Particularities of fully-parallel manipulators in 6-DOFs robots design: a review of critical aspects
Directory of Open Access Journals (Sweden)
Milica Lucian
2017-01-01
Full Text Available A whole range of industrial applications requires the presence of parallel mechanisms with six degrees of freedom (6-DOF which have been developed in the last fifteen years, and one of the reasons why they still are a current topic is that present-day computers are capable of performing real-time motion laws of great complexity associated with these types of parallel mechanisms. The present work underlines particularities of parallel manipulators and their importance in the design of 6-DOF robots. The paper reveals the progress made in the last twenty years in the development of 6-DOF parallel manipulators, which increasingly find a wide scope of applications in different industrial areas such as robotics, manufacture and assisted medicine. It also emphasizes the need to determine singular configurations and the effect of cinematic redundancy which can increase the working space of the manipulators by adding active joints in one or more branches of the manipulator. Throughout the work, there were outlined three types of singularities encountered in the modelling of different types of parallel manipulators, and three types of redundancy. Furthermore, an analysis was made of the dimension of the workspace for a series of parallel manipulators, highlighting a number of factors that influence its size.
Type synthesis for 4-DOF parallel press mechanism using GF set theory
He, Jun; Gao, Feng; Meng, Xiangdun; Guo, Weizhong
2015-07-01
Parallel mechanisms is used in the large capacity servo press to avoid the over-constraint of the traditional redundant actuation. Currently, the researches mainly focus on the performance analysis for some specific parallel press mechanisms. However, the type synthesis and evaluation of parallel press mechanisms is seldom studied, especially for the four degrees of freedom(DOF) press mechanisms. The type synthesis of 4-DOF parallel press mechanisms is carried out based on the generalized function(GF) set theory. Five design criteria of 4-DOF parallel press mechanisms are firstly proposed. The general procedure of type synthesis of parallel press mechanisms is obtained, which includes number synthesis, symmetrical synthesis of constraint GF sets, decomposition of motion GF sets and design of limbs. Nine combinations of constraint GF sets of 4-DOF parallel press mechanisms, ten combinations of GF sets of active limbs, and eleven combinations of GF sets of passive limbs are synthesized. Thirty-eight kinds of press mechanisms are presented and then different structures of kinematic limbs are designed. Finally, the geometrical constraint complexity( GCC), kinematic pair complexity( KPC), and type complexity( TC) are proposed to evaluate the press types and the optimal press type is achieved. The general methodologies of type synthesis and evaluation for parallel press mechanism are suggested.
Adaptive Controller for 6-DOF Parallel Robot Using T-S Fuzzy Inference
Directory of Open Access Journals (Sweden)
Xue Jian
2013-02-01
Full Text Available 6-DOF parallel robot always appears in the form of Stewart platform. It has been widely used in industry for the benefits such as strong structural stiffness, high movement accuracy and so on. Space docking technology makes higher requirements of motion accuracy and dynamic performance to the control method on 6-DOF parallel robot. In this paper, a hydraulic 6-DOF parallel robot was used to simulate the docking process. Based on this point, this paper gave a thorough study on the design of an adaptive controller to eliminate the asymmetric of controlled plant and uncertain load force interference. Takagi-Sugeno (T-S fuzzy inference model was used to build the fuzzy adaptive controller. With T-S model, the controller directly imposes adaptive control signal on the plant to make sure that the output of plant could track the reference model output. The controller has simple structure and is easy to implement. Experiment results show that the controller can eliminate asymmetric and achieve good dynamic performance, and has good robustness to load interference.
Structural Synthesis of 3-DoF Spatial Fully Parallel Manipulators
Directory of Open Access Journals (Sweden)
Alfonso Hernandez
2014-07-01
Full Text Available In this paper, the architectures of three degrees of freedom (3-DoF spatial, fully parallel manipulators (PMs, whose limbs are structurally identical, are obtained systematically. To do this, the methodology followed makes use of the concepts of the displacement group theory of rigid body motion. This theory works with so-called ‘motion generators’. That is, every limb is a kinematic chain that produces a certain type of displacement in the mobile platform or end-effector. The laws of group algebra will determine the actual motion pattern of the end-effector. The structural synthesis is a combinatorial process of different kinematic chains’ topologies employed in order to get all of the 3-DoF motion pattern possibilities in the end-effector of the fully parallel manipulator.
A redundant, 6-DOF parallel manipulator structure with improved workspace and dexterity
International Nuclear Information System (INIS)
Stoughton, R.S.; Salerno, R.; Canfield, S.; Reinholtz, C.
1994-08-01
This paper presents a novel manipulator structure which combines two known parallel manipulator structures--a Stewart Platform (SP), and a double octahedral Variable Geometry Truss (VGT). The combined VGT + SP structure is redundant, using nine actuators to realize six-DOF motion. Combining the two structures allows the translational and orientational workspaces of the two individual structures to sum together to a much larger workspace than is generally achievable with parallel manipulator structures. In addition, the VGT portion of the structure allows the configuration of the Stewart Platform to be changed ''on the fly'' from one with a large workspace to one with high dexterity. A useful application of this structure is at the distal end of a truss-based manipulator, where it can serve as a dexterous wrist while preserving an internal passageway for cabling and/or conveyance systems
Chattering-Free Neuro-Sliding Mode Control of 2-DOF Planar Parallel Manipulators
Directory of Open Access Journals (Sweden)
Tien Dung Le
2013-01-01
Full Text Available This paper proposes a novel chattering free neuro-sliding mode controller for the trajectory tracking control of two degrees of freedom (DOF parallel manipulators which have a complicated dynamic model, including modelling uncertainties, frictional uncertainties and external disturbances. A feedforward neural network (NN is combined with an error estimator to completely compensate the large nonlinear uncertainties and external disturbances of the parallel manipulators. The online weight tuning algorithms of the NN and the structure of the error estimator are derived with the strict theoretical stability proof of the Lyapunov theorem. The upper bound of uncertainties and the upper bound of the approximation errors are not required to be known in advance in order to guarantee the stability of the closed-loop system. The example simulation results show the effectiveness of the proposed control strategy for the tracking control of a 2-DOF parallel manipulator. It results in its being chattering-free, very small tracking errors and its robustness against uncertainties and external disturbances.
Co-simulation of Six DOF Wire Driven Parallel Mechanism Based on ADAMS and Matlab
Directory of Open Access Journals (Sweden)
Tang Aofei
2015-01-01
Full Text Available The dynamic model of the 6 DOF Wire Driven Parallel Mechanism (WDPM system is introduced. Based on MATLAB system, the simulation of the inverse dynamic model is achieved. According to the simulation result, the mechanical model for the WDPM system is reasonable. Using ADAMS system, the dynamic model of the virtual prototype is verified by the simulation analysis. The combined control model based on ADAMS/Simulink is derived. The WDPM control system is designed with MATLAB/Simulink. The torque control method is selected for the outer ring and the PD control method for the inner ring. Combined with the ADAMS control model and control law design, the interactive simulation analysis of the WDPM system is completed. According to the simulation results of the spatial circle tracking and line tracking at the end of the moving platform, the tracking error can be reduced by the designed control algorithm. The minimum tracking error is 0.2 mm to 0.3 mm. Therefore, the theoretical foundation for designing hardware systems of the WDPM control system is established.
Decoupled Sliding Mode Control for a Novel 3-DOF Parallel Manipulator with Actuation Redundancy
Directory of Open Access Journals (Sweden)
Niu Xuemei
2015-05-01
Full Text Available This paper presents a decoupled nonsingular terminal sliding mode controller (DNTSMC for a novel 3-DOF parallel manipulator with actuation redundancy. According to kinematic analysis, the inverse dynamic model for a novel 3-DOF redundantly actuated parallel manipulator is formulated in the task space using Lagrangian formalism and decoupled into three entirely independent subsystems under generalized coordinates to significantly reduce system complexity. Based on the dynamic model, a decoupled sliding mode control strategy is proposed for the parallel manipulator; the idea behind this strategy is to design a nonsingular terminal sliding mode controller for each subsystem, which can drive states of three subsystems to the original equilibrium points simultaneously by two intermediate variables. Additionally, a RBF neural network is used to compensate the cross-coupling force and gravity to enhance the control precision. Simulation and experimental results show that the proposed DNTSMC can achieve better control performances compared with the conventional sliding mode controller (SMC and the DNTSMC without compensator.
A Six-DOF Buoyancy Tank Microgravity Test Bed with Active Drag Compensation
Sun, Chong; Chen, Shiyu; Yuan, Jianping; Zhu, Zhanxia
2017-10-01
Ground experiment under microgravity is very essential because it can verify the space enabling technologies before applied in space missions. In this paper, a novel ground experiment system that can provide long duration, large scale and high microgravity level for the six degree of freedom (DOF) spacecraft trajectory tracking is presented. In which, the most gravity of the test body is balanced by the buoyancy, and the small residual gravity is offset by the electromagnetic force. Because the electromagnetic force on the test body can be adjusted in the electromagnetic system, it can significantly simplify the balancing process using the proposed microgravity test bed compared to the neutral buoyance system. Besides, a novel compensation control system based on the active disturbance rejection control (ADRC) method is developed to estimate and compensate the water resistance online, in order to improve the fidelity of the ground experiment. A six-DOF trajectory tracking in the microgravity system is applied to testify the efficiency of the proposed compensation controller, and the experimental simulation results are compared to that obtained using the classic proportional-integral-derivative (PID) method. The simulation results demonstrated that, for the six-DOF motion ground experiment, the microgravity level can reach to 5 × 10-4 g. And, because the water resistance has been estimated and compensated, the performance of the presented controller is much better than the PID controller. The presented ground microgravity system can be applied in on-orbit service and other related technologies in future.
Design of a planar 3-DOF parallel micromanipulator
International Nuclear Information System (INIS)
Lee, Jeong Jae; Dong, Yanlu; Jeon, Yong Ho; Lee, Moon Gu
2013-01-01
A planar three degree-of-freedom (DOF) parallel manipulator is proposed to be applied for alignment during assembly of microcomponents. It adopts a PRR (prismatic-revolute-revolute) mechanism to meet the requirements of high precision for assembly and robustness against disturbance. The mechanism was designed to have a large workspace and good dexterity because parallel mechanisms usually have a narrow range and singularity of motion compared to serial mechanisms. Inverse kinematics and a simple closed-loop algorithm of the parallel manipulator are presented to control it. Experimental tests have been carried out with high-resolution capacitance sensors to verify the performance of the mechanism. The results of experiments show that the manipulator has a large workspace of ±1.0 mm, ±1.0 mm, and ±10 mrad in the X-, Y-, and θ-directions, respectively. This is a large workspace when considering it adopts a parallel mechanism and has a small size, 100 ´ 100 ´ 100 mm3 . It also has a good precision of 2 μm, 3 μm, and 0.2 mrad, in the X-, Y-, and θ- axes, respectively. These are high resolutions considering the manipulator adopts conventional joints. The manipulator is expected to have good dexterity.
Huijts, Martijn; Brouwer, Dannis Michel; van Dijk, Johannes
2009-01-01
Manipulators with guidance constructions based on elastic mechanisms are of interest for the increasing number of precision vacuum applications. Previously, the design of an elastic MEMS-based 6-DOFs manipulator was presented. Characterization in six degrees of freedom (DOFs) of a manipulator the
Directory of Open Access Journals (Sweden)
Hsu-Chih Huang
2014-01-01
Full Text Available This paper presents a hybrid Taguchi deoxyribonucleic acid (DNA swarm intelligence for solving the inverse kinematics redundancy problem of six degree-of-freedom (DOF humanoid robot arms. The inverse kinematics problem of the multi-DOF humanoid robot arm is redundant and has no general closed-form solutions or analytical solutions. The optimal joint configurations are obtained by minimizing the predefined performance index in DNA algorithm for real-world humanoid robotics application. The Taguchi method is employed to determine the DNA parameters to search for the joint solutions of the six-DOF robot arms more efficiently. This approach circumvents the disadvantage of time-consuming tuning procedure in conventional DNA computing. Simulation results are conducted to illustrate the effectiveness and merit of the proposed methods. This Taguchi-based DNA (TDNA solver outperforms the conventional solvers, such as geometric solver, Jacobian-based solver, genetic algorithm (GA solver and ant, colony optimization (ACO solver.
Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator
Directory of Open Access Journals (Sweden)
Qingcheng Chen
2015-10-01
Full Text Available Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics solution by introducing the screw theory. Unlike other methods, the proposed method only establishes two coordinates, namely the inertial coordinate and the tool coordinate; the screw motion of each link is carried out based on the inertial coordinate, ensuring definite geometric meaning. Furthermore, we adopt a new inverse kinematics algorithm, developing an improved sub-problem method along with Paden-Kahan sub-problems. This method has high efficiency and can be applied in real-time industrial operation. It is convenient to select the desired solutions directly from among multiple solutions by examining clear geometric meaning. Finally, the effectiveness and reliability performance of the new algorithm are analysed and verified in comparative experiments carried out on the six-DOF serial robot “Qianjiang I”.
Dimensional synthesis of a 3-DOF parallel manipulator with full circle rotation
Ni, Yanbing; Wu, Nan; Zhong, Xueyong; Zhang, Biao
2015-07-01
Parallel robots are widely used in the academic and industrial fields. In spite of the numerous achievements in the design and dimensional synthesis of the low-mobility parallel robots, few research efforts are directed towards the asymmetric 3-DOF parallel robots whose end-effector can realize 2 translational and 1 rotational(2T1R) motion. In order to develop a manipulator with the capability of full circle rotation to enlarge the workspace, a new 2T1R parallel mechanism is proposed. The modeling approach and kinematic analysis of this proposed mechanism are investigated. Using the method of vector analysis, the inverse kinematic equations are established. This is followed by a vigorous proof that this mechanism attains an annular workspace through its circular rotation and 2 dimensional translations. Taking the first order perturbation of the kinematic equations, the error Jacobian matrix which represents the mapping relationship between the error sources of geometric parameters and the end-effector position errors is derived. With consideration of the constraint conditions of pressure angles and feasible workspace, the dimensional synthesis is conducted with a goal to minimize the global comprehensive performance index. The dimension parameters making the mechanism to have optimal error mapping and kinematic performance are obtained through the optimization algorithm. All these research achievements lay the foundation for the prototype building of such kind of parallel robots.
Workspace optimization and kinematic performance evaluation of 2-DOF parallel mechanisms
International Nuclear Information System (INIS)
Nam, Yun Joo; Park, Myeong Kwan
2006-01-01
This paper presents the kinematics and workspace optimization of the two different 2-DOF (Degrees-of-Freedom) planar parallel mechanisms: one (called 2-RPR mechanism) with translational actuators and the other (called 2-RRR mechanism) with rotational ones. First of all, the inverse kinematics and Jacobian matrix for each mechanism are derived analytically. Then, the workspace including the output-space and the joint-space is systematically analyzed in order to determine the geometric parameters and the operating range of the actuators. Finally, the kinematic optimization of the mechanisms is performed in consideration of their dexterity and rigidity. It is expected that the optimization results can be effectively used as a basic material for the applications of the presented mechanisms to more industrial fields
Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator
Chen, Qingcheng; Zhu, Shiqiang; Zhang, Xuequn
2015-01-01
Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H) notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics...
Novel Door-opening Method for Six-legged Robots Based on Only Force Sensing
Chen, Zhi-Jun; Gao, Feng; Pan, Yang
2017-09-01
Current door-opening methods are mainly developed on tracked, wheeled and biped robots by applying multi-DOF manipulators and vision systems. However, door-opening methods for six-legged robots are seldom studied, especially using 0-DOF tools to operate and only force sensing to detect. A novel door-opening method for six-legged robots is developed and implemented to the six-parallel-legged robot. The kinematic model of the six-parallel-legged robot is established and the model of measuring the positional relationship between the robot and the door is proposed. The measurement model is completely based on only force sensing. The real-time trajectory planning method and the control strategy are designed. The trajectory planning method allows the maximum angle between the sagittal axis of the robot body and the normal line of the door plane to be 45º. A 0-DOF tool mounted to the robot body is applied to operate. By integrating with the body, the tool has 6 DOFs and enough workspace to operate. The loose grasp achieved by the tool helps release the inner force in the tool. Experiments are carried out to validate the method. The results show that the method is effective and robust in opening doors wider than 1 m. This paper proposes a novel door-opening method for six-legged robots, which notably uses a 0-DOF tool and only force sensing to detect and open the door.
Zhang, Quan; Li, Chaodong; Zhang, Jiantao; Zhang, Xu
2017-11-01
The macro-micro combined approach, as an effective way to realize trans-scale nano-precision positioning with multi-dimensions and high velocity, plays a significant role in integrated circuit manufacturing field. A 3-degree-of-freedoms (3-DOFs) macro-micro manipulator is designed and analyzed to compromise the conflictions among the large stroke, high precision and multi-DOFs. The macro manipulator is a 3-Prismatic-Revolute-Revolute (3-PRR) structure parallel manipulator which is driven by three linear ultrasonic motors. The dynamic model and the cross-coupling error based synchronized motion controller of the 3-PRR parallel manipulator are theoretical analyzed and experimental tested. To further improve the positioning accuracy, a 3-DOFs monolithic compliant manipulator actuated by three piezoelectric stack actuators is designed. Then a multilayer BP neural network based inverse kinematic model identifier is developed to perform the positioning control. Finally, by forming the macro-micro structure, the dual stage manipulator successfully achieved the positioning task from the point (2 mm, 2 mm, 0 rad) back to the original point (0 mm, 0 mm, 0 rad) with the translation errors in X and Y directions less than ±50 nm and the rotation error around Z axis less than ±1 μrad, respectively.
Kinematics and optimization of 2-DOF parallel manipulator with revolute actuators and a passive leg
International Nuclear Information System (INIS)
Nam, Yun Joo; Park, Myeong Kwan
2006-01-01
In this paper, a 2-DOF planar parallel manipulator with two revolute actuators and one passive constraining leg. The kinematic analysis of the mechanism is analytically performed : the inverse and forward kinematics problems are solved in closed forms, the workspace is derived systematically, and the three kinds of singular configurations are found. The optimal design to determine the geometric parameters and the operating limits of the actuated legs is performed considering the kinematic manipulability and workspace size. These results of the paper show the effectiveness of the presented manipulator
Modeling and controller design of a 6-DOF precision positioning system
Cai, Kunhai; Tian, Yanling; Liu, Xianping; Fatikow, Sergej; Wang, Fujun; Cui, Liangyu; Zhang, Dawei; Shirinzadeh, Bijan
2018-05-01
A key hurdle to meet the needs of micro/nano manipulation in some complex cases is the inadequate workspace and flexibility of the operation ends. This paper presents a 6-degree of freedom (DOF) serial-parallel precision positioning system, which consists of two compact type 3-DOF parallel mechanisms. Each parallel mechanism is driven by three piezoelectric actuators (PEAs), guided by three symmetric T-shape hinges and three elliptical flexible hinges, respectively. It can extend workspace and improve flexibility of the operation ends. The proposed system can be assembled easily, which will greatly reduce the assembly errors and improve the positioning accuracy. In addition, the kinematic and dynamic model of the 6-DOF system are established, respectively. Furthermore, in order to reduce the tracking error and improve the positioning accuracy, the Discrete-time Model Predictive Controller (DMPC) is applied as an effective control method. Meanwhile, the effectiveness of the DMCP control method is verified. Finally, the tracking experiment is performed to verify the tracking performances of the 6-DOF stage.
Static balancing of a spatial six-degree-of-freedom decoupling parallel mechanism
International Nuclear Information System (INIS)
Gao, Taoran Liu; Zhao, Xianchao; Qi, Chenkun
2014-01-01
The static balancing of a spatial 6-degree-of-freedom (6-DoF) decoupling parallel mechanism is discussed in this paper. Two traditional approaches (using counterweights and the springs) are used to statically balance the mechanism. Due to the existence of their shortcomings, a hybrid approach is proposed based on the static balancing of the mechanism. The main feature of this mechanism is that the 3-DoF rotating part can be static balancing itself, which means that its mass has no effect on the gravity balancing of the system, for any configuration of the mechanism, so the rotating part can be considered as a whole and the calculation is simplified. Finally, examples and dynamic analysis corresponding to the three balancing methods are given to illustrate the results.
Towards holonomic electro-elastomer actuators with six degrees of freedom
International Nuclear Information System (INIS)
Conn, A T; Rossiter, J
2012-01-01
Functionally efficient six degree of freedom (DOF) actuators have not yet been developed in a scale-invariant and inherently compliant unified form. This has primarily been due to the use of conventional serial or parallel kinematical configurations and electromagnetic motors, pneumatics and hydraulics. Contrary to traditional technologies, utilizing electro-active elastomers enables multi-DOF actuation and holonomic operation with minimal structural complexity. Conical dielectric elastomer actuators (DEAs) are compact multi-DOF actuator–sensors that are scalable and can be entirely polymeric, making them suitable for a variety of applications including minimally invasive medical devices. In this paper, cone DEAs are developed towards integrated 6-DOF actuation with muscle-like performance from a single structure. This is achieved by demonstrating the feasibility of holonomic 6-DOF actuation and through experimental characterization of a 5-DOF prototype. The 5-DOF prototype (50 mm length, 60 mm diameter) produced rotational actuation outputs of ±21.7° and ±9.42 mN m and linear actuation outputs of ±4.45 mm (±9.1%) and ±0.55 N. Finally, combined multi-DOF actuation is demonstrated as part of development towards scalable holonomic electro-active elastomer actuators. (paper)
Towards holonomic electro-elastomer actuators with six degrees of freedom
Conn, A. T.; Rossiter, J.
2012-03-01
Functionally efficient six degree of freedom (DOF) actuators have not yet been developed in a scale-invariant and inherently compliant unified form. This has primarily been due to the use of conventional serial or parallel kinematical configurations and electromagnetic motors, pneumatics and hydraulics. Contrary to traditional technologies, utilizing electro-active elastomers enables multi-DOF actuation and holonomic operation with minimal structural complexity. Conical dielectric elastomer actuators (DEAs) are compact multi-DOF actuator-sensors that are scalable and can be entirely polymeric, making them suitable for a variety of applications including minimally invasive medical devices. In this paper, cone DEAs are developed towards integrated 6-DOF actuation with muscle-like performance from a single structure. This is achieved by demonstrating the feasibility of holonomic 6-DOF actuation and through experimental characterization of a 5-DOF prototype. The 5-DOF prototype (50 mm length, 60 mm diameter) produced rotational actuation outputs of ±21.7° and ±9.42 mN m and linear actuation outputs of ±4.45 mm (±9.1%) and ±0.55 N. Finally, combined multi-DOF actuation is demonstrated as part of development towards scalable holonomic electro-active elastomer actuators.
Spacecraft attitude maneuver control using two parallel mounted 3-DOF spherical actuators
Directory of Open Access Journals (Sweden)
Guidan Li
2017-02-01
Full Text Available A parallel configuration using two 3-degree-of-freedom (3-DOF spherical electromagnetic momentum exchange actuators is investigated for large angle spacecraft attitude maneuvers. First, the full dynamic equations of motion for the spacecraft system are derived by the Newton-Euler method. To facilitate computation, virtual gimbal coordinate frames are established. Second, a nonlinear control law in terms of quaternions is developed via backstepping method. The proposed control law compensates the coupling torques arising from the spacecraft rotation, and is robust against the external disturbances. Then, the singularity problem is analyzed. To avoid singularities, a modified weighed Moore-Pseudo inverse velocity steering law based on null motion is proposed. The weighted matrices are carefully designed to switch the actuators and redistribute the control torques. The null motion is used to reorient the rotor away from the tilt angle saturation state. Finally, numerical simulations of rest-to-rest maneuvers are performed to validate the effectiveness of the proposed method.
O'Hara, John M.
1987-01-01
Two studies were conducted evaluating methods of controlling a telerobot; bilateral force reflecting master controllers and proportional rate six degrees of freedom (DOF) hand controllers. The first study compared the controllers on performance of single manipulator arm tasks, a peg-in-the-hole task, and simulated satellite orbital replacement unit changeout. The second study, a Space Station truss assembly task, required simultaneous operation of both manipulator arms (all 12 DOFs) and complex multiaxis slave arm movements. Task times were significantly longer and fewer errors were committed with the hand controllers. The hand controllers were also rated significantly higher in cognitive and manual control workload on the two-arm task. The master controllers were rated significantly higher in physical workload. There were no significant differences in ratings of manipulator control quality.
Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica).
Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi
2017-01-01
Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Measurement of six-degree-of-freedom planar motions by using a multiprobe surface encoder
Li, Xinghui; Shimizu, Yuki; Ito, Takeshi; Cai, Yindi; Ito, So; Gao, Wei
2014-12-01
A multiprobe surface encoder for optical metrology of six-degree-of-freedom (six-DOF) planar motions is presented. The surface encoder is composed of an XY planar scale grating with identical microstructures in X- and Y-axes and an optical sensor head. In the optical sensor head, three paralleled laser beams were used as laser probes. After being divided by a beam splitter, the three laser probes were projected onto the scale grating and a reference grating with identical microstructures, respectively. For each probe, the first-order positive and negative diffraction beams along the X- and Y-directions from the scale grating and from the reference grating superimposed with each other and four pieces of interference signals were generated. Three-DOF translational motions of the scale grating Δx, Δy, and Δz can be obtained simultaneously from the interference signals of each probe. Three-DOF angular error motions θX, θY, and θZ can also be calculated simultaneously from differences of displacement output variations and the geometric relationship among the three probes. A prototype optical sensor head was designed, constructed, and evaluated. Experimental results verified that this surface encoder could provide measurement resolutions of subnanometer and better than 0.1 arc sec for three-DOF translational motions and three-DOF angular error motions, respectively.
BALCO 6/7-DoF trajectory model
Wey, P.; Corriveau, D.; Saitz, T.A.; Ruijter, W. de; Strömbäck, P.
2016-01-01
BALCO is a six- and seven-degree-of-freedom trajectory simulation program based on the mathematical model defined by the NATO Standardization Recommendation 4618. The primary goal of BALCO is to compute high-fidelity trajectories for both conventional and precision-guided projectiles. The 6-DoF
Directory of Open Access Journals (Sweden)
Xiang Chen
2014-01-01
Full Text Available This paper presents a comparison study of two important three-degree-of-freedom (DOF parallel manipulators, the Sprint Z3 head and the A3 head, both commonly used in industry. As an initial step, the inverse kinematics are derived and an analysis of two classes of limbs is carried out via screw theory. For comparison, three transmission indices are then defined to describe their motion/force transmission performance. Based on the same main parameters, the compared results reveal some distinct characteristics in addition to the similarities between the two parallel manipulators. To a certain extent, the A3 head outperforms the common Sprint Z3 head, providing a new and satisfactory option for a machine tool head in industry.
The LET Procedure for Prosthetic Myocontrol: Towards Multi-DOF Control Using Single-DOF Activations.
Directory of Open Access Journals (Sweden)
Markus Nowak
Full Text Available Simultaneous and proportional myocontrol of dexterous hand prostheses is to a large extent still an open problem. With the advent of commercially and clinically available multi-fingered hand prostheses there are now more independent degrees of freedom (DOFs in prostheses than can be effectively controlled using surface electromyography (sEMG, the current standard human-machine interface for hand amputees. In particular, it is uncertain, whether several DOFs can be controlled simultaneously and proportionally by exclusively calibrating the intended activation of single DOFs. The problem is currently solved by training on all required combinations. However, as the number of available DOFs grows, this approach becomes overly long and poses a high cognitive burden on the subject. In this paper we present a novel approach to overcome this problem. Multi-DOF activations are artificially modelled from single-DOF ones using a simple linear combination of sEMG signals, which are then added to the training set. This procedure, which we named LET (Linearly Enhanced Training, provides an augmented data set to any machine-learning-based intent detection system. In two experiments involving intact subjects, one offline and one online, we trained a standard machine learning approach using the full data set containing single- and multi-DOF activations as well as using the LET-augmented data set in order to evaluate the performance of the LET procedure. The results indicate that the machine trained on the latter data set obtains worse results in the offline experiment compared to the full data set. However, the online implementation enables the user to perform multi-DOF tasks with almost the same precision as single-DOF tasks without the need of explicitly training multi-DOF activations. Moreover, the parameters involved in the system are statistically uniform across subjects.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...
A 6-DOF parallel bone-grinding robot for cervical disc replacement surgery.
Tian, Heqiang; Wang, Chenchen; Dang, Xiaoqing; Sun, Lining
2017-12-01
Artificial cervical disc replacement surgery has become an effective and main treatment method for cervical disease, which has become a more common and serious problem for people with sedentary work. To improve cervical disc replacement surgery significantly, a 6-DOF parallel bone-grinding robot is developed for cervical bone-grinding by image navigation and surgical plan. The bone-grinding robot including mechanical design and low level control is designed. The bone-grinding robot navigation is realized by optical positioning with spatial registration coordinate system defined. And a parametric robot bone-grinding plan and high level control have been developed for plane grinding for cervical top endplate and tail endplate grinding by a cylindrical grinding drill and spherical grinding for two articular surfaces of bones by a ball grinding drill. Finally, the surgical flow for a robot-assisted cervical disc replacement surgery procedure is present. The final experiments results verified the key technologies and performance of the robot-assisted surgery system concept excellently, which points out a promising clinical application with higher operability. Finally, study innovations, study limitations, and future works of this present study are discussed, and conclusions of this paper are also summarized further. This bone-grinding robot is still in the initial stage, and there are many problems to be solved from a clinical point of view. Moreover, the technique is promising and can give a good support for surgeons in future clinical work.
Kim, Hyungsae
2010-10-05
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong
2010-01-01
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
TH-AB-202-11: Spatial and Rotational Quality Assurance of 6DOF Patient Tracking Systems
Energy Technology Data Exchange (ETDEWEB)
Belcher, AH; Liu, X; Grelewicz, Z; Wiersma, R [The University of Chicago, Chicago, IL (United States)
2016-06-15
Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations (6DOF). In this work, we develop a novel technique to evaluate the 6DOF performance of external motion tracking systems. We apply this methodology to an infrared (IR) marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to follow input trajectories with sub-millimeter and sub-degree accuracy. The 6DOF positions of the robotic system were then tracked and recorded independently by three optical camera systems. A calibration methodology which associates the motion phantom and camera coordinate frames was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20×20×16 mm and 5×5×5 degree workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the IR marker tracking system to have maximal root mean square error (RMSE) values of 0.25 mm translationally and 0.09 degrees rotationally, in any one axis, comparing intended 6DOF positions to positions measured by the IR camera. The 6DOF RSME discrepancy for the first 3D optical surface tracking unit yielded maximal values of 0.60 mm and 0.11 degrees over the same 6DOF volume. An earlier generation 3D optical surface tracker was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.74 mm and 0.28 degrees within the same 6DOF evaluation space. Conclusion: The proposed technique was effective at evaluating the performance of 6DOF patient tracking systems. All systems examined exhibited tracking capabilities at the sub-millimeter and sub-degree level within a 6DOF workspace.
Towards frameless maskless SRS through real-time 6DoF robotic motion compensation
Belcher, Andrew H.; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D.
2017-12-01
Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient’s skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system’s effectiveness in maintaining the target’s 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system’s effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system’s success with volunteers has demonstrated its capability for implementation with frameless and
Towards frameless maskless SRS through real-time 6DoF robotic motion compensation.
Belcher, Andrew H; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D
2017-11-13
Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient's skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system's effectiveness in maintaining the target's 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system's effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system's success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS
Kinematics analysis of a novel planar parallel manipulator with kinematic redundancy
Energy Technology Data Exchange (ETDEWEB)
Qu, Haibo; Guo, Sheng [Beijing Jiaotong University, Beijing (China)
2017-04-15
In this paper, a novel planar parallel manipulator with kinematic redundancy is proposed. First, the Degrees of freedom (DOF) of the whole parallel manipulator and the Relative DOF (RDOF) between the moving platform and fixed base are studied. The results indicate that the proposed mechanism is kinematically redundant. Then, the kinematics, Jacobian matrices and workspace of this proposed parallel manipulator with kinematic redundancy are analyzed. Finally, the statics simulation of the proposed parallel manipulator is performed. The obtained stress and displacement distribution can be used to determine the easily destroyed place in the mechanism configurations.
Kinematics analysis of a novel planar parallel manipulator with kinematic redundancy
International Nuclear Information System (INIS)
Qu, Haibo; Guo, Sheng
2017-01-01
In this paper, a novel planar parallel manipulator with kinematic redundancy is proposed. First, the Degrees of freedom (DOF) of the whole parallel manipulator and the Relative DOF (RDOF) between the moving platform and fixed base are studied. The results indicate that the proposed mechanism is kinematically redundant. Then, the kinematics, Jacobian matrices and workspace of this proposed parallel manipulator with kinematic redundancy are analyzed. Finally, the statics simulation of the proposed parallel manipulator is performed. The obtained stress and displacement distribution can be used to determine the easily destroyed place in the mechanism configurations
Kozić, Ružica; Meštrić, Lucija
2013-01-01
Projekt studentske radionice bio je kontrola DOF-a u mjerilu 1:2000 na području općine Đurđevac. Proveden je terenski dio kontrole točnosti DMR-a, DOF-a, izvedene signalizacije te načina signalizacije. Mjerenja su obavljena 19.travnja 2013. godine. Obavljena je ponovna izmjera GPS točaka homogenog polja Đurđevac RTK metodom u sustavu CROPOS s ciljem kontrole tih točaka, čije su koordinate već određene u sklopu izrade DOF2. Uz trajno stabilizirane točke homogenog polja, RTK metodom snimane su ...
Development of an Underactuated 2-DOF Wrist Joint using McKibben PAMs
Rajagopal, S. P.; Jain, S.; Ramasubramanian, S. N.; Johnson, B. V.; Dwivedy, S. K.
2014-10-01
In this work, model of an underactuated 2-DOF wrist joint with pneumatically actuated muscles is proposed. For the joint, McKibben-type artificial muscles are used in parallel configuration for the actuation. For each Degree of Freedom (DOF) one agonist-antagonist pair arrangement is usually used with a pulley mechanism. A mathematical model of wrist joint is derived using conventional forward kinematic analysis. The static model relating pressure in the muscle with the orientation of the wrist joint is obtained by combining the experimental data and mathematical model. Regulation of pressure can be achieved by pulse width modulation control of on/off solenoid valves. A set of free vibration experiments are done for the dynamic identification of the muscle characteristics.
A six degrees of freedom mems manipulator
de Jong, B.R.
2006-01-01
This thesis reports about a six degrees of freedom (DOF) precision manipulator in MEMS, concerning concept generation for the manipulator followed by design and fabrication (of parts) of the proposed manipulation concept in MEMS. Researching the abilities of 6 DOF precision manipulation in MEMS is
Directory of Open Access Journals (Sweden)
Christos E. Syrseloudis
2011-01-01
Full Text Available The aim of this work is to propose a new 2-DOF robotic platform with hybrid parallel-serial structure and to undertake its parametric design so that it can follow the whole range of ankle related foot movements. This robot can serve as a human ankle rehabilitation device. The existing ankle rehabilitation devices present typically one or more of the following shortcomings: redundancy, large size, or high cost, hence the need for a device that could offer simplicity, modularity, and low cost of construction and maintenance. In addition, our targeted device must be safe during operation, disallow undesirable movements of the foot, while adaptable to any human foot. Our detailed study of foot kinematics has led us to a new hybrid architecture, which strikes a balance among all aforementioned goals. It consists of a passive serial kinematics chain with two adjustable screws so that the axes of the chain match the two main ankle-axes of typical feet. An active parallel chain, which consists of two prismatic actuators, provides the movement of the platform. Thus, the platform can follow the foot movements, thanks to the passive chain, and also possesses the advantages of parallel robots, including rigidity, high stiffness and force capabilities. The lack of redundancy yields a simpler device with lower size and cost. The paper describes the kinematics modelling of the platform and analyses the force and velocity transmission. The parametric design of the platform is carried out; our simulations confirm the platform's suitability for ankle rehabilitation.
TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study
Energy Technology Data Exchange (ETDEWEB)
Belcher, AH; Liu, X; Wiersma, R [The University of Chicago, Chicago, IL (United States)
2016-06-15
Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning
TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study
International Nuclear Information System (INIS)
Belcher, AH; Liu, X; Wiersma, R
2016-01-01
Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning
Directory of Open Access Journals (Sweden)
Zhihua Liu
2013-01-01
Full Text Available The first adjustable feed support system in FAST is a six-cable-driven parallel manipulator. Due to flexibility of the cables, the cable-driven parallel manipulator bears a concern of possible vibration caused by wind disturbance or internal force from the fine drive system. The purpose of this paper is to analyze vibration characteristic of the six-cable-driven parallel manipulator in FAST. The tension equilibrium equation of the six-cable-driven parallel manipulator is set up regarding the cables as catenaries. Then, vibration equation is established considering the longitudinal vibration of the cables. On this basis, the natural frequencies are depicted in figures since both analytical and numerical solutions are ineffective. Influence of the sags of the cables on the natural frequencies is discussed. It is shown that the sags of the cables will decrease the natural frequencies of the six-cable-driven parallel manipulator. Simplification to acquire the natural frequencies is proposed in this paper. The results justify effectiveness of the simplification to calculate the first-order natural frequencies. Distribution of the first-order natural frequencies in the required workspace is provided based on the simplification method. Finally, parameters optimization is implemented in terms of natural frequencies for building the six-cable-driven parallel manipulator in FAST.
Directory of Open Access Journals (Sweden)
Hernando-Amado Sara
2012-11-01
Full Text Available Abstract Background Transcription factors (TFs are proteins that have played a central role both in evolution and in domestication, and are major regulators of development in living organisms. Plant genome sequences reveal that approximately 7% of all genes encode putative TFs. The DOF (DNA binding with One Finger TF family has been associated with vital processes exclusive to higher plants and to their close ancestors (algae, mosses and ferns. These are seed maturation and germination, light-mediated regulation, phytohormone and plant responses to biotic and abiotic stresses, etc. In Hordeum vulgare and Oryza sativa, 26 and 30 different Dof genes, respectively, have been annotated. Brachypodium distachyon has been the first Pooideae grass to be sequenced and, due to its genomic, morphological and physiological characteristics, has emerged as the model system for temperate cereals, such as wheat and barley. Results Through searches in the B. distachyon genome, 27 Dof genes have been identified and a phylogenetic comparison with the Oryza sativa and the Hordeum vulgare DOFs has been performed. To explore the evolutionary relationship among these DOF proteins, a combined phylogenetic tree has been constructed with the Brachypodium DOFs and those from rice and barley. This phylogenetic analysis has classified the DOF proteins into four Major Cluster of Orthologous Groups (MCOGs. Using RT-qPCR analysis the expression profiles of the annotated BdDof genes across four organs (leaves, roots, spikes and seeds has been investigated. These results have led to a classification of the BdDof genes into two groups, according to their expression levels. The genes highly or preferentially expressed in seeds have been subjected to a more detailed expression analysis (maturation, dry stage and germination. Conclusions Comparison of the expression profiles of the Brachypodium Dof genes with the published functions of closely related DOF sequences from the cereal
Structural Design of a 6-DoF Hip Exoskeleton using Linear Series Elastic Actuators
Li, Xiao
2017-01-01
A novel hip exoskeleton with six degrees of freedom (DoF) was developed, and multiple prototypes of this product were created in this thesis. The device was an upper level of the 12-DoF lower-body exoskeleton project, which was known as the Orthotic Lower-body Locomotion Exoskeleton (OLL-E). The hip exoskeleton had three motions per leg, which were roll, yaw, and pitch. Currently, the sufferers of hemiplegia and paraplegia can be addressed by using a wheelchair or operating an exoskeleton wi...
Kinematic Analysis and Performance Evaluation of Novel PRS Parallel Mechanism
Balaji, K.; Khan, B. Shahul Hamid
2018-02-01
In this paper, a 3 DoF (Degree of Freedom) novel PRS (Prismatic-Revolute- Spherical) type parallel mechanisms has been designed and presented. The combination of striaght and arc type linkages for 3 DOF parallel mechanism is introduced for the first time. The performances of the mechanisms are evaluated based on the indices such as Minimum Singular Value (MSV), Condition Number (CN), Local Conditioning Index (LCI), Kinematic Configuration Index (KCI) and Global Conditioning Index (GCI). The overall reachable workspace of all mechanisms are presented. The kinematic measure, dexterity measure and workspace analysis for all the mechanism have been evaluated and compared.
Energy Technology Data Exchange (ETDEWEB)
Yoon, Jung Won; Hwang, Yoon Kwon [Gyeongsang National University, Jinju (Korea, Republic of); Ryu, Je Ha [Gwangju Institute of Science and Technology, Gwangju (Korea, Republic of)
2010-05-15
This paper proposes an optimum design method that satisfies the desired orientation workspace at the boundary of the translation workspace while maximizing the mechanism isotropy for parallel manipulators. A simple genetic algorithm is used to obtain the optimal linkage parameters of a six-degree-of-freedom parallel manipulator that can be used as a haptic device. The objective function is composed of a desired spherical shape translation workspace and a desired orientation workspace located on the boundaries of the desired translation workspace, along with a global conditioning index based on a homogeneous Jacobian matrix. The objective function was optimized to satisfy the desired orientation workspace at the boundary positions as translated from a neutral position of the increased entropy mechanism. An optimization result with desired translation and orientation workspaces for a haptic device was obtained to show the effectiveness of the suggested scheme, and the kinematic performances of the proposed model were compared with those of a preexisting base model
International Nuclear Information System (INIS)
Yoon, Jung Won; Hwang, Yoon Kwon; Ryu, Je Ha
2010-01-01
This paper proposes an optimum design method that satisfies the desired orientation workspace at the boundary of the translation workspace while maximizing the mechanism isotropy for parallel manipulators. A simple genetic algorithm is used to obtain the optimal linkage parameters of a six-degree-of-freedom parallel manipulator that can be used as a haptic device. The objective function is composed of a desired spherical shape translation workspace and a desired orientation workspace located on the boundaries of the desired translation workspace, along with a global conditioning index based on a homogeneous Jacobian matrix. The objective function was optimized to satisfy the desired orientation workspace at the boundary positions as translated from a neutral position of the increased entropy mechanism. An optimization result with desired translation and orientation workspaces for a haptic device was obtained to show the effectiveness of the suggested scheme, and the kinematic performances of the proposed model were compared with those of a preexisting base model
Techniques applied in design optimization of parallel manipulators
CSIR Research Space (South Africa)
Modungwa, D
2011-11-01
Full Text Available the desired dexterous workspace " Robot.Comput.Integrated Manuf., vol. 23, pp. 38 - 46, 2007. [12] A.P. Murray, F. Pierrot, P. Dauchez and J.M. McCarthy, "A planar quaternion approach to the kinematic synthesis of a parallel manipulator " Robotica, vol... design of a three translational DoFs parallel manipulator " Robotica, vol. 24, pp. 239, 2005. [15] J. Angeles, "The robust design of parallel manipulators," in 1st Int. Colloquium, Collaborative Research Centre 562, 2002. [16] S. Bhattacharya, H...
Fast robot kinematics modeling by using a parallel simulator (PSIM)
International Nuclear Information System (INIS)
El-Gazzar, H.M.; Ayad, N.M.A.
2002-01-01
High-speed computers are strongly needed not only for solving scientific and engineering problems, but also for numerous industrial applications. Such applications include computer-aided design, oil exploration, weather predication, space applications and safety of nuclear reactors. The rapid development in VLSI technology makes it possible to implement time consuming algorithms in real-time situations. Parallel processing approaches can now be used to reduce the processing-time for models of very high mathematical structure such as the kinematics molding of robot manipulator. This system is used to construct and evaluate the performance and cost effectiveness of several proposed methods to solve the Jacobian algorithm. Parallelism is introduced to the algorithms by using different task-allocations and dividing the whole job into sub tasks. Detailed analysis is performed and results are obtained for the case of six DOF (degree of freedom) robot arms (Stanford Arm). Execution times comparisons between Von Neumann (uni processor) and parallel processor architectures by using parallel simulator package (PSIM) are presented. The gained results are much in favour for the parallel techniques by at least fifty-percent improvements. Of course, further studies are needed to achieve the convenient and optimum number of processors has to be done
Fast robot kinematics modeling by using a parallel simulator (PSIM)
Energy Technology Data Exchange (ETDEWEB)
El-Gazzar, H M; Ayad, N M.A. [Atomic Energy Authority, Reactor Dept., Computer and Control Lab., P.O. Box no 13759 (Egypt)
2002-09-15
High-speed computers are strongly needed not only for solving scientific and engineering problems, but also for numerous industrial applications. Such applications include computer-aided design, oil exploration, weather predication, space applications and safety of nuclear reactors. The rapid development in VLSI technology makes it possible to implement time consuming algorithms in real-time situations. Parallel processing approaches can now be used to reduce the processing-time for models of very high mathematical structure such as the kinematics molding of robot manipulator. This system is used to construct and evaluate the performance and cost effectiveness of several proposed methods to solve the Jacobian algorithm. Parallelism is introduced to the algorithms by using different task-allocations and dividing the whole job into sub tasks. Detailed analysis is performed and results are obtained for the case of six DOF (degree of freedom) robot arms (Stanford Arm). Execution times comparisons between Von Neumann (uni processor) and parallel processor architectures by using parallel simulator package (PSIM) are presented. The gained results are much in favour for the parallel techniques by at least fifty-percent improvements. Of course, further studies are needed to achieve the convenient and optimum number of processors has to be done.
Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil
2014-08-10
In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In
A novel integrated 4-DOF radial hybrid magnetic bearing for MSCMG
Energy Technology Data Exchange (ETDEWEB)
Jinji, Sun; Ziyan, Ju [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China); Weitao, Han, E-mail: hanweitaotao@163.com [CRRC Qingdao Sifang CO., LTD, Qingdao 266111 (China); Gang, Liu [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China)
2017-01-01
This paper proposes a novel integrated radial hybrid magnetic bearing (RHMB) for application with the small-sized magnetically suspended control moment gyroscope (MSCMG), which can control four degrees of freedom (4-DOFs), including two radial translational DOFs and two radial tilting DOFs, and provide the axial passive resilience. The configuration and working principle of the RHMB are introduced. Mathematical models of radial force, axial resilience and moment are established by using equivalent magnetic circuit method (EMCM), from which the radial force–radial displacement, radial force–current relationships are derived, as well as axial resilience–axial displacement, moment–tilting angle and moment–current. Finite element method (FEM) is also applied to analyze the performance and characteristics of the RHMB. The analysis results are in good agreement with that calculated by the EMCM, which is helpful in designing, optimizing and controlling the RHMB. The comparisons between the performances of the integrated 4-DOF RHMB and the traditional 4-DOF RHMB are made. The contrast results indicate that the proposed integrated 4-DOF RHMB possesses better performance compared to the traditional structure, such as copper loss, current stiffness, and tilting current stiffness. - Highlights: • An integrated 4-DOF RHMB is proposed for the small-sized MSCMG. • The 4-DOF RHMB has good linear force–displacement and force–current characteristics. • The RHMB has good linear moment–current and the moment–tilting angle characteristic.
Directory of Open Access Journals (Sweden)
Yao Jiang
2017-06-01
Full Text Available The output and input coupling characteristics of the compliant parallel mechanism (CPM bring difficulty in the motion control and challenge its high performance and operational safety. This paper presents a systematic design method for a 2-degrees-of-freedom (DOFs CPM with excellent decoupling performance. A symmetric kinematic structure can guarantee a CPM with a complete output decoupling characteristic; input coupling is reduced by resorting to a flexure-based decoupler. This work discusses the stiffness design requirement of the decoupler and proposes a compound flexure hinge as its basic structure. Analytical methods have been derived to assess the mechanical performances of the CPM in terms of input and output stiffness, motion stroke, input coupling degree, and natural frequency. The CPM’s geometric parameters were optimized to minimize the input coupling while ensuring key performance indicators at the same time. The optimized CPM’s performances were then evaluated by using a finite element analysis. Finally, a prototype was constructed and experimental validations were carried out to test the performance of the CPM and verify the effectiveness of the design method. The design procedure proposed in this paper is systematic and can be extended to design the CPMs with other types of motion.
Parallel Implicit Runge-Kutta Methods Applied to Coupled Orbit/Attitude Propagation
Hatten, Noble; Russell, Ryan P.
2017-12-01
A variable-step Gauss-Legendre implicit Runge-Kutta (GLIRK) propagator is applied to coupled orbit/attitude propagation. Concepts previously shown to improve efficiency in 3DOF propagation are modified and extended to the 6DOF problem, including the use of variable-fidelity dynamics models. The impact of computing the stage dynamics of a single step in parallel is examined using up to 23 threads and 22 associated GLIRK stages; one thread is reserved for an extra dynamics function evaluation used in the estimation of the local truncation error. Efficiency is found to peak for typical examples when using approximately 8 to 12 stages for both serial and parallel implementations. Accuracy and efficiency compare favorably to explicit Runge-Kutta and linear-multistep solvers for representative scenarios. However, linear-multistep methods are found to be more efficient for some applications, particularly in a serial computing environment, or when parallelism can be applied across multiple trajectories.
Patanè, Fabrizio; Cappa, Paolo
2011-04-01
In this paper a novel electrically actuated parallel robot with three degrees-of-freedom (3 DOF) for dynamic postural studies is presented. The design has been described, the solution to the inverse kinematics has been found, and a numerical solution for the direct kinematics has been proposed. The workspace of the implemented robot is characterized by an angular range of motion of about ±10° for roll and pitch when yaw is in the range ±15°. The robot was constructed and the orientation accuracy was tested by means of an optoelectronic system and by imposing a sinusoidal input, with a frequency of 1 Hz and amplitude of 10°, along the three axes, in sequence. The collected data indicated a phase delay of 1° and an amplitude error of 0.5%-1.5%; similar values were observed for cross-axis sensitivity errors. We also conducted a clinical application on a group of normal subjects, who were standing in equilibrium on the robot base with eyes open (EO) and eyes closed (EC), which was rotated with a tri-axial sinusoidal trajectory with a frequency of 0.5 Hz and amplitude 5° for roll and pitch and 10° for the yaw. The postural configuration of the subjects was recorded with an optoelectronic system. However, due to the mainly technical nature of this paper, only initial validation outcomes are reported here. The clinical application showed that only the tilt and displacement on the sagittal pane of head, trunk, and pelvis in the trials conducted with eyes closed were affected by drift and that the reduction of the yaw rotation and of the mediolateral translation was not a controlled parameter, as happened, instead, for the other anatomical directions.
A general approach for optimal kinematic design of 6-DOF parallel ...
Indian Academy of Sciences (India)
Optimal kinematic design of parallel manipulators is a challenging problem. In this work, an attempt has been made to present a generalized approach of kinematic design for a 6-legged parallel manipulator, by considering only the minimally required design parameters. The same approach has been used to design a ...
Six-degree-of-freedom Sensor Fish design - Governing equations and motion modeling
Energy Technology Data Exchange (ETDEWEB)
Zeng, D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Richmond, M. C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Simmons, C. S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Carlson, T. J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)
2004-07-01
The Sensor Fish device is being used at Northwest hydropower projects to better understand the conditions fish experience during passage through hydro turbines and other dam bypass alternatives. Since its initial development in 1997, the Sensor Fish has undergone numerous design changes to improve its function and extend the range of its use. The most recent Sensor Fish design, the three degree of freedom (3DOF) device, has been used successfully to characterize the environment fish experience when passing through turbines, in spill, or in engineered fish bypass facilities at dams. Pacific Northwest National Laboratory (PNNL) is in the process of redesigning the current 3DOF Sensor Fish device package to improve its field performance. Rate gyros will be added to the new six degree of freedom (6DOF) device so that it will be possible to observe the six linear and angular accelerations of the Sensor Fish as it passes the dam. Before the 6DOF Sensor Fish device can be developed and deployed, governing equations of motion must be developed in order to understand the design implications of instrument selection and placement within the body of the device. The report describes a fairly general formulation for the coordinate systems, equations of motion, force and moment relationships necessary to simulate the 6DOF movement of an underwater body.
Energy Technology Data Exchange (ETDEWEB)
Kim, J [The University of Sydney, Sydney, New South Wales (Australia); Nguyen, D; O’Brien, R; Keall, P [University of Sydney, Sydney, NSW (Australia); Huang, C [Sydney Medical School, Camperdown (Australia); Caillet, V [The University of Sydney, Sydney, NSW (Australia); Poulsen, P [Aarhus University Hospital, Aarhus (Denmark); Booth, J [Royal North Shore Hospital, Sydney (Australia)
2016-06-15
Purpose: Kilovoltage intrafraction monitoring (KIM) scheme has been successfully used to simultaneously monitor 3D tumor motion during radiotherapy. Recently, an iterative closest point (ICP) algorithm was implemented in KIM to also measure rotations about three axes, enabling real-time tracking of tumor motion in six degrees-of-freedom (DoF). This study aims to evaluate the accuracy of the six DoF motion estimates of KIM by comparing it with the corresponding motion (i) measured by the Calypso; and (ii) derived from kV/MV triangulation. Methods: (i) Various motions (static and dynamic) were applied to a CIRS phantom with three embedded electromagnetic transponders (Calypso Medical) using a 5D motion platform (HexaMotion) and a rotating treatment couch while both KIM and Calypso were used to concurrently track the phantom motion in six DoF. (ii) KIM was also used to retrospectively estimate six DoF motion from continuous sets of kV projections of a prostate, implanted with three gold fiducial markers (2 patients with 80 fractions in total), acquired during the treatment. Corresponding motion was obtained from kV/MV triangulation using a closed form least squares method based on three markers’ positions. Only the frames where all three markers were present were used in the analysis. The mean differences between the corresponding motion estimates were calculated for each DoF. Results: Experimental results showed that the mean of absolute differences in six DoF phantom motion measured by Calypso and KIM were within 1.1° and 0.7 mm. kV/MV triangulation derived six DoF prostate tumor better agreed with KIM estimated motion with the mean (s.d.) difference of up to 0.2° (1.36°) and 0.2 (0.25) mm for rotation and translation, respectively. Conclusion: These results suggest that KIM can provide an accurate six DoF intrafraction tumor during radiotherapy.
Principle Research on a Single Mass Piezoelectric Six-Degrees-of-Freedom Accelerometer
Directory of Open Access Journals (Sweden)
Jingcheng Liu
2013-08-01
Full Text Available A signal mass piezoelectric six-degrees-of-freedom (six-DOF accelerometer is put forward in response to the need for health monitoring of the dynamic vibration characteristics of high grade digitally controlled machine tools. The operating principle of the piezoelectric six-degrees-of-freedom accelerometer is analyzed, and its structure model is constructed. The numerical simulation model (finite element model of the six axis accelerometer is established. Piezoelectric quartz is chosen for the acceleration sensing element and conversion element, and its static sensitivity, static coupling interference and dynamic natural frequency, dynamic cross coupling are analyzed by ANSYS software. Research results show that the piezoelectric six-DOF accelerometer has advantages of simple and rational structure, correct sensing principle and mathematic model, good linearity, high rigidity, and theoretical natural frequency is more than 25 kHz, no nonlinear cross coupling and no complex decoupling work.
Effect of suspension kinematic on 14 DOF vehicle model
Wongpattananukul, T.; Chantharasenawong, C.
2017-12-01
Computer simulations play a major role in shaping modern science and engineering. They reduce time and resource consumption in new studies and designs. Vehicle simulations have been studied extensively to achieve a vehicle model used in minimum lap time solution. Simulation result accuracy depends on the abilities of these models to represent real phenomenon. Vehicles models with 7 degrees of freedom (DOF), 10 DOF and 14 DOF are normally used in optimal control to solve for minimum lap time. However, suspension kinematics are always neglected on these models. Suspension kinematics are defined as wheel movements with respect to the vehicle body. Tire forces are expressed as a function of wheel slip and wheel position. Therefore, the suspension kinematic relation is appended to the 14 DOF vehicle model to investigate its effects on the accuracy of simulate trajectory. Classical 14 DOF vehicle model is chosen as baseline model. Experiment data is collected from formula student style car test runs as baseline data for simulation and comparison between baseline model and model with suspension kinematic. Results show that in a single long turn there is an accumulated trajectory error in baseline model compared to model with suspension kinematic. While in short alternate turns, the trajectory error is much smaller. These results show that suspension kinematic had an effect on the trajectory simulation of vehicle. Which optimal control that use baseline model will result in inaccuracy control scheme.
Output Error Analysis of Planar 2-DOF Five-bar Mechanism
Niu, Kejia; Wang, Jun; Ting, Kwun-Lon; Tao, Fen; Cheng, Qunchao; Wang, Quan; Zhang, Kaiyang
2018-03-01
Aiming at the mechanism error caused by clearance of planar 2-DOF Five-bar motion pair, the method of equivalent joint clearance of kinematic pair to virtual link is applied. The structural error model of revolute joint clearance is established based on the N-bar rotation laws and the concept of joint rotation space, The influence of the clearance of the moving pair is studied on the output error of the mechanis. and the calculation method and basis of the maximum error are given. The error rotation space of the mechanism under the influence of joint clearance is obtained. The results show that this method can accurately calculate the joint space error rotation space, which provides a new way to analyze the planar parallel mechanism error caused by joint space.
Six-Degree-of-Freedom Sensor Fish Design: Governing Equations and Motion Modeling
Energy Technology Data Exchange (ETDEWEB)
Deng, Zhiqun; Richmond, Marshall C.; Simmons, Carver S.; Carlson, Thomas J.
2004-08-19
The Sensor Fish device is being used at Northwest hydropower projects to better understand the conditions fish experience during passage through hydroturbines and other dam bypass alternatives. Since its initial development in 1997, the Sensor Fish has undergone numerous design changes to improve its function and extend the range of its use. The most recent Sensor Fish design, the three degree of freedom (3DOF) device, has been used successfully to characterize the environment fish experience when passing through turbines, in spill, or in engineered fish bypass facilities at dams. Pacific Northwest National Laboratory (PNNL) is in the process of redesigning the current 3DOF Sensor Fish device package to improve its field performance. Rate gyros will be added to the new six degree of freedom (6DOF) device so that it will be possible to observe the six linear and angular accelerations of the Sensor Fish as it passes the dam. Before the 6DOF Sensor Fish device can be developed and deployed, governing equations of motion must be developed in order to understand the design implications of instrument selection and placement within the body of the device. In this report, we describe a fairly general formulation for the coordinate systems, equations of motion, force and moment relationships necessary to simulate the 6DOF movement of an underwater body. Some simplifications are made by considering the Sensor Fish device to be a rigid, axisymmetric body. The equations of motion are written in the body-fixed frame of reference. Transformations between the body-fixed and interial reference frames are performed using a formulation based on quaternions. Force and moment relationships specific to the Sensor Fish body are currently not available. However, examples of the trajectory simulations using the 6DOF equations are presented using existing low and high-Reynolds number force and moment correlations. Animation files for the test cases are provided in an attached CD. The next
Parallelization of mathematical library for generalized eigenvalue problem for real band matrices
International Nuclear Information System (INIS)
Tanaka, Yasuhisa.
1997-05-01
This research has focused on a parallelization of the mathematical library for a generalized eigenvalue problem for real band matrices on IBM SP and Hitachi SR2201. The origin of the library is LASO (Lanczos Algorithm with Selective Orthogonalization), which was developed on the basis of Block Lanczos method for standard eigenvalue problem for real band matrices at Texas University. We adopted D.O.F. (Degree Of Freedom) decomposition method for a parallelization of this library, and evaluated its parallel performance. (author)
Comparative study of 2-DOF micromirrors for precision light manipulation
Young, Johanna I.; Shkel, Andrei M.
2001-08-01
Many industry experts predict that the future of fiber optic telecommunications depends on the development of all-optical components for switching of photonic signals from fiber to fiber throughout the networks. MEMS is a promising technology for providing all-optical switching at high speeds with significant cost reductions. This paper reports on the the analysis of two designs for 2-DOF electrostatically actuated MEMS micromirrors for precision controllable large optical switching arrays. The behavior of the micromirror designs is predicted by coupled-field electrostatic and modal analysis using a finite element analysis (FEA) multi-physics modeling software. The analysis indicates that the commonly used gimbal type mirror design experiences electrostatic interference and would therefore be difficult to precisely control for 2-DOF motion. We propose a new design approach which preserves 2-DOF actuation while minimizing electrostatic interference between the drive electrodes and the mirror. Instead of using two torsional axes, we use one actuator which combines torsional and flexural DOFs. A comparative analysis of the conventional gimbal design and the one proposed in this paper is performed.
Position calibration of a 3-DOF hand-controller with hybrid structure
Zhu, Chengcheng; Song, Aiguo
2017-09-01
A hand-controller is a human-robot interactive device, which measures the 3-DOF (Degree of Freedom) position of the human hand and sends it as a command to control robot movement. The device also receives 3-DOF force feedback from the robot and applies it to the human hand. Thus, the precision of 3-DOF position measurements is a key performance factor for hand-controllers. However, when using a hybrid type 3-DOF hand controller, various errors occur and are considered originating from machining and assembly variations within the device. This paper presents a calibration method to improve the position tracking accuracy of hybrid type hand-controllers by determining the actual size of the hand-controller parts. By re-measuring and re-calibrating this kind of hand-controller, the actual size of the key parts that cause errors is determined. Modifying the formula parameters with the actual sizes, which are obtained in the calibrating process, improves the end position tracking accuracy of the device.
Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping
2009-11-01
DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Directory of Open Access Journals (Sweden)
Bin Liu
2014-01-01
Full Text Available It is pivotal to find an effective mathematical model revealing the galloping mechanism. And it is important to compare the difference between the existing mathematical models on the conductor galloping. In this paper, the continuum cable model for transmission lines was proposed using the Hamilton principle. Discrete models of one DOF, two DOFs, and three DOFs were derived from the continuum model by using the Garlekin method. And the three models were compared by analyzing the galloping vertical amplitude and torsional angle with different influence factors. The influence factors include wind velocity, flow density, span length, damping ratio, and initial tension. The three-DOF model is more accurate at calculating the galloping characteristics than the other two models, but the one-DOF and two-DOF models can also present the trend of galloping amplitude change from the point view of qualitative analysis. And the change of the galloping amplitude relative to the main factors was also obtained, which is very essential to the antigalloping design applied in the actual engineering.
Research of a New 6-Dof Force Feedback Hand Controller System
Directory of Open Access Journals (Sweden)
Xin Gao
2014-01-01
Full Text Available The field of teleoperation with force telepresence has expanded its scope to include manipulation at different scales and in virtual worlds, and the key component of which is force feedback hand controller. This paper presents a novel force feedback hand controller system, including a 3-dof translational and 3-dof rotational hand controllers, respectively, to implement position and posture teleoperation of the robot end effector. The 3-dof translational hand controller adopts innovative three-axes decoupling structure based on the linear motor; the 3-dof rotational hand controller adopts serial mechanism based on three-axes intersecting at one point, improving its overall stiffness. Based on the kinematics, statics, and dynamics analyses for two platforms separately, the system applies big closed-loop force control method based on the zero force/torque, improving the feedback force/torque accuracy effectively. Experimental results show that self-developed 6-dof force feedback hand controller has good mechanical properties. The translational hand controller has the following advantages: simple kinematics solver, fast dynamic response, and better than 0.05 mm accuracy of three-axis end positioning, while the advantages of the rotational hand controller are wide turning space, larger than 1 Nm feedback, greater than 180 degrees of operating space of three axes, respectively, and high operation precision.
Continuous path control of a 5-DOF parallel-serial hybrid robot
International Nuclear Information System (INIS)
Uchiyama, Takuma; Terada, Hidetsugu; Mitsuya, Hironori
2010-01-01
Using the 5-degree of freedom parallel-serial hybrid robot, to realize the de-burring, new forward and inverse kinematic calculation methods based on the 'off-line teaching' method are proposed. This hybrid robot consists of a parallel stage section and a serial stage section. Considering this point, each section is calculated individually. And the continuous path control algorithm of this hybrid robot is proposed. To verify the usefulness, a prototype robot is tested which is controlled based on the proposed methods. This verification includes a positioning test and a pose test. The positioning test evaluates the continuous path of the tool center point. The pose test evaluates the pose on the tool center point. As the result, it is confirmed that this hybrid robot moves correctly using the proposed methods
Xin Wang; Qiuzhi Song; Xiaoguang Wang; Pengzhan Liu
2018-01-01
The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF) upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parame...
Elastic Cube Actuator with Six Degrees of Freedom Output
Directory of Open Access Journals (Sweden)
Pengchuan Wang
2015-09-01
Full Text Available Unlike conventional rigid actuators, soft robotic technologies possess inherent compliance, so they can stretch and twist along every axis without the need for articulated joints. This compliance is exploited here using dielectric elastomer membranes to develop a novel six degrees of freedom (6-DOF polymer actuator that unifies ordinarily separate components into a simple cubic structure. This cube actuator design incorporates elastic dielectric elastomer membranes on four faces which are coupled by a cross-shaped end effector. The inherent elasticity of each membrane greatly reduces kinematic constraint and enables a 6-DOF actuation output to be produced via the end effector. An electro-mechanical model of the cube actuator is presented that captures the non-linear hyperelastic behaviour of the active membranes. It is demonstrated that the model accurately predicts actuator displacement and blocking moment for a range of input voltages. Experimental testing of a prototype 60 mm device demonstrates 6-DOF operation. The prototype produces maximum linear and rotational displacements of ±2.6 mm (±4.3% and ±4.8° respectively and a maximum blocking moment of ±76 mNm. The capacity for full 6-DOF actuation from a compact, readily scalable and easily fabricated polymeric package enables implementation in a range of mechatronics and robotics applications.
Application of 2DOF controller for reactor power control. Verification by numerical simulation
International Nuclear Information System (INIS)
Ishikawa, Nobuyuki; Suzuki, Katsuo
1996-09-01
In this report the usefulness of the two degree of freedom (2DOF) control is discussed to improve the reference response characteristics and robustness for reactor power control system. The 2DOF controller consists of feedforward and feedback elements. The feedforward element was designed by model matching method and the feedback element by solving the mixed sensitivity problem of H ∞ control. The 2DOF control gives good performance in both reference response and robustness to disturbance and plant perturbation. The simulation of reactor power control was performed by digitizing the 2DOF controller with the digital control periods of 10[msec]. It is found that the control period of 10[msec] is enough not to make degradation of the control performance by digitizing. (author)
Design and implementation of a 2-DOF PID compensation for magnetic levitation systems.
Ghosh, Arun; Rakesh Krishnan, T; Tejaswy, Pailla; Mandal, Abhisek; Pradhan, Jatin K; Ranasingh, Subhakant
2014-07-01
This paper employs a 2-DOF (degree of freedom) PID controller for compensating a physical magnetic levitation system. It is shown that because of having a feedforward gain in the proposed 2-DOF PID control, the transient performance of the compensated system can be changed in a desired manner unlike the conventional 1-DOF PID control. It is also shown that for a choice of PID parameters, although the theoretical loop robustness is the same for both the compensated systems, in real-time, 2-DOF PID control may provide superior robustness if a suitable choice of the feedforward parameter is made. The results are verified through simulations and experiments. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.
Development of 6-DOF painting robot control system
Huang, Junbiao; Liu, Jianqun; Gao, Weiqiang
2017-01-01
With the development of society, the spraying technology of manufacturing industry in China has changed from the manual operation to the 6-DOF (Degree Of Freedom)robot automatic spraying. Spraying painting robot can not only complete the work which does harm to human being, but also improve the production efficiency and save labor costs. Control system is the most critical part of the 6-DOF robots, however, there is still a lack of relevant technology research in China. It is very necessary to study a kind of control system of 6-DOF spraying painting robots which is easy to operation, and has high efficiency and stable performance. With Googol controller platform, this paper develops programs based on Windows CE embedded systems to control the robot to finish the painting work. Software development is the core of the robot control system, including the direct teaching module, playback module, motion control module, setting module, man-machine interface, alarm module, log module, etc. All the development work of the entire software system has been completed, and it has been verified that the entire software works steady and efficient.
On non-linear dynamics of coupled 1+1DOF versus 1+1/2DOF Electro-Mechanical System
DEFF Research Database (Denmark)
Darula, Radoslav; Sorokin, Sergey
2014-01-01
The electro-mechanical systems (EMS) are used from nano-/micro-scale (NEMS/MEMS) up to macro-scale applications. From mathematical view point, they are modelled with the second order differential equation (or a set of equations) for mechanical system, which is nonlinearly coupled with the second...... or the first order differential equation (or a set of equations) for electrical system, depending on properties of the electrical circuit. For the sake of brevity, we assume a 1DOF mechanical system, coupled to 1 or 1/2DOF electrical system (depending whether the capacitance is, or is not considered......). In the paper, authors perform a parametric study to identify operation regimes, where the capacitance term contributes to the non-linear behaviour of the coupled system. To accomplish this task, the classical method of multiple scales is used. The parametric study allows us to assess for which applications...
Design of a 3-DOF Parallel Hand-Controller
Directory of Open Access Journals (Sweden)
Chengcheng Zhu
2017-01-01
Full Text Available Hand-controllers, as human-machine-interface (HMI devices, can transfer the position information of the operator’s hands into the virtual environment to control the target objects or a real robot directly. At the same time, the haptic information from the virtual environment or the sensors on the real robot can be displayed to the operator. It helps human perceive haptic information more truly with feedback force. A parallel hand-controller is designed in this paper. It is simplified from the traditional delta haptic device. The swing arms in conventional delta devices are replaced with the slider rail modules. The base consists of two hexagons and several links. For the use of the linear sliding modules instead of swing arms, the arc movement is replaced by linear movement. So that, the calculating amount of the position positive solution and the force inverse solution is reduced for the simplification of the motion. The kinematics, static mechanics, and dynamic mechanics are analyzed in this paper. What is more, two demonstration applications are developed to verify the performance of the designed hand-controller.
Design of a novel 6-DOF planar maglev system
International Nuclear Information System (INIS)
Lai, Y.-C.; Yen, J.-Y.
2006-01-01
This paper describes a novel single-deck and six degree-of-freedom (DOF) planar maglev positioning system design. The proposed design uses an array of solenoids to levitate and to hold a permanent magnet carrier in place. The solenoids are excited separately to generate restoring forces when the permanent magnet carrier is displaced from its equilibrium position. The research uses the ANSOFT finite element analysis simulation to analyze the solenoid restoring forces and to motivate a suitable permanent magnets arrangement. Active control on the solenoid currents is then used to maintain the carrier position. The system identification is carried out by perturbing the experimental set-up from its equilibrium position. The simulation results based on the identification models show that simple control is effective for maintaining the carrier position. Initial implementation has also showed that the concept is feasible
Design and Calibration of a New 6 DOF Haptic Device
Directory of Open Access Journals (Sweden)
Huanhuan Qin
2015-12-01
Full Text Available For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed.
Design and Calibration of a New 6 DOF Haptic Device
Qin, Huanhuan; Song, Aiguo; Liu, Yuqing; Jiang, Guohua; Zhou, Bohe
2015-01-01
For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom) haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed. PMID:26690449
Kinematics and Workspace of a 4-DOF Hybrid Palletizing Robot
Directory of Open Access Journals (Sweden)
Yong Tao
2014-06-01
Full Text Available We presented the kinematical analysis of a 4-DOF hybrid palletizing robot. The palletizing robot structure was proposed and the arm model of the robot was presented. The kinematical analysis of the end robotic manipulator was given. As a result, the position, velocity, and acceleration curves as well as the maximum workspace were demonstrated by simulation in Matlab. This study would be useful for the kinematical characteristics of the 4-DOF palletizing robot in space.
Rocking motion of structures under earthquakes. Overturning of 2-DOF system
International Nuclear Information System (INIS)
Kobayashi, Koichi; Watanabe, Tetsuya; Tanaka, Kihachiro; Tomoda, Akinori
2011-01-01
In recent years, huge earthquakes happen, for example, The South Hyogo prefecture Earthquake in 1995, The Mid Niigata Prefecture Earthquake in 2004, The Iwate-Miyagi Nairiku Earthquake in 2008. In The Niigataken Chuetsu-oki Earthquake in 2007, hundreds of drums fell down and water spilled out. A lot of studies about rocking behavior of rigid body had been performed from 1960's. However, these studies were only for a specific condition of the structure size or input vibration characteristics. Therefore, generalizes fall condition for earthquake is required. This paper deals with the analytical and the experimental study of the rocking vibration of 1-DOF rocking system, 2-DOF vibration-rocking system and 2-DOF rocking system under earthquakes. In this study, the equation of motion for each rocking systems are developed. The numerical model of 2-DOF rocking system is evaluated by free rocking experiment. In this paper, 'Overturning Map' which can distinguish whether structures falls or not is proposed. The overturning map of each rocking systems excited by the artificial earthquake wave calculated from the design spectrum is shown. As the result, overturning condition of structures is clarified. (author)
Directory of Open Access Journals (Sweden)
Xin Wang
2018-03-01
Full Text Available The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parameters of the 3-DOF upper-limb exoskeleton were determined, and the differences and singularities of the two exoskeletons were analyzed. The workspace, the joint torques and the power consumption of two exoskeletons were analyzed by kinematics and dynamics, and an exoskeleton prototype experiment was performed. The results showed that, compared with a typical anthropomorphic upper-limb exoskeleton, the non-anthropomorphic 3-DOF upper-limb exoskeleton had the same actual workspace; eliminated singularities within the workspace; improved the elbow joint force situation; and the maximum elbow joint torque, elbow external-flexion/internal-extension and shoulder flexion/extension power consumption were significantly reduced. The proposed non-anthropomorphic 3-DOF upper-limb exoskeleton can be applied to a power-assisted upper-limb exoskeleton in industrial settings.
Measurement system and model for simultaneously measuring 6DOF geometric errors.
Zhao, Yuqiong; Zhang, Bin; Feng, Qibo
2017-09-04
A measurement system to simultaneously measure six degree-of-freedom (6DOF) geometric errors is proposed. The measurement method is based on a combination of mono-frequency laser interferometry and laser fiber collimation. A simpler and more integrated optical configuration is designed. To compensate for the measurement errors introduced by error crosstalk, element fabrication error, laser beam drift, and nonparallelism of two measurement beam, a unified measurement model, which can improve the measurement accuracy, is deduced and established using the ray-tracing method. A numerical simulation using the optical design software Zemax is conducted, and the results verify the correctness of the model. Several experiments are performed to demonstrate the feasibility and effectiveness of the proposed system and measurement model.
Simulated Energy Usage for a Novel 6 DOF Articulated Robot
International Nuclear Information System (INIS)
Shaik, A A; Tlale, N; Bright, G
2014-01-01
The serial robot architecture is widespread in modern day manufacturing, and over the last few decades the technology has matured and settled to its current state. One drawback from the architecture however is the location of motors and gearboxes which are either at the joint it controls or close by. A novel hybrid 6 DOF robot was designed to move all the actuators to the robot base, and to control the desired axis through a set of connected links and gears, while maintaining the same workspace and dexterity. This would reduce the inertia of the movable part of the robot and some of the moment arms on the 3 axes required for translation of the 3 DOF spherical wrist. Doing so would decrease the energy requirements when compared to a 6 DOF serial robot. This paper focuses on the mathematical modelling and simulation of the novel hybrid machine design and compares it to an equivalent serial robot
Evaluation of a new six degrees of freedom couch for radiation therapy
International Nuclear Information System (INIS)
Schmidhalter, D.; Fix, M. K.; Manser, P.; Wyss, M.; Schaer, N.; Munro, P.; Scheib, S.; Kunz, P.
2013-01-01
Purpose: The aim of this work is to evaluate the geometric accuracy of a prerelease version of a new six degrees of freedom (6DoF) couch. Additionally, a quality assurance method for 6DoF couches is proposed.Methods: The main principle of the performance tests was to request a known shift for the 6DoF couch and to compare this requested shift with the actually applied shift by independently measuring the applied shift using different methods (graph paper, laser, inclinometer, and imaging system). The performance of each of the six axes was tested separately as well as in combination with the other axes. Functional cases as well as realistic clinical cases were analyzed. The tests were performed without a couch load and with a couch load of up to 200 kg and shifts in the range between −4 and +4 cm for the translational axes and between −3° and +3° for the rotational axes were applied. The quality assurance method of the new 6DoF couch was performed using a simple cube phantom and the imaging system.Results: The deviations (mean ± one standard deviation) accumulated over all performance tests between the requested shifts and the measurements of the applied shifts were −0.01 ± 0.02, 0.01 ± 0.02, and 0.01 ± 0.02 cm for the longitudinal, lateral, and vertical axes, respectively. The corresponding values for the three rotational axes couch rotation, pitch, and roll were 0.03°± 0.06°, −0.04°± 0.12°, and −0.01°± 0.08°, respectively. There was no difference found between the tests with and without a couch load of up to 200 kg.Conclusions: The new 6DoF couch is able to apply requested shifts with high accuracy. It has the potential to be used for treatment techniques with the highest demands in patient setup accuracy such as those needed in stereotactic treatments. Shifts can be applied efficiently and automatically. Daily quality assurance of the 6DoF couch can be performed in an easy and efficient way. Long-term stability has to be evaluated in
Meng, Qizhi; Xie, Fugui; Liu, Xin-Jun
2018-06-01
This paper deals with the conceptual design, kinematic analysis and workspace identification of a novel four degrees-of-freedom (DOFs) high-speed spatial parallel robot for pick-and-place operations. The proposed spatial parallel robot consists of a base, four arms and a 1½ mobile platform. The mobile platform is a major innovation that avoids output singularity and offers the advantages of both single and double platforms. To investigate the characteristics of the robot's DOFs, a line graph method based on Grassmann line geometry is adopted in mobility analysis. In addition, the inverse kinematics is derived, and the constraint conditions to identify the correct solution are also provided. On the basis of the proposed concept, the workspace of the robot is identified using a set of presupposed parameters by taking input and output transmission index as the performance evaluation criteria.
A kinematic analysis of the modified flight telerobotic servicer manipulator system
Crane, Carl; Carnahan, Tim; Duffy, Joseph
1992-01-01
A reverse kinematic analysis is presented of a six-DOF subchain of a modified seven-DOF flight telerobotic servicer manipulator system. The six-DOF subchain is designated as a TR-RT chain, which describes the sequence of manipulator joints beginning with the first grounded hook joint (universal joint) T, where the sequence R-R designates a pair of revolute joints with parallel axes. At the outset, it had been thought that the reverse kinematic analysis would be similar to a TTT manipulator previously analyzed, in which the third and fourth joints intersected at a finite point. However, this is shown not the case, and a 16th-degree tan-half-angle polynomial is derived for the TR-RT manipulator.
International Nuclear Information System (INIS)
Niu, Zhi; Zhao, Yanzhi; Zhao, Tieshi; Cao, Yachao; Liu, Menghua
2017-01-01
An over-constrained, parallel six-dimensional force sensor has various advantages, including its ability to bear heavy loads and provide redundant force measurement information. These advantages render the sensor valuable in important applications in the field of aerospace (space docking tests, etc). The stiffness of each component in the over-constrained structure has a considerable influence on the internal force distribution of the structure. Thus, the measurement model changes when the measurement branches of the sensor are under tensile or compressive force. This study establishes a general measurement model for an over-constrained parallel six-dimensional force sensor considering the different branch tensions and compression stiffness values. Numerical calculations and analyses are performed using practical examples. Based on the parallel mechanism, an over-constrained, orthogonal structure is proposed for a six-dimensional force sensor. Hence, a prototype is designed and developed, and a calibration experiment is conducted. The measurement accuracy of the sensor is improved based on the measurement model under different branch tensions and compression stiffness values. Moreover, the largest class I error is reduced from 5.81 to 2.23% full scale (FS), and the largest class II error is reduced from 3.425 to 1.871% FS. (paper)
Ouyang, Bo; Shang, Weiwei
2016-03-01
The solution of tension distributions is infinite for cable-driven parallel manipulators(CDPMs) with redundant cables. A rapid optimization method for determining the optimal tension distribution is presented. The new optimization method is primarily based on the geometry properties of a polyhedron and convex analysis. The computational efficiency of the optimization method is improved by the designed projection algorithm, and a fast algorithm is proposed to determine which two of the lines are intersected at the optimal point. Moreover, a method for avoiding the operating point on the lower tension limit is developed. Simulation experiments are implemented on a six degree-of-freedom(6-DOF) CDPM with eight cables, and the results indicate that the new method is one order of magnitude faster than the standard simplex method. The optimal distribution of tension distribution is thus rapidly established on real-time by the proposed method.
Design and characterization of an ocean wave powered lifejacket using 2DOF floating boards
Mi, Jia; Xu, Lin; Yang, Yaling; Zuo, Lei
2018-04-01
Lifejacket is an indispensable life-saving equipment for ships and airplanes. Traditional lifejacket is designed to prevent human from drowning. However, the water temperature is usually low, especially in winter, which significantly reduces the human body temperature and leads to death. Meanwhile, power is critical for drowning people to use emergency communication equipment. This paper proposed an ocean wave powered lifejacket using 2DOF floating boards to provide both buoyance and electricity for drowning people. Hence, they can use this continuous electric power to keep key body warm and send distress signal. This lifejacket is featured with two 2DOF floating boards and the mechanical motion rectifier (MMR) can convert the 2-DOF motions to the unidirectional rotation of generator. The design principle is illustrated and the dynamic modelling for the 2-DOF motions has been analyzed. Bench test and lake test have been conducted to validate the design concept.
Control of 4-DOF MR haptic master for medical application
Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok
2014-03-01
In this work, magnetorheological (MR) based haptic master for robot-assisted minimally invasive surgery (RMIS) is proposed and analyzed. Using a controllable MR fluid, the masters can generate a reflection force with the 4-DOF motion. The proposed master consists of two actuators: MR clutch featuring gimbal mechanism for 2-DOF rotational motion (X and Y axes) and MR clutch attached at gripper of gimbal structures for 1-DOF rotational motion (Z axis) and 1-DOF translational motion. After analyzing the dynamic motion by integrating mechanical and physical properties of the actuators, torque model of the proposed haptic master is derived. For realization of master-slave system, an encoder which can measure position information is integrated with the MR haptic master. In the RMIS system, the measured position is converted as a command signal and sent to the slave robot. In this work, slave and organ of patient are modeled in virtual space. In order to embody a human organ into virtual space, a volumetric deformable object is mathematically formulated by a shape retaining chain linked (S-chain) model. Accordingly, the haptic architecture is established by incorporating the virtual slave with the master device in which the reflection force and desired position originated from the object of the virtual slave and operator of the master, respectively, are transferred to each other. In order to achieve the desired force trajectories, a proportional-integral-derivative (PID) controller is designed and implemented. It has been demonstrated that the effective tracking control performance for the desired motion of reflection force is well presented in time domain.
Li, Ying-Jun; Yang, Cong; Wang, Gui-Cong; Zhang, Hui; Cui, Huan-Yong; Zhang, Yong-Liang
2017-09-01
This paper presents a novel integrated piezoelectric six-dimensional force sensor which can realize dynamic measurement of multi-dimensional space load. Firstly, the composition of the sensor, the spatial layout of force-sensitive components, and measurement principle are analyzed and designed. There is no interference of piezoelectric six-dimensional force sensor in theoretical analysis. Based on the principle of actual work and deformation compatibility coherence, this paper deduces the parallel load sharing principle of the piezoelectric six-dimensional force sensor. The main effect factors which affect the load sharing ratio are obtained. The finite element model of the piezoelectric six-dimensional force sensor is established. In order to verify the load sharing principle of the sensor, a load sharing test device of piezoelectric force sensor is designed and fabricated. The load sharing experimental platform is set up. The experimental results are in accordance with the theoretical analysis and simulation results. The experiments show that the multi-dimensional and heavy force measurement can be realized by the parallel arrangement of the load sharing ring and the force sensitive element in the novel integrated piezoelectric six-dimensional force sensor. The ideal load sharing effect of the sensor can be achieved by appropriate size parameters. This paper has an important guide for the design of the force measuring device according to the load sharing mode. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.
Cui, Cunxing; Feng, Qibo; Zhang, Bin; Zhao, Yuqiong
2016-03-21
A novel method for simultaneously measuring six degree-of-freedom (6DOF) geometric motion errors is proposed in this paper, and the corresponding measurement instrument is developed. Simultaneous measurement of 6DOF geometric motion errors using a polarization maintaining fiber-coupled dual-frequency laser is accomplished for the first time to the best of the authors' knowledge. Dual-frequency laser beams that are orthogonally linear polarized were adopted as the measuring datum. Positioning error measurement was achieved by heterodyne interferometry, and other 5DOF geometric motion errors were obtained by fiber collimation measurement. A series of experiments was performed to verify the effectiveness of the developed instrument. The experimental results showed that the stability and accuracy of the positioning error measurement are 31.1 nm and 0.5 μm, respectively. For the straightness error measurements, the stability and resolution are 60 and 40 nm, respectively, and the maximum deviation of repeatability is ± 0.15 μm in the x direction and ± 0.1 μm in the y direction. For pitch and yaw measurements, the stabilities are 0.03″ and 0.04″, the maximum deviations of repeatability are ± 0.18″ and ± 0.24″, and the accuracies are 0.4″ and 0.35″, respectively. The stability and resolution of roll measurement are 0.29″ and 0.2″, respectively, and the accuracy is 0.6″.
The Integration of the Image Sensor with a 3-DOF Pneumatic Parallel Manipulator
Directory of Open Access Journals (Sweden)
Hao-Ting Lin
2016-07-01
Full Text Available The study aims to integrate the image sensor for a three-axial pneumatic parallel manipulator which can pick and place objects automatically by the feature information of the image processed through the SURF algorithm. The SURF algorithm is adopted for defining and matching the features of a target object and an object database. In order to accurately mark the center of target and strengthen the feature matching results, the random sample and consensus method (RANSAC is utilized. The ASUS Xtion Pro Live depth camera which can directly estimate the 3-D location of the target point is used in this study. A set of coordinate estimation calibrations is developed for enhancing the accuracy of target location estimation. This study also presents hand gesture recognition exploiting skin detection and noise elimination to determine the active finger count for input signals of the parallel manipulator. The end-effector of the parallel manipulator can be manipulated to the desired poses according to the measured finger count. Finally, the proposed methods are successfully to achieve the feature recognition and pick and place of the target object.
Integrated 6-DOF Orbit-Attitude Dynamical Modeling and Control Using Geometric Mechanics
Directory of Open Access Journals (Sweden)
Ling Jiang
2017-01-01
Full Text Available The integrated 6-DOF orbit-attitude dynamical modeling and control have shown great importance in various missions, for example, formation flying and proximity operations. The integrated approach yields better performances than the separate one in terms of accuracy, efficiency, and agility. One challenge in the integrated approach is to find a unified representation for the 6-DOF motion with configuration space SE(3. Recently, exponential coordinates of SE(3 have been used in dynamics and control of the 6-DOF motion, however, only on the kinematical level. In this paper, we will improve the current method by adopting exponential coordinates on the dynamical level, by giving the relation between the second-order derivative of exponential coordinates and spacecraft’s accelerations. In this way, the 6-DOF motion in terms of exponential coordinates can be written as a second-order system with a quite compact form, to which a broader range of control theories, such as higher-order sliding modes, can be applied. For a demonstration purpose, a simple asymptotic tracking control law with almost global convergence is designed. Finally, the integrated modeling and control are applied to the body-fixed hovering over an asteroid and verified by a simulation, in which absolute motions of the spacecraft and asteroid are simulated separately.
Directory of Open Access Journals (Sweden)
Hui Li
2016-01-01
Full Text Available Tea plant (Camellia sinensis (L. O. Kuntze is affected by abiotic stress during its growth and development. DNA-binding with one finger (Dof transcription factors (TFs play important roles in abiotic stress tolerance of plants. In this study, a total of 29 putative Dof TFs were identified based on transcriptome of tea plant, and the conserved domains and common motifs of these CsDof TFs were predicted and analyzed. The 29 CsDof proteins were divided into 7 groups (A, B1, B2, C1, C2.1, C2.2, and D2, and the interaction networks of Dof proteins in C. sinensis were established according to the data in Arabidopsis. Gene expression was analyzed in “Yingshuang” and “Huangjinya” under four experimental stresses by qRT-PCR. CsDof genes were expressed differentially and related to different abiotic stress conditions. In total, our results might suggest that there is a potential relationship between CsDof factors and tea plant stress resistance.
Development of parallel 3D discrete ordinates transport program on JASMIN framework
International Nuclear Information System (INIS)
Cheng, T.; Wei, J.; Shen, H.; Zhong, B.; Deng, L.
2015-01-01
A parallel 3D discrete ordinates radiation transport code JSNT-S is developed, aiming at simulating real-world radiation shielding and reactor physics applications in a reasonable time. Through the patch-based domain partition algorithm, the memory requirement is shared among processors and a space-angle parallel sweeping algorithm is developed based on data-driven algorithm. Acceleration methods such as partial current rebalance are implemented. The correctness is proved through the VENUS-3 and other benchmark models. In the radiation shielding calculation of the Qinshan-II reactor pressure vessel model with 24.3 billion DoF, only 88 seconds is required and the overall parallel efficiency of 44% is achieved on 1536 CPU cores. (author)
Su, Hao; Dickstein-Fischer, Laurie; Harrington, Kevin; Fu, Qiushi; Lu, Weina; Huang, Haibo; Cole, Gregory; Fischer, Gregory S
2010-01-01
This paper presents the development of new prismatic actuation approach and its application in human-safe humanoid head design. To reduce actuator output impedance and mitigate unexpected external shock, the prismatic actuation method uses cables to drive a piston with preloaded spring. By leveraging the advantages of parallel manipulator and cable-driven mechanism, the developed neck has a parallel manipulator embodiment with two cable-driven limbs embedded with preloaded springs and one passive limb. The eye mechanism is adapted for low-cost webcam with succinct "ball-in-socket" structure. Based on human head anatomy and biomimetics, the neck has 3 degree of freedom (DOF) motion: pan, tilt and one decoupled roll while each eye has independent pan and synchronous tilt motion (3 DOF eyes). A Kalman filter based face tracking algorithm is implemented to interact with the human. This neck and eye structure is translatable to other human-safe humanoid robots. The robot's appearance reflects a non-threatening image of a penguin, which can be translated into a possible therapeutic intervention for children with Autism Spectrum Disorders.
Design and Nonlinear Control of a 2-DOF Flexible Parallel Humanoid Arm Joint Robot
Directory of Open Access Journals (Sweden)
Leijie Jiang
2017-01-01
Full Text Available The paper focuses on the design and nonlinear control of the humanoid wrist/shoulder joint based on the cable-driven parallel mechanism which can realize roll and pitch movement. In view of the existence of the flexible parts in the mechanism, it is necessary to solve the vibration control of the flexible wrist/shoulder joint. In this paper, a cable-driven parallel robot platform is developed for the experiment study of the humanoid wrist/shoulder joint. And the dynamic model of the mechanism is formulated by using the coupling theory of the flexible body’s large global motion and small flexible deformation. Based on derived dynamics, antivibration control of the joint robot is studied with a nonlinear control method. Finally, simulations and experiments were performed to validate the feasibility of the developed parallel robot prototype and the proposed control scheme.
Kinematic Analysis of 3-DOF Planer Robot Using Artificial Neural Network
Directory of Open Access Journals (Sweden)
Jolly Atit Shah
2012-07-01
Full Text Available Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the forward and inverse kinematics of 3-DOF robotic manipulator with revolute joints. In this study the Denavit- Hartenberg (D-H model is used to model robot links and joints. Also forward and inverse kinematics solution has been achieved using Artificial Neural Networks for 3-DOF robotic manipulator. It shows that by using artificial neural network the solution we get is faster, acceptable and has zero error.
Zang, Dandan; Wang, Lina; Zhang, Yiming; Zhao, Huimin; Wang, Yucheng
2017-07-01
Identification of the upstream regulators of a gene is important to characterize the transcriptional pathway and the function of the gene. Previously, we found that a zinc finger protein (ThZFP1) is involved in abiotic stress tolerance of Tamarix hispida. In the present study, we further investigated the transcriptional pathway of ThZFP1. Dof motifs are abundant in the ThZFP1 promoter; therefore, we used them to screen for transcriptional regulators of ThZFP1. A Dof protein, ThDof1.4, binds to the Dof motif specifically, and was hypothesized as the upstream regulator of ThZFP1. Further study showed that overexpression of ThDof1.4 in T. hispida activated the expression of GUS controlled by the ThZFP1 promoter. In T. hispida, transient overexpression of ThDof1.4 increased the transcripts of ThZFP1; conversely, transient RNAi-silencing of ThDof1.4 reduced the expression of ThZFP1. Chromatin immunoprecipitation indicated that ThDof1.4 binds to the ThZFP1 promoter. Additionally, ThDof1.4 and ThZFP1 share similar expression patterns in response to salt or drought stress. Furthermore, like ThZFP1, ThDof1.4 could increase the proline level and enhance ROS scavenging capability to improve salt and osmotic stress tolerance. Together, these results suggested that ThDof1.4 and ThZFP1 form a transcriptional regulatory cascade involved in abiotic stress resistance in T. hispida.
Optimal Design of a 3-DOF Cable-Driven Upper Arm Exoskeleton
Directory of Open Access Journals (Sweden)
Zhu-Feng Shao
2014-04-01
Full Text Available With outstanding advantages, such as large workspace, flexibility, and lightweight and low inertia, cable-driven parallel manipulator shows great potential for application as the exoskeleton rehabilitation robot. However, the optimal design is still a challenging problem to be solved. In this paper, the optimal design of a 3-DOF (3-degree-of-freedom cable-driven upper arm exoskeleton is accomplished considering the force exerted on the arm. After analysis of the working conditions, two promising configurations of the cable-driven upper arm exoskeleton are put forward and design parameters are simplified. Then, candidate ranges of two angle parameters are determined with the proposed main workspace requirement. Further, global force indices are defined to evaluate the force applied to the arm by the exoskeleton, in order to enhance the system safety and comfort. Finally, the optimal design of each configuration is obtained with proposed force indices. In addition, atlases and charts given in this paper well illustrate trends of workspace and force with different values of design parameters.
Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation
Directory of Open Access Journals (Sweden)
Karen Junius
2017-01-01
Full Text Available A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton.
Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation
Degelaen, Marc; Lefeber, Nina; Swinnen, Eva; Vanderborght, Bram; Lefeber, Dirk
2017-01-01
A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF) in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton. PMID:28790799
da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando
2016-01-01
The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.
A novel six-degrees-of-freedom series-parallel manipulator
Energy Technology Data Exchange (ETDEWEB)
Gallardo-Alvarado, J.; Rodriguez-Castro, R.; Aguilar-Najera, C. R.; Perez-Gonzalez, L. [Instituto Tecnologico de Celaya, Celaya (Mexico)
2012-06-15
This paper addresses the description and kinematic analyses of a new non-redundant series-parallel manipulator. The primary feature of the robot is to have a decoupled topology consisting of a lower parallel manipulator, for controlling the orientation of the coupler platform, assembled in series connection with a upper parallel manipulator, for controlling the position of the output platform, capable to provide arbitrary poses to the output platform with respect to the fixed platform. The forward displacement analysis is carried-out in semi-closed form solutions by resorting to simple closure equations. On the other hand; the velocity, acceleration and singularity analyses of the manipulator are approached by means of the theory of screws. Simple and compact expressions are derived here for solving the infinitesimal kinematics by taking advantage of the concept of reciprocal screws. Furthermore, the analysis of the Jacobians of the robot shows that the lower parallel manipulator is practically free of singularities. In order to illustrate the performance of the manipulator, a numerical example which consists of solving the inverse/forward kinematics of the series-parallel manipulator as well as its singular configurations is provided.
Mumma, Joel M; Durso, Francis T; Ferguson, Ashley N; Gipson, Christina L; Casanova, Lisa; Erukunuakpor, Kimberly; Kraft, Colleen S; Walsh, Victoria L; Zimring, Craig; DuBose, Jennifer; Jacob, Jesse T
2018-03-05
Doffing protocols for personal protective equipment (PPE) are critical for keeping healthcare workers (HCWs) safe during care of patients with Ebola virus disease. We assessed the relationship between errors and self-contamination during doffing. Eleven HCWs experienced with doffing Ebola-level PPE participated in simulations in which HCWs donned PPE marked with surrogate viruses (ɸ6 and MS2), completed a clinical task, and were assessed for contamination after doffing. Simulations were video recorded, and a failure modes and effects analysis and fault tree analyses were performed to identify errors during doffing, quantify their risk (risk index), and predict contamination data. Fifty-one types of errors were identified, many having the potential to spread contamination. Hand hygiene and removing the powered air purifying respirator (PAPR) hood had the highest total risk indexes (111 and 70, respectively) and number of types of errors (9 and 13, respectively). ɸ6 was detected on 10% of scrubs and the fault tree predicted a 10.4% contamination rate, likely occurring when the PAPR hood inadvertently contacted scrubs during removal. MS2 was detected on 10% of hands, 20% of scrubs, and 70% of inner gloves and the predicted rates were 7.3%, 19.4%, 73.4%, respectively. Fault trees for MS2 and ɸ6 contamination suggested similar pathways. Ebola-level PPE can both protect and put HCWs at risk for self-contamination throughout the doffing process, even among experienced HCWs doffing with a trained observer. Human factors methodologies can identify error-prone steps, delineate the relationship between errors and self-contamination, and suggest remediation strategies.
Parallel Robot for Lower Limb Rehabilitation Exercises
Directory of Open Access Journals (Sweden)
Alireza Rastegarpanah
2016-01-01
Full Text Available The aim of this study is to investigate the capability of a 6-DoF parallel robot to perform various rehabilitation exercises. The foot trajectories of twenty healthy participants have been measured by a Vicon system during the performing of four different exercises. Based on the kinematics and dynamics of a parallel robot, a MATLAB program was developed in order to calculate the length of the actuators, the actuators’ forces, workspace, and singularity locus of the robot during the performing of the exercises. The calculated length of the actuators and the actuators’ forces were used by motion analysis in SolidWorks in order to simulate different foot trajectories by the CAD model of the robot. A physical parallel robot prototype was built in order to simulate and execute the foot trajectories of the participants. Kinect camera was used to track the motion of the leg’s model placed on the robot. The results demonstrate the robot’s capability to perform a full range of various rehabilitation exercises.
Establishing an Improved Kane Dynamic Model for the 7-DOF Reconfigurable Modular Robot
Directory of Open Access Journals (Sweden)
Xiao Li
2017-01-01
Full Text Available We propose an improved Kane dynamic model theory for the 7-DOF modular robot in this paper, and the model precision is improved by the improved function T′it. We designed three types of progressive modular joints for reconfigurable modular robot that can be used in industrial robot, space robot, and special robot. The Kane dynamic model and the solid dynamic model are established, respectively, for the 7-DOF modular robot. After that, the experimental results are obtained from the simulation experiment of typical task in the established dynamic models. By the analysis model of error, the equation of the improved torque T′it is derived and proposed. And the improved Kane dynamic model is established for the modular robot that used T′it. Based on the experimental data, the undetermined coefficient matrix is five-order linear that was proved in 7-DOF modular robot. And the explicit formulation is solved of the Kane dynamic model and can be used in control system.
Proposed Robot Scheme with 5 DoF and Dynamic Modelling Using Maple Software
Directory of Open Access Journals (Sweden)
Shala Ahmet
2017-11-01
Full Text Available In this paper is represented Dynamical Modelling of robots which is commonly first important step of Modelling, Analysis and Control of robotic systems. This paper is focused on using Denavit-Hartenberg (DH convention for kinematics and Newton-Euler Formulations for dynamic modelling of 5 DoF - Degree of Freedom of 3D robot. The process of deriving of dynamical model is done using Software Maple. Derived Dynamical Model of 5 DoF robot is converted for Matlab use for future analysis, control and simulations.
Automated optimal coordination of multiple-DOF neuromuscular actions in feedforward neuroprostheses.
Lujan, J Luis; Crago, Patrick E
2009-01-01
This paper describes a new method for designing feedforward controllers for multiple-muscle, multiple-DOF, motor system neural prostheses. The design process is based on experimental measurement of the forward input/output properties of the neuromechanical system and numerical optimization of stimulation patterns to meet muscle coactivation criteria, thus resolving the muscle redundancy (i.e., overcontrol) and the coupled DOF problems inherent in neuromechanical systems. We designed feedforward controllers to control the isometric forces at the tip of the thumb in two directions during stimulation of three thumb muscles as a model system. We tested the method experimentally in ten able-bodied individuals and one patient with spinal cord injury. Good control of isometric force in both DOFs was observed, with rms errors less than 10% of the force range in seven experiments and statistically significant correlations between the actual and target forces in all ten experiments. Systematic bias and slope errors were observed in a few experiments, likely due to the neuromuscular fatigue. Overall, the tests demonstrated the ability of a general design approach to satisfy both control and coactivation criteria in multiple-muscle, multiple-axis neuromechanical systems, which is applicable to a wide range of neuromechanical systems and stimulation electrodes.
Directory of Open Access Journals (Sweden)
Bangcheng Han
2014-01-01
Full Text Available We propose a novel combined five-degrees-of-freedom (5-DOFs hybrid magnetic bearing (HMB with only one permanent magnet ring (PMR used for turboexpanders. It has two radial magnetic bearing (RMB units; each has four poles and one thrust magnetic bearing (TMB to control 5-DOFs. Based on one PMR, the bias flux of the two radial magnetic bearing units and the one thrust magnetic bearing unit is constructed. As a result, ultra-high-speed, lower power loss, small size, and low cost can be achieved. Furthermore, the equivalent magnetic circuit method and 3D finite element method (FEM are used to model and analyze the combined 5-DOFs HMB. The force-current, force-position, torque-coil currents, the torque-angle position, and the stiffness models of the combined 5-DOFs HMB are given. Moreover, its coupling problems between the RMB units and the AMB unit are also proposed in this paper. An example is given to clarify the mathematical models and the coupling problems, and the linearized models are proposed for the follow-up controller design.
A 6-DOF vibration isolation system for hydraulic hybrid vehicles
Nguyen, The; Elahinia, Mohammad; Olson, Walter W.; Fontaine, Paul
2006-03-01
This paper presents the results of vibration isolation analysis for the pump/motor component of hydraulic hybrid vehicles (HHVs). The HHVs are designed to combine gasoline/diesel engine and hydraulic power in order to improve the fuel efficiency and reduce the pollution. Electric hybrid technology is being applied to passenger cars with small and medium engines to improve the fuel economy. However, for heavy duty vehicles such as large SUVs, trucks, and buses, which require more power, the hydraulic hybridization is a more efficient choice. In function, the hydraulic hybrid subsystem improves the fuel efficiency of the vehicle by recovering some of the energy that is otherwise wasted in friction brakes. Since the operation of the main component of HHVs involves with rotating parts and moving fluid, noise and vibration are an issue that affects both passengers (ride comfort) as well as surrounding people (drive-by noise). This study looks into the possibility of reducing the transmitted noise and vibration from the hydraulic subsystem to the vehicle's chassis by using magnetorheological (MR) fluid mounts. To this end, the hydraulic subsystem is modeled as a six degree of freedom (6-DOF) rigid body. A 6-DOF isolation system, consisting of five mounts connected to the pump/motor at five different locations, is modeled and simulated. The mounts are designed by combining regular elastomer components with MR fluids. In the simulation, the real loading and working conditions of the hydraulic subsystem are considered and the effects of both shock and vibration are analyzed. The transmissibility of the isolation system is monitored in a wide range of frequencies. The geometry of the isolation system is considered in order to sustain the weight of the hydraulic system without affecting the design of the chassis and the effectiveness of the vibration isolating ability. The simulation results shows reduction in the transmitted vibration force for different working cycles of
Thermal Actuation Based 3-DoF Non-Resonant Microgyroscope Using MetalMUMPs
Directory of Open Access Journals (Sweden)
Muhammad Masood ul Hassan
2009-04-01
Full Text Available High force, large displacement and low voltage consumption are a primary concern for microgyroscopes. The chevron-shaped thermal actuators are unique in terms of high force generation combined with the large displacements at a low operating voltage in comparison with traditional electrostatic actuators. A Nickel based 3-DoF micromachined gyroscope comprising 2-DoF drive mode and 1-DoF sense mode oscillator utilizing the chevron-shaped thermal actuators is presented here. Analytical derivations and finite element simulations are carried out to predict the performance of the proposed device using the thermo-physical properties of electroplated nickel. The device sensitivity is improved by utilizing the dynamical amplification of the oscillation in 2-DoF drive mode using an active-passive mass configuration. A comprehensive theoretical description, dynamics and mechanical design considerations of the proposed gyroscopes model are discussed in detail. Parametric optimization of gyroscope, its prototype modeling and fabrication using MetalMUMPs has also been investigated. Dynamic transient simulation results predicted that the sense mass of the proposed device achieved a drive displacement of 4.1µm when a sinusoidal voltage of 0.5V is applied at 1.77 kHz exhibiting a mechanical sensitivity of 1.7μm /o/s in vacuum. The wide bandwidth frequency response of the 2-DoF drive mode oscillator consists of two resonant peaks and a flat region of 2.11 kHz between the peaks defining the operational frequency region. The sense mode resonant frequency can lie anywhere within this region and therefore the amplitude of the response is insensitive to structural parameter variations, enhancing device robustness against such variations. The proposed device has a size of 2.2 x 2.6 mm2, almost one third in comparison with existing M-DoF vibratory gyroscope with an estimated power consumption of 0.26 Watts. These predicted results illustrate that the chevron
Adaptive tuning of a 2DOF controller for robust cell manipulation using IPMC actuators
International Nuclear Information System (INIS)
McDaid, A J; Aw, K C; Haemmerle, E; Xie, S Q; Shahinpoor, M
2011-01-01
Rapid advancement in medicine and bioscience is causing demand for faster, more accurate and dexterous as well as safer and more reliable micro-manipulators capable of handling biological cells. Current micro-manipulation techniques commonly damage cell walls and membranes due to their stiffness and rigidity. Ionic polymer-metal composite (IPMC) actuators have inherent compliance and with their ability to operate well in fluid and cellular environments they present a unique solution for safe cell manipulation. The reason for the downfall of IPMCs is that their complex behaviour makes them hard to control precisely in unknown environments and in the presence of sizeable external disturbances. This paper presents a novel scheme for adaptively tuning IPMC actuators for precise and robust micro-manipulation of biological cells. A two-degree-of-freedom (2DOF) controller is developed to allow optimal performance for both disturbance rejection (DR) and set point (SP) tracking. These criteria are optimized using a proposed IFT algorithm which adaptively updates the controller parameters, with no model or prior knowledge of the operating conditions, to achieve a compliant manipulation system which can precisely track targets in the presence of large external disturbances, as will be encountered in real biological environments. Experiments are presented showing the performance optimization of an IPMC actuator in the presence of external mechanical disturbances as well as the optimization of the SP tracking. The IFT algorithm successfully tunes the DR and SP to an 85% and 69% improvement, respectively. Results are also presented for a one-degree-of-freedom (1DOF) controller tuned first for DR and then for SP, for a comparison with the 2DOF controller. Validation has been undertaken to verify that the 2DOF controller does indeed outperform both 1DOF controllers over a variety of operating conditions.
Directory of Open Access Journals (Sweden)
Liu M
2018-01-01
Full Text Available Mengyao Liu,1,2 Guofang Hu,2 Yuan Wang,2 Jun Guo,2 Liyan Liu,2 Xiao Han,2 Zhehai Wang2 1School of Medicine and Life Sciences, University of Jinan-Shandong Academy of Medical Sciences, Jinan, Shandong, 2Department of Oncology, Shandong Cancer Hospital, affiliated to Shandong University, Shandong Academy of Medical Sciences, Jinan, Shandong, People’s Republic of China Background: Our study retrospectively assesses the safety and efficacy of the FOLFOX (oxaliplatin, fluorouracil, and leucovorin versus DOF (docetaxel, oxaliplatin, and fluorouracil regimens in untreated locally advanced gastric cancer (AGC.Patients and methods: A total of 108 patients underwent DOF (N=58 and FOLFOX (N=50 regimens. The end points were overall response rate (ORR, survival, and toxicity. Kaplan–Meier curve was used to estimate overall survival (OS and progression-free survival (PFS and Cox regression for multivariate analysis.Results: The ORRs were 50% for DOF and 30% for FOLFOX groups (P<0.05, and disease control rates were 91.4% and 72%, respectively. The median PFS and OS in DOF group were significantly better than FOLFOX group (8.2 versus 6.4 months, P<0.05; 16.3 versus 11.2 months, P<0.001. Both groups showed acceptable toxicity; all grades and grade 3–4 toxicity had no significant differences (P=0.071; P=0.247. However, the incidence of grade 3–4 peripheral neuropathy was significantly higher in DOF group (10.3% versus 2%, P<0.05. In the subgroup analysis for elderly AGC patients (≥65 years, administration of DOF also resulted in a superior PFS (8.5 versus 5.9 months; P=0.038 and OS (15.3 versus 9.8 months; P=0.004 compared with FOLFOX. However, DOF regimen was associated with more neutropenia (67% versus 30%; P<0.05, thrombocytopenia (61% versus 52%; P<0.05, and peripheral neuropathy (49% versus 22%; P<0.05.Conclusion: DOF regimen was more effective than FOLFOX for AGC, both in younger and older patients. The adverse effects of the two regimens were
Stair Climbing Control for 4-DOF Tracked Vehicle Based on Internal Sensors
Directory of Open Access Journals (Sweden)
Daisuke Endo
2017-01-01
Full Text Available In search-and-rescue missions, multi-degrees-of-freedom (DOF tracked robots that are equipped with subtracks are commonly used. These types of robots have superior locomotion performance on rough terrain. However, in teleoperated missions, the performance of tracked robots depends largely on the operators’ ability to control every subtrack appropriately. Therefore, an autonomous traversal function can significantly help in the teleoperation of such robots. In this paper, we propose a planning and control method for 4-DOF tracked robots climbing up/down known stairs automatically based on internal sensors. Experimental results obtained using mockup stairs verify the effectiveness of the proposed method.
IKO: A Five Actuated DoF Upper Limb Exoskeleton Oriented to Workplace Assistance
Directory of Open Access Journals (Sweden)
Felix Martinez
2009-01-01
Full Text Available IKerlan’s Orthosis (IKO is an upper limb exoskeleton oriented to increasing human force during routine activity at the workplace. Therefore, it can be considered as a force-amplification device conceived to work in collaboration with the human arm and implementing biomimetic principles. The aim of the proposed design is to find the best compromise between maximum reachable workspace and minimum moving mass, which are the key factors for obtaining an ergonomic, wearable exoskeleton. It consists of five actuated degree of freedom (DoF to move the human arm and three non-actuated DoF between the back and shoulder to allow relative displacement of the sterno-clavicular joint. Conventional electrical motors are used for most of the DoF and pneumatic muscles for one of them (forearm rotation. Power transmission is based on Bowden cables. This paper presents the IKO design, the mechanical structure of a first prototype and the redesign process from an aesthetic point of view. Controller set-up and control strategies are also shown, together with dynamic performance from experimental results.
Dunning, A.G.; Tolou, N.; Herder, J.
2011-01-01
For many applications in precision engineering, a six degrees of freedom (DoF) compliant stage (CS) with zero stiffness is desirable, to deal with problems like backlash, friction, lubrication, and at the same time, reduce the actuation force. To this end, the compliant stage (also known as
Reference trajectory tracking for a multi-DOF robot arm
Directory of Open Access Journals (Sweden)
Krasňanský Róbert
2015-12-01
Full Text Available This paper presents the problem of tracking the generated reference trajectory by the simulation model of a multi-DOF robot arm. The kinematic transformation between task space and joint configuration coordinates is nonlinear and configuration dependent. To obtain the solution of the forward kinematics problem, the homogeneous transformation matrix is used. A solution to the inverse kinematics is a vector of joint configuration coordinates calculated using of pseudoinverse Jacobian technique. These coordinates correspond to a set of task space coordinates. The algorithm is presented which uses iterative solution and is simplified by considering stepper motors in robot arm joints. The reference trajectory in Cartesian coordinate system is generated on-line by the signal generator previously developed in MS Excel. Dynamic Data Exchange communication protocol allows sharing data with Matlab-Simulink. These data represent the reference tracking trajectory of the end effector. Matlab-Simulink software is used to calculate the representative joint rotations. The proposed algorithm is demonstrated experimentally on the model of 7-DOF robot arm system.
Herlihey, Tracey A; Gelmi, Stefano; Cafazzo, Joseph A; Hall, Trevor N T
2017-06-01
OBJECTIVE To explore the impact of environmental design on doffing personal protective equipment in a simulated healthcare environment. METHODS A mixed-methods approach was used that included human-factors usability testing and qualitative questionnaire responses. A patient room and connecting anteroom were constructed for testing purposes. This experimental doffing area was designed to overcome the environmental failures identified in a previous study and was not constructed based on any generalizable hospital standard. RESULTS In total, 72 healthcare workers from Ontario, Canada, took part in the study and tested the simulated doffing area. The following environmental design changes were tested and were deemed effective: increasing prominence of color-coded zones; securing disinfectant wipes and hand sanitizer; outlining disposal bins locations; providing mirrors to detect possible contamination; providing hand rails to assist with doffing; and restricting the space to doff. Further experimentation and iterative design are required with regard to several important features: positioning the disposal bins for safety, decreasing the risk of contamination and user accessibility; optimal positioning of mirrors for safety; communication within the team; and positioning the secondary team member for optimal awareness. Additional design suggestions also emerged during this study, and they require future investigation. CONCLUSIONS This study highlights the importance of the environment on doffing personal protective equipment in a healthcare setting. Iterative testing and modification of the design of the environment (doffing area) are important to enhancing healthcare worker safety. Infect Control Hosp Epidemiol 2017;38:712-717.
International Nuclear Information System (INIS)
Mian, Muhammad Umer; Khir, M. H. Md.; Tang, T. B.; Dennis, John Ojur; Riaz, Kashif; Iqbal, Abid; Bazaz, Shafaat A.
2015-01-01
Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used
Energy Technology Data Exchange (ETDEWEB)
Mian, Muhammad Umer, E-mail: umermian@gmail.com; Khir, M. H. Md.; Tang, T. B. [Department of Electrical and Electronic Engineering, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Dennis, John Ojur [Department of Fundamental & Applied Sciences, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Riaz, Kashif; Iqbal, Abid [Faculty of Electronics Engineering, GIK Institute of Engineering Sciences and Technology, Topi, Khyber Pakhtunkhaw (Pakistan); Bazaz, Shafaat A. [Department of Computer Science, Center for Advance Studies in Engineering, Islamabad (Pakistan)
2015-07-22
Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used.
Co-simulation of dynamic systems in parallel and serial model configurations
International Nuclear Information System (INIS)
Sweafford, Trevor; Yoon, Hwan Sik
2013-01-01
Recent advancement in simulation software and computation hardware make it realizable to simulate complex dynamic systems comprised of multiple submodels developed in different modeling languages. The so-called co-simulation enables one to study various aspects of a complex dynamic system with heterogeneous submodels in a cost-effective manner. Among several different model configurations for co-simulation, synchronized parallel configuration is regarded to expedite the simulation process by simulation multiple sub models concurrently on a multi core processor. In this paper, computational accuracies as well as computation time are studied for three different co-simulation frameworks : integrated, serial, and parallel. for this purpose, analytical evaluations of the three different methods are made using the explicit Euler method and then they are applied to two-DOF mass-spring systems. The result show that while the parallel simulation configuration produces the same accurate results as the integrated configuration, results of the serial configuration, results of the serial configuration show a slight deviation. it is also shown that the computation time can be reduced by running simulation in the parallel configuration. Therefore, it can be concluded that the synchronized parallel simulation methodology is the best for both simulation accuracy and time efficiency.
Lassooij, J.; Tolou, N.; Tortora, G.; Caccavaro, S.; Menciassi, A.; Herder, J.L.
2012-01-01
This article presents the design of a newly developed 2DoF robotic arm with a novel statically balanced and bi-stable compliant grasper as the end effector for laparoscopic surgery application. The arm is based on internal motors actuating 2 rotational DoFs: pitch and roll. The positive stiffness of
A NEW GENERAL 3DOF QUASI-STEADY AERODYNAMIC INSTABILITY MODEL
DEFF Research Database (Denmark)
Gjelstrup, Henrik; Larsen, Allan; Georgakis, Christos
2008-01-01
but can generally be applied for aerodynamic instability prediction for prismatic bluff bodies. The 3DOF, which make up the movement of the model, are the displacements in the XY-plane and the rotation around the bluff body’s rotational axis. The proposed model incorporates inertia coupling between...
An Inertial and Optical Sensor Fusion Approach for Six Degree-of-Freedom Pose Estimation
He, Changyu; Kazanzides, Peter; Sen, Hasan Tutkun; Kim, Sungmin; Liu, Yue
2015-01-01
Optical tracking provides relatively high accuracy over a large workspace but requires line-of-sight between the camera and the markers, which may be difficult to maintain in actual applications. In contrast, inertial sensing does not require line-of-sight but is subject to drift, which may cause large cumulative errors, especially during the measurement of position. To handle cases where some or all of the markers are occluded, this paper proposes an inertial and optical sensor fusion approach in which the bias of the inertial sensors is estimated when the optical tracker provides full six degree-of-freedom (6-DOF) pose information. As long as the position of at least one marker can be tracked by the optical system, the 3-DOF position can be combined with the orientation estimated from the inertial measurements to recover the full 6-DOF pose information. When all the markers are occluded, the position tracking relies on the inertial sensors that are bias-corrected by the optical tracking system. Experiments are performed with an augmented reality head-mounted display (ARHMD) that integrates an optical tracking system (OTS) and inertial measurement unit (IMU). Experimental results show that under partial occlusion conditions, the root mean square errors (RMSE) of orientation and position are 0.04° and 0.134 mm, and under total occlusion conditions for 1 s, the orientation and position RMSE are 0.022° and 0.22 mm, respectively. Thus, the proposed sensor fusion approach can provide reliable 6-DOF pose under long-term partial occlusion and short-term total occlusion conditions. PMID:26184191
Qibo, Feng; Bin, Zhang; Cunxing, Cui; Cuifang, Kuang; Yusheng, Zhai; Fenglin, You
2013-11-04
A simple method for simultaneously measuring the 6DOF geometric motion errors of the linear guide was proposed. The mechanisms for measuring straightness and angular errors and for enhancing their resolution are described in detail. A common-path method for measuring the laser beam drift was proposed and it was used to compensate the errors produced by the laser beam drift in the 6DOF geometric error measurements. A compact 6DOF system was built. Calibration experiments with certain standard measurement meters showed that our system has a standard deviation of 0.5 µm in a range of ± 100 µm for the straightness measurements, and standard deviations of 0.5", 0.5", and 1.0" in the range of ± 100" for pitch, yaw, and roll measurements, respectively.
Real-time control of the 3-DOF sled dynamics of a null-flux Maglev System with a passive sled
Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.
2006-01-01
The real-time control of the three degrees of freedom (DOF) dynamics of an electrodynamic (EDS) Maglev vehicle is presented. The design is based on a 5-DOF state-space model of the sled dynamics that uses a simple algebraic model to describe the interaction between the -flux coils on the track and
Mechatronic Model Based Computed Torque Control of a Parallel Manipulator
Directory of Open Access Journals (Sweden)
Zhiyong Yang
2008-11-01
Full Text Available With high speed and accuracy the parallel manipulators have wide application in the industry, but there still exist many difficulties in the actual control process because of the time-varying and coupling. Unfortunately, the present-day commercial controlles cannot provide satisfying performance for its single axis linear control only. Therefore, aimed at a novel 2-DOF (Degree of Freedom parallel manipulator called Diamond 600, a motor-mechanism coupling dynamic model based control scheme employing the computed torque control algorithm are presented in this paper. First, the integrated dynamic coupling model is deduced, according to equivalent torques between the mechanical structure and the PM (Permanent Magnetism servomotor. Second, computed torque controller is described in detail for the above proposed model. At last, a series of numerical simulations and experiments are carried out to test the effectiveness of the system, and the results verify the favourable tracking ability and robustness.
Mechatronic Model Based Computed Torque Control of a Parallel Manipulator
Directory of Open Access Journals (Sweden)
Zhiyong Yang
2008-03-01
Full Text Available With high speed and accuracy the parallel manipulators have wide application in the industry, but there still exist many difficulties in the actual control process because of the time-varying and coupling. Unfortunately, the present-day commercial controlles cannot provide satisfying performance for its single axis linear control only. Therefore, aimed at a novel 2-DOF (Degree of Freedom parallel manipulator called Diamond 600, a motor-mechanism coupling dynamic model based control scheme employing the computed torque control algorithm are presented in this paper. First, the integrated dynamic coupling model is deduced, according to equivalent torques between the mechanical structure and the PM (Permanent Magnetism servomotor. Second, computed torque controller is described in detail for the above proposed model. At last, a series of numerical simulations and experiments are carried out to test the effectiveness of the system, and the results verify the favourable tracking ability and robustness.
Kinematic Analysis and Optimization of a New Compliant Parallel Micromanipulator
Directory of Open Access Journals (Sweden)
Qingsong Xu
2008-11-01
Full Text Available In this paper, a new three translational degrees of freedom (DOF compliant parallel micromanipulator (CPM is proposed, which has an excellent accuracy of parallel mechanisms with flexure hinges. The system is established by a proper selection of hardware and analyzed via the derived pseudo-rigid-body model. In view of the physical constraints imposed by both the piezoelectric actuators and flexure hinges, the CPM's reachable workspace is determined analytically, where a maximum cylinder defined as an usable workspace can be inscribed. Moreover, the optimal design of the CPM with the consideration of the usable workspace size and global dexterity index simultaneously is carried out by utilizing the approaches of direct search method, genetic algorithm (GA, and particle swarm optimization (PSO, respectively. The simulation results show that the PSO is the best method for the optimization, and the results are valuable in the design of a new micromanipulator.
Simulation and training of lumbar punctures using haptic volume rendering and a 6DOF haptic device
Färber, Matthias; Heller, Julika; Handels, Heinz
2007-03-01
The lumbar puncture is performed by inserting a needle into the spinal chord of the patient to inject medicaments or to extract liquor. The training of this procedure is usually done on the patient guided by experienced supervisors. A virtual reality lumbar puncture simulator has been developed in order to minimize the training costs and the patient's risk. We use a haptic device with six degrees of freedom (6DOF) to feedback forces that resist needle insertion and rotation. An improved haptic volume rendering approach is used to calculate the forces. This approach makes use of label data of relevant structures like skin, bone, muscles or fat and original CT data that contributes information about image structures that can not be segmented. A real-time 3D visualization with optional stereo view shows the punctured region. 2D visualizations of orthogonal slices enable a detailed impression of the anatomical context. The input data consisting of CT and label data and surface models of relevant structures is defined in an XML file together with haptic rendering and visualization parameters. In a first evaluation the visible human male data has been used to generate a virtual training body. Several users with different medical experience tested the lumbar puncture trainer. The simulator gives a good haptic and visual impression of the needle insertion and the haptic volume rendering technique enables the feeling of unsegmented structures. Especially, the restriction of transversal needle movement together with rotation constraints enabled by the 6DOF device facilitate a realistic puncture simulation.
Development of a 6DOF robotic motion phantom for radiation therapy
International Nuclear Information System (INIS)
Belcher, Andrew H.; Liu, Xinmin; Grelewicz, Zachary; Pearson, Erik; Wiersma, Rodney D.
2014-01-01
Purpose: The use of medical technology capable of tracking patient motion or positioning patients along 6 degree-of-freedom (6DOF) has steadily increased in the field of radiation therapy. However, due to the complex nature of tracking and performing 6DOF motion, it is critical that such technology is properly verified to be operating within specifications in order to ensure patient safety. In this study, a robotic motion phantom is presented that can be programmed to perform highly accurate motion along any X (left–right), Y (superior–inferior), Z (anterior–posterior), pitch (around X), roll (around Y), and yaw (around Z) axes. In addition, highly synchronized motion along all axes can be performed in order to simulate the dynamic motion of a tumor in 6D. The accuracy and reproducibility of this 6D motion were characterized. Methods: An in-house designed and built 6D robotic motion phantom was constructed following the Stewart–Gough parallel kinematics platform archetype. The device was controlled using an inverse kinematics formulation, and precise movements in all 6 degrees-of-freedom (X, Y, Z, pitch, roll, and yaw) were performed, both simultaneously and separately for each degree-of-freedom. Additionally, previously recorded 6D cranial and prostate motions were effectively executed. The robotic phantom movements were verified using a 15 fps 6D infrared marker tracking system and the measured trajectories were compared quantitatively to the intended input trajectories. The workspace, maximum 6D velocity, backlash, and weight load capabilities of the system were also established. Results: Evaluation of the 6D platform demonstrated translational root mean square error (RMSE) values of 0.14, 0.22, and 0.08 mm over 20 mm in X and Y and 10 mm in Z, respectively, and rotational RMSE values of 0.16°, 0.06°, and 0.08° over 10° of pitch, roll, and yaw, respectively. The robotic stage also effectively performed controlled 6D motions, as well as reproduced
Development of a Flat Type Six-Axis Stage Based on Piezoelectric Actuators
Directory of Open Access Journals (Sweden)
Hau-Wei Lee
2014-01-01
Full Text Available This study presents and investigates a six-DOF (degrees of freedom piezoelectric based stage for positioning error compensation. The relationship between the displacement of the piezoelectric actuators and the stage can be computed according to the geometric relationships of the actuators installed. In this study, a feedforward compensator based on the hysteresis model has been designed for compensation and a PI controller was used for positioning. The combination of a feedforward compensator and PI controller gives the stage good positioning and tracking performance. Stage position information is feedback from a six-DOF optical measurement system comprised of three modular two-dimensional measurement devices. Each module employs a quadrant photodiode (QPD, a laser diode, and a lens. The measurement signal is acquired and processed using an FPGA based processor for real time control. The linear and angular positioning resolution is 0.02 μm and 0.1 arcsec, respectively. When the stage is controlled in a closed loop, the positioning errors are in the range of ±0.1 μm and ±0.5 arcsec. The stage is controlled to track a sinusoidal wave with an amplitude of 2.5 μm and a frequency of 5 Hz; tracking errors were within ±0.1 μm and ±0.2 arcsec.
Module Six: Parallel Circuits; Basic Electricity and Electronics Individualized Learning System.
Bureau of Naval Personnel, Washington, DC.
In this module the student will learn the rules that govern the characteristics of parallel circuits; the relationships between voltage, current, resistance and power; and the results of common troubles in parallel circuits. The module is divided into four lessons: rules of voltage and current, rules for resistance and power, variational analysis,…
A Comparative Study of Control Methods for a Robotic Manipulator with Six DOF in Simulation
Directory of Open Access Journals (Sweden)
Smyrnaiou Georgia P.
2017-01-01
Full Text Available In this paper a comparative study of the classical control methods for the testing of a mathematical model, which controls six actuators of a six degrees of freedom robotic arm with a single controller, is illustrated, aiming to the constructive simplification of the system. In more detail, a mathematical model of the system is designed which simulates all mechanical parts, including 5-way directional pneumatic valve, the pneumatic actuators/pistons and the mathematical model of the controller. The purpose of the above is the tuning of a Single Input, Multiple Output (SIMO controller which will direct the motion of the six pneumatic pistons. The thorough analysis of the implementation of the pneumatic system in Matlab/Simulink environment is followed by experimentation and results using Proportional (P, Proportional-Integral (PI, Proportional-Derivative (PD and Proportional-Integral-Derivative (PID controllers. The simulation results show the advantages of the above classical control methods on the robotic human arm which imitating human motion and made by a well-known company in the field of pneumatic automation.
Ueki, Toshiyuki; Inouye, Sumiko
2005-12-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
Ueki, Toshiyuki; Inouye, Sumiko
2005-01-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
Experimental Analysis and Full Prediction Model of a 5-DOF Motorized Spindle
Directory of Open Access Journals (Sweden)
Weiyu Zhang
2017-01-01
Full Text Available The cost and power consumption of DC power amplifiers are much greater than that of AC power converters. Compared to a motorized spindle supported with DC magnetic bearings, a motorized spindle supported with AC magnetic bearings is inexpensive and more efficient. This paper studies a five-degrees-of-freedom (5-DOF motorized spindle supported with AC hybrid magnetic bearings (HMBs. Most models of suspension forces, except a “switching model”, are quite accurate, but only in a particular operating area and not in regional coverage. If a “switching model” is applied to a 5-DOF motorized spindle, the real-time performance of the control system can be significantly decreased due to the large amount of data processing for both displacement and current. In order to solve this defect, experiments based on the “switching model” are performed, and the resulting data are analyzed. Using the data analysis results, a “full prediction model” based on the operating state is proposed to improve real-time performance and precision. Finally, comparative, verification and stiffness tests are conducted to verify the improvement of the proposed model. Results of the tests indicate that the rotor has excellent characteristics, such as good real-time performance, superior anti-interference performance with load and the accuracy of the model in full zone. The satisfactory experimental results demonstrate the effectiveness of the “full prediction model” applied to the control system under different operating stages. Therefore, the results of the experimental analysis and the proposed full prediction model can provide a control system of a 5-DOF motorized spindle with the most suitable mathematical models of the suspension force.
On Virtual Integrated Model of a 6DoF Manipulator Arm for Emergency Cases Interventions
Directory of Open Access Journals (Sweden)
Gigi Naidin
2011-09-01
Full Text Available This research deals with a virtual integrated model for a 6DoF manipulator arm dedicated to use for emergency situations intervention. The virtual model can simulates both the entire structural and mechanical configuration of the manipulator, and the driving system with automated command unit. The basic idea supposes to develop a complex simulator for kinematical and dynamic behavior analysis of 6DoF robot manipulator, and for facilely cross correlation and comparative evaluation between essential parameters and extremely bearing cases defining the manipulator working state. The analysis was developed in Matlab© - SimScape© software. The conclusions dignify the main functional capability of the manipulator supposing the capacity of driving system and mechanical structure.
Real-time simultaneous and proportional myoelectric control using intramuscular EMG
Smith, Lauren H.; Kuiken, Todd A.; Hargrove, Levi J.
2014-12-01
Objective. Myoelectric prostheses use electromyographic (EMG) signals to control movement of prosthetic joints. Clinically available myoelectric control strategies do not allow simultaneous movement of multiple degrees of freedom (DOFs); however, the use of implantable devices that record intramuscular EMG signals could overcome this constraint. The objective of this study was to evaluate the real-time simultaneous control of three DOFs (wrist rotation, wrist flexion/extension, and hand open/close) using intramuscular EMG. Approach. We evaluated task performance of five able-bodied subjects in a virtual environment using two control strategies with fine-wire EMG: (i) parallel dual-site differential control, which enabled simultaneous control of three DOFs and (ii) pattern recognition control, which required sequential control of DOFs. Main results. Over the course of the experiment, subjects using parallel dual-site control demonstrated increased use of simultaneous control and improved performance in a Fitts’ Law test. By the end of the experiment, performance using parallel dual-site control was significantly better (up to a 25% increase in throughput) than when using sequential pattern recognition control for tasks requiring multiple DOFs. The learning trends with parallel dual-site control suggested that further improvements in performance metrics were possible. Subjects occasionally experienced difficulty in performing isolated single-DOF movements with parallel dual-site control but were able to accomplish related Fitts’ Law tasks with high levels of path efficiency. Significance. These results suggest that intramuscular EMG, used in a parallel dual-site configuration, can provide simultaneous control of a multi-DOF prosthetic wrist and hand and may outperform current methods that enforce sequential control.
International Nuclear Information System (INIS)
Cui, J; Guo, Z Y; Yang, Z C; Hao, Y L; Yan, G Z
2011-01-01
In this paper, we demonstrate a novel control strategy for the drive mode of a microgyroscope using ascending frequency drive (AFD) with an AGC-2DOF PID controller, which drives a resonator with a modulation signal not at the resonant frequency and senses the vibration signal at the resonant frequency, thus realizing the isolation between the actual mechanical response and electrical coupling signal. This approach holds the following three advantages: (1) it employs the AFD signal instead of the resonant frequency drive signal to excite the gyroscope in the drive direction, suppressing the electrical coupling from the drive electrode to the sense electrode; (2) it can reduce the noise at low frequency and resonant frequency by shifting flicker noise to the high-frequency part; (3) it can effectively improve the performance of the transient response of the closed-loop control with a 2-DOF (degree of freedom) PID controller compared with the conventional 1-DOF PID. The stability condition of the whole loop is investigated by utilizing the averaging and linearization method. The control approach is applied to drive a lateral tuning fork microgyroscope. Test results show good agreement with the theoretical and simulation results. The non-ideal electrical antiresonance peak is removed and the resonant peak height increases by approximately 10 dB over a 400 Hz span with a flicker noise reduction of 30 dB within 100 Hz using AFD. The percent overshoot is reduced from 36.2% (1DOF PID) to 8.95% (2DOF PID, about 75.3% overshoot suppression) with 15.3% improvement in setting time
Guan, Shanyuanye; Gray, Hans A; Schache, Anthony G; Feller, Julian; de Steiger, Richard; Pandy, Marcus G
2017-08-01
No data are available to describe six-degree-of-freedom (6-DOF) knee-joint kinematics for one complete cycle of overground walking following total knee arthroplasty (TKA). The aims of this study were firstly, to measure 6-DOF knee-joint kinematics and condylar motion for overground walking following TKA; and secondly, to determine whether such data differed between overground and treadmill gait when participants walked at the same speed during both tasks. A unique mobile biplane X-ray imaging system enabled accurate measurement of 6-DOF TKA knee kinematics during overground walking by simultaneously tracking and imaging the joint. The largest rotations occurred for flexion-extension and internal-external rotation whereas the largest translations were associated with joint distraction and anterior-posterior drawer. Strong associations were found between flexion-extension and adduction-abduction (R 2 = 0.92), joint distraction (R 2 = 1.00), and anterior-posterior translation (R 2 = 0.77), providing evidence of kinematic coupling in the TKA knee. Although the measured kinematic profiles for overground walking were grossly similar to those for treadmill walking, several statistically significant differences were observed between the two conditions with respect to temporo-spatial parameters, 6-DOF knee-joint kinematics, and condylar contact locations and sliding. Thus, caution is advised when making recommendations regarding knee implant performance based on treadmill-measured knee-joint kinematic data. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1634-1643, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
High-capacity quantum secure direct communication with two-photon six-qubit hyperentangled states
Wu, FangZhou; Yang, GuoJian; Wang, HaiBo; Xiong, Jun; Alzahrani, Faris; Hobiny, Aatef; Deng, FuGuo
2017-12-01
This study proposes the first high-capacity quantum secure direct communication (QSDC) with two-photon six-qubit hyper-entangled Bell states in two longitudinal momentum and polarization degrees of freedom (DOFs) of photon pairs, which can be generated using two 0.5 mm-thick type-I β barium borate crystal slabs aligned one behind the other and an eight-hole screen. The secret message can be independently encoded on the photon pairs with 64 unitary operations in all three DOFs. This protocol has a higher capacity than previous QSDC protocols because each photon pair can carry 6 bits of information, not just 2 or 4 bits. Our QSDC protocol decreases the influence of decoherence from environment noise by exploiting the decoy photons to check the security of the transmission of the first photon sequence. Compared with two-way QSDC protocols, our QSDC protocol is immune to an attack by an eavesdropper using Trojan horse attack strategies because it is a one-way quantum communication. The QSDC protocol has good applications in the future quantum communication because of all these features.
Design Optimization of a Cable-Driven Two-DOF Flexible Joint Module
Directory of Open Access Journals (Sweden)
Zhao Zhang
2012-11-01
Full Text Available This paper focuses on the kinematics, kinetostatics and design optimization of a 2-DOF cable-driven flexible joint module. Based on the motion characteristics of the 2-DOF joint module, the concept of instantaneous screw axis in conjunction with the Product-Of-Exponentials (POE formula is proposed to formulate its kinematic model. However, as the instantaneous screw axis is unfixed, the Lie group method is employed to derive the instantaneous kinematic model of the joint module. In order to generate the feasible workspace subject to positive tension constraint, the kinetostatics of the joint module is addressed, where the stiffness resulting from both the driving cables and the flexible backbone are considered. A numerical orientation workspace evaluation method is proposed based on an equi-volumetric partition in its parametric space and the volume-element associated integral factor. A global singular value (GSV index, which considers the minimum singular value of the stiffness matrix of joint module over the achievable workspace, is employed to optimize the geometric size of joint module. The simulation results demonstrate the effectiveness of the proposed GSV optimization algorithm.
A fast high-precision six-degree-of-freedom relative position sensor
Hughes, Gary B.; Macasaet, Van P.; Griswold, Janelle; Sison, Claudia A.; Lubin, Philip; Meinhold, Peter; Suen, Jonathan; Brashears, Travis; Zhang, Qicheng; Madajian, Jonathan
2016-03-01
Lasers are commonly used in high-precision measurement and profiling systems. Some laser measurement systems are based on interferometry principles, and others are based on active triangulation, depending on requirements of the application. This paper describes an active triangulation laser measurement system for a specific application wherein the relative position of two fixed, rigid mechanical components is to be measured dynamically with high precision in six degrees of freedom (DOF). Potential applications include optical systems with feedback to control for mechanical vibration, such as target acquisition devices with multiple focal planes. The method uses an array of several laser emitters mounted on one component. The lasers are directed at a reflective surface on the second component. The reflective surface consists of a piecewise-planar pattern such as a pyramid, or more generally a curved reflective surface such as a hyperbolic paraboloid. The reflected spots are sensed at 2-dimensional photodiode arrays on the emitter component. Changes in the relative position of the emitter component and reflective surface will shift the location of the reflected spots within photodiode arrays. Relative motion in any degree of freedom produces independent shifts in the reflected spot locations, allowing full six-DOF relative position determination between the two component positions. Response time of the sensor is limited by the read-out rate of the photodiode arrays. Algorithms are given for position determination with limits on uncertainty and sensitivity, based on laser and spot-sensor characteristics, and assuming regular surfaces. Additional uncertainty analysis is achievable for surface irregularities based on calibration data.
Design of a 7-DOF slave robot integrated with a magneto-rheological haptic master
Hwang, Yong-Hoon; Cha, Seung-Woo; Kang, Seok-Rae; Choi, Seung-Bok
2017-04-01
In this study, a 7-DOF slave robot integrated with the haptic master is designed and its dynamic motion is controlled. The haptic master is made using a controllable magneto-rheological (MR) clutch and brake and it provides the surgeon with a sense of touch by using both kinetic and kinesthetic information. Due to the size constraint of the slave robot, a wire actuating is adopted to make the desired motion of the end-effector which has 3-DOF instead of a conventional direct-driven motor. Another motions of the link parts that have 4-DOF use direct-driven motor. In total system, for working as a haptic device, the haptic master need to receive the information of repulsive forces applied on the slave robot. Therefore, repulsive forces on the end-effector are sensed by using three uniaxial torque transducer inserted in the wire actuating system and another repulsive forces applied on link part are sensed by using 6-axis transducer that is able to sense forces and torques. Using another 6-axis transducer, verify the reliability of force information on final end of slave robot. Lastly, integrated with a MR haptic master, psycho-physical test is conducted by different operators who can feel the different repulsive force or torque generated from the haptic master which is equivalent to the force or torque occurred on the end-effector to demonstrate the effectiveness of the proposed system.
Instantaneous Kinematics Analysis via Screw-Theory of a Novel 3-CRC Parallel Mechanism
Directory of Open Access Journals (Sweden)
Hussein de la Torre
2016-06-01
Full Text Available This paper presents the mobility and kinematics analysis of a novel parallel mechanism that is composed by one base, one platform and three identical limbs with CRC joints. The paper obtains closed-form solutions to the direct and inverse kinematics problems, and determines the mobility of the mechanism and instantaneous kinematics by applying screw theory. The obtained results show that this parallel robot is part of the family 2R1T, since the platform shows 3 DOF, i.e.: one translation perpendicular to the base and two rotations about skew axes. In order to calculate the direct instantaneous kinematics, this paper introduces the vector mh, which is part of the joint velocity vector that multiplies the overall inverse Jacobian matrix. This paper compares the results between simulations and numerical examples using Mathematica and SolidWorks in order to prove the accuracy of the analytical results.
Shared memory parallelism for 3D cartesian discrete ordinates solver
International Nuclear Information System (INIS)
Moustafa, S.; Dutka-Malen, I.; Plagne, L.; Poncot, A.; Ramet, P.
2013-01-01
This paper describes the design and the performance of DOMINO, a 3D Cartesian SN solver that implements two nested levels of parallelism (multi-core + SIMD - Single Instruction on Multiple Data) on shared memory computation nodes. DOMINO is written in C++, a multi-paradigm programming language that enables the use of powerful and generic parallel programming tools such as Intel TBB and Eigen. These two libraries allow us to combine multi-thread parallelism with vector operations in an efficient and yet portable way. As a result, DOMINO can exploit the full power of modern multi-core processors and is able to tackle very large simulations, that usually require large HPC clusters, using a single computing node. For example, DOMINO solves a 3D full core PWR eigenvalue problem involving 26 energy groups, 288 angular directions (S16), 46*10 6 spatial cells and 1*10 12 DoFs within 11 hours on a single 32-core SMP node. This represents a sustained performance of 235 GFlops and 40.74% of the SMP node peak performance for the DOMINO sweep implementation. The very high Flops/Watt ratio of DOMINO makes it a very interesting building block for a future many-nodes nuclear simulation tool. (authors)
Adaptive PSO for optimal LQR tracking control of 2 DoF laboratory helicopter
Vinodh Kumar, E.; Ganapathy Subramanian, R.; Jerome, J.
2016-01-01
This paper deals with the attitude tracking control problem for a 2 DoF laboratory helicopter using optimal linear quadratic regulator (LQR). As the performance of the LQR controller greatly depends on the weighting matrices (Q and R), it is important to select them optimally. However, normally the
Operation analysis of a Chebyshev-Pantograph leg mechanism for a single DOF biped robot
Liang, Conghui; Ceccarelli, Marco; Takeda, Yukio
2012-12-01
In this paper, operation analysis of a Chebyshev-Pantograph leg mechanism is presented for a single degree of freedom (DOF) biped robot. The proposed leg mechanism is composed of a Chebyshev four-bar linkage and a pantograph mechanism. In contrast to general fully actuated anthropomorphic leg mechanisms, the proposed leg mechanism has peculiar features like compactness, low-cost, and easy-operation. Kinematic equations of the proposed leg mechanism are formulated for a computer oriented simulation. Simulation results show the operation performance of the proposed leg mechanism with suitable characteristics. A parametric study has been carried out to evaluate the operation performance as function of design parameters. A prototype of a single DOF biped robot equipped with two proposed leg mechanisms has been built at LARM (Laboratory of Robotics and Mechatronics). Experimental test shows practical feasible walking ability of the prototype, as well as drawbacks are discussed for the mechanical design.
Robust design of a 2-DOF GMV controller: a direct self-tuning and fuzzy scheduling approach.
Silveira, Antonio S; Rodríguez, Jaime E N; Coelho, Antonio A R
2012-01-01
This paper presents a study on self-tuning control strategies with generalized minimum variance control in a fixed two degree of freedom structure-or simply GMV2DOF-within two adaptive perspectives. One, from the process model point of view, using a recursive least squares estimator algorithm for direct self-tuning design, and another, using a Mamdani fuzzy GMV2DOF parameters scheduling technique based on analytical and physical interpretations from robustness analysis of the system. Both strategies are assessed by simulation and real plants experimentation environments composed of a damped pendulum and an under development wind tunnel from the Department of Automation and Systems of the Federal University of Santa Catarina. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.
Quantum wave packet study of D+OF reaction
International Nuclear Information System (INIS)
Kurban, M.; Karabulut, E.; Tutuk, R.; Goektas, F.
2010-01-01
The quantum dynamics of the D+OF reaction on the adiabatic potential energy surface of the ground 1 3 A ' state has been studied by using a time-dependent quantum real wave packet method. The state-to-state and state-to-all reaction probabilities for total angular momentum J = 0 have been calculated. The probabilities for J > 0 have been calculated by J-shifting the J = 0 results by means of capture model. Then, the integral cross sections and initial state selected rate constants have been calculated. The initial state-selected reaction probabilities and reaction cross section show threshold but not manifest any resonances and the initial state selected rate constants are sensitive to the temperature.
Torque Measurement of 3-DOF Haptic Master Operated by Controllable Electrorheological Fluid
Directory of Open Access Journals (Sweden)
Oh Jong-Seok
2015-02-01
Full Text Available This work presents a torque measurement method of 3-degree-of-freedom (3-DOF haptic master featuring controllable electrorheological (ER fluid. In order to reflect the sense of an organ for a surgeon, the ER haptic master which can generate the repulsive torque of an organ is utilized as a remote controller for a surgery robot. Since accurate representation of organ feeling is essential for the success of the robot-assisted surgery, it is indispensable to develop a proper torque measurement method of 3-DOF ER haptic master. After describing the structural configuration of the haptic master, the torque models of ER spherical joint are mathematically derived based on the Bingham model of ER fluid. A new type of haptic device which has pitching, rolling, and yawing motions is then designed and manufactured using a spherical joint mechanism. Subsequently, the field-dependent parameters of the Bingham model are identified and generating repulsive torque according to applied electric field is measured. In addition, in order to verify the effectiveness of the proposed torque model, a comparative work between simulated and measured torques is undertaken.
Okubo, Takuro; Harada, Kanako; Fujii, Masahiro; Tanaka, Shinichi; Ishimaru, Tetsuya; Iwanaka, Tadashi; Nakatomi, Hirohumi; Sora, Sigeo; Morita, Akio; Sugita, Naohiko; Mitsuishi, Mamoru
2014-01-01
Neurosurgical procedures require precise and dexterous manipulation of a surgical suture in narrow and deep spaces in the brain. This is necessary for surgical tasks such as the anastomosis of microscopic blood vessels and dura mater suturing. A hand-held multi-degree of freedom (DOF) robotic forceps was developed to aid the performance of such difficult tasks. The diameter of the developed robotic forceps is 3.5 mm, and its tip has three DOFs, namely, bending, rotation, and grip. Experimental results showed that the robotic forceps had an average needle insertion force of 1.7 N. Therefore, an increase in the needle insertion force is necessary for practical application of the developed device.
Directory of Open Access Journals (Sweden)
Ho Pham Huy Anh
2012-10-01
Full Text Available In this paper, a novel forward adaptive neural MIMO NARX model is used for modelling and identifying the forward kinematics of an industrial 3-DOF robot arm system. The nonlinear features of the forward kinematics of the industrial robot arm drive are thoroughly modelled based on the forward adaptive neural NARX model-based identification process using experimental input-output training data. This paper proposes a novel use of a back propagation (BP algorithm to generate the forward neural MIMO NARX (FNMN model for the forward kinematics of the industrial 3-DOF robot arm. The results show that the proposed adaptive neural NARX model trained by a Back Propagation learning algorithm yields outstanding performance and perfect accuracy.
Markov Chain Monte Carlo (MCMC) methods for parameter estimation of a novel hybrid redundant robot
International Nuclear Information System (INIS)
Wang Yongbo; Wu Huapeng; Handroos, Heikki
2011-01-01
This paper presents a statistical method for the calibration of a redundantly actuated hybrid serial-parallel robot IWR (Intersector Welding Robot). The robot under study will be used to carry out welding, machining, and remote handing for the assembly of vacuum vessel of International Thermonuclear Experimental Reactor (ITER). The robot has ten degrees of freedom (DOF), among which six DOF are contributed by the parallel mechanism and the rest are from the serial mechanism. In this paper, a kinematic error model which involves 54 unknown geometrical error parameters is developed for the proposed robot. Based on this error model, the mean values of the unknown parameters are statistically analyzed and estimated by means of Markov Chain Monte Carlo (MCMC) approach. The computer simulation is conducted by introducing random geometric errors and measurement poses which represent the corresponding real physical behaviors. The simulation results of the marginal posterior distributions of the estimated model parameters indicate that our method is reliable and robust.
Study on the Workspace of a 6-DOF Parallel Topology Robot Related to Binary Link Lengths
Directory of Open Access Journals (Sweden)
Calin-Octavian Miclosina
2016-12-01
Full Text Available The paper presents a study on the workspace of a parallel topology robot with the structure FP3+6•SPS+MP3. The variable parameters are the binary link lengths, from both upper and lower levels, and the driving kinematical joint strokes. The workspace boundary is determined by SolidWorks software simulations. For different binary link lengths, workspace volume is determined and sections through the workspace are presented.
Sliding mode control of a "Soft" 2-DOF Planar Pneumatic Manipulator
Van Damme, M.; Vanderborght, B.; Beyl, P.; Versluys, R.; Vanderniepen, I.; Van Ham, R.; Cherelle, P.; Daerden, F.; Lefeber, D.
2008-10-01
This paper presents a sliding mode controller for a "Soft" 2-DOF Planar Pneumatic Manipulator actuated by pleated pneumatic artificial muscle actuators. Since actuator dynamics is not negligible, an approximate model for pressure dynamics was taken into account, which made it necessary to perform full input-output feedback linearization in order to design a sliding mode controller. The design of the controller is presented in detail, and experimental results obtained by implementing the controller are discussed
Evaluation of Linear Regression Simultaneous Myoelectric Control Using Intramuscular EMG.
Smith, Lauren H; Kuiken, Todd A; Hargrove, Levi J
2016-04-01
The objective of this study was to evaluate the ability of linear regression models to decode patterns of muscle coactivation from intramuscular electromyogram (EMG) and provide simultaneous myoelectric control of a virtual 3-DOF wrist/hand system. Performance was compared to the simultaneous control of conventional myoelectric prosthesis methods using intramuscular EMG (parallel dual-site control)-an approach that requires users to independently modulate individual muscles in the residual limb, which can be challenging for amputees. Linear regression control was evaluated in eight able-bodied subjects during a virtual Fitts' law task and was compared to performance of eight subjects using parallel dual-site control. An offline analysis also evaluated how different types of training data affected prediction accuracy of linear regression control. The two control systems demonstrated similar overall performance; however, the linear regression method demonstrated improved performance for targets requiring use of all three DOFs, whereas parallel dual-site control demonstrated improved performance for targets that required use of only one DOF. Subjects using linear regression control could more easily activate multiple DOFs simultaneously, but often experienced unintended movements when trying to isolate individual DOFs. Offline analyses also suggested that the method used to train linear regression systems may influence controllability. Linear regression myoelectric control using intramuscular EMG provided an alternative to parallel dual-site control for 3-DOF simultaneous control at the wrist and hand. The two methods demonstrated different strengths in controllability, highlighting the tradeoff between providing simultaneous control and the ability to isolate individual DOFs when desired.
Modeling the 3-DOF dynamics of an electrodynamic Maglev suspension system with a passive sled
Boeij, de J.; Gutierrez, H.M.; Agarwal, R.; Steinbuch, M.
2003-01-01
A model that describes the 3-DOF dynamics of a passively levitated electro-dynamic maglevsystem is presented. The model is based on the flux-current-force interactions and the geometricrelationships between the levitation coils and the permanent magnets on the sled. The model ispresented in a
Żuk, Magdalena; Pezowicz, Celina
2015-01-01
Objective. The purpose of the present work was to assess the validity of a six-degrees-of-freedom gait analysis model based on the ISB recommendation on definitions of joint coordinate systems (ISB 6DOF) through a quantitative comparison with the Helen Hays model (HH) and repeatability assessment. Methods. Four healthy subjects were analysed with both marker sets: an HH marker set and four marker clusters in ISB 6DOF. A navigated pointer was used to indicate the anatomical landmark position in the cluster reference system according to the ISB recommendation. Three gait cycles were selected from the data collected simultaneously for the two marker sets. Results. Two protocols showed good intertrial repeatability, which apart from pelvic rotation did not exceed 2°. The greatest differences between protocols were observed in the transverse plane as well as for knee angles. Knee internal/external rotation revealed the lowest subject-to-subject and interprotocol repeatability and inconsistent patterns for both protocols. Knee range of movement in transverse plane was overestimated for the HH set (the mean is 34°), which could indicate the cross-talk effect. Conclusions. The ISB 6DOF anatomically based protocol enabled full 3D kinematic description of joints according to the current standard with clinically acceptable intertrial repeatability and minimal equipment requirements.
Kinematic modelling of a five-DOFs spatial manipulator used in robot-assisted surgery
Directory of Open Access Journals (Sweden)
Shakti Singh
2016-09-01
Full Text Available Since last three decades, research in the field of robot kinematics is boosted-up among different researchers worldwide. This is mainly due to their increased use in various challenging fields of engineering and science. One such challenging application is the use of master–slave concept in a robot-assisted surgery. The authors have already performed the kinematic study and gravity balancing of seven degrees-of-freedom (DOFs surgeon-side manipulator (Singh et al., 2015a, 2015b. To meet these challenging demands, the most important aspect of a robotic manipulator is to develop an accurate kinematic model. In this direction, different researchers in the literature have made significant contributions. Out of these, the most prominent one is D–H parameters method, which was proposed by Denavit and Hartenberg in 1955. In the present work, this method is applied to a five-DOFs spatial manipulator, named as patient-side manipulator, which tracks the motion of surgeon-side manipulator during a robot-assisted surgery. The prototype considered in this work is a spatial serial manipulator, being developed at CSIR-CSIO Chandigarh. Experimental validations are performed and results are found to be in close agreement.
Error Modeling and Experimental Study of a Flexible Joint 6-UPUR Parallel Six-Axis Force Sensor.
Zhao, Yanzhi; Cao, Yachao; Zhang, Caifeng; Zhang, Dan; Zhang, Jie
2017-09-29
By combining a parallel mechanism with integrated flexible joints, a large measurement range and high accuracy sensor is realized. However, the main errors of the sensor involve not only assembly errors, but also deformation errors of its flexible leg. Based on a flexible joint 6-UPUR (a kind of mechanism configuration where U-universal joint, P-prismatic joint, R-revolute joint) parallel six-axis force sensor developed during the prephase, assembly and deformation error modeling and analysis of the resulting sensors with a large measurement range and high accuracy are made in this paper. First, an assembly error model is established based on the imaginary kinematic joint method and the Denavit-Hartenberg (D-H) method. Next, a stiffness model is built to solve the stiffness matrix. The deformation error model of the sensor is obtained. Then, the first order kinematic influence coefficient matrix when the synthetic error is taken into account is solved. Finally, measurement and calibration experiments of the sensor composed of the hardware and software system are performed. Forced deformation of the force-measuring platform is detected by using laser interferometry and analyzed to verify the correctness of the synthetic error model. In addition, the first order kinematic influence coefficient matrix in actual circumstances is calculated. By comparing the condition numbers and square norms of the coefficient matrices, the conclusion is drawn theoretically that it is very important to take into account the synthetic error for design stage of the sensor and helpful to improve performance of the sensor in order to meet needs of actual working environments.
Error Modeling and Experimental Study of a Flexible Joint 6-UPUR Parallel Six-Axis Force Sensor
Directory of Open Access Journals (Sweden)
Yanzhi Zhao
2017-09-01
Full Text Available By combining a parallel mechanism with integrated flexible joints, a large measurement range and high accuracy sensor is realized. However, the main errors of the sensor involve not only assembly errors, but also deformation errors of its flexible leg. Based on a flexible joint 6-UPUR (a kind of mechanism configuration where U-universal joint, P-prismatic joint, R-revolute joint parallel six-axis force sensor developed during the prephase, assembly and deformation error modeling and analysis of the resulting sensors with a large measurement range and high accuracy are made in this paper. First, an assembly error model is established based on the imaginary kinematic joint method and the Denavit-Hartenberg (D-H method. Next, a stiffness model is built to solve the stiffness matrix. The deformation error model of the sensor is obtained. Then, the first order kinematic influence coefficient matrix when the synthetic error is taken into account is solved. Finally, measurement and calibration experiments of the sensor composed of the hardware and software system are performed. Forced deformation of the force-measuring platform is detected by using laser interferometry and analyzed to verify the correctness of the synthetic error model. In addition, the first order kinematic influence coefficient matrix in actual circumstances is calculated. By comparing the condition numbers and square norms of the coefficient matrices, the conclusion is drawn theoretically that it is very important to take into account the synthetic error for design stage of the sensor and helpful to improve performance of the sensor in order to meet needs of actual working environments.
New Jacobian Matrix and Equations of Motion for a 6 d.o.f Cable-Driven Robot
Directory of Open Access Journals (Sweden)
Ali Afshari
2007-03-01
Full Text Available In this paper, we introduce a new method and new motion variables to study kinematics and dynamics of a 6 d.o.f cable-driven robot. Using these new variables and Lagrange equations, we achieve new equations of motion which are different in appearance and several aspects from conventional equations usually used to study 6 d.o.f cable robots. Then, we introduce a new Jacobian matrix which expresses kinematical relations of the robot via a new approach and is basically different from the conventional Jacobian matrix. One of the important characteristics of the new method is computational efficiency in comparison with the conventional method. It is demonstrated that using the new method instead of the conventional one, significantly reduces the computation time required to determine workspace of the robot as well as the time required to solve the equations of motion.
Directory of Open Access Journals (Sweden)
Zoltan-Iosif Korka
2016-12-01
Full Text Available The paper presents an experimental investigation regarding the positioning accuracy and kinematical parameters of the base translation module of a 6-DOF industrial robot. The positioning error of the translation module was computed for two cases: one way movement and reversed movement.
Directory of Open Access Journals (Sweden)
Tian Tixian
2015-04-01
Full Text Available A new simple and effective inertial parameter identification method based on sinusoidal vibrations of a six-degree-of-freedom parallel manipulator is proposed. Compared with previously known identification algorithms, the advantages of the new approach are there is no need to design the excitation trajectory to consider the condition number of the observation matrix and the inertial matrix can be accurately defined regardless of the effect of viscous friction. In addition, the use of a sinusoidal exciting trajectory allows calculation of the velocities and accelerations from the measured position response. Simulations show that the new approach has acceptable tolerance of dry friction when using a simple coupling parameter modified formula. The experimental application to the hydraulically driven Stewart platform demonstrates the capability and efficiency of the proposed identification method.
Parallel processing for artificial intelligence 1
Kanal, LN; Kumar, V; Suttner, CB
1994-01-01
Parallel processing for AI problems is of great current interest because of its potential for alleviating the computational demands of AI procedures. The articles in this book consider parallel processing for problems in several areas of artificial intelligence: image processing, knowledge representation in semantic networks, production rules, mechanization of logic, constraint satisfaction, parsing of natural language, data filtering and data mining. The publication is divided into six sections. The first addresses parallel computing for processing and understanding images. The second discus
Tsukamoto, Jun; Iwai, Daisuke; Kashima, Kenji
2015-11-01
This paper proposes a novel radiometric compensation technique for cooperative projection system based-on distributed optimization. To achieve high scalability and robustness, we assume cooperative projection environments such that 1. each projector does not have information about other projectors as well as target images, 2. the camera does not have information about the projectors either, while having the target images, and 3. only a broadcast communication from the camera to the projectors is allowed to suppress the data transfer bandwidth. To this end, we first investigate a distributed optimization based feedback mechanism that is suitable for the required decentralized information processing environment. Next, we show that this mechanism works well for still image projection, however not necessary for moving images due to the lack of dynamic responsiveness. To overcome this issue, we propose to implement an additional feedforward mechanism. Such a 2 Degree Of Freedom (2-DOF) control structure is well-known in control engineering community as a typical method to enhance not only disturbance rejection but also reference tracking capability, simultaneously. We theoretically guarantee and experimentally demonstrate that this 2-DOF structure yields the moving image projection accuracy that is overwhelming the best achievable performance only by the distributed optimization mechanisms.
2012-10-29
... activity in both options and underlying stocks.\\23\\ In addition, the Exchange states that its surveillance... exercise limits are designed to minimize the potential for mini-manipulations and for corners or squeezes... believes that this liquidity would lessen the opportunity for manipulation of this product and disruption...
Athanasios lliopoulos; John G. Michopoulos; John G. C. Hermanson
2012-01-01
This paper describes a data reduction methodology for eliminating the systematic aberrations introduced by the unwanted behavior of a multiaxial testing machine, into the massive amounts of experimental data collected from testing of composite material coupons. The machine in reference is a custom made 6-DoF system called NRL66.3 and developed at the NAval...
Geometric technique for the kinematic modeling of a 5 DOF redundant manipulator
CSIR Research Space (South Africa)
Makondo, N
2012-11-01
Full Text Available ,? Dipartimento di Elettronica, Informatica e Sistemistica (DEIS), Universit a di Bologna [Online]; Available at: http://www- lar.deis.unibo.it/people/cmelchiorri/Files Robotica/FIR 04 Kinem.pdf[31 October 2012] [18] Manocha, D.; Canny, J.F.; , ?Efficient... to the inverse kinematics of the Pioneer 2 robotic arm ?, Robotica, 2005, vol.23, pp.123, DOI: 10.1017/S0263574704000529 [20] De Xu, Carlos A. Acosta Calderon, John Q. Gan etc .An Analysis of the Inverse Kinematics for a 5-DOF Manipulator, International...
Directory of Open Access Journals (Sweden)
WS Mada Sanjaya
2016-12-01
Full Text Available Telah dilakukan penelitian yang menggambarkan implementasi pengenalan pola suara untuk mengontrol gerak robot arm 5 DoF dalam mengambil dan menyimpan benda. Dalam penelitian ini metode yang digunakan adalah Mel-Frequency Cepstrum Coefficients (MFCC dan Adaptive Neuro-Fuzzy Inferense System (ANFIS. Metode MFCC digunakan untuk ekstraksi ciri sinyal suara, sedangkan ANFIS digunakan sebagai metode pembelajaran untuk pengenalan pola suara. Pada proses pembelajaran ANFIS data latih yang digunakan sebanyak 6 ciri. Data suara terlatih dan data suara tak terlatih digunakan untuk pengujian sistem pengenalan pola suara. Hasil pengujian menunjukkan tingkat keberhasilan, untuk data suara terlatih sebesar 87,77% dan data tak terlatih sebesar 78,53%. Sistem pengenalan pola suara ini telah diaplikasikan dengan baik untuk mengerakan robot arm 5 DoF berbasis mikrokontroler Arduino. Have been implemented of sound pattern recognition to control 5 DoF of Arm Robot to pick and place an object. In this research used Mel-Frequency Cepstrum Coefficients (MFCC and Adaptive Neuro-Fuzzy Interferense System (ANFIS methods. MFCC method used for features extraction of sound signal, meanwhile ANFIS used to learn sound pattern recognition. On ANFIS method data learning use 6 features. Trained and not trained data used to examine the system of sound pattern identification. The result show the succesfull level, for trained data 87.77% and for not trained data 78.53%. Sound pattern identification system was appliedto controlled 5 DoF arm robot based Arduino microcontroller.
Active Vibration Suppression of a 3-DOF Flexible Parallel Manipulator Using Efficient Modal Control
Directory of Open Access Journals (Sweden)
Quan Zhang
2014-01-01
Full Text Available This paper addresses the dynamic modeling and efficient modal control of a planar parallel manipulator (PPM with three flexible linkages actuated by linear ultrasonic motors (LUSM. To achieve active vibration control, multiple lead zirconate titanate (PZT transducers are mounted on the flexible links as vibration sensors and actuators. Based on Lagrange’s equations, the dynamic model of the flexible links is derived with the dynamics of PZT actuators incorporated. Using the assumed mode method (AMM, the elastic motion of the flexible links are discretized under the assumptions of pinned-free boundary conditions, and the assumed mode shapes are validated through experimental modal test. Efficient modal control (EMC, in which the feedback forces in different modes are determined according to the vibration amplitude or energy of their own, is employed to control the PZT actuators to realize active vibration suppression. Modal filters are developed to extract the modal displacements and velocities from the vibration sensors. Numerical simulation and vibration control experiments are conducted to verify the proposed dynamic model and controller. The results show that the EMC method has the capability of suppressing multimode vibration simultaneously, and both the structural and residual vibrations of the flexible links are effectively suppressed using EMC approach.
A 3-DOF haptic master device for minimally invasive surgery
Nguyen, Phuong-Bac; Oh, Jong-Seok; Choi, Seung-Bok
2012-04-01
This paper introduces a novel 3-DOF haptic master device for minimally invasive surgery featuring magneto-rheological (MR) fluid. It consists of three rotational motions. These motions are constituted by two bi-directional MR (BMR) plus one conventional MR brakes. The BMR brake used in the system possesses a salient advantage that its range of braking torque varies from negative to positive values. Therefore, the device is expected to be able sense in a wide environment from very soft tissues to bones. In this paper, overall of the design of the device is presented from idea, modeling, optimal design, manufacturing to control of the device. Moreover, experimental investigation is undertaken to validate the effectiveness of the device.
Yang, Chifu; Zhao, Jinsong; Li, Liyi; Agrawal, Sunil K
2018-01-01
Robotic spine brace based on parallel-actuated robotic system is a new device for treatment and sensing of scoliosis, however, the strong dynamic coupling and anisotropy problem of parallel manipulators result in accuracy loss of rehabilitation force control, including big error in direction and value of force. A novel active force control strategy named modal space force control is proposed to solve these problems. Considering the electrical driven system and contact environment, the mathematical model of spatial parallel manipulator is built. The strong dynamic coupling problem in force field is described via experiments as well as the anisotropy problem of work space of parallel manipulators. The effects of dynamic coupling on control design and performances are discussed, and the influences of anisotropy on accuracy are also addressed. With mass/inertia matrix and stiffness matrix of parallel manipulators, a modal matrix can be calculated by using eigenvalue decomposition. Making use of the orthogonality of modal matrix with mass matrix of parallel manipulators, the strong coupled dynamic equations expressed in work space or joint space of parallel manipulator may be transformed into decoupled equations formulated in modal space. According to this property, each force control channel is independent of others in the modal space, thus we proposed modal space force control concept which means the force controller is designed in modal space. A modal space active force control is designed and implemented with only a simple PID controller employed as exampled control method to show the differences, uniqueness, and benefits of modal space force control. Simulation and experimental results show that the proposed modal space force control concept can effectively overcome the effects of the strong dynamic coupling and anisotropy problem in the physical space, and modal space force control is thus a very useful control framework, which is better than the current joint
Mathematical model of the 5-DOF sled dynamics of an electrodynamic Maglev system with a passive sled
Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.
2005-01-01
A model that describes the five-degrees-of-freedom (5-DOF) dynamics of a passively levitated electrodynamic maglev system is presented. The model is based on the flux-current-force interactions and the geometric relationships between the levitation coils and the permanent magnets on the sled. The
Ngeo, Jimson; Tamei, Tomoya; Shibata, Tomohiro
2014-01-01
Surface electromyographic (EMG) signals have often been used in estimating upper and lower limb dynamics and kinematics for the purpose of controlling robotic devices such as robot prosthesis and finger exoskeletons. However, in estimating multiple and a high number of degrees-of-freedom (DOF) kinematics from EMG, output DOFs are usually estimated independently. In this study, we estimate finger joint kinematics from EMG signals using a multi-output convolved Gaussian Process (Multi-output Full GP) that considers dependencies between outputs. We show that estimation of finger joints from muscle activation inputs can be improved by using a regression model that considers inherent coupling or correlation within the hand and finger joints. We also provide a comparison of estimation performance between different regression methods, such as Artificial Neural Networks (ANN) which is used by many of the related studies. We show that using a multi-output GP gives improved estimation compared to multi-output ANN and even dedicated or independent regression models.
A simple 5-DoF MR-compatible motion signal measurement system.
Chung, Soon-Cheol; Kim, Hyung-Sik; Yang, Jae-Woong; Lee, Su-Jeong; Choi, Mi-Hyun; Kim, Ji-Hye; Yeon, Hong-Won; Park, Jang-Yeon; Yi, Jeong-Han; Tack, Gye-Rae
2011-09-01
The purpose of this study was to develop a simple motion measurement system with magnetic resonance (MR) compatibility and safety. The motion measurement system proposed here can measure 5-DoF motion signals without deteriorating the MR images, and it has no effect on the intense and homogeneous main magnetic field, the temporal-gradient magnetic field (which varies rapidly with time), the transceiver radio frequency (RF) coil, and the RF pulse during MR data acquisition. A three-axis accelerometer and a two-axis gyroscope were used to measure 5-DoF motion signals, and Velcro was used to attach a sensor module to a finger or wrist. To minimize the interference between the MR imaging system and the motion measurement system, nonmagnetic materials were used for all electric circuit components in an MR shield room. To remove the effect of RF pulse, an amplifier, modulation circuit, and power supply were located in a shielded case, which was made of copper and aluminum. The motion signal was modulated to an optic signal using pulse width modulation, and the modulated optic signal was transmitted outside the MR shield room using a high-intensity light-emitting diode and an optic cable. The motion signal was recorded on a PC by demodulating the transmitted optic signal into an electric signal. Various kinematic variables, such as angle, acceleration, velocity, and jerk, can be measured or calculated by using the motion measurement system developed here. This system also enables motion tracking by extracting the position information from the motion signals. It was verified that MR images and motion signals could reliably be measured simultaneously.
Cycle time reduction using lean six sigma in make-to-order (MTO) environment: Conceptual framework
Man, Siti Mariam; Zain, Zakiyah; Nawawi, Mohd Kamal Mohd
2015-12-01
This paper outlines the framework for application of lean six sigma (LSS) methodology to improve semiconductor assembly cycle time in a make-to-order (MTO) business environment. The cycle time reduction is the prime objective in the context of an overall productivity improvement particularly in the MTO environment. The interaction of the production rate and cycle time is described, while the emphasis is on Define-Measure-Analyze-Improve-Control (DMAIC) and Plan-Do-Check-Act (PDCA) activities. A framework for the conceptual understanding is provided along with practical implementation issues. A relevant measure for the degree of flexibility (DOF) in the context of quick setup is also discussed.
International Nuclear Information System (INIS)
Lee, ChaBum; Kim, Gyu Ha; Lee, Sun-Kyu
2011-01-01
This paper presents the method of a six-degree-of-freedom (DOF) posture measurement in a linear stage by employing a single unit of an optical encoder. The proposed optical encoder was constructed to simultaneously measure the posture along the traveling axis; angular errors, pitch, yaw and roll; and translational errors, ΔX, ΔY and ΔZ. It consists of a diffractive optical element, a corner cube, four separate two-dimensional position-sensitive detectors, four photodiodes and auxiliary optics components. The circularly polarizing interferometric technique was integrated to measure the displacement of the stage along the traveling axis in a robust manner and the resolution was estimated to be less than 0.4 nm. Two types of stages were employed for the measurement implementation, the piezoelectric transducer-driven and the ballscrew-driven, and they were feedback-controlled for the traveling axis, respectively. With a single travel of the stage, it provided a six-DOF motion error with a high resolution, less than 0.03 arcsec, 20 nm and 0.4 nm for angular errors, ΔY and ΔZ, and ΔX, respectively, at the same time. As a result, it was seen that motion errors of the stage have relevance to the driving mechanism and the whole construction of the stage
Workspace Analysis for Parallel Robot
Directory of Open Access Journals (Sweden)
Ying Sun
2013-05-01
Full Text Available As a completely new-type of robot, the parallel robot possesses a lot of advantages that the serial robot does not, such as high rigidity, great load-carrying capacity, small error, high precision, small self-weight/load ratio, good dynamic behavior and easy control, hence its range is extended in using domain. In order to find workspace of parallel mechanism, the numerical boundary-searching algorithm based on the reverse solution of kinematics and limitation of link length has been introduced. This paper analyses position workspace, orientation workspace of parallel robot of the six degrees of freedom. The result shows: It is a main means to increase and decrease its workspace to change the length of branch of parallel mechanism; The radius of the movement platform has no effect on the size of workspace, but will change position of workspace.
End-Effector Position Analysis Using Forward Kinematics For 5 Dof Pravak Robot Arm
Jolly Atit Shah; S.S. Rattan; B.C. Nakra
2013-01-01
Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the kinematic analysis of a Pravak Robot arm which is used for doing successful robotic manipulation task in its workspace. The Pravak Robot Arm is a 5-DOF robot having all the joints revolute. The kinematics problem is defined as the transformation from the Cartesian space to the joint space and vice versa. In this study the Denavit- Hartenberg (D-H) model is used to m...
Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force
Boku, Kazuhiko; Nakamura, Taro
2009-02-01
.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.
Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force
International Nuclear Information System (INIS)
Boku, Kazuhiko; Nakamura, Taro
2009-01-01
Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.
Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force
Energy Technology Data Exchange (ETDEWEB)
Boku, Kazuhiko; Nakamura, Taro [Chuo University, Faculty of Science and Engineering, Department of Precision Mechanics, 1-13-27 Kasuga, Bunkyo-ku, Tokyo 112-8551 (Japan)], E-mail: k_boku@bio.mech.chuo-u.ac.jp
2009-02-01
Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.
International Nuclear Information System (INIS)
Tang, Xiaoqiang; Tang, Lewei; Wang, Jinsong; Sun, Dengfeng
2013-01-01
With the advantage of large workspace, low energy consumption and small inertia, the cable-driven parallel manipulator (CDPM) is suitable for heavy workpieces in rapid velocity and acceleration. We present a workspace analysis approach to solve force and torque equilibriums of completely restrained CDPMs. By this approach, not only the distribution but also the value of tensions driven by cables is investigated together. Two new indices, all cable tension distribution index (ACTDI) and area of the global quality workspace (AG) are proposed to evaluate the quality of the workspace. By concentrating on the workspace and its quality combined with the tension characteristics, these criteria are used to determine the optimal workspace in CDPMs. To verify the capacity of the proposed method, simulation examples are presented and the results demonstrate the approach's effectiveness. In the end, the dimensional design for a planar CDPM is discussed with the indices of workspace quality.
Directory of Open Access Journals (Sweden)
Yasser Al Hamidi
2016-04-01
Full Text Available Piezoelectric tube actuators are extensively used in scanning probe microscopes to provide dynamic scanning motions in open-loop operations. Furthermore, they are employed as micropositioners due to their high bandwidth, high resolution and ease of excitation. However, these piezoelectric micropositioners exhibit badly damped vibrations that occur when the input excites the dynamic response, which tends to degrade positioning accuracy and performance. This paper deals with vibrations’ feedforward control of a multi-degrees of freedom (DOF piezoelectric micropositioner in order to damp the vibrations in the direct axes and to reduce the cross-couplings. The novelty in this paper relative to the existing vibrations feedforward controls is the simplicity in design approach, the minimal number of shaper impulses for each input required to damp all modes of vibration at each output, and the account for the strong cross-couplings which only occur in multi-DOF cases. A generalization to a multiple degrees of freedom actuator is first proposed. Then simulation runs on a 3-DOF piezoelectric tube micropositioner have been effectuated to demonstrate the efficiency of the proposed method. Finally, experimental tests were carried out to validate and to confirm the predicted simulation.
Architectural study of the design and operation of advanced force feedback manual controllers
Tesar, Delbert; Kim, Whee-Kuk
1990-01-01
A teleoperator system consists of a manual controller, control hardware/software, and a remote manipulator. It was employed in either hazardous or unstructured, and/or remote environments. In teleoperation, the main-in-the-loop is the central concept that brings human intelligence to the teleoperator system. When teleoperation involves contact with an uncertain environment, providing the feeling of telepresence to the human operator is one of desired characteristics of the teleoperator system. Unfortunately, most available manual controllers in bilateral or force-reflecting teleoperator systems can be characterized by their bulky size, high costs, or lack of smoothness and transparency, and elementary architectures. To investigate other alternatives, a force-reflecting, 3 degree of freedom (dof) spherical manual controller is designed, analyzed, and implemented as a test bed demonstration in this research effort. To achieve an improved level of design to meet criteria such as compactness, portability, and a somewhat enhanced force-reflecting capability, the demonstration manual controller employs high gear-ratio reducers. To reduce the effects of the inertia and friction on the system, various force control strategies are applied and their performance investigated. The spherical manual controller uses a parallel geometry to minimize inertial and gravitational effects on its primary task of transparent information transfer. As an alternative to the spherical 3-dof manual controller, a new conceptual (or parallel) spherical 3-dof module is introduced with a full kinematic analysis. Also, the resulting kinematic properties are compared to those of other typical spherical 3-dof systems. The conceptual design of a parallel 6-dof manual controller and its kinematic analysis is presented. This 6-dof manual controller is similar to the Stewart Platform with the actuators located on the base to minimize the dynamic effects. Finally, a combination of the new 3-dof and 6-dof
Towards Kilo-Hertz 6-DoF Visual Tracking Using an Egocentric Cluster of Rolling Shutter Cameras.
Bapat, Akash; Dunn, Enrique; Frahm, Jan-Michael
2016-11-01
To maintain a reliable registration of the virtual world with the real world, augmented reality (AR) applications require highly accurate, low-latency tracking of the device. In this paper, we propose a novel method for performing this fast 6-DOF head pose tracking using a cluster of rolling shutter cameras. The key idea is that a rolling shutter camera works by capturing the rows of an image in rapid succession, essentially acting as a high-frequency 1D image sensor. By integrating multiple rolling shutter cameras on the AR device, our tracker is able to perform 6-DOF markerless tracking in a static indoor environment with minimal latency. Compared to state-of-the-art tracking systems, this tracking approach performs at significantly higher frequency, and it works in generalized environments. To demonstrate the feasibility of our system, we present thorough evaluations on synthetically generated data with tracking frequencies reaching 56.7 kHz. We further validate the method's accuracy on real-world images collected from a prototype of our tracking system against ground truth data using standard commodity GoPro cameras capturing at 120 Hz frame rate.
Energy Technology Data Exchange (ETDEWEB)
Tang, Xiaoqiang; Tang, Lewei; Wang, Jinsong [Tsinghua University, Beijing (China); Sun, Dengfeng [Purdue University, West Lafayette (United States)
2013-08-15
With the advantage of large workspace, low energy consumption and small inertia, the cable-driven parallel manipulator (CDPM) is suitable for heavy workpieces in rapid velocity and acceleration. We present a workspace analysis approach to solve force and torque equilibriums of completely restrained CDPMs. By this approach, not only the distribution but also the value of tensions driven by cables is investigated together. Two new indices, all cable tension distribution index (ACTDI) and area of the global quality workspace (AG) are proposed to evaluate the quality of the workspace. By concentrating on the workspace and its quality combined with the tension characteristics, these criteria are used to determine the optimal workspace in CDPMs. To verify the capacity of the proposed method, simulation examples are presented and the results demonstrate the approach's effectiveness. In the end, the dimensional design for a planar CDPM is discussed with the indices of workspace quality.
Principal components analysis based control of a multi-dof underactuated prosthetic hand
Directory of Open Access Journals (Sweden)
Magenes Giovanni
2010-04-01
Full Text Available Abstract Background Functionality, controllability and cosmetics are the key issues to be addressed in order to accomplish a successful functional substitution of the human hand by means of a prosthesis. Not only the prosthesis should duplicate the human hand in shape, functionality, sensorization, perception and sense of body-belonging, but it should also be controlled as the natural one, in the most intuitive and undemanding way. At present, prosthetic hands are controlled by means of non-invasive interfaces based on electromyography (EMG. Driving a multi degrees of freedom (DoF hand for achieving hand dexterity implies to selectively modulate many different EMG signals in order to make each joint move independently, and this could require significant cognitive effort to the user. Methods A Principal Components Analysis (PCA based algorithm is used to drive a 16 DoFs underactuated prosthetic hand prototype (called CyberHand with a two dimensional control input, in order to perform the three prehensile forms mostly used in Activities of Daily Living (ADLs. Such Principal Components set has been derived directly from the artificial hand by collecting its sensory data while performing 50 different grasps, and subsequently used for control. Results Trials have shown that two independent input signals can be successfully used to control the posture of a real robotic hand and that correct grasps (in terms of involved fingers, stability and posture may be achieved. Conclusions This work demonstrates the effectiveness of a bio-inspired system successfully conjugating the advantages of an underactuated, anthropomorphic hand with a PCA-based control strategy, and opens up promising possibilities for the development of an intuitively controllable hand prosthesis.
Trajectory control of an articulated robot with a parallel drive arm based on splines under tension
Yi, Seung-Jong
Today's industrial robots controlled by mini/micro computers are basically simple positioning devices. The positioning accuracy depends on the mathematical description of the robot configuration to place the end-effector at the desired position and orientation within the workspace and on following the specified path which requires the trajectory planner. In addition, the consideration of joint velocity, acceleration, and jerk trajectories are essential for trajectory planning of industrial robots to obtain smooth operation. The newly designed 6 DOF articulated robot with a parallel drive arm mechanism which permits the joint actuators to be placed in the same horizontal line to reduce the arm inertia and to increase load capacity and stiffness is selected. First, the forward kinematic and inverse kinematic problems are examined. The forward kinematic equations are successfully derived based on Denavit-Hartenberg notation with independent joint angle constraints. The inverse kinematic problems are solved using the arm-wrist partitioned approach with independent joint angle constraints. Three types of curve fitting methods used in trajectory planning, i.e., certain degree polynomial functions, cubic spline functions, and cubic spline functions under tension, are compared to select the best possible method to satisfy both smooth joint trajectories and positioning accuracy for a robot trajectory planner. Cubic spline functions under tension is the method selected for the new trajectory planner. This method is implemented for a 6 DOF articulated robot with a parallel drive arm mechanism to improve the smoothness of the joint trajectories and the positioning accuracy of the manipulator. Also, this approach is compared with existing trajectory planners, 4-3-4 polynomials and cubic spline functions, via circular arc motion simulations. The new trajectory planner using cubic spline functions under tension is implemented into the microprocessor based robot controller and
Trajectory Planning of 7-DOF Space Manipulator for Minimizing Base Disturbance
Directory of Open Access Journals (Sweden)
Qiang Zhang
2016-03-01
Full Text Available In the free-floating mode, there is intense dynamic coupling existing between the space manipulator and the base, and the base attitude may change while performing a motion with its manipulator. Therefore, it is necessary to reduce the interference that resulted from the manipulator movement. For planning trajectories of the space manipulator with 7 degrees of freedom (7-DOF, simulated annealing particle swarm optimization (SAPSO algorithm is presented in the paper. Firstly, kinematics equations are setup. Secondly, the joint functions are parameterized by sinusoidal functions, and the objective function is defined according to the motion constraints of manipulator and accuracy requirements of the base attitude. Finally, SAPSO algorithm is used to search the optimal trajectory. The simulation results verify the proposed method.
Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm
Nabeel, Hafiz Muhammad; Azher, Anum; Usman Ali, Syed M.; Wahab Mughal, Abdul
2013-12-01
In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface.
Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm
International Nuclear Information System (INIS)
Nabeel, Hafiz Muhammad; Azher, Anum; Ali, Syed M Usman; Mughal, Abdul Wahab
2013-01-01
In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface
DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter
Directory of Open Access Journals (Sweden)
Cominelli Eleonora
2011-11-01
Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.
Evaluation of head-collision safety of a 7-DOF manipulator according to posture variation
Energy Technology Data Exchange (ETDEWEB)
Kim, Ki Hong, E-mail: rome582@khu.ac.kr; Park, In Jun, E-mail: demianjun@gmail.com; Choi, Jin-Hwan, E-mail: jhchoi@khu.ac.kr; Rhim, Sungsoo, E-mail: ssrhim@khu.ac.kr [Kyung Hee University, Department of Mechanical Engineering (Korea, Republic of)
2016-05-15
As the need for the improvement of the productivity in the manufacturing process grows, industrial robots are brought out of the safety fences and used in the direct collaborative operation with human workers. Consequently, the intended and/or unintended contact between the human and the robot in the collaborative operation is no longer an extraordinary event and is a mundane possibility. The level of the risk of the collision depends on various quantities associated with the collision, for example, inertia, velocity, stiffness, and so on. MSI (manipulator safety index) which is based on HIC (head injury criteria) conventionally used in the automotive industry is one of the practically available measures to estimate the risk of the collision between the human and the manipulator. In this paper MSI is applied to evaluate the collision safety of a 7-DOF articulated human-arm-like manipulator. The risk of the collision could be reduced by choosing different postures without deviating from the given end-effector trajectory using the redundant degree of freedom in the 7-DOF manipulator. The paper shows how the redundant degree of the freedom is utilized to design safer trajectories and/or safer manipulator configurations among many available. A parametric analysis and simulation results for a given trajectory illustrate the usefulness of the concept of the trajectory design for alleviating the risk of the manipulator operation in the human–robot coexisting workspace.
Shi, Shendong; Yang, Linghui; Lin, Jiarui; Ren, Yongjie; Guo, Siyang; Zhu, Jigui
2018-04-01
In this paper we present a novel omnidirectional angle constraint based method for dynamic 6-DOF (six-degree-of-freedom) measurement. A photoelectric scanning measurement network is employed whose photoelectric receivers are fixed on the measured target. They are in a loop distribution and receive signals from rotating transmitters. Each receiver indicates an angle constraint direction. Therefore, omnidirectional angle constraints can be constructed in each rotation cycle. By solving the constrained optimization problem, 6-DOF information can be obtained, which is independent of traditional rigid coordinate system transformation. For the dynamic error caused by the measurement principle, we present an interpolation method for error reduction. Accuracy testing is performed in an 8 × 8 m measurement area with four transmitters. The experimental results show that the dynamic orientation RMSEs (root-mean-square errors) are reduced from 0.077° to 0.044°, 0.040° to 0.030° and 0.032° to 0.015° in the X, Y, and Z axes, respectively. The dynamic position RMSE is reduced from 0.65 mm to 0.24 mm. This method is applied during the final approach phase in the rendezvous and docking simulation. Experiments under different conditions are performed in a 40 × 30 m area, and the method is verified to be effective.
Nguyen, D. T.; Bertholet, J.; Kim, J.-H.; O'Brien, R.; Booth, J. T.; Poulsen, P. R.; Keall, P. J.
2018-01-01
Increasing evidence suggests that intrafraction tumour motion monitoring needs to include both 3D translations and 3D rotations. Presently, methods to estimate the rotation motion require the 3D translation of the target to be known first. However, ideally, translation and rotation should be estimated concurrently. We present the first method to directly estimate six-degree-of-freedom (6DoF) motion from the target’s projection on a single rotating x-ray imager in real-time. This novel method is based on the linear correlations between the superior-inferior translations and the motion in the other five degrees-of-freedom. The accuracy of the method was evaluated in silico with 81 liver tumour motion traces from 19 patients with three implanted markers. The ground-truth motion was estimated using the current gold standard method where each marker’s 3D position was first estimated using a Gaussian probability method, and the 6DoF motion was then estimated from the 3D positions using an iterative method. The 3D position of each marker was projected onto a gantry-mounted imager with an imaging rate of 11 Hz. After an initial 110° gantry rotation (200 images), a correlation model between the superior-inferior translations and the five other DoFs was built using a least square method. The correlation model was then updated after each subsequent frame to estimate 6DoF motion in real-time. The proposed algorithm had an accuracy (±precision) of -0.03 ± 0.32 mm, -0.01 ± 0.13 mm and 0.03 ± 0.52 mm for translations in the left-right (LR), superior-inferior (SI) and anterior-posterior (AP) directions respectively; and, 0.07 ± 1.18°, 0.07 ± 1.00° and 0.06 ± 1.32° for rotations around the LR, SI and AP axes respectively on the dataset. The first method to directly estimate real-time 6DoF target motion from segmented marker positions on a 2D imager was devised. The algorithm was evaluated using 81
Robust nonlinear PID-like fuzzy logic control of a planar parallel (2PRP-PPR) manipulator.
Londhe, P S; Singh, Yogesh; Santhakumar, M; Patre, B M; Waghmare, L M
2016-07-01
In this paper, a robust nonlinear proportional-integral-derivative (PID)-like fuzzy control scheme is presented and applied to complex trajectory tracking control of a 2PRP-PPR (P-prismatic, R-revolute) planar parallel manipulator (motion platform) with three degrees-of-freedom (DOF) in the presence of parameter uncertainties and external disturbances. The proposed control law consists of mainly two parts: first part uses a feed forward term to enhance the control activity and estimated perturbed term to compensate for the unknown effects namely external disturbances and unmodeled dynamics, and the second part uses a PID-like fuzzy logic control as a feedback portion to enhance the overall closed-loop stability of the system. Experimental results are presented to show the effectiveness of the proposed control scheme. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Řidký Václav
2014-03-01
Full Text Available The work is devoted to 3D and 2D parallel numerical computation of pressure and velocity fields around an elastically supported airfoil self-oscillating due to interaction with the airflow. Numerical solution is computed in the OpenFOAM package, an open-source software package based on finite volume method. Movement of airfoil is described by translation and rotation, identified from experimental data. A new boundary condition for the 2DOF motion of the airfoil was implemented. The results of numerical simulations (velocity are compared with data measured in a wind tunnel, where a physical model of NACA0015 airfoil was mounted and tuned to exhibit the flutter instability. The experimental results were obtained previously in the Institute of Thermomechanics by interferographic measurements in a subsonic wind tunnel in Nový Knín.
Lai, Lei-Jie; Gu, Guo-Ying; Zhu, Li-Min
2012-04-01
This paper presents a novel decoupled two degrees of freedom (2-DOF) translational parallel micro-positioning stage. The stage consists of a monolithic compliant mechanism driven by two piezoelectric actuators. The end-effector of the stage is connected to the base by four independent kinematic limbs. Two types of compound flexure module are serially connected to provide 2-DOF for each limb. The compound flexure modules and mirror symmetric distribution of the four limbs significantly reduce the input and output cross couplings and the parasitic motions. Based on the stiffness matrix method, static and dynamic models are constructed and optimal design is performed under certain constraints. The finite element analysis results are then given to validate the design model and a prototype of the XY stage is fabricated for performance tests. Open-loop tests show that maximum static and dynamic cross couplings between the two linear motions are below 0.5% and -45 dB, which are low enough to utilize the single-input-single-out control strategies. Finally, according to the identified dynamic model, an inversion-based feedforward controller in conjunction with a proportional-integral-derivative controller is applied to compensate for the nonlinearities and uncertainties. The experimental results show that good positioning and tracking performances are achieved, which verifies the effectiveness of the proposed mechanism and controller design. The resonant frequencies of the loaded stage at 2 kg and 5 kg are 105 Hz and 68 Hz, respectively. Therefore, the performance of the stage is reasonably good in term of a 200 N load capacity. © 2012 American Institute of Physics
The Study of Multifunction External Fixator Based on Stewart Platform
Directory of Open Access Journals (Sweden)
Guo Yue
2015-01-01
Full Text Available The article develops the model of bone deformities, making 6-DOF Parallel Mechanism have widely applied to correction of deformities. The platform’s positional direct solution is the posture of the motion platform. Malformation can be measured by X-ray, based on the space coordinate transformation can find the final posture of the motion platform. Regarding the reverse solution to platform kinematics the paper gives a quick arithmetic program, six actuators to realize motion requirements. For the computer-assisted fracture reduction, we produced an application interface.
Survey on present status and trend of parallel programming environments
International Nuclear Information System (INIS)
Takemiya, Hiroshi; Higuchi, Kenji; Honma, Ichiro; Ohta, Hirofumi; Kawasaki, Takuji; Imamura, Toshiyuki; Koide, Hiroshi; Akimoto, Masayuki.
1997-03-01
This report intends to provide useful information on software tools for parallel programming through the survey on parallel programming environments of the following six parallel computers, Fujitsu VPP300/500, NEC SX-4, Hitachi SR2201, Cray T94, IBM SP, and Intel Paragon, all of which are installed at Japan Atomic Energy Research Institute (JAERI), moreover, the present status of R and D's on parallel softwares of parallel languages, compilers, debuggers, performance evaluation tools, and integrated tools is reported. This survey has been made as a part of our project of developing a basic software for parallel programming environment, which is designed on the concept of STA (Seamless Thinking Aid to programmers). (author)
Implementation of impedance trajectory control on a 6-DoF manipulator
Directory of Open Access Journals (Sweden)
Shardyko Igor
2018-01-01
Full Text Available Aiming at enhancing the performance of a robotic system, i.e. of a robot manipulator, it is extremely important to ensure the safety of its functioning and the convenience of operating it. Special attention is required if there is a possibility of a collision, especially with costly equipment or with a person. Among the different means and approaches to prevent or react to such situations, implementation of forcetorque control is considered in this paper. A trajectory task is analysed and an impedance control law is employed to achieve the desired robot behaviour. The effectiveness of the approach has been verified by using a 6-DoF elbow manipulator to perform two types of operations: a peg-in-hole task and path execution with obstacles on the way.
Development of a 6 DOF force-reflecting master input device
International Nuclear Information System (INIS)
Yoon, Ji Sup; Yoon, Ho Sik
1999-05-01
The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis) is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 figs
Development of a 6 DOF force-reflecting master input device
Energy Technology Data Exchange (ETDEWEB)
Yoon, Ji Sup; Yoon, Ho Sik
1999-05-01
The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 fi0008.
Development of a 6 DOF force-reflecting master input device
Energy Technology Data Exchange (ETDEWEB)
Yoon, Ji Sup; Yoon, Ho Sik
1999-05-01
The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 fi0008.
Lower Limb Rehabilitation Using Patient Data
Directory of Open Access Journals (Sweden)
Alireza Rastegarpanah
2016-01-01
Full Text Available The aim of this study is to investigate the performance of a 6-DoF parallel robot in tracking the movement of the foot trajectory of a paretic leg during a single stride. The foot trajectories of nine patients with a paretic leg including both males and females have been measured and analysed by a Vicon system in a gait laboratory. Based on kinematic and dynamic analysis of a 6-DoF UPS parallel robot, an algorithm was developed in MATLAB to calculate the length of the actuators and their required forces during all trajectories. The workspace and singularity points of the robot were then investigated in nine different cases. A 6-DoF UPS parallel robot prototype with high repeatability was designed and built in order to simulate a single stride. Results showed that the robot was capable of tracking all of the trajectories with the maximum position error of 1.2 mm.
The FORCE: A highly portable parallel programming language
Jordan, Harry F.; Benten, Muhammad S.; Alaghband, Gita; Jakob, Ruediger
1989-01-01
Here, it is explained why the FORCE parallel programming language is easily portable among six different shared-memory microprocessors, and how a two-level macro preprocessor makes it possible to hide low level machine dependencies and to build machine-independent high level constructs on top of them. These FORCE constructs make it possible to write portable parallel programs largely independent of the number of processes and the specific shared memory multiprocessor executing them.
The FORCE - A highly portable parallel programming language
Jordan, Harry F.; Benten, Muhammad S.; Alaghband, Gita; Jakob, Ruediger
1989-01-01
This paper explains why the FORCE parallel programming language is easily portable among six different shared-memory multiprocessors, and how a two-level macro preprocessor makes it possible to hide low-level machine dependencies and to build machine-independent high-level constructs on top of them. These FORCE constructs make it possible to write portable parallel programs largely independent of the number of processes and the specific shared-memory multiprocessor executing them.
Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks
Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.
1989-01-01
The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.
Applying Lean and Six Sigma in financial service
Does, R.J.M.M.; de Koning, H.; Anthony, J.; Kumar, M.
2006-01-01
Abstract Lean and Six Sigma have gone through parallel developments in recent years. Originally applied to a small range of industries, both approaches are now also used widely in healthcare, administration and service. A recent development is the integration of the two approaches. In this paper we
Eslami, Sohrab; Shang, Weijian; Li, Gang; Patel, Nirav; Fischer, Gregory S.; Tokuda, Junichi; Hata, Nobuhiko; Tempany, Clare M.; Iordachita, Iulian
2015-01-01
Background The robot-assisted minimally-invasive surgery is well recognized as a feasible solution for diagnosis and treatment of the prostate cancer in human. Methods In this paper the kinematics of a parallel 4 Degrees-of-Freedom (DOF) surgical manipulator designed for minimally invasive in-bore prostate percutaneous interventions through the patient's perineum. The proposed manipulator takes advantage of 4 sliders actuated by MRI-compatible piezoelectric motors and incremental rotary encoders. Errors, mostly originating from the design and manufacturing process, need to be identified and reduced before the robot is deployed in the clinical trials. Results The manipulator has undergone several experiments to evaluate the repeatability and accuracy of the needle placement which is an essential concern in percutaneous prostate interventions. Conclusion The acquired results endorse the sustainability, precision (about 1 mm in air (in x or y direction) at the needle's reference point) and reliability of the manipulator. PMID:26111458
Directory of Open Access Journals (Sweden)
Yong-Lin Kuo
2014-01-01
Full Text Available This paper implements the model predictive control to fulfill the position control of a 3-DOF 3-RRR planar parallel manipulator. The research work covers experimental and numerical studies. First, an experimental hardware-in-the-loop system to control the manipulator is constructed. The manipulator is driven by three DC motors, and each motor has an encoder to measure the rotating angles of the motors. The entire system is designed as a semiclosed-loop control system. The controller receives the encoder signals as inputs to produce signals driving the motors. Secondly, the motor parameters are obtained by system identification, and the controllers are designed based on these parameters. Finally, the numerical simulations are performed by incorporating the manipulator kinematics and the motor dynamics; the results are compared with those from the experiments. Both results show that they are in good agreement at steady state. There are two main contributions in this paper. One is the application of the model predictive control to the planar parallel manipulator, and the other one is to overcome the effects of the uncertainties of the DC motors and the performance of the position control due to the dynamic behavior of the manipulator.
6-DOF Pose Estimation of a Robotic Navigation Aid by Tracking Visual and Geometric Features.
Ye, Cang; Hong, Soonhac; Tamjidi, Amirhossein
2015-10-01
This paper presents a 6-DOF Pose Estimation (PE) method for a Robotic Navigation Aid (RNA) for the visually impaired. The RNA uses a single 3D camera for PE and object detection. The proposed method processes the camera's intensity and range data to estimates the camera's egomotion that is then used by an Extended Kalman Filter (EKF) as the motion model to track a set of visual features for PE. A RANSAC process is employed in the EKF to identify inliers from the visual feature correspondences between two image frames. Only the inliers are used to update the EKF's state. The EKF integrates the egomotion into the camera's pose in the world coordinate system. To retain the EKF's consistency, the distance between the camera and the floor plane (extracted from the range data) is used by the EKF as the observation of the camera's z coordinate. Experimental results demonstrate that the proposed method results in accurate pose estimates for positioning the RNA in indoor environments. Based on the PE method, a wayfinding system is developed for localization of the RNA in a home environment. The system uses the estimated pose and the floorplan to locate the RNA user in the home environment and announces the points of interest and navigational commands to the user through a speech interface. This work was motivated by the limitations of the existing navigation technology for the visually impaired. Most of the existing methods use a point/line measurement sensor for indoor object detection. Therefore, they lack capability in detecting 3D objects and positioning a blind traveler. Stereovision has been used in recent research. However, it cannot provide reliable depth data for object detection. Also, it tends to produce a lower localization accuracy because its depth measurement error quadratically increases with the true distance. This paper suggests a new approach for navigating a blind traveler. The method uses a single 3D time-of-flight camera for both 6-DOF PE and 3D object
3-M syndrome: description of six new patients with review of the literature.
Wal, G. van der; Otten, B.J.; Brunner, H.G.; Burgt, C.J.A.M. van der
2001-01-01
3-M syndrome combines pre- and postnatal growth retardation and dysmorphic facial features with autosomal recessive inheritance. Six new patients with 3-M syndrome are described and compared with 28 cases from the literature. Our six patients have a growth pattern, which parallels that of
Ho Pham Huy Anh; Nguyen Thanh Nam
2012-01-01
In this paper, a novel forward adaptive neural MIMO NARX model is used for modelling and identifying the forward kinematics of an industrial 3‐DOF robot arm system. The nonlinear features of the forward kinematics of the industrial robot arm drive are thoroughly modelled based on the forward adaptive neural NARX model‐based identification process using experimental input‐output training data. This paper proposes a novel use of a back propagation (BP) algorithm to generate the forward neural M...
International Nuclear Information System (INIS)
Mohd Zaid Hassan; Anwar Abdul Rahman; Azraf Azman; Mohd Rizal Mamat; Mohd Arif Hamzah
2014-01-01
This paper presents the Microsoft visual studio development for 5DOF Nuclear Malaysia Robot Arm V2 control system. The kinematics analysis is the study of the relationship between the individual joints of robot manipulator, the position and orientation of the end-effector. The Denavit-Hartenberg (DH) model is used to model the robot links and joints. Both forward and inverse kinematic are presented. The simulation software has been developed by using Microsoft visual studio to solve the robot arms kinematic behavior. (author)
Directory of Open Access Journals (Sweden)
Eloise T. Choice
2016-11-01
Full Text Available A Debilitating Conflict Resolved. The account of Creation (as chronicled in the Biblical book of Genesis, King James Version 1611, in Tankah: The Holy Scriptures, in The Holy Quran, and in extra-Biblical texts and the scientifically determined pre-geologic, geologic, and “evolution” timelines regarding the development of the universe, the Earth and life upon it, fuse. What Scriptures say happened on each of the six “days” of Creation precisely parallels that which scientists have determined to have occurred during the universe’s 13.7-billion-years of existence and Earth’s 4.7-billion-year development. The concrete connection between the two serves the religious interest as it validates the Intelligent Design belief. It serves the secular interest of helping Biblical Literalists to advance in their attainment of scientific knowledge as it provides evidence that the universe, the earth, and life upon it, were not created less than 10,000 years ago in six literal 24-hour periods.
International Nuclear Information System (INIS)
Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng
2010-01-01
In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone > nylon cyclone > IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage.
Adaptive control of 5 DOF upper-limb exoskeleton robot with improved safety.
Kang, Hao-Bo; Wang, Jian-Hui
2013-11-01
This paper studies an adaptive control strategy for a class of 5 DOF upper-limb exoskeleton robot with a special safety consideration. The safety requirement plays a critical role in the clinical treatment when assisting patients with shoulder, elbow and wrist joint movements. With the objective of assuring the tracking performance of the pre-specified operations, the proposed adaptive controller is firstly designed to be robust to the model uncertainties. To further improve the safety and fault-tolerance in the presence of unknown large parameter variances or even actuator faults, the adaptive controller is on-line updated according to the information provided by an adaptive observer without additional sensors. An output tracking performance is well achieved with a tunable error bound. The experimental example also verifies the effectiveness of the proposed control scheme. © 2013 ISA. Published by ISA. All rights reserved.
Some aspects of floor spectra of 1DOF nonlinear primary structures
International Nuclear Information System (INIS)
Politopoulos, I.; Feau, C.
2007-01-01
In this paper the influence of the nonlinear behaviour of the primary structure on floor spectra is investigated by means of simple models. The general trends of floor spectra for different types of nonlinear behaviour of one degree of freedom (1DOF) primary structure are shown and we point out their common futures and their differences. A special attention is given to the cases of elastoplastic and nonlinear elastic behaviours and methods to determine an equivalent linear oscillator are proposed. The properties (frequency and damping) of this equivalent linear oscillator are quite different from the properties of equivalent linear oscillators commonly considered in practice. In particular, in the case of elastoplastic behaviour, there is no frequency shift and damping is smaller than assumed by other methods commonly used. In the case of nonlinear elastic behaviour, the concept of an equivalent frequency which is a random variable is used. Finally, a design floor spectrum of primary structures, exhibiting energy dissipating nonlinear behaviour is proposed. (authors)
Analysis on the Workspace of Six-degrees-of-freedom Industrial Robot Based on AutoCAD
Directory of Open Access Journals (Sweden)
Li Jin-quan
2017-01-01
Full Text Available This research discusses the workspace of the industrial robot with six degrees of freedom(6-DOF based on AutoCAD platform. Based on the analysis of the overall configuration of the robot, this research establishes the kinematic mathematical model of the industrial robot by using DH parameters, and then solves the workspace of the robot consequently. In the AutoCAD, Auto Lisp language program is adopted to simulate the two-dimensional(2D and three-dimensional(3D space of the robot. Software user interface is written by using the dialog box control language of Visual LISP. At last, the research analyzes the trend of the shape and direction of the workspace when the length and angle range of the robot are changed. This research lays the foundation for the design, control and planning of industrial robots.
International Nuclear Information System (INIS)
Mohd Zaid Hassan; Anwar Abdul Rahman; Rosli Darmawan; Mohd Arif Hamzah
2010-01-01
This paper presents the preliminary software development for the kinematics analysis of 5 DOF rescue robot. The kinematics analysis is the study of relationship between the individual joints of the robot manipulator, the position and orientation of the end-effector. The Denavit-Hartenberg (DH) model is used to model the robot links and joints. Both forward and inverse kinematic are presented. The simulation software has been developed by using MATLAB to solve the robot arms kinematic behavior. (author)
A method of reactor power decrease by 2DOF control system during BWR power oscillation
International Nuclear Information System (INIS)
Ishikawa, Nobuyuki; Suzuki, Katsuo
1998-09-01
Occurrence of power oscillation events caused by void feedback effects in BWRs operated at low-flow and high-power condition has been reported. After thoroughly examining these events, BWRs have been equipped with the SRI (Selected Rod Insertion) system to avoid the power oscillation by decreasing the power under such reactor condition. This report presents a power control method for decreasing the reactor power stably by a two degree of freedom (2DOF) control. Performing a numerical simulation by utilizing a simple reactor dynamics model, it is found that the control system designed attains a satisfactory control performance of power decrease from a viewpoint of setting time and oscillation. (author)
Directory of Open Access Journals (Sweden)
Yueling Wang
2013-01-01
Full Text Available A unique fuzzy self-tuning disturbance decoupling controller (FSDDC is designed for a serial-parallel hybrid humanoid arm (HHA to implement the throwing trajectory-tracking mission. Firstly, the dynamic model of the HHA is established and the input signal of the throwing process is obtained by studying the throwing process of human's arm. Secondly, the FSDDC, incorporating the disturbance decoupling controller (DDC and the fuzzy logic controller (FLC, is designed to ensure trajectory tracking of the HHA in the presence of uncertainties and disturbances. With the FSDDC method, the HHA system can be decoupled by actively estimating and rejecting the effects of both the internal plant dynamics and external disturbances. The self-tuning parameters are adapted online to improve the performance of the FSDDC; thus, it does not require detailed system parameters of the presented FSDDC. Finally, the controller introduced is compared with a PD controller which is commonly used for the robot manipulators control in industry. The effectiveness of the designed FSDDC is illustrated by simulations.
PARALLEL MOVING MECHANICAL SYSTEMS
Directory of Open Access Journals (Sweden)
Florian Ion Tiberius Petrescu
2014-09-01
Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 Moving mechanical systems parallel structures are solid, fast, and accurate. Between parallel systems it is to be noticed Stewart platforms, as the oldest systems, fast, solid and precise. The work outlines a few main elements of Stewart platforms. Begin with the geometry platform, kinematic elements of it, and presented then and a few items of dynamics. Dynamic primary element on it means the determination mechanism kinetic energy of the entire Stewart platforms. It is then in a record tail cinematic mobile by a method dot matrix of rotation. If a structural mottoelement consists of two moving elements which translates relative, drive train and especially dynamic it is more convenient to represent the mottoelement as a single moving components. We have thus seven moving parts (the six motoelements or feet to which is added mobile platform 7 and one fixed.
Control Architecture of a 10 DOF Lower Limbs Exoskeleton for Gait Rehabilitation
Directory of Open Access Journals (Sweden)
Natasa Koceska
2013-01-01
Full Text Available This paper describes the control architecture of a 10 DOF (Degrees of Freedom lower limbs exoskeleton for the gait rehabilitation of patients with gait dysfunction. The system has 4 double-acting rod pneumatic actuators (two for each leg that control the hip and knee joints. The motion of each cylinder's piston is controlled by two proportional pressure valves, connected to both cylinder chambers. The control strategy has been specifically designed in order to ensure a proper trajectory control for guiding patient's legs along a fixed reference gait pattern. An adaptive fuzzy controller which is capable of compensating for the influence of the dry friction was successfully designed, implemented and tested on an embedded real-time PC/104. In order to verify the proposed control architecture, laboratory experiments without a patient were carried out and the results are reported here and discussed.
Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng
2010-04-15
In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone>nylon cyclone>IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage. 2009 Elsevier B.V. All rights reserved.
A mirror for lab-based quasi-monochromatic parallel x-rays.
Nguyen, Thanhhai; Lu, Xun; Lee, Chang Jun; Jung, Jin-Ho; Jin, Gye-Hwan; Kim, Sung Youb; Jeon, Insu
2014-09-01
A multilayered parabolic mirror with six W/Al bilayers was designed and fabricated to generate monochromatic parallel x-rays using a lab-based x-ray source. Using this mirror, curved bright bands were obtained in x-ray images as reflected x-rays. The parallelism of the reflected x-rays was investigated using the shape of the bands. The intensity and monochromatic characteristics of the reflected x-rays were evaluated through measurements of the x-ray spectra in the band. High intensity, nearly monochromatic, and parallel x-rays, which can be used for high resolution x-ray microscopes and local radiation therapy systems, were obtained.
Realization of a Desktop Flight Simulation System for Motion-Cueing Studies
Directory of Open Access Journals (Sweden)
Berkay Volkaner
2016-05-01
Full Text Available Parallel robotic mechanisms are generally used in flight simulators with a motion-cueing algorithm to create an unlimited motion feeling of a simulated medium in a bounded workspace of the simulator. A major problem in flight simulators is that the simulation has an unbounded space and the manipulator has a limited one. Using a washout filter in the motion-cueing algorithm overcomes this. In this study, a low-cost six degrees of freedom (DoF desktop parallel manipulator is used to test a classical motion-cueing algorithm; the algorithm's functionality is confirmed with a Simulink real-time environment. Translational accelerations and angular velocities of the simulated medium obtained from FlightGear flight simulation software are processed through a generated washout filter algorithm and the simulated medium's motion information is transmitted to the desktop parallel robotic mechanism as a set point for each leg. The major issues of this paper are designing a desktop simulation system, controlling the parallel manipulator, communicating between the flight simulation and the platform, designing a motion-cueing algorithm and determining the parameters of the washout filters.
Crookshank, Meghan C; Beek, Maarten; Singh, Devin; Schemitsch, Emil H; Whyne, Cari M
2013-07-01
Accurate alignment of femoral shaft fractures treated with intramedullary nailing remains a challenge for orthopaedic surgeons. The aim of this study is to develop and validate a cone-beam CT-based, semi-automated algorithm to quantify the malalignment in six degrees of freedom (6DOF) using a surface matching and principal axes-based approach. Complex comminuted diaphyseal fractures were created in nine cadaveric femora and cone-beam CT images were acquired (27 cases total). Scans were cropped and segmented using intensity-based thresholding, producing superior, inferior and comminution volumes. Cylinders were fit to estimate the long axes of the superior and inferior fragments. The angle and distance between the two cylindrical axes were calculated to determine flexion/extension and varus/valgus angulation and medial/lateral and anterior/posterior translations, respectively. Both surfaces were unwrapped about the cylindrical axes. Three methods of matching the unwrapped surface for determination of periaxial rotation were compared based on minimizing the distance between features. The calculated corrections were compared to the input malalignment conditions. All 6DOF were calculated to within current clinical tolerances for all but two cases. This algorithm yielded accurate quantification of malalignment of femoral shaft fractures for fracture gaps up to 60 mm, based on a single CBCT image of the fractured limb. Copyright © 2012 IPEM. Published by Elsevier Ltd. All rights reserved.
Grasp planning for a reconfigurable parallel robot with an underactuated arm structure
Directory of Open Access Journals (Sweden)
M. Riedel
2010-12-01
Full Text Available In this paper, a novel approach of grasp planning is applied to find out the appropriate grasp points for a reconfigurable parallel robot called PARAGRIP (Parallel Gripping. This new handling system is able to manipulate objects in the six-dimensional Cartesian space by several robotic arms using only six actuated joints. After grasping, the contact elements at the end of the underactuated arm mechanisms are connected to the object which forms a closed loop mechanism similar to the architecture of parallel manipulators. As the mounting and grasp points of the arms can easily be changed, the manipulator can be reconfigured to match the user's preferences and needs. This paper raises the question, how and where these grasp points are to be placed on the object to perform well for a certain manipulation task.
This paper was presented at the IFToMM/ASME International Workshop on Underactuated Grasping (UG2010, 19 August 2010, Montréal, Canada.
End-Effector Position Analysis Using Forward Kinematics For 5 Dof Pravak Robot Arm
Directory of Open Access Journals (Sweden)
Jolly Atit Shah
2013-03-01
Full Text Available Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the kinematic analysis of a Pravak Robot arm which is used for doing successful robotic manipulation task in its workspace. The Pravak Robot Arm is a 5-DOF robot having all the joints revolute. The kinematics problem is defined as the transformation from the Cartesian space to the joint space and vice versa. In this study the Denavit- Hartenberg (D-H model is used to model robot links and joints. Pravak Robot Arm is a simple and safe robotic system designed for laboratory training and research applications. This robot allows to gain theoretical and practical experience in robotics, automation and control systems. The MATLAB R2007 is used to analyse end effectors position for a set of joint parameter.
Fusion reactor handling operations with cable-driven parallel robots
Energy Technology Data Exchange (ETDEWEB)
Izard, Jean-Baptiste, E-mail: jeanbaptiste.izard@tecnalia.com; Michelin, Micael; Baradat, Cédric
2015-10-15
Highlights: • CDPR allow 6DOF positioning of loads using cable as links without payload swag. • Conceptual design of a CDPR for carrying and positioning tokamak sectors is given. • A CDPR for threading stellarator coils (6D trajectory following) is provided. • Both designs are capable of fullfilling the required precision without tooling. - Abstract: Cable-driven parallel robots (CDPR) are in their concept cranes with inclined cables which allow control of all the degrees of freedom of its payload, and therefore stability of all the degrees of freedom, including rotations. The workspace of a CDPR is only limited by the length of the cables, and the payload capacity related to the mass of the whole robot is very important. Besides, the control being based on kinematic models, the behavior of a CDPR is really that of a robot capable of automated trajectories or remote handling. The present paper gives a presentation of two use case studies based on some of the assembly phases and remote handling actions as designed for the recent fusion machines. Based on the use cases already in place in fusion reactor baselines, the opportunity of using CDPR for assembly of structural elements and coils is discussed. Finally, prospects for remote handling equipment from the reactor in hot cells are envisioned based on current CDPR research.
Kalkan, Erol; Kwong, Neal S.
2012-01-01
According to regulatory building codes in United States (for example, 2010 California Building Code), at least two horizontal ground-motion components are required for three-dimensional (3D) response history analysis (RHA) of buildings. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHA analyses should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak responses of engineering demand parameters (EDPs) were obtained for rotation angles ranging from 0° through 180° for evaluating the FN/FP directions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.
Design of a biologically inspired lower limb exoskeleton for human gait rehabilitation.
Lyu, Mingxing; Chen, Weihai; Ding, Xilun; Wang, Jianhua; Bai, Shaoping; Ren, Huichao
2016-10-01
This paper proposes a novel bionic model of the human leg according to the theory of physiology. Based on this model, we present a biologically inspired 3-degree of freedom (DOF) lower limb exoskeleton for human gait rehabilitation, showing that the lower limb exoskeleton is fully compatible with the human knee joint. The exoskeleton has a hybrid serial-parallel kinematic structure consisting of a 1-DOF hip joint module and a 2-DOF knee joint module in the sagittal plane. A planar 2-DOF parallel mechanism is introduced in the design to fully accommodate the motion of the human knee joint, which features not only rotation but also relative sliding. Therefore, the design is consistent with the requirements of bionics. The forward and inverse kinematic analysis is studied and the workspace of the exoskeleton is analyzed. The structural parameters are optimized to obtain a larger workspace. The results using MATLAB-ADAMS co-simulation are shown in this paper to demonstrate the feasibility of our design. A prototype of the exoskeleton is also developed and an experiment performed to verify the kinematic analysis. Compared with existing lower limb exoskeletons, the designed mechanism has a large workspace, while allowing knee joint rotation and small amount of sliding.
Design of a biologically inspired lower limb exoskeleton for human gait rehabilitation
Lyu, Mingxing; Chen, Weihai; Ding, Xilun; Wang, Jianhua; Bai, Shaoping; Ren, Huichao
2016-10-01
This paper proposes a novel bionic model of the human leg according to the theory of physiology. Based on this model, we present a biologically inspired 3-degree of freedom (DOF) lower limb exoskeleton for human gait rehabilitation, showing that the lower limb exoskeleton is fully compatible with the human knee joint. The exoskeleton has a hybrid serial-parallel kinematic structure consisting of a 1-DOF hip joint module and a 2-DOF knee joint module in the sagittal plane. A planar 2-DOF parallel mechanism is introduced in the design to fully accommodate the motion of the human knee joint, which features not only rotation but also relative sliding. Therefore, the design is consistent with the requirements of bionics. The forward and inverse kinematic analysis is studied and the workspace of the exoskeleton is analyzed. The structural parameters are optimized to obtain a larger workspace. The results using MATLAB-ADAMS co-simulation are shown in this paper to demonstrate the feasibility of our design. A prototype of the exoskeleton is also developed and an experiment performed to verify the kinematic analysis. Compared with existing lower limb exoskeletons, the designed mechanism has a large workspace, while allowing knee joint rotation and small amount of sliding.
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Sadhana. Vivek Kumar Mehta. Articles written in Sadhana. Volume 36 Issue 6 December 2011 pp 977-994. A general approach for optimal kinematic design of 6-DOF parallel manipulators · Vivek Kumar Mehta Bhaskar Dasgupta · More Details Abstract Fulltext PDF. Optimal kinematic design of parallel ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Sadhana. Bhaskar Dasgupta. Articles written in Sadhana. Volume 36 Issue 6 December 2011 pp 977-994. A general approach for optimal kinematic design of 6-DOF parallel manipulators · Vivek Kumar Mehta Bhaskar Dasgupta · More Details Abstract Fulltext PDF. Optimal kinematic design of parallel ...
Optimal design of an alignment-free two-DOF rehabilitation robot for the shoulder complex.
Galinski, Daniel; Sapin, Julien; Dehez, Bruno
2013-06-01
This paper presents the optimal design of an alignment-free exoskeleton for the rehabilitation of the shoulder complex. This robot structure is constituted of two actuated joints and is linked to the arm through passive degrees of freedom (DOFs) to drive the flexion-extension and abduction-adduction movements of the upper arm. The optimal design of this structure is performed through two steps. The first step is a multi-objective optimization process aiming to find the best parameters characterizing the robot and its position relative to the patient. The second step is a comparison process aiming to select the best solution from the optimization results on the basis of several criteria related to practical considerations. The optimal design process leads to a solution outperforming an existing solution on aspects as kinematics or ergonomics while being more simple.
Analysis and experiments of a novel and compact 3-DOF precision positioning platform
International Nuclear Information System (INIS)
Huang, Hu; Zhao, Hongwei; Fan, Zunqiang; Zhang, Hui; Ma, Zhichao; Yang, Zhaojun
2013-01-01
A novel 3-DOF precision positioning platform with dimensions of 48 mm X 50 mm X 35 mm was designed by integrating piezo actuators and flexure hinges. The platform has a compact structure but it can do high precision positioning in three axes. The dynamic model of the platform in a single direction was established. Stiffness of the flexure hinges and modal characteristics of the flexure hinge mechanism were analyzed by the finite element method. Output displacements of the platform along three axes were forecasted via stiffness analysis. Output performance of the platform in x and y axes with open-loop control as well as the z-axis with closed-loop control was tested and discussed. The preliminary application of the platform in the field of nanoindentation indicates that the designed platform works well during nanoindentation tests, and the closed-loop control ensures the linear displacement output. With suitable control, the platform has the potential to realize different positioning functions under various working conditions.
Investigation for Synchronization of a Rotor-Pendulum System considering the Multi-DOF Vibration
Directory of Open Access Journals (Sweden)
Yongjun Hou
2016-01-01
Full Text Available This work is a continuation for our published literature for vibration synchronization. A new mechanism, two rotors coupled with a pendulum rod in a multi-DOF vibration system, is proposed to implement coupling synchronization, and the dynamics equation of mechanism is derived by Lagrange equation. In addition, the coupling relationship between the vibrobody and the pendulum rod is ascertained with the Laplace transformation method, based on the dimensionless equation of the dynamics system. The Poincare method is employed to study the synchronization state between the two unbalanced rotors, which is converted into that of existence and the stability of solutions for synchronization-balance equations. The obtained results are supported by computer simulations. It is demonstrated that the values of the spring stiffness coefficient, the length of the pendulum, and the angular installation of the pendulum are important parameters with respect to the synchronous behavior in the rotor-pendulum system.
six six six paradox : [luuletused] / Triin Tasuja
Tasuja, Triin
2008-01-01
Sisu: six six six paradox ; cat stevens ; "vahel tundub, et mu ümber..." ; sääse ; Salaalaealised ; kolkalapsed ; longin mööda lumiseid tänavaid ; punkrock dekadents ; "Igast kirjaneitsist..." ; "mina olengi see saikochick..."
A parallel robot to assist vitreoretinal surgery
Energy Technology Data Exchange (ETDEWEB)
Nakano, Taiga; Sugita, Naohiko; Mitsuishi, Mamoru [University of Tokyo, School of Engineering, Tokyo (Japan); Ueta, Takashi; Tamaki, Yasuhiro [University of Tokyo, Graduate School of Medicine, Tokyo (Japan)
2009-11-15
This paper describes the development and evaluation of a parallel prototype robot for vitreoretinal surgery where physiological hand tremor limits performance. The manipulator was specifically designed to meet requirements such as size, precision, and sterilization; this has six-degree-of-freedom parallel architecture and provides positioning accuracy with micrometer resolution within the eye. The manipulator is controlled by an operator with a ''master manipulator'' consisting of multiple joints. Results of the in vitro experiments revealed that when compared to the manual procedure, a higher stability and accuracy of tool positioning could be achieved using the prototype robot. This microsurgical system that we have developed has superior operability as compared to traditional manual procedure and has sufficient potential to be used clinically for vitreoretinal surgery. (orig.)
Liang, Dong; Song, Yimin; Sun, Tao; Jin, Xueying
2018-03-01
This paper addresses the problem of rigid-flexible coupling dynamic modeling and active control of a novel flexible parallel manipulator (PM) with multiple actuation modes. Firstly, based on the flexible multi-body dynamics theory, the rigid-flexible coupling dynamic model (RFDM) of system is developed by virtue of the augmented Lagrangian multipliers approach. For completeness, the mathematical models of permanent magnet synchronous motor (PMSM) and piezoelectric transducer (PZT) are further established and integrated with the RFDM of mechanical system to formulate the electromechanical coupling dynamic model (ECDM). To achieve the trajectory tracking and vibration suppression, a hierarchical compound control strategy is presented. Within this control strategy, the proportional-differential (PD) feedback controller is employed to realize the trajectory tracking of end-effector, while the strain and strain rate feedback (SSRF) controller is developed to restrain the vibration of the flexible links using PZT. Furthermore, the stability of the control algorithm is demonstrated based on the Lyapunov stability theory. Finally, two simulation case studies are performed to illustrate the effectiveness of the proposed approach. The results indicate that, under the redundant actuation mode, the hierarchical compound control strategy can guarantee the flexible PM achieves singularity-free motion and vibration attenuation within task workspace simultaneously. The systematic methodology proposed in this study can be conveniently extended for the dynamic modeling and efficient controller design of other flexible PMs, especially the emerging ones with multiple actuation modes.
An online gait generator for quadruped walking using motor primitives
Directory of Open Access Journals (Sweden)
Chunlin Zhou
2016-11-01
Full Text Available This article presents implementation of an online gait generator on a quadruped robot. Firstly, the design of a quadruped robot is presented. The robot contains four leg modules each of which is constructed by a 2 degrees of freedom (2-DOF five-bar parallel linkage mechanism. Together with other two rotational DOF, the leg module is able to perform 4-DOF movement. The parallel mechanism of the robot allows all the servos attached on the body frame, so that the leg mass is decreased and motor load can be balanced. Secondly, an online gait generator based on dynamic movement primitives for the walking control is presented. Dynamic movement primitives provide an approach to generate periodic trajectories and they can be modulated in real time, which makes the online adjustment of walking gaits possible. This gait controller is tested by the quadruped robot in regulating walking speed, switching between forward\\backward movements and steering. The controller is easy to apply, expand and is quite effective on phase coordination and online trajectory modulation. Results of simulated experiments are presented.
Intelligent controller of a flexible hybrid robot machine for ITER assembly and maintenance
International Nuclear Information System (INIS)
Al-saedi, Mazin I.; Wu, Huapeng; Handroos, Heikki
2014-01-01
Highlights: • Studying flexible multibody dynamic of hybrid parallel robot. • Investigating fuzzy-PD controller to control a hybrid flexible hydraulically driven robot. • Investigating ANFIS-PD controller to control a hybrid flexible robot. Compare to traditional PID this method gives better performance. • Using the equilibrium of reaction forces between the parallel and serial parts of hybrid robot to control the serial part hydraulically driven. - Abstract: The assembly and maintenance of International Thermonuclear Experimental Reactor (ITER) vacuum vessel (VV) is highly challenging since the tasks performed by the robot involve welding, material handling, and machine cutting from inside the VV. To fulfill the tasks in ITER application, this paper presents a hybrid redundant manipulator with four DOFs provided by serial kinematic axes and six DOFs by parallel mechanism. Thus, in machining, to achieve greater end-effector trajectory tracking accuracy for surface quality, a robust control of the actuators for the flexible link has to be deduced. In this paper, the intelligent control of a hydraulically driven parallel robot part based on the dynamic model and two control schemes have been investigated: (1) fuzzy-PID self tuning controller composed of the conventional PID control and with fuzzy logic; (2) adaptive neuro-fuzzy inference system-PID (ANFIS-PID) self tuning of the gains of the PID controller, which are implemented independently to control each hydraulic cylinder of the parallel robot based on rod position predictions. The obtained results of the fuzzy-PID and ANFIS-PID self tuning controller can reduce more tracking errors than the conventional PID controller. Subsequently, the serial component of the hybrid robot can be analyzed using the equilibrium of reaction forces at the universal joint connections of the hexa-element. To achieve precise positional control of the end effector for maximum precision machining, the hydraulic cylinder should
Intelligent controller of a flexible hybrid robot machine for ITER assembly and maintenance
Energy Technology Data Exchange (ETDEWEB)
Al-saedi, Mazin I., E-mail: mazin.al-saedi@lut.fi; Wu, Huapeng; Handroos, Heikki
2014-10-15
Highlights: • Studying flexible multibody dynamic of hybrid parallel robot. • Investigating fuzzy-PD controller to control a hybrid flexible hydraulically driven robot. • Investigating ANFIS-PD controller to control a hybrid flexible robot. Compare to traditional PID this method gives better performance. • Using the equilibrium of reaction forces between the parallel and serial parts of hybrid robot to control the serial part hydraulically driven. - Abstract: The assembly and maintenance of International Thermonuclear Experimental Reactor (ITER) vacuum vessel (VV) is highly challenging since the tasks performed by the robot involve welding, material handling, and machine cutting from inside the VV. To fulfill the tasks in ITER application, this paper presents a hybrid redundant manipulator with four DOFs provided by serial kinematic axes and six DOFs by parallel mechanism. Thus, in machining, to achieve greater end-effector trajectory tracking accuracy for surface quality, a robust control of the actuators for the flexible link has to be deduced. In this paper, the intelligent control of a hydraulically driven parallel robot part based on the dynamic model and two control schemes have been investigated: (1) fuzzy-PID self tuning controller composed of the conventional PID control and with fuzzy logic; (2) adaptive neuro-fuzzy inference system-PID (ANFIS-PID) self tuning of the gains of the PID controller, which are implemented independently to control each hydraulic cylinder of the parallel robot based on rod position predictions. The obtained results of the fuzzy-PID and ANFIS-PID self tuning controller can reduce more tracking errors than the conventional PID controller. Subsequently, the serial component of the hybrid robot can be analyzed using the equilibrium of reaction forces at the universal joint connections of the hexa-element. To achieve precise positional control of the end effector for maximum precision machining, the hydraulic cylinder should
Kinematics and Application of a Hybrid Industrial Robot – Delta-RST
Directory of Open Access Journals (Sweden)
Ning Liu
2014-04-01
Full Text Available Serial robots and parallel robots have their own pros and cons. While hybrid robots consisting of both of them are possible and expected to retain their merits and minimize the disadvantages. The Delta-RST presented here is such a hybrid robot built up by integrating a 3-DoFs traditional Delta parallel structure and a 3-DoFs RST robotic wrist. In this paper, we focus on its kinematics analysis and its applications in industry. Firstly, the robotic system of the Delta-RST will be described briefly. Then the complete and systemic kinematics of this kind of robot will be presented in detail, followed by simulations and applications to demonstrate the correctness of the analysis, as well as the effectiveness of the developed robotic system. The closed-form kinematic analysis results are universal for similar hybrid robots constructing with the Delta parallel mechanism and serial chains.
Directory of Open Access Journals (Sweden)
Yan Naing Aye
2013-10-01
Full Text Available The intelligent handheld instrument, ITrem2, enhances manual positioning accuracy by cancelling erroneous hand movements and, at the same time, provides automatic micromanipulation functions. Visual data is acquired from a high speed monovision camera attached to the optical surgical microscope and acceleration measurements are acquired from the inertial measurement unit (IMU on board ITrem2. Tremor estimation and canceling is implemented via Band-limited Multiple Fourier Linear Combiner (BMFLC filter. The piezoelectric actuated micromanipulator in ITrem2 generates the 3D motion to compensate erroneous hand motion. Preliminary bench-top 2-DOF experiments have been conducted. The error motions simulated by a motion stage is reduced by 67% for multiple frequency oscillatory motions and 56.16% for pre-conditioned recorded physiological tremor.
Quality assurance for a six degrees-of-freedom table using a 3D printed phantom.
Woods, Kyle; Ayan, Ahmet S; Woollard, Jeffrey; Gupta, Nilendu
2018-01-01
To establish a streamlined end-to-end test of a 6 degrees-of-freedom (6DoF) robotic table using a 3D printed phantom for periodic quality assurance. A 3D printed phantom was fabricated with translational and rotational offsets and an imbedded central ball-bearing (BB). The phantom underwent each step of the radiation therapy process: CT simulation in a straight orientation, plan generation using the treatment planning software, setup to offset marks at the linac, registration and corrected 6DoF table adjustments via hidden target test, delivery of a Winston-Lutz test to the BB, and verification of table positioning via field and laser lights. The registration values, maximum total displacement of the combined Winston-Lutz fields, and a pass or fail criterion of the laser and field lights were recorded. The quality assurance process for each of the three linacs were performed for the first 30 days. Within a 95% confidence interval, the overall uncertainty values for both translation and rotation were below 1.0 mm and 0.5° for each linac respectively. When combining the registration values and other uncertainties for all three linacs, the average deviations were within 2.0 mm and 1.0° of the designed translation and rotation offsets of the 3D print respectively. For all three linacs, the maximum total deviation for the Winston-Lutz test did not exceed 1.0 mm. Laser and light field verification was within tolerance every day for all three linacs given the latest guidance documentation for table repositioning. The 3D printer is capable of accurately fabricating a quality assurance phantom for 6DoF positioning verification. The end-to-end workflow allows for a more efficient test of the 6DoF mechanics while including other important tests needed for routine quality assurance. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.
A parallel direct solver for the self-adaptive hp Finite Element Method
Paszyński, Maciej R.
2010-03-01
In this paper we present a new parallel multi-frontal direct solver, dedicated for the hp Finite Element Method (hp-FEM). The self-adaptive hp-FEM generates in a fully automatic mode, a sequence of hp-meshes delivering exponential convergence of the error with respect to the number of degrees of freedom (d.o.f.) as well as the CPU time, by performing a sequence of hp refinements starting from an arbitrary initial mesh. The solver constructs an initial elimination tree for an arbitrary initial mesh, and expands the elimination tree each time the mesh is refined. This allows us to keep track of the order of elimination for the solver. The solver also minimizes the memory usage, by de-allocating partial LU factorizations computed during the elimination stage of the solver, and recomputes them for the backward substitution stage, by utilizing only about 10% of the computational time necessary for the original computations. The solver has been tested on 3D Direct Current (DC) borehole resistivity measurement simulations problems. We measure the execution time and memory usage of the solver over a large regular mesh with 1.5 million degrees of freedom as well as on the highly non-regular mesh, generated by the self-adaptive h p-FEM, with finite elements of various sizes and polynomial orders of approximation varying from p = 1 to p = 9. From the presented experiments it follows that the parallel solver scales well up to the maximum number of utilized processors. The limit for the solver scalability is the maximum sequential part of the algorithm: the computations of the partial LU factorizations over the longest path, coming from the root of the elimination tree down to the deepest leaf. © 2009 Elsevier Inc. All rights reserved.
Parallel Programming with Intel Parallel Studio XE
Blair-Chappell , Stephen
2012-01-01
Optimize code for multi-core processors with Intel's Parallel Studio Parallel programming is rapidly becoming a "must-know" skill for developers. Yet, where to start? This teach-yourself tutorial is an ideal starting point for developers who already know Windows C and C++ and are eager to add parallelism to their code. With a focus on applying tools, techniques, and language extensions to implement parallelism, this essential resource teaches you how to write programs for multicore and leverage the power of multicore in your programs. Sharing hands-on case studies and real-world examples, the
Sensor module design and forward and inverse kinematics analysis of 6-DOF sorting transferring robot
Zhou, Huiying; Lin, Jiajian; Liu, Lei; Tao, Meng
2017-09-01
To meet the demand of high strength express sorting, it is significant to design a robot with multiple degrees of freedom that can sort and transfer. This paper uses infrared sensor, color sensor and pressure sensor to receive external information, combine the plan of motion path in advance and the feedback information from the sensors, then write relevant program. In accordance with these, we can design a 6-DOF robot that can realize multi-angle seizing. In order to obtain characteristics of forward and inverse kinematics, this paper describes the coordinate directions and pose estimation by the D-H parameter method and closed solution. On the basis of the solution of forward and inverse kinematics, geometric parameters of links and link parameters are optimized in terms of application requirements. In this way, this robot can identify route, sort and transfer.
A fuzzy PID-controlled SMA actuator for a two-DOF joint
Directory of Open Access Journals (Sweden)
Shi Zhenyun
2014-04-01
Full Text Available Shape memory alloy (SMA actuator is a potential advanced component for servo-systems of aerospace vehicles and aircraft. This paper presents a joint with two degrees of freedom (DOF and a mobility range close to ±60° when driven by SMA triple wires. The fuzzy proportional-integral-derivative (PID-controlled actuator drive was designed using antagonistic SMA triple wires, and the resistance feedback signal made a closed loop. Experiments showed that, with the driving responding frequency increasing, the overstress became harder to be avoided at the position under the maximum friction force. Furthermore, the hysteresis gap between the heating and cooling paths of the strain-to-resistance curve expanded under this condition. A fuzzy logic control was considered as a solution, and the curves of the wires were then modeled by fitting polynomials so that the measured resistance was used directly to determine the control signal. Accurate control was demonstrated through the step response, and the experimental results showed that under the fuzzy PID-control program, the mean absolute error (MAE of the rotation angle was about 3.147°. In addition, the investigation of the external interference to the system proved the controllable maximum output.
Design of a New 4-DOF Haptic Master Featuring Magnetorheological Fluid
Directory of Open Access Journals (Sweden)
Byung-Keun Song
2014-08-01
Full Text Available This work presents a novel 4-degree-of-freedom (4-DOF haptic master using magnetorheological (MR fluid which is applicable to a robot-assisted minimally invasive surgery (RMIS system. By using MR fluid, the proposed haptic device can easily generate bidirectional repulsive torque along the directions of the required motions. The proposed master consists of two actuators: an MR bidirectional clutch associated with a planetary gear system and an MR clutch with a bevel gear system. After demonstrating the configuration, the torque models of MR actuators are mathematically derived based on the field-dependent Bingham model. An optimal design that accounts for spatial-limitation and the desired torque constraint is then undertaken. An optimization procedure based on finite element analysis is proposed to determine optimal geometric dimensions. Based on the design procedure, MR haptic master with the optimal parameters has been manufactured. In order to demonstrate the practical feasibility of the proposed haptic master, the field-dependent generating repulsive force is measured. In addition, a proportional-integral-derivative (PID controller is empirically implemented to accomplish the desired torque trajectories. It has been shown that the proposed haptic master can track the desired torque trajectory without a significant error.
Transparency in stereopsis: parallel encoding of overlapping depth planes.
Reeves, Adam; Lynch, David
2017-08-01
We report that after extensive training, expert adults can accurately report the number, up to six, of transparent overlapping depth planes portrayed by brief (400 ms or 200 ms) random-element stereoscopic displays, and can well discriminate six from seven planes. Naïve subjects did poorly above three planes. Displays contained seven rows of 12 randomly located ×'s or +'s; jittering the disparities and number in each row to remove spurious cues had little effect on accuracy. Removing the central 3° of the 10° display to eliminate foveal vision hardly reduced the number of reportable planes. Experts could report how many of six planes contained +'s when the remainder contained ×'s, and most learned to report up to six planes in reverse contrast (left eye white +'s; right eye black +'s). Long-term training allowed some experts to reach eight depth planes. Results suggest that adult stereoscopic vision can learn to distinguish the outputs of six or more statistically independent, contrast-insensitive, narrowly tuned, asymmetric disparity channels in parallel.
Yang, Huiliao; Jiang, Bin; Yang, Hao; Liu, Hugh H T
2018-04-01
The distributed cooperative control strategy is proposed to make the networked nonlinear 3-DOF helicopters achieve the attitude synchronization in the presence of actuator faults and saturations. Based on robust adaptive control, the proposed control method can both compensate the uncertain partial loss of control effectiveness and deal with the system uncertainties. To address actuator saturation problem, the control scheme is designed to ensure that the saturation constraint on the actuation will not be violated during the operation in spite of the actuator faults. It is shown that with the proposed control strategy, both the tracking errors of the leading helicopter and the attitude synchronization errors of each following helicopter are bounded in the existence of faulty actuators and actuator saturations. Moreover, the state responses of the entire group would not exceed the predesigned performance functions which are totally independent from the underlaying interaction topology. Simulation results illustrate the effectiveness of the proposed control scheme. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gaballa, H; O’Brien, M; Riegel, A; Jamshidi, A; Klein, E [Northwell Health, Lake Success, NY (United States)
2016-06-15
Purpose: To develop a daily quality assurance (QA) device that can test the 6DoF (degrees of freedom) couch repositioning accuracy, prior to SBRT treatment deliveries, with an accuracy of ±0.3 degrees and ±0.3 mm. Methods: A daily QA phantom is designed with a focus on the derived center of projections of its markers, rather than tracking its individual markers one at a time. This approach can be the most favorable to address the intended machining accuracy of the QA phantom and the CBCT spatial resolution limitations, primarily 1 mm min slice thickness, simultaneously. With the current design, ±0.1 mm congruence of the resultant center of gravity of the markers with reference CT (0.6 mm minimum slice thickness) vs CBCT (1.0 mm minimum slice thickness) can be achieved. If successful, the QA device should be qualified to test 6DoF couch performance with a gauged accuracy of ±0.3 degrees/±0.3 mm. Testing is performed for the Varian True Beam 2.0 6DoF system. Results: Once the QA phantom is constructed and tested, agreement of the center of gravity of the reference CT scan and the CBCT scan of ±0.1 mm is achieved. This has translated into a consistent 3D-3D match on the treatment machine, CT vs CBCT, with a repetitive ±0.1 mm variation, thus exceeding our expectations. We have deployed the phantom for daily QA on one of our accelerators, and found that the QA time has increased by only 10 minutes. Conclusion: A 6DoF phantom has been designed (patent pending) and built with a realistic work flow in mind where the daily couch accuracy QA checks taking less than 10 minutes. Current developments include integration with the Varian’s Machine Performance Check consistency module.
Parallel alternating direction preconditioner for isogeometric simulations of explicit dynamics
Łoś, Marcin
2015-04-27
In this paper we present a parallel implementation of the alternating direction preconditioner for isogeometric simulations of explicit dynamics. The Alternating Direction Implicit (ADI) algorithm, belongs to the category of matrix-splitting iterative methods, was proposed almost six decades ago for solving parabolic and elliptic partial differential equations, see [1–4]. The new version of this algorithm has been recently developed for isogeometric simulations of two dimensional explicit dynamics [5] and steady-state diffusion equations with orthotropic heterogenous coefficients [6]. In this paper we present a parallel version of the alternating direction implicit algorithm for three dimensional simulations. The algorithm has been incorporated as a part of PETIGA an isogeometric framework [7] build on top of PETSc [8]. We show the scalability of the parallel algorithm on STAMPEDE linux cluster up to 10,000 processors, as well as the convergence rate of the PCG solver with ADI algorithm as preconditioner.
MEMS 6 degrees of freedom parallel micro manipulator for TEM sample manipulation
Brouwer, Dannis Michel; de Jong, B.R.; Soemers, Herman
2005-01-01
Up till now MEMS actuators acted either only in-plane or only out-of plane restricting to 3 DOF manipulation. A design for a millimeter-sized manipulator with 6 degrees of freedom to manipulate a micron-sized substrate at nanometer resolution over strokes of 10 microns with a position stability
A novel numerical approach for workspace determination of parallel mechanisms
Energy Technology Data Exchange (ETDEWEB)
Zhou, Yiqun; Niu, Junchuan; Liu, Zhihui; Zhang, Fuliang [Shandong University, Shandong (China)
2017-06-15
In this paper, a novel numerical approach is proposed for workspace determination of parallel mechanisms. Compared with the classical numerical approaches, this presented approach discretizes both location and orientation of the mechanism simultaneously, not only one of the two. This technique makes the presented numerical approach applicable in determining almost all types of workspaces, while traditional numerical approaches are only applicable in determining the constant orientation workspace and orientation workspace. The presented approach and its steps to determine the inclusive orientation workspace and total orientation workspace are described in detail. A lower-mobility parallel mechanism and a six-degrees-of-freedom Stewart platform are set as examples, the workspaces of these mechanisms are estimated and visualized by the proposed numerical approach. Furthermore, the efficiency of the presented approach is discussed. The examples show that the presented approach is applicable in determining the inclusive orientation workspace and total orientation workspace of parallel mechanisms with high efficiency.
Physics Structure Analysis of Parallel Waves Concept of Physics Teacher Candidate
International Nuclear Information System (INIS)
Sarwi, S; Linuwih, S; Supardi, K I
2017-01-01
The aim of this research was to find a parallel structure concept of wave physics and the factors that influence on the formation of parallel conceptions of physics teacher candidates. The method used qualitative research which types of cross-sectional design. These subjects were five of the third semester of basic physics and six of the fifth semester of wave course students. Data collection techniques used think aloud and written tests. Quantitative data were analysed with descriptive technique-percentage. The data analysis technique for belief and be aware of answers uses an explanatory analysis. Results of the research include: 1) the structure of the concept can be displayed through the illustration of a map containing the theoretical core, supplements the theory and phenomena that occur daily; 2) the trend of parallel conception of wave physics have been identified on the stationary waves, resonance of the sound and the propagation of transverse electromagnetic waves; 3) the influence on the parallel conception that reading textbooks less comprehensive and knowledge is partial understanding as forming the structure of the theory. (paper)
The importance of position and path repeatability on force at the knee during six-DOF joint motion.
Darcy, Shon P; Gil, Jorge E; Woo, Savio L-Y; Debski, Richard E
2009-06-01
Mechanical devices, such as robotic manipulators have been designed to measure joint and ligament function because of their ability to position a diarthrodial joint in six degrees-of-freedom with fidelity. However, the precision and performance of these testing devices vary. Therefore, the objective of this study was to determine the effect of systematic errors in position and path repeatability of two high-payload robotic manipulators (Manipulators 1 and 2) on the resultant forces at the knee. Using a porcine knee, the position and path repeatability of these manipulators were determined during passive flexion-extension with a coordinate measuring machine. The position repeatability of Manipulator 1 was 0.3 mm in position and 0.2 degrees in orientation while Manipulator 2 had a better position repeatability of 0.1 mm in position and 0.1 degrees in orientation throughout the range of positions examined. The corresponding variability in the resultant force at the knee for these assigned positions was 32+/-33 N for Manipulator 1 and 4+/-1 N for Manipulator 2. Furthermore, the repeatability of the trajectory of each manipulator while moving between assigned positions (path repeatability) was 0.8 mm for Manipulator 1 while the path repeatability for Manipulator 2 was improved (0.1 mm). These path discrepancies produced variability in the resultant force at the knee of 44+/-24 and 21+/-8 N, respectively, for Manipulators 1 and 2 primarily due to contact between the articular surfaces of the tibia and femur. Therefore, improved position and path repeatability yields lower variability in the resultant forces at the knee. Although position repeatability has been the most common criteria for evaluating biomechanical testing devices, the current study has clearly demonstrated that path repeatability can have an even larger effect on the variability in resultant force at the knee. Consequently, the repeatability of the path followed by the joint throughout its prescribed
Six degree-of-freedom knee joint kinematics in obese individuals with knee pain during gait.
Li, Jing-Sheng; Tsai, Tsung-Yuan; Felson, David T; Li, Guoan; Lewis, Cara L
2017-01-01
Knee joint pain is a common symptom in obese individuals and walking is often prescribed as part of management programs. Past studies in obese individuals have focused on standing alignment and kinematics in the sagittal and coronal planes. Investigation of 6 degree-of-freedom (6DOF) knee joint kinematics during standing and gait is important to thoroughly understand knee function in obese individuals with knee pain. This study aimed to investigate the 6DOF knee joint kinematics in standing and during gait in obese patients using a validated fluoroscopic imaging system. Ten individuals with obesity and knee pain were recruited. While standing, the knee was in 7.4±6.3°of hyperextension, 2.8±3.3° of abduction and 5.6±7.3° of external rotation. The femoral center was located 0.7±3.1mm anterior and 5.1±1.5mm medial to the tibial center. During treadmill gait, the sagittal plane motion, i.e., flexion/extension and anterior-posterior translation, showed a clear pattern. Specifically, obese individuals with knee pain maintained the knee in more flexion and more anterior tibial translation during most of the stance phase of the gait cycle and had a reduced total range of knee flexion when compared to a healthy non-obese group. In conclusion, obese individuals with knee pain used hyperextension knee posture while standing, but maintained the knee in more flexion during gait with reduced overall range of motion in the 6DOF analysis.
A highly scalable massively parallel fast marching method for the Eikonal equation
Yang, Jianming; Stern, Frederick
2017-03-01
The fast marching method is a widely used numerical method for solving the Eikonal equation arising from a variety of scientific and engineering fields. It is long deemed inherently sequential and an efficient parallel algorithm applicable to large-scale practical applications is not available in the literature. In this study, we present a highly scalable massively parallel implementation of the fast marching method using a domain decomposition approach. Central to this algorithm is a novel restarted narrow band approach that coordinates the frequency of communications and the amount of computations extra to a sequential run for achieving an unprecedented parallel performance. Within each restart, the narrow band fast marching method is executed; simple synchronous local exchanges and global reductions are adopted for communicating updated data in the overlapping regions between neighboring subdomains and getting the latest front status, respectively. The independence of front characteristics is exploited through special data structures and augmented status tags to extract the masked parallelism within the fast marching method. The efficiency, flexibility, and applicability of the parallel algorithm are demonstrated through several examples. These problems are extensively tested on six grids with up to 1 billion points using different numbers of processes ranging from 1 to 65536. Remarkable parallel speedups are achieved using tens of thousands of processes. Detailed pseudo-codes for both the sequential and parallel algorithms are provided to illustrate the simplicity of the parallel implementation and its similarity to the sequential narrow band fast marching algorithm.
Directory of Open Access Journals (Sweden)
El Aroudi A.
2014-01-01
Full Text Available In this paper, the model of a two-degree-of-freedom (2-DOF spring resonator with end stopper for an energy harvesting application is presented. Then we characterize its nonlinear dynamical behavior by numerical simulations when some suitable parameters are varied. The system is formed by two resonators subject to external vibrational excitation and with an end stopper. We present the continuous time dynamical model of the system in the form of a switched fourth order differential equation. Harmonic vibrations are considered as the main ambient energy source for the system and its frequency response representing the RMS value of the displacement is first computed. The dynamical behavior is unveiled by computing state-space trajectories, timedomain series and FFT spectra and frequency response as the excitation amplitude is varied.
Morse, H Stephen
1994-01-01
Practical Parallel Computing provides information pertinent to the fundamental aspects of high-performance parallel processing. This book discusses the development of parallel applications on a variety of equipment.Organized into three parts encompassing 12 chapters, this book begins with an overview of the technology trends that converge to favor massively parallel hardware over traditional mainframes and vector machines. This text then gives a tutorial introduction to parallel hardware architectures. Other chapters provide worked-out examples of programs using several parallel languages. Thi
Design of a 7-DOF haptic master using a magneto-rheological devices for robot surgery
Kang, Seok-Rae; Choi, Seung-Bok; Hwang, Yong-Hoon; Cha, Seung-Woo
2017-04-01
This paper presents a 7 degrees-of-freedom (7-DOF) haptic master which is applicable to the robot-assisted minimally invasive surgery (RMIS). By utilizing a controllable magneto-rheological (MR) fluid, the haptic master can provide force information to the surgeon during surgery. The proposed haptic master consists of three degrees motions of X, Y, Z and four degrees motions of the pitch, yaw, roll and grasping. All of them have force feedback capability. The proposed haptic master can generate the repulsive forces or torques by activating MR clutch and MR brake. Both MR clutch and MR brake are designed and manufactured with consideration of the size and output torque which is usable to the robotic surgery. A proportional-integral-derivative (PID) controller is then designed and implemented to achieve torque/force tracking trajectories. It is verified that the proposed haptic master can track well the desired torque and force occurred in the surgical place by controlling the input current applied to MR clutch and brake.
Crockett, Thomas W.
1995-01-01
This article provides a broad introduction to the subject of parallel rendering, encompassing both hardware and software systems. The focus is on the underlying concepts and the issues which arise in the design of parallel rendering algorithms and systems. We examine the different types of parallelism and how they can be applied in rendering applications. Concepts from parallel computing, such as data decomposition, task granularity, scalability, and load balancing, are considered in relation to the rendering problem. We also explore concepts from computer graphics, such as coherence and projection, which have a significant impact on the structure of parallel rendering algorithms. Our survey covers a number of practical considerations as well, including the choice of architectural platform, communication and memory requirements, and the problem of image assembly and display. We illustrate the discussion with numerous examples from the parallel rendering literature, representing most of the principal rendering methods currently used in computer graphics.
A novel 6-DOF parallel robot and its pose errors compensation
Shi, Zhixin; Ye, Meiyan; Luo, Yufeng
2011-10-01
In the traditional security solution conditions, software firewall cannot intercept and respond the invasion before being attacked. And because of the high cost, the hardware firewall does not apply to the security strategy of the end nodes, so we have designed a kind of solution of embedded firewall with hardware and software. With ARM embedding Linux operating system, we have designed packet filter module and intrusion detection module to implement the basic function of firewall. Experiments and results show that that firewall has the advantages of low cost, high processing speed, high safety and the application of the computer terminals. This paper focuses on packet filtering module design and implementation.
A general approach for optimal kinematic design of 6-DOF parallel ...
Indian Academy of Sciences (India)
In this work, an attempt has been made to present a generalized approach of ..... made either with the help of contour plots (figures 6a and b) or by comparing the .... IEEE International Conference on Robotics and Automation 3: 1970–1975.
1982-01-01
Parallel Computations focuses on parallel computation, with emphasis on algorithms used in a variety of numerical and physical applications and for many different types of parallel computers. Topics covered range from vectorization of fast Fourier transforms (FFTs) and of the incomplete Cholesky conjugate gradient (ICCG) algorithm on the Cray-1 to calculation of table lookups and piecewise functions. Single tridiagonal linear systems and vectorized computation of reactive flow are also discussed.Comprised of 13 chapters, this volume begins by classifying parallel computers and describing techn
A combined vision-inertial fusion approach for 6-DoF object pose estimation
Li, Juan; Bernardos, Ana M.; Tarrío, Paula; Casar, José R.
2015-02-01
The estimation of the 3D position and orientation of moving objects (`pose' estimation) is a critical process for many applications in robotics, computer vision or mobile services. Although major research efforts have been carried out to design accurate, fast and robust indoor pose estimation systems, it remains as an open challenge to provide a low-cost, easy to deploy and reliable solution. Addressing this issue, this paper describes a hybrid approach for 6 degrees of freedom (6-DoF) pose estimation that fuses acceleration data and stereo vision to overcome the respective weaknesses of single technology approaches. The system relies on COTS technologies (standard webcams, accelerometers) and printable colored markers. It uses a set of infrastructure cameras, located to have the object to be tracked visible most of the operation time; the target object has to include an embedded accelerometer and be tagged with a fiducial marker. This simple marker has been designed for easy detection and segmentation and it may be adapted to different service scenarios (in shape and colors). Experimental results show that the proposed system provides high accuracy, while satisfactorily dealing with the real-time constraints.
A Tabular Format for Computing Inverse Kinematic Equations for a 3DOF Robot Leg
Directory of Open Access Journals (Sweden)
F. Nickols
2009-09-01
Full Text Available A method is presented for accurately computing the three servomechanism angles that place the leg tip of a 3DOF robot leg in cylindrical coordinate space, R, θ, Z. The method is characterized by (i a multivariable integer power series for each degree of freedom that can be used to replace traditional trigonometrical functions, and, (ii only integer numbers are used. A technique is shown that derives the coefficients, Ci j k, of each of the terms in the series that represents a servomechanism angle, S. This power series method has the advantage of; (i satisfying accuracy requirements, (ii producing a unique solution, (iii high speed realtime computation, (iv low memory requirement and (v implementation into a generic algorithm or hardware such as a field programmable gate array. The series can represent many continuous kinematic systems just by changing the values of the coefficients. The coefficients are rapidly computed via a spreadsheet. The method can be extended to more than three degrees of freedom and also mapped into other coordinate frames such as a Cartesian or spherical.
Akl, Selim G
1985-01-01
Parallel Sorting Algorithms explains how to use parallel algorithms to sort a sequence of items on a variety of parallel computers. The book reviews the sorting problem, the parallel models of computation, parallel algorithms, and the lower bounds on the parallel sorting problems. The text also presents twenty different algorithms, such as linear arrays, mesh-connected computers, cube-connected computers. Another example where algorithm can be applied is on the shared-memory SIMD (single instruction stream multiple data stream) computers in which the whole sequence to be sorted can fit in the
Graphics Processing Unit Enhanced Parallel Document Flocking Clustering
Energy Technology Data Exchange (ETDEWEB)
Cui, Xiaohui [ORNL; Potok, Thomas E [ORNL; ST Charles, Jesse Lee [ORNL
2010-01-01
Analyzing and clustering documents is a complex problem. One explored method of solving this problem borrows from nature, imitating the flocking behavior of birds. One limitation of this method of document clustering is its complexity O(n2). As the number of documents grows, it becomes increasingly difficult to generate results in a reasonable amount of time. In the last few years, the graphics processing unit (GPU) has received attention for its ability to solve highly-parallel and semi-parallel problems much faster than the traditional sequential processor. In this paper, we have conducted research to exploit this archi- tecture and apply its strengths to the flocking based document clustering problem. Using the CUDA platform from NVIDIA, we developed a doc- ument flocking implementation to be run on the NVIDIA GEFORCE GPU. Performance gains ranged from thirty-six to nearly sixty times improvement of the GPU over the CPU implementation.
Irwansyah; Sinh, N. P.; Lai, J. Y.; Essomba, T.; Asbar, R.; Lee, P. Y.
2018-02-01
In this paper, we present study to integrate virtual fracture bone reduction simulation tool with a novel hybrid 3-DOF-RPS external fixator to relocate back bone fragments into their anatomically original position. A 3D model of fractured bone was reconstructed and manipulated using 3D design and modeling software, PhysiGuide. The virtual reduction system was applied to reduce a bilateral femoral shaft fracture type 32-A3. Measurement data from fracture reduction and fixation stages were implemented to manipulate the manipulator pose in patient’s clinical case. The experimental result presents that by merging both of those techniques will give more possibilities to reduce virtual bone reduction time, improve facial and shortest healing treatment.
Jeon, Jaeho; Kim, Yongdeok; Kim, Jongryoul; Kang, Heejea; Ji, Hyunjin
2013-01-01
The aim of this paper was to propose a new method of bimaxillary orthognathic surgery planning and model surgery based on the concept of 6 degrees of freedom (DOF). A 22-year-old man with Class III malocclusion was referred to our clinic with complaints of facial deformity and chewing difficulty. To correct a prognathic mandible, facial asymmetry, flat occlusal plane angle, labioversion of the maxillary central incisors, and concavity of the facial profile, bimaxillary orthognathic surgery was planned. After preoperative orthodontic treatment, surgical planning based on the concept of 6 DOF was performed on a surgical treatment objective drawing, and a Jeon's model surgery chart (JMSC) was prepared. Model surgery was performed with Jeon's orthognathic surgery simulator (JOSS) using the JMSC, and an interim wafer was fabricated. Le Fort I osteotomy, bilateral sagittal split ramus osteotomy, and malar augmentation were performed. The patient received lateral cephalometric and posteroanterior cephalometric analysis in postretention for 1 year. The follow-up results were determined to be satisfactory, and skeletal relapse did not occur after 1.5 years of surgery. When maxillary and mandibular models are considered as rigid bodies, and their state of motion is described in a quantitative manner based on 6 DOF, sharing of exact information on locational movement in 3-dimensional space is possible. The use of JMSC and JOSS will actualize accurate communication and performance of model surgery among clinicians based on objective measurements. PMID:23503161
Deshmane, Anagha; Gulani, Vikas; Griswold, Mark A; Seiberlich, Nicole
2012-07-01
Parallel imaging is a robust method for accelerating the acquisition of magnetic resonance imaging (MRI) data, and has made possible many new applications of MR imaging. Parallel imaging works by acquiring a reduced amount of k-space data with an array of receiver coils. These undersampled data can be acquired more quickly, but the undersampling leads to aliased images. One of several parallel imaging algorithms can then be used to reconstruct artifact-free images from either the aliased images (SENSE-type reconstruction) or from the undersampled data (GRAPPA-type reconstruction). The advantages of parallel imaging in a clinical setting include faster image acquisition, which can be used, for instance, to shorten breath-hold times resulting in fewer motion-corrupted examinations. In this article the basic concepts behind parallel imaging are introduced. The relationship between undersampling and aliasing is discussed and two commonly used parallel imaging methods, SENSE and GRAPPA, are explained in detail. Examples of artifacts arising from parallel imaging are shown and ways to detect and mitigate these artifacts are described. Finally, several current applications of parallel imaging are presented and recent advancements and promising research in parallel imaging are briefly reviewed. Copyright © 2012 Wiley Periodicals, Inc.
A Soft Parallel Kinematic Mechanism.
White, Edward L; Case, Jennifer C; Kramer-Bottiglio, Rebecca
2018-02-01
In this article, we describe a novel holonomic soft robotic structure based on a parallel kinematic mechanism. The design is based on the Stewart platform, which uses six sensors and actuators to achieve full six-degree-of-freedom motion. Our design is much less complex than a traditional platform, since it replaces the 12 spherical and universal joints found in a traditional Stewart platform with a single highly deformable elastomer body and flexible actuators. This reduces the total number of parts in the system and simplifies the assembly process. Actuation is achieved through coiled-shape memory alloy actuators. State observation and feedback is accomplished through the use of capacitive elastomer strain gauges. The main structural element is an elastomer joint that provides antagonistic force. We report the response of the actuators and sensors individually, then report the response of the complete assembly. We show that the completed robotic system is able to achieve full position control, and we discuss the limitations associated with using responsive material actuators. We believe that control demonstrated on a single body in this work could be extended to chains of such bodies to create complex soft robots.
von Davier, Matthias
2016-01-01
This report presents results on a parallel implementation of the expectation-maximization (EM) algorithm for multidimensional latent variable models. The developments presented here are based on code that parallelizes both the E step and the M step of the parallel-E parallel-M algorithm. Examples presented in this report include item response…
Gravity, two times, tractors, Weyl invariance, and six-dimensional quantum mechanics
International Nuclear Information System (INIS)
Bonezzi, R.; Latini, E.; Waldron, A.
2010-01-01
Fefferman and Graham showed some time ago that four-dimensional conformal geometries could be analyzed in terms of six-dimensional, ambient, Riemannian geometries admitting a closed homothety. Recently, it was shown how conformal geometry provides a description of physics manifestly invariant under local choices of unit systems. Strikingly, Einstein's equations are then equivalent to the existence of a parallel scale tractor (a six-component vector subject to a certain first order covariant constancy condition at every point in four-dimensional spacetime). These results suggest a six-dimensional description of four-dimensional physics, a viewpoint promulgated by the 2 times physics program of Bars. The Fefferman-Graham construction relies on a triplet of operators corresponding, respectively, to a curved six-dimensional light cone, the dilation generator and the Laplacian. These form an sp(2) algebra which Bars employs as a first class algebra of constraints in a six-dimensional gauge theory. In this article four-dimensional gravity is recast in terms of six-dimensional quantum mechanics by melding the 2 times and tractor approaches. This parent formulation of gravity is built from an infinite set of six-dimensional fields. Successively integrating out these fields yields various novel descriptions of gravity including a new four-dimensional one built from a scalar doublet, a tractor-vector multiplet and a conformal class of metrics.
A SPECT reconstruction method for extending parallel to non-parallel geometries
International Nuclear Information System (INIS)
Wen Junhai; Liang Zhengrong
2010-01-01
Due to its simplicity, parallel-beam geometry is usually assumed for the development of image reconstruction algorithms. The established reconstruction methodologies are then extended to fan-beam, cone-beam and other non-parallel geometries for practical application. This situation occurs for quantitative SPECT (single photon emission computed tomography) imaging in inverting the attenuated Radon transform. Novikov reported an explicit parallel-beam formula for the inversion of the attenuated Radon transform in 2000. Thereafter, a formula for fan-beam geometry was reported by Bukhgeim and Kazantsev (2002 Preprint N. 99 Sobolev Institute of Mathematics). At the same time, we presented a formula for varying focal-length fan-beam geometry. Sometimes, the reconstruction formula is so implicit that we cannot obtain the explicit reconstruction formula in the non-parallel geometries. In this work, we propose a unified reconstruction framework for extending parallel-beam geometry to any non-parallel geometry using ray-driven techniques. Studies by computer simulations demonstrated the accuracy of the presented unified reconstruction framework for extending parallel-beam to non-parallel geometries in inverting the attenuated Radon transform.
The language parallel Pascal and other aspects of the massively parallel processor
Reeves, A. P.; Bruner, J. D.
1982-01-01
A high level language for the Massively Parallel Processor (MPP) was designed. This language, called Parallel Pascal, is described in detail. A description of the language design, a description of the intermediate language, Parallel P-Code, and details for the MPP implementation are included. Formal descriptions of Parallel Pascal and Parallel P-Code are given. A compiler was developed which converts programs in Parallel Pascal into the intermediate Parallel P-Code language. The code generator to complete the compiler for the MPP is being developed independently. A Parallel Pascal to Pascal translator was also developed. The architecture design for a VLSI version of the MPP was completed with a description of fault tolerant interconnection networks. The memory arrangement aspects of the MPP are discussed and a survey of other high level languages is given.
Parallel Atomistic Simulations
Energy Technology Data Exchange (ETDEWEB)
HEFFELFINGER,GRANT S.
2000-01-18
Algorithms developed to enable the use of atomistic molecular simulation methods with parallel computers are reviewed. Methods appropriate for bonded as well as non-bonded (and charged) interactions are included. While strategies for obtaining parallel molecular simulations have been developed for the full variety of atomistic simulation methods, molecular dynamics and Monte Carlo have received the most attention. Three main types of parallel molecular dynamics simulations have been developed, the replicated data decomposition, the spatial decomposition, and the force decomposition. For Monte Carlo simulations, parallel algorithms have been developed which can be divided into two categories, those which require a modified Markov chain and those which do not. Parallel algorithms developed for other simulation methods such as Gibbs ensemble Monte Carlo, grand canonical molecular dynamics, and Monte Carlo methods for protein structure determination are also reviewed and issues such as how to measure parallel efficiency, especially in the case of parallel Monte Carlo algorithms with modified Markov chains are discussed.
Parallel integer sorting with medium and fine-scale parallelism
Dagum, Leonardo
1993-01-01
Two new parallel integer sorting algorithms, queue-sort and barrel-sort, are presented and analyzed in detail. These algorithms do not have optimal parallel complexity, yet they show very good performance in practice. Queue-sort designed for fine-scale parallel architectures which allow the queueing of multiple messages to the same destination. Barrel-sort is designed for medium-scale parallel architectures with a high message passing overhead. The performance results from the implementation of queue-sort on a Connection Machine CM-2 and barrel-sort on a 128 processor iPSC/860 are given. The two implementations are found to be comparable in performance but not as good as a fully vectorized bucket sort on the Cray YMP.
Srivastava, Saurabh; Pandit, V S
2017-11-01
This paper focuses on the analytical design of a Proportional Integral and Derivative (PID) controller together with a unique set point filter that makes the overall Two-Degree of-Freedom (2-Dof) control system for integrating processes with time delay. The PID controller tuning is based on the Linear Quadratic Regulator (LQR) using dominant pole placement approach to obtain good regulatory response. The set point filter is designed with the calculated PID parameters and using a single filter time constant (λ) to precisely control the servo response. The effectiveness of the proposed methodology is demonstrated through a series of illustrative examples using real industrial integrated process models. The whole range of PID parameters is obtained for each case in a tradeoff between the robustness of the closed loop system measured in terms of Maximum Sensitivity (M s ) and the load disturbance measured in terms of Integral of Absolute Errors (IAE). Results show improved closed loop response in terms of regulatory and servo responses with less control efforts when compared with the latest PID tuning methods of integrating systems. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.
Dark/visible parallel universes and Big Bang nucleosynthesis
International Nuclear Information System (INIS)
Bertulani, C. A.; Frederico, T.; Fuqua, J.; Hussein, M. S.; Oliveira, O.; Paula, W. de
2012-01-01
We develop a model for visible matter-dark matter interaction based on the exchange of a massive gray boson called herein the Mulato. Our model hinges on the assumption that all known particles in the visible matter have their counterparts in the dark matter. We postulate six families of particles five of which are dark. This leads to the unavoidable postulation of six parallel worlds, the visible one and five invisible worlds. A close study of big bang nucleosynthesis (BBN), baryon asymmetries, cosmic microwave background (CMB) bounds, galaxy dynamics, together with the Standard Model assumptions, help us to set a limit on the mass and width of the new gauge boson. Modification of the statistics underlying the kinetic energy distribution of particles during the BBN is also discussed. The changes in reaction rates during the BBN due to a departure from the Debye-Hueckel electron screening model is also investigated.
Nugteren, C.; Corporaal, H.
2012-01-01
Multi-core and many-core were already major trends for the past six years and are expected to continue for the next decade. With these trends of parallel computing, it becomes increasingly difficult to decide on which processor to run a given application, mainly because the programming of these
About Parallel Programming: Paradigms, Parallel Execution and Collaborative Systems
Directory of Open Access Journals (Sweden)
Loredana MOCEAN
2009-01-01
Full Text Available In the last years, there were made efforts for delineation of a stabile and unitary frame, where the problems of logical parallel processing must find solutions at least at the level of imperative languages. The results obtained by now are not at the level of the made efforts. This paper wants to be a little contribution at these efforts. We propose an overview in parallel programming, parallel execution and collaborative systems.
Fox, Geoffrey C; Messina, Guiseppe C
2014-01-01
A clear illustration of how parallel computers can be successfully appliedto large-scale scientific computations. This book demonstrates how avariety of applications in physics, biology, mathematics and other scienceswere implemented on real parallel computers to produce new scientificresults. It investigates issues of fine-grained parallelism relevant forfuture supercomputers with particular emphasis on hypercube architecture. The authors describe how they used an experimental approach to configuredifferent massively parallel machines, design and implement basic systemsoftware, and develop
Characterization of robotics parallel algorithms and mapping onto a reconfigurable SIMD machine
Lee, C. S. G.; Lin, C. T.
1989-01-01
The kinematics, dynamics, Jacobian, and their corresponding inverse computations are six essential problems in the control of robot manipulators. Efficient parallel algorithms for these computations are discussed and analyzed. Their characteristics are identified and a scheme on the mapping of these algorithms to a reconfigurable parallel architecture is presented. Based on the characteristics including type of parallelism, degree of parallelism, uniformity of the operations, fundamental operations, data dependencies, and communication requirement, it is shown that most of the algorithms for robotic computations possess highly regular properties and some common structures, especially the linear recursive structure. Moreover, they are well-suited to be implemented on a single-instruction-stream multiple-data-stream (SIMD) computer with reconfigurable interconnection network. The model of a reconfigurable dual network SIMD machine with internal direct feedback is introduced. A systematic procedure internal direct feedback is introduced. A systematic procedure to map these computations to the proposed machine is presented. A new scheduling problem for SIMD machines is investigated and a heuristic algorithm, called neighborhood scheduling, that reorders the processing sequence of subtasks to reduce the communication time is described. Mapping results of a benchmark algorithm are illustrated and discussed.
Setsompop, Kawin; Alagappan, Vijayanand; Gagoski, Borjan; Witzel, Thomas; Polimeni, Jonathan; Potthast, Andreas; Hebrank, Franz; Fontius, Ulrich; Schmitt, Franz; Wald, Lawrence L; Adalsteinsson, Elfar
2008-12-01
Slice-selective RF waveforms that mitigate severe B1+ inhomogeneity at 7 Tesla using parallel excitation were designed and validated in a water phantom and human studies on six subjects using a 16-element degenerate stripline array coil driven with a butler matrix to utilize the eight most favorable birdcage modes. The parallel RF waveform design applied magnitude least-squares (MLS) criteria with an optimized k-space excitation trajectory to significantly improve profile uniformity compared to conventional least-squares (LS) designs. Parallel excitation RF pulses designed to excite a uniform in-plane flip angle (FA) with slice selection in the z-direction were demonstrated and compared with conventional sinc-pulse excitation and RF shimming. In all cases, the parallel RF excitation significantly mitigated the effects of inhomogeneous B1+ on the excitation FA. The optimized parallel RF pulses for human B1+ mitigation were only 67% longer than a conventional sinc-based excitation, but significantly outperformed RF shimming. For example the standard deviations (SDs) of the in-plane FA (averaged over six human studies) were 16.7% for conventional sinc excitation, 13.3% for RF shimming, and 7.6% for parallel excitation. This work demonstrates that excitations with parallel RF systems can provide slice selection with spatially uniform FAs at high field strengths with only a small pulse-duration penalty. (c) 2008 Wiley-Liss, Inc.
Eigensolution of finite element problems in a completely connected parallel architecture
Akl, Fred A.; Morel, Michael R.
1989-01-01
A parallel algorithm for the solution of the generalized eigenproblem in linear elastic finite element analysis, (K)(phi)=(M)(phi)(omega), where (K) and (M) are of order N, and (omega) is of order q is presented. The parallel algorithm is based on a completely connected parallel architecture in which each processor is allowed to communicate with all other processors. The algorithm has been successfully implemented on a tightly coupled multiple-instruction-multiple-data (MIMD) parallel processing computer, Cray X-MP. A finite element model is divided into m domains each of which is assumed to process n elements. Each domain is then assigned to a processor, or to a logical processor (task) if the number of domains exceeds the number of physical processors. The macro-tasking library routines are used in mapping each domain to a user task. Computational speed-up and efficiency are used to determine the effectiveness of the algorithm. The effect of the number of domains, the number of degrees-of-freedom located along the global fronts and the dimension of the subspace on the performance of the algorithm are investigated. For a 64-element rectangular plate, speed-ups of 1.86, 3.13, 3.18 and 3.61 are achieved on two, four, six and eight processors, respectively.
Directory of Open Access Journals (Sweden)
Yanzhi Zhao
2016-08-01
Full Text Available Nowadays improving the accuracy and enlarging the measuring range of six-axis force sensors for wider applications in aircraft landing, rocket thrust, and spacecraft docking testing experiments has become an urgent objective. However, it is still difficult to achieve high accuracy and large measuring range with traditional parallel six-axis force sensors due to the influence of the gap and friction of the joints. Therefore, to overcome the mentioned limitations, this paper proposed a 6-Universal-Prismatic-Universal-Revolute (UPUR joints parallel mechanism with flexible joints to develop a large measurement range six-axis force sensor. The structural characteristics of the sensor are analyzed in comparison with traditional parallel sensor based on the Stewart platform. The force transfer relation of the sensor is deduced, and the force Jacobian matrix is obtained using screw theory in two cases of the ideal state and the state of flexibility of each flexible joint is considered. The prototype and loading calibration system are designed and developed. The K value method and least squares method are used to process experimental data, and in errors of kind Ι and kind II linearity are obtained. The experimental results show that the calibration error of the K value method is more than 13.4%, and the calibration error of the least squares method is 2.67%. The experimental results prove the feasibility of the sensor and the correctness of the theoretical analysis which are expected to be adopted in practical applications.
Zhao, Yanzhi; Zhang, Caifeng; Zhang, Dan; Shi, Zhongpan; Zhao, Tieshi
2016-08-11
Nowadays improving the accuracy and enlarging the measuring range of six-axis force sensors for wider applications in aircraft landing, rocket thrust, and spacecraft docking testing experiments has become an urgent objective. However, it is still difficult to achieve high accuracy and large measuring range with traditional parallel six-axis force sensors due to the influence of the gap and friction of the joints. Therefore, to overcome the mentioned limitations, this paper proposed a 6-Universal-Prismatic-Universal-Revolute (UPUR) joints parallel mechanism with flexible joints to develop a large measurement range six-axis force sensor. The structural characteristics of the sensor are analyzed in comparison with traditional parallel sensor based on the Stewart platform. The force transfer relation of the sensor is deduced, and the force Jacobian matrix is obtained using screw theory in two cases of the ideal state and the state of flexibility of each flexible joint is considered. The prototype and loading calibration system are designed and developed. The K value method and least squares method are used to process experimental data, and in errors of kind Ι and kind II linearity are obtained. The experimental results show that the calibration error of the K value method is more than 13.4%, and the calibration error of the least squares method is 2.67%. The experimental results prove the feasibility of the sensor and the correctness of the theoretical analysis which are expected to be adopted in practical applications.
Archer, Charles J.; Blocksome, Michael A.; Ratterman, Joseph D.; Smith, Brian E.
2014-08-12
Endpoint-based parallel data processing in a parallel active messaging interface (`PAMI`) of a parallel computer, the PAMI composed of data communications endpoints, each endpoint including a specification of data communications parameters for a thread of execution on a compute node, including specifications of a client, a context, and a task, the compute nodes coupled for data communications through the PAMI, including establishing a data communications geometry, the geometry specifying, for tasks representing processes of execution of the parallel application, a set of endpoints that are used in collective operations of the PAMI including a plurality of endpoints for one of the tasks; receiving in endpoints of the geometry an instruction for a collective operation; and executing the instruction for a collective operation through the endpoints in dependence upon the geometry, including dividing data communications operations among the plurality of endpoints for one of the tasks.
COMPARISON OF PARALLEL AND SERIES HYBRID POWERTRAINS FOR TRANSIT BUS APPLICATION
Energy Technology Data Exchange (ETDEWEB)
Gao, Zhiming [ORNL; Daw, C Stuart [ORNL; Smith, David E [ORNL; Jones, Perry T [ORNL; LaClair, Tim J [ORNL; Parks, II, James E [ORNL
2016-01-01
The fuel economy and emissions of both conventional and hybrid buses equipped with emissions aftertreatment were evaluated via computational simulation for six representative city bus drive cycles. Both series and parallel configurations for the hybrid case were studied. The simulation results indicate that series hybrid buses have the greatest overall advantage in fuel economy. The series and parallel hybrid buses were predicted to produce similar CO and HC tailpipe emissions but were also predicted to have reduced NOx tailpipe emissions compared to the conventional bus in higher speed cycles. For the New York bus cycle (NYBC), which has the lowest average speed among the cycles evaluated, the series bus tailpipe emissions were somewhat higher than they were for the conventional bus, while the parallel hybrid bus had significantly lower tailpipe emissions. All three bus powertrains were found to require periodic active DPF regeneration to maintain PM control. Plug-in operation of series hybrid buses appears to offer significant fuel economy benefits and is easily employed due to the relatively large battery capacity that is typical of the series hybrid configuration.
ColDICE: A parallel Vlasov–Poisson solver using moving adaptive simplicial tessellation
International Nuclear Information System (INIS)
Sousbie, Thierry; Colombi, Stéphane
2016-01-01
Resolving numerically Vlasov–Poisson equations for initially cold systems can be reduced to following the evolution of a three-dimensional sheet evolving in six-dimensional phase-space. We describe a public parallel numerical algorithm consisting in representing the phase-space sheet with a conforming, self-adaptive simplicial tessellation of which the vertices follow the Lagrangian equations of motion. The algorithm is implemented both in six- and four-dimensional phase-space. Refinement of the tessellation mesh is performed using the bisection method and a local representation of the phase-space sheet at second order relying on additional tracers created when needed at runtime. In order to preserve in the best way the Hamiltonian nature of the system, refinement is anisotropic and constrained by measurements of local Poincaré invariants. Resolution of Poisson equation is performed using the fast Fourier method on a regular rectangular grid, similarly to particle in cells codes. To compute the density projected onto this grid, the intersection of the tessellation and the grid is calculated using the method of Franklin and Kankanhalli [65–67] generalised to linear order. As preliminary tests of the code, we study in four dimensional phase-space the evolution of an initially small patch in a chaotic potential and the cosmological collapse of a fluctuation composed of two sinusoidal waves. We also perform a “warm” dark matter simulation in six-dimensional phase-space that we use to check the parallel scaling of the code.
ColDICE: A parallel Vlasov–Poisson solver using moving adaptive simplicial tessellation
Energy Technology Data Exchange (ETDEWEB)
Sousbie, Thierry, E-mail: tsousbie@gmail.com [Institut d' Astrophysique de Paris, CNRS UMR 7095 and UPMC, 98bis, bd Arago, F-75014 Paris (France); Department of Physics, The University of Tokyo, Tokyo 113-0033 (Japan); Research Center for the Early Universe, School of Science, The University of Tokyo, Tokyo 113-0033 (Japan); Colombi, Stéphane, E-mail: colombi@iap.fr [Institut d' Astrophysique de Paris, CNRS UMR 7095 and UPMC, 98bis, bd Arago, F-75014 Paris (France); Yukawa Institute for Theoretical Physics, Kyoto University, Kyoto 606-8502 (Japan)
2016-09-15
Resolving numerically Vlasov–Poisson equations for initially cold systems can be reduced to following the evolution of a three-dimensional sheet evolving in six-dimensional phase-space. We describe a public parallel numerical algorithm consisting in representing the phase-space sheet with a conforming, self-adaptive simplicial tessellation of which the vertices follow the Lagrangian equations of motion. The algorithm is implemented both in six- and four-dimensional phase-space. Refinement of the tessellation mesh is performed using the bisection method and a local representation of the phase-space sheet at second order relying on additional tracers created when needed at runtime. In order to preserve in the best way the Hamiltonian nature of the system, refinement is anisotropic and constrained by measurements of local Poincaré invariants. Resolution of Poisson equation is performed using the fast Fourier method on a regular rectangular grid, similarly to particle in cells codes. To compute the density projected onto this grid, the intersection of the tessellation and the grid is calculated using the method of Franklin and Kankanhalli [65–67] generalised to linear order. As preliminary tests of the code, we study in four dimensional phase-space the evolution of an initially small patch in a chaotic potential and the cosmological collapse of a fluctuation composed of two sinusoidal waves. We also perform a “warm” dark matter simulation in six-dimensional phase-space that we use to check the parallel scaling of the code.
Sartipi, S.; Jansma, H.; Bosma, D.; Boshuizen, B.; Makkee, M.; Gascon, J.; Kapteijn, F.
2013-01-01
Design and operation of a “six-flow fixed-bed microreactor” setup for Fischer-Tropsch synthesis (FTS) is described. The unit consists of feed and mixing, flow division, reaction, separation, and analysis sections. The reactor system is made of five heating blocks with individual temperature controllers, assuring an identical isothermal zone of at least 10 cm along six fixed-bed microreactor inserts (4?mm inner diameter). Such a lab-scale setup allows running six experiments in parallel, under...
Design of human controlled 1 DOF right hand exoskeleton using electromyography signal
Azzam, M.; Wijaya, S. K.; Prawito
2017-07-01
Exoskeleton in general is a structure that is anatomically designed to be able to accommodate the physical movement of its user and provide additional strength. The use of EMG signal to control a 1 DOF right arm exoskeleton is evaluated in this research. This research aims to achieve optimum control using EMG signal. EMG signal is a variation of voltage that occurs when muscle contracts hence its strong correlation with the user's intention of movement. The RMS values of each EMG signal that originates from bicep and tricep muscle are calculated and processed to determine the direction and speed of rotation of a DC motor that actuates the exoskeleton. The RMS calculation is conducted at various array length that will theoretically affect its accuracy. The difference between those two RMS values is then calculated and interpreted as the intention of flexion or extension movement that will control the DC motor rotational direction. The absolute value of the RMS difference multiplied with a gain factor is used to regulate the duty cycle of a PWM signal that is used to control the rotational speed of the DC motor. To achieve the smallest settling time, array length and gain factor were varied. The test was conducted in two stages, static and dynamic tests. The test result shows a trend where the settling time decreases when array length is shortened and gain is increased. It shows that optimum control can be achieved by selecting the right array length and gain.
Computational experience with a parallel algorithm for tetrangle inequality bound smoothing.
Rajan, K; Deo, N
1999-09-01
Determining molecular structure from interatomic distances is an important and challenging problem. Given a molecule with n atoms, lower and upper bounds on interatomic distances can usually be obtained only for a small subset of the 2(n(n-1)) atom pairs, using NMR. Given the bounds so obtained on the distances between some of the atom pairs, it is often useful to compute tighter bounds on all the 2(n(n-1)) pairwise distances. This process is referred to as bound smoothing. The initial lower and upper bounds for the pairwise distances not measured are usually assumed to be 0 and infinity. One method for bound smoothing is to use the limits imposed by the triangle inequality. The distance bounds so obtained can often be tightened further by applying the tetrangle inequality--the limits imposed on the six pairwise distances among a set of four atoms (instead of three for the triangle inequalities). The tetrangle inequality is expressed by the Cayley-Menger determinants. For every quadruple of atoms, each pass of the tetrangle inequality bound smoothing procedure finds upper and lower limits on each of the six distances in the quadruple. Applying the tetrangle inequalities to each of the (4n) quadruples requires O(n4) time. Here, we propose a parallel algorithm for bound smoothing employing the tetrangle inequality. Each pass of our algorithm requires O(n3 log n) time on a REW PRAM (Concurrent Read Exclusive Write Parallel Random Access Machine) with O(log(n)n) processors. An implementation of this parallel algorithm on the Intel Paragon XP/S and its performance are also discussed.
Parallel phase model : a programming model for high-end parallel machines with manycores.
Energy Technology Data Exchange (ETDEWEB)
Wu, Junfeng (Syracuse University, Syracuse, NY); Wen, Zhaofang; Heroux, Michael Allen; Brightwell, Ronald Brian
2009-04-01
This paper presents a parallel programming model, Parallel Phase Model (PPM), for next-generation high-end parallel machines based on a distributed memory architecture consisting of a networked cluster of nodes with a large number of cores on each node. PPM has a unified high-level programming abstraction that facilitates the design and implementation of parallel algorithms to exploit both the parallelism of the many cores and the parallelism at the cluster level. The programming abstraction will be suitable for expressing both fine-grained and coarse-grained parallelism. It includes a few high-level parallel programming language constructs that can be added as an extension to an existing (sequential or parallel) programming language such as C; and the implementation of PPM also includes a light-weight runtime library that runs on top of an existing network communication software layer (e.g. MPI). Design philosophy of PPM and details of the programming abstraction are also presented. Several unstructured applications that inherently require high-volume random fine-grained data accesses have been implemented in PPM with very promising results.
Arkin, Ethem; Tekinerdogan, Bedir; Imre, Kayhan M.
2017-01-01
The need for high-performance computing together with the increasing trend from single processor to parallel computer architectures has leveraged the adoption of parallel computing. To benefit from parallel computing power, usually parallel algorithms are defined that can be mapped and executed
Directory of Open Access Journals (Sweden)
B. Ding
2017-05-01
Full Text Available Flexure-based mechanisms have been widely used for scanning tunneling microscopy, nanoimprint lithography, fast servo tool system and micro/nano manipulation. In this paper, a novel planar micromanipulation stage with large rotational displacement is proposed. The designed monolithic manipulator has three degrees of freedom (DOF, i.e. two translations along the X and Y axes and one rotation around Z axis. In order to get a large workspace, the lever mechanism is adopted to magnify the stroke of the piezoelectric actuators and also the leaf beam flexure is utilized due to its large rotational scope. Different from conventional pre-tightening mechanism, a modified pre-tightening mechanism, which is less harmful to the stacked actuators, is proposed in this paper. Taking the circular flexure hinges and leaf beam flexures hinges as revolute joints, the forward kinematics and inverse kinematics models of this stage are derived. The workspace of the micromanipulator is finally obtained, which is based on the derived kinematic models.
Directory of Open Access Journals (Sweden)
Jianxun Fu
2015-05-01
Full Text Available This article presents a special 6-degree-of freedom parallel manipulator, and the mechanical structure of this robot has been introduced; with this structure, the kinematic constrain equations are decoupled. Based on this character, the polynomial solutions of the forward kinematics problem are also presented. In this method, the closed-loop kinematic chain of the manipulator is divided into two parts, the solution forward position kinematics is obtained by a first-degree polynomial equation first, and then an eighth-degree polynomial equation in a single variable for the forward orientation kinematics is obtained. Based on those solutions, the configurations of the robot, including position and orientation of the end-effector, are graphically displayed. A numerical simulation is given to verify the algorithm, and the result implies that for a given set of input values, the manipulator can be assembled in eight different configurations at most. And a set of experiments illustrate the motion ability for forward kinematics of the prototype of this manipulator.
Casanova, Henri; Robert, Yves
2008-01-01
""…The authors of the present book, who have extensive credentials in both research and instruction in the area of parallelism, present a sound, principled treatment of parallel algorithms. … This book is very well written and extremely well designed from an instructional point of view. … The authors have created an instructive and fascinating text. The book will serve researchers as well as instructors who need a solid, readable text for a course on parallelism in computing. Indeed, for anyone who wants an understandable text from which to acquire a current, rigorous, and broad vi
The Role of Music Perception in Predicting Phonological Awareness in Five- and Six-Year-Old Children
Lathroum, Linda M.
2011-01-01
The purpose of this study was to examine the role of music perception in predicting phonological awareness in five- and six-year-old children. This study was based on the hypothesis that music perception and phonological awareness appear to have parallel auditory perceptual mechanisms. Previous research investigating the relationship between these…
International Nuclear Information System (INIS)
Lei-Jian, Shen; Chuang-She, Li; Yi-Gang, Du; Cui-Cui, Zuo; Zhi-Qiang, Nie; Yan-Peng, Zhang; Yuan-Yuan, Li; Chen-Li, Gan; Ke-Qing, Lu
2008-01-01
We study the competition between dispersion and absorption of doubly-dressed four-wave mixing (DDFWM) and dressed six-wave mixing. In the case of weak coupling fields limit, we find DDFWM signal is affected by destructive interference between four-wave mixing(FWM) and six-wave mixing as well as constructive interference between FWM and eight-wave mixing. By analysing the difference between two kinds of doubly dressing mechanisms (parallel cascade and nested cascade) in this opening five-level system, we can further understand the generated high-order nonlinear optical signal dressed by multi-fields
Testing New Programming Paradigms with NAS Parallel Benchmarks
Jin, H.; Frumkin, M.; Schultz, M.; Yan, J.
2000-01-01
was applied to several benchmarks, noticeably BT and SP, resulting in better sequential performance. In order to overcome the lack of an HPF performance model and guide the development of the HPF codes, we employed an empirical performance model for several primitives found in the benchmarks. We encountered a few limitations of HPF, such as lack of supporting the "REDISTRIBUTION" directive and no easy way to handle irregular computation. The parallelization with OpenMP directives was done at the outer-most loop level to achieve the largest granularity. The performance of six HPF and OpenMP benchmarks is compared with their MPI counterparts for the Class-A problem size in the figure in next page. These results were obtained on an SGI Origin2000 (195MHz) with MIPSpro-f77 compiler 7.2.1 for OpenMP and MPI codes and PGI pghpf-2.4.3 compiler with MPI interface for HPF programs.
Six-Degree-of-Freedom Sensor Fish Design and Instrumentation
Directory of Open Access Journals (Sweden)
Marshall C. Richmond
2007-11-01
Full Text Available Fish passing through dams may be injured or killed despite advances in turbinedesign, project operations and other fish bypass systems. The six-degree-of-freedom (6DOFSensor Fish device is an autonomous sensor package that characterizes the physical conditionsand physical stresses to which fish are exposed when they pass through complex hydraulicenvironments. It has been used to identify the locations and operations where conditions aresevere enough to injure or kill fish. During the design process, a set of governing equationsof motion for the Sensor Fish was derived and simulated to understand the design implica-tions of instrument selection and placement within the body of the device. The Sensor Fishpackage includes three rotation sensors, three acceleration sensors, a pressure sensor, and atemperature sensor with a sampling frequency of 2,000 Hz. Its housing is constructed of clearpolycarbonate plastic. It is 24.5 mm in diameter and 90 mm in length and weighs about 43 g,similar to the size and density of a yearling salmon smolt. The accuracy of the pressure sensorwas determined to be within 0.2 psi. In laboratory acceptance tests, the relative errors of boththe linear acceleration and angular velocity measurements were determined to be less than5%. An exposure is defined as a significant event when the acceleration reaches predefinedthresholds. Based on the different characteristic of acceleration and rotation velocities, theexposure event is categorized as either a collision between the Sensor Fish and a solid struc-ture or shear caused by turbulence. Since its development in 2005, the 6DOF Sensor Fish hasbeen deployed successfully at many major dams in the United States.
DEFF Research Database (Denmark)
Darula, Radoslav; Sorokin, Sergey
2013-01-01
An electro-magneto-mechanical system combines three physical domains - a mechanical structure, a magnetic field and an electric circuit. The interaction between these domains is analysed for a structure with two degrees of freedom (translational and rotational) and two electrical circuits. Each...... electrical circuit is described by a differential equation of the 1st order, which is considered to contribute to the coupled system by 0.5 DOF. The electrical and mechanical systems are coupled via a magnetic circuit, which is inherently non-linear, due to a non-linear nature of the electro-magnetic force...
The Structure and Dimensional Design of a Reconfigurable PKM
Directory of Open Access Journals (Sweden)
Xiaoqiang Tang
2013-06-01
Full Text Available Parallel Kinematic Machines (PKMs have many advantages and have been widely used in the machine industry. Benefitting from its modular structure, a PKM is more reconfigurable than traditional serial machines. In this paper, a new type of driving strut module and innovative joints are designed for the Reconfigurable Parallel Kinematic Machine (RPKM. The new driving strut module can be changed from linear drive mode to telescopic drive mode easily, and the new spherical joint and universal joint are designed to achieve a large rotation angle. The inverse kinematics problems in relation to the 6-DOF RPKM are analysed, and the Workspace Volume Index (WVI and the Global ConditionIndex (GCI are adopted to design the RPKM. According to the WVI and GCI analysis of the selected parameters for two types of 6-DOF PKM, the dimensional parameters of the RPKM are designed. In the end, the new type of RPKM prototype is built, with which a wax pattern is machined.
Parallel computation of automatic differentiation applied to magnetic field calculations
International Nuclear Information System (INIS)
Hinkins, R.L.; Lawrence Berkeley Lab., CA
1994-09-01
The author presents a parallelization of an accelerator physics application to simulate magnetic field in three dimensions. The problem involves the evaluation of high order derivatives with respect to two variables of a multivariate function. Automatic differentiation software had been used with some success, but the computation time was prohibitive. The implementation runs on several platforms, including a network of workstations using PVM, a MasPar using MPFortran, and a CM-5 using CMFortran. A careful examination of the code led to several optimizations that improved its serial performance by a factor of 8.7. The parallelization produced further improvements, especially on the MasPar with a speedup factor of 620. As a result a problem that took six days on a SPARC 10/41 now runs in minutes on the MasPar, making it feasible for physicists at Lawrence Berkeley Laboratory to simulate larger magnets
A new macro-micro dual drive parallel robot for chromosome dissection
Energy Technology Data Exchange (ETDEWEB)
Feng, Jin; Gao, Feng; Zhao, Xianchao; Yue, Yi; Liu, Renqiang [Shanghai Jiao Tong University, Shanghai (China)
2012-01-15
This paper presents a parallel-structure system dually driven by six servo motors and six piezoelectric actuators. Due to the combination of macro and micro manipulators which are both of orthogonal structures, the proposed system possesses a concise structure as well as actuation isolation and output motion decoupling properties. By using a glass needle mounted on a six-dimensional force sensor in endpoint operating, this system can be applied to chromosome dissection that to make the whole process more efficient and automatic. The glass needle tip has a stroke of 106 mm in three linear motions and 18.7-arc-degrees in three angle motion directions, with servo motors adopted. It also has the resolution of 20 nanometers with the adoption of piezoelectric actuators. The kinematics, isotropy, decoupling and design considerations of the proposed robot are discussed. Workspace and resolution of both macro and micro manipulators are measured separately. The experiments are also conducted to show its capability in dissecting chromosomes.
Nugteren, C.; Corporaal, H.
2012-01-01
Multi-core and many-core were already major trends for the past six years, and are expected to continue for the next decades. With these trends of parallel computing, it becomes increasingly difficult to decide on which architecture to run a given application. In this work, we use an algorithm
Directory of Open Access Journals (Sweden)
Omar Ahmed
2016-01-01
Full Text Available In order to achieve cooperation of multi-robots simultaneously, this paper presents an approach of Trajectory planning for two decoupled robots with six degrees of freedom (DOF each to execute packing task. The Denavit-Hartenberg (D-H representation is used to model robot links and solve the transformation matrices of each joint. The inverse kinematics solution using for a 6- DOF Robotic arm is presented, for given initial and final configurations of the robots, the robots are placed so that their workspaces overlap. An algorithm successfully finds a set of configurations to ensure, collision free transition from start to end configuration. Simulation and experiments based on 6-dof robot are carried out and the results verified the effectiveness of the proposed algorithm.
International Nuclear Information System (INIS)
Bose, Supratik; Shukla, Himanshu; Maltz, Jonathan
2010-01-01
Purpose: In current image guided pretreatment patient position adjustment methods, image registration is used to determine alignment parameters. Since most positioning hardware lacks the full six degrees of freedom (DOF), accuracy is compromised. The authors show that such compromises are often unnecessary when one models the planned treatment beams as part of the adjustment calculation process. The authors present a flexible algorithm for determining optimal realizable adjustments for both step-and-shoot and arc delivery methods. Methods: The beam shape model is based on the polygonal intersection of each beam segment with the plane in pretreatment image volume that passes through machine isocenter perpendicular to the central axis of the beam. Under a virtual six-DOF correction, ideal positions of these polygon vertices are computed. The proposed method determines the couch, gantry, and collimator adjustments that minimize the total mismatch of all vertices over all segments with respect to their ideal positions. Using this geometric error metric as a function of the number of available DOF, the user may select the most desirable correction regime. Results: For a simulated treatment plan consisting of three equally weighted coplanar fixed beams, the authors achieve a 7% residual geometric error (with respect to the ideal correction, considered 0% error) by applying gantry rotation as well as translation and isocentric rotation of the couch. For a clinical head-and-neck intensity modulated radiotherapy plan with seven beams and five segments per beam, the corresponding error is 6%. Correction involving only couch translation (typical clinical practice) leads to a much larger 18% mismatch. Clinically significant consequences of more accurate adjustment are apparent in the dose volume histograms of target and critical structures. Conclusions: The algorithm achieves improvements in delivery accuracy using standard delivery hardware without significantly increasing
Parallel algorithms for mapping pipelined and parallel computations
Nicol, David M.
1988-01-01
Many computational problems in image processing, signal processing, and scientific computing are naturally structured for either pipelined or parallel computation. When mapping such problems onto a parallel architecture it is often necessary to aggregate an obvious problem decomposition. Even in this context the general mapping problem is known to be computationally intractable, but recent advances have been made in identifying classes of problems and architectures for which optimal solutions can be found in polynomial time. Among these, the mapping of pipelined or parallel computations onto linear array, shared memory, and host-satellite systems figures prominently. This paper extends that work first by showing how to improve existing serial mapping algorithms. These improvements have significantly lower time and space complexities: in one case a published O(nm sup 3) time algorithm for mapping m modules onto n processors is reduced to an O(nm log m) time complexity, and its space requirements reduced from O(nm sup 2) to O(m). Run time complexity is further reduced with parallel mapping algorithms based on these improvements, which run on the architecture for which they create the mappings.
Dynamics modeling for parallel haptic interfaces with force sensing and control.
Bernstein, Nicholas; Lawrence, Dale; Pao, Lucy
2013-01-01
Closed-loop force control can be used on haptic interfaces (HIs) to mitigate the effects of mechanism dynamics. A single multidimensional force-torque sensor is often employed to measure the interaction force between the haptic device and the user's hand. The parallel haptic interface at the University of Colorado (CU) instead employs smaller 1D force sensors oriented along each of the five actuating rods to build up a 5D force vector. This paper shows that a particular manipulandum/hand partition in the system dynamics is induced by the placement and type of force sensing, and discusses the implications on force and impedance control for parallel haptic interfaces. The details of a "squaring down" process are also discussed, showing how to obtain reduced degree-of-freedom models from the general six degree-of-freedom dynamics formulation.
Energy Technology Data Exchange (ETDEWEB)
1991-10-23
An account of the Caltech Concurrent Computation Program (C{sup 3}P), a five year project that focused on answering the question: Can parallel computers be used to do large-scale scientific computations '' As the title indicates, the question is answered in the affirmative, by implementing numerous scientific applications on real parallel computers and doing computations that produced new scientific results. In the process of doing so, C{sup 3}P helped design and build several new computers, designed and implemented basic system software, developed algorithms for frequently used mathematical computations on massively parallel machines, devised performance models and measured the performance of many computers, and created a high performance computing facility based exclusively on parallel computers. While the initial focus of C{sup 3}P was the hypercube architecture developed by C. Seitz, many of the methods developed and lessons learned have been applied successfully on other massively parallel architectures.
Anatomical kinematic constraints: consequences on muscular forces and joint reactions
MOISSENET, F; CHEZE, L; DUMAS, R
2011-01-01
This paper presents a method to determine musculo-tendon forces and joint reactions during gait, using a 3D right leg model with 5 DoFs: spherical joint at the hip and parallel mechanisms at both knee and ankle. A typical set of natural coordinates is used to obtain the dynamic equations. First, using a global optimization method, "anatomical" kinematic constraints (i.e., parallel mechanisms) are applied on the kinematics obtained from motion capture data. Consistent derivatives are computed ...
Parallel segmented outlet flow high performance liquid chromatography with multiplexed detection
International Nuclear Information System (INIS)
Camenzuli, Michelle; Terry, Jessica M.; Shalliker, R. Andrew; Conlan, Xavier A.; Barnett, Neil W.; Francis, Paul S.
2013-01-01
Graphical abstract: -- Highlights: •Multiplexed detection for liquid chromatography. •‘Parallel segmented outlet flow’ distributes inner and outer portions of the analyte zone. •Three detectors were used simultaneously for the determination of opiate alkaloids. -- Abstract: We describe a new approach to multiplex detection for HPLC, exploiting parallel segmented outlet flow – a new column technology that provides pressure-regulated control of eluate flow through multiple outlet channels, which minimises the additional dead volume associated with conventional post-column flow splitting. Using three detectors: one UV-absorbance and two chemiluminescence systems (tris(2,2′-bipyridine)ruthenium(III) and permanganate), we examine the relative responses for six opium poppy (Papaver somniferum) alkaloids under conventional and multiplexed conditions, where approximately 30% of the eluate was distributed to each detector and the remaining solution directed to a collection vessel. The parallel segmented outlet flow mode of operation offers advantages in terms of solvent consumption, waste generation, total analysis time and solute band volume when applying multiple detectors to HPLC, but the manner in which each detection system is influenced by changes in solute concentration and solution flow rates must be carefully considered
Parallel segmented outlet flow high performance liquid chromatography with multiplexed detection
Energy Technology Data Exchange (ETDEWEB)
Camenzuli, Michelle [Australian Centre for Research on Separation Science (ACROSS), School of Science and Health, University of Western Sydney (Parramatta), Sydney, NSW (Australia); Terry, Jessica M. [Centre for Chemistry and Biotechnology, School of Life and Environmental Sciences, Deakin University, Geelong, Victoria 3216 (Australia); Shalliker, R. Andrew, E-mail: r.shalliker@uws.edu.au [Australian Centre for Research on Separation Science (ACROSS), School of Science and Health, University of Western Sydney (Parramatta), Sydney, NSW (Australia); Conlan, Xavier A.; Barnett, Neil W. [Centre for Chemistry and Biotechnology, School of Life and Environmental Sciences, Deakin University, Geelong, Victoria 3216 (Australia); Francis, Paul S., E-mail: paul.francis@deakin.edu.au [Centre for Chemistry and Biotechnology, School of Life and Environmental Sciences, Deakin University, Geelong, Victoria 3216 (Australia)
2013-11-25
Graphical abstract: -- Highlights: •Multiplexed detection for liquid chromatography. •‘Parallel segmented outlet flow’ distributes inner and outer portions of the analyte zone. •Three detectors were used simultaneously for the determination of opiate alkaloids. -- Abstract: We describe a new approach to multiplex detection for HPLC, exploiting parallel segmented outlet flow – a new column technology that provides pressure-regulated control of eluate flow through multiple outlet channels, which minimises the additional dead volume associated with conventional post-column flow splitting. Using three detectors: one UV-absorbance and two chemiluminescence systems (tris(2,2′-bipyridine)ruthenium(III) and permanganate), we examine the relative responses for six opium poppy (Papaver somniferum) alkaloids under conventional and multiplexed conditions, where approximately 30% of the eluate was distributed to each detector and the remaining solution directed to a collection vessel. The parallel segmented outlet flow mode of operation offers advantages in terms of solvent consumption, waste generation, total analysis time and solute band volume when applying multiple detectors to HPLC, but the manner in which each detection system is influenced by changes in solute concentration and solution flow rates must be carefully considered.
Application of parallelized software architecture to an autonomous ground vehicle
Shakya, Rahul; Wright, Adam; Shin, Young Ho; Momin, Orko; Petkovsek, Steven; Wortman, Paul; Gautam, Prasanna; Norton, Adam
2011-01-01
This paper presents improvements made to Q, an autonomous ground vehicle designed to participate in the Intelligent Ground Vehicle Competition (IGVC). For the 2010 IGVC, Q was upgraded with a new parallelized software architecture and a new vision processor. Improvements were made to the power system reducing the number of batteries required for operation from six to one. In previous years, a single state machine was used to execute the bulk of processing activities including sensor interfacing, data processing, path planning, navigation algorithms and motor control. This inefficient approach led to poor software performance and made it difficult to maintain or modify. For IGVC 2010, the team implemented a modular parallel architecture using the National Instruments (NI) LabVIEW programming language. The new architecture divides all the necessary tasks - motor control, navigation, sensor data collection, etc. into well-organized components that execute in parallel, providing considerable flexibility and facilitating efficient use of processing power. Computer vision is used to detect white lines on the ground and determine their location relative to the robot. With the new vision processor and some optimization of the image processing algorithm used last year, two frames can be acquired and processed in 70ms. With all these improvements, Q placed 2nd in the autonomous challenge.
Template based parallel checkpointing in a massively parallel computer system
Archer, Charles Jens [Rochester, MN; Inglett, Todd Alan [Rochester, MN
2009-01-13
A method and apparatus for a template based parallel checkpoint save for a massively parallel super computer system using a parallel variation of the rsync protocol, and network broadcast. In preferred embodiments, the checkpoint data for each node is compared to a template checkpoint file that resides in the storage and that was previously produced. Embodiments herein greatly decrease the amount of data that must be transmitted and stored for faster checkpointing and increased efficiency of the computer system. Embodiments are directed to a parallel computer system with nodes arranged in a cluster with a high speed interconnect that can perform broadcast communication. The checkpoint contains a set of actual small data blocks with their corresponding checksums from all nodes in the system. The data blocks may be compressed using conventional non-lossy data compression algorithms to further reduce the overall checkpoint size.
Directory of Open Access Journals (Sweden)
Abdelhakim Cherfia
2007-08-01
Full Text Available This paper presents a geometrical model of a constrained robot of three degrees of freedom (d.o.f added to a PPP passive central segment. This structure provides a pure translation motion. We will also determine the relations between generalized and articular velocities by using the inverse Jacobian matrix. Further, we determine the reciprocal relations between cartesian and angular velocities of the end-effector via articular velocities by simple derivation of the direct geometrical model expressions. A determination of the workspace based on the geometrical model analysis is derived followed by a numerical calculation of all the atteignables points enabling a graphical visualisation of such a workspace. Moreover, the analysis of the Jacobian matrix has permitted to ensure that there are no singularities of type 1 and 2 in such a structure. A prototype of a parallel robot has been built up in our laboratory in order to validate the proposed models.Este trabajo presenta el modelo geométrico de un robot paralelo con tres grados de libertad (d.o.f agregados a un segmento central pasivo del PPP. Esta estructura proporciona un movimiento de translación pura. También determinaremos las relaciones entre las velocidades generalizadas y articulares usando la matriz Jacobiana inversa. Además, determinamos las relaciones recíprocas entre las velocidades cartesianas y angulares del end-effector vía velocidades articulares por la derivación simple de las expresiones del modelo geométrico directo. Una determinación del espacio de trabajo basado en el análisis del modelo geométrico es derivado seguido por un cálculo numérico de todos los puntos que deben alcanzarse permitiendo una visualización gráfica de tal espacio de trabajo. Por otra parte, el análisis de los coeficientes de la matriz Jacobiana permite asegurar que no haya singularidades del tipo 1 y 2 en tal estructura. Se ha realizado un prototipo de robot paralelo en nuestro laboratorio
Development of structural schemes of parallel structure manipulators using screw calculus
Rashoyan, G. V.; Shalyukhin, K. A.; Gaponenko, EV
2018-03-01
The paper considers the approach to the structural analysis and synthesis of parallel structure robots based on the mathematical apparatus of groups of screws and on a concept of reciprocity of screws. The results are depicted of synthesis of parallel structure robots with different numbers of degrees of freedom, corresponding to the different groups of screws. Power screws are applied with this aim, based on the principle of static-kinematic analogy; the power screws are similar to the orts of axes of not driven kinematic pairs of a corresponding connecting chain. Accordingly, kinematic screws of the outlet chain of a robot are simultaneously determined which are reciprocal to power screws of kinematic sub-chains. Solution of certain synthesis problems is illustrated with practical applications. Closed groups of screws can have eight types. The three-membered groups of screws are of greatest significance, as well as four-membered screw groups [1] and six-membered screw groups. Three-membered screw groups correspond to progressively guiding mechanisms, to spherical mechanisms, and to planar mechanisms. The four-membered group corresponds to the motion of the SCARA robot. The six-membered group includes all possible motions. From the works of A.P. Kotelnikov, F.M. Dimentberg, it is known that closed fifth-order screw groups do not exist. The article presents examples of the mechanisms corresponding to the given groups.
The Masterson Approach with play therapy: a parallel process between mother and child.
Mulherin, M A
2001-01-01
This paper discusses a case in which the Masterson Approach was used with play therapy to treat a child with a developing personality disorder. It describes the parallel progression of the child and mother in adjunct therapy throughout a six-year period. The unique value of the Masterson Approach is that it provides the therapist with a framework and tool to diagnose and treat a child during the dynamic process of play. The case describes the mother-child dyad throughout therapy. It traces their parallel processes that involve separation, individuation, rapprochement, and the recovery of real self-capacities. Each stage of treatment is described, including verbal interventions. The child's internal affective state and intrapsychic structure during the various stages of treatment are illustrated by representative pictures.
International Nuclear Information System (INIS)
Solyman, A.E.; Keshk, A.B.; Sharshar, K.A.; Roman, M.R.
2016-01-01
Robotics has proved its efficiency in nuclear and radiation fields. Computer vision is one of the advanced approaches used to enhance robotic efficiency. The current work investigates the possibility of using a vision-based controlled arm robot to collect the fallen hot Cobalt-60 capsules inside wet storage pool of industrial irradiator. A 5-DOF arm robot is designed and vision algorithms are established to pick the fallen capsules on the bottom surface of the storage pool, read the information printed on its edge (cap) and move it to a safe storage place. Two object detection approaches are studied; RGB-based filter and background subtraction technique. Vision algorithms and camera calibration are done using MATLAB/SIMULINK program. Robot arm forward and inverse kinematics are developed and programmed using an embedded micro controller system. Experiments show the validity of the proposed system and prove its success. The collecting process will be done without interference of operators, hence radiation safety will be increased.
Introduction to parallel programming
Brawer, Steven
1989-01-01
Introduction to Parallel Programming focuses on the techniques, processes, methodologies, and approaches involved in parallel programming. The book first offers information on Fortran, hardware and operating system models, and processes, shared memory, and simple parallel programs. Discussions focus on processes and processors, joining processes, shared memory, time-sharing with multiple processors, hardware, loops, passing arguments in function/subroutine calls, program structure, and arithmetic expressions. The text then elaborates on basic parallel programming techniques, barriers and race
Parallelism in matrix computations
Gallopoulos, Efstratios; Sameh, Ahmed H
2016-01-01
This book is primarily intended as a research monograph that could also be used in graduate courses for the design of parallel algorithms in matrix computations. It assumes general but not extensive knowledge of numerical linear algebra, parallel architectures, and parallel programming paradigms. The book consists of four parts: (I) Basics; (II) Dense and Special Matrix Computations; (III) Sparse Matrix Computations; and (IV) Matrix functions and characteristics. Part I deals with parallel programming paradigms and fundamental kernels, including reordering schemes for sparse matrices. Part II is devoted to dense matrix computations such as parallel algorithms for solving linear systems, linear least squares, the symmetric algebraic eigenvalue problem, and the singular-value decomposition. It also deals with the development of parallel algorithms for special linear systems such as banded ,Vandermonde ,Toeplitz ,and block Toeplitz systems. Part III addresses sparse matrix computations: (a) the development of pa...
A comparative critical analysis of modern task-parallel runtimes.
Energy Technology Data Exchange (ETDEWEB)
Wheeler, Kyle Bruce; Stark, Dylan; Murphy, Richard C.
2012-12-01
The rise in node-level parallelism has increased interest in task-based parallel runtimes for a wide array of application areas. Applications have a wide variety of task spawning patterns which frequently change during the course of application execution, based on the algorithm or solver kernel in use. Task scheduling and load balance regimes, however, are often highly optimized for specific patterns. This paper uses four basic task spawning patterns to quantify the impact of specific scheduling policy decisions on execution time. We compare the behavior of six publicly available tasking runtimes: Intel Cilk, Intel Threading Building Blocks (TBB), Intel OpenMP, GCC OpenMP, Qthreads, and High Performance ParalleX (HPX). With the exception of Qthreads, the runtimes prove to have schedulers that are highly sensitive to application structure. No runtime is able to provide the best performance in all cases, and those that do provide the best performance in some cases, unfortunately, provide extremely poor performance when application structure does not match the schedulers assumptions.
Arkin, Ethem; Tekinerdogan, Bedir
2016-01-01
Mapping parallel algorithms to parallel computing platforms requires several activities such as the analysis of the parallel algorithm, the definition of the logical configuration of the platform, the mapping of the algorithm to the logical configuration platform and the implementation of the
CERN. Geneva
2016-01-01
The traditionally used and well established parallel programming models OpenMP and MPI are both targeting lower level parallelism and are meant to be as language agnostic as possible. For a long time, those models were the only widely available portable options for developing parallel C++ applications beyond using plain threads. This has strongly limited the optimization capabilities of compilers, has inhibited extensibility and genericity, and has restricted the use of those models together with other, modern higher level abstractions introduced by the C++11 and C++14 standards. The recent revival of interest in the industry and wider community for the C++ language has also spurred a remarkable amount of standardization proposals and technical specifications being developed. Those efforts however have so far failed to build a vision on how to seamlessly integrate various types of parallelism, such as iterative parallel execution, task-based parallelism, asynchronous many-task execution flows, continuation s...
Massively parallel mathematical sieves
Energy Technology Data Exchange (ETDEWEB)
Montry, G.R.
1989-01-01
The Sieve of Eratosthenes is a well-known algorithm for finding all prime numbers in a given subset of integers. A parallel version of the Sieve is described that produces computational speedups over 800 on a hypercube with 1,024 processing elements for problems of fixed size. Computational speedups as high as 980 are achieved when the problem size per processor is fixed. The method of parallelization generalizes to other sieves and will be efficient on any ensemble architecture. We investigate two highly parallel sieves using scattered decomposition and compare their performance on a hypercube multiprocessor. A comparison of different parallelization techniques for the sieve illustrates the trade-offs necessary in the design and implementation of massively parallel algorithms for large ensemble computers.
Computer-Aided Parallelizer and Optimizer
Jin, Haoqiang
2011-01-01
The Computer-Aided Parallelizer and Optimizer (CAPO) automates the insertion of compiler directives (see figure) to facilitate parallel processing on Shared Memory Parallel (SMP) machines. While CAPO currently is integrated seamlessly into CAPTools (developed at the University of Greenwich, now marketed as ParaWise), CAPO was independently developed at Ames Research Center as one of the components for the Legacy Code Modernization (LCM) project. The current version takes serial FORTRAN programs, performs interprocedural data dependence analysis, and generates OpenMP directives. Due to the widely supported OpenMP standard, the generated OpenMP codes have the potential to run on a wide range of SMP machines. CAPO relies on accurate interprocedural data dependence information currently provided by CAPTools. Compiler directives are generated through identification of parallel loops in the outermost level, construction of parallel regions around parallel loops and optimization of parallel regions, and insertion of directives with automatic identification of private, reduction, induction, and shared variables. Attempts also have been made to identify potential pipeline parallelism (implemented with point-to-point synchronization). Although directives are generated automatically, user interaction with the tool is still important for producing good parallel codes. A comprehensive graphical user interface is included for users to interact with the parallelization process.
International Nuclear Information System (INIS)
Boehm, K.-J.; Gibson, C. R.; Hollaway, J. R.; Espinoza-Loza, F.
2016-01-01
This study presents the design of a flexure-based mount allowing adjustment in three rotational degrees of freedom (DOFs) through high-precision set-screw actuators. The requirements of the application called for small but controlled angular adjustments for mounting a cantilevered beam. The proposed design is based on an array of parallel beams to provide sufficiently high stiffness in the translational directions while allowing angular adjustment through the actuators. A simplified physical model in combination with standard beam theory was applied to estimate the deflection profile and maximum stresses in the beams. A finite element model was built to calculate the stresses and beam profiles for scenarios in which the flexure is simultaneously actuated in more than one DOF.
Data communications in a parallel active messaging interface of a parallel computer
Archer, Charles J; Blocksome, Michael A; Ratterman, Joseph D; Smith, Brian E
2013-11-12
Data communications in a parallel active messaging interface (`PAMI`) of a parallel computer composed of compute nodes that execute a parallel application, each compute node including application processors that execute the parallel application and at least one management processor dedicated to gathering information regarding data communications. The PAMI is composed of data communications endpoints, each endpoint composed of a specification of data communications parameters for a thread of execution on a compute node, including specifications of a client, a context, and a task, the compute nodes and the endpoints coupled for data communications through the PAMI and through data communications resources. Embodiments function by gathering call site statistics describing data communications resulting from execution of data communications instructions and identifying in dependence upon the call cite statistics a data communications algorithm for use in executing a data communications instruction at a call site in the parallel application.
Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening
Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas
2017-07-01
The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.
DEFF Research Database (Denmark)
Sitchinava, Nodar; Zeh, Norbert
2012-01-01
We present the parallel buffer tree, a parallel external memory (PEM) data structure for batched search problems. This data structure is a non-trivial extension of Arge's sequential buffer tree to a private-cache multiprocessor environment and reduces the number of I/O operations by the number of...... in the optimal OhOf(psortN + K/PB) parallel I/O complexity, where K is the size of the output reported in the process and psortN is the parallel I/O complexity of sorting N elements using P processors....
Application Portable Parallel Library
Cole, Gary L.; Blech, Richard A.; Quealy, Angela; Townsend, Scott
1995-01-01
Application Portable Parallel Library (APPL) computer program is subroutine-based message-passing software library intended to provide consistent interface to variety of multiprocessor computers on market today. Minimizes effort needed to move application program from one computer to another. User develops application program once and then easily moves application program from parallel computer on which created to another parallel computer. ("Parallel computer" also include heterogeneous collection of networked computers). Written in C language with one FORTRAN 77 subroutine for UNIX-based computers and callable from application programs written in C language or FORTRAN 77.
Parallel Algorithms and Patterns
Energy Technology Data Exchange (ETDEWEB)
Robey, Robert W. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2016-06-16
This is a powerpoint presentation on parallel algorithms and patterns. A parallel algorithm is a well-defined, step-by-step computational procedure that emphasizes concurrency to solve a problem. Examples of problems include: Sorting, searching, optimization, matrix operations. A parallel pattern is a computational step in a sequence of independent, potentially concurrent operations that occurs in diverse scenarios with some frequency. Examples are: Reductions, prefix scans, ghost cell updates. We only touch on parallel patterns in this presentation. It really deserves its own detailed discussion which Gabe Rockefeller would like to develop.
Totally parallel multilevel algorithms
Frederickson, Paul O.
1988-01-01
Four totally parallel algorithms for the solution of a sparse linear system have common characteristics which become quite apparent when they are implemented on a highly parallel hypercube such as the CM2. These four algorithms are Parallel Superconvergent Multigrid (PSMG) of Frederickson and McBryan, Robust Multigrid (RMG) of Hackbusch, the FFT based Spectral Algorithm, and Parallel Cyclic Reduction. In fact, all four can be formulated as particular cases of the same totally parallel multilevel algorithm, which are referred to as TPMA. In certain cases the spectral radius of TPMA is zero, and it is recognized to be a direct algorithm. In many other cases the spectral radius, although not zero, is small enough that a single iteration per timestep keeps the local error within the required tolerance.
Neural Parallel Engine: A toolbox for massively parallel neural signal processing.
Tam, Wing-Kin; Yang, Zhi
2018-05-01
Large-scale neural recordings provide detailed information on neuronal activities and can help elicit the underlying neural mechanisms of the brain. However, the computational burden is also formidable when we try to process the huge data stream generated by such recordings. In this study, we report the development of Neural Parallel Engine (NPE), a toolbox for massively parallel neural signal processing on graphical processing units (GPUs). It offers a selection of the most commonly used routines in neural signal processing such as spike detection and spike sorting, including advanced algorithms such as exponential-component-power-component (EC-PC) spike detection and binary pursuit spike sorting. We also propose a new method for detecting peaks in parallel through a parallel compact operation. Our toolbox is able to offer a 5× to 110× speedup compared with its CPU counterparts depending on the algorithms. A user-friendly MATLAB interface is provided to allow easy integration of the toolbox into existing workflows. Previous efforts on GPU neural signal processing only focus on a few rudimentary algorithms, are not well-optimized and often do not provide a user-friendly programming interface to fit into existing workflows. There is a strong need for a comprehensive toolbox for massively parallel neural signal processing. A new toolbox for massively parallel neural signal processing has been created. It can offer significant speedup in processing signals from large-scale recordings up to thousands of channels. Copyright © 2018 Elsevier B.V. All rights reserved.
A possibility of parallel and anti-parallel diffraction measurements on ...
Indian Academy of Sciences (India)
However, a bent perfect crystal (BPC) monochromator at monochromatic focusing condition can provide a quite flat and equal resolution property at both parallel and anti-parallel positions and thus one can have a chance to use both sides for the diffraction experiment. From the data of the FWHM and the / measured ...
International Nuclear Information System (INIS)
Baron, E.; Hauschildt, Peter H.
1998-01-01
We describe an important addition to the parallel implementation of our generalized nonlocal thermodynamic equilibrium (NLTE) stellar atmosphere and radiative transfer computer program PHOENIX. In a previous paper in this series we described data and task parallel algorithms we have developed for radiative transfer, spectral line opacity, and NLTE opacity and rate calculations. These algorithms divided the work spatially or by spectral lines, that is, distributing the radial zones, individual spectral lines, or characteristic rays among different processors and employ, in addition, task parallelism for logically independent functions (such as atomic and molecular line opacities). For finite, monotonic velocity fields, the radiative transfer equation is an initial value problem in wavelength, and hence each wavelength point depends upon the previous one. However, for sophisticated NLTE models of both static and moving atmospheres needed to accurately describe, e.g., novae and supernovae, the number of wavelength points is very large (200,000 - 300,000) and hence parallelization over wavelength can lead both to considerable speedup in calculation time and the ability to make use of the aggregate memory available on massively parallel supercomputers. Here, we describe an implementation of a pipelined design for the wavelength parallelization of PHOENIX, where the necessary data from the processor working on a previous wavelength point is sent to the processor working on the succeeding wavelength point as soon as it is known. Our implementation uses a MIMD design based on a relatively small number of standard message passing interface (MPI) library calls and is fully portable between serial and parallel computers. copyright 1998 The American Astronomical Society
International Nuclear Information System (INIS)
Pessi, P.
2009-01-01
It is necessary to use highly specialized robots in ITER (International Thermonuclear Experimental Reactor) both in the manufacturing and maintenance of the reactor due to a demanding environment. The sectors of the ITER vacuum vessel (VV) require more stringent tolerances than normally expected for the size of the structure involved. VV consists of nine sectors that are to be welded together. The vacuum vessel has a toroidal chamber structure. The task of the designed robot is to carry the welding apparatus along a path with a stringent tolerance during the assembly operation. In addition to the initial vacuum vessel assembly, after a limited running period, sectors need to be replaced for repair. Mechanisms with closed-loop kinematic chains are used in the design of robots in this work. One version is a purely parallel manipulator and another is a hybrid manipulator where the parallel and serial structures are combined. Traditional industrial robots that generally have the links actuated in series are inherently not very rigid and have poor dynamic performance in high speed and high dynamic loading conditions. Compared with open chain manipulators, parallel manipulators have high stiffness, high accuracy and a high force/torque capacity in a reduced workspace. Parallel manipulators have a mechanical architecture where all of the links are connected to the base and to the end-effector of the robot. The purpose of this thesis is to develop special parallel robots for the assembly, machining and repairing of the VV of the ITER. The process of the assembly and machining of the vacuum vessel needs a special robot. By studying the structure of the vacuum vessel, two novel parallel robots were designed and built; they have six and ten degrees of freedom driven by hydraulic cylinders and electrical servo motors. Kinematic models for the proposed robots were defined and two prototypes built. Experiments for machine cutting and laser welding with the 6-DOF robot were
Energy Technology Data Exchange (ETDEWEB)
Pessi, P.
2009-07-01
It is necessary to use highly specialized robots in ITER (International Thermonuclear Experimental Reactor) both in the manufacturing and maintenance of the reactor due to a demanding environment. The sectors of the ITER vacuum vessel (VV) require more stringent tolerances than normally expected for the size of the structure involved. VV consists of nine sectors that are to be welded together. The vacuum vessel has a toroidal chamber structure. The task of the designed robot is to carry the welding apparatus along a path with a stringent tolerance during the assembly operation. In addition to the initial vacuum vessel assembly, after a limited running period, sectors need to be replaced for repair. Mechanisms with closed-loop kinematic chains are used in the design of robots in this work. One version is a purely parallel manipulator and another is a hybrid manipulator where the parallel and serial structures are combined. Traditional industrial robots that generally have the links actuated in series are inherently not very rigid and have poor dynamic performance in high speed and high dynamic loading conditions. Compared with open chain manipulators, parallel manipulators have high stiffness, high accuracy and a high force/torque capacity in a reduced workspace. Parallel manipulators have a mechanical architecture where all of the links are connected to the base and to the end-effector of the robot. The purpose of this thesis is to develop special parallel robots for the assembly, machining and repairing of the VV of the ITER. The process of the assembly and machining of the vacuum vessel needs a special robot. By studying the structure of the vacuum vessel, two novel parallel robots were designed and built; they have six and ten degrees of freedom driven by hydraulic cylinders and electrical servo motors. Kinematic models for the proposed robots were defined and two prototypes built. Experiments for machine cutting and laser welding with the 6-DOF robot were
Energy Technology Data Exchange (ETDEWEB)
2017-04-04
A parallelization of the k-means++ seed selection algorithm on three distinct hardware platforms: GPU, multicore CPU, and multithreaded architecture. K-means++ was developed by David Arthur and Sergei Vassilvitskii in 2007 as an extension of the k-means data clustering technique. These algorithms allow people to cluster multidimensional data, by attempting to minimize the mean distance of data points within a cluster. K-means++ improved upon traditional k-means by using a more intelligent approach to selecting the initial seeds for the clustering process. While k-means++ has become a popular alternative to traditional k-means clustering, little work has been done to parallelize this technique. We have developed original C++ code for parallelizing the algorithm on three unique hardware architectures: GPU using NVidia's CUDA/Thrust framework, multicore CPU using OpenMP, and the Cray XMT multithreaded architecture. By parallelizing the process for these platforms, we are able to perform k-means++ clustering much more quickly than it could be done before.
Parallel magnetic resonance imaging
International Nuclear Information System (INIS)
Larkman, David J; Nunes, Rita G
2007-01-01
Parallel imaging has been the single biggest innovation in magnetic resonance imaging in the last decade. The use of multiple receiver coils to augment the time consuming Fourier encoding has reduced acquisition times significantly. This increase in speed comes at a time when other approaches to acquisition time reduction were reaching engineering and human limits. A brief summary of spatial encoding in MRI is followed by an introduction to the problem parallel imaging is designed to solve. There are a large number of parallel reconstruction algorithms; this article reviews a cross-section, SENSE, SMASH, g-SMASH and GRAPPA, selected to demonstrate the different approaches. Theoretical (the g-factor) and practical (coil design) limits to acquisition speed are reviewed. The practical implementation of parallel imaging is also discussed, in particular coil calibration. How to recognize potential failure modes and their associated artefacts are shown. Well-established applications including angiography, cardiac imaging and applications using echo planar imaging are reviewed and we discuss what makes a good application for parallel imaging. Finally, active research areas where parallel imaging is being used to improve data quality by repairing artefacted images are also reviewed. (invited topical review)
Next Generation, High Accuracy Optical Tracker for Target Acquisition and Cueing
National Research Council Canada - National Science Library
Odell, Don S; Kogan, Vlad
2006-01-01
A critical need exists for a fast, cost-effective, six-degrees-of-freedom (6DOF) tracker that is immune to cockpit and helmet scatterers of magnetic/electrical field energy, vehicle vibration, and harsh lighting conditions...
Experiences in Data-Parallel Programming
Directory of Open Access Journals (Sweden)
Terry W. Clark
1997-01-01
Full Text Available To efficiently parallelize a scientific application with a data-parallel compiler requires certain structural properties in the source program, and conversely, the absence of others. A recent parallelization effort of ours reinforced this observation and motivated this correspondence. Specifically, we have transformed a Fortran 77 version of GROMOS, a popular dusty-deck program for molecular dynamics, into Fortran D, a data-parallel dialect of Fortran. During this transformation we have encountered a number of difficulties that probably are neither limited to this particular application nor do they seem likely to be addressed by improved compiler technology in the near future. Our experience with GROMOS suggests a number of points to keep in mind when developing software that may at some time in its life cycle be parallelized with a data-parallel compiler. This note presents some guidelines for engineering data-parallel applications that are compatible with Fortran D or High Performance Fortran compilers.
Non-Cartesian parallel imaging reconstruction.
Wright, Katherine L; Hamilton, Jesse I; Griswold, Mark A; Gulani, Vikas; Seiberlich, Nicole
2014-11-01
Non-Cartesian parallel imaging has played an important role in reducing data acquisition time in MRI. The use of non-Cartesian trajectories can enable more efficient coverage of k-space, which can be leveraged to reduce scan times. These trajectories can be undersampled to achieve even faster scan times, but the resulting images may contain aliasing artifacts. Just as Cartesian parallel imaging can be used to reconstruct images from undersampled Cartesian data, non-Cartesian parallel imaging methods can mitigate aliasing artifacts by using additional spatial encoding information in the form of the nonhomogeneous sensitivities of multi-coil phased arrays. This review will begin with an overview of non-Cartesian k-space trajectories and their sampling properties, followed by an in-depth discussion of several selected non-Cartesian parallel imaging algorithms. Three representative non-Cartesian parallel imaging methods will be described, including Conjugate Gradient SENSE (CG SENSE), non-Cartesian generalized autocalibrating partially parallel acquisition (GRAPPA), and Iterative Self-Consistent Parallel Imaging Reconstruction (SPIRiT). After a discussion of these three techniques, several potential promising clinical applications of non-Cartesian parallel imaging will be covered. © 2014 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Li, Helong; Zhou, Wei; Wang, Xiongfei
2018-01-01
This paper addresses the transient current distribution in the multichip half-bridge power modules, where two types of paralleling connections with different current commutation mechanisms are considered: paralleling dies and paralleling half-bridges. It reveals that with paralleling dies, both t...
Parallel Architectures and Parallel Algorithms for Integrated Vision Systems. Ph.D. Thesis
Choudhary, Alok Nidhi
1989-01-01
Computer vision is regarded as one of the most complex and computationally intensive problems. An integrated vision system (IVS) is a system that uses vision algorithms from all levels of processing to perform for a high level application (e.g., object recognition). An IVS normally involves algorithms from low level, intermediate level, and high level vision. Designing parallel architectures for vision systems is of tremendous interest to researchers. Several issues are addressed in parallel architectures and parallel algorithms for integrated vision systems.
International Nuclear Information System (INIS)
Idomura, Yasuhiro; Jolliet, Sebastien
2010-01-01
A gyrokinetic toroidal five dimensional Eulerian code GT5D is ported on six advanced massively parallel platforms and comprehensive benchmark tests are performed. A parallelisation technique based on physical properties of the gyrokinetic equation is presented. By extending the parallelisation technique with a hybrid parallel model, the scalability of the code is improved on platforms with multi-core processors. In the benchmark tests, a good salability is confirmed up to several thousands cores on every platforms, and the maximum sustained performance of ∼18.6 Tflops is achieved using 16384 cores of BX900. (author)
Pattern-Driven Automatic Parallelization
Directory of Open Access Journals (Sweden)
Christoph W. Kessler
1996-01-01
Full Text Available This article describes a knowledge-based system for automatic parallelization of a wide class of sequential numerical codes operating on vectors and dense matrices, and for execution on distributed memory message-passing multiprocessors. Its main feature is a fast and powerful pattern recognition tool that locally identifies frequently occurring computations and programming concepts in the source code. This tool also works for dusty deck codes that have been "encrypted" by former machine-specific code transformations. Successful pattern recognition guides sophisticated code transformations including local algorithm replacement such that the parallelized code need not emerge from the sequential program structure by just parallelizing the loops. It allows access to an expert's knowledge on useful parallel algorithms, available machine-specific library routines, and powerful program transformations. The partially restored program semantics also supports local array alignment, distribution, and redistribution, and allows for faster and more exact prediction of the performance of the parallelized target code than is usually possible.
Data communications in a parallel active messaging interface of a parallel computer
Archer, Charles J; Blocksome, Michael A; Ratterman, Joseph D; Smith, Brian E
2013-10-29
Data communications in a parallel active messaging interface (`PAMI`) of a parallel computer, the parallel computer including a plurality of compute nodes that execute a parallel application, the PAMI composed of data communications endpoints, each endpoint including a specification of data communications parameters for a thread of execution on a compute node, including specifications of a client, a context, and a task, the compute nodes and the endpoints coupled for data communications through the PAMI and through data communications resources, including receiving in an origin endpoint of the PAMI a data communications instruction, the instruction characterized by an instruction type, the instruction specifying a transmission of transfer data from the origin endpoint to a target endpoint and transmitting, in accordance with the instruction type, the transfer data from the origin endpoint to the target endpoint.
The STAPL Parallel Graph Library
Harshvardhan,; Fidel, Adam; Amato, Nancy M.; Rauchwerger, Lawrence
2013-01-01
This paper describes the stapl Parallel Graph Library, a high-level framework that abstracts the user from data-distribution and parallelism details and allows them to concentrate on parallel graph algorithm development. It includes a customizable
Parallelism and array processing
International Nuclear Information System (INIS)
Zacharov, V.
1983-01-01
Modern computing, as well as the historical development of computing, has been dominated by sequential monoprocessing. Yet there is the alternative of parallelism, where several processes may be in concurrent execution. This alternative is discussed in a series of lectures, in which the main developments involving parallelism are considered, both from the standpoint of computing systems and that of applications that can exploit such systems. The lectures seek to discuss parallelism in a historical context, and to identify all the main aspects of concurrency in computation right up to the present time. Included will be consideration of the important question as to what use parallelism might be in the field of data processing. (orig.)
MEMS-based clamp with a passive hold function for precision position retaining of micro manipulators
International Nuclear Information System (INIS)
Brouwer, D M; Van Dijk, J; Soemers, H M J R; De Jong, B R; De Boer, M J; Jansen, H V; Krijnen, G J M
2009-01-01
In this paper the design, modeling and fabrication of a precision MEMS-based clamp with a relatively large clamping force are presented. The purpose of the clamp is to mechanically fix a six-degree-of-freedom (DOF) MEMS-based sample manipulator (Brouwer et al J. Int. Soc. Precis. Eng. Nanotechnol. submitted) once the sample has been positioned in all DOFs. The clamping force is generated by a rotational electrostatic comb-drive actuator and can be latched passively by a parallel plate type electrostatically driven locking device. The clamp design is based on the principles of exact constraint design, resulting in a high actuation compliance (flexibility) combined with a high suspension stiffness. Therefore, a relatively large blocking force of 1.4 mN in relation to the used area of 1.8 mm 2 is obtained. The fabrication is based on silicon bulk micromachining technology and combines a high-aspect-ratio deep reactive ion etching (DRIE), conformal deposition of low-pressure chemical vapor deposition (LPCVD) silicon nitride and an anisotropic potassium hydroxide (KOH) backside etching technology. Special attention is given to void reduction of Si x N y trench isolation and reduction of heating phenomena during front-side release etching. Guidelines are given for the applied process. Measurements showed that the clamp was able to fix, hold and release a test actuator. The dynamic behavior was in good agreement with the modal analysis
Development master arm of 2-DOF planar parallel manipulator for In-Vitro Fertilization
Thamrongaphichartkul, Kitti; Vongbunyong, Supachai; Nuntakarn, Lalana
2018-01-01
Micromanipulator is a mechanical device used for manipulating miniature objects in the order of micron. It is widely used in In-Vitro Fertilization (IVF) in which sperms will be held in a micro-needle and penetrate to an oocyte for fertilization. IVF needs to be performed by high skill embryologists to control the movement of the needle accurately due to the lack of tactile perception of the user. Haptic device is a device that can transmit and simulate position, velocity and force in order to enhance interaction between the user and system. However, commercially available haptic devices have unnecessary degrees of freedom and limited workspace which are inappropriate for IVF process. This paper focuses on development of a haptic device for using in IVF process. It will be used as a master arm for the master-slave system for IVF process in order to enhance the ability of users to control the micromanipulator. As a result, the embryologist is able to carry out the IVF process more effectively with having tactile perception.
International Nuclear Information System (INIS)
Ishizuki, Shigeru; Kawai, Wataru; Nemoto, Toshiyuki; Ogasawara, Shinobu; Kume, Etsuo; Adachi, Masaaki; Kawasaki, Nobuo; Yatake, Yo-ichi
2000-03-01
Several computer codes in the nuclear field have been vectorized, parallelized and transported on the FUJITSU VPP500 system, the AP3000 system and the Paragon system at Center for Promotion of Computational Science and Engineering in Japan Atomic Energy Research Institute. We dealt with 12 codes in fiscal 1998. These results are reported in 3 parts, i.e., the vectorization and parallelization on vector processors part, the parallelization on scalar processors part and the porting part. In this report, we describe the vectorization and parallelization on vector processors. In this vectorization and parallelization on vector processors part, the vectorization of General Tokamak Circuit Simulation Program code GTCSP, the vectorization and parallelization of Molecular Dynamics NTV (n-particle, Temperature and Velocity) Simulation code MSP2, Eddy Current Analysis code EDDYCAL, Thermal Analysis Code for Test of Passive Cooling System by HENDEL T2 code THANPACST2 and MHD Equilibrium code SELENEJ on the VPP500 are described. In the parallelization on scalar processors part, the parallelization of Monte Carlo N-Particle Transport code MCNP4B2, Plasma Hydrodynamics code using Cubic Interpolated Propagation Method PHCIP and Vectorized Monte Carlo code (continuous energy model / multi-group model) MVP/GMVP on the Paragon are described. In the porting part, the porting of Monte Carlo N-Particle Transport code MCNP4B2 and Reactor Safety Analysis code RELAP5 on the AP3000 are described. (author)
Parallel External Memory Graph Algorithms
DEFF Research Database (Denmark)
Arge, Lars Allan; Goodrich, Michael T.; Sitchinava, Nodari
2010-01-01
In this paper, we study parallel I/O efficient graph algorithms in the Parallel External Memory (PEM) model, one o f the private-cache chip multiprocessor (CMP) models. We study the fundamental problem of list ranking which leads to efficient solutions to problems on trees, such as computing lowest...... an optimal speedup of ¿(P) in parallel I/O complexity and parallel computation time, compared to the single-processor external memory counterparts....
COMPARISON BETWEEN TEST METHODS TO DETERMINE WOOD EMBEDMENT STRENGTH PARALLEL TO THE GRAIN
Directory of Open Access Journals (Sweden)
Diego Henrique de Almeida
Full Text Available ABSTRACT This study compares the test methods according to the ABNT NBR 7190:1997, EN 383:2007, ASTM D5764:2007, EUROCODE 5:2004, NDS:2001 standards in order to provide support to establish a new test method for determining the embedment strength of wood parallel to the grain. Parallel-to-grain tests were carried out for six wood species (Schizolobium amazonicum; Pinus elliottii; Pinus oocarpa; Hymenaea spp.; Lyptus(r: hybrid Eucalyptus grandis and Eucalyptus urophylla, and Goupia glabra using four diameters (8 mm, 10 mm, 12 mm and 16 mm for the metal pin fasteners (bolts. The experimental results obtained according to the EN 383:2007 standard were closer to the specific values for the metal-dowel connections design used by ABNT NBR 7190:1997, which are considered equal compression parallel to the grain. The use of maximum embedment force or the force causing displacement of 5 mm between the bolt and the test-piece as criteria for determining embedment strength for EN 383:2007 appears to be more appropriate than the criteria used by the Brazilian and American Standards.
Parallel inter channel interaction mechanisms
International Nuclear Information System (INIS)
Jovic, V.; Afgan, N.; Jovic, L.
1995-01-01
Parallel channels interactions are examined. For experimental researches of nonstationary regimes flow in three parallel vertical channels results of phenomenon analysis and mechanisms of parallel channel interaction for adiabatic condition of one-phase fluid and two-phase mixture flow are shown. (author)
Six Lessons We Learned Applying Six Sigma
Carroll, Napoleon; Casleton, Christa H.
2005-01-01
As Chief Financial Officer of Kennedy Space Center (KSC), I'm not only responsible for financial planning and accounting but also for building strong partnerships with the CFO customers, who include Space Shuttle and International Space Station operations as well all who manage the KSC Spaceport. My never ending goal is to design, manage and continuously improve our core business processes so that they deliver world class products and services to the CFO's customers. I became interested in Six Sigma as Christa Casleton (KSC's first Six Sigma Black belt) applied Six Sigma tools and methods to our Plan and Account for Travel Costs Process. Her analysis was fresh, innovative and thorough but, even more impressive, was her approach to ensure ongoing, continuous process improvement. Encouraged by the results, I launched two more process improvement initiatives aimed at applying Six Sigma principles to CFO processes that not only touch most of my employees but also have direct customer impact. As many of you know, Six Sigma is a measurement scale that compares the output of a process with customer requirements. That's straight forward, but demands that you not only understand your processes but also know your products and the critical customer requirements. The objective is to isolate and eliminate the causes of process variation so that the customer sees consistently high quality.
Five-DOF innovative linear MagLev slider to account for pitch, tilt and load uncertainty
Kao, Yi-Ming; Tsai, Nan-Chyuan; Chiu, Hsin-Lin
2017-02-01
This paper is focused at position deviation regulation upon a slider by Fuzzy Sliding Mode Control (FSMC). Five Degrees Of Freedom (DOF) of position deviation are required to be regulated except for the direction (i.e., X-axis) in which the slider moves forward and backward. Totally 8 sets of Magnetic Actuators (MAs) and an Electro-Pneumatic Transducer (EPT) are employed to drive the slider carrying loads under the commands of FSMC. EPT is applied to adjust the pressure of compressed air to counterbalance the weight of slider itself. At first, the system dynamic model of slider, including load uncertainty and load position uncertainty, is established. Intensive computer simulations are undertaken to verify the validity of proposed control strategy. Finally, a prototype of realistic slider position deviation regulation system is successfully built up. According to the experiments by cooperation of pneumatic and magnetic control, the actual linear position deviations of slider can be regulated within ±8 μm and angular position deviations within ±1 mini-degrees. From the viewpoint of energy consumption, the applied currents to 8 sets of MAs are all below 1.2 A. To sum up, the closed-loop levitation system by cooperation of pneumatic and magnetic control is capable to account for load uncertainty and uncertainty of the standing position of load to be carried.
Two improvements on numerical simulation of 2-DOF vortex-induced vibration with low mass ratio
Kang, Zhuang; Ni, Wen-chi; Zhang, Xu; Sun, Li-ping
2017-12-01
Till now, there have been lots of researches on numerical simulation of vortex-induced vibration. Acceptable results have been obtained for fixed cylinders with low Reynolds number. However, for responses of 2-DOF vortex-induced vibration with low mass ratio, the accuracy is not satisfactory, especially for the maximum amplitudes. In Jauvtis and Williamson's work, the maximum amplitude of the cylinder with low mass ratio m*=2.6 can reach as large as 1.5 D to be called as the "super-upper branch", but from current literatures, few simulation results can achieve such value, even fail to capture the upper branch. Besides, it is found that the amplitude decays too fast in the lower branch with the RANS-based turbulence model. The reason is likely to be the defects of the turbulence model itself in the prediction of unsteady separated flows as well as the unreasonable setting of the numerical simulation parameters. Aiming at above issues, a modified turbulence model is proposed in this paper, and the effect of the acceleration of flow field on the response of vortex-induced vibration is studied based on OpenFOAM. By analyzing the responses of amplitude, phase and trajectory, frequency and vortex mode, it is proved that the vortex-induced vibration can be predicted accurately with the modified turbulence model under appropriate flow field acceleration.
Energy Technology Data Exchange (ETDEWEB)
Lober, R.R.; Tautges, T.J.; Vaughan, C.T.
1997-03-01
Paving is an automated mesh generation algorithm which produces all-quadrilateral elements. It can additionally generate these elements in varying sizes such that the resulting mesh adapts to a function distribution, such as an error function. While powerful, conventional paving is a very serial algorithm in its operation. Parallel paving is the extension of serial paving into parallel environments to perform the same meshing functions as conventional paving only on distributed, discretized models. This extension allows large, adaptive, parallel finite element simulations to take advantage of paving`s meshing capabilities for h-remap remeshing. A significantly modified version of the CUBIT mesh generation code has been developed to host the parallel paving algorithm and demonstrate its capabilities on both two dimensional and three dimensional surface geometries and compare the resulting parallel produced meshes to conventionally paved meshes for mesh quality and algorithm performance. Sandia`s {open_quotes}tiling{close_quotes} dynamic load balancing code has also been extended to work with the paving algorithm to retain parallel efficiency as subdomains undergo iterative mesh refinement.
A Reconfigurable System Approach to the Direct Kinematics of a 5 D.o.f Robotic Manipulator
Directory of Open Access Journals (Sweden)
Diego F. Sánchez
2010-01-01
Full Text Available Hardware acceleration in high performance computer systems has a particular interest for many engineering and scientific applications in which a large number of arithmetic operations and transcendental functions must be computed. In this paper a hardware architecture for computing direct kinematics of robot manipulators with 5 degrees of freedom (5 D.o.f using floating-point arithmetic is presented for 32, 43, and 64 bit-width representations and it is implemented in Field Programmable Gate Arrays (FPGAs. The proposed architecture has been developed using several floating-point libraries for arithmetic and transcendental functions operators, allowing the designer to select (pre-synthesis a suitable bit-width representation according to the accuracy and dynamic range, as well as the area, elapsed time and power consumption requirements of the application. Synthesis results demonstrate the effectiveness and high performance of the implemented cores on commercial FPGAs. Simulation results have been addressed in order to compute the Mean Square Error (MSE, using the Matlab as statistical estimator, validating the correct behavior of the implemented cores. Additionally, the processing time of the hardware architecture was compared with the same formulation implemented in software, using the PowerPC (FPGA embedded processor, demonstrating that the hardware architecture speeds-up by factor of 1298 the software implementation.
Allphin, Devin
benefits of this technique. For the offline approximation, latin hypercube sampling (LHS) was used for design space filling across four (4) independent design variable degrees of freedom (DOF). Flow solutions at the mapped test sites were converged using STAR-CCM+ with aerodynamic forces from the CFD models then functionally approximated using Kriging interpolation. For the closed-form approximation, the problem was interpreted as an ideal 2-D converging-diverging (C-D) nozzle, where aerodynamic forces were directly mapped by application of the Euler equation solutions for isentropic compression/expansion. A cost-weighting procedure was finally established for creating model-selective discretionary logic, with a synthesized parallel simulation resource summary provided.
DEFF Research Database (Denmark)
Christensen, Mark Schram; Ehrsson, H Henrik; Nielsen, Jens Bo
2013-01-01
a different network, involving bilateral dorsal premotor cortex (PMd), primary motor cortex, and SMA, was more active when subjects viewed parallel movements while performing either symmetrical or parallel movements. Correlations between behavioral instability and brain activity were present in right lateral...... adduction-abduction movements symmetrically or in parallel with real-time congruent or incongruent visual feedback of the movements. One network, consisting of bilateral superior and middle frontal gyrus and supplementary motor area (SMA), was more active when subjects performed parallel movements, whereas...
The numerical parallel computing of photon transport
International Nuclear Information System (INIS)
Huang Qingnan; Liang Xiaoguang; Zhang Lifa
1998-12-01
The parallel computing of photon transport is investigated, the parallel algorithm and the parallelization of programs on parallel computers both with shared memory and with distributed memory are discussed. By analyzing the inherent law of the mathematics and physics model of photon transport according to the structure feature of parallel computers, using the strategy of 'to divide and conquer', adjusting the algorithm structure of the program, dissolving the data relationship, finding parallel liable ingredients and creating large grain parallel subtasks, the sequential computing of photon transport into is efficiently transformed into parallel and vector computing. The program was run on various HP parallel computers such as the HY-1 (PVP), the Challenge (SMP) and the YH-3 (MPP) and very good parallel speedup has been gotten
Murni, Bustamam, A.; Ernastuti, Handhika, T.; Kerami, D.
2017-07-01
Calculation of the matrix-vector multiplication in the real-world problems often involves large matrix with arbitrary size. Therefore, parallelization is needed to speed up the calculation process that usually takes a long time. Graph partitioning techniques that have been discussed in the previous studies cannot be used to complete the parallelized calculation of matrix-vector multiplication with arbitrary size. This is due to the assumption of graph partitioning techniques that can only solve the square and symmetric matrix. Hypergraph partitioning techniques will overcome the shortcomings of the graph partitioning technique. This paper addresses the efficient parallelization of matrix-vector multiplication through hypergraph partitioning techniques using CUDA GPU-based parallel computing. CUDA (compute unified device architecture) is a parallel computing platform and programming model that was created by NVIDIA and implemented by the GPU (graphics processing unit).
Writing parallel programs that work
CERN. Geneva
2012-01-01
Serial algorithms typically run inefficiently on parallel machines. This may sound like an obvious statement, but it is the root cause of why parallel programming is considered to be difficult. The current state of the computer industry is still that almost all programs in existence are serial. This talk will describe the techniques used in the Intel Parallel Studio to provide a developer with the tools necessary to understand the behaviors and limitations of the existing serial programs. Once the limitations are known the developer can refactor the algorithms and reanalyze the resulting programs with the tools in the Intel Parallel Studio to create parallel programs that work. About the speaker Paul Petersen is a Sr. Principal Engineer in the Software and Solutions Group (SSG) at Intel. He received a Ph.D. degree in Computer Science from the University of Illinois in 1993. After UIUC, he was employed at Kuck and Associates, Inc. (KAI) working on auto-parallelizing compiler (KAP), and was involved in th...
Parallel Framework for Cooperative Processes
Directory of Open Access Journals (Sweden)
Mitică Craus
2005-01-01
Full Text Available This paper describes the work of an object oriented framework designed to be used in the parallelization of a set of related algorithms. The idea behind the system we are describing is to have a re-usable framework for running several sequential algorithms in a parallel environment. The algorithms that the framework can be used with have several things in common: they have to run in cycles and the work should be possible to be split between several "processing units". The parallel framework uses the message-passing communication paradigm and is organized as a master-slave system. Two applications are presented: an Ant Colony Optimization (ACO parallel algorithm for the Travelling Salesman Problem (TSP and an Image Processing (IP parallel algorithm for the Symmetrical Neighborhood Filter (SNF. The implementations of these applications by means of the parallel framework prove to have good performances: approximatively linear speedup and low communication cost.
Compiler Technology for Parallel Scientific Computation
Directory of Open Access Journals (Sweden)
Can Özturan
1994-01-01
Full Text Available There is a need for compiler technology that, given the source program, will generate efficient parallel codes for different architectures with minimal user involvement. Parallel computation is becoming indispensable in solving large-scale problems in science and engineering. Yet, the use of parallel computation is limited by the high costs of developing the needed software. To overcome this difficulty we advocate a comprehensive approach to the development of scalable architecture-independent software for scientific computation based on our experience with equational programming language (EPL. Our approach is based on a program decomposition, parallel code synthesis, and run-time support for parallel scientific computation. The program decomposition is guided by the source program annotations provided by the user. The synthesis of parallel code is based on configurations that describe the overall computation as a set of interacting components. Run-time support is provided by the compiler-generated code that redistributes computation and data during object program execution. The generated parallel code is optimized using techniques of data alignment, operator placement, wavefront determination, and memory optimization. In this article we discuss annotations, configurations, parallel code generation, and run-time support suitable for parallel programs written in the functional parallel programming language EPL and in Fortran.
Robot-assisted ultrasound imaging: overview and development of a parallel telerobotic system.
Monfaredi, Reza; Wilson, Emmanuel; Azizi Koutenaei, Bamshad; Labrecque, Brendan; Leroy, Kristen; Goldie, James; Louis, Eric; Swerdlow, Daniel; Cleary, Kevin
2015-02-01
Ultrasound imaging is frequently used in medicine. The quality of ultrasound images is often dependent on the skill of the sonographer. Several researchers have proposed robotic systems to aid in ultrasound image acquisition. In this paper we first provide a short overview of robot-assisted ultrasound imaging (US). We categorize robot-assisted US imaging systems into three approaches: autonomous US imaging, teleoperated US imaging, and human-robot cooperation. For each approach several systems are introduced and briefly discussed. We then describe a compact six degree of freedom parallel mechanism telerobotic system for ultrasound imaging developed by our research team. The long-term goal of this work is to enable remote ultrasound scanning through teleoperation. This parallel mechanism allows for both translation and rotation of an ultrasound probe mounted on the top plate along with force control. Our experimental results confirmed good mechanical system performance with a positioning error of < 1 mm. Phantom experiments by a radiologist showed promising results with good image quality.
Parallel computing: numerics, applications, and trends
National Research Council Canada - National Science Library
Trobec, Roman; Vajteršic, Marián; Zinterhof, Peter
2009-01-01
... and/or distributed systems. The contributions to this book are focused on topics most concerned in the trends of today's parallel computing. These range from parallel algorithmics, programming, tools, network computing to future parallel computing. Particular attention is paid to parallel numerics: linear algebra, differential equations, numerica...
Parallel Computing Strategies for Irregular Algorithms
Biswas, Rupak; Oliker, Leonid; Shan, Hongzhang; Biegel, Bryan (Technical Monitor)
2002-01-01
Parallel computing promises several orders of magnitude increase in our ability to solve realistic computationally-intensive problems, but relies on their efficient mapping and execution on large-scale multiprocessor architectures. Unfortunately, many important applications are irregular and dynamic in nature, making their effective parallel implementation a daunting task. Moreover, with the proliferation of parallel architectures and programming paradigms, the typical scientist is faced with a plethora of questions that must be answered in order to obtain an acceptable parallel implementation of the solution algorithm. In this paper, we consider three representative irregular applications: unstructured remeshing, sparse matrix computations, and N-body problems, and parallelize them using various popular programming paradigms on a wide spectrum of computer platforms ranging from state-of-the-art supercomputers to PC clusters. We present the underlying problems, the solution algorithms, and the parallel implementation strategies. Smart load-balancing, partitioning, and ordering techniques are used to enhance parallel performance. Overall results demonstrate the complexity of efficiently parallelizing irregular algorithms.
Preconditioned Krylov and Gauss-Seidel solutions of response matrix equations
International Nuclear Information System (INIS)
Lewis, E.E.; Smith, M.A.; Yang, W.S.; Wollaber, A.
2011-01-01
The use of preconditioned Krylov methods is examined as an alternative to the partitioned matrix acceleration applied to red-black Gauss Seidel (RBGS) iteration that is presently used in the variational nodal code, VARIANT. We employ the GMRES algorithm to treat non-symmetric response matrix equations. A pre conditioner is formulated for the within-group diffusion equation which is equivalent to partitioned matrix acceleration of RBGS iterations. We employ the pre conditioner, which closely parallels two-level p multigrid, to improve RBGS and GMRES algorithms. Of the accelerated algorithms, GMRES converges with less computational effort than RBGS and therefore is chosen for further development. The p multigrid pre conditioner requires response matrices with two or more degrees of freedom (DOF) per interface that are polynomials, which are both orthogonal and hierarchical. It is therefore not directly applicable to very fine mesh calculations that are both slow to converge and that are often modeled with response matrices with only one DOF per interface. Orthogonal matrix aggregation (OMA) is introduced to circumvent this difficulty by combining N×N fine mesh response matrices with one DOF per interface into a coarse mesh response matrix with N orthogonal DOF per interface. Numerical results show that OMA used alone or in combination with p multigrid preconditioning substantially accelerates GMRES solutions. (author)
Preconditioned Krylov and Gauss-Seidel solutions of response matrix equations
Energy Technology Data Exchange (ETDEWEB)
Lewis, E.E., E-mail: e-lewis@northwestern.edu [Department of Mechanical Engineering, Northwestern University, Evanston, IL (United States); Smith, M.A.; Yang, W.S.; Wollaber, A., E-mail: masmith@anl.gov, E-mail: wsyang@anl.gov, E-mail: wollaber@lanl.gov [Nuclear Engineering Division, Argonne National Laboratory, Argonne, IL (United States)
2011-07-01
The use of preconditioned Krylov methods is examined as an alternative to the partitioned matrix acceleration applied to red-black Gauss Seidel (RBGS) iteration that is presently used in the variational nodal code, VARIANT. We employ the GMRES algorithm to treat non-symmetric response matrix equations. A pre conditioner is formulated for the within-group diffusion equation which is equivalent to partitioned matrix acceleration of RBGS iterations. We employ the pre conditioner, which closely parallels two-level p multigrid, to improve RBGS and GMRES algorithms. Of the accelerated algorithms, GMRES converges with less computational effort than RBGS and therefore is chosen for further development. The p multigrid pre conditioner requires response matrices with two or more degrees of freedom (DOF) per interface that are polynomials, which are both orthogonal and hierarchical. It is therefore not directly applicable to very fine mesh calculations that are both slow to converge and that are often modeled with response matrices with only one DOF per interface. Orthogonal matrix aggregation (OMA) is introduced to circumvent this difficulty by combining N×N fine mesh response matrices with one DOF per interface into a coarse mesh response matrix with N orthogonal DOF per interface. Numerical results show that OMA used alone or in combination with p multigrid preconditioning substantially accelerates GMRES solutions. (author)
Haptic rendering for simulation of fine manipulation
Wang, Dangxiao; Zhang, Yuru
2014-01-01
This book introduces the latest progress in six degrees of freedom (6-DoF) haptic rendering with the focus on a new approach for simulating force/torque feedback in performing tasks that require dexterous manipulation skills. One of the major challenges in 6-DoF haptic rendering is to resolve the conflict between high speed and high fidelity requirements, especially in simulating a tool interacting with both rigid and deformable objects in a narrow space and with fine features. The book presents a configuration-based optimization approach to tackle this challenge. Addressing a key issue in man
Directory of Open Access Journals (Sweden)
Ashkan Tousimojarad
2013-12-01
Full Text Available We present the Glasgow Parallel Reduction Machine (GPRM, a novel, flexible framework for parallel task-composition based many-core programming. We allow the programmer to structure programs into task code, written as C++ classes, and communication code, written in a restricted subset of C++ with functional semantics and parallel evaluation. In this paper we discuss the GPRM, the virtual machine framework that enables the parallel task composition approach. We focus the discussion on GPIR, the functional language used as the intermediate representation of the bytecode running on the GPRM. Using examples in this language we show the flexibility and power of our task composition framework. We demonstrate the potential using an implementation of a merge sort algorithm on a 64-core Tilera processor, as well as on a conventional Intel quad-core processor and an AMD 48-core processor system. We also compare our framework with OpenMP tasks in a parallel pointer chasing algorithm running on the Tilera processor. Our results show that the GPRM programs outperform the corresponding OpenMP codes on all test platforms, and can greatly facilitate writing of parallel programs, in particular non-data parallel algorithms such as reductions.
Comparative Analysis between Lean, Six Sigma and Lean Six Sigma Concepts
Directory of Open Access Journals (Sweden)
Alexandra Mirela Cristina MUNTEANU
2017-06-01
Full Text Available This paper analyzes the benefits of Lean Six Sigma in comparison with Lean and Six Sigma, traditional improvement methodologies. The introduction highlights the appearance of Lean Six Sigma, early 2000s, as well as the benefits brought by the integrated approach. The following parts of the study emphasize the main differences between methodologies and their commonalities based on their synergy. Finally the advantages of Lean Six Sigma versus Lean and Six Sigma are analyzed and systematized by author in order to reveal Lean Six Sigma’s benefits.
Streaming for Functional Data-Parallel Languages
DEFF Research Database (Denmark)
Madsen, Frederik Meisner
In this thesis, we investigate streaming as a general solution to the space inefficiency commonly found in functional data-parallel programming languages. The data-parallel paradigm maps well to parallel SIMD-style hardware. However, the traditional fully materializing execution strategy...... by extending two existing data-parallel languages: NESL and Accelerate. In the extensions we map bulk operations to data-parallel streams that can evaluate fully sequential, fully parallel or anything in between. By a dataflow, piecewise parallel execution strategy, the runtime system can adjust to any target...... flattening necessitates all sub-computations to materialize at the same time. For example, naive n by n matrix multiplication requires n^3 space in NESL because the algorithm contains n^3 independent scalar multiplications. For large values of n, this is completely unacceptable. We address the problem...
Patterns for Parallel Software Design
Ortega-Arjona, Jorge Luis
2010-01-01
Essential reading to understand patterns for parallel programming Software patterns have revolutionized the way we think about how software is designed, built, and documented, and the design of parallel software requires you to consider other particular design aspects and special skills. From clusters to supercomputers, success heavily depends on the design skills of software developers. Patterns for Parallel Software Design presents a pattern-oriented software architecture approach to parallel software design. This approach is not a design method in the classic sense, but a new way of managin
Prabhat
2014-01-01
Gain Critical Insight into the Parallel I/O EcosystemParallel I/O is an integral component of modern high performance computing (HPC), especially in storing and processing very large datasets to facilitate scientific discovery. Revealing the state of the art in this field, High Performance Parallel I/O draws on insights from leading practitioners, researchers, software architects, developers, and scientists who shed light on the parallel I/O ecosystem.The first part of the book explains how large-scale HPC facilities scope, configure, and operate systems, with an emphasis on choices of I/O har
Parallel transport of long mean-free-path plasma along open magnetic field lines: Parallel heat flux
International Nuclear Information System (INIS)
Guo Zehua; Tang Xianzhu
2012-01-01
In a long mean-free-path plasma where temperature anisotropy can be sustained, the parallel heat flux has two components with one associated with the parallel thermal energy and the other the perpendicular thermal energy. Due to the large deviation of the distribution function from local Maxwellian in an open field line plasma with low collisionality, the conventional perturbative calculation of the parallel heat flux closure in its local or non-local form is no longer applicable. Here, a non-perturbative calculation is presented for a collisionless plasma in a two-dimensional flux expander bounded by absorbing walls. Specifically, closures of previously unfamiliar form are obtained for ions and electrons, which relate two distinct components of the species parallel heat flux to the lower order fluid moments such as density, parallel flow, parallel and perpendicular temperatures, and the field quantities such as the magnetic field strength and the electrostatic potential. The plasma source and boundary condition at the absorbing wall enter explicitly in the closure calculation. Although the closure calculation does not take into account wave-particle interactions, the results based on passing orbits from steady-state collisionless drift-kinetic equation show remarkable agreement with fully kinetic-Maxwell simulations. As an example of the physical implications of the theory, the parallel heat flux closures are found to predict a surprising observation in the kinetic-Maxwell simulation of the 2D magnetic flux expander problem, where the parallel heat flux of the parallel thermal energy flows from low to high parallel temperature region.
Energy Technology Data Exchange (ETDEWEB)
Fijany, A. [Jet Propulsion Lab., Pasadena, CA (United States); Coley, T.R. [Virtual Chemistry, Inc., San Diego, CA (United States); Cagin, T.; Goddard, W.A. III [California Institute of Technology, Pasadena, CA (United States)
1997-12-31
Successful molecular dynamics (MD) simulation of large systems (> million atoms) for long times (> nanoseconds) requires the integration of constrained equations of motion (CEOM). Constraints are used to eliminate high frequency degrees of freedom (DOF) and to allow the use of rigid bodies. Solving the CEOM allows for larger integration time-steps and helps focus the simulation on the important collective dynamics of chemical, biological, and materials systems. We explore advances in multibody dynamics which have resulted in O(N) algorithms for propagating the CEOM. However, because of their strictly sequential nature, the computational time required by these algorithms does not scale down with increased numbers of processors. We then present the new constraint force algorithm for solving the CEOM and show that this algorithm is fully parallelizable, leading to a computational cost of O(N/P+IogP) for N DOF on P processors.
Is Monte Carlo embarrassingly parallel?
Energy Technology Data Exchange (ETDEWEB)
Hoogenboom, J. E. [Delft Univ. of Technology, Mekelweg 15, 2629 JB Delft (Netherlands); Delft Nuclear Consultancy, IJsselzoom 2, 2902 LB Capelle aan den IJssel (Netherlands)
2012-07-01
Monte Carlo is often stated as being embarrassingly parallel. However, running a Monte Carlo calculation, especially a reactor criticality calculation, in parallel using tens of processors shows a serious limitation in speedup and the execution time may even increase beyond a certain number of processors. In this paper the main causes of the loss of efficiency when using many processors are analyzed using a simple Monte Carlo program for criticality. The basic mechanism for parallel execution is MPI. One of the bottlenecks turn out to be the rendez-vous points in the parallel calculation used for synchronization and exchange of data between processors. This happens at least at the end of each cycle for fission source generation in order to collect the full fission source distribution for the next cycle and to estimate the effective multiplication factor, which is not only part of the requested results, but also input to the next cycle for population control. Basic improvements to overcome this limitation are suggested and tested. Also other time losses in the parallel calculation are identified. Moreover, the threading mechanism, which allows the parallel execution of tasks based on shared memory using OpenMP, is analyzed in detail. Recommendations are given to get the maximum efficiency out of a parallel Monte Carlo calculation. (authors)
Is Monte Carlo embarrassingly parallel?
International Nuclear Information System (INIS)
Hoogenboom, J. E.
2012-01-01
Monte Carlo is often stated as being embarrassingly parallel. However, running a Monte Carlo calculation, especially a reactor criticality calculation, in parallel using tens of processors shows a serious limitation in speedup and the execution time may even increase beyond a certain number of processors. In this paper the main causes of the loss of efficiency when using many processors are analyzed using a simple Monte Carlo program for criticality. The basic mechanism for parallel execution is MPI. One of the bottlenecks turn out to be the rendez-vous points in the parallel calculation used for synchronization and exchange of data between processors. This happens at least at the end of each cycle for fission source generation in order to collect the full fission source distribution for the next cycle and to estimate the effective multiplication factor, which is not only part of the requested results, but also input to the next cycle for population control. Basic improvements to overcome this limitation are suggested and tested. Also other time losses in the parallel calculation are identified. Moreover, the threading mechanism, which allows the parallel execution of tasks based on shared memory using OpenMP, is analyzed in detail. Recommendations are given to get the maximum efficiency out of a parallel Monte Carlo calculation. (authors)
SU-E-T-234: Daily Quality Assurance for a Six Degrees of Freedom Couch Using a Novel Phantom
Energy Technology Data Exchange (ETDEWEB)
Woods, K; Woollard, J; Ayan, A; Sandu, A; Sommerfeld, J; Gupta, N [Ohio State Univ, Columbus, OH (United States); Laurel, A [Memorial Medical Center, Modesto, CA (United States)
2015-06-15
Purpose: To test the accuracy and reproducibility of both translational and rotational movements for a couch with six degrees of freedom (6DoF) using a novel phantom design Methods: An end-to-end test was carried out using two different phantoms. A 6 cm3 cube with a central fiducial BB (WL-QA Sun Nuclear) and a custom fabricated rectangular prism (31 cm x 8 cm x 8 cm), placed on a baseplate with known angular offsets for pitch, roll and yaw with a central fiducial BB and unique surface structures for registration purposes, were used. The end-to-end test included an initial CT simulation for a reference study, setup to an offset mark on each phantom, registration of the reference CT to the acquired cone-beam CT, and final Winston-Lutz delivery at four cardinal gantry angles. Results for both translational and rotational movements were recorded and compared for both phantoms. Results: Translational and rotational measurements were performed with a PerfectPitch (Varian) couch for 10 trials for both phantoms. Distinct translational shifts were [−5.372±0.384mm, −10.183±0.137mm, 14.028±0.155mm] for the cube and [7.520±0.159mm, −9.117±0.101mm, 16.273±0.115mm] for the prototype phantom for lateral, longitudinal, and vertical shifts, respectively. Distinct rotational adjustments were [1.121±0.102o, −1.067±0.235o, −2.662±0.380o] for the cube and [2.534±0.059o, 1.994±0.025o, 2.094±0.076o] for the prototype for pitch, roll, and yaw, respectively. Winston-Lutz test results performed after 6DoF couch correction from each cardinal gantry angle ranged from 0.26–0.72mm for the cube and 0.55–0.86mm for the prototype. Conclusion: The prototype phantom is more precise for both translational and rotational adjustments compared to a commercial phantom. The design of the prototype phantom allows for a more discernible visual confirmation of correct translational and rotational adjustments with the prototype phantom. Winston-Lutz results are more accurate for the
SU-E-T-234: Daily Quality Assurance for a Six Degrees of Freedom Couch Using a Novel Phantom
International Nuclear Information System (INIS)
Woods, K; Woollard, J; Ayan, A; Sandu, A; Sommerfeld, J; Gupta, N; Laurel, A
2015-01-01
Purpose: To test the accuracy and reproducibility of both translational and rotational movements for a couch with six degrees of freedom (6DoF) using a novel phantom design Methods: An end-to-end test was carried out using two different phantoms. A 6 cm3 cube with a central fiducial BB (WL-QA Sun Nuclear) and a custom fabricated rectangular prism (31 cm x 8 cm x 8 cm), placed on a baseplate with known angular offsets for pitch, roll and yaw with a central fiducial BB and unique surface structures for registration purposes, were used. The end-to-end test included an initial CT simulation for a reference study, setup to an offset mark on each phantom, registration of the reference CT to the acquired cone-beam CT, and final Winston-Lutz delivery at four cardinal gantry angles. Results for both translational and rotational movements were recorded and compared for both phantoms. Results: Translational and rotational measurements were performed with a PerfectPitch (Varian) couch for 10 trials for both phantoms. Distinct translational shifts were [−5.372±0.384mm, −10.183±0.137mm, 14.028±0.155mm] for the cube and [7.520±0.159mm, −9.117±0.101mm, 16.273±0.115mm] for the prototype phantom for lateral, longitudinal, and vertical shifts, respectively. Distinct rotational adjustments were [1.121±0.102o, −1.067±0.235o, −2.662±0.380o] for the cube and [2.534±0.059o, 1.994±0.025o, 2.094±0.076o] for the prototype for pitch, roll, and yaw, respectively. Winston-Lutz test results performed after 6DoF couch correction from each cardinal gantry angle ranged from 0.26–0.72mm for the cube and 0.55–0.86mm for the prototype. Conclusion: The prototype phantom is more precise for both translational and rotational adjustments compared to a commercial phantom. The design of the prototype phantom allows for a more discernible visual confirmation of correct translational and rotational adjustments with the prototype phantom. Winston-Lutz results are more accurate for the
Analysis of clinical complication data for radiation hepatitis using a parallel architecture model
International Nuclear Information System (INIS)
Jackson, A.; Haken, R.K. ten; Robertson, J.M.; Kessler, M.L.; Kutcher, G.J.; Lawrence, T.S.
1995-01-01
Purpose: The detailed knowledge of dose volume distributions available from the three-dimensional (3D) conformal radiation treatment of tumors in the liver (reported elsewhere) offers new opportunities to quantify the effect of volume on the probability of producing radiation hepatitis. We aim to test a new parallel architecture model of normal tissue complication probability (NTCP) with these data. Methods and Materials: Complication data and dose volume histograms from a total of 93 patients with normal liver function, treated on a prospective protocol with 3D conformal radiation therapy and intraarterial hepatic fluorodeoxyuridine, were analyzed with a new parallel architecture model. Patient treatment fell into six categories differing in doses delivered and volumes irradiated. By modeling the radiosensitivity of liver subunits, we are able to use dose volume histograms to calculate the fraction of the liver damaged in each patient. A complication results if this fraction exceeds the patient's functional reserve. To determine the patient distribution of functional reserves and the subunit radiosensitivity, the maximum likelihood method was used to fit the observed complication data. Results: The parallel model fit the complication data well, although uncertainties on the functional reserve distribution and subunit radiosensitivy are highly correlated. Conclusion: The observed radiation hepatitis complications show a threshold effect that can be described well with a parallel architecture model. However, additional independent studies are required to better determine the parameters defining the functional reserve distribution and subunit radiosensitivity
Parallel algorithms for continuum dynamics
International Nuclear Information System (INIS)
Hicks, D.L.; Liebrock, L.M.
1987-01-01
Simply porting existing parallel programs to a new parallel processor may not achieve the full speedup possible; to achieve the maximum efficiency may require redesigning the parallel algorithms for the specific architecture. The authors discuss here parallel algorithms that were developed first for the HEP processor and then ported to the CRAY X-MP/4, the ELXSI/10, and the Intel iPSC/32. Focus is mainly on the most recent parallel processing results produced, i.e., those on the Intel Hypercube. The applications are simulations of continuum dynamics in which the momentum and stress gradients are important. Examples of these are inertial confinement fusion experiments, severe breaks in the coolant system of a reactor, weapons physics, shock-wave physics. Speedup efficiencies on the Intel iPSC Hypercube are very sensitive to the ratio of communication to computation. Great care must be taken in designing algorithms for this machine to avoid global communication. This is much more critical on the iPSC than it was on the three previous parallel processors
Parallel S/sub n/ iteration schemes
International Nuclear Information System (INIS)
Wienke, B.R.; Hiromoto, R.E.
1986-01-01
The iterative, multigroup, discrete ordinates (S/sub n/) technique for solving the linear transport equation enjoys widespread usage and appeal. Serial iteration schemes and numerical algorithms developed over the years provide a timely framework for parallel extension. On the Denelcor HEP, the authors investigate three parallel iteration schemes for solving the one-dimensional S/sub n/ transport equation. The multigroup representation and serial iteration methods are also reviewed. This analysis represents a first attempt to extend serial S/sub n/ algorithms to parallel environments and provides good baseline estimates on ease of parallel implementation, relative algorithm efficiency, comparative speedup, and some future directions. The authors examine ordered and chaotic versions of these strategies, with and without concurrent rebalance and diffusion acceleration. Two strategies efficiently support high degrees of parallelization and appear to be robust parallel iteration techniques. The third strategy is a weaker parallel algorithm. Chaotic iteration, difficult to simulate on serial machines, holds promise and converges faster than ordered versions of the schemes. Actual parallel speedup and efficiency are high and payoff appears substantial
Energy Technology Data Exchange (ETDEWEB)
Adachi, Masaaki; Ogasawara, Shinobu; Kume, Etsuo [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Ishizuki, Shigeru; Nemoto, Toshiyuki; Kawasaki, Nobuo; Kawai, Wataru [Fujitsu Ltd., Tokyo (Japan); Yatake, Yo-ichi [Hitachi Ltd., Tokyo (Japan)
2001-02-01
Several computer codes in the nuclear field have been vectorized, parallelized and trans-ported on the FUJITSU VPP500 system, the AP3000 system, the SX-4 system and the Paragon system at Center for Promotion of Computational Science and Engineering in Japan Atomic Energy Research Institute. We dealt with 18 codes in fiscal 1999. These results are reported in 3 parts, i.e., the vectorization and the parallelization part on vector processors, the parallelization part on scalar processors and the porting part. In this report, we describe the vectorization and parallelization on vector processors. In this vectorization and parallelization on vector processors part, the vectorization of Relativistic Molecular Orbital Calculation code RSCAT, a microscopic transport code for high energy nuclear collisions code JAM, three-dimensional non-steady thermal-fluid analysis code STREAM, Relativistic Density Functional Theory code RDFT and High Speed Three-Dimensional Nodal Diffusion code MOSRA-Light on the VPP500 system and the SX-4 system are described. (author)
Comparative Analysis between Lean, Six Sigma and Lean Six Sigma Concepts
Alexandra Mirela Cristina MUNTEANU
2017-01-01
This paper analyzes the benefits of Lean Six Sigma in comparison with Lean and Six Sigma, traditional improvement methodologies. The introduction highlights the appearance of Lean Six Sigma, early 2000s, as well as the benefits brought by the integrated approach. The following parts of the study emphasize the main differences between methodologies and their commonalities based on their synergy. Finally the advantages of Lean Six Sigma versus Lean and Six Sigma are analyzed and systematized by...
International Nuclear Information System (INIS)
Heggarty, J.W.
1999-06-01
For almost thirty years, sequential R-matrix computation has been used by atomic physics research groups, from around the world, to model collision phenomena involving the scattering of electrons or positrons with atomic or molecular targets. As considerable progress has been made in the understanding of fundamental scattering processes, new data, obtained from more complex calculations, is of current interest to experimentalists. Performing such calculations, however, places considerable demands on the computational resources to be provided by the target machine, in terms of both processor speed and memory requirement. Indeed, in some instances the computational requirements are so great that the proposed R-matrix calculations are intractable, even when utilising contemporary classic supercomputers. Historically, increases in the computational requirements of R-matrix computation were accommodated by porting the problem codes to a more powerful classic supercomputer. Although this approach has been successful in the past, it is no longer considered to be a satisfactory solution due to the limitations of current (and future) Von Neumann machines. As a consequence, there has been considerable interest in the high performance multicomputers, that have emerged over the last decade which appear to offer the computational resources required by contemporary R-matrix research. Unfortunately, developing codes for these machines is not as simple a task as it was to develop codes for successive classic supercomputers. The difficulty arises from the considerable differences in the computing models that exist between the two types of machine and results in the programming of multicomputers to be widely acknowledged as a difficult, time consuming and error-prone task. Nevertheless, unless parallel R-matrix computation is realised, important theoretical and experimental atomic physics research will continue to be hindered. This thesis describes work that was undertaken in
Implementation and performance of parallelized elegant
International Nuclear Information System (INIS)
Wang, Y.; Borland, M.
2008-01-01
The program elegant is widely used for design and modeling of linacs for free-electron lasers and energy recovery linacs, as well as storage rings and other applications. As part of a multi-year effort, we have parallelized many aspects of the code, including single-particle dynamics, wakefields, and coherent synchrotron radiation. We report on the approach used for gradual parallelization, which proved very beneficial in getting parallel features into the hands of users quickly. We also report details of parallelization of collective effects. Finally, we discuss performance of the parallelized code in various applications.
Parallelizing the spectral transform method: A comparison of alternative parallel algorithms
International Nuclear Information System (INIS)
Foster, I.; Worley, P.H.
1993-01-01
The spectral transform method is a standard numerical technique for solving partial differential equations on the sphere and is widely used in global climate modeling. In this paper, we outline different approaches to parallelizing the method and describe experiments that we are conducting to evaluate the efficiency of these approaches on parallel computers. The experiments are conducted using a testbed code that solves the nonlinear shallow water equations on a sphere, but are designed to permit evaluation in the context of a global model. They allow us to evaluate the relative merits of the approaches as a function of problem size and number of processors. The results of this study are guiding ongoing work on PCCM2, a parallel implementation of the Community Climate Model developed at the National Center for Atmospheric Research
Algorithms for parallel computers
International Nuclear Information System (INIS)
Churchhouse, R.F.
1985-01-01
Until relatively recently almost all the algorithms for use on computers had been designed on the (usually unstated) assumption that they were to be run on single processor, serial machines. With the introduction of vector processors, array processors and interconnected systems of mainframes, minis and micros, however, various forms of parallelism have become available. The advantage of parallelism is that it offers increased overall processing speed but it also raises some fundamental questions, including: (i) which, if any, of the existing 'serial' algorithms can be adapted for use in the parallel mode. (ii) How close to optimal can such adapted algorithms be and, where relevant, what are the convergence criteria. (iii) How can we design new algorithms specifically for parallel systems. (iv) For multi-processor systems how can we handle the software aspects of the interprocessor communications. Aspects of these questions illustrated by examples are considered in these lectures. (orig.)
Parallel processing for fluid dynamics applications
International Nuclear Information System (INIS)
Johnson, G.M.
1989-01-01
The impact of parallel processing on computational science and, in particular, on computational fluid dynamics is growing rapidly. In this paper, particular emphasis is given to developments which have occurred within the past two years. Parallel processing is defined and the reasons for its importance in high-performance computing are reviewed. Parallel computer architectures are classified according to the number and power of their processing units, their memory, and the nature of their connection scheme. Architectures which show promise for fluid dynamics applications are emphasized. Fluid dynamics problems are examined for parallelism inherent at the physical level. CFD algorithms and their mappings onto parallel architectures are discussed. Several example are presented to document the performance of fluid dynamics applications on present-generation parallel processing devices
Massange-Sánchez, Julio A.; Palmeros-Suárez, Paola A.; Espitia-Rangel, Eduardo; Rodríguez-Arévalo, Isaac; Sánchez-Segura, Lino; Martínez-Gallardo, Norma A.; Alatorre-Cobos, Fulgencio; Tiessen, Axel; Délano-Frier, John P.
2016-01-01
Two grain amaranth transcription factor (TF) genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII) conferred tolerance to water-deficit stress (WS) in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA)-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS). WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI) provided salt-stress (SS) tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms. PMID:27749893
Directory of Open Access Journals (Sweden)
Julio A Massange-Sánchez
Full Text Available Two grain amaranth transcription factor (TF genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII conferred tolerance to water-deficit stress (WS in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS. WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI provided salt-stress (SS tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms.
Parallel discrete event simulation
Overeinder, B.J.; Hertzberger, L.O.; Sloot, P.M.A.; Withagen, W.J.
1991-01-01
In simulating applications for execution on specific computing systems, the simulation performance figures must be known in a short period of time. One basic approach to the problem of reducing the required simulation time is the exploitation of parallelism. However, in parallelizing the simulation
Micro-vision servo control of a multi-axis alignment system for optical fiber assembly
International Nuclear Information System (INIS)
Chen, Weihai; Yu, Fei; Qu, Jianliang; Chen, Wenjie; Zhang, Jianbin
2017-01-01
This paper describes a novel optical fiber assembly system featuring a multi-axis alignment function based on micro-vision feedback control. It consists of an active parallel alignment mechanism, a passive compensation mechanism, a micro-gripper and a micro-vision servo control system. The active parallel alignment part is a parallelogram-based design with remote-center-of-motion (RCM) function to achieve precise rotation without fatal lateral motion. The passive mechanism, with five degrees of freedom (5-DOF), is used to implement passive compensation for multi-axis errors. A specially designed 1-DOF micro-gripper mounted onto the active parallel alignment platform is adopted to grasp and rotate the optical fiber. A micro-vision system equipped with two charge-coupled device (CCD) cameras is introduced to observe the small field of view and obtain multi-axis errors for servo feedback control. The two CCD cameras are installed in an orthogonal arrangement—thus the errors can be easily measured via the captured images. Meanwhile, a series of tracking and measurement algorithms based on specific features of the target objects are developed. Details of the force and displacement sensor information acquisition in the assembly experiment are also provided. An experiment demonstrates the validity of the proposed visual algorithm by achieving the task of eliminating errors and inserting an optical fiber to the U-groove accurately. (paper)
Overview of the Force Scientific Parallel Language
Directory of Open Access Journals (Sweden)
Gita Alaghband
1994-01-01
Full Text Available The Force parallel programming language designed for large-scale shared-memory multiprocessors is presented. The language provides a number of parallel constructs as extensions to the ordinary Fortran language and is implemented as a two-level macro preprocessor to support portability across shared memory multiprocessors. The global parallelism model on which the Force is based provides a powerful parallel language. The parallel constructs, generic synchronization, and freedom from process management supported by the Force has resulted in structured parallel programs that are ported to the many multiprocessors on which the Force is implemented. Two new parallel constructs for looping and functional decomposition are discussed. Several programming examples to illustrate some parallel programming approaches using the Force are also presented.
The Galley Parallel File System
Nieuwejaar, Nils; Kotz, David
1996-01-01
Most current multiprocessor file systems are designed to use multiple disks in parallel, using the high aggregate bandwidth to meet the growing I/0 requirements of parallel scientific applications. Many multiprocessor file systems provide applications with a conventional Unix-like interface, allowing the application to access multiple disks transparently. This interface conceals the parallelism within the file system, increasing the ease of programmability, but making it difficult or impossible for sophisticated programmers and libraries to use knowledge about their I/O needs to exploit that parallelism. In addition to providing an insufficient interface, most current multiprocessor file systems are optimized for a different workload than they are being asked to support. We introduce Galley, a new parallel file system that is intended to efficiently support realistic scientific multiprocessor workloads. We discuss Galley's file structure and application interface, as well as the performance advantages offered by that interface.
PDDP, A Data Parallel Programming Model
Directory of Open Access Journals (Sweden)
Karen H. Warren
1996-01-01
Full Text Available PDDP, the parallel data distribution preprocessor, is a data parallel programming model for distributed memory parallel computers. PDDP implements high-performance Fortran-compatible data distribution directives and parallelism expressed by the use of Fortran 90 array syntax, the FORALL statement, and the WHERE construct. Distributed data objects belong to a global name space; other data objects are treated as local and replicated on each processor. PDDP allows the user to program in a shared memory style and generates codes that are portable to a variety of parallel machines. For interprocessor communication, PDDP uses the fastest communication primitives on each platform.
Design considerations for parallel graphics libraries
Crockett, Thomas W.
1994-01-01
Applications which run on parallel supercomputers are often characterized by massive datasets. Converting these vast collections of numbers to visual form has proven to be a powerful aid to comprehension. For a variety of reasons, it may be desirable to provide this visual feedback at runtime. One way to accomplish this is to exploit the available parallelism to perform graphics operations in place. In order to do this, we need appropriate parallel rendering algorithms and library interfaces. This paper provides a tutorial introduction to some of the issues which arise in designing parallel graphics libraries and their underlying rendering algorithms. The focus is on polygon rendering for distributed memory message-passing systems. We illustrate our discussion with examples from PGL, a parallel graphics library which has been developed on the Intel family of parallel systems.
Automatic Loop Parallelization via Compiler Guided Refactoring
DEFF Research Database (Denmark)
Larsen, Per; Ladelsky, Razya; Lidman, Jacob
For many parallel applications, performance relies not on instruction-level parallelism, but on loop-level parallelism. Unfortunately, many modern applications are written in ways that obstruct automatic loop parallelization. Since we cannot identify sufficient parallelization opportunities...... for these codes in a static, off-line compiler, we developed an interactive compilation feedback system that guides the programmer in iteratively modifying application source, thereby improving the compiler’s ability to generate loop-parallel code. We use this compilation system to modify two sequential...... benchmarks, finding that the code parallelized in this way runs up to 8.3 times faster on an octo-core Intel Xeon 5570 system and up to 12.5 times faster on a quad-core IBM POWER6 system. Benchmark performance varies significantly between the systems. This suggests that semi-automatic parallelization should...
Aspects of computation on asynchronous parallel processors
International Nuclear Information System (INIS)
Wright, M.
1989-01-01
The increasing availability of asynchronous parallel processors has provided opportunities for original and useful work in scientific computing. However, the field of parallel computing is still in a highly volatile state, and researchers display a wide range of opinion about many fundamental questions such as models of parallelism, approaches for detecting and analyzing parallelism of algorithms, and tools that allow software developers and users to make effective use of diverse forms of complex hardware. This volume collects the work of researchers specializing in different aspects of parallel computing, who met to discuss the framework and the mechanics of numerical computing. The far-reaching impact of high-performance asynchronous systems is reflected in the wide variety of topics, which include scientific applications (e.g. linear algebra, lattice gauge simulation, ordinary and partial differential equations), models of parallelism, parallel language features, task scheduling, automatic parallelization techniques, tools for algorithm development in parallel environments, and system design issues
H5Part A Portable High Performance Parallel Data Interface for Particle Simulations
Adelmann, Andreas; Shalf, John M; Siegerist, Cristina
2005-01-01
Largest parallel particle simulations, in six dimensional phase space generate wast amont of data. It is also desirable to share data and data analysis tools such as ParViT (Particle Visualization Toolkit) among other groups who are working on particle-based accelerator simulations. We define a very simple file schema built on top of HDF5 (Hierarchical Data Format version 5) as well as an API that simplifies the reading/writing of the data to the HDF5 file format. HDF5 offers a self-describing machine-independent binary file format that supports scalable parallel I/O performance for MPI codes on a variety of supercomputing systems and works equally well on laptop computers. The API is available for C, C++, and Fortran codes. The file format will enable disparate research groups with very different simulation implementations to share data transparently and share data analysis tools. For instance, the common file format will enable groups that depend on completely different simulation implementations to share c...
Six Degree-of-Freedom Haptic Simulation of a Stringed Musical Instrument for Triggering Sounds.
Dangxiao Wang; Xiaohan Zhao; Youjiao Shi; Yuru Zhang; Jing Xiao
2017-01-01
Six degree-of-freedom (DoF) haptic rendering of multi-region contacts between a moving hand avatar and varied-shaped components of a music instrument is fundamental to realizing interactive simulation of music playing. There are two aspects of computational challenges: first, some components have significantly small sizes in some dimensions, such as the strings on a seven-string plucked instrument (e.g., Guqin), which makes it challenging to avoid pop-through during multi-region contact scenarios. Second, deformable strings may produce high-frequency vibration, which requires simulating diversified and subtle force sensations when a hand interacts with strings in different ways. In this paper, we propose a constraint-based approach to haptic interaction and simulation between a moving hand avatar and various parts of a string instrument, using a cylinder model for the string that has a large length-radius ratio and a sphere-tree model for the other parts that have complex shapes. Collision response algorithms based on configuration-based optimization is adapted to solve for the contact configuration of the hand avatar interacting with thin strings without penetration. To simulate the deformation and vibration of a string, a cylindrical volume with variable diameters is defined with response to the interaction force applied by the operator. Experimental results have validated the stability and efficiency of the proposed approach. Subtle force feelings can be simulated to reflect varied interaction patterns, to differentiate collisions between the hand avatar with a static or vibrating string and the effects of various colliding forces and touch locations on the strings.
Design of a 4-DOF MR haptic master for application to robot surgery: virtual environment work
Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok
2014-09-01
This paper presents the design and control performance of a novel type of 4-degrees-of-freedom (4-DOF) haptic master in cyberspace for a robot-assisted minimally invasive surgery (RMIS) application. By using a controllable magnetorheological (MR) fluid, the proposed haptic master can have a feedback function for a surgical robot. Due to the difficulty in utilizing real human organs in the experiment, the cyberspace that features the virtual object is constructed to evaluate the performance of the haptic master. In order to realize the cyberspace, a volumetric deformable object is represented by a shape-retaining chain-linked (S-chain) model, which is a fast volumetric model and is suitable for real-time applications. In the haptic architecture for an RMIS application, the desired torque and position induced from the virtual object of the cyberspace and the haptic master of real space are transferred to each other. In order to validate the superiority of the proposed master and volumetric model, a tracking control experiment is implemented with a nonhomogenous volumetric cubic object to demonstrate that the proposed model can be utilized in real-time haptic rendering architecture. A proportional-integral-derivative (PID) controller is then designed and empirically implemented to accomplish the desired torque trajectories. It has been verified from the experiment that tracking the control performance for torque trajectories from a virtual slave can be successfully achieved.
Design of a 4-DOF MR haptic master for application to robot surgery: virtual environment work
International Nuclear Information System (INIS)
Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok
2014-01-01
This paper presents the design and control performance of a novel type of 4-degrees-of-freedom (4-DOF) haptic master in cyberspace for a robot-assisted minimally invasive surgery (RMIS) application. By using a controllable magnetorheological (MR) fluid, the proposed haptic master can have a feedback function for a surgical robot. Due to the difficulty in utilizing real human organs in the experiment, the cyberspace that features the virtual object is constructed to evaluate the performance of the haptic master. In order to realize the cyberspace, a volumetric deformable object is represented by a shape-retaining chain-linked (S-chain) model, which is a fast volumetric model and is suitable for real-time applications. In the haptic architecture for an RMIS application, the desired torque and position induced from the virtual object of the cyberspace and the haptic master of real space are transferred to each other. In order to validate the superiority of the proposed master and volumetric model, a tracking control experiment is implemented with a nonhomogenous volumetric cubic object to demonstrate that the proposed model can be utilized in real-time haptic rendering architecture. A proportional-integral-derivative (PID) controller is then designed and empirically implemented to accomplish the desired torque trajectories. It has been verified from the experiment that tracking the control performance for torque trajectories from a virtual slave can be successfully achieved. (paper)
Note: Rotaphone, a new self-calibrated six-degree-of-freedom seismic sensor
Brokešová, Johana; Málek, Jiří; Evans, John R.
2012-01-01
We have developed and tested (calibration, linearity, and cross-axis errors) a new six-degree-of-freedom mechanical seismic sensor for collocated measurements of three translational and three rotational ground motion velocity components. The device consists of standard geophones arranged in parallel pairs to detect spatial gradients. The instrument operates in a high-frequency range (above the natural frequency of the geophones, 4.5 Hz). Its theoretical sensitivity limit in this range is 10(-9) m/s in ground velocity and 10(-9) rad/s in rotation rate. Small size and weight, and easy installation and maintenance make the instrument useful for local-earthquake recording and seismic prospecting.
Parallelization of the FLAPW method
International Nuclear Information System (INIS)
Canning, A.; Mannstadt, W.; Freeman, A.J.
1999-01-01
The FLAPW (full-potential linearized-augmented plane-wave) method is one of the most accurate first-principles methods for determining electronic and magnetic properties of crystals and surfaces. Until the present work, the FLAPW method has been limited to systems of less than about one hundred atoms due to a lack of an efficient parallel implementation to exploit the power and memory of parallel computers. In this work we present an efficient parallelization of the method by division among the processors of the plane-wave components for each state. The code is also optimized for RISC (reduced instruction set computer) architectures, such as those found on most parallel computers, making full use of BLAS (basic linear algebra subprograms) wherever possible. Scaling results are presented for systems of up to 686 silicon atoms and 343 palladium atoms per unit cell, running on up to 512 processors on a CRAY T3E parallel computer
Parallelization of the FLAPW method
Canning, A.; Mannstadt, W.; Freeman, A. J.
2000-08-01
The FLAPW (full-potential linearized-augmented plane-wave) method is one of the most accurate first-principles methods for determining structural, electronic and magnetic properties of crystals and surfaces. Until the present work, the FLAPW method has been limited to systems of less than about a hundred atoms due to the lack of an efficient parallel implementation to exploit the power and memory of parallel computers. In this work, we present an efficient parallelization of the method by division among the processors of the plane-wave components for each state. The code is also optimized for RISC (reduced instruction set computer) architectures, such as those found on most parallel computers, making full use of BLAS (basic linear algebra subprograms) wherever possible. Scaling results are presented for systems of up to 686 silicon atoms and 343 palladium atoms per unit cell, running on up to 512 processors on a CRAY T3E parallel supercomputer.
Chief of Naval Education and Training Support, Pensacola, FL.
This individualized learning module on parallel circuits is one in a series of modules for a course in basic electricity and electronics. The course is one of a number of military-developed curriculum packages selected for adaptation to vocational instructional and curriculum development in a civilian setting. Four lessons are included in the…
Parallelization of 2-D lattice Boltzmann codes
International Nuclear Information System (INIS)
Suzuki, Soichiro; Kaburaki, Hideo; Yokokawa, Mitsuo.
1996-03-01
Lattice Boltzmann (LB) codes to simulate two dimensional fluid flow are developed on vector parallel computer Fujitsu VPP500 and scalar parallel computer Intel Paragon XP/S. While a 2-D domain decomposition method is used for the scalar parallel LB code, a 1-D domain decomposition method is used for the vector parallel LB code to be vectorized along with the axis perpendicular to the direction of the decomposition. High parallel efficiency of 95.1% by the vector parallel calculation on 16 processors with 1152x1152 grid and 88.6% by the scalar parallel calculation on 100 processors with 800x800 grid are obtained. The performance models are developed to analyze the performance of the LB codes. It is shown by our performance models that the execution speed of the vector parallel code is about one hundred times faster than that of the scalar parallel code with the same number of processors up to 100 processors. We also analyze the scalability in keeping the available memory size of one processor element at maximum. Our performance model predicts that the execution time of the vector parallel code increases about 3% on 500 processors. Although the 1-D domain decomposition method has in general a drawback in the interprocessor communication, the vector parallel LB code is still suitable for the large scale and/or high resolution simulations. (author)
Parallelization of 2-D lattice Boltzmann codes
Energy Technology Data Exchange (ETDEWEB)
Suzuki, Soichiro; Kaburaki, Hideo; Yokokawa, Mitsuo
1996-03-01
Lattice Boltzmann (LB) codes to simulate two dimensional fluid flow are developed on vector parallel computer Fujitsu VPP500 and scalar parallel computer Intel Paragon XP/S. While a 2-D domain decomposition method is used for the scalar parallel LB code, a 1-D domain decomposition method is used for the vector parallel LB code to be vectorized along with the axis perpendicular to the direction of the decomposition. High parallel efficiency of 95.1% by the vector parallel calculation on 16 processors with 1152x1152 grid and 88.6% by the scalar parallel calculation on 100 processors with 800x800 grid are obtained. The performance models are developed to analyze the performance of the LB codes. It is shown by our performance models that the execution speed of the vector parallel code is about one hundred times faster than that of the scalar parallel code with the same number of processors up to 100 processors. We also analyze the scalability in keeping the available memory size of one processor element at maximum. Our performance model predicts that the execution time of the vector parallel code increases about 3% on 500 processors. Although the 1-D domain decomposition method has in general a drawback in the interprocessor communication, the vector parallel LB code is still suitable for the large scale and/or high resolution simulations. (author).
Huang, Fang; Liu, Dingsheng; Tan, Xicheng; Wang, Jian; Chen, Yunping; He, Binbin
2011-04-01
To design and implement an open-source parallel GIS (OP-GIS) based on a Linux cluster, the parallel inverse distance weighting (IDW) interpolation algorithm has been chosen as an example to explore the working model and the principle of algorithm parallel pattern (APP), one of the parallelization patterns for OP-GIS. Based on an analysis of the serial IDW interpolation algorithm of GRASS GIS, this paper has proposed and designed a specific parallel IDW interpolation algorithm, incorporating both single process, multiple data (SPMD) and master/slave (M/S) programming modes. The main steps of the parallel IDW interpolation algorithm are: (1) the master node packages the related information, and then broadcasts it to the slave nodes; (2) each node calculates its assigned data extent along one row using the serial algorithm; (3) the master node gathers the data from all nodes; and (4) iterations continue until all rows have been processed, after which the results are outputted. According to the experiments performed in the course of this work, the parallel IDW interpolation algorithm can attain an efficiency greater than 0.93 compared with similar algorithms, which indicates that the parallel algorithm can greatly reduce processing time and maximize speed and performance.
Parallel Monte Carlo reactor neutronics
International Nuclear Information System (INIS)
Blomquist, R.N.; Brown, F.B.
1994-01-01
The issues affecting implementation of parallel algorithms for large-scale engineering Monte Carlo neutron transport simulations are discussed. For nuclear reactor calculations, these include load balancing, recoding effort, reproducibility, domain decomposition techniques, I/O minimization, and strategies for different parallel architectures. Two codes were parallelized and tested for performance. The architectures employed include SIMD, MIMD-distributed memory, and workstation network with uneven interactive load. Speedups linear with the number of nodes were achieved
Surgical bedside master console for neurosurgical robotic system.
Arata, Jumpei; Kenmotsu, Hajime; Takagi, Motoki; Hori, Tatsuya; Miyagi, Takahiro; Fujimoto, Hideo; Kajita, Yasukazu; Hayashi, Yuichiro; Chinzei, Kiyoyuki; Hashizume, Makoto
2013-01-01
We are currently developing a neurosurgical robotic system that facilitates access to residual tumors and improves brain tumor removal surgical outcomes. The system combines conventional and robotic surgery allowing for a quick conversion between the procedures. This concept requires a new master console that can be positioned at the surgical bedside and be sterilized. The master console was developed using new technologies, such as a parallel mechanism and pneumatic sensors. The parallel mechanism is a purely passive 5-DOF (degrees of freedom) joystick based on the author's haptic research. The parallel mechanism enables motion input of conventional brain tumor removal surgery with a compact, intuitive interface that can be used in a conventional surgical environment. In addition, the pneumatic sensors implemented on the mechanism provide an intuitive interface and electrically isolate the tool parts from the mechanism so they can be easily sterilized. The 5-DOF parallel mechanism is compact (17 cm width, 19cm depth, and 15cm height), provides a 505,050 mm and 90° workspace and is highly backdrivable (0.27N of resistance force representing the surgical motion). The evaluation tests revealed that the pneumatic sensors can properly measure the suction strength, grasping force, and hand contact. In addition, an installability test showed that the master console can be used in a conventional surgical environment. The proposed master console design was shown to be feasible for operative neurosurgery based on comprehensive testing. This master console is currently being tested for master-slave control with a surgical robotic system.
Parallel Implicit Algorithms for CFD
Keyes, David E.
1998-01-01
The main goal of this project was efficient distributed parallel and workstation cluster implementations of Newton-Krylov-Schwarz (NKS) solvers for implicit Computational Fluid Dynamics (CFD.) "Newton" refers to a quadratically convergent nonlinear iteration using gradient information based on the true residual, "Krylov" to an inner linear iteration that accesses the Jacobian matrix only through highly parallelizable sparse matrix-vector products, and "Schwarz" to a domain decomposition form of preconditioning the inner Krylov iterations with primarily neighbor-only exchange of data between the processors. Prior experience has established that Newton-Krylov methods are competitive solvers in the CFD context and that Krylov-Schwarz methods port well to distributed memory computers. The combination of the techniques into Newton-Krylov-Schwarz was implemented on 2D and 3D unstructured Euler codes on the parallel testbeds that used to be at LaRC and on several other parallel computers operated by other agencies or made available by the vendors. Early implementations were made directly in Massively Parallel Integration (MPI) with parallel solvers we adapted from legacy NASA codes and enhanced for full NKS functionality. Later implementations were made in the framework of the PETSC library from Argonne National Laboratory, which now includes pseudo-transient continuation Newton-Krylov-Schwarz solver capability (as a result of demands we made upon PETSC during our early porting experiences). A secondary project pursued with funding from this contract was parallel implicit solvers in acoustics, specifically in the Helmholtz formulation. A 2D acoustic inverse problem has been solved in parallel within the PETSC framework.
Parallel kinematics type, kinematics, and optimal design
Liu, Xin-Jun
2014-01-01
Parallel Kinematics- Type, Kinematics, and Optimal Design presents the results of 15 year's research on parallel mechanisms and parallel kinematics machines. This book covers the systematic classification of parallel mechanisms (PMs) as well as providing a large number of mechanical architectures of PMs available for use in practical applications. It focuses on the kinematic design of parallel robots. One successful application of parallel mechanisms in the field of machine tools, which is also called parallel kinematics machines, has been the emerging trend in advanced machine tools. The book describes not only the main aspects and important topics in parallel kinematics, but also references novel concepts and approaches, i.e. type synthesis based on evolution, performance evaluation and optimization based on screw theory, singularity model taking into account motion and force transmissibility, and others. This book is intended for researchers, scientists, engineers and postgraduates or above with interes...
Experiments with parallel algorithms for combinatorial problems
G.A.P. Kindervater (Gerard); H.W.J.M. Trienekens
1985-01-01
textabstractIn the last decade many models for parallel computation have been proposed and many parallel algorithms have been developed. However, few of these models have been realized and most of these algorithms are supposed to run on idealized, unrealistic parallel machines. The parallel machines
Parallel reservoir simulator computations
International Nuclear Information System (INIS)
Hemanth-Kumar, K.; Young, L.C.
1995-01-01
The adaptation of a reservoir simulator for parallel computations is described. The simulator was originally designed for vector processors. It performs approximately 99% of its calculations in vector/parallel mode and relative to scalar calculations it achieves speedups of 65 and 81 for black oil and EOS simulations, respectively on the CRAY C-90
The STAPL Parallel Graph Library
Harshvardhan,
2013-01-01
This paper describes the stapl Parallel Graph Library, a high-level framework that abstracts the user from data-distribution and parallelism details and allows them to concentrate on parallel graph algorithm development. It includes a customizable distributed graph container and a collection of commonly used parallel graph algorithms. The library introduces pGraph pViews that separate algorithm design from the container implementation. It supports three graph processing algorithmic paradigms, level-synchronous, asynchronous and coarse-grained, and provides common graph algorithms based on them. Experimental results demonstrate improved scalability in performance and data size over existing graph libraries on more than 16,000 cores and on internet-scale graphs containing over 16 billion vertices and 250 billion edges. © Springer-Verlag Berlin Heidelberg 2013.
The parallel volume at large distances
DEFF Research Database (Denmark)
Kampf, Jürgen
In this paper we examine the asymptotic behavior of the parallel volume of planar non-convex bodies as the distance tends to infinity. We show that the difference between the parallel volume of the convex hull of a body and the parallel volume of the body itself tends to . This yields a new proof...... for the fact that a planar body can only have polynomial parallel volume, if it is convex. Extensions to Minkowski spaces and random sets are also discussed....
The parallel volume at large distances
DEFF Research Database (Denmark)
Kampf, Jürgen
In this paper we examine the asymptotic behavior of the parallel volume of planar non-convex bodies as the distance tends to infinity. We show that the difference between the parallel volume of the convex hull of a body and the parallel volume of the body itself tends to 0. This yields a new proof...... for the fact that a planar body can only have polynomial parallel volume, if it is convex. Extensions to Minkowski spaces and random sets are also discussed....
Expressing Parallelism with ROOT
Energy Technology Data Exchange (ETDEWEB)
Piparo, D. [CERN; Tejedor, E. [CERN; Guiraud, E. [CERN; Ganis, G. [CERN; Mato, P. [CERN; Moneta, L. [CERN; Valls Pla, X. [CERN; Canal, P. [Fermilab
2017-11-22
The need for processing the ever-increasing amount of data generated by the LHC experiments in a more efficient way has motivated ROOT to further develop its support for parallelism. Such support is being tackled both for shared-memory and distributed-memory environments. The incarnations of the aforementioned parallelism are multi-threading, multi-processing and cluster-wide executions. In the area of multi-threading, we discuss the new implicit parallelism and related interfaces, as well as the new building blocks to safely operate with ROOT objects in a multi-threaded environment. Regarding multi-processing, we review the new MultiProc framework, comparing it with similar tools (e.g. multiprocessing module in Python). Finally, as an alternative to PROOF for cluster-wide executions, we introduce the efforts on integrating ROOT with state-of-the-art distributed data processing technologies like Spark, both in terms of programming model and runtime design (with EOS as one of the main components). For all the levels of parallelism, we discuss, based on real-life examples and measurements, how our proposals can increase the productivity of scientists.
Expressing Parallelism with ROOT
Piparo, D.; Tejedor, E.; Guiraud, E.; Ganis, G.; Mato, P.; Moneta, L.; Valls Pla, X.; Canal, P.
2017-10-01
The need for processing the ever-increasing amount of data generated by the LHC experiments in a more efficient way has motivated ROOT to further develop its support for parallelism. Such support is being tackled both for shared-memory and distributed-memory environments. The incarnations of the aforementioned parallelism are multi-threading, multi-processing and cluster-wide executions. In the area of multi-threading, we discuss the new implicit parallelism and related interfaces, as well as the new building blocks to safely operate with ROOT objects in a multi-threaded environment. Regarding multi-processing, we review the new MultiProc framework, comparing it with similar tools (e.g. multiprocessing module in Python). Finally, as an alternative to PROOF for cluster-wide executions, we introduce the efforts on integrating ROOT with state-of-the-art distributed data processing technologies like Spark, both in terms of programming model and runtime design (with EOS as one of the main components). For all the levels of parallelism, we discuss, based on real-life examples and measurements, how our proposals can increase the productivity of scientists.
Parallel hierarchical radiosity rendering
Energy Technology Data Exchange (ETDEWEB)
Carter, Michael [Iowa State Univ., Ames, IA (United States)
1993-07-01
In this dissertation, the step-by-step development of a scalable parallel hierarchical radiosity renderer is documented. First, a new look is taken at the traditional radiosity equation, and a new form is presented in which the matrix of linear system coefficients is transformed into a symmetric matrix, thereby simplifying the problem and enabling a new solution technique to be applied. Next, the state-of-the-art hierarchical radiosity methods are examined for their suitability to parallel implementation, and scalability. Significant enhancements are also discovered which both improve their theoretical foundations and improve the images they generate. The resultant hierarchical radiosity algorithm is then examined for sources of parallelism, and for an architectural mapping. Several architectural mappings are discussed. A few key algorithmic changes are suggested during the process of making the algorithm parallel. Next, the performance, efficiency, and scalability of the algorithm are analyzed. The dissertation closes with a discussion of several ideas which have the potential to further enhance the hierarchical radiosity method, or provide an entirely new forum for the application of hierarchical methods.
Six networks on a universal neuromorphic computing substrate
Directory of Open Access Journals (Sweden)
Thomas ePfeil
2013-02-01
Full Text Available In this study, we present a highly configurable neuromorphic computing substrate and use it for emulating several types of neural networks. At the heart of this system lies a mixed-signal chip, with analog implementations of neurons and synapses and digital transmission of action potentials. Major advantages of this emulation device, which has been explicitly designed as a universal neural network emulator, are its inherent parallelism and high acceleration factor compared to conventional computers. Its configurability allows the realization of almost arbitrary network topologies and the use of widely varied neuronal and synaptic parameters. Fixed-pattern noise inherent to analog circuitry is reduced by calibration routines. An integrated development environment allows neuroscientists to operate the device without any prior knowledge of neuromorphic circuit design. As a showcase for the capabilities of the system, we describe the successful emulation of six different neural networks which cover a broad spectrum of both structure and functionality.
Six networks on a universal neuromorphic computing substrate.
Pfeil, Thomas; Grübl, Andreas; Jeltsch, Sebastian; Müller, Eric; Müller, Paul; Petrovici, Mihai A; Schmuker, Michael; Brüderle, Daniel; Schemmel, Johannes; Meier, Karlheinz
2013-01-01
In this study, we present a highly configurable neuromorphic computing substrate and use it for emulating several types of neural networks. At the heart of this system lies a mixed-signal chip, with analog implementations of neurons and synapses and digital transmission of action potentials. Major advantages of this emulation device, which has been explicitly designed as a universal neural network emulator, are its inherent parallelism and high acceleration factor compared to conventional computers. Its configurability allows the realization of almost arbitrary network topologies and the use of widely varied neuronal and synaptic parameters. Fixed-pattern noise inherent to analog circuitry is reduced by calibration routines. An integrated development environment allows neuroscientists to operate the device without any prior knowledge of neuromorphic circuit design. As a showcase for the capabilities of the system, we describe the successful emulation of six different neural networks which cover a broad spectrum of both structure and functionality.
International Nuclear Information System (INIS)
Adelmann, Andreas; Gsell, Achim; Oswald, Benedikt; Schietinger, Thomas; Bethel, Wes; Shalf, John; Siegerist, Cristina; Stockinger, Kurt
2007-01-01
Significant problems facing all experimental and computational sciences arise from growing data size and complexity. Common to all these problems is the need to perform efficient data I/O on diverse computer architectures. In our scientific application, the largest parallel particle simulations generate vast quantities of six-dimensional data. Such a simulation run produces data for an aggregate data size up to several TB per run. Motivated by the need to address data I/O and access challenges, we have implemented H5Part, an open source data I/O API that simplifies the use of the Hierarchical Data Format v5 library (HDF5). HDF5 is an industry standard for high performance, cross-platform data storage and retrieval that runs on all contemporary architectures from large parallel supercomputers to laptops. H5Part, which is oriented to the needs of the particle physics and cosmology communities, provides support for parallel storage and retrieval of particles, structured and in the future unstructured meshes. In this paper, we describe recent work focusing on I/O support for particles and structured meshes and provide data showing performance on modern supercomputer architectures like the IBM POWER 5
Shared Variable Oriented Parallel Precompiler for SPMD Model
Institute of Scientific and Technical Information of China (English)
无
1995-01-01
For the moment,commercial parallel computer systems with distributed memory architecture are usually provided with parallel FORTRAN or parallel C compliers,which are just traditional sequential FORTRAN or C compilers expanded with communication statements.Programmers suffer from writing parallel programs with communication statements. The Shared Variable Oriented Parallel Precompiler (SVOPP) proposed in this paper can automatically generate appropriate communication statements based on shared variables for SPMD(Single Program Multiple Data) computation model and greatly ease the parallel programming with high communication efficiency.The core function of parallel C precompiler has been successfully verified on a transputer-based parallel computer.Its prominent performance shows that SVOPP is probably a break-through in parallel programming technique.
Evaluating parallel optimization on transputers
Directory of Open Access Journals (Sweden)
A.G. Chalmers
2003-12-01
Full Text Available The faster processing power of modern computers and the development of efficient algorithms have made it possible for operations researchers to tackle a much wider range of problems than ever before. Further improvements in processing speed can be achieved utilising relatively inexpensive transputers to process components of an algorithm in parallel. The Davidon-Fletcher-Powell method is one of the most successful and widely used optimisation algorithms for unconstrained problems. This paper examines the algorithm and identifies the components that can be processed in parallel. The results of some experiments with these components are presented which indicates under what conditions parallel processing with an inexpensive configuration is likely to be faster than the traditional sequential implementations. The performance of the whole algorithm with its parallel components is then compared with the original sequential algorithm. The implementation serves to illustrate the practicalities of speeding up typical OR algorithms in terms of difficulty, effort and cost. The results give an indication of the savings in time a given parallel implementation can be expected to yield.
Programming massively parallel processors a hands-on approach
Kirk, David B
2010-01-01
Programming Massively Parallel Processors discusses basic concepts about parallel programming and GPU architecture. ""Massively parallel"" refers to the use of a large number of processors to perform a set of computations in a coordinated parallel way. The book details various techniques for constructing parallel programs. It also discusses the development process, performance level, floating-point format, parallel patterns, and dynamic parallelism. The book serves as a teaching guide where parallel programming is the main topic of the course. It builds on the basics of C programming for CUDA, a parallel programming environment that is supported on NVI- DIA GPUs. Composed of 12 chapters, the book begins with basic information about the GPU as a parallel computer source. It also explains the main concepts of CUDA, data parallelism, and the importance of memory access efficiency using CUDA. The target audience of the book is graduate and undergraduate students from all science and engineering disciplines who ...
6DoF object pose measurement by a monocular manifold-based pattern recognition technique
International Nuclear Information System (INIS)
Kouskouridas, Rigas; Charalampous, Konstantinos; Gasteratos, Antonios
2012-01-01
In this paper, a novel solution to the compound problem of object recognition and 3D pose estimation is presented. An accurate measurement of the geometrical configuration of a recognized target, relative to a known coordinate system, is of fundamental importance and constitutes a prerequisite for several applications such as robot grasping or obstacle avoidance. The proposed method lays its foundations on the following assumptions: (a) the same object captured under varying viewpoints and perspectives represents data that could be projected onto a well-established and highly distinguishable subspace; (b) totally different objects observed under the same viewpoints and perspectives share identical 3D pose that can be sufficiently modeled to produce a generalized model. Toward this end, we propose an advanced architecture that allows both recognizing patterns and providing efficient solution for 6DoF pose estimation. We employ a manifold modeling architecture that is grounded on a part-based representation of an object, which in turn, is accomplished via an unsupervised clustering of the extracted visual cues. The main contributions of the proposed framework are: (a) the proposed part-based architecture requires minimum supervision, compared to other contemporary solutions, whilst extracting new features encapsulating both appearance and geometrical attributes of the objects; (b) contrary to related projects that extract high-dimensional data, thus, increasing the complexity of the system, the proposed manifold modeling approach makes use of low dimensionality input vectors; (c) the formulation of a novel input–output space mapping that outperforms the existing dimensionality reduction schemes. Experimental results justify our theoretical claims and demonstrate the superiority of our method comparing to other related contemporary projects. (paper)
Exploiting Symmetry on Parallel Architectures.
Stiller, Lewis Benjamin
1995-01-01
This thesis describes techniques for the design of parallel programs that solve well-structured problems with inherent symmetry. Part I demonstrates the reduction of such problems to generalized matrix multiplication by a group-equivariant matrix. Fast techniques for this multiplication are described, including factorization, orbit decomposition, and Fourier transforms over finite groups. Our algorithms entail interaction between two symmetry groups: one arising at the software level from the problem's symmetry and the other arising at the hardware level from the processors' communication network. Part II illustrates the applicability of our symmetry -exploitation techniques by presenting a series of case studies of the design and implementation of parallel programs. First, a parallel program that solves chess endgames by factorization of an associated dihedral group-equivariant matrix is described. This code runs faster than previous serial programs, and discovered it a number of results. Second, parallel algorithms for Fourier transforms for finite groups are developed, and preliminary parallel implementations for group transforms of dihedral and of symmetric groups are described. Applications in learning, vision, pattern recognition, and statistics are proposed. Third, parallel implementations solving several computational science problems are described, including the direct n-body problem, convolutions arising from molecular biology, and some communication primitives such as broadcast and reduce. Some of our implementations ran orders of magnitude faster than previous techniques, and were used in the investigation of various physical phenomena.
Advanced parallel processing with supercomputer architectures
International Nuclear Information System (INIS)
Hwang, K.
1987-01-01
This paper investigates advanced parallel processing techniques and innovative hardware/software architectures that can be applied to boost the performance of supercomputers. Critical issues on architectural choices, parallel languages, compiling techniques, resource management, concurrency control, programming environment, parallel algorithms, and performance enhancement methods are examined and the best answers are presented. The authors cover advanced processing techniques suitable for supercomputers, high-end mainframes, minisupers, and array processors. The coverage emphasizes vectorization, multitasking, multiprocessing, and distributed computing. In order to achieve these operation modes, parallel languages, smart compilers, synchronization mechanisms, load balancing methods, mapping parallel algorithms, operating system functions, application library, and multidiscipline interactions are investigated to ensure high performance. At the end, they assess the potentials of optical and neural technologies for developing future supercomputers
Archer, Charles J; Blocksome, Michael A; Cernohous, Bob R; Ratterman, Joseph D; Smith, Brian E
2014-11-11
Endpoint-based parallel data processing with non-blocking collective instructions in a PAMI of a parallel computer is disclosed. The PAMI is composed of data communications endpoints, each including a specification of data communications parameters for a thread of execution on a compute node, including specifications of a client, a context, and a task. The compute nodes are coupled for data communications through the PAMI. The parallel application establishes a data communications geometry specifying a set of endpoints that are used in collective operations of the PAMI by associating with the geometry a list of collective algorithms valid for use with the endpoints of the geometry; registering in each endpoint in the geometry a dispatch callback function for a collective operation; and executing without blocking, through a single one of the endpoints in the geometry, an instruction for the collective operation.
A Parallel Energy-Sharing Control Strategy for Fuel Cell Hybrid Vehicle
Directory of Open Access Journals (Sweden)
Nik Rumzi Nik Idris
2011-08-01
Full Text Available This paper presents a parallel energy-sharing control strategy for the application of fuel cell hybrid vehicles (FCHVs. The hybrid source discussed consists of a fuel cells (FCs generator and energy storage units (ESUs which composed by the battery and ultracapacitor (UC modules. A direct current (DC bus is used to interface between the energy sources and the electric vehicles (EV propulsion system (loads. Energy sources are connected to the DC bus using of power electronics converters. A total of six control loops are designed in the supervisory system in order to regulate the DC bus voltage, control of current flow and to monitor the state of charge (SOC of each energy storage device at the same time. Proportional plus integral (PI controllers are employed to regulate the output from each control loop referring to their reference signals. The proposed energy control system is simulated in MATLAB/Simulink environment. Results indicated that the proposed parallel energy-sharing control system is capable to provide a practical hybrid vehicle in respond to the vehicle traction response and avoids the FC and battery from overstressed at the same time.
SOFTWARE FOR DESIGNING PARALLEL APPLICATIONS
Directory of Open Access Journals (Sweden)
M. K. Bouza
2017-01-01
Full Text Available The object of research is the tools to support the development of parallel programs in C/C ++. The methods and software which automates the process of designing parallel applications are proposed.
An Introduction to Parallel Computation R
Indian Academy of Sciences (India)
How are they programmed? This article provides an introduction. A parallel computer is a network of processors built for ... and have been used to solve problems much faster than a single ... in parallel computer design is to select an organization which ..... The most ambitious approach to parallel computing is to develop.
Building a parallel file system simulator
International Nuclear Information System (INIS)
Molina-Estolano, E; Maltzahn, C; Brandt, S A; Bent, J
2009-01-01
Parallel file systems are gaining in popularity in high-end computing centers as well as commercial data centers. High-end computing systems are expected to scale exponentially and to pose new challenges to their storage scalability in terms of cost and power. To address these challenges scientists and file system designers will need a thorough understanding of the design space of parallel file systems. Yet there exist few systematic studies of parallel file system behavior at petabyte- and exabyte scale. An important reason is the significant cost of getting access to large-scale hardware to test parallel file systems. To contribute to this understanding we are building a parallel file system simulator that can simulate parallel file systems at very large scale. Our goal is to simulate petabyte-scale parallel file systems on a small cluster or even a single machine in reasonable time and fidelity. With this simulator, file system experts will be able to tune existing file systems for specific workloads, scientists and file system deployment engineers will be able to better communicate workload requirements, file system designers and researchers will be able to try out design alternatives and innovations at scale, and instructors will be able to study very large-scale parallel file system behavior in the class room. In this paper we describe our approach and provide preliminary results that are encouraging both in terms of fidelity and simulation scalability.
Professional Parallel Programming with C# Master Parallel Extensions with NET 4
Hillar, Gastón
2010-01-01
Expert guidance for those programming today's dual-core processors PCs As PC processors explode from one or two to now eight processors, there is an urgent need for programmers to master concurrent programming. This book dives deep into the latest technologies available to programmers for creating professional parallel applications using C#, .NET 4, and Visual Studio 2010. The book covers task-based programming, coordination data structures, PLINQ, thread pools, asynchronous programming model, and more. It also teaches other parallel programming techniques, such as SIMD and vectorization.Teach
Parallelization for first principles electronic state calculation program
International Nuclear Information System (INIS)
Watanabe, Hiroshi; Oguchi, Tamio.
1997-03-01
In this report we study the parallelization for First principles electronic state calculation program. The target machines are NEC SX-4 for shared memory type parallelization and FUJITSU VPP300 for distributed memory type parallelization. The features of each parallel machine are surveyed, and the parallelization methods suitable for each are proposed. It is shown that 1.60 times acceleration is achieved with 2 CPU parallelization by SX-4 and 4.97 times acceleration is achieved with 12 PE parallelization by VPP 300. (author)
International Nuclear Information System (INIS)
Jejcic, A.; Maillard, J.; Maurel, G.; Silva, J.; Wolff-Bacha, F.
1997-01-01
The work in the field of parallel processing has developed as research activities using several numerical Monte Carlo simulations related to basic or applied current problems of nuclear and particle physics. For the applications utilizing the GEANT code development or improvement works were done on parts simulating low energy physical phenomena like radiation, transport and interaction. The problem of actinide burning by means of accelerators was approached using a simulation with the GEANT code. A program of neutron tracking in the range of low energies up to the thermal region has been developed. It is coupled to the GEANT code and permits in a single pass the simulation of a hybrid reactor core receiving a proton burst. Other works in this field refers to simulations for nuclear medicine applications like, for instance, development of biological probes, evaluation and characterization of the gamma cameras (collimators, crystal thickness) as well as the method for dosimetric calculations. Particularly, these calculations are suited for a geometrical parallelization approach especially adapted to parallel machines of the TN310 type. Other works mentioned in the same field refer to simulation of the electron channelling in crystals and simulation of the beam-beam interaction effect in colliders. The GEANT code was also used to simulate the operation of germanium detectors designed for natural and artificial radioactivity monitoring of environment
Directory of Open Access Journals (Sweden)
Helio Yochihiro Fuchigami
2014-08-01
Full Text Available This article addresses the problem of minimizing makespan on two parallel flow shops with proportional processing and setup times. The setup times are separated and sequence-independent. The parallel flow shop scheduling problem is a specific case of well-known hybrid flow shop, characterized by a multistage production system with more than one machine working in parallel at each stage. This situation is very common in various kinds of companies like chemical, electronics, automotive, pharmaceutical and food industries. This work aimed to propose six Simulated Annealing algorithms, their perturbation schemes and an algorithm for initial sequence generation. This study can be classified as “applied research” regarding the nature, “exploratory” about the objectives and “experimental” as to procedures, besides the “quantitative” approach. The proposed algorithms were effective regarding the solution and computationally efficient. Results of Analysis of Variance (ANOVA revealed no significant difference between the schemes in terms of makespan. It’s suggested the use of PS4 scheme, which moves a subsequence of jobs, for providing the best percentage of success. It was also found that there is a significant difference between the results of the algorithms for each value of the proportionality factor of the processing and setup times of flow shops.
Energy Technology Data Exchange (ETDEWEB)
Nishioka, K.; Nakamura, Y. [Graduate School of Energy Science, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Nishimura, S. [National Institute for Fusion Science, 322-6 Oroshi-cho, Toki, Gifu 509-5292 (Japan); Lee, H. Y. [Korea Advanced Institute of Science and Technology, Daejeon 305-701 (Korea, Republic of); Kobayashi, S.; Mizuuchi, T.; Nagasaki, K.; Okada, H.; Minami, T.; Kado, S.; Yamamoto, S.; Ohshima, S.; Konoshima, S.; Sano, F. [Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan)
2016-03-15
A moment approach to calculate neoclassical transport in non-axisymmetric torus plasmas composed of multiple ion species is extended to include the external parallel momentum sources due to unbalanced tangential neutral beam injections (NBIs). The momentum sources that are included in the parallel momentum balance are calculated from the collision operators of background particles with fast ions. This method is applied for the clarification of the physical mechanism of the neoclassical parallel ion flows and the multi-ion species effect on them in Heliotron J NBI plasmas. It is found that parallel ion flow can be determined by the balance between the parallel viscosity and the external momentum source in the region where the external source is much larger than the thermodynamic force driven source in the collisional plasmas. This is because the friction between C{sup 6+} and D{sup +} prevents a large difference between C{sup 6+} and D{sup +} flow velocities in such plasmas. The C{sup 6+} flow velocities, which are measured by the charge exchange recombination spectroscopy system, are numerically evaluated with this method. It is shown that the experimentally measured C{sup 6+} impurity flow velocities do not contradict clearly with the neoclassical estimations, and the dependence of parallel flow velocities on the magnetic field ripples is consistent in both results.
Structural Properties of G,T-Parallel Duplexes
Directory of Open Access Journals (Sweden)
Anna Aviñó
2010-01-01
Full Text Available The structure of G,T-parallel-stranded duplexes of DNA carrying similar amounts of adenine and guanine residues is studied by means of molecular dynamics (MD simulations and UV- and CD spectroscopies. In addition the impact of the substitution of adenine by 8-aminoadenine and guanine by 8-aminoguanine is analyzed. The presence of 8-aminoadenine and 8-aminoguanine stabilizes the parallel duplex structure. Binding of these oligonucleotides to their target polypyrimidine sequences to form the corresponding G,T-parallel triplex was not observed. Instead, when unmodified parallel-stranded duplexes were mixed with their polypyrimidine target, an interstrand Watson-Crick duplex was formed. As predicted by theoretical calculations parallel-stranded duplexes carrying 8-aminopurines did not bind to their target. The preference for the parallel-duplex over the Watson-Crick antiparallel duplex is attributed to the strong stabilization of the parallel duplex produced by the 8-aminopurines. Theoretical studies show that the isomorphism of the triads is crucial for the stability of the parallel triplex.
International Nuclear Information System (INIS)
Tsuji, Masashi; Chiba, Gou
2000-01-01
A hierarchical domain decomposition boundary element method (HDD-BEM) for solving the multiregion neutron diffusion equation (NDE) has been fully parallelized, both for numerical computations and for data communications, to accomplish a high parallel efficiency on distributed memory message passing parallel computers. Data exchanges between node processors that are repeated during iteration processes of HDD-BEM are implemented, without any intervention of the host processor that was used to supervise parallel processing in the conventional parallelized HDD-BEM (P-HDD-BEM). Thus, the parallel processing can be executed with only cooperative operations of node processors. The communication overhead was even the dominant time consuming part in the conventional P-HDD-BEM, and the parallelization efficiency decreased steeply with the increase of the number of processors. With the parallel data communication, the efficiency is affected only by the number of boundary elements assigned to decomposed subregions, and the communication overhead can be drastically reduced. This feature can be particularly advantageous in the analysis of three-dimensional problems where a large number of processors are required. The proposed P-HDD-BEM offers a promising solution to the deterioration problem of parallel efficiency and opens a new path to parallel computations of NDEs on distributed memory message passing parallel computers. (author)
New partially parallel acquisition technique in cerebral imaging: preliminary findings
International Nuclear Information System (INIS)
Tintera, Jaroslav; Gawehn, Joachim; Bauermann, Thomas; Vucurevic, Goran; Stoeter, Peter
2004-01-01
In MRI applications where short acquisition time is necessary, the increase of acquisition speed is often at the expense of image resolution and SNR. In such cases, the newly developed parallel acquisition techniques could provide images without mentioned limitations and in reasonably shortened measurement time. A newly designed eight-channel head coil array (i-PAT coil) allowing for parallel acquisition of independently reconstructed images (GRAPPA mode) has been tested for its applicability in neuroradiology. Image homogeneity was tested in standard phantom and healthy volunteers. BOLD signal changes were studied in a group of six volunteers using finger tapping stimulation. Phantom studies revealed an important drop of signal even after the use of a normalization filter in the center of the image and an important increase of artifact power with reduction of measurement time strongly depending on the combination of acceleration parameters. The additional application of a parallel acquisition technique such as GRAPPA decreases measurement time in the range of about 30%, but further reduction is often possible only at the expense of SNR. This technique performs best in conditions in which imaging speed is important, such as CE MRA, but time resolution still does not allow the acquisition of angiograms separating the arterial and venous phase. Significantly larger areas of BOLD activation were found using the i-PAT coil compared to the standard head coil. Being an eight-channel surface coil array, peripheral cortical structures profit from high SNR as high-resolution imaging of small cortical dysplasias and functional activation of cortical areas imaged by BOLD contrast. In BOLD contrast imaging, susceptibility artifacts are reduced, but only if an appropriate combination of acceleration parameters is used. (orig.)
New partially parallel acquisition technique in cerebral imaging: preliminary findings
Energy Technology Data Exchange (ETDEWEB)
Tintera, Jaroslav [Institute for Clinical and Experimental Medicine, Prague (Czech Republic); Gawehn, Joachim; Bauermann, Thomas; Vucurevic, Goran; Stoeter, Peter [University Clinic Mainz, Institute of Neuroradiology, Mainz (Germany)
2004-12-01
In MRI applications where short acquisition time is necessary, the increase of acquisition speed is often at the expense of image resolution and SNR. In such cases, the newly developed parallel acquisition techniques could provide images without mentioned limitations and in reasonably shortened measurement time. A newly designed eight-channel head coil array (i-PAT coil) allowing for parallel acquisition of independently reconstructed images (GRAPPA mode) has been tested for its applicability in neuroradiology. Image homogeneity was tested in standard phantom and healthy volunteers. BOLD signal changes were studied in a group of six volunteers using finger tapping stimulation. Phantom studies revealed an important drop of signal even after the use of a normalization filter in the center of the image and an important increase of artifact power with reduction of measurement time strongly depending on the combination of acceleration parameters. The additional application of a parallel acquisition technique such as GRAPPA decreases measurement time in the range of about 30%, but further reduction is often possible only at the expense of SNR. This technique performs best in conditions in which imaging speed is important, such as CE MRA, but time resolution still does not allow the acquisition of angiograms separating the arterial and venous phase. Significantly larger areas of BOLD activation were found using the i-PAT coil compared to the standard head coil. Being an eight-channel surface coil array, peripheral cortical structures profit from high SNR as high-resolution imaging of small cortical dysplasias and functional activation of cortical areas imaged by BOLD contrast. In BOLD contrast imaging, susceptibility artifacts are reduced, but only if an appropriate combination of acceleration parameters is used. (orig.)
Parallel education: what is it?
Amos, Michelle Peta
2017-01-01
In the history of education it has long been discussed that single-sex and coeducation are the two models of education present in schools. With the introduction of parallel schools over the last 15 years, there has been very little research into this 'new model'. Many people do not understand what it means for a school to be parallel or they confuse a parallel model with co-education, due to the presence of both boys and girls within the one institution. Therefore, the main obj...
Parallel computing of physical maps--a comparative study in SIMD and MIMD parallelism.
Bhandarkar, S M; Chirravuri, S; Arnold, J
1996-01-01
Ordering clones from a genomic library into physical maps of whole chromosomes presents a central computational problem in genetics. Chromosome reconstruction via clone ordering is usually isomorphic to the NP-complete Optimal Linear Arrangement problem. Parallel SIMD and MIMD algorithms for simulated annealing based on Markov chain distribution are proposed and applied to the problem of chromosome reconstruction via clone ordering. Perturbation methods and problem-specific annealing heuristics are proposed and described. The SIMD algorithms are implemented on a 2048 processor MasPar MP-2 system which is an SIMD 2-D toroidal mesh architecture whereas the MIMD algorithms are implemented on an 8 processor Intel iPSC/860 which is an MIMD hypercube architecture. A comparative analysis of the various SIMD and MIMD algorithms is presented in which the convergence, speedup, and scalability characteristics of the various algorithms are analyzed and discussed. On a fine-grained, massively parallel SIMD architecture with a low synchronization overhead such as the MasPar MP-2, a parallel simulated annealing algorithm based on multiple periodically interacting searches performs the best. For a coarse-grained MIMD architecture with high synchronization overhead such as the Intel iPSC/860, a parallel simulated annealing algorithm based on multiple independent searches yields the best results. In either case, distribution of clonal data across multiple processors is shown to exacerbate the tendency of the parallel simulated annealing algorithm to get trapped in a local optimum.
On synchronous parallel computations with independent probabilistic choice
International Nuclear Information System (INIS)
Reif, J.H.
1984-01-01
This paper introduces probabilistic choice to synchronous parallel machine models; in particular parallel RAMs. The power of probabilistic choice in parallel computations is illustrate by parallelizing some known probabilistic sequential algorithms. The authors characterize the computational complexity of time, space, and processor bounded probabilistic parallel RAMs in terms of the computational complexity of probabilistic sequential RAMs. They show that parallelism uniformly speeds up time bounded probabilistic sequential RAM computations by nearly a quadratic factor. They also show that probabilistic choice can be eliminated from parallel computations by introducing nonuniformity
Automatic Parallelization Tool: Classification of Program Code for Parallel Computing
Directory of Open Access Journals (Sweden)
Mustafa Basthikodi
2016-04-01
Full Text Available Performance growth of single-core processors has come to a halt in the past decade, but was re-enabled by the introduction of parallelism in processors. Multicore frameworks along with Graphical Processing Units empowered to enhance parallelism broadly. Couples of compilers are updated to developing challenges forsynchronization and threading issues. Appropriate program and algorithm classifications will have advantage to a great extent to the group of software engineers to get opportunities for effective parallelization. In present work we investigated current species for classification of algorithms, in that related work on classification is discussed along with the comparison of issues that challenges the classification. The set of algorithms are chosen which matches the structure with different issues and perform given task. We have tested these algorithms utilizing existing automatic species extraction toolsalong with Bones compiler. We have added functionalities to existing tool, providing a more detailed characterization. The contributions of our work include support for pointer arithmetic, conditional and incremental statements, user defined types, constants and mathematical functions. With this, we can retain significant data which is not captured by original speciesof algorithms. We executed new theories into the device, empowering automatic characterization of program code.
Resistor Combinations for Parallel Circuits.
McTernan, James P.
1978-01-01
To help simplify both teaching and learning of parallel circuits, a high school electricity/electronics teacher presents and illustrates the use of tables of values for parallel resistive circuits in which total resistances are whole numbers. (MF)
Parallelization methods study of thermal-hydraulics codes
International Nuclear Information System (INIS)
Gaudart, Catherine
2000-01-01
The variety of parallelization methods and machines leads to a wide selection for programmers. In this study we suggest, in an industrial context, some solutions from the experience acquired through different parallelization methods. The study is about several scientific codes which simulate a large variety of thermal-hydraulics phenomena. A bibliography on parallelization methods and a first analysis of the codes showed the difficulty of our process on the whole applications to study. Therefore, it would be necessary to identify and extract a representative part of these applications and parallelization methods. The linear solver part of the codes forced itself. On this particular part several parallelization methods had been used. From these developments one could estimate the necessary work for a non initiate programmer to parallelize his application, and the impact of the development constraints. The different methods of parallelization tested are the numerical library PETSc, the parallelizer PAF, the language HPF, the formalism PEI and the communications library MPI and PYM. In order to test several methods on different applications and to follow the constraint of minimization of the modifications in codes, a tool called SPS (Server of Parallel Solvers) had be developed. We propose to describe the different constraints about the optimization of codes in an industrial context, to present the solutions given by the tool SPS, to show the development of the linear solver part with the tested parallelization methods and lastly to compare the results against the imposed criteria. (author) [fr
Directory of Open Access Journals (Sweden)
Steinmetz Patrick RH
2010-12-01
Full Text Available Abstract Background The heads of annelids (earthworms, polychaetes, and others and arthropods (insects, myriapods, spiders, and others and the arthropod-related onychophorans (velvet worms show similar brain architecture and for this reason have long been considered homologous. However, this view is challenged by the 'new phylogeny' placing arthropods and annelids into distinct superphyla, Ecdysozoa and Lophotrochozoa, together with many other phyla lacking elaborate heads or brains. To compare the organisation of annelid and arthropod heads and brains at the molecular level, we investigated head regionalisation genes in various groups. Regionalisation genes subdivide developing animals into molecular regions and can be used to align head regions between remote animal phyla. Results We find that in the marine annelid Platynereis dumerilii, expression of the homeobox gene six3 defines the apical region of the larval body, peripherally overlapping the equatorial otx+ expression. The six3+ and otx+ regions thus define the developing head in anterior-to-posterior sequence. In another annelid, the earthworm Pristina, as well as in the onychophoran Euperipatoides, the centipede Strigamia and the insects Tribolium and Drosophila, a six3/optix+ region likewise demarcates the tip of the developing animal, followed by a more posterior otx/otd+ region. Identification of six3+ head neuroectoderm in Drosophila reveals that this region gives rise to median neurosecretory brain parts, as is also the case in annelids. In insects, onychophorans and Platynereis, the otx+ region instead harbours the eye anlagen, which thus occupy a more posterior position. Conclusions These observations indicate that the annelid, onychophoran and arthropod head develops from a conserved anterior-posterior sequence of six3+ and otx+ regions. The six3+ anterior pole of the arthropod head and brain accordingly lies in an anterior-median embryonic region and, in consequence, the optic
Simulation Exploration through Immersive Parallel Planes
Energy Technology Data Exchange (ETDEWEB)
Brunhart-Lupo, Nicholas J [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Bush, Brian W [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Gruchalla, Kenny M [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Smith, Steve [Los Alamos Visualization Associates
2017-05-25
We present a visualization-driven simulation system that tightly couples systems dynamics simulations with an immersive virtual environment to allow analysts to rapidly develop and test hypotheses in a high-dimensional parameter space. To accomplish this, we generalize the two-dimensional parallel-coordinates statistical graphic as an immersive 'parallel-planes' visualization for multivariate time series emitted by simulations running in parallel with the visualization. In contrast to traditional parallel coordinate's mapping the multivariate dimensions onto coordinate axes represented by a series of parallel lines, we map pairs of the multivariate dimensions onto a series of parallel rectangles. As in the case of parallel coordinates, each individual observation in the dataset is mapped to a polyline whose vertices coincide with its coordinate values. Regions of the rectangles can be 'brushed' to highlight and select observations of interest: a 'slider' control allows the user to filter the observations by their time coordinate. In an immersive virtual environment, users interact with the parallel planes using a joystick that can select regions on the planes, manipulate selection, and filter time. The brushing and selection actions are used to both explore existing data as well as to launch additional simulations corresponding to the visually selected portions of the input parameter space. As soon as the new simulations complete, their resulting observations are displayed in the virtual environment. This tight feedback loop between simulation and immersive analytics accelerates users' realization of insights about the simulation and its output.
Massively Parallel Finite Element Programming
Heister, Timo; Kronbichler, Martin; Bangerth, Wolfgang
2010-01-01
Today's large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.
Massively Parallel Finite Element Programming
Heister, Timo
2010-01-01
Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.
Collectively loading an application in a parallel computer
Aho, Michael E.; Attinella, John E.; Gooding, Thomas M.; Miller, Samuel J.; Mundy, Michael B.
2016-01-05
Collectively loading an application in a parallel computer, the parallel computer comprising a plurality of compute nodes, including: identifying, by a parallel computer control system, a subset of compute nodes in the parallel computer to execute a job; selecting, by the parallel computer control system, one of the subset of compute nodes in the parallel computer as a job leader compute node; retrieving, by the job leader compute node from computer memory, an application for executing the job; and broadcasting, by the job leader to the subset of compute nodes in the parallel computer, the application for executing the job.
Productive Parallel Programming: The PCN Approach
Directory of Open Access Journals (Sweden)
Ian Foster
1992-01-01
Full Text Available We describe the PCN programming system, focusing on those features designed to improve the productivity of scientists and engineers using parallel supercomputers. These features include a simple notation for the concise specification of concurrent algorithms, the ability to incorporate existing Fortran and C code into parallel applications, facilities for reusing parallel program components, a portable toolkit that allows applications to be developed on a workstation or small parallel computer and run unchanged on supercomputers, and integrated debugging and performance analysis tools. We survey representative scientific applications and identify problem classes for which PCN has proved particularly useful.
Glaese, John R.; Tobbe, Patrick A.
1986-01-01
The Space Station Mechanism Test Bed consists of a hydraulically driven, computer controlled six degree of freedom (DOF) motion system with which docking, berthing, and other mechanisms can be evaluated. Measured contact forces and moments are provided to the simulation host computer to enable representation of orbital contact dynamics. This report describes the development of a generalized math model which represents the relative motion between two rigid orbiting vehicles. The model allows motion in six DOF for each body, with no vehicle size limitation. The rotational and translational equations of motion are derived. The method used to transform the forces and moments from the sensor location to the vehicles' centers of mass is also explained. Two math models of docking mechanisms, a simple translational spring and the Remote Manipulator System end effector, are presented along with simulation results. The translational spring model is used in an attempt to verify the simulation with compensated hardware in the loop results.
Parallel-In-Time For Moving Meshes
Energy Technology Data Exchange (ETDEWEB)
Falgout, R. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Manteuffel, T. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Southworth, B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Schroder, J. B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-02-04
With steadily growing computational resources available, scientists must develop e ective ways to utilize the increased resources. High performance, highly parallel software has be- come a standard. However until recent years parallelism has focused primarily on the spatial domain. When solving a space-time partial di erential equation (PDE), this leads to a sequential bottleneck in the temporal dimension, particularly when taking a large number of time steps. The XBraid parallel-in-time library was developed as a practical way to add temporal parallelism to existing se- quential codes with only minor modi cations. In this work, a rezoning-type moving mesh is applied to a di usion problem and formulated in a parallel-in-time framework. Tests and scaling studies are run using XBraid and demonstrate excellent results for the simple model problem considered herein.
Integrated Task And Data Parallel Programming: Language Design
Grimshaw, Andrew S.; West, Emily A.
1998-01-01
his research investigates the combination of task and data parallel language constructs within a single programming language. There are an number of applications that exhibit properties which would be well served by such an integrated language. Examples include global climate models, aircraft design problems, and multidisciplinary design optimization problems. Our approach incorporates data parallel language constructs into an existing, object oriented, task parallel language. The language will support creation and manipulation of parallel classes and objects of both types (task parallel and data parallel). Ultimately, the language will allow data parallel and task parallel classes to be used either as building blocks or managers of parallel objects of either type, thus allowing the development of single and multi-paradigm parallel applications. 1995 Research Accomplishments In February I presented a paper at Frontiers '95 describing the design of the data parallel language subset. During the spring I wrote and defended my dissertation proposal. Since that time I have developed a runtime model for the language subset. I have begun implementing the model and hand-coding simple examples which demonstrate the language subset. I have identified an astrophysical fluid flow application which will validate the data parallel language subset. 1996 Research Agenda Milestones for the coming year include implementing a significant portion of the data parallel language subset over the Legion system. Using simple hand-coded methods, I plan to demonstrate (1) concurrent task and data parallel objects and (2) task parallel objects managing both task and data parallel objects. My next steps will focus on constructing a compiler and implementing the fluid flow application with the language. Concurrently, I will conduct a search for a real-world application exhibiting both task and data parallelism within the same program m. Additional 1995 Activities During the fall I collaborated
Performance of the Galley Parallel File System
Nieuwejaar, Nils; Kotz, David
1996-01-01
As the input/output (I/O) needs of parallel scientific applications increase, file systems for multiprocessors are being designed to provide applications with parallel access to multiple disks. Many parallel file systems present applications with a conventional Unix-like interface that allows the application to access multiple disks transparently. This interface conceals the parallism within the file system, which increases the ease of programmability, but makes it difficult or impossible for sophisticated programmers and libraries to use knowledge about their I/O needs to exploit that parallelism. Furthermore, most current parallel file systems are optimized for a different workload than they are being asked to support. We introduce Galley, a new parallel file system that is intended to efficiently support realistic parallel workloads. Initial experiments, reported in this paper, indicate that Galley is capable of providing high-performance 1/O to applications the applications that rely on them. In Section 3 we describe that access data in patterns that have been observed to be common.
Aerodynamic Drag Analysis of 3-DOF Flex-Gimbal GyroWheel System in the Sense of Ground Test
Huo, Xin; Feng, Sizhao; Liu, Kangzhi; Wang, Libin; Chen, Weishan
2016-01-01
GyroWheel is an innovative device that combines the actuating capabilities of a control moment gyro with the rate sensing capabilities of a tuned rotor gyro by using a spinning flex-gimbal system. However, in the process of the ground test, the existence of aerodynamic disturbance is inevitable, which hinders the improvement of the specification performance and control accuracy. A vacuum tank test is a possible candidate but is sometimes unrealistic due to the substantial increase in costs and complexity involved. In this paper, the aerodynamic drag problem with respect to the 3-DOF flex-gimbal GyroWheel system is investigated by simulation analysis and experimental verification. Concretely, the angular momentum envelope property of the spinning rotor system is studied and its integral dynamical model is deduced based on the physical configuration of the GyroWheel system with an appropriately defined coordinate system. In the sequel, the fluid numerical model is established and the model geometries are checked with FLUENT software. According to the diversity and time-varying properties of the rotor motions in three-dimensions, the airflow field around the GyroWheel rotor is analyzed by simulation with respect to its varying angular velocity and tilt angle. The IPC-based experimental platform is introduced, and the properties of aerodynamic drag in the ground test condition are obtained through comparing the simulation with experimental results. PMID:27941602
Directory of Open Access Journals (Sweden)
Yufeng Zhuang
2015-01-01
Full Text Available This paper presents a unified singularity modeling and reconfiguration analysis of variable topologies of a class of metamorphic parallel mechanisms with parallel constraint screws. The new parallel mechanisms consist of three reconfigurable rTPS limbs that have two working phases stemming from the reconfigurable Hooke (rT joint. While one phase has full mobility, the other supplies a constraint force to the platform. Based on these, the platform constraint screw systems show that the new metamorphic parallel mechanisms have four topologies by altering the limb phases with mobility change among 1R2T (one rotation with two translations, 2R2T, and 3R2T and mobility 6. Geometric conditions of the mechanism design are investigated with some special topologies illustrated considering the limb arrangement. Following this and the actuation scheme analysis, a unified Jacobian matrix is formed using screw theory to include the change between geometric constraints and actuation constraints in the topology reconfiguration. Various singular configurations are identified by analyzing screw dependency in the Jacobian matrix. The work in this paper provides basis for singularity-free workspace analysis and optimal design of the class of metamorphic parallel mechanisms with parallel constraint screws which shows simple geometric constraints with potential simple kinematics and dynamics properties.
Directory of Open Access Journals (Sweden)
A. L. Lapikov
2014-01-01
Full Text Available The article is aimed at creating techniques to study multi-sectional manipulators with parallel structure. To solve this task the analysis in the field concerned was carried out to reveal both advantages and drawbacks of such executive mechanisms and main problems to be encountered in the course of research. The work shows that it is inefficient to create complete mathematical models of multisectional manipulators, which in the context of solving a direct kinematic problem are to derive a functional dependence of location and orientation of the end effector on all the generalized coordinates of the mechanism. The structure of multisectional manipulators was considered, where the sections are platform manipulators of parallel kinematics with six degrees of freedom. The paper offers an algorithm to define location and orientation of the end effector of the manipulator by means of iterative solution of analytical equation of the moving platform plane for each section. The equation for the unknown plane is derived using three points, which are attachment points of the moving platform joints. To define the values of joint coordinates a system of nine non-linear equations is completed. It is necessary to mention that for completion of the equation system are used the equations with the same type of non-linearity. The physical sense of all nine equations of the system is Euclidean distance between the points of the manipulator. The result of algorithm execution is a matrix of homogenous transformation for each section. The correlations describing transformations between adjoining sections of the manipulator are given. An example of the mechanism consisting of three sections is examined. The comparison of theoretical calculations with results obtained on a 3D-prototype is made. The next step of the work is to conduct research activities both in the field of dynamics of platform parallel kinematics manipulators with six degrees of freedom and in the
Murphy, Mark; Alley, Marcus; Demmel, James; Keutzer, Kurt; Vasanawala, Shreyas; Lustig, Michael
2012-01-01
We present ℓ1-SPIRiT, a simple algorithm for auto calibrating parallel imaging (acPI) and compressed sensing (CS) that permits an efficient implementation with clinically-feasible runtimes. We propose a CS objective function that minimizes cross-channel joint sparsity in the Wavelet domain. Our reconstruction minimizes this objective via iterative soft-thresholding, and integrates naturally with iterative Self-Consistent Parallel Imaging (SPIRiT). Like many iterative MRI reconstructions, ℓ1-SPIRiT’s image quality comes at a high computational cost. Excessively long runtimes are a barrier to the clinical use of any reconstruction approach, and thus we discuss our approach to efficiently parallelizing ℓ1-SPIRiT and to achieving clinically-feasible runtimes. We present parallelizations of ℓ1-SPIRiT for both multi-GPU systems and multi-core CPUs, and discuss the software optimization and parallelization decisions made in our implementation. The performance of these alternatives depends on the processor architecture, the size of the image matrix, and the number of parallel imaging channels. Fundamentally, achieving fast runtime requires the correct trade-off between cache usage and parallelization overheads. We demonstrate image quality via a case from our clinical experimentation, using a custom 3DFT Spoiled Gradient Echo (SPGR) sequence with up to 8× acceleration via poisson-disc undersampling in the two phase-encoded directions. PMID:22345529
International Nuclear Information System (INIS)
Barletta, A.
2008-01-01
The necessary condition for the onset of parallel flow in the fully developed region of an inclined duct is applied to the case of a circular tube. Parallel flow in inclined ducts is an uncommon regime, since in most cases buoyancy tends to produce the onset of secondary flow. The present study shows how proper thermal boundary conditions may preserve parallel flow regime. Mixed convection flow is studied for a special non-axisymmetric thermal boundary condition that, with a proper choice of a switch parameter, may be compatible with parallel flow. More precisely, a circumferentially variable heat flux distribution is prescribed on the tube wall, expressed as a sinusoidal function of the azimuthal coordinate θ with period 2π. A π/2 rotation in the position of the maximum heat flux, achieved by setting the switch parameter, may allow or not the existence of parallel flow. Two cases are considered corresponding to parallel and non-parallel flow. In the first case, the governing balance equations allow a simple analytical solution. On the contrary, in the second case, the local balance equations are solved numerically by employing a finite element method
Parallel programming with Easy Java Simulations
Esquembre, F.; Christian, W.; Belloni, M.
2018-01-01
Nearly all of today's processors are multicore, and ideally programming and algorithm development utilizing the entire processor should be introduced early in the computational physics curriculum. Parallel programming is often not introduced because it requires a new programming environment and uses constructs that are unfamiliar to many teachers. We describe how we decrease the barrier to parallel programming by using a java-based programming environment to treat problems in the usual undergraduate curriculum. We use the easy java simulations programming and authoring tool to create the program's graphical user interface together with objects based on those developed by Kaminsky [Building Parallel Programs (Course Technology, Boston, 2010)] to handle common parallel programming tasks. Shared-memory parallel implementations of physics problems, such as time evolution of the Schrödinger equation, are available as source code and as ready-to-run programs from the AAPT-ComPADRE digital library.
Hsu, Liang-Yan; Wu, Ning; Rabitz, Herschel
2016-11-30
We investigate electron transport through series and parallel intramolecular circuits in the framework of the multi-level Redfield theory. Based on the assumption of weak monomer-bath couplings, the simulations depict the length and temperature dependence in six types of intramolecular circuits. In the tunneling regime, we find that the intramolecular circuit rule is only valid in the weak monomer coupling limit. In the thermally activated hopping regime, for circuits based on two different molecular units M a and M b with distinct activation energies E act,a > E act,b , the activation energies of M a and M b in series are nearly the same as E act,a while those in parallel are nearly the same as E act,b . This study gives a comprehensive description of electron transport through intramolecular circuits from tunneling to thermally activated hopping. We hope that this work can motivate additional studies to design intramolecular circuits based on different types of building blocks, and to explore the corresponding circuit laws and the length and temperature dependence of conductance.
Parallelism and Scalability in an Image Processing Application
DEFF Research Database (Denmark)
Rasmussen, Morten Sleth; Stuart, Matthias Bo; Karlsson, Sven
2008-01-01
parallel programs. This paper investigates parallelism and scalability of an embedded image processing application. The major challenges faced when parallelizing the application were to extract enough parallelism from the application and to reduce load imbalance. The application has limited immediately......The recent trends in processor architecture show that parallel processing is moving into new areas of computing in the form of many-core desktop processors and multi-processor system-on-chip. This means that parallel processing is required in application areas that traditionally have not used...
Parallelism and Scalability in an Image Processing Application
DEFF Research Database (Denmark)
Rasmussen, Morten Sleth; Stuart, Matthias Bo; Karlsson, Sven
2009-01-01
parallel programs. This paper investigates parallelism and scalability of an embedded image processing application. The major challenges faced when parallelizing the application were to extract enough parallelism from the application and to reduce load imbalance. The application has limited immediately......The recent trends in processor architecture show that parallel processing is moving into new areas of computing in the form of many-core desktop processors and multi-processor system-on-chips. This means that parallel processing is required in application areas that traditionally have not used...