) were significantly reduced in several donor groups when compared to control cultures. Biopsies from donors with steroid treatment, drug abuse and combined nicotine and alcohol abuse could not be established beyond passage 0 degrees or 1 degree, respectively. We conclude that isolation and expansion of skin cells from donors with certain medical histories may require larger biopsies, prolonged expansion times or may even result in failure. These findings may therefore be of clinical importance in the field of autologous skin cell transplantation.

  11. Redistribution of melanosomal complexes within keratinocytes following UV-A irradiation

    International Nuclear Information System (INIS)

    Lavker, R.M.; Kaidbey, K.H.

    1982-01-01

    In contrast to other ultraviolet (UV) wavelengths, UV-A can induce long-term or 'true' pigmentation rapidly with little or no latency. The response cannot be clearly separated from immediate pigment darkening and is too rapid in onset to be explained by neomelanogenesis. In order to investigate possible mechanisms for this phenomenon, UV-irradiated skin was examined microscopically and ultrastructurally 18 h postirradiation. Specimens from skin sites tanned by exposure to melanogenic doses of UV-A showed a paradoxical reduction in the degree of basal melanization by light microscopy compared to unirradiated skin. Ultrastructurally, there was migration and dispersion of packaged melanosomes within keratinocytes from their normal, aggregated location around the nucleus towards the periphery of the cell. These changes were not observed in specimens exposed to melanogenic doses of UV-B. We propose that UV-A wavelengths can selectively cause redistribution of melanin-laden organelles within human keratinocytes in vivo and that this phenomenon accounts for the visually observed hyperpigmentation that develops soon after single exposures to these wavelengths. Dispersion of melanosomal complexes may be another mechanism by which UV-radiation (UVR) can induce tanning in human skin. (orig.)

  12. Redistribution of melanosomal complexes within keratinocytes following UV-A irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Lavker, R.M.; Kaidbey, K.H.

    1982-03-01

    In contrast to other ultraviolet (UV) wavelengths, UV-A can induce long-term or 'true' pigmentation rapidly with little or no latency. The response cannot be clearly separated from immediate pigment darkening and is too rapid in onset to be explained by neomelanogenesis. In order to investigate possible mechanisms for this phenomenon, UV-irradiated skin was examined microscopically and ultrastructurally 18 h postirradiation. Specimens from skin sites tanned by exposure to melanogenic doses of UV-A showed a paradoxical reduction in the degree of basal melanization by light microscopy compared to unirradiated skin. Ultrastructurally, there was migration and dispersion of packaged melanosomes within keratinocytes from their normal, aggregated location around the nucleus towards the periphery of the cell. These changes were not observed in specimens exposed to melanogenic doses of UV-B. We propose that UV-A wavelengths can selectively cause redistribution of melanin-laden organelles within human keratinocytes in vivo and that this phenomenon accounts for the visually observed hyperpigmentation that develops soon after single exposures to these wavelengths. Dispersion of melanosomal complexes may be another mechanism by which UV-radiation (UVR) can induce tanning in human skin.

  13. Anticancer drugs and the regulation of Hedgehog genes GLI1 and PTCH1, a comparative study in nonmelanoma skin cancer cell lines

    DEFF Research Database (Denmark)

    Olesen, Uffe H; Bojesen, Sophie; Gehl, Julie

    2017-01-01

    Nonmelanoma skin cancer is the most common cancer in humans, comprising mainly basal cell carcinoma (BCC) and squamous cell carcinoma (SCC). BCC proliferation is highly dependent on the Hedgehog signaling pathway. We aimed to investigate a panel of anticancer drugs with known activity against skin...... of immortalized keratinocytes (HaCaT), BCC (UWBCC1 and BCC77015), and SCC (A431 and SCC25) cell lines. The impact of treatment on the regulation of Hedgehog pathway target genes (GLI1 and PTCH1), measured by real-time PCR, was compared between UWBCC1 and HaCaT. Varying cell line sensitivity profiles...... to the examined anticancer drugs were observed. Generally, 24-h drug exposure was sufficient to reduce cell viability. We found that 5-FU, MTX, and cisplatin significantly downregulated the expression of two genes controlled by the Hedgehog pathway (≤25-, 2.9-, and 12.5-fold, respectively, for GLI1 in UWBCC1...

  14. DNA damage by carbonyl stress in human skin cells

    International Nuclear Information System (INIS)

    Roberts, Michael J.; Wondrak, Georg T.; Laurean, Daniel Cervantes; Jacobson, Myron K.; Jacobson, Elaine L.

    2003-01-01

    Reactive carbonyl species (RCS) are potent mediators of cellular carbonyl stress originating from endogenous chemical processes such as lipid peroxidation and glycation. Skin deterioration as observed in photoaging and diabetes has been linked to accumulative protein damage from glycation, but the effects of carbonyl stress on skin cell genomic integrity are ill defined. In this study, the genotoxic effects of acute carbonyl stress on HaCaT keratinocytes and CF3 fibroblasts were assessed. Administration of the α-dicarbonyl compounds glyoxal and methylglyoxal as physiologically relevant RCS inhibited skin cell proliferation, led to intra-cellular protein glycation as evidenced by the accumulation of N ε -(carboxymethyl)-L-lysine (CML) in histones, and caused extensive DNA strand cleavage as assessed by the comet assay. These effects were prevented by treatment with the carbonyl scavenger D-penicillamine. Both glyoxal and methylglyoxal damaged DNA in intact cells. Glyoxal caused DNA strand breaks while methylglyoxal produced extensive DNA-protein cross-linking as evidenced by pronounced nuclear condensation and total suppression of comet formation. Glycation by glyoxal and methylglyoxal resulted in histone cross-linking in vitro and induced oxygen-dependent cleavage of plasmid DNA, which was partly suppressed by the hydroxyl scavenger mannitol. We suggest that a chemical mechanism of cellular DNA damage by carbonyl stress occurs in which histone glycoxidation is followed by reactive oxygen induced DNA stand breaks. The genotoxic potential of RCS in cultured skin cells and its suppression by a carbonyl scavenger as described in this study have implications for skin damage and carcinogenesis and its prevention by agents selective for carbonyl stress

  15. DNA damage by carbonyl stress in human skin cells

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, Michael J.; Wondrak, Georg T.; Laurean, Daniel Cervantes; Jacobson, Myron K.; Jacobson, Elaine L

    2003-01-28

    Reactive carbonyl species (RCS) are potent mediators of cellular carbonyl stress originating from endogenous chemical processes such as lipid peroxidation and glycation. Skin deterioration as observed in photoaging and diabetes has been linked to accumulative protein damage from glycation, but the effects of carbonyl stress on skin cell genomic integrity are ill defined. In this study, the genotoxic effects of acute carbonyl stress on HaCaT keratinocytes and CF3 fibroblasts were assessed. Administration of the {alpha}-dicarbonyl compounds glyoxal and methylglyoxal as physiologically relevant RCS inhibited skin cell proliferation, led to intra-cellular protein glycation as evidenced by the accumulation of N{sup {epsilon}}-(carboxymethyl)-L-lysine (CML) in histones, and caused extensive DNA strand cleavage as assessed by the comet assay. These effects were prevented by treatment with the carbonyl scavenger D-penicillamine. Both glyoxal and methylglyoxal damaged DNA in intact cells. Glyoxal caused DNA strand breaks while methylglyoxal produced extensive DNA-protein cross-linking as evidenced by pronounced nuclear condensation and total suppression of comet formation. Glycation by glyoxal and methylglyoxal resulted in histone cross-linking in vitro and induced oxygen-dependent cleavage of plasmid DNA, which was partly suppressed by the hydroxyl scavenger mannitol. We suggest that a chemical mechanism of cellular DNA damage by carbonyl stress occurs in which histone glycoxidation is followed by reactive oxygen induced DNA stand breaks. The genotoxic potential of RCS in cultured skin cells and its suppression by a carbonyl scavenger as described in this study have implications for skin damage and carcinogenesis and its prevention by agents selective for carbonyl stress.

  16. Aplicação de substituto de pele em oncologia cutânea: estudo experimental com derme acelular e ceratinócitos cultivados Application of skin substitutes in skin oncology: experimental study using acellular dermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    José Anselmo Lofêgo Filho

    2008-02-01

    Full Text Available FUNDAMENTOS: As neoplasias malignas da pele de grandes dimensões apresentam dificuldades de reconstrução após a excisão. OBJETIVO: O objetivo deste estudo foi avaliar a exeqüibilidade de uma nova proposta de cobertura para feridas cirúrgicas criadas após a ressecção de grandes tumores cutâneos, a combinação da derme acelular humana com epitélio autólogo cultivado. MÉTODOS: A aplicação dos substitutos de pele foi feita em quatro pacientes com área de implante variando de 33 a 120 cm2. Além da observação dos resultados clínicos, realizou-se estudo morfológico para avaliação da integração dos implantes. RESULTADOS: Ceratinócitos autólogos cultivados foram enxertados em dois pacientes e não demonstraram integração. A derme acelular foi aplicada em quatro pacientes, sendo que em um deles foram feitas duas aplicações. Dos cinco implantes de derme acelular realizados, dois não apresentaram integração, em dois a integração foi de 70%, e de 50% no último. CONCLUSÃO: A cobertura imediata e definitiva de defeitos cirúrgicos através da aplicação de derme acelular humana combinada com epitélio autólogo cultivado é exeqüível. Em oncologia cutânea apenas em situações especiais o uso de substitutos de pele pode ser conveniente no sentido de evitar reconstruções mais complexas.BACKGROUND: Reconstruction difficulties may arise after excision of large malignant skin neoplasms.a OBJECTIVE: The objective of this study was to assess the feasibility of a new coverage for surgical wounds following resection of large skin tumors: a combination of human acellular dermis with cultured autologous epithelium. METHODS: The skin substitute was implanted in four patients, one of them received two implants and the area ranged from 33 to 120 cm2. Clinical results and morphologic studies were assessed as to implant integration. RESULTS: Cultured autologous epithelium was grafted in two patients and no integration was

  17. Targeting the vitamin D endocrine system (VDES) for the management of inflammatory and malignant skin diseases: An historical view and outlook.

    Science.gov (United States)

    Reichrath, Jörg; Zouboulis, Christos C; Vogt, Thomas; Holick, Michael F

    2016-09-01

    Vitamin D represents one of the major driving factors for the development of life on earth and for human evolution. While up to 10-20 % of the human organism's requirements in vitamin D can be obtained by the diet (under most living conditions in the USA and Europe), approximately 90 % of all needed vitamin D has to be photosynthesized in the skin through the action of the sun (ultraviolet-B (UV-B)). The skin represents a key organ of the human body's vitamin D endocrine system (VDES), being both the site of vitamin D synthesis and a target tissue for biologically active vitamin D metabolites. It was shown that human keratinocytes possess the enzymatic machinery (CYP27B1) for the synthesis of the biologically most active natural vitamin D metabolite 1,25-dihydroxyvitamin D 3 (1,25(OH) 2 D 3 ), representing an autonomous vitamin D 3 pathway. Cutaneous production of 1,25(OH) 2 D 3 may exert intracrine, autocrine, and paracrine effects on keratinocytes and on neighboring cells. Many skin cells (including keratinocytes, sebocytes, fibroblasts, melanocytes, and skin immune cells) express the vitamin D receptor (VDR), an absolute pre-requisite for the mediation of genomic effects of 1,25(OH) 2 D 3 and analogs. VDR belongs to the superfamily of trans-acting transcriptional regulatory factors, which includes the steroid and thyroid hormone receptors as well as the retinoid X receptors (RXR) and retinoic acid receptors (RAR). Numerous studies, including cDNA microarray analyses of messenger RNAs (mRNAs), indicate that as many as 500-1000 genes may be regulated by VDR ligands that control various cellular functions including growth, differentiation, and apoptosis. The observation that 1,25(OH) 2 D 3 is extremely effective in inducing the terminal differentiation and in inhibiting the proliferation of cultured human keratinocytes has resulted in the use of vitamin D analogs for the treatment of psoriasis. This review gives an historical view and summarizes our present

  18. Challenge and perspective: the relevance of ultraviolet (UV) radiation and the vitamin D endocrine system (VDES) for psoriasis and other inflammatory skin diseases.

    Science.gov (United States)

    Reichrath, Jörg; Saternus, Roman; Vogt, Thomas

    2017-03-16

    During evolution, the ability of many organisms to synthesize vitamin D photochemically represented, and still represents, a major driving factor for the development of life on earth. In humans because not more than 10-20% of the requirement of vitamin D can be satisfied by the diet (under most living conditions in the US and Europe), the remaining 80-90% need to be photochemically synthesized in the skin through the action of solar or artificial ultraviolet-B (UV-B) radiation. The skin is a key organ of the human body's vitamin D endocrine system (VDES), representing both the site of vitamin D synthesis and a target tissue for biologically active vitamin D metabolites. Human keratinocytes contain the enzymatic machinery (CYP27B1) for the synthesis of the biologically most active natural vitamin D metabolite 1,25-dihydroxyvitamin D 3 (1,25(OH) 2 D 3 ), representing an autonomous vitamin D 3 pathway. Cutaneous production of 1,25(OH) 2 D 3 may mediate intracrine, autocrine and paracrine effects on keratinocytes and on neighboring cells. Many skin cells (including keratinocytes, sebocytes, fibroblasts, melanocytes, macrophages and other skin immune cells) express the vitamin D receptor (VDR), an absolute pre-requisite for exerting genomic effects of 1,25(OH) 2 D 3 and analogs. The VDR is a member of the superfamily of trans-acting transcriptional regulatory factors, which also contains the steroid and thyroid hormone receptors as well as the retinoid-X receptors (RXR) and retinoic acid receptors (RAR). A large body of evidence, including cDNA microarray analyses of mRNAs, indicates that as many as 500-1000 genes may be controlled by VDR ligands that regulate a broad variety of cellular functions including growth, differentiation, and apoptosis. Clinical and laboratory investigations, including the observation that 1,25(OH) 2 D 3 is very effective in inducing the terminal differentiation and in inhibiting the proliferation of cultured human keratinocytes have resulted

  19. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    International Nuclear Information System (INIS)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-01-01

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  20. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  1. UV decreases the synthesis of free fatty acids and triglycerides in the epidermis of human skin in vivo, contributing to development of skin photoaging.

    Science.gov (United States)

    Kim, Eun Ju; Jin, Xing-Ji; Kim, Yeon Kyung; Oh, In Kyung; Kim, Ji Eun; Park, Chi-Hyun; Chung, Jin Ho

    2010-01-01

    Although fatty acids are known to be important in various skin functions, their roles on photoaging in human skin are poorly understood. We investigated the alteration of lipid metabolism in the epidermis by photoaging and acute UV irradiation in human skin. UV irradiated young volunteers (21-33 years, n=6) and elderly volunteers (70-75 years, n=7) skin samples were obtained by punch biopsy. Then the epidermis was separated from dermis and lipid metabolism was investigated. We observed that the amounts of free fatty acids (FFA) and triglycerides (TG) in the epidermis of photoaged or acutely UV irradiated human skin were significantly decreased. The expressions of genes related to lipid synthesis, including acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoyl-CoA desaturase (SCD), sterol regulatory element binding proteins (SREBPs), and peroxisome proliferator-activated receptors (PPARgamma) were also markedly decreased. To elucidate the significance of these changes of epidermal lipids in human skin, we investigated the effects of TG or various inhibitors for the enzymes involved in TG synthesis on the expression of matrix metalloproteinase-1 (MMP-1) in cultured human epidermal keratinocytes. We demonstrated that triolein (TG) reduced basal and UV-induced MMP-1 mRNA expression. In addition, each inhibitor for various lipid synthesis enzymes, such as TOFA (ACC inhibitor), cerulenin (FAS inhibitor) and trans-10, cis-12-CLA (SCD inhibitor), increased the MMP-1 expression significantly in a dose-dependent manner. We also demonstrated that triolein could inhibit cerulenin-induced MMP-1 expression. Furthermore, topical application of triolein (10%) significantly prevented UV-induced MMP-13, COX-2, and IL-1beta expression in hairless mice. Our results suggest that TG and FFA may play important roles in photoaging of human skin. Copyright 2009 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  2. Evaluation of the effect of laser radiation on fibroblast proliferation in repair of skin wounds of rats with iron deficiency anemia

    Science.gov (United States)

    DeCastro, Isabele C. V.; Oliveira-Sampaio, Susana C. P.; Monteiro, Juliana S. de C.; Ferreira, Maria de Fátima L.; Cangussu, Maria T.; N. dos Santos, Jean; Pinheiro, Antonio Luiz B.

    2011-03-01

    The aim of this study was to assess the effect of low- level laser therapy (LLLT) on fibroblast proliferation on wound repair of rats with Iron deficiency anemia since there is no reports on literature about this subject. Iron deficiency anemia was induced on 36 newborn rats then an excisional wound was created on the dorsum of the animals which were divided into four groups: (I) - non-anemic, (II) - Anemic, (III) - non-anemic + LLLT, (IV) Anemic+ LLLT. The animals in each group were sacrificed at 7, 14 and 21 days. Laser irradiation was performed on each group (λ660nm,40Mw,CW) by contact mode with a dose of 2,5J/ cm2 in four points on the area of the wound and total of 10J/cm2 per session. Data were evaluated by analysis of variance (ANOVA) followed by Paired t-test. The results showed LLLT was able to stimulate fibroblastic proliferation in rats with iron deficiency anemia at the 21st day while at control group (III) no statistically significant differences was found.

  3. Interaction of Mycobacterium leprae with the HaCaT human keratinocyte cell line: new frontiers in the cellular immunology of leprosy.

    Science.gov (United States)

    Lyrio, Eloah C D; Campos-Souza, Ivy C; Corrêa, Luiz C D; Lechuga, Guilherme C; Verícimo, Maurício; Castro, Helena C; Bourguignon, Saulo C; Côrte-Real, Suzana; Ratcliffe, Norman; Declercq, Wim; Santos, Dilvani O

    2015-07-01

    Leprosy is a chronic granulomatous disease caused by Mycobacterium leprae affecting the skin and peripheral nerves. Despite M. leprae invasion of the skin and keratinocytes importance in innate immunity, the interaction of these cells in vitro during M. leprae infection is poorly understood. Conventional and fluorescence optical microscopy, transmission electronic microscopy, flow cytometry and ELISA were used to study the in vitro interaction of M. leprae with the HaCaT human keratinocyte cell line. Keratinocytes uptake of M. leprae is described, and modulation of the surface expression of CD80 and CD209, cathelicidin expression and TNF-α and IL-1β production of human keratinocytes are compared with dendritic cells and macrophages during M. leprae interaction. This study demonstrated that M. leprae interaction with human keratinocytes enhanced expression of cathelicidin and greatly increased TNF-α production. The highest spontaneous expression of cathelicidin was by dendritic cells which are less susceptible to M. leprae infection. In contrast, keratinocytes displayed low spontaneous cathelicidin expression and were more susceptible to M. leprae infection than dendritic cells. The results show, for the first time, an active role for keratinocytes during infection by irradiated whole cells of M. leprae and the effect of vitamin D on this process. They also suggest that therapies which target cathelicidin modulation may provide novel approaches for treatment of leprosy. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  5. miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    McKenna, Declan J., E-mail: dj.mckenna@ulster.ac.uk [Biomedical Sciences Research Institute, University of Ulster, Coleraine, Co. Derry BT52 1SA (United Kingdom); Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); Patel, Daksha, E-mail: d.patel@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); McCance, Dennis J., E-mail: d.mccance@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom)

    2014-01-05

    A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes.

  6. miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes

    International Nuclear Information System (INIS)

    McKenna, Declan J.; Patel, Daksha; McCance, Dennis J.

    2014-01-01

    A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes

  7. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    International Nuclear Information System (INIS)

    Shi, Ge; Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin; Ou, Bai-sheng; Kim, Sooil; Lee, Young Ho; Yoon, Tae-Jin; Kim, Seong-Jin; Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon; Kim, Chang Deok

    2010-01-01

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  8. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Ge [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Ou, Bai-sheng [Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Kim, Sooil; Lee, Young Ho [Department of Anatomy, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Yoon, Tae-Jin [Department of Dermatology, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Kim, Seong-Jin [Department of Dermatology, Chonnam National University Medical School, Gwangju, 501-757 (Korea, Republic of); Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Kim, Chang Deok, E-mail: cdkimd@cnu.ac.kr [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of)

    2010-11-15

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  9. Valproic acid induces cutaneous wound healing in vivo and enhances keratinocyte motility.

    Directory of Open Access Journals (Sweden)

    Soung-Hoon Lee

    Full Text Available BACKGROUND: Cutaneous wound healing is a complex process involving several signaling pathways such as the Wnt and extracellular signal-regulated kinase (ERK signaling pathways. Valproic acid (VPA is a commonly used antiepileptic drug that acts on these signaling pathways; however, the effect of VPA on cutaneous wound healing is unknown. METHODS AND FINDINGS: We created full-thickness wounds on the backs of C3H mice and then applied VPA. After 7 d, we observed marked healing and reduced wound size in VPA-treated mice. In the neo-epidermis of the wounds, β-catenin and markers for keratinocyte terminal differentiation were increased after VPA treatment. In addition, α-smooth muscle actin (α-SMA, collagen I and collagen III in the wounds were significantly increased. VPA induced proliferation and suppressed apoptosis of cells in the wounds, as determined by Ki67 and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL staining analyses, respectively. In vitro, VPA enhanced the motility of HaCaT keratinocytes by activating Wnt/β-catenin, ERK and phosphatidylinositol 3-kinase (PI3-kinase/Akt signaling pathways. CONCLUSIONS: VPA enhances cutaneous wound healing in a murine model and induces migration of HaCaT keratinocytes.

  10. Bilayered nanofibrous 3D hierarchy as skin rudiment by emulsion electrospinning for burn wound management.

    Science.gov (United States)

    Pal, Pallabi; Dadhich, Prabhash; Srivas, Pavan Kumar; Das, Bodhisatwa; Maulik, Dhrubajyoti; Dhara, Santanu

    2017-08-22

    Mimicking skin extracellular matrix hierarchy, the present work aims to develop a bilayer skin graft comprising a porous cotton-wool-like 3D layer with membranous structure of PCL-chitosan nanofibers. Emulsion electrospinning with differential stirring periods of PCL-chitosan emulsion results in development of a bilayer 3D structure with varied morphology. The electrospun membrane has fiber diameter ∼274 nm and pore size ∼1.16 μm while fluffy 3D layer has fiber diameter ∼1.62 μm and pore size ∼62 μm. The 3D layer was further coated with collagen I isolated from Cirrhinus cirrhosus fish scales to improve biofunctionality. Surface coating with collagen I resulted in bundling the fibers together, thereby increasing their average diameter to 2.80 μm and decreasing pore size to ∼45 μm. The architecture and composition of the scaffold promotes efficient cellular activity where interconnected porosity with ECM resembling collagen I coating assists cellular adhesion, infiltration, and proliferation from initial days of fibroblast seeding, while keratinocytes migrate on the surface only without infiltrating in the membranous nanofiber layer. Anatomy of the scaffold arising due to variation in pore size distribution at different layers thereby facilitates compartmentalization and prevents initial cellular transmigration. The scaffold also assists in extracellular matrix protein synthesis and keratinocyte stratification in vitro. Further, the scaffold effectively integrates and attaches with third-degree burn wound margins created in rat models and accelerates healing in comparison to standard Tegaderm dressing™. The bilayer scaffold is thus a promising, readily available, cost-effective, off-the-shelf matrix as a skin substitute.

  11. Mitogen activated protein kinases selectively regulate palytoxin-stimulated gene expression in mouse keratinocytes

    International Nuclear Information System (INIS)

    Zeliadt, Nicholette A.; Warmka, Janel K.; Wattenberg, Elizabeth V.

    2003-01-01

    We have been investigating how the novel skin tumor promoter palytoxin transmits signals through mitogen activated protein kinases (MAPKs). Palytoxin activates three major MAPKs, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, in a keratinocyte cell line derived from initiated mouse skin (308). We previously showed that palytoxin requires ERK to increase matrix metalloproteinase-13 (MMP-13) gene expression, an enzyme implicated in carcinogenesis. Diverse stimuli require JNK and p38 to increase MMP-13 gene expression, however. We therefore used the JNK and p38 inhibitors SP 600125 and SB 202190, respectively, to investigate the role of these MAPKs in palytoxin-induced MMP-13 gene expression. Surprisingly, palytoxin does not require JNK and p38 to increase MMP-13 gene expression. Accordingly, ERK activation, independent of palytoxin and in the absence of JNK and p38 activation, is sufficient to induce MMP-13 gene expression in 308 keratinocytes. Dexamethasone, a synthetic glucocorticoid that inhibits activator protein-1 (AP-1), blocked palytoxin-stimulated MMP-13 gene expression. Therefore, the AP-1 site present in the promoter of the MMP-13 gene appears to be functional and to play a key role in palytoxin-stimulated gene expression. Previous studies showed that palytoxin simulates an ERK-dependent selective increase in the c-Fos content of AP-1 complexes that bind to the promoter of the MMP-13 gene. JNK and p38 can also modulate c-Fos. Palytoxin does not require JNK or p38 to increase c-Fos binding, however. Altogether, these studies indicate that ERK plays a distinctly essential role in transmitting palytoxin-stimulated signals to specific nuclear targets in keratinocytes derived from initiated mouse skin

  12. Increased oxidative stress and antioxidant expression in mouse keratinocytes following exposure to paraquat

    International Nuclear Information System (INIS)

    Black, Adrienne T.; Gray, Joshua P.; Shakarjian, Michael P.; Laskin, Debra L.; Heck, Diane E.; Laskin, Jeffrey D.

    2008-01-01

    Paraquat (1,1'-dimethyl-4,4'-bipyridinium) is a widely used herbicide known to induce skin toxicity. This is thought to be due to oxidative stress resulting from the generation of cytotoxic reactive oxygen intermediates (ROI) during paraquat redox cycling. The skin contains a diverse array of antioxidant enzymes which protect against oxidative stress including superoxide dismutase (SOD), catalase, glutathione peroxidase-1 (GPx-1), heme oxygenase-1 (HO-1), metallothionein-2 (MT-2), and glutathione-S-transferases (GST). In the present studies we compared paraquat redox cycling in primary cultures of undifferentiated and differentiated mouse keratinocytes and determined if this was associated with oxidative stress and altered expression of antioxidant enzymes. We found that paraquat readily undergoes redox cycling in both undifferentiated and differentiated keratinocytes, generating superoxide anion and hydrogen peroxide as well as increased protein oxidation which was greater in differentiated cells. Paraquat treatment also resulted in increased expression of HO-1, Cu,Zn-SOD, catalase, GSTP1, GSTA3 and GSTA4. However, no major differences in expression of these enzymes were evident between undifferentiated and differentiated cells. In contrast, expression of GSTA1-2 was significantly greater in differentiated relative to undifferentiated cells after paraquat treatment. No changes in expression of MT-2, Mn-SOD, GPx-1, GSTM1 or the microsomal GST's mGST1, mGST2 and mGST3, were observed in response to paraquat. These data demonstrate that paraquat induces oxidative stress in keratinocytes leading to increased expression of antioxidant genes. These intracellular proteins may be important in protecting the skin from paraquat-mediated cytotoxicity

  13. A comparison of the direct medical costs for individuals with or without basal or squamous cell skin cancer: A study from Australia

    Directory of Open Access Journals (Sweden)

    David Rowell

    2016-05-01

    Full Text Available Objectives: The composition of the medical costs incurred by people treated for basal cell and squamous cell carcinomas (hereafter keratinocyte cancers is not adequately understood. We sought to compare the medical costs of individuals with or without keratinocyte cancers. Methods: We used national health insurance data to analyze the direct medical costs of 2000 cases and 2000 controls nested within the QSkin prospective cohort study (n = 43,794 conducted in Australia. We reconstructed the medical history of patients using medical and pharmaceutical item codes and then compared the health service costs of individuals treated for keratinocyte cancers with those not treated for keratinocyte cancers. Results: Individuals treated for keratinocyte cancers consumed on average AUD$1320 per annum more in medical services than those without keratinocyte cancers. Only 23.2% of costs were attributed to the explicit treatment of keratinocyte cancers. The principal drivers of the residual costs were medical attendances, surgical procedures on the skin, and histopathology services. We found significant positive associations between history of treatment for keratinocyte cancers with treatments for other health conditions, including melanoma, cardiovascular disease, lipidemia, osteoporosis, rheumatoid arthritis, colorectal cancer, prostate cancer, and tuberculosis. Conclusion: Individuals treated for keratinocyte cancers have substantially higher medical costs overall than individuals without keratinocyte cancers. The direct costs of skin cancer excision account for only one-fifth of this difference.

  14. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  15. Protective effect of different antioxidant agents in UVB-irradiated keratinocytes

    Directory of Open Access Journals (Sweden)

    Sara Salucci

    2017-09-01

    Full Text Available Skin cells can respond to UVB-induced damage either by tolerating it, or restoring it through antioxidant activation and DNA repair mechanisms or, ultimately, undergoing programmed cell death, when damage is massive. Nutritional factors, in particular, food antioxidants, have attracted much interest because of their potential use in new preventive, protective, and therapeutic strategies for chronic degenerative diseases, including skin inflammation and cancer. Some polyphenols, present in virgin olive oil, well tolerated by organism after oral administration, show a variety of pharmacological and clinical benefits such as anti-oxidant, anti-cancer, anti-inflammatory, and neuro-protective activities. Here, the protective effects of antioxidant compounds against UV-induced apoptosis have been described in HaCat cell line. Human keratinocytes were pre-treated with antioxidants before UVB exposure and their effects have been evaluated by means of ultrastructural analyses. After UVB radiation, a known cell death trigger, typical apoptotic features, absent in control condition and in antioxidant alone-treated cells, appear. An evident numerical decrease of ultrastructural apoptotic patterns and TUNEL positive nuclei can be observed when natural antioxidants were supplied before cell death induction. These data have been confirmed by molecular investigation of caspase activity. In conclusion, this paper highlights antioxidant compound ability to prevent apoptotic cell death in human keratinocytes exposed to UVB, suggesting, for these molecules, a potential role in preventing skin damage. 

  16. Resveratrol-Sensitized UVA Induced Apoptosis in Human Keratinocytes through Mitochondrial Oxidative Stress and Pore Opening

    Science.gov (United States)

    Boyer, Jean Z; Jandova, Jana; Janda, Jaroslav; Vleugels, Frank R; Elliott, David; Sligh, James E

    2012-01-01

    Resveratrol (3, 5, 4′-trihydroxy- trans- stilbene), a polyphenol compound, is derived from natural products such as the skin of red grapes, blueberries and cranberries. Resveratrol not only exhibits antioxidant, cardioprotection, and anti-aging properties, but can also inhibit cancer cell growth and induce apoptosis. It has been shown that resveratrol inhibits the activation of Nf-kB and subsequently down regulates the expression of Nf-kB regulated genes such as interleukin-2 and Bcl-2, leading to cell cycle arrest and increased apoptosis in multiple myeloma cells. In the skin, resveratrol has been reported to sensitize keratinocytes to UVA induced apoptosis. However, the effect of resveratrol on opening of the mitochondrial permeability transition pore has not been previously examined. Our data show that UVA (14J/cm2) along with resveratrol causes massive oxidative stress in mitochondria. As a consequence of oxidative stress, the mitochondrial membrane potential decreases which results in opening of the mitochondrial pores ultimately leading to apoptosis in human keratinocytes. These results may have clinical implications for development of future chemotherapeutic treatment for tumors of the skin. PMID:22673012

  17. Expression of proliferative and inflammatory markers in a full-thickness human skin equivalent following exposure to the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide

    International Nuclear Information System (INIS)

    Black, Adrienne T.; Hayden, Patrick J.; Casillas, Robert P.; Heck, Diane E.; Gerecke, Donald R.; Sinko, Patrick J.; Laskin, Debra L.; Laskin, Jeffrey D.

    2010-01-01

    Sulfur mustard is a potent vesicant that induces inflammation, edema and blistering following dermal exposure. To assess molecular mechanisms mediating these responses, we analyzed the effects of the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide, on EpiDerm-FT TM , a commercially available full-thickness human skin equivalent. CEES (100-1000 μM) caused a concentration-dependent increase in pyknotic nuclei and vacuolization in basal keratinocytes; at high concentrations (300-1000 μM), CEES also disrupted keratin filament architecture in the stratum corneum. This was associated with time-dependent increases in expression of proliferating cell nuclear antigen, a marker of cell proliferation, and poly(ADP-ribose) polymerase (PARP) and phosphorylated histone H2AX, markers of DNA damage. Concentration- and time-dependent increases in mRNA and protein expression of eicosanoid biosynthetic enzymes including COX-2, 5-lipoxygenase, microsomal PGE 2 synthases, leukotriene (LT) A 4 hydrolase and LTC 4 synthase were observed in CEES-treated skin equivalents, as well as in antioxidant enzymes, glutathione S-transferases A1-2 (GSTA1-2), GSTA3 and GSTA4. These data demonstrate that CEES induces rapid cellular damage, cytotoxicity and inflammation in full-thickness skin equivalents. These effects are similar to human responses to vesicants in vivo and suggest that the full thickness skin equivalent is a useful in vitro model to characterize the biological effects of mustards and to develop potential therapeutics.

  18. Skin moisturization mechanisms: new data.

    Science.gov (United States)

    Bonté, F

    2011-05-01

    The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  19. Identification of quenchers of photoexcited States as novel agents for skin photoprotection.

    Science.gov (United States)

    Wondrak, Georg T; Jacobson, Myron K; Jacobson, Elaine L

    2005-02-01

    Photooxidative stress is a key mechanism in UVA-induced skin photodamage. Photoexcited states of endogenous UVA chromophores such as porphyrins, melanin precursors, and cross-link-fluorophores of skin collagen exert skin photodamage by direct reaction with substrate molecules (type I photosensitization) or molecular oxygen (type II), leading to formation of reactive oxygen species. Based on our previous research on the role of photoexcited states of endogenous skin chromophores as sensitizers of photooxidative stress, we describe here the identification of a novel class of chemopreventive agents for topical skin photoprotection: quenchers of photoexcited states (QPES). QPES compounds antagonize the harmful excited state chemistry of endogenous sensitizers by physical quenching, facilitating the harmless return of the sensitizer excited state to the electronic ground state by energy dissipation. To identify QPES compounds suitable for development, we designed a primary screening assay based on QPES suppression of photosensitized plasmid cleavage using conditions that exclude antioxidants. This screen is followed with a screen to test for nonsacrificial quenching of dye-sensitized singlet oxygen ((1)O(2)) formation by electron paramagnetic resonance detection of 2,2,6,6-tetramethyl-piperidine-1-oxyl, a stable free radical indicative of (1)O(2) formation. These initial screens identified a pyrrolidine pharmacophore with pronounced QPES activity, and l-proline and other noncytotoxic proline derivatives containing this pharmacophore were then screened for efficacy in cellular models of sensitized photodamage. These compounds showed QPES protection against dye-sensitized and psoralen-UVA-induced apoptosis and suppression of proliferation in cultured human skin keratinocytes and fibroblasts. Furthermore, QPES photoprotection of reconstructed full thickness human skin exposed to solar simulated light has been demonstrated.

  20. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  1. Interleukin 1 gene expression in cultured human keratinocytes is augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.

    1987-01-01

    Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure

  2. Internalization of EGF receptor following lipid rafts disruption in keratinocytes is delayed and dependent on p38 MAPK activation

    DEFF Research Database (Denmark)

    Lambert, S.; Ameels, H.; Gniadecki, R.

    2008-01-01

    The receptor for epidermal growth factor (EGF) plays an important role in epidermal keratinocytes and is known to move out of lipid raft after cholesterol depletion, leading to ligand-independent activation. Accumulation of evidence indicates the ability of EGF receptor (EGFR) to undergo internal......The receptor for epidermal growth factor (EGF) plays an important role in epidermal keratinocytes and is known to move out of lipid raft after cholesterol depletion, leading to ligand-independent activation. Accumulation of evidence indicates the ability of EGF receptor (EGFR) to undergo...... internalization without participation of the ligand under the control of p38 MAPK during stress conditions. Since cholesterol depletion using methyl-beta-cyclodextrin is known to induce ligand-independent activation of EGFR in keratinocytes, we investigated by confocal microscopy and ligand-binding tests...... the process of internalization, which can be considered as a protective response to stress. Moreover, cholesterol-depleted keratinocytes recover their ability to proliferate during the recovery period that follows lipid raft disruption Udgivelsesdato: 2008/12...

  3. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  4. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    International Nuclear Information System (INIS)

    Hasegawa, Tatsuya; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-01-01

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE_2. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  5. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Tatsuya, E-mail: tatsuya.hasegawa@to.shiseido.co.jp; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-08-26

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE{sub 2}. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  6. The herpes simplex virus-induced demise of keratinocytes is associated with a dysregulated pattern of p63 expression.

    Science.gov (United States)

    Megyeri, Klára; Orosz, László; Kormos, Bernadett; Pásztor, Katalin; Seprényi, György; Ocsovszki, Imre; Mándi, Yvette; Bata-Csörgo, Zsuzsanna; Kemény, Lajos

    2009-01-01

    p63 plays a pivotal role in the development and maintenance of stratified epithelial tissues. In an effort to gain insight into the pathogenic mechanisms of skin infections caused by HSV-1 and HSV-2, we determined the patterns of p63 expression in primary keratinocytes and in the HaCaT cell line. The levels of DeltaNp63alpha and a 50kDa p73 isoform were decreased, Bax-alpha remained unaffected, while the expressions of the Bax-beta, TAp63gamma and a 44.5kDa p73 isoform were highly increased in both HSV-1-infected HaCaT cells and primary keratinocytes. In contrast, in response to HSV-2 infection the levels of DeltaNp63alpha, a 50kDa p73 isoform and a 44.5kDa p73 protein were decreased, Bax-alpha and TAp63gamma remained unaffected, while the expression of Bax-beta was slightly increased. The knockdown of TAp63 expression enhanced the viability of HSV-1-infected cells. Thus, HSV-1 and HSV-2 modulate the patterns of p63 and Bax expression in a serotype-specific manner. The dysregulated pattern of p63 expression observed in HSV-infected keratinocytes may comprise part of a mechanism by which these viruses perturb the functions of keratinocytes and lead to their demise.

  7. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  8. Influence of ionizing radiation, photoperiod, and environmental temperature on cell proliferation in the intestinal epithelium of the rough-skinned newt (Taricha granulosa)

    International Nuclear Information System (INIS)

    Filipy, R.E.

    1977-01-01

    Kinetics of cell division in the intestinal epithelial proliferative cells (cell nests) of the rough-skinned newt, Taricha granulosa, were studied using tritiated thymidine autoradiography and the mitotic arresting properties of colcemid. Percent labeled mitoses (PLM) curves were drawn from the autoradiographic data from two separate experiments in which the newts were maintained at room temperature (22 to 23 0 C). In those experiments, groups of newts were intraperitoneally injected with tritiated thymidine at times ranging between 5 and 58 hours before they were killed. Each newt in both experiments was intraperitoneally injected with colcemid five hours before it was killed. Data from both experiments were very similar and the PLM curves were used to estimate cell cycle phase durations in the cell nests. The DNA synthetic phase was estimated to be 41 hours long and the sum of the G 2 phase duration and one-half the duration of mitosis was approximately seven hours. The duration of the entire cell cycle was considered to be longer than 100 hours and the duration of the G 1 phase longer than 50 hours. Whole-body exposure of newts to 100 R x irradiation essentially stopped mitotic activity in the intestinal cell nests for 32 hours and exposure to 200 R stopped the mitotic activity for 56 hours. Recovery of mitotic activity in the cell nests was in evidence in data from both groups of animals after both those time periods. Whole-body exposure of newts to 1000 R x irradiation severely depressed mitotic activity in the intestinal cell nests for at least 78 hours and resulted in diminished numbers of the cell nests although the mature cells of the intestinal cells appeared to be relatively radioresistant

  9. Platelet-rich plasma with keratinocytes and fibroblasts enhance healing of full-thickness wounds.

    Science.gov (United States)

    Law, Jia Xian; Chowdhury, Shiplu Roy; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj

    2017-08-01

    Advances in tissue engineering led to the development of various tissue-engineered skin substitutes (TESS) for the treatment of skin injuries. The majority of the autologous TESS required lengthy and costly cell expansion process to fabricate. In this study, we determine the possibility of using a low density of human skin cells suspended in platelet-rich plasma (PRP)-enriched medium to promote the healing of full-thickness skin wounds. To achieve this, full-thickness wounds of size 1.767 cm 2 were created at the dorsum part of nude mice and treated with keratinocytes (2 × 10 4  cells/cm 2 ) and fibroblasts (3 × 10 4  cells/cm 2 ) suspended in 10% PRP-enriched medium. Wound examination was conducted weekly and the animals were euthanized after 2 weeks. Gross examination showed that re-epithelialization was fastest in the PRP+cells group at both day 7 and 14, followed by the PRP group and NT group receiving no treatment. Only the PRP+cells group achieved complete wound closure by 2 weeks. Epidermal layer was presence in the central region of the wound of the PRP+cells and PRP groups but absence in the NT group. Comparison between the PRP+cells and PRP groups showed that the PRP+cells-treated wound was more mature as indicated by the presence of thinner epidermis with single cell layer thick basal keratinocytes and less cellular dermis. In summary, the combination of low cell density and diluted PRP creates a synergistic effect which expedites the healing of full-thickness wounds. This combination has the potential to be developed as a rapid wound therapy via the direct application of freshly harvested skin cells in diluted PRP. Copyright © 2017 Tissue Viability Society. Published by Elsevier Ltd. All rights reserved.

  10. Protection against 2-chloroethyl ethyl sulfide (CEES) - induced cytotoxicity in human keratinocytes by an inducer of the glutathione detoxification pathway

    International Nuclear Information System (INIS)

    Abel, Erika L.; Bubel, Jennifer D.; Simper, Melissa S.; Powell, Leslie; McClellan, S. Alex; Andreeff, Michael; MacLeod, Michael C.; DiGiovanni, John

    2011-01-01

    Sulfur mustard (SM or mustard gas) was first used as a chemical warfare agent almost 100 years ago. Due to its toxic effects on the eyes, lungs, and skin, and the relative ease with which it may be synthesized, mustard gas remains a potential chemical threat to the present day. SM exposed skin develops fluid filled bullae resulting from potent cytotoxicity of cells lining the basement membrane of the epidermis. Currently, there are no antidotes for SM exposure; therefore, chemopreventive measures for first responders following an SM attack are needed. Glutathione (GSH) is known to have a protective effect against SM toxicity, and detoxification of SM is believed to occur, in part, via GSH conjugation. Therefore, we screened 6 potential chemopreventive agents for ability to induce GSH synthesis and protect cultured human keratinocytes against the SM analog, 2-chloroethyl ethyl sulfide (CEES). Using NCTC2544 human keratinocytes, we found that both sulforaphane and methyl-2-cyano-3,12-dioxooleana-1,9-dien-28-oate (CDDO-Me) stimulated nuclear localization of Nrf2 and induced expression of the GSH synthesis gene, GCLM. Additionally, we found that treatment with CDDO-Me elevated reduced GSH content of NCTC2544 cells and preserved their viability by ∼ 3-fold following exposure to CEES. Our data also suggested that CDDO-Me may act additively with 2,6-dithiopurine (DTP), a nucleophilic scavenging agent, to increase the viability of keratinocytes exposed to CEES. These results suggest that CDDO-Me is a promising chemopreventive agent for SM toxicity in the skin. - Highlights: → CDDO-Me treatment increased intracellular GSH in human keratinocytes. → CDDO-Me increased cell viability following exposure to the half-mustard, CEES. → The cytoprotective effect of CDDO-Me was likely due to scavenging with endogenous GSH.

  11. Rho kinase inhibitor Y-27632 promotes the differentiation of human bone marrow mesenchymal stem cells into keratinocyte-like cells in xeno-free conditioned medium.

    Science.gov (United States)

    Li, Zhenzhen; Han, Shichao; Wang, Xingqin; Han, Fu; Zhu, Xiongxiang; Zheng, Zhao; Wang, Hongtao; Zhou, Qin; Wang, Yunchuan; Su, Linlin; Shi, Jihong; Tang, Chaowu; Hu, Dahai

    2015-03-11

    Bone marrow mesenchymal stem cells (BMSCs), which have the ability to self-renew and to differentiate into multiple cell types, have recently become a novel strategy for cell-based therapies. The differentiation of BMSCs into keratinocytes may be beneficial for patients with burns, disease, or trauma. However, the currently available cells are exposed to animal materials during their cultivation and induction. These xeno-contaminations severely limit their clinical outcomes. Previous studies have shown that the Rho kinase (ROCK) inhibitor Y-27632 can promote induction efficiency and regulate the self-renewal and differentiation of stem cells. In the present study, we attempted to establish a xeno-free system for the differentiation of BMSCs into keratinocytes and to investigate whether Y-27632 can facilitate this differentiation. BMSCs isolated from patients were cultured by using a xeno-free system and characterised by using flow cytometric analysis and adipogenic and osteogenic differentiation assays. Human primary keratinocytes were also isolated from patients. Then, the morphology, population doubling time, and β-galactosidase staining level of these cells were evaluated in the presence or absence of Y-27632 to determine the effects of Y-27632 on the state of the keratinocytes. Keratinocyte-like cells (KLCs) were detected at different time points by immunocytofluorescence analysis. Moreover, the efficiency of BMSC differentiation under different conditions was measured by quantitative real-time-polymerase chain reaction (RT-PCR) and Western blot analyses. The ROCK inhibitor Y-27632 promoted the proliferation and lifespan of human primary keratinocytes. In addition, we showed that keratinocyte-specific markers could be detected in BMSCs cultured in a xeno-free system using keratinocyte-conditioned medium (KCM) independent of the presence of Y-27632. However, the efficiency of the differentiation of BMSCs into KLCs was significantly higher in the presence of Y

  12. Total Defense + Repair: A Novel Concept in Solar Protection and Skin Rejuvenation.

    Science.gov (United States)

    McDaniel, David H; Hamzavi, Iltefat H; Zeichner, Joshua A; Fabi, Sabrina G; Bucay, Vivian W; Harper, Julie C; Comstock, Jody A; Makino, Elizabeth T; Mehta, Rahul C; Vega, Virginia L

    2015-07-01

    For more than a century, solar radiation has been known to contribute significantly to the extrinsic aging of skin. Until recently, this was almost exclusively attributed to the photodamage caused by ultraviolet (UV) light. However, a growing body of evidence now indicates that both infrared (IR) and visible light may also contribute to extrinsic skin aging. Infrared radiation, comprised of IR-A, IR-B, and IR-C, accounts for 54.3% of the total solar radiation reaching the skin. Studies have shown that IR radiation is also responsible for skin aging. Thus, IR-A radiation regulates hundreds of genes in skin, with roles in extracellular matrix (ECM) homeostasis regulation, apoptosis, cell growth, and stress responses. IR-B and IR-C radiation are primarily responsible for the increase in skin temperature associated with solar exposure, and are implicated in heat-related skin destruction of collagen and elastin, which is characterized by an increase in the expression of matrix metalloproteinases (MMPs). The contribution of visible light to photoaging is less well understood; however, some preliminary indication associates visible light with the upregulation of MMPs' expression, DNA damage, and keratinocyte proliferation. Interestingly, the common denominator that links skin damage to the different solar wavelengths is the enhanced production of reactive molecule species (RMS) and therewith increased oxidative stress. SkinMedica® Total Defense + Repair (TD+R; SkinMedica Inc., an Allergan company, Irvine, CA) is a "superscreen," which combines broad spectrum UV protection with a unique blend of antioxidants (SOL-IR Advanced Antioxidant Complex™) that provide protection from IR radiation while promoting skin repair. Preclinical studies have indicated that TD+R SPF34 prevents the formation of UV-induced sunburn cells and cyclobutane pyrimidine dimers while preserving or improving the expression of ECM genes. In addition, it prevents IR-A-triggered fragmentation of

  13. Differentiation of human scalp hair follicle keratinocytes in culture.

    Science.gov (United States)

    Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J

    1984-01-01

    The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.

  14. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

    Science.gov (United States)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  16. Alteration of keratinocyte differentiation and senescence by the tumor promoter dioxin

    International Nuclear Information System (INIS)

    Ray, Soma S.; Swanson, Hollie I.

    2003-01-01

    Exposure to the environmental contaminant dioxin, elicits a variety of responses, which includes tumor promotion, embryotoxicity/teratogenesis, and carcinogenesis in both animals and humans. Many of the effects of dioxin are mediated by the aryl hydrocarbon receptor (AHR), a ligand-activated bHLH (basic helix-loop-helix)/PAS transcription factor. We initiated this study to determine whether dioxin's tumor-promoting activities may lie in its ability to alter proliferation, differentiation, and/or senescence using normal human epidermal keratinocytes (HEKs). Here, we report that dioxin appears to accelerate differentiation as measured by flow cytometry and by increased expression of the differentiation markers involucrin and filaggrin. In addition, dioxin appears to increase proliferation as indicated by an increase in NADH/NADPH production and changes in cell cycle. Finally, dioxin decreases SA (senescence associated) β-galactosidase staining, an indicator of senescence, in the differentiating keratinocytes. These changes were accompanied by decreases in the expression levels of key cell cycle regulatory proteins p53, p16 INK4a , and p14 ARF . Our findings support the idea that dioxin may exert its tumor-promoting actions, in part, by downregulating the expression levels of key tumor suppressor proteins, which may impair the cell's ability to maintain its appropriate cellular status

  17. The Pseudomonas aeruginosa quorum sensing signal molecule N-(3-oxododecanoyl) homoserine lactone enhances keratinocyte migration and induces Mmp13 gene expression in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Paes, Camila, E-mail: camilaquinetti@gmail.com [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Nakagami, Gojiro, E-mail: gojiron-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Minematsu, Takeo, E-mail: tminematsu-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Nagase, Takashi, E-mail: tnagase@fb3.so-net.ne.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Huang, Lijuan, E-mail: koureikenhlj@gmail.com [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sari, Yunita, E-mail: yunita-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sanada, Hiromi, E-mail: hsanada-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan)

    2012-10-19

    Highlights: Black-Right-Pointing-Pointer An evidence of the positive effect of AHL on epithelialization process is provided. Black-Right-Pointing-Pointer AHL enhances keratinocyte's ability to migrate in an in vitro scratch wound model. Black-Right-Pointing-Pointer AHL induces the expression of Mmp13. Black-Right-Pointing-Pointer Topical application of AHL represents a possible strategy to treat chronic wounds. -- Abstract: Re-epithelialization is an essential step of wound healing involving three overlapping keratinocyte functions: migration, proliferation and differentiation. While quorum sensing (QS) is a cell density-dependent signaling system that enables bacteria to regulate the expression of certain genes, the QS molecule N-(3-oxododecanoyl) homoserine lactone (AHL) exerts effects also on mammalian cells in a process called inter-kingdom signaling. Recent studies have shown that AHL improves epithelialization in in vivo wound healing models but detailed understanding of the molecular and cellular mechanisms are needed. The present study focused on the AHL as a candidate reagent to improve wound healing through direct modulation of keratinocyte's activity in the re-epithelialization process. Results indicated that AHL enhances the keratinocyte's ability to migrate in an in vitro scratch wound healing model probably due to the high Mmp13 gene expression analysis after AHL treatment that was revealed by real-time RT-PCR. Inhibition of activator protein 1 (AP-1) signaling pathway completely prevented the migration of keratinocytes, and also resulted in a diminished Mmp13 gene expression, suggesting that AP-1 might be essential in the AHL-induced migration. Taken together, these results imply that AHL is a promising candidate molecule to improve re-epithelialization through the induction of migration of keratinocytes. Further investigation is needed to clarify the mechanism of action and molecular pathway of AHL on the keratinocyte migration

  18. Release by ultraviolet B (u.v.B) radiation of nitric oxide (NO) from human keratinocytes: a potential role for nitric oxide in erythema production

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stravrides, J.C.

    1995-01-01

    The mechanism of human sunburn is poorly understood but its characteristic features include the development of erythema. In this study we attempted to determine whether human keratinocytes possess a nitric oxide (NO) synthase (NOS), if this enzyme could be activated to release NO following exposure to ultraviolet B (u.v.B) and to define whether this photo-induced response could be involved in the pathogenesis of sunburn erythema. The present results indicate that u.v.B radiation acts as a potent stimulator of NOS in keratinocytes. NO is lipophilic and may diffuse out of the keratinocytes, activating sGC in endothelial cells and neighbouring smooth muscle cells. This may be a major part of the integrated response of the skin leading to vasodilatation and erythema. (author)

  19. JWA deficiency suppresses dimethylbenz[a]anthracene-phorbol ester induced skin papillomas via inactivation of MAPK pathway in mice.

    Directory of Open Access Journals (Sweden)

    Zhenghua Gong

    Full Text Available Our previous studies indicated that JWA plays an important role in DNA damage repair, cell migration, and regulation of MAPKs. In this study, we investigated the role of JWA in chemical carcinogenesis using conditional JWA knockout (JWA(Δ2/Δ2 mice and two-stage model of skin carcinogenesis. Our results indicated that JWA(Δ2/Δ2 mice were resistant to the development of skin papillomas initiated by 7, 12-dimethylbenz(aanthracene (DMBA followed by promotion with 12-O-tetradecanoylphorbol-13-acetate (TPA. In JWA(Δ2/Δ2 mice, the induction of papilloma was delayed, and the tumor number and size were reduced. In primary keratinocytes from JWA(Δ2/Δ2 mice, DMBA exposure induced more intensive DNA damage, while TPA-promoted cell proliferation was reduced. The further mechanistic studies showed that JWA deficiency blocked TPA-induced activation of MAPKs and its downstream transcription factor Elk1 both in vitro and in vivo. JWA(Δ2/Δ2 mice are resistance to tumorigenesis induced by DMBA/TPA probably through inhibition of transcription factor Elk1 via MAPKs. These results highlight the importance of JWA in skin homeostasis and in the process of skin tumor development.

  20. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer

    International Nuclear Information System (INIS)

    Chen, Yi; Pirisi, Lucia; Creek, Kim E.

    2013-01-01

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. - Highlights: • Ski oncoprotein levels increase during progression of HPV16-transformed cells. • Ski and phospho-Ski protein levels are cell cycle dependent. • Ski knock-down in HPV16-transformed keratinocytes inhibited cell proliferation. • Cervical cancer samples overexpress Ski

  1. Persistent DNA damage after high dose in vivo gamma exposure of minipig skin.

    Directory of Open Access Journals (Sweden)

    Emad A Ahmed

    Full Text Available Exposure to high doses of ionizing radiation (IR can lead to localized radiation injury of the skin and exposed cells suffer dsDNA breaks that may elicit cell death or stochastic changes. Little is known about the DNA damage response after high-dose exposure of the skin. Here, we investigate the cellular and DNA damage response in acutely irradiated minipig skin.IR-induced DNA damage, repair and cellular survival were studied in 15 cm(2 of minipig skin exposed in vivo to ~50 Co-60 γ rays. Skin biopsies of control and 4 h up to 96 days post exposure were investigated for radiation-induced foci (RIF formation using γ-H2AX, 53BP1, and active ATM-p immunofluorescence. High-dose IR induced massive γ-H2AX phosphorylation and high 53BP1 RIF numbers 4 h, 20 h after IR. As time progressed RIF numbers dropped to a low of 3-fold elevated at all subsequent time points. Replicating basal cells (Ki67+ were reduced 3 days post IR followed by increased proliferation and recovery of epidermal cellularity after 28 days.Acute high dose irradiation of minipig epidermis impaired stem cell replication and induced elevated apoptosis from 3 days onward. DNA repair cleared the high numbers of DBSs in skin cells, while RIFs that persisted in <1% cells marked complex and potentially lethal DNA damage up to