WorldWideScience

Sample records for situs inversus totalis

  1. Laparoscopic cholecystectomy technique in a patient with situs inversus totalis

    Directory of Open Access Journals (Sweden)

    İbrahim Aydın

    2013-01-01

    Full Text Available Situs inversus totalis is a rare congenital anomaly. It mayproduce difficulties in diagnosis and therapeutic managementof abdominal pathology, particularly in laparoscopicsurgery because of the mirror-image anatomy. Here wereport a case of situs inversus totalis and cholelithiasissuccessfully treated laparoscopically.Key words: Situs inversus totalis, cholelithiasis, laparoscopiccholecystectomy

  2. SITUS INVERSUS TOTALIS. REPORTE DE UN CASO

    Directory of Open Access Journals (Sweden)

    Manuel Brito Velásquez

    2014-12-01

    Full Text Available Caso clínico: Paciente femenino de 9 años quien acude a la emergencia por presentar episodios eméticos, a la cual se le diagnosticó un Situs Inversus Totalis de forma casual. Motivo de reporte: El Situs Inversus Totalis es una anomalía congénita del desarrollo embrionario, caracterizada por disfunción del establecimiento del eje derecha-izquierda con la consecuente inversión en espejo de todos los órganos torácicos y abdominales. Solo un 5 a 10 % presentan malformaciones cardio- vasculares congénitas que debutan clínicamente con síntomas asociados a estas alteraciones, mientras el resto permanecen de forma subclínica. Conclusión: Es una condición muy rara, con muy pocos reportes en la literatura. En algunas ocasiones puede pasar desapercibida al no presentar manifestaciones clínicas. Palabras Clave: Situs Inversus, Anomalías Congénitas, Anomalías Cardiovasculares,  Dextrocardia.

  3. Mediastinal Cystic Lymphangioma in a Patient with Situs Inversus Totalis

    Directory of Open Access Journals (Sweden)

    Teruya Komatsu

    2014-01-01

    Full Text Available We present a case of cystic lymphangioma of the mediastinum complicated with situs inversus totalis. The 70-year-old man underwent thoracoscopic resection of a mediastinal cystic tumor, which was diagnosed as cystic lymphangioma. Cystic lymphangiomas are congenital cystic abnormalities of the lymphatic system. The head and neck area is often involved while the mediastinum is rarely affected. The rarity of this case is further attributed to the coexistence of situs inversus totalis.

  4. Coexisting Situs Inversus Totalis and Immune Thrombocytopenic Purpura.

    Science.gov (United States)

    Gundogdu, Kemal; Altintoprak, Fatih; Uzunoğlu, Mustafa Yener; Dikicier, Enis; Zengin, İsmail; Yağmurkaya, Orhan

    2016-01-01

    Situs inversus totalis is a rare congenital abnormality with mirror symmetry of mediastinal and abdominal organs. Immune thrombocytopenic purpura is an autoimmune disease with destruction of thrombocytes. This paper is presentation of surgical approach to a case with coexistence of these two conditions.

  5. Coexisting Situs Inversus Totalis and Immune Thrombocytopenic Purpura

    Directory of Open Access Journals (Sweden)

    Kemal Gundogdu

    2016-01-01

    Full Text Available Situs inversus totalis is a rare congenital abnormality with mirror symmetry of mediastinal and abdominal organs. Immune thrombocytopenic purpura is an autoimmune disease with destruction of thrombocytes. This paper is presentation of surgical approach to a case with coexistence of these two conditions.

  6. Situs inversus totalis with carcinoma of gastric cardia: a case report

    Directory of Open Access Journals (Sweden)

    Ke Pan

    2012-12-01

    Full Text Available Abstract Situs inversus is an uncommon anomaly with rare incidence. Some cases of situs inversus totalis have been described with different types of associations. Here we report a case of situs inversus with carcinoma of the gastric cardia.

  7. Myocardial revascularization in patient with situs inversus totalis: case report

    Directory of Open Access Journals (Sweden)

    Soncini da Rosa George Ronald

    2002-01-01

    Full Text Available This is a report of an unusual case of a patient, with dextrocardia and a "situs inversus totalis". She presented angina pectoris during an ECG stress test. The coronary arteriography revealed severe obstruction in the main left coronary artery. The patient underwent coronary artery bypass grafting surgery. We did not find a similar case in the national medical literature. The myocardial revascularization performed utilizing the right mammary artery for anterior descending artery and saphenous vein grafts for first diagonal branch and first marginal branch.

  8. Blunt splenic injury in a child with situs inversus totalis treated with transcatheter arterial embolization

    Directory of Open Access Journals (Sweden)

    Naoki Hashizume

    2016-10-01

    Full Text Available We report the first case of blunt splenic rupture in a child with situs inversus totalis treated with transcatheter arterial embolization (TAE. A 12-year-old girl fell roughly 4 feet onto the pavement while riding her bicycle. Contrast-enhanced computed tomography revealed situs inversus totalis, a massive hemorrhage in the abdominal cavity, and a ruptured spleen with extravasation. Arteriography showed that the internal organs were located opposite their normal positioning. TAE was carried out with gelfoam and a micro coils at the branch of the upper lobe of the splenic artery. TAE is effective for blunt splenic injury with extravasation in a child with situs inversus. In TAE, there is no technical difference about situs inversus excepted mirror image of abdominal vascular formation.

  9. Technical difficulties and its remedies in laparoscopic cholecystectomy in situs inversus totalis: A rare case report.

    Science.gov (United States)

    Arya, S V; Das, Anupam; Singh, Sunil; Kalwaniya, Dheer Singh; Sharma, Ashok; Thukral, B B

    2013-01-01

    Laparoscopic cholecystectomy is considered to be the gold standard surgical procedure for cholelithiasis and is one of the commonest surgical procedures in the world today. However, in rare cases of previously undiagnosed situs inversus totalis (with dextrocardia), the presentation of the cholecystitis, its diagnosis and the operative procedure can pose problems. We present here one such case and discuss how the diagnosis was made and difficulties encountered during surgery and how they were coped with. A 35 year old female presented with left hypochondrium pain and dyspepsia, for 2 years. A diagnosis of cholelithiasis with situs inversus was confirmed after thorough clinical examination, abdominal and chest X-rays and ultrasonography of the abdomen. Laparoscopic cholecystectomy, which is the standard treatment, was performed with numerous modifications in the positioning of the monitor, insufflator, ports and the position of the members of the surgical team and the laparoscopic instruments. The patient had an uneventful recovery. Situs inversus totalis is itself a rare condition and when associated with cholelithiasis poses a challenge in the management of the condition. We must appreciate the necessity of setting up the operating theatre, the positioning of the ports, the surgical team and the instruments. Therefore, it becomes important for the right handed surgeons to modify their techniques and establish a proper hand eye coordination to adapt to the mirror image anatomy of the Calot's triangle in a patient of situs inversus totalis. Copyright © 2013 Surgical Associates Ltd. Published by Elsevier Ltd. All rights reserved.

  10. Situs inversus totalis associated with subaortic stenosis, restrictive ventricular septal defect, and tricuspid dysplasia in an adult dog

    OpenAIRE

    Piantedosi, Diego; Cortese, Laura; Meomartino, Leonardo; Di Loria, Antonio; Ciaramella, Paolo

    2011-01-01

    A rare association between situs inversus totalis (SIT), restrictive ventricular septal defect, severe subaortic stenosis, and tricuspid dysplasia was observed in an adult mixed-breed dog. Primary ciliary dyskinesia and Kartagener’s syndrome were excluded. After 15 mo the dog died suddenly. The association between SIT and congenital heart diseases is discussed.

  11. Situs inversus totalis associated with subaortic stenosis, restrictive ventricular septal defect, and tricuspid dysplasia in an adult dog.

    Science.gov (United States)

    Piantedosi, Diego; Cortese, Laura; Meomartino, Leonardo; Di Loria, Antonio; Ciaramella, Paolo

    2011-11-01

    A rare association between situs inversus totalis (SIT), restrictive ventricular septal defect, severe subaortic stenosis, and tricuspid dysplasia was observed in an adult mixed-breed dog. Primary ciliary dyskinesia and Kartagener's syndrome were excluded. After 15 mo the dog died suddenly. The association between SIT and congenital heart diseases is discussed.

  12. Angiographic Embolization of a Postpartum Vulvovaginal Hematoma in a Patient with Situs Inversus Totalis: An Effective Second-Line Treatment

    Directory of Open Access Journals (Sweden)

    Elias M. Dahdouh

    2013-01-01

    Full Text Available Situs inversus totalis is a rare congenital anomaly where asymmetrical positioning of internal organs may affect the surgical and radiological management of certain conditions. Vulvovaginal hematoma is a life-threatening complication of vaginal delivery whose primary treatment usually consists of incision and drainage of the hematoma and ligation of the responsible vessels, followed by wound packing. Failure of these measures to control the bleeding was previously considered as an indication for laparotomy to perform bilateral hypogastric artery ligation and, if needed, a hysterectomy. Relative to major abdominal surgery, selective percutaneous angiographic embolization offers considerable advantages and significant less morbidity. Indeed, angiographic embolization is routinely used as a measure to control refractory pelvic bleeding, though the literature and experience in women with situs inversus totalis are scarce. In this paper, we report a case of postpartum vulvovaginal hematoma in a patient with situs inversus, refractory to conventional treatment, where arteriographic embolization was successfully used to control the bleeding. The management of this obstetrical complication and the use of this minimally invasive technique are also reviewed. To the best of our knowledge, this is the first report in the literature describing the feasibility of this technique in a patient with situs inversus totalis.

  13. Laparoscopic Nissen fundoplication in situs inversus totalis: Technical and ergonomic issues

    Directory of Open Access Journals (Sweden)

    Khandelwal Radha

    2010-01-01

    Full Text Available We report a laparoscopic Nissen fundoplication for gastroesophageal reflux disease (GERD in a patient with situs inversus totalis (SIT. A 34-year-old man was diagnosed with SIT on performing chest X-ray and abdominal sonography as a routine preoperative investigations. He presented with chronic gastro-esophageal reflux disease (GERD inadequately controlled by medications. The laparoscopic procedure was performed using five ports placed in a mirror-image configuration and with the patient in the modified lithotomy position. Few technical difficulties were encountered during the operation. The position of the primary surgeon, working between the lower limbs of the patient as in case of standard fundoplication, was considered most prudent position to the success of this case. In SIT, this position provides the least visual disorientation from the reversed abdominal organs. We recommend that preoperative detection of SIT is essential to understand the symptomatology of the patient and for planning of any upper abdominal laparoscopic procedure.

  14. Surgical treatment of choledocholithiasis in a patient with situs inversus totalis: a case report and literature review

    Directory of Open Access Journals (Sweden)

    Jerson Francisco Morales-Rodríguez

    2017-07-01

    Full Text Available Resumen El situs inversus totalis es una rara condición en la que existe trasposición de los órganos torácicos abdominales. Esta situación da lugar a dificultades diagnósticas y terapéuticas en pacientes con cuadros de abdomen agudo quirúrgico. El objetivo de este reporte es dar cuenta del caso de un paciente que presentó con dolor de tipo cólico en epigastrio e hipocondrio izquierdo. Luego de los estudios imagenológicos del caso, el paciente fue diagnosticado como situs inversus totalis, con colelitiasis y coledocolitiasis. El tratamiento fue realizado mediante una colangiopancreatografía retrograda endoscópica y posterior exploración quirúrgica de vías biliares. Ambos procedimientos fueron fallidos, debido a dificultades técnicas generadas por la condición del paciente. En conclusión, pese al reporte de casos exitosos en la literatura de colangiopancreatografía retrograda endoscópica y tratamiento quirúrgico de la vía biliar en situs inversus totalis, pueden existir situaciones que no permitan un abordaje exitoso. Es por ello que una planificación quirúrgica meticulosa y el uso de métodos de apoyo son necesarios en el manejo de estos pacientes.

  15. Congenital duodenal obstruction with situs inversus totalis: Report of a rare association and discussion

    Directory of Open Access Journals (Sweden)

    Sharma Satendra

    2008-01-01

    Full Text Available This report is to present and discuss an extremely rare association of situs inversus with duodenal atresia in an 11-day-old male neonate born full term and weighing 1.9 kg. The baby presented with recurrent bilious vomiting. Babygram revealed situs inversus and duodenal obstruction. Echocardiography showed dextrocardia with a small ASD. Exploration confirmed a duodenal diaphragm with a central perforation between the third and fourth part of the duodenum and situs inversus. The literature search revealed 20 cases reported so far.

  16. Double primary malignancies associated with colon cancer in patients with situs inversus totalis: two case reports

    Directory of Open Access Journals (Sweden)

    Kim Dae

    2011-09-01

    Full Text Available Abstract Situs inversus totalis (SIT is not itself a premalignant condition, however, rare synchronous or metachronous multiple primary malignancies have been reported. Herein we present a case of synchronous transverse and sigmoid colon cancers and a case of metachronous rectosigmoid colon and gastric cancers in patients with SIT. A 66-year-old male with SIT was referred for a two-month history of hematochezia. Synchronous colonic tumors were found on the proximal transverse and sigmoid colon. The patient underwent open total colectomy and was discharged without incident. A 71-year-old female with rectosigmoid colon cancer and SIT underwent laparoscopy-assisted low anterior resection. Fourteen months after the surgery, the patient developed a single hepatic metastasis and underwent hepatic segmentectomy (S6. Forty-six months after laparoscopy-assisted low anterior resection, the patient developed metachronous early gastric cancer on the antrum and underwent radical subtotal gastrectomy with gastroduodenostomy. The patient is doing well without recurrence for 28 months.

  17. [Surgical treatment of choledocholithiasis in a patient with situs inversus totalis: a case report and literature review].

    Science.gov (United States)

    Morales-Rodríguez, Jerson Francisco; Corina Cotillo, Estefania; Moreno-Loaiza, Oscar

    2017-07-26

    Situs inversus totalis (SIT) is a rare condition, in which there is transposition of the thoraco-abdominal organs. This situation leads to diagnostic and therapeutic difficulties in patients with acute surgical abdomen. The objective of this report is to present the case of a patient who presented with colonic pain in the epigastrium and left hypochondrium, in which the diagnosis of SIT, cholelithiasis and choledocholithiasis was reached after the respective imaging studies. Once the diagnosis was made, treatment was performed through retrograde endoscopic cholangiopancreatography (ERCP) and subsequent surgical exploration of bile ducts. Both procedures were failed due to technical difficulties generated by the patient's condition. In conclusion, in spite of the report of successful cases in the literature of ERCP and surgical treatment of the biliary tract in SIT, there may be situations that do not allow a successful approach, so meticulous surgical planning and the use of support methods are necessary In the management of these patients.

  18. Caudal dysgenesis, sirenomelia, and situs inversus totalis: a primitive defect in blastogenesis.

    Science.gov (United States)

    Rougemont, Anne-Laure; Bouron-Dal Soglio, Dorothée; Désilets, Valérie; Jovanovic, Mubina; Perreault, Gilles; Laurier Oligny, Luc; Fournet, Jean-Christophe

    2008-06-01

    Caudal dysgenesis (CD) constitutes a heterogeneous spectrum of congenital caudal anomalies, including varying degrees of agenesis of the vertebral column, as well as anorectal and genitourinary anomalies. Sirenomelia, characterized by a fusion of the lower limbs, could represent the most severe end of this spectrum. The two main debated pathogenic hypotheses are an aberrant vascular supply versus a primary axial mesoderm defect. We present the autopsy findings of two fetuses of non-diabetic mothers, with normal karyotype. Both fetuses presented situs inversus associated with a CD, in one case consisting of sirenomelia, establishing a very rare association profile that might be random. This association also suggests the occurrence of a common pathogenic mechanism, in accordance to recent genetic data, such as displayed in the Kif3A murine mutation phenotype. Some cases of sirenomelia and CD could represent developmental field defects of blastogenesis involving the caudal mesoderm, rather than being related to vascular insufficiency.

  19. Specificities of transplantation of kidneys procured from donors with situs inversus totalis: A case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Petrović Milica

    2015-01-01

    Full Text Available Introduction. Situs inversus totalis (SIT represents a total vertical transposition of the thoracic and abdominal organs which are arranged in a mirror image reversal of the normal positioning 1. We presented a successful pre-dialysis kidney transplantation from a living sibling donor with SIT and the longest donor follow-up period, along with analysis of the reviewed literature. Case report. The pair for pre-dialysis kidney transplantation included a 68-year-old mother and 34-year-old daughter at low immunological risk. Comorbidities evidenced in kidney donors with previously diagnosed SIT, included moderate arterial hypertension and borderline blood glucose level. Explantation of the left donor kidney and its placement into the right iliac fossa of the recipient were performed in the course of the surgical procedure. A month after nephrectomy, second degree renal failure was noticed in the donor. A 20-month follow-up of the donor’s kidney and graft in the recipient proved that their functions were excellent. Conclusion. In donors with previously diagnosed SIT the multidisciplinary approach, preoperative evaluation of the patient and detection of possible vascular anomalies are required to provide maximum safety for the donor.

  20. Situs Inversus Totalis y Cardiopatía congénita: Diagnóstico casual en un lactante con neumonía

    Directory of Open Access Journals (Sweden)

    Hebel Oziel Urquia Osorio

    2012-02-01

    Full Text Available El Situs Inversus Totalis es una rara entidad que se caracteriza por la imagen en espejo de las vísceras torácicas y abdominales con respecto al plano sagital, cuya prevalencia se estima de 1-2/10,000 nacidos vivos, de los cuales solo el 1-10% presentan malformaciones cardiovasculares congénitas asociadas. Presentamos el caso de un lactante de sexo masculino de 11 meses de edad, que fue atendido en el ¨Hospital Materno Infantil¨ ubicado en la ciudad de Tegucigalpa, Honduras, por presentar tos seca, cianotizante no emetizante de 1 mes de evolución, exacerbada en los últimos 4 días y acompañada de dificultad respiratoria con periodos de apnea, fiebre subjetivamente alta, tiraje subcostal, taquipnea y crépitos basales bilaterales. La realización de una radiografía de tórax reveló: dextrocardia, bazo y cámara gástrica lateralizados hacia la derecha e hígado hacia la izquierda. Se decide realizar una ecocardiografía y un ultrasonido abdominal para verificar el hallazgo, reportando: situs inversus, dextrocardia, agenesia de la vena cava inferior, defecto interventricular de entrada (tipo canal, ductos arterioso, vasos transpuestos, bazo en cuadrante superior derecho e hígado localizado en cuadrante superior izquierdo. El diagnostico de esta condición pasa desapercibido en la mayoría de los casos, por esta razón debemos incentivar la práctica de un examen físico minucioso, evitando así la dependencia de los hallazgos fortuitos e incidentales. Palabras Claves: Situs Inversus, Cardiopatía Congénita, Dextrocardia.

  1. Off-pump myocardial revascularisation in an octogenarian patient with dextrocardia and situs inversus.

    Science.gov (United States)

    Ennker, I C; Pietrowski, D; Ennker, J

    2006-01-01

    Dextrocardia associated with situs inversus totalis is a rare condition and there are few reports of myocardial revascularisation in such patients. An 82-year-old woman with dextrocardia and situs inversus totalis underwent successful off-pump coronary artery bypass grafting using internal mammary arteries. The operative technique was similar to that of off-pump coronary artery bypass grafting for situs solitus. However, for a right-handed surgeon the operation was easier standing on the left side of the patient.

  2. Dextrocardia and Situs inversus in a dog

    Directory of Open Access Journals (Sweden)

    G L G Almeida

    2012-12-01

    Full Text Available Aim: The aim of this study was to report a case of dextrocardia with Situs inversus totalis. Case History and Observation: A nine-year-old male Cocker Spaniels dog was referred for cardiologic evaluation due to non-productive cough. Thoracic radiography and ultrasound examination showed the reversed position not only of the heart but also of the abdominal organs such as liver and gallbladder, stomach, spleen, aorta and caudal vena cava. Except dextrocardia itself, the echocardiogram was normal. On the electrocardiogram the P-QRST waves were inverted in lead D1. On the base of these results, the case was diagnosed as dextrocardia and Situs inversus totalis. Discussion: Dextrocardia and Situs inversus (DSI is a rare congenital anomaly characterized by mirror-image of the normal anatomic arrangement of all internal organs. In dogs, the majority of reported cases were associated with Kartagener's syndrome (KS, but our patient had no evidences of this cilliary disorder.. Besides radiography and ultrasound examination, the ECG can be of great value to diagnose DSI as demonstrated in this report. [Vet. World 2012; 5(6.000: 369-372

  3. Chondroblastoma of rib in situs inversus

    Directory of Open Access Journals (Sweden)

    Purwa R Patil

    2014-01-01

    Full Text Available Chondroblastoma is a rare benign cartilaginous tumour accounting for approximately 1% of all bone tumours. It commonly arises from epiphysis of a long bone, particularly the humerus, tibia and femur. Rib is an extremely rare site for this tumour with a few cases reported in the literature. It is commonly seen in children and adults between the ages of 10 - 20 years. Although roentgenographic findings are quite common characteristic of this tumour, it can sometimes be misdiagnosed as giant cell tumour, osteogenic sarcoma and myeloma on histopathology. We report a 26-year-old male patient with situs inversus and chondroblastoma of rib. To the best of our knowledge, this is the first case of chondroblastoma of the rib in a patient of situs inversus. Segmental resection is the treatment of choice. It usually behaves in a benign fashion, but few cases have shown local recurrences and distant metastasis; hence, follow-up of the patient is essential.

  4. Laparoscopic management of acute appendicitis in situs inversus

    Directory of Open Access Journals (Sweden)

    Golash Vishwanath

    2006-01-01

    Full Text Available Situs inversus is often detected incidentally in adults during imaging for a acute surgical emergency. We present a case of acute appendicitis in an adult who was previously unaware about his situs anomaly. A laparoscopic approach is helpful to deal with this condition. A 40 year old man was admitted with history of acute left lower abdominal pain, with uncontrolled diabetic keto-acidosis. Clinically, he was diagnosed as acute diverticulitis with localized peritonitis. Subsequent imaging studies and laparoscopy confirmed the diagnosis of situs inversus and acute left- sided appendicitis. He successfully underwent laparoscopic appendectomy. His postoperative recovery was uneventful. Although technically more challenging because of the reverse laparoscopic view of the anatomy, the laparoscopic diagnosis and management of acute appendicitis is indicated in situs inversus.

  5. Sydenham Chorea in a Girl with Dextrocardia and Situs Inversus

    Directory of Open Access Journals (Sweden)

    Alireza Vakilian

    2017-06-01

    Full Text Available Sydenham Chorea (SC is a childhood disease that most frequently occurs after infection with group A β-hemolytic streptococcus species. SC is the most commonly acquired childhood chorea, usually affecting 5 to 15-year-old children. Dextrocardia situs inversus refers to the heart being situated on the right side of the body. We found a case of SC with coexisting dextrocardia and situs inversus, which is rare to our knowledge. A 14-year-old girl was referred to Ali-Ibn-Abiltaleb Hospital due to choreoathetotic movements more in her upper than lower extremities, which impaired her usual function. Antistreptolysin O (ASO titer was high. Her throat culture was positive for streptococci beta hemolytic. In cardiac study, moderate mitral regurgitation, tricuspid regurgitation, diastolic dysfunction, conus in the Right Ventricle Outlet (RVOT, rightsided aortic arch, dextrocardia, and situs inversus were reported. This was a rare case with SC that had such anomalies.

  6. Acute appendicitis in situs inversus- a case report | Shugaba ...

    African Journals Online (AJOL)

    This was a case of acute appendicitis in a patient with situs inversus found at Surgery for twisted left ovarian cyst in a 26 year old married woman. The case was interesting because the diagnosis of acute appendicitis as apposed to twisted left ovarian cyst was made intraoperatively when it was found in the left iliac fossa ...

  7. Triple-Vessel Percutaneous Coronary Revascularization In Situs Inversus Dextrocardia

    Directory of Open Access Journals (Sweden)

    Nikolaos Kakouros

    2010-01-01

    Full Text Available Dextrocardia with situs inversus occurs in approximately one in 10,000 individuals of whom 20% have primary ciliary dyskinesia inherited as an autosomal recessive trait. These patients have a high incidence of congenital cardiac disease but their risk of coronary artery disease is similar to that of the general population. We report what is, to our knowledge, the first case of total triple-vessel coronary revascularization by percutaneous stent implantation in a 79-year-old woman with situs inversus dextrocardia. We describe the successful use of standard diagnostic and interventional guide catheters with counter rotation and transversely inversed image acquisition techniques. The case also highlights that the right precordial pain may represent cardiac ischemia in this population.

  8. Klippel-feil syndrome with situs inversus. A rare association

    International Nuclear Information System (INIS)

    Jalil, J.; Shafique, M.; Dar, N.R.

    2008-01-01

    Klippel-Feil Syndrome (KFS) is a congenital anomaly characterized by a defect in the formation or segmentation of the cervical vertebrae. The clinical triad consists of short neck, low posterior hairline and limited neck movement. Multiple congenital anomalies have been associated with this disease. This is a case of KFS in a young girl along with situs inversus, which is an extremely rare association. Various systemic associations occurring in this multi-system disorder are also discussed. (author)

  9. A Rare Triad of Giant Occipital Encephalocele with Lipomyelomeningocele, Tetralogy of Fallot, and Situs Inversus

    Science.gov (United States)

    Franco, Arie; Jo, Stephanie Y; Mehta, Amar S; Pandya, Dave J; Yang, Carina W

    2016-01-01

    Giant encephalocele is an uncommon congenital anomaly with very few published reports available in the English literature. Tetralogy of Fallot associated with situs inversus is also infrequently reported. To our knowledge there are no published reports of an association between giant encephalocele and Tetralogy of Fallot. The additional finding of situs inversus results in a rare pathologic triad, not heretofore described. PMID:27200165

  10. Apendicitis and situs inversus viscerum in a 32-year-old female ...

    African Journals Online (AJOL)

    Situs inversus is a relatively rare congenital abnormality in which the internal organs are disposed in a mirror image of the normal. It is said to be an autosomal recessive genetic condition. Its prevalence varies with population. In the United States, Situs inversus is found in 0.01% of the population. The incidence in Nigeria is ...

  11. Hand-assisted robotic right donor nephrectomy in patient with total situs inversus: A case report.

    Science.gov (United States)

    Gonzalez-Heredia, Raquel; Garcia-Roca, Raquel; Benedetti, Enrico

    2016-01-01

    Total situs inversus" is an infrequent congenital condition. The robot has been already proved as a safe and attractive approach for living donor nephrectomies. We report here the first right donor nephrectomy in a patient with total situs inversus that is performed using the Da Vinci platform. Published by Elsevier Ltd.

  12. A Rare Triad of Giant Occipital Encephalocele with Lipomyelomeningocele, Tetralogy of Fallot, and Situs Inversus.

    Science.gov (United States)

    Franco, Arie; Jo, Stephanie Y; Mehta, Amar S; Pandya, Dave J; Yang, Carina W

    2016-03-01

    Giant encephalocele is an uncommon congenital anomaly with very few published reports available in the English literature. Tetralogy of Fallot associated with situs inversus is also infrequently reported. To our knowledge there are no published reports of an association between giant encephalocele and Tetralogy of Fallot. The additional finding of situs inversus results in a rare pathologic triad, not heretofore described.

  13. Dichotic listening in patients with situs inversus: brain asymmetry and situs asymmetry.

    Science.gov (United States)

    Tanaka, S; Kanzaki, R; Yoshibayashi, M; Kamiya, T; Sugishita, M

    1999-06-01

    In order to investigate the relation between situs asymmetry and functional asymmetry of the human brain, a consonant-vowel syllable dichotic listening test known as the Standard Dichotic Listening Test (SDLT) was administered to nine subjects with situs inversus (SI) that ranged in age from 6 to 46 years old (mean of 21.8 years old, S.D. = 15.6); the four males and five females all exhibited strong right-handedness. The SDLT was also used to study twenty four age-matched normal subjects that were from 6 to 48 years old (mean 21.7 years old, S.D. = 15.3); the twelve males and twelve females were all strongly right-handed and served as a control group. Eight out of the nine subjects (88.9%) with SI more often reproduced the sounds from the right ear than sounds from the left ear; this is called right ear advantage (REA). The ratio of REA in the control group was almost the same, i.e., nineteen out of the twenty-four subjects (79.1%) showed REA. Results of the present study suggest that the left-right reversal in situs inversus does not involve functional asymmetry of the brain. As such, the system that produces functional asymmetry in the human brain must independently recognize laterality from situs asymmetry.

  14. Successful Obstetric Outcome in Dextrocardia with Situs Inversus and Moderate Pulmonary Hypertension- Rare Case.

    Science.gov (United States)

    Deepika; Wadhwa, Leena; Shekhar, Chandna; Saini, Jyoti; Chetani, Monica

    2016-10-01

    Situs inversus is a rare congenital anomaly, which is characterized by right sided heart (Dextrocardia) and inversely rotated visceral organs of abdomen. In present case, the patient reported with G3p2l2, 34 weeks of gestational period along with breathlessness accompanied and labour pains. On further investigation, she was diagnosed as dextrocardia with situs inversus and moderate pulmonary artery hypertension along with severe iron deficiency anaemia. Patient had normal vaginal delivery with intra-partum and post-partum period. Normally, any patient having situs inversus has a normal life expectancy and is not associated with any significant morbidity or mortality.

  15. Successful Obstetric Outcome in Dextrocardia with Situs Inversus and Moderate Pulmonary Hypertension- Rare Case

    OpenAIRE

    Deepika,; Wadhwa, Leena; Shekhar, Chandna; Saini, Jyoti; Chetani, Monica

    2016-01-01

    Situs inversus is a rare congenital anomaly, which is characterized by right sided heart (Dextrocardia) and inversely rotated visceral organs of abdomen. In present case, the patient reported with G3p2l2, 34 weeks of gestational period along with breathlessness accompanied and labour pains. On further investigation, she was diagnosed as dextrocardia with situs inversus and moderate pulmonary artery hypertension along with severe iron deficiency anaemia. Patient had normal vaginal delivery wit...

  16. Hand-assisted robotic right donor nephrectomy in patient with total situs inversus: A case report

    Directory of Open Access Journals (Sweden)

    Raquel Gonzalez-Heredia

    2016-01-01

    Full Text Available Total situs inversus” is an infrequent congenital condition. The robot has been already proved as a safe and attractive approach for living donor nephrectomies. We report here the first right donor nephrectomy in a patient with total situs inversus that is performed using the Da Vinci platform.

  17. LEFT LOBE LIVER TRANSPLANTATION FROM AB0-INCOMPATIBLE LIVING DONOR WITH SITUS INVERSUS

    Directory of Open Access Journals (Sweden)

    S. V. Gautier

    2014-01-01

    Full Text Available Situs inversus is a rare congenital abnormality that affects approximately 0.005% of all live births. Traditionally, this condition is considered as a contraindication for liver donation, primarily due to the peculiarities of the vascular anatomy and the diffi culties in graft placement in the abdominal cavity. Review of the world literature testifi es to fi ve cases of use of the whole liver from deceased donor with situs inversus in adult recipients, and to just one case of inverted right lobe transplantation from living donor to 53-year-old man. Thus, transplantation of an inverted left liver lobe from a living related donor in pediatric patients was performed for the fi rst time. The article presents a successful experience of liver transplantation in child with tyrosinemia type 1 from AB0-incompatible living donor with situs inversus.

  18. Peripapillary retinal nerve fiber layer and optic nerve head characteristics in eyes with situs inversus of the optic disc.

    Science.gov (United States)

    Kang, Sunah; Jin, Sunyoung; Roh, Kyu Hwa; Hwang, Young Hoon

    2015-01-01

    This study was performed to investigate the peripapillary retinal nerve fiber layer (RNFL) and optic nerve head (ONH) characteristics, as determined using a spectral-domain optical coherence tomography (OCT), in eyes with situs inversus of the optic disc. The peripapillary RNFL and the ONH were assessed in 12 eyes belonging to 6 subjects with situs inversus of the optic disc (situs inversus group) and 24 eyes in 12 age-matched, sex-matched, and refractive error-matched healthy subjects (control group) by using OCT. The average, quadrant, and clock-hour RNFL thicknesses (clock-hour 9 on the scan represented the temporal side of the optic disc in both eyes), the superior/inferior RNFL peak locations, and ONH characteristics such as disc area, rim area, cup-to-disc ratio, vertical cup-to-disc ratio, and cup volume were obtained. The differences in RNFL and ONH characteristics between the 2 groups were analyzed. The situs inversus group had a thicker RNFL in the clock-hour sectors 3 and 4, a thinner RNFL in the clock-hour sectors 7, 8, and 11, and more nasally located superior and inferior RNFL peak locations than the control group (P≤0.001). The situs inversus group had a smaller cup-to-disc area ratio, smaller vertical cup-to-disc ratio, and a lesser cup volume than the control group (Poptic disc showed different peripapillary RNFL and ONH characteristics from those without this abnormality. These findings should be considered when assessing eyes with situs inversus of the optic disc.

  19. Percutaneous transvenous mitral commissurotomy in a patient with situs inversus and dextrocardia: A case report

    Directory of Open Access Journals (Sweden)

    Aliakbar Tavassoli

    2011-04-01

    Full Text Available INTRODUCTION: Dextrocardia situs inversus refers to the heart being a mirror image situated on the right side of the body. Distorted cardiac anatomy provides technical difficulties during fluoroscopy‐guided transcatheter procedures. This is even more difficult in the case with percutaneous transvenous mitral commissurotomy (PTMC. Mitral valvuloplasty is a minimally invasive therapeutic procedure to correct an uncomplicated mitral stenosis by dilating the valve using a balloon. Here, we describe a case of a 25 years-old male with situs inversus and dextrocardia. CASE REPORT: A 25 years-old man, having situs inversus and suffering from mitral stenosis was referred to hospital for PTMC. His initial examination findings were unremarkable and an electrocardiographic (ECG, trans-esophageal and transthoracic echocardiographic evaluation were performed. Mitral valve (MV was dome shape and severely stenotic with mild mitral regurgitation (MR. Left ventricular ejection Fraction (LVEF was about 40%, Femoral arterial and venous punctures were made on the left side; the left femoral artery and vein were cannulated with a 5F arterial and 6F venous sheaths, respectively. Then special maneuvers were done to solve the mitral valve stenosis. At the end of the procedure, no MR was documented by checking LV angiogram and there were no signs of mitral stenosis (MS. DISCUSSION: Mirror‐image dextrocardia, as in our case, has been estimated to occur with a prevalence of 1:10,000. However, there are only a few case reports in the literature on PTMC in similar settings. This might be due to the fact that many of these patients undergo surgical commissurotomy due to the technical difficulties involved in a percutaneous procedure in general. Trans-septal catheterization is considered a technical challenge in anatomically malpositioned hearts, as it is fraught with a higher risk of cardiac perforation. Despite the challenging anatomy, PTMC has been demonstrated to be a

  20. Situs Inversus with Levocardia and Congenitally Corrected Transposition of Great Vessels in a 35 year old Male: A Case report.

    Science.gov (United States)

    Ghorbnazadeh, Atefeh; Zirak, Nahid; Fazlinezhad, Afsoon; Moenipour, Aliasghar; Manshadi, Hamid Hoseinikhah; Teshnizi, Mohammad Abbasi

    2017-01-01

    Situs inversus with levocardia and congenitally corrected transposition of the great arteries represents a relatively very rare congenital condition and most patients are diagnosed in infancy or early age. This case report describes a 35-year old man with congenitally corrected transposition of the great arteries which presented with a five month history of exertional dyspnea. A diagnosis was confirmed by transesophageal echocardiogram, showing situs inversus, levocardia, atrioventricular and ventriculoarterial discordance. He underwent physiologic repair, and was discharged thirty five days after the operation, in a good general condition. Although management of the corrected transposition of the great arteries patients remains controversial, the recommendation is that physiologic repair may be the procedure of choice for some patients, particularly complicated cases.

  1. Situs anomalies on prenatal MRI

    International Nuclear Information System (INIS)

    Nemec, Stefan F.; Brugger, Peter C.; Nemec, Ursula; Bettelheim, Dieter; Kasprian, Gregor; Amann, Gabriele; Rimoin, David L.; Graham, John M.; Prayer, Daniela

    2012-01-01

    Objective: Situs anomalies refer to an abnormal organ arrangement, which may be associated with severe errors of development. Due regard being given to prenatal magnetic resonance imaging (MRI) as an adjunct to ultrasonography (US), this study sought to demonstrate the in utero visualization of situs anomalies on MRI, compared to US. Materials and methods: This retrospective study included 12 fetuses with situs anomalies depicted on fetal MRI using prenatal US as a comparison modality. With an MRI standard protocol, the whole fetus was assessed for anomalies, with regard to the position and morphology of the following structures: heart; venous drainage and aorta; stomach and intestines; liver and gallbladder; and the presence and number of spleens. Results: Situs inversus totalis was found in 3/12 fetuses; situs inversus with levocardia in 1/12 fetuses; situs inversus abdominis in 2/12 fetuses; situs ambiguous with polysplenia in 3/12 fetuses, and with asplenia in 2/12 fetuses; and isolated dextrocardia in 1/12 fetuses. Congenital heart defects (CHDs), vascular anomalies, and intestinal malrotations were the most frequent associated malformations. In 5/12 cases, the US and MRI diagnoses were concordant. Compared to US, in 7/12 cases, additional MRI findings specified the situs anomaly, but CHDs were only partially visualized in six cases. Conclusions: Our initial MRI results demonstrate the visualization of situs anomalies and associated malformations in utero, which may provide important information for perinatal management. Using a standard protocol, MRI may identify additional findings, compared to US, which confirm and specify the situs anomaly, but, with limited MRI visualization of fetal CHDs.

  2. Situs inversus, bronchiectasis, and sinusitis and its relation to immotile cilia: history of the diseases and their discoverers - Manes Kartagener and Bjorn Afzelius

    Energy Technology Data Exchange (ETDEWEB)

    Berdon, Walter E. [Department of Radiology, Children' s Hospital of New York, 3959 Broadway, CHN 3-325, NY 10032, New York (United States); Willi, Ulrich [Department of Radiology, University of Zurich Children' s Hospital, Zurich (Switzerland)

    2004-01-01

    The relationship of Kartagener's syndrome to immobile cilia syndrome is a fascinating merging of clinical observations and basic science in Zurich, Stockholm, and Toronto. In 1933, Manes Kartagener, a Zurich pulmonary physician, reported four patients with the triad of sinusitis, bronchiectasis, and situs inversus. In the following decades, he reviewed reports of hundreds of cases, but the fact that the male patients with the condition never had offspring eluded his notice. In the 1970s, Bjorn Afzelius, a Ph.D. ultrastructuralist from Stockholm, reported cilia immotility in infertile males, some of the cases occurring in families. Half of the cases had Kartagener's triad. The observation of Afzelius was soon applied to children by Jennifer Sturgess, a Ph.D. ultrastructuralist, and her medical colleagues in Toronto. With over 500 MEDLINE references since 1966 on Kartagener's and over 1,000 references on immotile cilia, the causes of the pulmonary infections have become clearer as the patients demonstrate impaired clearance of mucus with resultant sinus and bronchial disease. The cause of the situs inversus remains elusive to this day. It is appropriate to call the condition Kartagener-Afzelius syndrome. (orig.)

  3. An extremely rare clinical entity: congenitally corrected transposition with situs ınversus and single coronary artery presented with complete atrioventricular block in a young man.

    Science.gov (United States)

    Cirakoglu, Omer Faruk; Bayraktar, Ali; Sayin, Muhammet Rasit

    2018-05-01

    Congenitally corrected transposition of the great arteries is a rare form of CHD. Situs inversus is a much less common variant of a congenitally corrected transposition of the great arteries. In rare cases, transposition events may be accompanied by various cardiac anomalies. However, situs inversus patients with congenitally corrected transposition, single coronary artery anomaly, and atrioventricular block together have not been reported previously. This combination of abnormalities is presented as a first in the literature.

  4. NJP VOLUME 41 NO 3

    African Journals Online (AJOL)

    PROF. EZECHUKWU

    2013-04-10

    Apr 10, 2013 ... unrelated conditions1. Individuals with dextrocardia and situs inversus totalis may have associated congenital heart malformations2, primary ciliary dyskinesia or splenic malformations.3. We describe a case of dextrocardia with situs inversus totalis in a one day old neonate with neonatal sepsis, the.

  5. Hand-assisted robotic right donor nephrectomy in patient with total sinus inversus: A case report

    Science.gov (United States)

    Gonzalez-Heredia, Raquel; Garcia-Roca, Raquel; Benedetti, Enrico

    2016-01-01

    Total situs inversus” is an infrequent congenital condition. The robot has been already proved as a safe and attractive approach for living donor neprectomies. We report here the first right donor nephrectomy in a patient with total sinus inversus that is performed using the Da Vinci platform. PMID:27085108

  6. Situs Inversus in A 53 Year Old Man: A Case Report | Uchenna ...

    African Journals Online (AJOL)

    Result: A 53 year old man was referred to the cardiology clinic from the general outpatient department on account of an abnormal ECG. On examination his apex could not be located on the left and was subsequently located on the right 5th intercostal space mid-clavicular line. Examination of the abdomen revealed an ...

  7. Adenocarcinoma of the Cervix Uteri and Endometrium Combined With the Kartagener Syndrome on FDG PET/CT.

    Science.gov (United States)

    Zhang, Yin; Chen, Yue; Huang, Zhanwen; Zhou, Fan

    2015-11-01

    A 45-year-old woman with pathologically confirmed adenocarcinoma of the cervix uteri and endometrium underwent FDG PET/CT for staging. No metastasis was found. However, the images revealed bronchiectasis, sinusitis, and situs inversus totalis, which are the triad of Kartagener syndrome.

  8. Conventions and workflows for using Situs

    International Nuclear Information System (INIS)

    Wriggers, Willy

    2012-01-01

    Recent developments of the Situs software suite for multi-scale modeling are reviewed. Typical workflows and conventions encountered during processing of biophysical data from electron microscopy, tomography or small-angle X-ray scattering are described. Situs is a modular program package for the multi-scale modeling of atomic resolution structures and low-resolution biophysical data from electron microscopy, tomography or small-angle X-ray scattering. This article provides an overview of recent developments in the Situs package, with an emphasis on workflows and conventions that are important for practical applications. The modular design of the programs facilitates scripting in the bash shell that allows specific programs to be combined in creative ways that go beyond the original intent of the developers. Several scripting-enabled functionalities, such as flexible transformations of data type, the use of symmetry constraints or the creation of two-dimensional projection images, are described. The processing of low-resolution biophysical maps in such workflows follows not only first principles but often relies on implicit conventions. Situs conventions related to map formats, resolution, correlation functions and feature detection are reviewed and summarized. The compatibility of the Situs workflow with CCP4 conventions and programs is discussed

  9. Prenatal diagnosis of sirenomelia with anencephaly and craniorachischisis totalis

    Science.gov (United States)

    Theofanakis, Charalampos; Theodora, Marianna; Sindos, Michail; Daskalakis, George

    2017-01-01

    Abstract Rationale: Sirenomelia and anencephaly are well-defined congenital malformations that usually occur independently. Patient concerns: We report a case of combined sirenomelia, anencephaly and complete rachischisis, diagnosed in the 16th week of gestation. Diagnoses: To our knowledge, this is the 7th case in the literature and the first that is diagnosed so early in pregnancy. Interventions: The final diagnosis is confirmed with radiological examination after the termination of pregnancy. Outcomes: Prenatal diagnosis of sirenomelia is difficult due to the presence of kidney agenesis and severe oligohydramnios. Lessons: The combination of sirenomelia and craniorachischisis totalis is extremely rare and prenatal ultrasound scan are a challenge, even for experts in the field. PMID:29390297

  10. A Case of Lichen Planus Pigmentosus-Inversus

    Directory of Open Access Journals (Sweden)

    Belkız Uyar

    2012-09-01

    Full Text Available Lichen planus pigmentosus is a rare subtype of lichen planus. Because of its rarity, we present the case of a patient diagnosed as lichen planus pigmentosus-inversus based on clinical and histopatological findings, which clinical appearance did not resemble lichen planus at initial examination.

  11. Kajian terhadap Eksistensi Situs Facebook untuk Kepentingan Pelajar Indonesia

    OpenAIRE

    --, Hayadin

    2010-01-01

    Tujuan penelitian ini yaitu untuk mendiskripsikan keberadaan facebook bagi pelajar di Indonesia.Studi ini dilakukan melalui situs media facebook.com secara mendalam dengan berbagai aspek dalamlayanan facebook, fitur facebook, platform, tujuan dan sasarannya. Dengan menggunakan metode riviupada situs facebook, dan buku panduan untuk menerangkan materi dalam facebook, dan juga sumberyang lain yang relevan pada internet dengan menggunakan sumber “google dan yahoo”. Hasil studimenunjukkan bahwa f...

  12. Blepharophimosis, ptosis, and epicanthus inversus syndrome (BPES) and microcephaly

    Energy Technology Data Exchange (ETDEWEB)

    Ishikiriyama, Satoshi [Chiba Children`s Hospital (Japan); Goto, Michiyo [Chiba Rehabilitation Center (Japan)

    1994-08-15

    This succinct {open_quotes}Letter to the Editor{close_quotes} describes recent articles concerning the clinical diagnosis of blepharophimosis, ptosis, and epicanthus inversus syndrome (BPES) associated with interstitial deletion of chromosome 3q. The authors suggested that BPES and microcephaly make up a contiguous gene sydrome; the hypothesis is presented that a putative gene for BPES and some kind of microcephaly are very closely located at 3q23. 10 refs.

  13. PRESENTASI DIRI PEKERJA RUMAH TANGGA PADA SITUS JEJARING SOSIAL FACEBOOK

    Directory of Open Access Journals (Sweden)

    Nuria Astagini

    2016-08-01

    Full Text Available Abstrak Pengguna situs jejaring sosial Facebook kini sudah merambah berbagai kalangan, mulai dari pemimpin negara, hingga para pekerja rumah tangga (PRT. Meski sering diasosiasikan sebagai kalangan kelas bawah, para pekerja rumah tangga  ini merupakan pengguna aktif situs jejaring sosial. Melalui metode penelitian kualitatif dengan wawancara mendalam kepada informan yang berprofesi sebagai pekerja rumah tangga; diketahui bahwa mereka menggunakan situs jejaring sosial Facebook karena Facebook telah menjadi pengganti sahabat atau teman dekat yang mereka miliki di dunia nyata. Oleh karena itu penting bagi informan untuk menampilkan diri secara berbeda pada halaman profil Facebook mereka. Kedua informan mempresentasikan diri pada situs jejaring sosial ini sesuai dengan peran, naskah dan kostum mereka masing-masing.  Hal ini terlihat melalui berbagai konten yang mereka unggah, interaksi yang terjalin melalui halaman profil dan foto-foto yag ditampilkan pada profil mereka. Adapun terkait dengan profesi mereka sebagai PRT, keduanya sama-sama melemahkan stigma negatif dengan tidak mengasosiasikan profil mereka dengan profesi sebagai pekerja rumah tangga. Keberhasilan pengelolaan kesan pada panggung depan dinilai melalui tanda suka (like dan komentar positif yang diberikan audience kepada informan. Bagi informan kedua hal ini merupakan bentuk perhatian dan penerimaan yang diberikan kepada mereka Kata kunci:Pekerja Rumah Tangga, Domestik, Facebook, Situs Jejaring Sosial, Presentasi Diri, Dramaturgi

  14. Gorlin-Goltz syndrome with situs oppositus.

    Science.gov (United States)

    Guruprasad, Yadavalli; Prabhu, Prashanth R

    2010-01-01

    Gorlin-Goltz syndrome, also known as nevoid basal cell carcicoma syndrome, is caused due to a genetic alteration produced by a mutation in the "Patched" tumor suppressor gene, and it is inherited in a dominant autosomal way, though sporadic cases have been found. This syndrome shows a high penetrance and variable expressiveness. It is a multisystemic process that is characterized by the presence of multiple pigmented basocellular carcinomas, keratocysts in the jaws, palmar and/or plantar pits and calcification of the falx cerebri. Together with these major features, a great number of processes considered as minor features have also been described. The latter include numerous skeletal, dermatology related and neurological anomalies, among others. In some occasions, the presence of very aggressive basocellular carcinomas has been described as well as other malignant neoplasia. Due to the importance of oral maxillofacial manifestations of this syndrome, it is fundamental to know its characteristics in order to make a diagnosis, to provide an early preventive treatment and to establish right genetic advice. We report a rare association of Gorlin-Goltz syndrome with situs oppositus.

  15. Situs Permukiman Kuno di Waeyasel Kecamatan Leihitu Barat Maluku Tengah

    Directory of Open Access Journals (Sweden)

    Marlyn Salhuteru

    2016-04-01

    Full Text Available Situs permukiman kuno yang terdapat di dusun Waeyasel, penduduk setempat menyebutnya Kota Mulu adalah sebuah dataran di antara bukit karang yang cukup terjal. Penduduk di sekitar situs meyakini bahwa Kota Mulu adalah lokasi permukiman masyarakat Waeyasel pada masa lampau. Tim penelitian Balai Arkeologi Ambon melakukan penelitian di situs ini dengan menerapkan metode survei permukaan bertujuan untuk mendata dan mendokumentasikan sebanyak mungkin data arkeologi. Penelitian ini  menghasilkan sejumlah data arkeologi yang berciri megalitik berupa dolmen, sejumlah fragmentaris keramik lokal maupun keramik asing, dan sebuah makam. Sementara dapat disimpulkan bahwa situs kota mulu adalah situs permukiman yang didalamnya juga berlangsung kegiatan sakral sesuai dengan kepercayaan penghuninya, yang dibuktikan dengan keberadaan dolmen sebagai media upacara megalitik. Sedangkan keberadaan makam pada situs ini oleh penduduk sekitar dikatakan merupakan makam dari seorang pesiar agama Islam yang menyebarkan ajaran agama di waeyasel dan sekitarnya. Beliau kemudian meninggal dan dimakamkan di lokasi ini.   Site of ancient settlements located in the hamlet Waeyasel, the locals call it the City Mulu is a plateau in between fairly steep cliff. Residents around the site believes that the City Mulu is Waeyasel community settlements in the past. Ambon Archaeological Institute research team conducted research at this site by applying the method of surface survey aims to assess and document the archaeological data as much as possible. This study resulted in a number of archaeological data, characterized by megalithic dolmen form, a number of fragmentary local and foreign ceramics ceramics, and a tomb. While it can be concluded that the site Mulu city is the site of settlements which also takes place in accordance with the trust sacred activity occupants, as evidenced by the presence of megalithic dolmen as a media ceremony. While the existence of the tomb on this site

  16. Simbolisme Kompleks Bangunan Situs Ki Buyut Trusmi Cirebon

    Directory of Open Access Journals (Sweden)

    Muhammad Al Mujabuddawat

    2016-12-01

    Full Text Available Ki Buyut Trusmi Site is a burial site bounded by walls surrounding the complex site. In the complex area of the site, several buildings scattered in the barrier wall of the spatial division sites as many as 4 cemetery yard; West, East, Central, and North. The buildings are in the midst of hundreds of tombs in the complex area of the site. Based on the results of an overview of the physical form and position of the object of those buildings, it is understood that every buildings has its function and symbolic meaning. The position of the components of the building symbolically form a plan groove toward the main location of the most sanctified, the graves of Ki Gede Trusmi and Prince Trusmi in North yard site. Based on symbolic significance and hundred of tombs scattered in the area of the site, they are clearly show a blend of Islamic buildings affected by local culture which already existed, with the animism and Hindu-Buddhist. Those cultural blends form a pre-Islamic cultural treasures material which tangible on the architecture of the building full of symbolism outside the real Islamic law. Local culture become part of construction to the Islamization of local communities, Islam developed in the area Trusmi shows Islamic character integrative and accommodating to the local indigenous community.   Situs Ki Buyut Trusmi merupakan situs pemakaman yang dibatasi oleh tembok keliling yang mengelilingi kompleks situs. Dalam area kompleks situs, berdiri sejumlah bangunan yang tersebar dalam sekat-sekat tembok pembagian halaman situs sebanyak 4 halaman, yaitu Halaman barat, Halaman timur, Halaman tengah, dan Halaman utara. Bangunan-bangunan tersebut berdiri ditengah-tengah ratusan makam di dalam area kompleks situs. Berdasarkan hasil tinjauan terhadap bentuk fisik dan keletakan dari objek bangunan-bangunan tersebut, diketahui memiliki fungsi dan makna simbolik tersendiri. Keletakan komponen-komponen bangunannya secara simbolis membentuk denah alur

  17. Two Instances of Mundus Inversus in Psalm 113

    Directory of Open Access Journals (Sweden)

    A. Basson

    2009-07-01

    Full Text Available The psalms often praise Yahweh for his transformative and restorative interventions both in the past and in all times. They portray the deity as the one who offers protection to the weak and defenceless members of society. He uplifts the downtrodden and affords them a place in structure where they gain a new status. In Psalm 113:7-9, Yahweh changes the circumstances of the poor and needy and the childless woman. Social outcasts have their dignity and honour restored. This article explicates these divine acts in terms of the topos of mundus inversus (world-upside down. This cultural phenomenon, which finds expression in artistic, socio-political and religious spheres, accentuates the possibility of another reality by inverting the status quo. Psalm 113 praises Yahweh as the incomparable God who inverts the situation of those condemned to a life of suffering. His incomparability is linked with his power to create a mundus inversus in which the poor and needy have a banquet with nobles and a barren woman takes pleasure in motherhood.

  18. Penghunian, Pemanfaatan, dan Interaksi Pcndukung Situs-Situs di Kawasan Danau Ranau Lampung Barat

    Directory of Open Access Journals (Sweden)

    Nurul Laili

    2016-06-01

    Full Text Available Abstract, The archeological research that was conducted in the banks of Ranau Lake. West Lampung had been result some of conclusions and can be classified as religious sites, settlement sites and both. As religious sites they are Hujung Cumalagi, Batu Andak Kenihang. Johor. Way Lumbok. Batin Katung. and Si Pahit Lidah. and as settlement sites are Langkat. Batu l.umpang land 2. while sites considered as both religious and settlement is Tanjung Raya. The estima­tion of period that goes along the usage of the banks of Ranau Lake was based on relative chronology and ceramics dale. As a result, the sites could 've been occupied at least in 7 - 19 M and the presence of some megalithic traditions could be lies in the banks since late prehistoiy until history. Ceramics found that also lies there giving notes that these people has been interact with their outside place. Kata Kunci: penghunian, interaksi, Danau Ranau, situs

  19. PENILAIAN USABILITAS UNTUK SITUS e-COMMERCE (STUDI KASUS SITUS www.lazada.co.id dan www.mataharimall.com

    Directory of Open Access Journals (Sweden)

    Dian Palupi Restuputri

    2017-07-01

    Full Text Available Usabilitas merupakan syarat dari suatu situs E-commerce. Hal ini disebabkan apabila konsumen tidak dapat belanja dengan mudah, maka situs online  tidak akan berguna. Penelitian ini bertujuan menilai dua situs e-commerce di Indonesia yaitu lazada dan mataharimall. Lazada adalah toko perbelanjaan online yang menawarkan berbagai jenis merk terkenal. Saat ini Lazada adalah situs e-commerce terbesar di Indonesia. Sedangkan mataharimall adalah e-commerce yang menawarkan berbagai jenis produk seperti pakaian, kosmetik dan kesehatan, elektronik dll. Mataharimall merupakan salah satu situs terlengkap di Indonesia. Variable usabilitas yang digunakan dalam penelitian ini adalah 9 variable usabilitas yang digunakan dari model dasar Restuputri dan Yasierli (2014. Hasil dari penelitian ini yaitu 9 variable usabilitas ini valid untuk mengukur usabilitas di situs e-commerce jenis B2C (Bussiness to Customer yaitu lazada dan jenis O2O (Online-to-Offline dan Offline-to-Online yaitu mataharimall. Variabel yang perlu dilakukan perbaikan baik dari situs lazada maupun matahari yaitu variabel antara lain Bantuan, Kepuasan, Kualitas Informasi, Kehandalan, Jaminan dan Kontrak Perusahaan, Keamanan dan Fasilitas dan Universality. Untuk variabel Navigasi dan Indikator Waktu tidak perlu dilakukan tindakan perbaikan karena berada di kuadran ke empat yang artinya dinilai tidak penting maupun tidak puas   Abstract Usability is key from e-commerce. If a customer doesn’t like the site, customer simply looks for another e-commerce site to buy products from. This research assesses two largest e-commerce in Indonesia, which is lazada and mataarimall. Lazada is an online mall, offering a large selection of the world’s most popular brands. Currently, Lazada Indonesia is the nation’s leading business-to-consumer ecommerce site. MatahariMall is an ecommerce venture from the Lippo Group, offering one of the largest and most complete marketplaces in Indonesia. It covers fashion

  20. Gerabah Situs Wayputih sebagai Komoditi Barter di Kerajaan Hoamoal

    Directory of Open Access Journals (Sweden)

    Wuri Handoko

    2016-04-01

    Full Text Available The site of Wayputih settlement in the history and traditions of the various sources mentioned as the part of the Kingdom Hoamoal region. This study aims to clarify the role of settlement Wayputih sites as the region as one of the central region of the kingdom Hoamoal clove producer. In addition it describes the process of trade and exchange between commodities produced by commodity from outside the area. This study uses a survey to see traces of settlements based on primary data pottery artifacts, then perform quantitative and qualitative analysis of data to explain the use and development of the system of commodity exchanges in the region. The results of the study, found the distribution of pottery with a high quantity in the site area. It can be concluded that based on the intensity of pottery and not produced in the local area, then to obtain it from outside the region to barter with cloves produced in the local area. Trade and exchange of pottery with cloves in Wayputih, support the development of trade in the territory of the Kingdom Hoamoal. Situs pemukiman Wayputih dalam berbagai sumber sejarah maupun tradisi tutur merupakan wilayah pemerintahan dari Kerajaan Hoamoal. Penelitian ini bertujuan untuk menjelaskan peranan permukiman situs Wayputih sebagai wilayah sebagai salah satu wilayah pusat penghasil cengkeh bagi kerajaan Hoamoal. Selain itu menggambarkan proses perdagangan dan pertukaran antara komoditi yang dihasilkan dengan komoditi dari luar wilayah. Penelitian ini menggunakan metode survei untuk melihat jejak-jejak permukiman berdasarkan data utama artefak gerabah, selanjutnya melakukan analisis secara kuantitatif dan kualitatif data untuk menjelaskan penggunaan dan perkembangan sistem pertukaran komoditi di wilayah tersebut. Hasil penelitian, ditemukan sebaran gerabah dengan kuantitas yang tinggi di wilayah situs tersebut. Dapat disimpulkan bahwa berdasarkan intensitas gerabah dan tidak dihasilkan di wilayah setempat, maka untuk

  1. Karakteristik dan Habitasi Moluska di Situs Hatusua Seram Bagian Barat Maluku Indonesia

    Directory of Open Access Journals (Sweden)

    Karyamantha Surbakti

    2016-12-01

    Full Text Available Hatusua is a late prehistoric site in the southern coast of west Seram. Chronologically dated until 1,100 BP, Hatusua is a site with rich molusc findings. The aim of this research is to identify the profile of molusc in Hatusua site and its habitation characteristic in the regional context. Collecting data with surface survey, excavation and bibliographical study have been adopted as the approach in this research. The results show that The Hatusua Site is Site Complex with the history of geological genesis was a part of wallacea with the biotic marine faunal profile related to Sahul. Situs Hatusua adalah situs berkarakter masa prasejarah akhir di wilayah pesisir selatan seram bagian barat. Situs yang memiliki penanggalan hingga 1,100 tahun silam, ini merupakan salah satu situs yang banyak diidentifikasi temuan moluska. Penelitian ini bertujuan untuk mengenali profil temuan moluska yang ada di Situs Hatusua dan karakteristik habitasinya dalam konteks kawasan. Pengumpulan data dilakukan melalui survei permukaan, ekskavasi dan telaah pustaka. Hasil penelitian ini menemukan bahwa Situs Hatusua yang berada di Seram Bagian Barat merupakan kawasan situs yang memiliki histori pembentukan geologisnya termasuk dalam zona transisi Asia-Australia (Wallasea dengan kecenderungan fauna biotis lautnya termasuk dalam kategori Zona Kawasan Sahul.

  2. Neonatal intestinal volvulus and preduodenal portal vein associated with situs ambiguus: report of a case.

    Science.gov (United States)

    Watanabe, Toshihiko; Nakano, Miwako; Yamazawa, Kazuki; Maeyama, Katsuhiro; Endo, Masao

    2011-05-01

    Situs ambiguus is a rare lateralization anomaly that is frequently associated with other malformations, including preduodenal portal vein (PDPV), intestinal malrotation, and cardiovascular anomalies. This is a case report on a newborn that was clinically diagnosed with situs ambiguus and midgut volvulus. During surgery the patient was found to have intestinal malrotation, Meckel's diverticulum, and PDPV that was not a direct cause of duodenal obstruction. The patient was treated with Ladd's procedure and resection of Meckel's diverticulum. It is important to be familiar with the spectrum of situs anomalies to prevent trauma to the portal vein with serious complications during surgery.

  3. Cerebral Abscess and Extraaxial Empyema in a Patient with Kartagener Syndrome

    Directory of Open Access Journals (Sweden)

    Idil Gunes Tatar

    2013-06-01

    Full Text Available The triad of situs inversus totalis, bronchiectasis and sinusitis is known as Kartagener syndrome which is among the diseases with ciliopathies. Herein we present a case of cerebral abscess and extraaxial empyema detected in a 21-year-old male patient with Kartagener syndrome and a 10-year history of substance abuse. Preoperative CT, MRI findings and postoperative complications are presented with clinical and radiological review of primary ciliary dyskinesia. The consideration of primary ciliary dyskinesia in the differential diagnosis of frequent occurence of cough, rhinitis and otitis media in children is crucial since early diagnosis is known to affect the short term and long term morbidity.

  4. Prenatal diagnosis of sirenomelia with anencephaly and craniorachischisis totalis: A case report study.

    Science.gov (United States)

    Theofanakis, Charalampos; Theodora, Marianna; Sindos, Michail; Daskalakis, George

    2017-12-01

    Sirenomelia and anencephaly are well-defined congenital malformations that usually occur independently. We report a case of combined sirenomelia, anencephaly and complete rachischisis, diagnosed in the 16th week of gestation. To our knowledge, this is the 7th case in the literature and the first that is diagnosed so early in pregnancy. The final diagnosis is confirmed with radiological examination after the termination of pregnancy. Prenatal diagnosis of sirenomelia is difficult due to the presence of kidney agenesis and severe oligohydramnios. The combination of sirenomelia and craniorachischisis totalis is extremely rare and prenatal ultrasound scan are a challenge, even for experts in the field. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  5. Effetti dei blocchi totali del traffico motorizzato sulla concentrazione dei principali inquinamenti atmosferici

    Directory of Open Access Journals (Sweden)

    C. Signorelli

    2003-05-01

    Full Text Available

    Obiettivi: il contenimento degli inquinamenti atmosferici attraverso blocchi parziali e totali dei veicoli circolanti nelle aree critiche è un tema molto dibattuto negli ultimi anni, soprattutto in relazione all’efficacia a breve e medio termine di questi provvedimenti sulla concentrazione degli inquinanti nell’aria. Sulla base dei dati diffusi dall’ARPA della Regione Lombardia sono stati analizzati gli effetti di due blocchi totali del traffico motorizzato, avvenuti in due domeniche dell’inverno 2001-2002, sulle concentrazioni di due inquinanti specifici per il traffico veicolare, il PM10 e il benzene.

    Metodologia: l’analisi è stata condotta in Lombardia considerando i dati ambientali delle tre zone critiche dove sono stati registrati i valori più elevati di inquinanti atmosferici e dove sono stati attuati i blocchi del traffico come misura d’emergenza (Milano, Como e Sempione. Tramite l’elaborazione di alcuni parametri metereologici, di grafici e di dati relativi l’andamento delle medie giornaliere e orarie degli inquinanti considerati è stata, quindi valutata l’efficacia dei blocchi stradali ai fini della diminuzione dell’inquinamento atmosferico.

    Risultati: i risultati ottenuti hanno evidenziato che le concentrazioni di inquinanti subiscono complessivamente un calo nelle ore di blocco del traffico, ma risalgono rapidamente a partire dalle ore successive la conclusione dei blocchi e non subiscono variazioni significative nei giorni successivi. I fattori metereologici (vento e pioggia intensa rivestono grande importanza nel condizionare la concentrazioni di PM10 e benzene.

    Conclusioni: i risultati confermano che i provvedimenti d’emergenza di limitazione del traffico non rappresentano una soluzione definitiva per ridurre complessivamente l’inquinamento atmosferico nelle aree urbane. Risulta, quindi, necessario effettuare

  6. Comparison of thyroid function tests in alopecia totalis and universalis with control group

    Directory of Open Access Journals (Sweden)

    Hassan Seirafi

    2013-07-01

    Full Text Available Background: Alopecia areata (AA is a common cause of noncicatricial alopecia that occurs as a patchy, confluent or diffuse pattern. Exact etiologic factor of AA not yet recognized. Among many hypothesis, relationship between AA and autoimmune disease, especially thyroid disorders, was more interesting. The objective of this study was to determine the prevalence of thyroid test disorders in the patients with alopecia totalis and universalis in comparison with normal population.Methods: We analyzed medical records of 100 patients, including 44 male and 56 female in Tehran Razi Hospital from 1388 to 1389. The mean age was 24.1 years. Patients having totalis and universalis form of AA considered as case group while 100 normal person (42 male and 58 female with mean age of 26.1 who had not any form of AA considered as control group. Both groups had not any sign of thyroid disease at clinical examination according to their available medical records. Collected data were analyzed statistically in SPSS software 17th version. Results: In the majority of patients (54% the disease was manifested in the first two decades of life. History of atopia was seen in 9.8% of patient. Presence of the similar disease in first-degree family members was seen in 14.3% of patients. Abnormal T3, T4 and TSH were significantly higher in case group. Abnormal T3 uptake was higher in case group but not statistically significant. Conclusion: Paraclinical thyroid disorders were significantly higher in the alopecia areata patients than in normal population. There was no significant association between the age, sex and duration of disease and presence thyroid dysfunction.

  7. 2018-03-04T12:32:22Z https://www.ajol.info/index.php/all/oai oai:ojs ...

    African Journals Online (AJOL)

    article/64045 2018-03-04T12:32:22Z aipm:ART Apendicitis and situs inversus viscerum in a 32-year-old female Nigerian: a case report Adeniyi, AEO Akisanya, CO Akinremi, TO Erinle, CA Situs Inversus, Appendicitis, Dextrocardia Situs inversus ...

  8. PUVA treatment of alopecia areata partialis, totalis and universalis: audit of 10 years' experience at St John's Institute of Dermatology

    International Nuclear Information System (INIS)

    Taylor, C.R.; Hawk, J.L.M.

    1995-01-01

    Our 10-year experience with PUVA treatment for alopecia areata, partialis, totalis and universalis was retrospectively reviewed using charts and follow-up questionnaires for 70 patients at St John's Institute of Dermatology. In all cases, several previous therapies were judged to be unsatisfactory prior to starting PUVA, and many cases were already deemed clinically refractory prior to referral for PUVA. If cases of vellus hair growth are excluded, and those who lost their PUVA-induced regrowth rapidly on follow-up, the effective success rate was at best 6.3% for alopecia areata partialis, 12.5% for alopecia areata totalis and 13.3% for alopecia areata universalis. We affirm that PUVA is generally not an effective treatment for alopecia areata. (Author)

  9. Novel occurrence of axenfeld: Rieger syndrome in a patient with blepharophimosis ptosis epicanthus inversus syndrome

    Directory of Open Access Journals (Sweden)

    Bhavin M Shah

    2014-01-01

    Full Text Available Blepharophimosis ptosis epicanthus inversus syndrome (BPES is a complex eyelid malformation characterized by the classical tetrad of blepharophimosis, telecanthus, ptosis, and epicanthus inversus. It has been reported to be associated with other ocular anomalies such as euryblepharon, strabismus, nystagmus, amblyopia, microphthalmos, lacrimal drainage apparatus abnormality, extra ocular muscle abnormalities, microcornea, trabecular dysgenesis, optic nerve hypoplasias, and colobomas of the optic disk. We describe a case of BPES with Axenfeld-Rieger syndrome, a neurocristopathy characterized by maldevelopment of the anterior segment with predisposition to development of glaucoma. Interestingly, both syndromes are caused by mutations in the same class of genes, namely the winged-helix/forked transcription factors (FOX involved in a variety of developmental processes.

  10. FAKTOR-FAKTOR YANG MEMENGARUHI MINAT BELI PANGAN ORGANIK MELALUI SITUS ONLINE

    Directory of Open Access Journals (Sweden)

    Hasrini Sari

    2017-03-01

    Full Text Available This study is aimed to explore the factors that can increase the intention to buy and their implications in the design of marketing sites. Theoretical background used in the study is mainly adopted from the Technology Acceptance Model. Five variables are included in this research including Online Buying Intention, Ease of Use, Perceived Usefulness, Trust and Information on the Site. Data of 426 respondents were collected and analyzed using statistical methods of structural equation modeling to test the research model. The results show that the Information on the Site significantly influences Trust, and Perceived Usefulness and Trust significantly influence Online Buying Intention. Ease of Use does not significantly influence Online Buying Intention. The results of this study later become the basis for designing the information presented on a site of organic processed foods in a form of recommendations on information that should be presented on its website.Keywords:  technology acceptance model, online marketing, websites, organic products, structural equation modellingAbstrakPenelitian ini bertujuan menggali faktor-faktor yang dapat meningkatkan minat beli dari pengunjung situs, serta implikasinya dalam perancangan situs pemasaran, Model utama mengadopsi Technology Acceptance Model. Empat variabel digunakan dalam penelitian ini, yaitu kemudahan penggunaan, persepsi terhadap kegunaan, rasa percaya dan informasi pada situs. Data untuk menguji model penelitian dikumpulkan dari 426 responden, dan dianalisis menggunakan metode statistik structural equation modelling. Hasilnya menunjukkan bahwa informasi pada situs berpengaruh signifikan terhadap rasa percaya. Persepsi terhadap kegunaan dan rasa percaya berpengaruh signifikan terhadap minat beli online. Kemudahan penggunaan tidak berpengaruh signifikan terhadap minat beli online. Hasil penelitian ini kemudian menjadi dasar dalam merancang informasi yang disajikan pada sebuah situs makanan olahan

  11. MENINGKATKAN PRESTASI BELAJAR SEJARAH SISWA SMP NEGERI 1 LIMPUNG MELALUI PEMANFAATAN SITUS BATANG KUNO

    Directory of Open Access Journals (Sweden)

    Butuk Buwang

    2011-10-01

    Full Text Available Batang regency has many historical sites, especially the classical heritage of Indonesia. Sites located at County Trunk can be used as an alternative source of learning for students of history. The purpose of this research is to find out how to improve school performance through the use of historical sites in the study of ancient trunk. This study uses classroom action research. Research carried out in SMP N 1 Limpung. The results showed that the use of stem sites through field trip activities can enhance learning achievement of history. This is prooven with an increase in each cycle until it reaches the complete study in cycle II.   Key words: learning achievement, history, sites of ancient Batang   Kabupaten Batang memiliki banyak situs sejarah, khususnya warisan klasik Indonesia. Situs yang terletak di Kabupaten Batang dapat digunakan sebagai alternatif sumber belajar bagi siswa sejarah. Tujuan dari penelitian ini adalah untuk mengetahui bagaimana memperbaiki kinerja sekolah melalui penggunaan situs sejarah dalam studi batang kuno. Penelitian ini menggunakan penelitian tindakan kelas. Penelitian yang dilakukan di SMP N 1 Limpung. Hasil penelitian menunjukkan bahwa penggunaan situs induk melalui kegiatan field trip dapat meningkatkan prestasi belajar sejarah. Hal ini dibuktikan dengan peningkatan pada setiap siklus sampai mencapai ketuntasan belajar pada siklus II.   Kata kunci: prestasi belajar, sejarah, situs Batang kuno  

  12. KONSEP TALAK: Versus Situs www. darussalaf.or.id dan Undang- Undang Perkawinan di Indonesia

    Directory of Open Access Journals (Sweden)

    Sheila Fakhria

    2016-05-01

    baligh, berakal, mumayyiz yang mengerti dengan apa yang dilakukan. Selain itu, situs ini juga menjelaskan bahwa seorang istri tidak diperkenankan meminta cerai tanpa alasan yang syar’i, sebaliknya seorang istri diperbolehkan meminta untuk berpisah dengan suaminya dengan alasan syar’i diantaranya jika dia membenci kejelekan akhlak, agama, atau fisik suaminya, serta khawatir tidak mampu menegakkan hak-hak suaminya yang wajib ditunaikannya ketika hidup bersamanya. Oleh karena itu perlu dikaji tentang sejauh mana relevansi konsep keabsahan talak antara situs www.darussalaf.or.id dan undang-undang perkawinan di Indonesia.

  13. POTENSI DAN KAIDAH PERANCANGAN SITUS-WEB SEBAGAI MEDIA KOMUNIKASI VISUAL

    Directory of Open Access Journals (Sweden)

    Freddy H. Istanto

    2001-01-01

    Full Text Available The world is overwhelmed with the newly advanced-communication%2C that is Internet. One which widely known is web-site. Performing as the media of information through visual communication%2C web site is very potential and provides a wide variety of work field for the designers. The rules in web-site design are not far different from those of visual communication design. The essential elements%2C such as typography%2C illustration%2C symbolism%2C and photography%2C act as the key design in producing the web sites. Abstract in Bahasa Indonesia : Dunia dilanda model komunikasi baru yaitu internet. Salah satu bentuknya yang sangat terkenal adalah situs-web. Sebagai media penyebaran informasi melalui komunikasi visual%2C situs-web merupakan potensi dan lapangan kerja yang luar biasa bagi desainer komunikasi visual. Kaidah-kaidah perancangan situs-web tidak berbeda jauh dengan kaidah-kaidah pokok desain komunikasi visual. Elemen-elemen penting dalam desain komunikasi visual seperti typografi%2C ilustrasi%2C simbolisme dan fotografi merupakan kunci perancangan tampilan situs-web. web-site%2C potensi%2C design-criteria%2C visual communication design

  14. Income from immovable property - Preserving the situs and the permanent establishment principles

    NARCIS (Netherlands)

    Sanghavi, Dhruv

    2016-01-01

    It is accepted that tax treaties should allocate primary taxing rights over immovable property and income from immovable property to the situs state; the state in which a taxpayer has a permanent establishment (PE) should have priority over the state of its residence in so far as the taxation of

  15. Blepharophimosis, ptosis, epicanthus inversus syndrome (BPES and cleft lip and palate. Report of two Brazilian families

    Directory of Open Access Journals (Sweden)

    N.M. Kokitsu-Nakata

    1998-06-01

    Full Text Available We have evaluated a girl and a boy with the blepharophimosis, ptosis and epicanthus inversus syndrome (BPES. The girl presented cleft palate and the boy showed cleft lip and palate as additional clinical signs. Both showed familial recurrence in fourth and third generations, respectively. The other family members also presented blepharophimosis, ptosis, and epicanthus inversus, but without lip and palatal involvement. There were no additional clinical signs nor infertility in these patients. To our knowledge this is the first instance of cleft lip and palate reported as additional signs of the BPES syndrome.Os autores descrevem uma menina e um menino com a síndrome de blefarofimose, ptose e epicanto inverso (BPES. A menina apresentou fissura de palato e o menino mostrou fissura de lábio e palato como sinais clínicos adicionais. Ambos mostraram recorrência familial em quatro e três gerações, respectivamente. Outros membros de ambas as famílias apresentaram também blefarofimose, ptose e epicanto inverso, mas sem envolvimento de lábio e palato. Não existem sinais clínicos adicionais nem infertilidade nestes pacientes. De acordo com o nosso conhecimento, este é o primeiro relato de fissura de lábio e palato registrada como sinal adicional na síndrome BPES.

  16. Situs Pulau Ujir di Kepulauan Aru: Kampung Kuno, Islamisasi dan Perdagangan

    Directory of Open Access Journals (Sweden)

    Wuri Handoko

    2016-12-01

    Full Text Available Ujir ancient village on the island, is the site of settlement that shows the development of the Islamic period and colonial settlements in the territory of Aru Islands. Various archaeological data has been discovered, indicates the site serves as a growing settlements with the activities of the Muslim settlers and until recently has shown progress as one of the Muslim villages were quite advanced in the Aru Islands. This study is to explore the traces of Islamization and commercial developments in the Aru Islands, with the main focus in the Ujir Island to analyze the are role in the development of Islamization and commerce in the Aru Islands in the past. Study focused on the archaeological data collected from survey and excavation. The results showed that the old village site Ujir Island, called Site Uifana, is the site of settlements in the past is likely to be one of the centers spread of Islam in the Aru Islands which was later destroyed and abandoned during the influence of the entry of European colonization and later the Japanese. Ujir Island may also be a bridge in trade flows involving the surrounding area in the path of the spice trade and exotic commodities of Aru Islands. Kampung kuno di Pulau Ujir, merupakan situs permukiman yang menunjukkan perkembangan permukiman masa Islam dan kolonial di wilayah Kepulauan Aru. Penelitian ini menemukan, berbagai data arkeologi yang menunjukkan bahwa Pulau Ujir merupakan situs pemukiman yang maju dan berperan dalam jaringan Islamisasi dan perdagangan di kawasan Kepulauan Aru. Hasil penelitian memperliatkan bahwa situs kampung tua Pulau Ujir, yang disebut Situs Uifana, adalah situs permukiman yang pada masa lampau menjadi salah satu pusat penyebaran Islam yang kemudian hancur dan ditinggalkan pada masa pengaruh kolonialisasi Eropa  dan  Jepang. Pulau Ujir juga menjadi jaringan perdagangan yang melibatkan kawasan sekitarnya dalam jalur perdagangan rempah dan komoditi eksotik, seperti burung

  17. Classical lichen planus and lichen planus pigmentosus inversus overlap with dermoscopic features

    Directory of Open Access Journals (Sweden)

    Şule Güngör

    2014-01-01

    Full Text Available A 35-year-old man was referred to our hospital with a 3 months history of itchy cutaneous eruption on the trunk and asymptomatic cutaneous eruption on both groins. Physical examination revealed several, purplish-brown, scaly papules on the trunk and well-circumscribed, brown patchs in a linear distribution, on the bilateral inguinal regions. Dermoscopic examination of papules on the trunk revealed white crossing lines surrounded by brown dots; dermoscopic examination of patchs on groins revealed gray-brown dots and globules. According to histological, dermoscopical and clinical changes, the diagnoses of classical lichen planus (LP for the lesions on the trunk; and lichen planus pigmentosus inversus (LPPI for the lesions on the inguinal regions were made. Inhere we have described a rare case of LPPI and classical LP with dermoscopic features; and we suggest that LPPI is a variant of classical LP.

  18. Extended Hemi-Hepatectomy with Portal Vein Reconstruction in a Patient with Situs Ambiguous

    Directory of Open Access Journals (Sweden)

    Keishi Sugimachi

    2008-03-01

    Full Text Available We report a case of far-advanced hepatocellular carcinoma (HCC with situs ambiguous, complex visceral and vascular anomalies, who was successfully managed by extended hemi-hepatectomy. A 67-year-old man was referred to our hospital with a large liver mass. Abdominal ultrasonography, computed tomography and angiography revealed HCC with a diameter of 10 cm, with tumor thrombus in the main and first branch of the portal vein. Multiple complex anomalies in the abdomen were determined preoperatively. He had right-sided spleens-stomach-duodenum, liver at midline, inferior vena cava interruption with azygous continuation, and hepatic arterial anomaly. Extended left lobectomy of the liver with reconstruction of the portal vein was performed. Postoperatively, the patient recovered without major complications, and he was discharged on postoperative day 21. We report the first successful extended hepatectomy with portal vein reconstruction for HCC in a patient with rare situs anomalies.

  19. First trimester diagnosis of parapagus diprosopus dibrachius dipus twins with cranirachischisis totalis by three-dimensional ultrasound.

    Science.gov (United States)

    Ülker, Kahraman; Akyer, Şahika P; Temur, İsmail; Tan, Temel; Karaca, Mehmet; Adıgüzel, Esat; Gül, Abdülaziz

    2012-02-01

    Parapagus (laterally fused), diprosopus (two faces), dibrachius (two upper extremities), dipus (two lower extremities) conjoined twinning is extremely rare. The coexistence of anencephaly with a contiguous spinal defect (craniorachischisis totalis) makes the present case one of the rarest of the published cases. In our case, it was difficult to make the final diagnosis by two-dimensional abdominal and vaginal ultrasound. Three-dimensional ultrasound was helpful for final diagnosis and post-abortal examination confirmed the prenatal ultrasound diagnosis. The heart, diaphragm, liver and perineum were all united. Fine dissection of the heart showed four vessels arising from the ventricles and a membranous type ventricular septal defect. © 2011 The Authors. Journal of Obstetrics and Gynaecology Research © 2011 Japan Society of Obstetrics and Gynecology.

  20. PENGEMBANGAN MODEL PEMBELAJARAN SEJARAH BERBASIS SITUS SEJARAH LOKAL DI SMA NEGERI KABUPATEN TEMANGGUNG

    Directory of Open Access Journals (Sweden)

    Iin Purnamasari

    2011-10-01

    Full Text Available Teaching Learning model is the basis for learning practices that are designed based on the analysis of the implementation of the curriculum and its implications at the operational level in the classroom. There is a conceptual framework that describes a systematic procedure of organizing learning experiences to achieve the learning objectives. History study is a combination of learning and teaching activities that studying past events which closely related to the present. It is expected that the use of historical sources including local historical sites in the study of history, can improve the quality of students learning process which can be seen from the motivation and learning achievement. Based on the results of this study, it can be concluded that (1 The Development of Teaching learning model of history study based on local history sites can improve the quality of learning (2 local historical sites can be used as one of the effective teaching materials.   Key words: learning history, historical sites, high school   Model Belajar Mengajar adalah dasar dalam praksis pembelajaran yang dirancang berdasarkan analisis pelaksanaan kurikulum dan implikasinya pada tingkat operasional di kelas. Ada kerangka konseptual yang menggambarkan prosedur yang sistematis mengorganisir pengalaman belajar untuk mencapai tujuan pembelajaran. Mempelajari sejarah adalah kombinasi dari belajar dan mengajar kegiatan yang mempelajari peristiwa masa lalu yang berkaitan erat dengan saat ini. Diharapkan bahwa penggunaan sumber-sumber sejarah termasuk situs sejarah lokal dalam studi sejarah, dapat meningkatkan kualitas proses belajar siswa yang dapat dilihat dari motivasi dan prestasi belajar. Berdasarkan hasil penelitian ini, dapat disimpulkan bahwa (1 Pengembangan model pembelajaran studi Pengajaran sejarah berdasarkan situs sejarah lokal dapat meningkatkan kualitas pembelajaran (2 situs sejarah lokal dapat digunakan sebagai salah satu bahan ajar yang efektif. Kata

  1. PUVA treatment of alopecia areata partialis, totalis and universalis: audit of 10 years` experience at St John`s Institute of Dermatology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, C.R.; Hawk, J.L.M. [St Thomas` Hospital, London (United Kingdom). St John`s Institute of Dermatology

    1995-12-01

    Our 10-year experience with PUVA treatment for alopecia areata, partialis, totalis and universalis was retrospectively reviewed using charts and follow-up questionnaires for 70 patients at St John`s Institute of Dermatology. In all cases, several previous therapies were judged to be unsatisfactory prior to starting PUVA, and many cases were already deemed clinically refractory prior to referral for PUVA. If cases of vellus hair growth are excluded, and those who lost their PUVA-induced regrowth rapidly on follow-up, the effective success rate was at best 6.3% for alopecia areata partialis, 12.5% for alopecia areata totalis and 13.3% for alopecia areata universalis. We affirm that PUVA is generally not an effective treatment for alopecia areata. (Author).

  2. PENINGGALAN SITUS MEGALITIK SEKALA BRAK DAN IMPLIKASINYA DALAM PEMBELAJARAN SEJARAH LOKAL DI SEKOLAH DASAR

    Directory of Open Access Journals (Sweden)

    Yulia Siska

    2017-08-01

    Full Text Available The purpose of this study is to 1 describe in depth the megalithic relics of Sekala Brak sites; and 2 to describe the design of local history learning materials based on megaliths relic of Sekala Brak. This research method is descriptive qualitative. Techniques used in data collection are techniques of observation, documentation, and literature study. Analysis of the data presented descriptively, that is to articulate and describe the findings of the data according to the problems studied. The results showed that: 1 The archeological relic found in the megalithic sites of West Lampung consisting of Situs Batu Brak, Batu Jagur, Megalitik Telaga Mukmin, Megalitik Batu Kepapang, Batu Bertulis (Prasasti Hujung Langit, Batu Tameng, Batu Jaya, Batu Bertulis Belalau, Batu Spadu/Batu Putri, Batu Nakka/Batu Tegak, dan Situs Batu Raja; 2 Lampung local history materials that can be implemented in elementary school learning include: a Customs, b Traditional arts (dance, rupa / craft, music, c Historic places, d Habits and philosophy of life, e The relationship of kinship, f folklore, g The system of government (Kingdom, sultanate, keratuan, h Heroes and heroism, i Language, j of local historical events of the colonial era, k local historical events independence era, l local historical events post-independence era, m local history of contemporary events, and n Historiography Lampung in the media.  Keywords: megalithic Site Sekal Brak, local history learning materials, elementary school.

  3. Eesti kõrgkoolide esmakursuslaste õpi- ja teadmuskäsitus

    Directory of Open Access Journals (Sweden)

    Einike Pilli

    2013-10-01

    Full Text Available Mitmed üliõpilaste seas läbi viidud uuringud näitavad seost epistemoloogiliste uskumuste ehk teadmuskäsituse ja õpikäsituse vahel. Need uskumused ise aga tingivad selle, kuidas üliõpilased võtavad vastu erinevaid õppejõu tegevusi ja kuidas nad õpivad. Viimasel ajal levivad ka Eestis üha enam aktiivõppe meetodid, mis eeldavad üliõpilastelt teistsugust valmisolekut kui passiivne loengu vormis õppimine. Käesoleva töö eesmärk oligi kirjeldada, millised on Eesti esimese kursuse üliõpilaste epistemoloogilised uskumused ja õpikäsitus ning kuidas need mõjutavad üliõpilaste õpieelistusi. Lähtuti hüpoteesist, et Eesti esmakursuslased on pigem passiivsed, fikseeritud laadi epistemoloogiliste uskumustega ning ootavad õppejõult kui autoriteedilt nn valmisteadmisi. Seetõttu eelistavad nad töötada pigem üksi, mitte rühmas.Uurimuse hüpotees leidis üldjoontes kinnitust. Enamik uuritud esimese kursuse üliõpilastest käsitab teadmist oskuse või kogemusena. Õppimine on uute teadmiste omandamine õppejõult, kaaslastel on eelkõige vaid motiveeriv roll. Esmakursuslased eelistavad õppejõudu, kes on autoriteet ja ekspert, mistõttu oodatakse, et õppejõud tooks elulisi näiteid ja selgitaks õpitavat samm-sammult. Suur osa küsimustiku täitnud üliõpilastest on pindmise õpihoiakuga: nad mõistavad teadmist eelkõige fakti, kogemuse või oskusena ja eelistavad õppida üksi. Samal ajal on neil pluralistlikku laadi epistemoloogilised uskumused. Uuringust selgus ka, et sügava õpihoiakuga üliõpilased näevad õppimist protsessina ning teadmisi sealjuures ajas muutuvate ja arenevatena.Ainsaks kõrvalekaldeks esialgsest hüpoteesist olid üliõpilaste valdavalt pluralistlikud epistemoloogilised uskumused, mis võivad viidata ühiskonnas üldiselt levivale arusaamale, et pole ühtset tõde, vaid on palju tõlgendusi. Summary

  4. ANALISIS FAKTOR-FAKTOR YANG MENDORONG WISATAWAN MELAKUKAN KEPUTUSAN PEMBELIAN TIKET PESAWAT MELALUI MOBILE BOOKING PADA SITUS TRAVELOKA.COM

    Directory of Open Access Journals (Sweden)

    Erni Muliana

    2016-07-01

    Full Text Available Pembelian kebutuhan perjalanan wisata secara online merupakan bagian dari transaksi business to-customer (B2C. Produk yang ditawarkan biasanya terdiri dari: pemesanan paket wisata, penjualan tiket pesawat dan kereta api, kamar hotel dan penyewaan transportasi. Penelitian dilakukan dengan tujuan untuk mengetahui faktor-faktor yang mendorong wisatawan melakukan keputusan pembelian tiket pesawat melalui mobile booking pada situs Traveloka.com serta faktor yang paling banyak berkontribusi dalam menentukan keputusan pembelian tersebut. Teknik pengumpulan data yang digunakan adalah kuesioner online dan kuesioner yang disebarkan secara langsung (offline kepada 250 responden, penentuan responden ditetapaka menggunakn metode purposive sampling, sedangkan teknik analisis data yang digunakan adalah teknik analisis faktor. Hasil analisis faktor yang didapatakan menjelaskan 67,066% dari keseluruhan total variance, dan hasil analisis data menunjukkan empat faktor terbentuk yang mendorong wisatawan melakukan keputusan pembelian tiket pesawat melalui mobile booking pada situs Traveloka.com, yaitu: kemudahan dan sistem informasi website (24,396 %, pelayanan konsumen/customer service (15,211%, citra perusahaan (14,681 %, dan motivasi pembelian (12,779%, adapun faktor yang paling berkontribusi dalam mendorong wisatawan melakukan keputusan pembelian tiket pesawat melalui mobile booking pada situs Traveloka.com adalah faktor terbentuk yang memiliki faktor laoding tertinggi dari keseluruhan faktor yang terbentuk, yaitu faktor “Kemudahan dan Sistem Informasi Website”, faktor ini terdiri dari 13 variabel yakni: (1 Kemudahan pencarian situs web, (2 kecepatan waktu mengakses (load time, (3 nama domain perusahaan, (4 kemudahan pemesanan, (5 Informasi yang lengkap, (6 Informasi yang akurat, (7 Informasi yang menarik, (8 Pemaparan informasi yang tepat, (9 Ketersediaan dan aksesibilitas, (10 Harga yang kompetitif, (11 Pengalaman secara keseluruhan, (12 Keamanan data

  5. A case of triple volvulus

    Science.gov (United States)

    Basu, I; Phillips, D

    2012-01-01

    Situs inversus is a rare congenital anomaly that has reportedly been associated with caecal volvulus. We describe a case of partial situs inversus complicated by intestinal obstruction secondary to three simultaneously occurring volvuli of the stomach, caecum and sigmoid colon. To our knowledge, this is the first documented case in the literature of multiple, simultaneously occurring volvuli. PMID:22391352

  6. Syndrome! Polysplenia ina 10 year old girl | Ganiyu | Tropical ...

    African Journals Online (AJOL)

    We present a case of 10 year old patient with polysplenia, situs inversus abdominus, malrotation of bowel and renal anomalies. Polyspenia Syndrome refers to presence of two or more spleens associated with various abnormalities in chest and abdomen. Situs inversus is present in about 20% of cases Polysplenia ...

  7. A case of Kartagener syndrome with rhinolalia clausa | Raoufi | Pan ...

    African Journals Online (AJOL)

    Kartagener syndrome is an autosomal recessive genetic ciliary disorder comprising of a classic triad of sinusitis, situs inversus and bronchiectasis. It's the one of primary ciliary dyskinesia disorders with manifestations present from childhood. Most patients of PCD have situs inversus. We present a case of 18 year-old women ...

  8. Mutation spectrum of fork-head transcriptional factor gene (FOXL2) in Indian Blepharophimosis Ptosis Epicanthus Inversus Syndrome (BPES) patients.

    Science.gov (United States)

    Kaur, Inderjeet; Hussain, Avid; Naik, Milind N; Murthy, Ramesh; Honavar, Santosh G

    2011-06-01

    The fork-head transcription factor gene (FOXL2) gene has been implicated in Blepharophimosis Ptosis Epicanthus Inversus Syndrome (BPES) type I and type II. The authors aimed to evaluate the involvement of FOXL2 in familial and sporadic cases of BPES in an Indian cohort. The present cohort comprised clinically well-characterised BPES cases that included six affected families, two sporadic cases and 60 unaffected normal controls. The 5' untranslated and coding region of FOXL2 was screened by resequencing and confirmed by restriction digestion. Further, genotype-phenotype correlations were done to understand the implications of the observed mutation. Six mutations were observed in eight cases (87.5%). These included a novel deletion (c.860delC), three previously reported duplications (c.663-692dup 30, c.672-701dup30 and c.843-859dup17), a frame shift (c.804dupC) and a homozygous missense mutation (p.E69K). The p.E69k mutation was seen in both heterozygous and homozygous form in a large four-generational family, and disease severity was found to be directly linked to the allelic dosage. Two SNPs (c.501C→T, c.536C→G) were also noted. An unusual coexistence of polycystic ovarian disease (PCOD) with BPES was also seen in one of the families. Mutations in the region downstream of the fork-head domain were predominantly responsible for BPES among Indian patients.

  9. KAJIAN ZONASI PENGEMBANGAN KAWASAN PUSAKA. STUDI KASUS: SITUS SANGIRAN, SRAGEN (Zoning Study of Heritage Site Development Case Study: Sangiran Site, Sragen

    Directory of Open Access Journals (Sweden)

    Wiendu Nuryanti

    2008-11-01

    Full Text Available ABSTRAK Sebagai Warisan Budaya Dunia (World Culture Heritage yang ditetapkan oleh UNESCO pada tanggal 5 Desember 1996, Situs Sangiran merupakan bagian penting dalam sejarah manusia di dunia. Sesuai dengan keputusan Menteri Pendidikan dan Kebudayaan (Nomor 0701011977, situs tersebut telah ditetapkan sebagai cagar budaya (Widianto, et al.,1996. Penelitian ini memiliki dua tujuan utama: (1 menyusun konsepsi dasar pelestarian, dan (2 menyusun arahan desain (guidelines pelestarian Situs Sangiran. Permasalahan utama dari kajian ini adalah perubahan lahan karena faktor alam dan aktivitas manusia (pertanian, pembangunan, penambangan, ancaman pencurian, penggelapan, dan jual beli fosil, rendahnya partisipasi masyarakat dalam upaya pelestarian Situs Sangiran, dan belum adanya panduan/arahan pelestarian dan pemanfaatan wisata yang jelas. Dengan metoda kualitatif naturalistik, dihasilkan konsepsi (prinsip dasar pelestarian Situs Sangiran Sragen, dalanr masing-masing zona (zona I -3 sesuai dengan potensi tiap zona yang perlu dilestarikan dan dikernbangkan. Analisis yang digunakan dalam hal ini adalah analisis makro, meso, dan mikro. Dari kajian ini dapat disimpulkan bahwa dalam merencanakan pelestarian Situs Sangiran, hal terpenting adalah mentaati zonasi dasar situs, di mana setiap zona akan merniliki guidelines  tersendiri. Guidelines terdiri atas pengembangan produk (Klaster Ngebung, Bukuran, Dayu, street furniture, serta pemberdayaan masyarakat.   ABSTRACT  UNESCO has established Sangiran Site as a World Culture Heritage in December 5th 1996. Its present is important to the history of mankind in the world. Widianto, et al., 1996, stated that Sangiran site has become a Cultural Site regarding to the declaration of Minister of Culture and Education (No. 070/0/1977. This Research has two main purposes, (1 to arrange a conception of basic preservation, and (2 to arrange a design guidelines of Sangiran Site Preservation. There are several major issues in

  10. The Role of Cerl2 in the Establishment of Left-Right Asymmetries during Axis Formation and Heart Development

    Directory of Open Access Journals (Sweden)

    José A. Belo

    2017-12-01

    Full Text Available The formation of the asymmetric left-right (LR body axis is one of the fundamental aspects of vertebrate embryonic development, and one still raising passionate discussions among scientists. Although the conserved role of nodal is unquestionable in this process, several of the details around this signaling cascade are still unanswered. To further understand this mechanism, we have been studying Cerberus-like 2 (Cerl2, an inhibitor of Nodal, and its role in the generation of asymmetries in the early vertebrate embryo. The absence of Cerl2 results in a wide spectrum of malformations commonly known as heterotaxia, which comprises defects in either global organ position (e.g., situs inversus totalis, reversed orientation of at least one organ (e.g., situs ambiguus, and mirror images of usually asymmetric paired organs (e.g., left or right isomerisms of the lungs. Moreover, these laterality defects are frequently associated with congenital heart diseases (e.g., transposition of the great arteries, or atrioventricular septal defects. Here, reviewing the knowledge on the establishment of LR asymmetry in mouse embryos, the emerging conclusion is that as necessary as is the activation of the Nodal signaling cascade, the tight control that Cerl2-mediates on Nodal signaling is equally important, and that generates a further regionalized LR genetic program in the proper time and space.

  11. Single-Incision Transumbilical Surgery (SITUS) versus Single-Port Laparoscopic Surgery and conventional laparoscopic surgery: a prospective randomized comparative study of performance with novices in a dry laboratory.

    Science.gov (United States)

    Schoenthaler, Martin; Avcil, Tuba; Sevcenco, Sabina; Nagele, Udo; Hermann, Thomas E W; Kuehhas, Franklin E; Shariat, Shahrokh F; Frankenschmidt, Alexander; Wetterauer, Ulrich; Miernik, Arkadiusz

    2015-01-01

    To evaluate the Single-Incision Transumbilical Surgery (SITUS) technique as compared to an established laparoendoscopic single-site surgery (LESS) technique (Single-Port Laparoscopic Surgery, SPLS) and conventional laparoscopy (CLS) in a surgical simulator model. Sixty-three medical students without previous laparoscopic experience were randomly assigned to one of the three groups (SITUS, SPLS and CLS). Subjects were asked to perform five standardized tasks of increasing difficulty adopted from the Fundamentals of Laparoscopic Surgery curriculum. Statistical evaluation included task completion times and accuracy. Overall performances of all tasks (except precision cutting) were significantly faster and of higher accuracy in the CLS and SITUS groups than in the SPLS group (p = 0.004 to p port-assisted LESS technique such as SPLS. The demonstrated advantages of SITUS may be attributed to a preservation of the basic principles of conventional laparoscopy, such as the use of straight instruments and an adequate degree of triangulation.

  12. Discinesia ciliar primária revisitada: A propósito de três casos clínicos

    Directory of Open Access Journals (Sweden)

    Joana Fermeiro

    2010-09-01

    ciliary dyskinesia is a genetically and clinically heterogeneous disorder. Its pathogenesis reflects structural and functional compromise of the cilia.Common clinical manifestations include recurrent upper and lower respiratory tract infections and infertility, as well as situs inversus totalis in half of the affected patients.Besides its rarity and phenotypic heterogeneity its diagnosis usually requires a high suspicion index. The main purpose of this paper is to review the pathogenesis, clinical features, diagnostic and therapeutic approaches of primary ciliary dyskinesia beyond the discussion of three clinical reports.We report the cases of three patients all with a past history of neonatal respiratory distress and two with situs inversus totalis. The subsequent clinical manifestations included lower airway symptoms in two patients (chronic productive cough and recurrent pneumonia and wheezing and upper respiratory tract disease in all patients. Age at primary ciliary dyskinesia diagnosis differed considerably among patients (8 months, 5 and 12 years. The two patients with later diagnosis had already obstructive lung function compromise at the time of diagnosis.The authors discuss the different clinical patterns presented, therapeutic strategies and the clinical progression that ensued, factors possibly implicated in late diagnosis and its prognostic consequences.The main goal is to emphasize early and/or prevalent clinical features of primary ciliary dyskinesia in order to promote clinical awareness and early recognition of the disease. Palavras-chave: Discinesia ciliar primária, situs inversus total, Key-words: Primary ciliary dyskinesia, situs inversus totalis

  13. SITUS “KOTO RAYO” DAN KEARIFAN TRADISIONAL DI TEPI SUNGAI TABIR JAMBI

    Directory of Open Access Journals (Sweden)

    Pahrudin -

    2013-04-01

    Full Text Available Dalam penelitian ini, penulis  membahas  ‘Koto Rayo’, sebuah pemukiman kuno di sisi Sungai Tabir, Jambi sebagai sebuah budaya dan kearifan lokal. Penelitian difokuskan pada nilai kearifan lokal yang dimiliki masyarakat dalam kaitan dengan situs ini. Hasil penelitian dan pembahasan memunculkan fakta-fakta sebagai berikut. Pulau Sumatera memiliki peradaban tinggi di masa lalu, khususnya melalui Kerajaan Sriwijaya yang mengontrol dan mendominasi seluruh pulau ini dan sebagian besar wilayah Asia Tenggara. Salah satu wilayah Kerajaan Sriwijaya di Pulau Sumatera adalah Jambi, yang dahulu memiliki banyak Kerajaan Melayu. ‘Koto Rayo’ yang terletak di sisi Sungai Tabir ‘mungkin’ salah satu peradaban yang berhubungan dengan sejarah Kerajaan Melayu Jambi dan atau Kerajaan Sriwijaya di masa lalu. Situs ini mempengaruhi beberapa perilaku kearifan lokal pada masyarakat sekitar dalam wujud perilaku yang tegas dalam melestarikan lingkungan dan menjaga warisan budaya. Kearifan lokal ini penting untuk meminimalisir efek negatif globalisasi.The objective of this study is to discuss ’Koto Rayo’, an ancient settlement on the side of Tabir river, Jambi as a culture and local wisdom. The study focused on the value of local knowledge in the communities in connection with this site. Data was collected through observation, interviews and document analysis. The results and discussion led to the following facts. The island of Sumatra has a high civilization in the past, particularly through the kingdom of Srivijaya that controls and dominates the entire island and most of the Southeast Asia region. One of the kingdom of Srivijaya in Sumatra is Jambi, which once had many Malay kingdom. ’Rayo Koto’ located on the side of Tabir river is ’probably’ one of civilization associated with the history of the Malay kingdom of Srivijaya kingdom of Jambi in the past. This site affects some local

  14. Bi-allelic Mutations in PKD1L1 Are Associated with Laterality Defects in Humans.

    Science.gov (United States)

    Vetrini, Francesco; D'Alessandro, Lisa C A; Akdemir, Zeynep C; Braxton, Alicia; Azamian, Mahshid S; Eldomery, Mohammad K; Miller, Kathryn; Kois, Chelsea; Sack, Virginia; Shur, Natasha; Rijhsinghani, Asha; Chandarana, Jignesh; Ding, Yan; Holtzman, Judy; Jhangiani, Shalini N; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Hanchard, Neil A; Harel, Tamar; Rosenfeld, Jill A; Belmont, John W; Lupski, James R; Yang, Yaping

    2016-10-06

    Disruption of the establishment of left-right (L-R) asymmetry leads to situs anomalies ranging from situs inversus totalis (SIT) to situs ambiguus (heterotaxy). The genetic causes of laterality defects in humans are highly heterogeneous. Via whole-exome sequencing (WES), we identified homozygous mutations in PKD1L1 from three affected individuals in two unrelated families. PKD1L1 encodes a polycystin-1-like protein and its loss of function is known to cause laterality defects in mouse and medaka fish models. Family 1 had one fetus and one deceased child with heterotaxy and complex congenital heart malformations. WES identified a homozygous splicing mutation, c.6473+2_6473+3delTG, which disrupts the invariant splice donor site in intron 42, in both affected individuals. In the second family, a homozygous c.5072G>C (p.Cys1691Ser) missense mutation was detected in an individual with SIT and congenital heart disease. The p.Cys1691Ser substitution affects a highly conserved cysteine residue and is predicted by molecular modeling to disrupt a disulfide bridge essential for the proper folding of the G protein-coupled receptor proteolytic site (GPS) motif. Damaging effects associated with substitutions of this conserved cysteine residue in the GPS motif have also been reported in other genes, namely GPR56, BAI3, and PKD1 in human and lat-1 in C. elegans, further supporting the likely pathogenicity of p.Cys1691Ser in PKD1L1. The identification of bi-allelic PKD1L1 mutations recapitulates previous findings regarding phenotypic consequences of loss of function of the orthologous genes in mice and medaka fish and further expands our understanding of genetic contributions to laterality defects in humans. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  15. Moderate persistent asthma and dextrocardia; Asma persistente moderada e dextrocardia

    Energy Technology Data Exchange (ETDEWEB)

    Guimaraes, Maira de Lucca; Ferreira, Marcela Goncalves [Medicina da Universidade do Vale do Sapucai (UNIVAS), Pouso Alegre, MG (Brazil); Beraldo, Claudinei Leoncio; Magalhaes, Eugenio Fernandes de [Pneumologia da Universidade do Vale do Sapucai (UNIVAS), Pouso Alegre, MG (Brazil); Beraldo, Bruno Leoncio de Moraes [Clinica Medica do Hospital das Clinicas Samuel Libanio, Pouso Alegre, MG (Brazil)

    2011-10-15

    Dextrocardia is a rare disorder that develops specially in adults. It is frequently associated with situs inversus, not necessarily implying cardiac and/or extracardiac malformations. The case herein reported is uncommon, because it is a case of dextrocardia situs solitus (the second most common) that does not present such malformations. (author)

  16. Heterotaxy syndrome: a case report; Sindrome de heterotaxia: relato de caso

    Energy Technology Data Exchange (ETDEWEB)

    Carneiro, Daniel de Souza; Arantes, Jamil Hussein de; Souza, Gustavo Veloso de; Barreto, Aline Santos; Cardoso, Mychaell Luciano; Gontijo, Flavia, E-mail: danielmed124@gmail.com [Hospital Madre Tereza, Belo Horizonte, MG (Brazil)

    2013-05-15

    The present report describes the findings at chest computed tomography angiography of a 28-year-old female patient with heterotaxy syndrome. This syndrome consists of a variety of anomalies of position and morphology of thoracoabdominal organs which do not follow the situs solitus or situs inversus arrangement. Imaging studies play a fundamental role in the individualization of the approach to the patient. (author)

  17. Moderate persistent asthma and dextrocardia

    International Nuclear Information System (INIS)

    Guimaraes, Maira de Lucca; Ferreira, Marcela Goncalves; Beraldo, Claudinei Leoncio; Magalhaes, Eugenio Fernandes de; Beraldo, Bruno Leoncio de Moraes

    2011-01-01

    Dextrocardia is a rare disorder that develops specially in adults. It is frequently associated with situs inversus, not necessarily implying cardiac and/or extracardiac malformations. The case herein reported is uncommon, because it is a case of dextrocardia situs solitus (the second most common) that does not present such malformations. (author)

  18. LAPAROSCOPIC CHOLECYSTECTOMY A PATIENT WITH ACUTE CALCULOSE CHOLECYSTITIS AND RECIPROCALLY TRANSPOSED INTERNAL ORGANS – CASE PRESENTATION

    Directory of Open Access Journals (Sweden)

    Igor Černi

    2003-07-01

    Full Text Available Background. Situs inversus viscerum totalis (reciprocally reversed position of internal organs is a rare case with genetic predisposition, inherited autosomnously recessive. The presented case involves an older patient with complete transposition of internal organs having acute calculous cholecystitis, which was successfully performed the laparoscopic cholecystectomy. Whilst the production of biliary stones in a case of transposed internal organs is very rare, it may well represent a diagnostic problem. It is not, however, the contraindication for laparoscopic surgery.Patients and methods. The case presents a 64-year-old patient, whose persistent biliary colic trouble eventually resulted in acute cholecystitis. Following routine diagnostics, a laparoscopic cholecystectomy was performed and the patient was released in domestic care after three day hospitalization.Conclusions. The laparoscopic cholecystectomy may also be safely performed in a patient with reciprocal transposition of all internal organs, but it is imperative to consider the fact that the extra-hepatic anatomy of gall bladder and vascular system is the mirror image of normal, right-hand positioned liver.

  19. Diagnosis of Appendicitis with Left Lower Quadrant Pain

    Directory of Open Access Journals (Sweden)

    Sen-Kuang Hou

    2005-12-01

    Full Text Available Abdominal pain is one of the most common chief complaints of patients presenting to the emergency department and, among the diagnoses of abdominal pain, appendicitis is the most common surgical disorder. Traditionally, the diagnosis of appendicitis is based on well-established clinical criteria combined with physician experience. However, appendicitis presenting with rare and misleading left lower quadrant (LLQ pain may result in an initial false-negative diagnosis by the physician and even result in failure to order the subsidiary examination of computed tomography (CT or ultrasound, so increasing the risk of perforation/abscess formation and prolonged hospital stay. In this report, we present 2 cases of atypical appendicitis with LLQ pain where the correct diagnosis was not initially considered. One patient had right-sided appendicitis; the inflamed appendix was 12 cm in length and projected into the LLQ. Local peritonitis developed during observation. With the aid of CT, the diagnosis was established in time. The other patient had left-sided appendicitis with situs inversus totalis. Adverse outcomes with appendiceal rupture and abscess formation occurred due to inadvertent physical examinations and inadequate observation. Early clinical suspicion and adequate observation are indicated in patients with uncertain clinical features. However, in patients with unresolved clinical symptoms and/or local peritonitis that develop during observation, imaging studies play a significant role in preoperative diagnosis and determination of proper treatment.

  20. Left-sided appendicitis: review of 95 published cases and a case report.

    Science.gov (United States)

    Akbulut, Sami; Ulku, Abdullah; Senol, Ayhan; Tas, Mahmut; Yagmur, Yusuf

    2010-11-28

    To give an overview of the literature on left-sided acute appendicitis (LSAA) associated with situs inversus totalis (SIT) and midgut malrotation (MM). We present a new case of LSAA with SIT and a literature review of studies published in the English language on LSAA, accessed via PubMed and Google Scholar databases. Ninety-five published cases of LSAA were evaluated and a 25-year-old female, who presented to our clinic with left lower abdominal pain caused by LSAA, is reported. In the reviewed literature, fifty-seven patients were male and 38 were female with an age range of 8 to 82 years and a median age of 29.1 ± 15.9 years. Sixty-six patients had SIT, 23 had MM, three had cecal malrotation, and two had a previously unnoted congenital abnormality. Fifty-nine patients had presented to the hospital with left lower, 14 with right lower and seven with bilateral lower quadrant pain, and seven subjects complained of left upper quadrant pain. The diagnosis was established preoperatively in 49 patients, intraoperatively in 19, and during the postoperative period in five; 14 patients were aware of having this anomaly. The data of eight patients were not unavailable. Eleven patients underwent laparoscopic appendectomy, which was combined with cholecystectomy in two cases. Histopathological examination of the appendix specimens revealed adenocarcinoma in only two of 95 patients. The diagnosis of left lower quadrant pain is based on well-established clinical symptoms, physical examination and physician's experience.

  1. Polysplenia syndrome with duodenal and pancreatic dysplasia in a Holstein calf: a case report.

    Science.gov (United States)

    Kondoh, Daisuke; Kawano, Tomomi; Kikuchi, Tomoaki; Hatate, Kaoru; Watanabe, Kenichi; Sasaki, Motoki; Yamagishi, Norio; Inokuma, Hisashi; Kitamura, Nobuo

    2017-09-29

    Laterality disorders of the abdominal organs include situs inversus totalis that mirrors the arrangements of all internal organs and heterotaxy syndrome (situs ambiguus) in which the thoracic or abdominal organs are abnormally arranged. Heterotaxy is often accompanied by multiple congenital malformations, and it generally comprises asplenia and polysplenia syndromes. To our knowledge, polysplenia syndrome has been reported in only three cattle, and computerized tomographic (CT) images of these animals were not obtained. A six-month-old Holstein heifer had ruminal tympani and right abdominal distension. CT imaging showed that the rumen occupied the right side of the abdominal cavity, the omasum and abomasum occupied the left ventral side and the liver was positioned on the left. The colon and cecum were located at the left dorsum of the cavity, and the left kidney was located more cranially than the right. Postmortem findings revealed two spleens attached to the rumen. Significantly, the duodenum was too short to be divided into segments, except the cranial and descending parts, or flexures, except the cranial flexure, and the pancreas, which lacked a left lobe, was covered with mesojejunum. The liver comprised a relatively large right lobe and a small left lobe without quadrate and caudate lobes. The caudal vena cava that connected to the left azygous vein passed irregularly through the aortic hiatus of the diaphragm, and the common hepatic vein without the caudal vena cava passed through the caval foramen. Although the lungs and heart were morphologically normal, the right atrium received three major systemic veins. Polysplenia syndrome was diagnosed based on the CT and postmortem findings. We defined the positions of the abdominal organs and morphological abnormalities in various organs of a calf with polysplenia syndrome based on CT and postmortem findings. These findings will improve understanding of the malpositioning and malformations that can occur in the

  2. Kognisi Sosial Melalui Situs Jejaring Youtube Pada Komunitas Online (Studi Kasus pada Komunitas Online LinkPictureID

    Directory of Open Access Journals (Sweden)

    Fitria Ayuningtyas

    2017-12-01

    dynamics that happened. Portal video Youtube telah menjadi salah satu saluran penyiaran alternatif. Penggunaan internet yang semakin meningkat membentuk sebuah ruang penggunaan visual yang bebas. Youtuber, sebutan untuk para produsen video di youtube telah membentuk sebuah nuansa tersendiri, didalamnya terdapat beberapa kajian kajian menarik terutama di pembentukan realita dan kognisi sosial. Video-video yang mengajarkan cara pandang dan pengungkapan opini maupun pendapat adalah contoh bagaimana para youtuber membentuk realita terhadap penontonnya. Kognisi sosial dalam pandangan ini sangatlah penting mengingat bahwa para penonton menggunakan logika video tersebut sebagai dasar dalam memahami berbagai hal disekitar lingkungannya. Namun demikian kapasitas maupun latar belakang para youtuber ini sangat bermacam–macam mengingat mereka tidak memiliki standard umum terhadap profesi mereka sebagai videografis. Tujuan penelitian ini untuk melihat bagaimana pengguna youtube melihat keadaan sosial sebagai kemampuan koginitif. Teori yang digunakan dalam penelitian ini yaitu kognisi sosial, situs jaringan sosial, dan youtube. Penelitian ini menggunakan metode penelitian kualitatif. Adapun hasil dari penelitian ini adalah interaksi antar pengguna dan pembuat video merupakan interaksi yang sangat berbeda, mengingat di era teknologi komunikasi ini mereka tidak lain dari produsen-konsumen. Pesatnya reproduksi pesan ini sangatlah dinamis terutama menanggapi keadaan sosial. Penelitian ini memfokuskan diri pada sebuah komunitas online yang aktif dan mengutamakan interaksi CMC lewat portal video youtube sebagai pembentukan kognisi sosial. Kesimpulan kognisi sosial melalui youtube memberikan pandangan bahwa kita bisa berkreasi sebaik mungkin untuk bisa berkarya secara bebas. Adapun penggunaan youtube sebagai sebagai referensi dan pembanding. Dalam hal ini, komunitas LinkPictureID paham dengan konsep “upgrade” dimana diperlukan sebuah kecepatan dalam mengambil keputusan berdasarkan

  3. Penyebaran Batuan Situs Purbakala Candi Palgading di Dusun Palgading, Desa Sinduharjo, Kecamatan Ngaglik, Kabupaten Sleman, Daerah Istimewa Yogyakarta dengan Menggunakan Metode Resistivitas Dipole Dipole

    Directory of Open Access Journals (Sweden)

    Usmardin Usmardin

    2015-10-01

    Full Text Available Candi Palgading yang terletak di Desa Sinduharjo, Ngaglik, Sleman, D.I.Yogyakarta tanggal 1 Juli 2009 sampai 4 Juli 2009 dengan menggunakan alat Resistivitymeter. Pemetaan ini bertujuan untuk mengetahui penyebaran dan kedalaman batuan penyusun candi pada Situs Candi Palgading serta sebagai sumber informasi bagi usaha penemuan benda-benda purbakala yang terpendam dalam tanah. Pengambilan data dilakukan dengan menggunakan 8 lintasan ukur, dan mencakup luas daerah pengukuran ±1000 m2. Lintasan 1, 2, 3, 4, 5, 6 dan 8 mengambil jarak rentang elektroda (a = 3 m sedangkan lintasan 7 jarak rentang elektrodanya (a = 2 m. Keseluruhan lintasan menggunakan n = 1 sampai dengan n = 7. Pengolahan data menggunakan software Res2dinv dan surfer. Nilai resistivitas yang digunakan untuk menentukan batuan penyusun candi adalah nilai resistivitas batu andesit. Hasilnya menunjukkan profil nilai resistivitas batuan penyusun candi 750 Ohm-m sampai 5000 Ohm-m yang berada hingga kedalaman rata-rata 4,5 m sebagai batu andesit. Terdapat 7 lokasi yang diduga merupakan batu andesit penyusun Candi Palgading sedangkan salah satu lokasi yang lain merupakan batuan andesit bukan penyusun candi. Batuan candi pada ketujuh lokasi tersebut salah satunya telah tersingkap yakni di lokasi 4 sedangkan lokasi yang lain batuan candinya masih terpendam.

  4. Heterotaxy syndrome: a case report

    Directory of Open Access Journals (Sweden)

    Daniel de Souza Carneiro

    2013-06-01

    Full Text Available The present report describes the findings at chest computed tomography angiography of a 28-year-old female patient with heterotaxy syndrome. This syndrome consists of a variety of anomalies of position and morphology of thoracoabdominal organs which do not follow the situs solitus or situs inversus arrangement. Imaging studies play a fundamental role in the individualization of the approach to the patient.

  5. A new heterozygous mutation of the FOXL2 gene is associated with a large ovarian cyst and ovarian dysfunction in an adolescent girl with blepharophimosis/ptosis/epicanthus inversus syndrome.

    Science.gov (United States)

    Raile, K; Stobbe, H; Tröbs, R B; Kiess, W; Pfäffle, R

    2005-09-01

    Blepharophimosis/ptosis/epicanthus inversus syndrome (BPES), an autosomal dominant syndrome in which eyelid malformation is associated with (type I BPES) or without premature ovarian failure (type II BPES). Mutations of a putative winged helix/forkhead transcription factor FOXL2 account for both types of BPES. We report on a 16-year-old adolescent girl with blepharophimosis and ptosis. Subsequently she developed oligomenorrhea, secondary amenorrhea for 6 months, and an extremely large cyst of one ovary. The cyst contained 8 l of cyst fluid and histopathology displayed a large corpus luteum cyst. Following laparotomy, gonadotropin levels were elevated (LH 17.2 U/l, FSH 29.4 U/l) and estradiol levels decreased (67 pmol/l). Because of clinical aspects of BPES and abnormal ovarian function we suspected a mutation of her FOXL2 gene and found a new in-frame mutation (904_939dup36) on one allele, leading to a 12 alanine expansion within the polyalanine domain. We conclude that the FOXL2 mutation 904_939dup36 may account not only for blepharophimosis and ptosis but also for ovarian dysfunction and growth of the large corpus luteum cyst. In contrast to known FOXL2 mutations with polyalanine expansions and association with BPES type II, clinical aspects of our girl may indicate some degree of ovarian dysfunction that might finally lead to BPES type I with premature ovarian failure.

  6. Case Report Autopsy Findings on a Pair of Dicephalic Parapagus ...

    African Journals Online (AJOL)

    KIGZ

    Defects of laterality, with absent spleen or situs inversus of the right twin's abdominal organs have been reported to accompany heart abnormalities (13). We report findings of a shared liver entirely within the thoracic cage, which had three lobes and two gall bladders. This is in accord with reports that the liver, pancreas, gall ...

  7. CCDC39 is required for assembly of inner dynein arms and the dynein regulatory complex and for normal ciliary motility in humans and dogs

    DEFF Research Database (Denmark)

    Merveille, Anne-Christine; Davis, Erica E; Becker-Heck, Anita

    2011-01-01

    Primary ciliary dyskinesia (PCD) is an inherited disorder characterized by recurrent infections of the upper and lower respiratory tract, reduced fertility in males and situs inversus in about 50% of affected individuals (Kartagener syndrome). It is caused by motility defects in the respiratory c...

  8. Author Details

    African Journals Online (AJOL)

    Adeniyi, AEO. Vol 6, No 1 (2008) - Articles Apendicitis and situs inversus viscerum in a 32-year-old female Nigerian: a case report. Abstract PDF. ISSN: 1597-1627. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  9. Annals of Ibadan Postgraduate Medicine - Vol 6, No 1 (2008)

    African Journals Online (AJOL)

    Apendicitis and situs inversus viscerum in a 32-year-old female Nigerian: a case report · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. AEO Adeniyi, CO Akisanya, TO Akinremi, CA Erinle, 84-86. http://dx.doi.org/10.4314/aipm.v6i1.64045 ...

  10. 31. Abordaje transaórtico de la tetralogía de fallot en el adulto

    Directory of Open Access Journals (Sweden)

    M.T. González López

    2012-04-01

    Conclusiones: El cierre de la CIV en la tetralogía de Fallot del adulto mediante abordaje transaórtico resulta sencillo, por las dimensiones de la raíz y el acabalgamiento sobre la misma. En casos de situs inversus, esta técnica facilita sobremanera la corrección final.

  11. Kartagener's Syndrome

    African Journals Online (AJOL)

    GB

    presenting with recurrent upper and lower respiratory tract infections, sinusitis or bronchiectasis. Inability to diagnose this condition may subject the patient to unnecessary and repeated hospital admissions, investigations and treatment failure. KEY WORDS: Kartagener's syndrome, primary cilliary dyskinesia, situs inversus, ...

  12. Primary presentation of Jeune's syndrome as gastric motility disorder in an infant: A case report

    Directory of Open Access Journals (Sweden)

    Amit Katyan

    2018-01-01

    Full Text Available We report a case of a 4-week-old female neonate with Jeune's asphyxiating thoracic dystrophy (JATD and coexistent situs anomaly, primarily presenting as gastric motility disorder. The child presented with abdominal distension and nonbilious vomiting since birth with failure to thrive. However, skeletal survey revealed JATD. Upper gastrointestinal contrast study showed situs inversus with delayed gastric emptying. Pyloric biopsy and intraoperative antro-duodenal manometry confirmed association of gastric motility disorder. Awareness of the unusual possibility of primary presentation of Jeune syndrome as gastric motility disorder will improve the management approach in such infants.

  13. The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation

    DEFF Research Database (Denmark)

    Becker-Heck, Anita; Zohn, Irene E; Okabe, Noriko

    2011-01-01

    Primary ciliary dyskinesia (PCD) is a genetically heterogeneous autosomal recessive disorder characterized by recurrent infections of the respiratory tract associated with the abnormal function of motile cilia. Approximately half of individuals with PCD also have alterations in the left-right...... organization of their internal organ positioning, including situs inversus and situs ambiguous (Kartagener's syndrome). Here, we identify an uncharacterized coiled-coil domain containing a protein, CCDC40, essential for correct left-right patterning in mouse, zebrafish and human. In mouse and zebrafish, Ccdc40...

  14. Primary ciliary dyskinesia: clinical and genetic aspects

    Directory of Open Access Journals (Sweden)

    E. D’Auria

    2012-06-01

    Full Text Available Primary ciliary dyskinesia (PCD is a rare, genetically heterogeneous disease, characterized by ciliary disfunction and impaired mucociliary clearance, resulting in a range of clinical manifestations such as chronic bronchitis, bronchiectasis, chronic rhino-sinusitis, chronic otitis media, situs viscerum inversus in almost 40-50% of cases and male infertility. The triad situs viscerum inversus, bronchiectasis and sinusitis is known as Kartagener syndrome. Up to now little is known about genetic, diagnostic and therapeutic aspects of primary motile ciliary diseases in children: for this reason, diagnosis is generally delayed and almost all treatments for PCD are not based on randomized studies but extrapolated from cystic fibrosis guidelines. The aim of this review is to propose to pediatricians a summary of current clinical and diagnostic evidence to obtain better knoledwge of this condition. The earlier diagnosis and the right treatment are both crucial to improve the prognosis of PCD.

  15. Kartagener's syndrome presented with nasal obstruction: A case report

    Directory of Open Access Journals (Sweden)

    Suna Asilsoy

    2014-08-01

    Full Text Available The nasal polyposis is a chronic inflammatory process of the nasal mucosa. Although it is rare in children, there may be also association with cystic fibrosis and primary ciliary dyskinesia. About 50% of primary ciliary dyskinesia patients develop situs inversus and it is known as Kartagener's syndrome. The Kartagener's sydrome is a rare autosomal recessive disorder characterized by sinusitis, bronchiectasis, situs inversus. Clinically, patients present to the otolaryngologist with nasal obstruction. We as pediatricians, should consider nasal polyposis as a rare cause of nasal obstruction in children. In the presence of recurrent upper and lower respiratory tract infections accompanying nasal polyposis, Kartagener's syndrome must be kept in mind as a rare reason. [Cukurova Med J 2014; 39(4.000: 942-945

  16. Successful drug-eluting stent implantation in a male patient with dextrocardia: a case report

    Directory of Open Access Journals (Sweden)

    Long Wenjie

    2017-12-01

    Full Text Available Situs inversus with dextrocardia is a rare condition, with complete transposition of all the body organs, including the heart. Percutaneous coronary intervention (PCI in these patients is technically difficult because of the mirror image of organs. Here, we describe a 56-year-old man with coronary heart disease with known situs inversus with dextrocardia and coronary percutaneous intervention was performed for stenosis in the right coronary artery. A drug eluting stent was implanted at this site successfully. This case suggested that the interventional management of such patients follows the same general rules as for non-dextrocardia patients, but the manipulation of the catheter and projection position choices need to be taken into consideration to obtain optimal benefits for the patient.

  17. Broncho-pneumopathies à répétition: penser à un syndrome de ...

    African Journals Online (AJOL)

    Le syndrome de Kartagener est une affection héréditaire rare de transmission autosomique récessive. Il se caractérise par une triade: bronchectasies, rhinosinusite chronique et situs inversus. L'évolution est dominée par la survenue d'infections respiratoires haute et basses. Patiente âgée de 21 ans, admise pour ...

  18. ARTI PENTING SITUS-SITUS PELABUHAN KUNA DI KARAWANG, JAWA BARAT, SEBAGAI JALUR TRANSPORTASI

    Directory of Open Access Journals (Sweden)

    Libra Hari Inagurasi

    2017-01-01

    Full Text Available Karawang is a district in West Java province in which the river territory were continuously flowing and  were identified as old  Citarum River and Cilamaya River which lies in the northern part of Java Sea. The Northern coast of Karawang has many gulf estuaries. The existence of port, rivers, and coastal areas in Karawang emerged in the 16th century and in the 17th century as well as on written documents of Portuguese sources, and also from those documents of Vereenigde Oost India Company (VOC.  The Northern coast of Karawang were crowded by navigation of merchant ships and patrol boats. From those facts of course raises the question of where was these ports originated in Karawang. This study aimed to uncover, identify, ancient ports which was located on the northern coast of Karawang based on the written documents, archaeological remains, and its natural environment. By using surveys, interviews, the results of this research found out the significance of the ancient ports were located at the  banks of the Citarum River, the banks of the mouth of a river in Pasir Putih, and Tangkolak River estuary. Those ports function for ships as it landed ashore and also as river transportation mode. Through these ports trading took place, the spread of Islam and also served as ships patrol. By searching through the names on the written documents, as well as ecological and remains, archaeological remains were found, some of which have been investigated functions as ancient ports which was mentioned by De Barros.

  19. PENEMPATAN SITUS-SITUS NEOLITIK DI KAWASAN KARANGNUNGGAL, TASIKMALAYA, JAWA BARAT

    Directory of Open Access Journals (Sweden)

    Nurul Laili

    2017-01-01

    Full Text Available This study aimed to examine more about Neolithic human life support in western Java. Research on the distribution patterns and factors affecting it which expected to give clues about human behavior patterns in the use of space or the natural environment for their activities. This study uses descriptive and inductive reasoning, which essentially aims to provide a snapshot of a particular fact or symptoms obtained in the study placement. There are two locations, namely (1 the sites in key river basins, namely Ci Langla and (2 sites in tributaries flow Ci Langla, among others are Ci Lumping, Ci Karaha, and Ci Sodong. Some are located in key river basins as much as five sites, occupy the other nine tributary of Ci Langla.

  20. Corrected transposition of the great arteries

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Young Hi; Park, Jae Hyung; Han, Man Chung [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1981-12-15

    The corrected transposition of the great arteries is an usual congenital cardiac malformation, which consists of transposition of great arteries and ventricular inversion, and which is caused by abnormal development of conotruncus and ventricular looping. High frequency of associated cardiac malformations makes it difficult to get accurate morphologic diagnosis. A total of 18 cases of corrected transposition of the great arteries is presented, in which cardiac catheterization and angiocardiography were done at the Department of Radiology, Seoul National University Hospital between September 1976 and June 1981. The clinical, radiographic, and operative findings with the emphasis on the angiocardiographic findings were analyzed. The results are as follows: 1. Among 18 cases, 13 cases have normal cardiac position, 2 cases have dextrocardia with situs solitus, 2 cases have dextrocardia with situs inversus and 1 case has levocardia with situs inversus. 2. Segmental sets are (S, L, L) in 15 cases, and (I, D,D) in 3 cases and there is no exception to loop rule. 3. Side by side interrelationships of both ventricles and both semilunar valves are noticed in 10 and 12 cases respectively. 4. Subaortic type conus is noted in all 18 cases. 5. Associated cardic malformations are VSD in 14 cases, PS in 11, PDA in 3, PFO in 3, ASD in 2, right aortic arch in 2, tricuspid insufficiency, mitral prolapse, persistent left SVC and persistent right SVC in 1 case respectively. 6. For accurate diagnosis of corrected TGA, selective biventriculography using biplane cineradiography is an essential procedure.

  1. Corrected transposition of the great arteries

    International Nuclear Information System (INIS)

    Choi, Young Hi; Park, Jae Hyung; Han, Man Chung

    1981-01-01

    The corrected transposition of the great arteries is an usual congenital cardiac malformation, which consists of transposition of great arteries and ventricular inversion, and which is caused by abnormal development of conotruncus and ventricular looping. High frequency of associated cardiac malformations makes it difficult to get accurate morphologic diagnosis. A total of 18 cases of corrected transposition of the great arteries is presented, in which cardiac catheterization and angiocardiography were done at the Department of Radiology, Seoul National University Hospital between September 1976 and June 1981. The clinical, radiographic, and operative findings with the emphasis on the angiocardiographic findings were analyzed. The results are as follows: 1. Among 18 cases, 13 cases have normal cardiac position, 2 cases have dextrocardia with situs solitus, 2 cases have dextrocardia with situs inversus and 1 case has levocardia with situs inversus. 2. Segmental sets are (S, L, L) in 15 cases, and (I, D,D) in 3 cases and there is no exception to loop rule. 3. Side by side interrelationships of both ventricles and both semilunar valves are noticed in 10 and 12 cases respectively. 4. Subaortic type conus is noted in all 18 cases. 5. Associated cardic malformations are VSD in 14 cases, PS in 11, PDA in 3, PFO in 3, ASD in 2, right aortic arch in 2, tricuspid insufficiency, mitral prolapse, persistent left SVC and persistent right SVC in 1 case respectively. 6. For accurate diagnosis of corrected TGA, selective biventriculography using biplane cineradiography is an essential procedure

  2. Genetics Home Reference: blepharophimosis, ptosis, and epicanthus inversus syndrome

    Science.gov (United States)

    ... features. Type I is also associated with an early loss of ovarian function (primary ovarian insufficiency) in women, which causes their menstrual periods to become less frequent and eventually stop before age 40. Primary ovarian insufficiency can lead to difficulty ...

  3. Blepharophimosis, ptosis, epicanthus inversus syndrome type 2 with ...

    African Journals Online (AJOL)

    Our patient had normal psychomotor development. His father was similarly affected suggesting autosomal dominant inheritance. The patient had red brown hair, lymphedema of lower limbs and kidney stones which were not reported before with this syndrome. Most probably these additional features are associations with ...

  4. Blepharophimosis, ptosis, epicanthus inversus syndrome type 2 with ...

    African Journals Online (AJOL)

    Rabah M. Shawky

    2015-01-08

    Jan 8, 2015 ... renal stones measuring 4.3 mm in the left kidney and 3.1 mm in the right kidney ... Arterial blood gas and .... sual facial features and the related head posture, but also to improve ... ment of lymphatic pressure and flow velocity.

  5. Left-sided gall bladder: Report of two cases

    Directory of Open Access Journals (Sweden)

    Chrungoo R

    2007-01-01

    Full Text Available Left-sided gall bladder without situs inversus viscerum is a rare albeit recognized clinical entity. We report our experience of two cases of left-sided gall bladder in two women aged 36 and 48 who underwent laparoscopic cholecystectomy for chronic calculous cholecystitis. Left-sided gall bladder may provide an unusual surprise to the surgeons during laparoscopy as routine pre-operative studies may not always detect the anomaly. Awareness of the unpredictable confluence of the cystic duct into the common bile duct (CBD and selective use of intraoperative cholangiography aid in the safe laparoscopic management of this unusual entity.

  6. The role of electrocardiogram in the diagnosis of dextrocardia with mirror image atrial arrangement and ventricular position in a young adult Nigerian in Ile-Ife: a case report.

    Science.gov (United States)

    Ogunlade, Oluwadare; Ayoka, Abiodun O; Akomolafe, Rufus O; Akinsomisoye, Olumide S; Irinoye, Adedayo I; Ajao, Adewale; Asafa, Muritala A

    2015-09-28

    Dextrocardia with situs inversus is a rare congenital disease. In patients with this condition, the heart is presented as a mirror image of itself with its apex pointing to the right. The pulmonary and abdominal anatomies are reversed. Dextrocardia with situs inversus occurs at birth but its diagnosis may be in adulthood. This case advances knowledge by graphically describing the unusual electrocardiographic features of dextrocardia in a young adult. We report a case of a 22-year-old Nigerian man of Yoruba ethnicity who presented himself for preadmission medical test. He had a standard 12-lead electrocardiogram which revealed uncommon features: inversion of P waves in leads I, aVL and aVR; dominantly negative QRS waves in leads I, V1 to V6; reverse R wave progression in chest leads; low voltage in V4 to V6; extreme QRS axis; flattened T waves in V4 to V6 and aVR; and inverted T waves in lead I and aVL. An electrocardiogram diagnosis of dextrocardia was made. The differential diagnosis considered was right ventricular hypertrophy. A cardiovascular examination showed pulse rate of 70 beats per minute, blood pressure of 119/62mmHg, visible cardiac impulse at right precordium, apex beat was located at his fifth right intercostal space mid-clavicular line. A chest X-ray (posterior anterior view) including upper abdomen showed dextrocardia; his aortic arch was located on the right. His stomach bubble was located below his right hemidiaphragm. His trachea was slightly deviated to the left. The findings in his lung fields were not remarkable. Abdominopelvic ultrasonography showed that right-sided intra-abdominal organs (liver, gallbladder) were located on the left while left-sided organs (stomach, spleen) were located on the right. His abdominal aorta was on the right while his inferior vena cava was located on the left. A diagnosis of dextrocardia with situs inversus was made ultrasonographically. A properly interpreted electrocardiogram was useful in suspecting the

  7. Coronary artery bypass surgery in a patient with Kartagener syndrome: a case report and literature review

    Directory of Open Access Journals (Sweden)

    Bougioukas Ioannis

    2010-08-01

    Full Text Available Abstract Kartagener syndrome consists of congenital bronchiectasis, sinusitis, and total situs inversus in half of the patients. A patient diagnosed with Kartagener syndrome was reffered to our department due to 3-vessel coronary disease. An off-pump coronary artery bypass operation was performed using both internal thoracic arteries and a saphenous vein graft. We performed a literature review for cases with Kartagener syndrome, coronary surgery and dextrocardia. Although a few cases of dextrocardia were found in the literature, no case of Kartagener syndrome was mentioned.

  8. Patient with congenital heart malformation and infective endocarditis

    Directory of Open Access Journals (Sweden)

    Ramírez Ortiz, Zoraida

    2014-10-01

    Full Text Available We present the case of a 17 year-old-man, with no remarkable past medical history, who had a one month history of worsening functional class, fatigability and dyspnea, in addition to fever and systemic inflammatory response syndrome (SIRS; a de-novo congenital heart malformation, situs inversus type, with levocardia and a ventricular septal defect (VSD associated with transposition of great vessels were documented. During hospitalization he received several antibiotic treatments without microbiological isolation or identification of the cause of hemodynamic decompensation. An Aspergillus endocarditis with emboli to different organs was identified in the post-mortem examination.

  9. Heterotaxy syndrome with intestinal malrotation, polysplenia and azygos continuity

    Directory of Open Access Journals (Sweden)

    Stéphanie Cupers

    2018-01-01

    Full Text Available Heterotaxy syndrome is a situs anomaly that comprises a large spectrum of cardiac and extracardiac malformations. Its association with intestinal malrotation is frequent. This later might be asymptomatic or manifest by signs of abdominal discomfort or of intestinal obstruction. We report on the case of a full term, small for gestational age neonate in whom heterotaxy syndrome with partial situs inversus abdominalis, intestinal malrotation, polysplenia and vena azygos continuity was diagnosed at prenatal echography. Due to the high risk of volvulus carried by the malrotation, Ladd’s procedure was performed at the age of two months. Follow-up examination at the age of four years shows excellent post-operative result and normal development of the child.

  10. Discinesia ciliar primária: quando o pediatra deve suspeitar e como diagnosticar? Primary ciliary dyskinesia: when the pediatrician must suspect and how to do the diagnosis?

    Directory of Open Access Journals (Sweden)

    Mary Anne K. Olm

    2007-12-01

    Full Text Available OBJETIVO: Revisar a discinesia ciliar primária (DCP quanto aos seus aspectos ultra-estruturais, discriminar os defeitos ciliares primários dos secundários, descrever o quadro clínico, os testes laboratoriais de triagem e de diagnóstico disponíveis, bem como seu manejo clínico. FONTE DE DADOS: Pesquisa nas bases de dados Medline, Lilacs e SciELO, no período de 1980 a 2007. SÍNTESE DOS DADOS: A DCP é uma doença autossômica recessiva que compromete a estrutura e/ou a função ciliar e, conseqüentemente, o transporte mucociliar. As manifestações clínicas envolvem o trato respiratório superior e inferior, com infecções recorrentes do ouvido médio, seios paranasais e pulmonares, que podem evoluir para bronquiectasias. Outras manifestações incluem situs inversus totalis e infertilidade masculina. O diagnóstico deve ser suspeitado pelos pediatras em várias situações: recém-nascidos de termo com desconforto respiratório sem causa aparente; neonatos portadores de dextrocardia; lactentes com tosse persistente e/ou infecções otorrinolaringológicas de repetição, excluindo-se as imunodeficiências e a fibrose cística; crianças com asma atípica e as com bronquiectasias sem causa definida. Os testes de triagem diagnóstica são os da sacarina e do óxido nítrico nasal. As avaliações do defeito ultra-estrutural e funcional exigem análise por microscopia eletrônica e da freqüência e formato da onda de batimento ciliar. CONCLUSÕES: A DCP, apesar da baixa prevalência, é pouco diagnosticada pelas dificuldades de estabelecer o diagnóstico definitivo do defeito ciliar devido à complexidade da investigação laboratorial e pela falta de reconhecimento da doença pelos médicos. A suspeita clínica e o diagnóstico precoce são fundamentais para reduzir a morbidade e prevenir o desenvolvimento de complicações.OBJECTIVE: To review primary ciliary dyskinesia (PCD and its ultrastructural aspects, to differentiate primary

  11. Absent right superior caval vein in situs solitus

    DEFF Research Database (Denmark)

    Lytzen, Rebekka; Sundberg, Karin; Vejlstrup, Niels

    2015-01-01

    Introduction In up to 0.07% of the general population, the right anterior cardinal vein obliterates and the left remains open, creating an absent right superior caval vein and a persistent left superior caval vein. Absent right superior caval vein is associated with additional congenital heart...... disease in about half the patients. We wished to study the consequences of absent right superior caval vein as an incidental finding on prenatal ultrasonic malformation screening. Material and methods This is a retrospective case series study of all foetuses diagnosed with absent right superior caval vein...... no postnatal complications. All children were found to have healthy hearts at follow-up. CONCLUSIONS: In all cases, the findings proved to be a benign condition with no clinical manifestations or complications. Although isolated absent right superior caval vein does not seem to affect the outcome, associated...

  12. Warisan dunia Situs Sangiran Persepsi menurut penduduk Sangiran

    Directory of Open Access Journals (Sweden)

    Bambang Sulistyanto

    2009-04-01

    Full Text Available Cultural heritages are things from the past, which are valued by communitiesin recent time as part of their nation’s culture. In reality, among the communitymembers there are problems that arise as a result of diverse perceptions, dueto the fact that each perception is based on own interests as is the case withthe Site of Sangiran. On the one hand, the Government, as part of the presentcommunity, has an idealistic orientation towards the Site of Sangiran as a culturalheritage which unquestionably needs to be protected for the purpose of scientificknowledge and national identity. The local people around Sangiran Site, onthe other hand, consider it as their ancestors’ area which possesses valuablecontents and advantages to improve their economic condition. This conflictand the consequences (fossil protection on the one hand and fossil trade on theother have so far not been resolved. Meanwhile, the destruction of the Site ofSangiran as the World Cultural Heritage No. 593 is still continuing.

  13. Analisa Perbedaan Brand Image Situs Berita Berbahasa Indonesia Online Lokal

    Directory of Open Access Journals (Sweden)

    Kuspuji Catur Bagus Wicaksono

    2011-11-01

    Full Text Available The amount of graduates and the availability of jobs are unbalanced, therefore unemployment is generalized; not only for uneducated but also those educated ones. This is supporting educational institutions to provide entrepreneurship subject for students to prepare themselves when they have no job and unemployment for the consequences. Entrpreneurial education is not about theory but also field practice that involves every parts such as educational institutions, small-scale and major business, and also government. Education that moves accordingly with the development and field practice for students to be prepared for their graduation, whether or not being an entrepreneur.

  14. Keberterimaan Situs Pajak: Pengindusian Orientasi Tujuan Pembelajaran dan Norma Subyektif

    Directory of Open Access Journals (Sweden)

    Sumiyana

    2010-12-01

    Full Text Available This study investigates a new IS success model that predicts the net benefits of tax consultans’ works especially in Indonesia by inducing learning goal orientation and subjective norms. This research investigates initially the basic IS success model (DeLone dan McLean, 1992 using system quality, information quality, intention to use and net benefits. This study induces stepwisely learning goal orientation and subjective norms to this model to predict net benefits improvement of the IS success model. This study suggests that system quality and information quality enhance intention to use and users’ satisfaction, then they could make net benefits. This study finds low goodness of fit level of the basic model. The inducement of learning goal orientation to the basic model did not improve the level, neither did subjective norms. It means that tax information systems in Indonesia are still far from the IS that could be used as decision support systems or expert systems tools

  15. Papers on topology Analysis Situs and its five supplements

    CERN Document Server

    Poincaré, Henri

    2010-01-01

    These famous papers, with their characteristic mixture of deep insight and inevitable confusion, are here presented complete and in English for the first time, with a commentary by their translator, John Stillwell, that guides the reader into the heart of the subject. One of the finest works of one of the great mathematicians is now available anew for students and experts alike. -Jeremy Gray The AMS and John Stillwell have made an important contribution to the mathematics literature in this translation of Poincaré. For many of us, these great papers on the foundations of topology are given greater clarity in English. Moreover, reading Poincaré here illustrates the ultimate in research by successive approximations (akin to my own way of mathematical thinking). - Stephen Smale I am a proud owner of the original complete works in green leather in French bought for a princely sum in Paris around 1975. I have read them extensively, and often during topology lectures I refer to parts of these works. I am happy th...

  16. Model Kepercayaan Konsumen pada Situs E-Commerce

    OpenAIRE

    Purbasari, Wika

    2017-01-01

    The world trading system has now grown to online commerce (electronic commerce) because a lot of people who buy goods through e-commerce. This can be evidenced by a study Consumer Web Watch reported that 86% of Internet users have switched make purchases traditional to online purchases, because that's important to know what factors are forming a model of consumer confidence in e-commerce, then it is necessary a prediction to determine any factors that shape consumer confidence in e-commerce. ...

  17. Mucociliary transport and upper airway disease

    International Nuclear Information System (INIS)

    Takeuchi, Kazuhiko

    2010-01-01

    Mucociliary transport so critical in nasal, paranasal sinus, and middle ear physiology is impaired in chronic sinsusitis and otitis media by factors such as increased mucus viscoelasticity, decreased ciliary area, and primary or secondary ciliary immotility. We reviewed the pathophysiology of primary ciliary dyskinesia, otitis media with effusion, chronic sinusitis, and allergic rhinitis in terms of mucociliary transport. Subjects with primary ciliary dyskinesia may experience recurrent middle ear infection, chronic airway infection, predominantly lower-lobe bronchiectasis, male sterility, or situs inversus. Primary ciliary dyskinesia is sometimes difficult to diagnose in cases without situs inversus. Nasal nitric oxide concentration in such patients decreases, although why is unclear. Mutations may involve dynein arm intermediate chain 1 (DNAI1) or dynein arm heavy chain 5 (DNAH5). Mucociliary clearance decreases more in those with otitis media with effusion than in those without, due in part to increased middle ear effusion viscosity. Prognosis is poor in subjects with viscous effusion, which is difficult to clear from the middle ear via the mucociliary system. An understanding of anatomic paranasal sinus variations is thus extremely important in chronic sinusitis when endoscopic sinus surgery is attempted, although recent advances in computed tomography (CT) have enabled paranasal sinus drainage pathways to be delineated more clearly than ever before. (author)

  18. Hearing loss in children with primary ciliary dyskinesia.

    Science.gov (United States)

    Kreicher, Kathryn L; Schopper, Heather K; Naik, Akash N; Hatch, Jonathan L; Meyer, Ted A

    2018-01-01

    To evaluate the type and severity of hearing impairment in pediatric patients with primary ciliary dyskinesia (PCD) and relate these measures to patient demographics, treatment options, and other otologic factors. A retrospective analysis of children with a diagnosis of PCD, Kartagener's syndrome, or situs inversus in the AudGen Database was conducted. Audiograms were analyzed for type of hearing loss (HL), severity, laterality, and progression. Medical charts were reviewed to identify factors that influence severity and progression of hearing loss. 56 patients met inclusion criteria and 42 patients had HL. 66.6% had bilateral and 33.3% had unilateral loss (70 total ears with HL). Conductive hearing loss (CHL) was the most common type of HL, though 30% of children had some sensorineural component to their hearing loss. 92.9% of children with HL received at least one diagnosis of otitis media, but HL did not improve in the majority (77.8%) of ears in our study regardless of ear tube placement. Slight to mild CHL and all types of otitis media are prevalent among patients with PCD, and some of these children have sensorineural hearing loss (SNHL). All patients diagnosed with situs inversus at birth should be evaluated by an otolaryngologist. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Transvenous permanent pacemaker implantation in dextrocardia: technique, challenges, outcome, and a brief review of literature.

    Science.gov (United States)

    Shenthar, Jayaprakash; Rai, Maneesh K; Walia, Rohit; Ghanta, Somasekhar; Sreekumar, Praveen; Reddy, Satish S

    2014-09-01

    Dextrocardia is a rare congenital anomaly. Pacemaker implantation in dextrocardia can be challenging because of the distorted anatomy and associated anomalies. The literature regarding implantation of pacemaker in dextrocardia is scarce. The study involved retrospective analysis of records of patients with dextrocardia who had undergone pacemaker implantation between January 2006 and July 2013 from a single centre. Six patients with dextrocardia (five males and one female) underwent permanent pacemaker implantation (PPI) between January 2006 and July 2013. Of them, three had situs solitus dextrocardia and three situs inversus dextrocardia. All three patients with situs solitus dextrocardia had associated corrected transposition of great arteries. The indication for pacemaker implantation was symptomatic complete atrioventricular (AV) block in four, high-grade AV block in one, and sinus node dysfunction in one patient. A favourable outcome was noted during a mean follow-up of 3.9 years (4 months to 7 years) with one patient needing a pulse generator replacement. Permanent pacemaker implantation in dextrocardia can be challenging because of the distorted anatomy. Use of a technique employing angiography to delineate chamber anatomy and relationship can assist the operator during such difficult PPIs. The medium- and long-term survival after a successful pacemaker implantation in dextrocardia is favourable. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.

  20. Kartagener′s syndrome: A case series

    Directory of Open Access Journals (Sweden)

    Mayank Mishra

    2012-01-01

    Full Text Available Kartagener′s syndrome is a rare, autosomal recessive genetic ciliary disorder comprising the triad of situs inversus, chronic sinusitis, and bronchiectasis. The basic problem lies in the defective movement of cilia, leading to recurrent chest infections, ear/nose/throat symptoms, and infertility. We hereby report three unusual cases of this rare entity - an infertile male with azoospermia in whom Bochdalek′s diaphragmatic hernia coexisted, another case of an infertile female, and a third of an infertile male with oligospermia. The need for a high index of suspicion to make an early diagnosis cannot be overemphasized in such patients so that wherever possible, options for timely treatment of infertility may be offered and unnecessary evaluation of symptoms is avoided.

  1. Creating a Fontan fenestration in a child with dextrocardia and interrupted inferior vena cava

    Directory of Open Access Journals (Sweden)

    Pradeepkumar Charlagorla

    2016-01-01

    Full Text Available Plastic bronchitis is a rare life-threatening complication of the Fontan operation. Transcatheter Fontan fenestration can ameliorate symptoms by decompressing elevated venous pressures. Transcatheter creation of a fenestration can be technically challenging in cases with complex venous anatomy. We report a case of a 5-year-old boy with heterotaxy, dextrocardia with unbalanced atrioventricular canal (AVC, atrial and visceral situs inversus, left-sided superior vena cava (SVC, and left-sided interrupted inferior vena cava (IVC with azygos continuation. With few modifications to the equipment, a successful Fontan fenestration with stent implantation was performed via transjugular approach. At 2-year follow-up, his symptoms of plastic bronchitis improved significantly.

  2. Síndrome de Kartagener: relato de caso

    Directory of Open Access Journals (Sweden)

    Swensson Rubem C.

    2003-01-01

    Full Text Available A Síndrome de Kartagener é causada por uma doença autossômica recessiva rara, que apresenta uma tríade composta por pansinusite crônica, bronquiectasia e situs inversus com dextrocardia. A incidência desta desordem genética é estimada em 1/25.000. Nosso objetivo é, neste trabalho, aduzir dados novos àqueles que pesquisam o assunto, para que estejam atentos, acompanhando os pacientes e esperando o aparecimento eventual desta malformação. Foram realizadas tomografias computadorizadas do tórax, abdome e crânio, além da tomografia computadorizada de alta resolução do tórax, audiometria, imitanciometria e vídeo-naso-fibroscopia.

  3. [Laparoscopic Kasai portoenterostom: present and future of biliary atresia treatment].

    Science.gov (United States)

    Ayuso, L; Vila-Carbó, J J; Lluna, J; Hernández, E; Marco, A

    2008-01-01

    Kasai's operation has proved its value in surgical treatment of biliary atresia (BA). Its laparoscopic approach is a new challenge for pediatric surgeons, with all the potential advantages of minimally invasive surgery. The aim of the present study has been to report our experience in laparoscopic management of five patients with biliary atresia. The average of age of five patients with biliary atresia, three boys and two girls was 58 days (range 40-64). Pre and postoperative management included antibiotic prophylaxis and choleretic treatment. Laparoscopic procedure was accomplished using one umbilical 10-mm trocar and two additional 5-mm trocars. We carried out the same technique in all the patients except in one of them with a total situs inversus and who compelled us to modify the original procedure. All five patients underwent a laparoscopic procedure, conversion was not necessary. The mean surgical time was 3 hours and 40 minutes (range: 5:30 y 3:10). There were not intra operative complications and all of them had a satisfactory recovery, except for the patient with situs inversus, who suffered a small bowel volvulus 9 days after the operation, leading us to perform an extensive bowel resection. All the patients, except this one, showed signs of adequate bile flow, with disappearance of clinical cholestasis. Biochemistry test became normal. Besides the certain advantages compared with conventional surgical procedures (lower surgical damage, diminished post-operative recovery), laparoscopic management of BA, allows a better exposure of the porta hepatis without hepatic mobilization so it shows similar or better preliminary results than conventional techniques. The advantages of laparoscopic portoenterostomy are yet to be proved whenever liver transplantation is indicated.

  4. Síndroma de Kartagener

    Directory of Open Access Journals (Sweden)

    Kattia Cristina Naves

    2005-09-01

    Full Text Available Resumo: Apresentouse para atendimento uma mulher de 48 anos, branca, natural e procedente de Uberaba-MG, com quadro de dispneia em repouso, febre, tosse produtiva, escarro esverdeado e dor torácica ventilatório-dependente há 3 dias. Durante a investigação foi visualizada, em radiograma e tomografia de tórax, presença de dextrocardia e consolidação em lobo inferior direito por processo broncopneumónico. Optou-se por internamento e antibioticoterapia. Prosseguiu-se investigação com realização de tomografia de mastóides e cavidades paranasais que indicaram otomastoidite crónica bilateral e imagens de sinusopatia crónica permitindo diagnosticar um caso de síndroma de Kartagener. O nosso objectivo é aduzir novos dados àqueles que pesquisam o assunto para que estejam atentos ao eventual aparecimento desta malformação.Rev Port Pneumol 2005; XI (5: 499-504 Abstract: A White, 48-year-old woman, natural from Uberaba-MG, presented herself to hospital. She had a picture of rest dispnea, fever, productive cough, greenish catarrh and ventilatory-depend-ent thoracic pain, for 3 days. During investigation, through radiogram and thoracic tomography, it was visualized the presence of dextrocardia and consolidation in low right lobe by bron-chopneumonic process. It was opted for hospitalization and antibiotic therapy. Investigation was carried on with tomography of mastoids and paranasal cavities which showed bilateral chronic otomastoiditis and images of chronic sinusopathty allowing the diagnosis of a case of Kartagener Syndrome. Our purpose in this case report is to include new informations for who search about this syndrome.Rev Port Pneumol 2005; XI (5: 499-504 Palavras-chave: Kartagener, bronquiectasia, situs inversus, dextrocardia, sinusopatia, otomastoidite, Key-words: Kartagener, bronchiectasia, situs inversus,dextrocardia, sinusopathy, ostomastoiditis

  5. Um caso raro de discinesia ciliar primária associada a heterotaxia A rare case of primary ciliary dyskinesia with heterotaxy

    Directory of Open Access Journals (Sweden)

    Cátia Quintela

    2009-01-01

    Full Text Available A discinesia ciliar primária é uma doença autossómica recessiva caracterizada pela história de infecções de repetição do aparelho respiratório superior e inferior, rinossinusite e bronquite associada a situs inversus completo ou parcial. Os autores apresentam um doente de 78 anos, eurocaucasiano, com rinossinusites, bronquite crónica e dispneia, otite média com défices auditivos, infertilidade, seguido em consulta de gastrenterologia por dispepsia e obstipação há vários anos. Realizou vários exames que mostraram: agenesia frontal direita, espessamento brônquico, bronquiectasias, cego e cólon ascendente localizados na fossa ilíaca esquerda. Excluiu-se imunodeficiência, alergias, fibrose quística e outros. No decurso da investigação concluímos que se tratava de um caso de discinesia ciliar primária. Pela raridade deste caso, decidimos apresentá-lo.Primary ciliary dyskinesia is an autosomal recessive disease with a clinical history of upper and lowers respiratory infections, rhinosinusitis and bronquitis associated with complete or partial situs inversus. The authors present a 78-year-old male caucasian patient with rhinosinusitis, lower respiratory tract infection and dyspnea, chronic otitis with hearing deficit and infertility followed in Gastroenterology for dyspepsia and constipation. The radiological studies revealed agenesis of right frontal sinus; bronchial wall thickening; bronchiectasis; cecum and ascending colon located on the left and small bowel occupies right side of abdomen. He had no immunodeficiency, allergies, cystic fibrosis and others. We concluded primary ciliary dyskinesia with heterotaxy. For the rarity of this case we decided to present it.

  6. ASPEK-ASPEK ARKEOLOGIS PADA SITUS-SITUS BERCORAK MEGALITIK DI KAWASAN BANTARKALONG TASIKMALAYA The Archaeological Aspects In The Proximity Of The Megalithic Sites In The Bantarkalong Tasikmalaya

    Directory of Open Access Journals (Sweden)

    Sudarti Prijono

    2016-06-01

    Full Text Available Abstract The Bantarkalong is located in the southern highlands of West Java. The topography of the area is limestone mountains, rivers, arable land, and it contains rocks that are useful resources for mankind. The condition of nature therefore appeals to the past human. This isevidenced by the examples of megalithic tradition sites and remains stone tools. Based on these things then this paper aims to uncover ebout the utilization of spaces related to the existence of human relationships with the natural environment. Next through the theory of adaptation and the paradigm of the scope of the site will be used to discuss this topic. Finally  obtained a summary that theBantarkalong ever used of  space activity takes place asit related to human adaptation.    Keywords: occupation, tool, terraces

  7. Valutazione cinematica intraoperatoria con utilizzo del navigatore e postoperatoria con rsa dinamica nelle protesi totali di ginocchio

    OpenAIRE

    Bruni, Danilo

    2014-01-01

    Restoring a correct implant kinematics and providing a good ligament balance and patellar tracking is mandatory to improve clinical and functional outcome after a Total Knee Replacement. Surgical navigation systems are a reliable and accurate tool to help the surgeon in achieving these goals. The aim of the present study was to use navigation system with an intra-operative surgical protocol to evaluate and determine an optimal implant kinematics during a Total Knee Replacement.

  8. The determination factors of left-right asymmetry disorders- a short review.

    Science.gov (United States)

    Catana, Andreea; Apostu, Adina Patricia

    2017-01-01

    Laterality defects in humans, situs inversus and heterotaxy, are rare disorders, with an incidence of 1:8000 to 1:10 000 in the general population, and a multifactorial etiology. It has been proved that 1.44/10 000 of all cardiac problems are associated with malformations of left-right asymmetry and heterotaxy accounts for 3% of all congenital heart defects. It is considered that defects of situs appear due to genetic and environmental factors. Also, there is evidence that the ciliopathies (defects of structure or function) are involved in development abnormalities. Over 100 genes have been reported to be involved in left-right patterning in model organisms, but only a few are likely to candidate for left-right asymmetry defects in humans. Left-right asymmetry disorders are genetically heterogeneous and have variable manifestations (from asymptomatic to serious clinical problems). The discovery of the right mechanism of left-right development will help explain the clinical complexity and may contribute to a therapy of these disorders.

  9. Vertebrate Left-Right Asymmetry: What Can Nodal Cascade Gene Expression Patterns Tell Us?

    Science.gov (United States)

    Schweickert, Axel; Ott, Tim; Kurz, Sabrina; Tingler, Melanie; Maerker, Markus; Fuhl, Franziska; Blum, Martin

    2017-12-29

    Laterality of inner organs is a wide-spread characteristic of vertebrates and beyond. It is ultimately controlled by the left-asymmetric activation of the Nodal signaling cascade in the lateral plate mesoderm of the neurula stage embryo, which results from a cilia-driven leftward flow of extracellular fluids at the left-right organizer. This scenario is widely accepted for laterality determination in wildtype specimens. Deviations from this norm come in different flavors. At the level of organ morphogenesis, laterality may be inverted (situs inversus) or non-concordant with respect to the main body axis (situs ambiguus or heterotaxia). At the level of Nodal cascade gene activation, expression may be inverted, bilaterally induced, or absent. In a given genetic situation, patterns may be randomized or predominantly lacking laterality (absence or bilateral activation). We propose that the distributions of patterns observed may be indicative of the underlying molecular defects, with randomizations being primarily caused by defects in the flow-generating ciliary set-up, and symmetrical patterns being the result of impaired flow sensing, on the left, the right, or both sides. This prediction, the reasoning of which is detailed in this review, pinpoints functions of genes whose role in laterality determination have remained obscure.

  10. PEMBERDAYAAN MASYARAKAT UNTUK BERPARTISIPASI DALAM PELESTARIAN SITUS PATIAYAM DI KABUPATEN KUDUS

    Directory of Open Access Journals (Sweden)

    Widiyati dan Wasino

    2011-10-01

    Full Text Available The results showed that groups who empowered society are Department of Culture and Tourism is Kudus Regency, Site Conservation Forum Patiayam, interpreters maintained, and the Society of Conservation Society Patiayam Site. Form of empowerment to do is socialize Heritage Law, the socialization of the Master Plan which is equipped with RTBL, to socialize and fossil sites Patiayam, lift the savior maintain Patiayam fossils at the site, and create a mini museum Patiayam site. Studies on community participation suggests that public understanding of the importance of the Patiayam as Heritage Objects, including the criteria to be positive both in terms of preservation Patiayam site. Public awareness in the form of active participation in preserving good sites including Patiayam. Active participation in preserving good sites that carry the impact of the sustainability of the site remains in preventive and curative.   Keywords: empowerment, society, sites, patiayam  

  11. Kaassõna keeleuurija ja -kasutaja käsituses / Külli Habicht, Pille Penjam

    Index Scriptorium Estoniae

    Habicht, Külli, 1964-

    2007-01-01

    Uuritakse kaassõnade eelneva nimi- või asesõnaga kokkukirjutamise tendentsi ning seda analüüsitakse grammatiseerumis- ja leksikaliseerumisteooria valguses. Lisana toodud küsimustik kaassõnade kokkukirjutamise leviku uurimiseks

  12. BUDAYA KERJA GURU PENDIDIKAN DASAR UNGGUL (Studi Situs SMP Negeri 1 Gunung Jati Cirebon

    Directory of Open Access Journals (Sweden)

    Sri Handayani

    2015-07-01

    Full Text Available This study is aimed at describing the working culture of administration, teaching learning activities, and evaluating the teaching learning process of accelerated class of SMP 1 Gunung Jati Cirebon teachers in doing their job. This study applies the qualitative of ethnographic that is to see directly the working culture of the subject of the study such as their behavior, their motivation, their perception and their action related to good teachers working culture. The data are taken from interviews with teachers, documents related of teachers job, and field study. In collecting the data, the researcher carried our interview with teachers, doing some observations, and study the documents related to teachers’ job. The data are analyzed and tested using credibility, dependability, and confirm ability tests.The results of the study are: (1 the teachers working culture in doing their administrative means how a teacher increases work such as developing syllabus, making lesson plan, developing indicators, and developing teachers materials. Teachers’ working culture in developing their administration work are developed in school and region teacher forum; (2 teachers working culture in teaching learning activities means how teacher increases work such as make, introduction activity, core activity, and final activity in the teaching and learning process as indicated by the curriculum. (3 teachers working culture in evaluating the teaching learning process means how teacher increases work such as compilation planning of assessment and execution of assessment. The study suggests: (1 the headmaster should give opportunities for teacher to develop their work so that they can contribute to the administration, classroom teaching learning process, evaluation and analysis; (2 the teachers can improve their work such as the administration, classroom teaching learning process, and evaluation of study with activities or constructions by school, duty education, and related institute; (3 the researcher, moreover, should conduct the study concerning the teacher working culture better.

  13. PERLINDUNGAN HUKUM BAGI KONSUMEN BERKAITAN DENGAN PENCANTUMAN DISCLAIMER OLEH PELAKU USAHA DALAM SITUS INTERNET (WEBSITE

    Directory of Open Access Journals (Sweden)

    Ni Putu Ria Dewi Marheni

    2014-04-01

    Full Text Available This Research is entitled “Legal Protection for Consumers Related to the Inclusion of Disclaimer by Business Owner in Website”. The problems of the present study are: first, how the inclusion of disclaimer in websites in Indonesia is like; second, what the legal protection for consumers related to the inclusion of disclaimer by business owner in websites is like. The method used in the present study is the normative legal research. The results of the study showed: first, no norm regulating disclaimer in the Act Number 11 of 2008 concerning the electronic information and transaction which specifically regulate activities in the cyberspace. However, if generally viewed from the protection for consumers in the Act Number 8 of 1999 concerning Protection for Consumers, most inclusions of disclaimer in the website is classified as exoneration clausal which is partially prepared by business agents to avoid what they are supposed to be responsible for. Second, the form of legal protection needed by consumers in the internet is still weak. However, the general legal protection for consumers may be provided through: a Being preventive:  Reliability Certification Board ‘Lembaga Sertifikasi Keandalan’(LSK which is supposed to give certification for every internet site already regulated by the Regulation of the Republic of Indonesia Number 82 of 2012 concerning the Implementation of Electronic System and Transaction  which is a derivative of Article 10 clause (2 of the Act Number 11 of 2008 concerning Electronic Information and Transaction; b being repressive: through Litigation Lane which may be done by submitting a civil suit and civil sanction based on the Act Number 11 of 2008 concerning Electronic Information and Transaction. Another alternative is through the Non Litigation lane, that is, the Arbitrate Lane, which is settled using the Alternative of Dispute Settlement

  14. HUBUNGAN ANTARA KECENDERUNGAN PERILAKU MENGAKSES SITUS PORNO DAN RELIGIUSITAS PADA REMAJA

    OpenAIRE

    Rahmawati, Diah Viska; Hadjam, M Noor Rochman; Afiatin, Tina

    2013-01-01

    The main purpose of this research is to see the correlations between tendency to access porn site and religiousity in adolescent. Total research subject is 83 users of Cupido and Intersat Nusantara Cyber Cafe. Research variables are measured by scale method, those are Tendency to Access Porn Site Scale which consists 48 items composed by researcher herself and Religiousity Scale by Turmudhi (1991). Religiousity Scale consists of 2 part, the first part contains 68 items with 12 pairs identical...

  15. Hubungan Antara Kecenderungan Perilaku Mengakses Situs Porno Dan Religiusitas Pada Remaja

    OpenAIRE

    Rahmawati, Diah Viska; Hadjam, M Noor Rochman; Afiatin, Tina

    2002-01-01

    The main purpose of this research is to see the correlations between tendency to access porn site and religiousity in adolescent. Total research subject is 83 users of Cupido and Intersat Nusantara Cyber Cafe. Research variables are measured by scale method, those are Tendency to Access Porn Site Scale which consists 48 items composed by researcher herself and Religiousity Scale by Turmudhi (1991). Religiousity Scale consists of 2 part, the first part contains 68 items with 12 pairs identical...

  16. Analisis dan Perencanaan Konsep Strategi Content Management Cyberwoman pada Situs Portal CBN.Net.Id

    Directory of Open Access Journals (Sweden)

    Suryadiputra Liawatimena

    2007-03-01

    Full Text Available Article discusses how the CyberWoman management strategy on CBN portal site to serve many information, service, and recovery concept that will be used for its better growing. The article purposes are to know whether the content management strategy of portal site applied by CBN, especially for CyberWoman, has been running well or not and also give a recovery concept in the future. The conclusion indicates that the CBN have opportunity and strength that can be used and the CBN portal site is in the state of growing. Therefore, the applied strategy is an aggressive growing policy strategy and concentration strategy through horizontal integration.

  17. Survey Tingkat Penggunaan Single Sign On pada 500 Situs Peringkat Teratas Alexa.com

    Directory of Open Access Journals (Sweden)

    I Wayan Manik Suhartanta

    2017-04-01

    Full Text Available Advances in Internet technology has provided a new market for the growth of the service provider. New sites appear in large numbers every year. This gives a new problem for users of the service. Users are forced to memorize many username and password to access the service. Overcoming it is a new emerging technology, the technology called Single Sign On (SSO. SSO offers simple authentication process for users to access many services sites. But the level of confidence of users and service providers, in the use of SSO technology have not been investigated. In this research shows that the rate of utilizing the SSO technology of the top 500 sites on alexa.com by 31% (155 websites. And the level of utilization of the SSO more than one provider, by 41%. In studies it appears that the most used SSO services provider is google followed by facebook and twitter. (turnitin check 9% Keyword— Single Sign On (SSO, Computer Security, Authentication DOI: 10.24843/MITE.1601.07

  18. Evaluasi Pengungkapan Laporan Keuangan Daerah di Situs Internet: Studi pada Pemerintah Daerah Indonesia

    Directory of Open Access Journals (Sweden)

    Gatot Soepriyanto

    2011-05-01

    Full Text Available The purpose of this study was to determine the extent of financial statement disclosure displayed on the website of local government in the years 2009-2010. The research method used is bibliography study and field study through the Internet. We found 2 types of financial information presented in the website, namely the information of financial statements and other financial information. There are 57 local governments that provide financial information from 392 local governments’ website. The 57 local government web sites, only nine local governments that provide information on its financial statements in accordance to SAP (Government Accounting Standards, while 40 local governments provide information on local government budgets (APBD and 8 present the financial information other than financial statements according to SAP and budget information (APBD. These findings suggest that transparency and accountability of local governments related to the financial statements and other financial information on the website is still lacking. 

  19. Juhan Liivi käsitus luulekunstist / Juhan Liiv's Conception of Poetics

    Directory of Open Access Journals (Sweden)

    Tanar Kirs

    2016-01-01

    The final section of this paper deals with Liiv’s understanding of poetics. When observing poetry in ”Marginalia“, Liiv first examines the smallest poetic unit—the poetic word—and then attempts to define poetic wording. According to Liiv, the most important function of the poetic word is the referential function, and the poetic function is only as important as its ability to amplify the referential function of a word. He claims that it is unnecessary to distinguish a word with poetic devices or highlight the wording of the poem itself; rather, words should be made invisible in order to bring their meaning to the foreground. The poetic function aims to simplify word use and applies to an entire poem: just as an individual word should be simple and referential, so too must the whole of the poem and its expression. Liiv also analyses how to use specific poetic devices to achieve simplicity in expression. He stresses the ”plasticity“ of expression as an integral means of communicating the experience one wishes to portray and exemplifies this idea in a section of his essay detailing poetic technique and imagery in which he describes how to clearly and exactly express ”plastic“ depictions in poetics. First he argues the necessity of a cornerstone image, meaning the ability to create space for that which is being described, thereby allowing the image in a piece to work. He also draws attention to the importance of contrast in poetry, which occurs with the use of two poetic techniques that he calls ”subtraction“ and ”addition.“ With subtraction, one presents the concepts individually in order for them to have greater poetic influence; whereas, with addition, these individual images are presented together. Liiv’s handling of poetic language could be called simplified poetics, as the significance of art is hidden in its simplicity. Simplified poetics works in combination with his broader aesthetic framework: the goal is to portray simple things using intrinsically simple and influencial expressions.

  20. Kepuasan Mahasiswa Telkom University Dalam Pemanfaatan Situs Smb.telkomuniversity.ac.id Sebagai Media Informasi

    OpenAIRE

    Putra, Raditya Pratama; Putri, Yuliani Rachma

    2015-01-01

    Proses komunikasi saat ini semakin berkembang dengan memanfaatkan teknologi yang memadukan antara teknologi informasi dan teknologi komunikasi sehingga muncul istilah Teknologi Informasi dan Komunikasi (TIK). Teknologi tersebut melahirkan sebuah sarana yaitu internet. Masyarakat menggunakan media, didasari oleh motif sebagai harapan khalayak ketika menggunakan media, dan kesenjangan kepuasan khalayak setelah menggunakan media. Tujuan penelitian ini untuk mengetahui motif informasi, motif iden...

  1. PERBINCANGAN MENGENAI HUKUMAN MATI TERKAIT KASUS BALI NINE DAN MARY JANE DALAM SITUS JEJARING SOSIAL TWITTER

    Directory of Open Access Journals (Sweden)

    Jimi Narotama Mahameruaji

    2016-06-01

    Full Text Available Twitter telah menjadi alat atau media komunikasi yang sangat populer diantara para pengguna Internet. Melalui Twitter, penggunanya dapat berbagi cerita hidup mereka sehari-hari, melakukan perbincangan dengan pengguna lain dan juga mengekspresikan pendapat mereka. Twitter juga dapat dilihat sebagai sebuah wadah untuk melakukan perbincangan politik dan isu-isu publik. Oleh karena itu, peran Twitter terkait partisipasi publik, kampanye, dan pembentukan opini publik kini semakin diperhitungkan (Jungherr, 2015. Fokus penelitian ini tentang perbincangan para pengguna Twitter di Indonesia mengenai peristiwa hukuman mati kasus narkoba Bali Nine dan Mary Jane. Penelitian ini bertujuan untuk mengetahui apa ragam perbincangan yang terjadi di antara para pengguna Twitter Indonesia terkait kasus hukuman mati tersebut, apa argumen yang muncul terkait penolakan maupun dukungan terhadap isu hukuman mati, dan juga siapa saja Twitter Influencer yang berperan dalam isu ini.   DOI: 10.24198/jkk.vol4n1.5

  2. Boundedness dan Polusi pada Situs Islam Cirebon Abad XVI—XVIII

    Directory of Open Access Journals (Sweden)

    Irmawati M. Johan

    2007-10-01

    Full Text Available Archaeological sites are the traces of people ‘s lives in the past. The remaining traces are texts, simply waiting to be read. This article tries to interpret the housing patterns in the sites of palaces in Cirebon using the concepts of boundedness, the sacred, the profane, and the pollution.

  3. Ziarah Perspektif Kajian Budaya (Studi Pada Situs Makam Mbah Priuk Jakarta Utara

    Directory of Open Access Journals (Sweden)

    Syahdan Syahdan

    2017-06-01

    Full Text Available Pilgrimage in this study tries to investigate from the perspective of cultural study, they are form (significant, function (application, interaction and meaning (signifie. This study aimed to obtain information about the process of pilgrimage ritual at the tomb of Mbah Priuk, also trying to comprehend the function and meaning contained in the pilgrimage ritual activities conducted at the tomb of Mbah Priuk. The results obtained in this study show that all the informants who researcher encountered have similar view about Mbah Priuk. The people’s motive who do pilgrimage, in general, is to pray and make Mbah Priuk as a mediator. The unique ritual done by pilgrims is throwing banknotes or coins into a small pond. In this ritual many pilgrims choose the pool eventhough there is already a place to put the money provided by the cemetary organizer. 

  4. PENGELOLAAN AKREDITASI SEKOLAH (STUDI SITUS SD NEGERI 2 MRANTI KECAMATAN PURWOREJO KABUPATEN PURWOREJO

    Directory of Open Access Journals (Sweden)

    Supriyatno Supriyatno

    2015-07-01

    Full Text Available The onjectives of this research are to describe (1 the preparation of school self-evaluation in improving school accreditation; (2 The visitation in improving school accreditation; (3 The results of school accreditation. The type of the research is qualitative and uses ethnography design. The site of the study is SD Negeri 2 Mranti Purworejo District, Purworejo. Techniques for collecting data used are interviews, observations, and documentation. The results of this research are as follows: (1 Preparation of school self-evaluation is conducted by a special team formed by the principal. The preparation done before the new school year, it takes place by collecting data from the SNP. EDS is consisting of EDS instrument and the physical evidence for each item SNP. The preparation is conducted byhaving a checklist for each item in the SNPs form that describes the real condition of the school; (2 the visitation process in improving schools accreditation runs smoothly and according to the procedure. The process begins with the submission of the letter that comes with the implementation of the accreditation document to School Accreditation Association (BAS of district; (3 the accreditation result increases from 79 in 2005 to 86.81 in 2010.

  5. Magnetic resonance imaging of acute myocardial infarction in dextrocardia with situs solitus (dextroversion)

    International Nuclear Information System (INIS)

    Salanitri, J.C.; Welker, M.; Pereles, F.S.

    2005-01-01

    The case report of an 88-year-old woman with dextroversion and acute anterior wall myocardial infarction is presented. The patient, who had been diagnosed with dextrocardia 3 years prior to this admission, presented with right-sided chest pain. Coronary angiography demonstrated an 80% proximal left anterior descending artery stenosis which was successfully stented. A cardiac MRI was performed to exclude a left atrial thrombus after an inconclusive echocardiogram. The MRI demonstrated findings consistent with dextroversion, with delayed contrast-enhanced viability sequences confirming a near transmural anterior wall myocardial infarct. To our knowledge, this is the first report illustrating the cardiac MRI findings in such a case. Copyright (2005) Blackwell Science Pty Ltd

  6. MARKET BASKET ANALYSIS (MBA PADA SITUS WEB E-COMMERCE ZAKIYAH COLLECTION

    Directory of Open Access Journals (Sweden)

    Ari Muzakir

    2016-11-01

    Full Text Available E-commerce menghubungkan antara produsen dengan produsen, produsen dengan konsumen, konsumen dengan produsen, konsumen dengan konsumen. Untuk mengimplementasi e-commerce dalam mendukung bisnis organisasi perlu di perhatikan 5 komponen utama yaitu ; pengembangan produk, promosi, transaksi online, product delivery dan after sales support. Hal ini yang tengah diterapkan pada Zakiyah Collection. Zakiyah Collection bergerak dibidang penjualan aneka macam kain khas Palembang seperti songket, blongket,tanjung, dan lain sebagainya. Untuk melakukan analisis terhadap pangsa pasar yang ada agar dapat bersaing dengan toko online lainnya dilakukan dengan strategi pemasaran dengan menggunakan pendekatan market basket analysis (MBA. MBA merupakan salah satu teknik dari data mining yang digunakan untuk menentukan produk-produk manakah yang akan dibeli oleh pelanggan secara bersamaan dengan melakukan analisa terhadap daftar transaksi pelanggan. Dengan mengetahui produk-produk tersebut, maka sebuah sistem e-commerce dapat membuat maupun mengembangkan sebuah sistem customer profiles dan dapat menentukan layout katalog pelanggannya sendiri. Model pengembangan sistem yang dilakukan menggunakan prototype dimana pelanggan dan pengguna akan dilibatkan secara langsung dalam proses ini. Hasil akhir dalam penelitian ini adalah berupa analisis data transaksi menggunakan market basket analysis dengan dilakukan 4 kali kombinasi produk yang berdasarkan nilai support x confidence terbesar dengan hasil berupa angka-angka kemungkinan transasksi yang berkaitan dengan produk yang dijual. Jika dengan menggunakan 1 kali kombinasi, maka didapatkan blongket dengan nilai support sebesar 0.5625. Jika dilakukan 2 kali kombinasi diperoleh kombinasi blongket dan songket dengan nilai support 0.375. Kata kunci: e-commerce, market basket analysis, association rules.

  7. Analisis Pengaruh Faktor Kognitif dan Faktor Afektif terhadap Usability Situs E-Commerce

    OpenAIRE

    Prayogo, Putra Indra; Susanto, Novie; Sriyanto, Sriyanto

    2015-01-01

    The development of the internet facility now be used for the activity of trade (commerce) by makes e-commerce sites. E-commerce site serves an electronic transaction of sale and purchase from producers to consumers must have good USAbility value so ease of use. The development site is now considered not only focus on the ease of use (cognitive) but required a development of the emotional side (affective) so that users feel are interested in using these sites. For testing the influence of cogn...

  8. Sotsioloogiline käsitus ja erakonnakonkurentsi kujundavad tuumkonfliktid Eestis ja mujal Euroopas / Tõnis Saarts

    Index Scriptorium Estoniae

    Saarts, Tõnis, 1978-

    2017-01-01

    Artikkel põhineb autori doktoritööl "The Sociological Approach in Party System Analysis: The Baltic Sates in the Central and Eastern European Context", mis kaitsti Tallinna Ülikooli ühiskonnateaduste instituudis 20.04. 2017

  9. Pendidikan Tata Rias Pengantin (Studi Situs Pengelolaan pada LKP Moncar Surakarta

    Directory of Open Access Journals (Sweden)

    Wahyu Ari Indriastuti

    2015-07-01

    Full Text Available This research aimed to describe characteristics of (1 education planning; (2 education organizing; (3 education implementation; (4 education evaluation; and (5 supporting and inhibiting factors for education bridal makeup at LKP Mon- car. Type of research is a qualitative with an ethnographic approach. Implementation research in LKP Moncar Surakarta. Informants were chosen are the owner of LKP Moncar, learners, instructure. The validity of the data using source triangulation tech- niques and triangulation method. The conclusions of this research are characteristics of education bridal makeup in LKP Moncar Surakarta (1 education planning through ideas, acceptance of new students, and preparing educational bridal makeup materials are arranged in the form of Teaching Education (Unit Satuan Ajar Pendidikan/ SAP; education organizing done by placing instructors to handle incoming new students and handling facility management skills institutions, infrastructure, media learning and personnel and the distribution of skill levels of learners to all instructors and organize training agenda and organize training agenda and competition schedules based on each competition to the instructor; (3 education implementation in are procurement, usage, maintenance, and removal of owned skills institutions and achievement social- ization to new students also move instructors to carry out activities to achieve the target graduation; (4 education evaluation is done through planning and implementa- tion of admission new students and refers to skills attainment, graduation rates, and acquisition grades of student while monitoring the performance of team success; and (5 Factors supporting education at LKP Moncar is the support of family (husband and children, cost of teaching and learning needs is low, learning facilities bridal makeup does not always use the media and certain brands, and inhibiting factor for education is the difficulty of obtaining student.

  10. Pemanfaatan Situs Web Resmi Lembaga Pendidikan sebagai Sumber Berita oleh Wartawan Surat Kabar Lokal di Yogyakarta

    Directory of Open Access Journals (Sweden)

    Narayana Mahendra Prastya

    2017-07-01

    Full Text Available This resarch based on concept that stated internet give organization advantages in media relations activities. Educational institution being chosen because media relations is important for them. This research uses descriptive qualitative method. The data-collecting technique is interview. The informant of the interview is representative from newsroom local newspapers in Yogyakarta. The research result shows that informant give their trust to official website from educational organization. Informant use the information to explore the issue and/or as alternative when they face condition lack of news. Informant also criticize the information quality and the structure of information that published on official website.

  11. Um caso raro de discinesia ciliar primária associada a heterotaxia

    Directory of Open Access Journals (Sweden)

    Cátia Quintela

    2009-01-01

    Full Text Available Resumo: A discinesia ciliar primária é uma doença autossómica recessiva caracterizada pela história de infecções de repetição do aparelho respiratório superior e inferior, rinossinusite e bronquite associada a situs inversus completo ou parcial. Os autores apresentam um doente de 78 anos, eurocaucasiano, com rinossinusites, bronquite crónica e dispneia, otite média com défices auditivos, infertilidade, seguido em consulta de gastrenterologia por dispepsia e obstipação há vários anos. Realizou vários exames que mostraram: agenesia frontal direita, espessamento brônquico, bronquiectasias, cego e cólon ascendente localizados na fossa ilíaca esquerda. Excluiu-se imunodeficiência, alergias, fibrose quística e outros. No decurso da investigação concluímos que se tratava de um caso de discinesia ciliar primária. Pela raridade deste caso, decidimos apresentá-lo.Rev Port Pneumol 2009; XV (1: 115-120 Abstract: Primary ciliary dyskinesia is an autosomal recessive disease with a clinical history of upper and lowers respiratory infections, rhinosinusitis and bronquitis associated with complete or partial situs inversus. The authors present a 78-year-old male caucasian patient with rhinosinusitis, lower respiratory tract infection and dyspnea, chronic otitis with hearing deficit and infertility followed in Gastroenterology for dyspepsia and constipation. The radiological studies revealed agenesis of right frontal sinus; bronchial wall thickening; bronchiectasis; cecum and ascending colon located on the left and small bowel occupies right side of abdomen. He had no immunodeficiency, allergies, cystic fibrosis and others. We concluded primary ciliary dyskinesia with heterotaxy. For the rarity of this case we decided to present it.Rev Port Pneumol 2009; XV (1: 115-120 Palavras-chave: Discinesia ciliar primária, heterotaxia, Key-words: Primary ciliary dyskinesia, heterotaxy

  12. Um caso raro de discinesia ciliar primária associada a heterotaxia

    Directory of Open Access Journals (Sweden)

    Cátia Quintela

    2009-01-01

    Full Text Available Resumo: A discinesia ciliar primária é uma doença autossómica recessiva caracterizada pela história de infecções de repetição do aparelho respiratório superior e inferior, rinossinusite e bronquite associada a situs inversus completo ou parcial. Os autores apresentam um doen te de 78 anos, eurocaucasiano, com rinossinusites, bronquite crónica e dispneia, otite média com défices auditivos, infertilidade, seguido em consulta de gastrenterologia por dispepsia e obstipação há vários anos. Realizou vários exames que mostraram: agenesia frontal direita, espessamento brônquico, bronquiectasias, cego e cólon ascendente localizados na fossa ilíaca esquerda. Excluiu-se imunodeficiência, alergias, fibrose quística e outros. No decurso da investigação concluímos que se tratava de um caso de discinesia ciliar primária. Pela raridade deste caso, decidimos apresentá-lo. Abstract: Primary ciliary dyskinesia is an autosomal recessive disease with a clinical history of upper and lowers respiratory infections, rhinosinusitis and bronquitis associated with complete or partial situs inversus. The authors present a 78-year-old male caucasian patient with rhinosinusitis, lower respiratory tract infection and dyspnea, chronic otitis with hearing deficit and infertility followed in Gastroenterology for dyspepsia and constipation. The radiological studies revealed agenesis of right frontal sinus; bronchial wall thickening; bronchiectasis; cecum and ascending colon located on the left and small bowel occupies right side of abdomen. He had no immunodeficiency, allergies, cystic fibrosis and others. We concluded primary ciliary dyskinesia with heterotaxy. For the rarity of this case we decided to present it. Palavras-chave: Discinesia ciliar primária, heterotaxia, Key-words: Primary ciliary dyskinesia, heterotaxy

  13. Radiological evaluation of double-outlet right ventricle - An analysis of cinecardioangiography in 44 cases -

    Energy Technology Data Exchange (ETDEWEB)

    Park, Cheong Hee; Yeon, Kyung Mo; Han, Man Chung [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1984-03-15

    Double-outlet right ventricle is defined as follows: both great arteries arise completely or nearly completely from the right ventricle; neither semilunar valve is in fibrous continuity with either atrioventricular valve; and usually a ventricular septal defect is present and the only outlet from the left ventricle. A total of 44 cases of double-outlet right ventricle is analyzed, in which cineangiocardiographies were done at the Department of Radiology, Seoul National University Hospital in recent 4 year and 6 months, with specific reference to the segmental combinations, the height of conus, the relationship of great arteries, the location of ventricular septal defects, and associated anomalies. The results were as follows; 1. Among 44 cases, 36 cases had normal cardiac position, 4 cases had dextrocardia with situs inversus 2 cases had dextrocardia with situs solitus, 1 case had levocardia with situs inversus, and another 1 case had mesocardia with situs ambiguus. 2. Segmental sets were [S,D,D] in 36 cases, [I,L,L] in 3 cases, [I,D,D] in 2 cases, [S,D,L], [S,L,L] and [A,D,D] in 1 case respectively. 3. All cases had bilateral conus. Aortic valve rings were same level as pulmonary valve rings in 25 cases, lower than pulmonary valve rings in 17 cases in which 15 cases were type A., and higher than pulmonary valve rings in 2 cases. 4. The relation of the great arteries were normal in 15 cases, side-by-side in 13 cases, dextromalposition in 13 cases, and levomal position in 3 cases. 5. The position of the ventricular septal defects with respect to the origins of the great arteries is subaortic (type A and type B) in 23 cases, subpulmonary (type C) in 13 cases, doubly committed (type D) in 3 cases, and uncommitted (type E) in 5 cases. 6. Associated cardiac malformations are pulmonary stenosis in 24 which had all cases of type A and type E, aortic stenosis in 6 which were only in type C, left SVC in 6, abnormality of atrioventricular valve in 5, single coronary artery

  14. Left-right symmetry breaking in mice by left-right dynein may occur via a biased chromatid segregation mechanism, without directly involving the Nodal gene

    Energy Technology Data Exchange (ETDEWEB)

    Sauer, Stephan; Klar, Amar J. S., E-mail: sauers@mail.nih.gov, E-mail: klara@mail.nih.gov [Gene Regulation and Chromosome Biology Laboratory, Frederick National Laboratory for Cancer Research, Frederick, MD (United States)

    2012-11-16

    Ever since cloning the classic iv (inversedviscerum) mutation identified the “left-right dynein” (lrd) gene in mice, most research on body laterality determination has focused on its function in motile cilia at the node embryonic organizer. This model is attractive, as it links chirality of cilia architecture to asymmetry development. However, lrd is also expressed in blastocysts and embryonic stem cells, where it was shown to bias the segregation of recombined sister chromatids away from each other in mitosis. These data suggested that lrd is part of a cellular mechanism that recognizes and selectively segregates sister chromatids based on their replication history: old “Watson” versus old “Crick” strands. We previously proposed that the mouse left-right axis is established via an asymmetric cell division prior to/or during gastrulation. In this model, left-right dynein selectively segregates epigenetically differentiated sister chromatids harboring a hypothetical “left-right axis development 1” (“lra1”) gene during the left-right axis establishing cell division. Here, asymmetry development would be ultimately governed by the chirality of the cytoskeleton and the DNA molecule. Our model predicts that randomization of chromatid segregation in lrd mutants should produce embryos with 25% situs solitus, 25% situs inversus, and 50% embryonic death due to heterotaxia and isomerism. Here we confirmed this prediction by using two distinct lrd mutant alleles. Other than lrd, thus far Nodal gene is the most upstream function implicated in visceral organs laterality determination. We next tested whether the Nodal gene constitutes the lra1 gene hypothesized in the model by testing mutant’s effect on 50% embryonic lethality observed in lrd mutants. Since Nodal mutation did not suppress lethality, we conclude that Nodal is not equivalent to the lra1 gene. In summary, we describe the origin of 50% lethality in lrd mutant mice not yet explained by any other

  15. Left-right symmetry breaking in mice by left-right dynein may occur via a biased chromatid segregation mechanism, without directly involving the Nodal gene

    Directory of Open Access Journals (Sweden)

    Stephan eSauer

    2012-11-01

    Full Text Available Ever since cloning the classic iv mutation identified the ‘left-right dynein’ (lrd gene in mice, most research on body laterality determination has focused on its function in motile cilia at the node embryonic organizer. This model is attractive, as it links chirality of cilia architecture to asymmetry development. However, lrd is also expressed in blastocysts and embryonic stem cells, where it was shown to bias the segregation of recombined sister chromatids away from each other in mitosis. These data suggested that lrd is part of a cellular mechanism that recognizes and selectively segregates sister chromatids based on their replication history: old ‘Watson’ vs. old ‘Crick’ strands. We previously proposed that the mouse left-right axis is established via an asymmetric cell division prior to/or during gastrulation. In this model, left-right dynein selectively segregates epigenetically differentiated sister chromatids harboring a hypothetical ‘left-right axis development 1’ (‘lra1’ gene during the left-right axis establishing cell division. Here, asymmetry development would be ultimately governed by the chirality of the cytoskeleton and the DNA molecule. Our model predicts that randomization of chromatid segregation in lrd mutants should produce embryos with 25% situs solitus, 25% situs inversus, and 50% embryonic death due to heterotaxia and isomerism. Here we confirmed this prediction by using two distinct lrd mutant alleles. Other than lrd, thus far Nodal gene is the most upstream function implicated in visceral organs laterality determination. We next tested whether the Nodal gene constitutes the lra1 gene hypothesized in the model by testing mutant’s effect on 50% embryonic lethality observed in lrd mutants. Since Nodal mutation did not suppress lethality, we conclude that Nodal is not equivalent to the lra1 gene. In summary, we describe the origin of 50% lethality in lrd mutant mice not yet explained by any other

  16. Left-right symmetry breaking in mice by left-right dynein may occur via a biased chromatid segregation mechanism, without directly involving the Nodal gene

    International Nuclear Information System (INIS)

    Sauer, Stephan; Klar, Amar J. S.

    2012-01-01

    Ever since cloning the classic iv (inversedviscerum) mutation identified the “left-right dynein” (lrd) gene in mice, most research on body laterality determination has focused on its function in motile cilia at the node embryonic organizer. This model is attractive, as it links chirality of cilia architecture to asymmetry development. However, lrd is also expressed in blastocysts and embryonic stem cells, where it was shown to bias the segregation of recombined sister chromatids away from each other in mitosis. These data suggested that lrd is part of a cellular mechanism that recognizes and selectively segregates sister chromatids based on their replication history: old “Watson” versus old “Crick” strands. We previously proposed that the mouse left-right axis is established via an asymmetric cell division prior to/or during gastrulation. In this model, left-right dynein selectively segregates epigenetically differentiated sister chromatids harboring a hypothetical “left-right axis development 1” (“lra1”) gene during the left-right axis establishing cell division. Here, asymmetry development would be ultimately governed by the chirality of the cytoskeleton and the DNA molecule. Our model predicts that randomization of chromatid segregation in lrd mutants should produce embryos with 25% situs solitus, 25% situs inversus, and 50% embryonic death due to heterotaxia and isomerism. Here we confirmed this prediction by using two distinct lrd mutant alleles. Other than lrd, thus far Nodal gene is the most upstream function implicated in visceral organs laterality determination. We next tested whether the Nodal gene constitutes the lra1 gene hypothesized in the model by testing mutant’s effect on 50% embryonic lethality observed in lrd mutants. Since Nodal mutation did not suppress lethality, we conclude that Nodal is not equivalent to the lra1 gene. In summary, we describe the origin of 50% lethality in lrd mutant mice not yet explained by any other

  17. Situs Blog Pribadi www.dianrainbow.blogspot.com dan Minat Menggunakan Jilbab (Studi Korelasional Pengaruh Situs Blog Pribadi www.dianrainbow.blogspot.com Terhadap Minat Menggunakan Jilbab Pada Mahasiswi Fakultas Keguruan Ilmu Pendidikan Universitas Muhammadyah Sumatera Utara).

    OpenAIRE

    Padang, Putri Sri Wahyuni

    2014-01-01

    The study entitled The Site of Personal Blog www.dianrainbow.blogspot.com and Interest of Using a Hijab (The Study of Correlational About Influence The Site of Personal Blog www.dianrainbow.blogspot.com Against The Interest of Using a Hijab On Coed Faculty of teacher training Education in North Sumatra Muhammadiyah University). Researchers used several theories relevant to research that is: The Uses and Gratifications Theory, Communications Technology, The Internet, Blogs and The Site of ...

  18. PENGGUNAAN SITUS WEB HOTEL DAN “ONLINE TRAVEL AGENCY” SEBAGAI MEDIA PROMOSI DAN PENJUALAN BAGI HOTEL MELATI DI UBUD

    Directory of Open Access Journals (Sweden)

    Pande Putu Indrayana Tirtayasa

    2016-08-01

    Full Text Available The growth of the number of hotel rooms in Ubud has caused increasing business competition among the so called non-star melati hotel.Non-star melati hotel is a category of hotel which is not qualified to be awarded as a star hotel by Indonesian Ministry of Tourism.In response to the competition, the hotels embrace internet as a sales and promotion media by developing hotel websites.Individual tourism trend ignites the emergence of online travel agency websites (OTA which used by tourists to compare and choose hotels thus increasing the importance of internet as a channel for selling and promoting hotel products.The purposes of this research are to identify motivation, perception, advantages and disadvantages of hotel website and OTA by non-star melati hotel operator’s perspective.Theories used are motivation, perception, and SWOT theory. Data was analyzed with descriptive qualitative method.Results show that hotel website and OTA have its own advantages and disadvantages. Motivation in using hotel website and OTA are very high.Perception in using hotel website and OTA are very agree. It is advised that hotels need to focus more on using OTA as source of getting guests, but also using hotel website, together as medium for promotion and sales activities.

  19. Penggabungan Konsep Web 2.0 dan Mashup dalam Pembuatan Situs Dinas Kebudayaan dan Pariwisata Provinsi DKI Jakarta

    Directory of Open Access Journals (Sweden)

    Bayu Kanigoro

    2011-06-01

    Full Text Available This study aims to design a website of the Jakarta regional office of Culture and Tourism by combining the concept of web 2.0 and mashup. This concept combines several APIs (Application Programming Interface into a new application. The APIs used are Facebook, Google Maps, Twitter, and Yahoo Weather. The created site applies the latest technology and advanced multimedia elements. With the combination of all elements above, a more interactive and dynamic site is succesfully obtained. 

  20. ERK Regulates Renal Cell Proliferation and Renal Cyst Expansion in inv Mutant Mice

    International Nuclear Information System (INIS)

    Okumura, Yasuko; Sugiyama, Noriyuki; Tanimura, Susumu; Nishida, Masashi; Hamaoka, Kenji; Kohno, Michiaki; Yokoyama, Takahiko

    2009-01-01

    Nephronophthisis (NPHP) is the most frequent genetic cause of end-stage kidney disease in children and young adults. Inv mice are a model for human nephronophthisis type 2 (NPHP2) and characterized by multiple renal cysts and situs inversus. Renal epithelial cells in inv cystic kidneys show increased cell proliferation. We studied the ERK pathway to understand the mechanisms that induce cell proliferation and renal cyst progression in inv kidneys. We studied the effects of ERK suppression by administering PD184352, an oral mitogen-activated protein kinase kinase (MEK) inhibitor on renal cyst expansion, extracellular signal-regulated protein kinase (ERK) activity, bromo-deoxyuridine (BrdU) incorporation and expression of cell-cycle regulators in invΔC kidneys. Phosphorylated ERK (p-ERK) level increased along with renal cyst enlargement. Cell-cycle regulators showed a high level of expression in invΔC kidneys. PD184352 successfully decreased p-ERK level and inhibited renal cyst enlargement. The inhibitor also decreased expression of cell-cycle regulators and BrdU incorporation in renal epithelial cells. The present results showed that ERK regulated renal cell proliferation and cyst expansion in inv mutants

  1. Heterozygous deletion of FOXA2 segregates with disease in a family with heterotaxy, panhypopituitarism, and biliary atresia.

    Science.gov (United States)

    Tsai, Ellen A; Grochowski, Christopher M; Falsey, Alexandra M; Rajagopalan, Ramakrishnan; Wendel, Danielle; Devoto, Marcella; Krantz, Ian D; Loomes, Kathleen M; Spinner, Nancy B

    2015-06-01

    Biliary atresia (BA) is a pediatric cholangiopathy with unknown etiology occurring in isolated and syndromic forms. Laterality defects affecting the cardiovascular and gastrointestinal systems are the most common features present in syndromic BA. Most cases are sporadic, although reports of familial cases have led to the hypothesis of genetic susceptibility in some patients. We identified a child with BA, malrotation, and interrupted inferior vena cava whose father presented with situs inversus, polysplenia, panhypopituitarism, and mildly dysmorphic facial features. Chromosomal microarray analysis demonstrated a 277 kb heterozygous deletion on chromosome 20, which included a single gene, FOXA2, in the proband and her father. This deletion was confirmed to be de novo in the father. The proband and her father share a common diagnosis of heterotaxy, but they also each presented with a variety of other issues. Further genetic screening revealed that the proband carried an additional protein-altering polymorphism (rs1904589; p.His165Arg) in the NODAL gene that is not present in the father, and this variant has been shown to decrease expression of the gene. As FOXA2 can be a regulator of NODAL expression, we propose that haploinsufficiency for FOXA2 combined with a decreased expression of NODAL is the likely cause for syndromic BA in this proband. © 2015 WILEY PERIODICALS, INC.

  2. Early presentation of cystic kidneys in a family with a homozygous INVS mutation.

    Science.gov (United States)

    Oud, Machteld M; van Bon, Bregje W; Bongers, Ernie M H F; Hoischen, Alexander; Marcelis, Carlo L; de Leeuw, Nicole; Mol, Suzanne J J; Mortier, Geert; Knoers, Nine V A M; Brunner, Han G; Roepman, Ronald; Arts, Heleen H

    2014-07-01

    Nephronophthisis (NPHP) is an autosomal recessive cystic kidney disease that is the most frequent monogenic cause of end-stage renal disease in children. Infantile NPHP, often in combination with other features like situs inversus, are commonly caused by mutations in the INVS gene. INVS encodes the ciliary protein inversin, and mutations induce dysfunction of the primary cilia. In this article, we present a family with two severely affected fetuses that were aborted after discovery of grossly enlarged cystic kidneys by ultrasonography before 22 weeks gestation. Exome sequencing showed that the fetuses were homozygous for a previously unreported nonsense mutation, resulting in a truncation in the IQ1 domain of inversin. This mutation induces nonsense-mediated RNA decay, as suggested by a reduced RNA level in fibroblasts derived from the fetus. However, a significant amount of mutant INVS RNA was present in these fibroblasts, yielding mutant inversin protein that was mislocalized. In control fibroblasts, inversin was present in the ciliary axoneme as well as at the basal body, whereas in the fibroblasts from the fetus, inversin could only be detected at the basal body. The phenotype of both fetuses is partly characteristic of infantile NPHP and Potter sequence. We also identified that the fetuses had mild skeletal abnormalities, including shortening and bowing of long bones, which may expand the phenotypic spectrum associated with INVS mutations. © 2014 Wiley Periodicals, Inc.

  3. Congenital heart defects: the 10-year experience at a single center.

    Science.gov (United States)

    Aydin, Emine; Aypar, Ebru; Oktem, Ahmet; Ozyuncu, Ozgur; Yurdakok, Murat; Guvener, Murat; Demircin, Metin; Beksac, M Sinan

    2018-06-18

    We aimed to evaluate congenital heart disease (CHD) cases according to EUROCAT subgroup classification that were diagnosed during the prenatal period in our center. CHDs that were prenatally diagnosed using ultrasonography and confirmed by fetal echocardiography were reviewed over a 10-year period. Subgroup classification was finalized at the post-partum period in terms of the EUROCAT guide 1.3. Congenital heart defect subtypes and obstetric outcomes (gestational week at delivery, birth weight, gender, extracardiac structural abnormalities, karyotype results if performed) were analyzed. The data of 180 cases with CHD was examined. Left ventricular outflow tract obstruction (LVOT) was the most common CHD subtype (57/180; 31.6%), which included 48, five, and four cases of hypoplastic left heart syndrome (HLHS), coarctation of the aorta, and aortic valve atresia/stenosis, respectively. Eighteen pregnancies were terminated; the most common CHD subtype among patients of terminated pregnancies was hypoplastic left heart syndrome (HLHS) (n = 7, 38.8%). The most common extracardiac malformations were a single umbilical artery, esophageal atresia, and situs inversus in our study group. Eighteen of the 96 (18.75%) neonates with CHD died during the neonatal period. The most common CHD subtype was HLHS (7/18; 38%) among the newborns who died after birth. Prenatal diagnosis of a CHD and subgroup classification is very important for clinical decision making, including prenatal management, recommendations for termination of the pregnancy, postnatal management of the patient, and for early referral to pediatric cardiology and cardiovascular surgery centers.

  4. Common variants in left/right asymmetry genes and pathways are associated with relative hand skill.

    Directory of Open Access Journals (Sweden)

    William M Brandler

    Full Text Available Humans display structural and functional asymmetries in brain organization, strikingly with respect to language and handedness. The molecular basis of these asymmetries is unknown. We report a genome-wide association study meta-analysis for a quantitative measure of relative hand skill in individuals with dyslexia [reading disability (RD] (n = 728. The most strongly associated variant, rs7182874 (P = 8.68 × 10(-9, is located in PCSK6, further supporting an association we previously reported. We also confirmed the specificity of this association in individuals with RD; the same locus was not associated with relative hand skill in a general population cohort (n = 2,666. As PCSK6 is known to regulate NODAL in the development of left/right (LR asymmetry in mice, we developed a novel approach to GWAS pathway analysis, using gene-set enrichment to test for an over-representation of highly associated variants within the orthologs of genes whose disruption in mice yields LR asymmetry phenotypes. Four out of 15 LR asymmetry phenotypes showed an over-representation (FDR ≤ 5%. We replicated three of these phenotypes; situs inversus, heterotaxia, and double outlet right ventricle, in the general population cohort (FDR ≤ 5%. Our findings lead us to propose that handedness is a polygenic trait controlled in part by the molecular mechanisms that establish LR body asymmetry early in development.

  5. Kartagener's Syndrome.

    Science.gov (United States)

    Dhar, D K; Ganguly, K C; Alam, S; Hossain, A; Sarker, U K; Das, B K; Haque, M J

    2009-01-01

    Kartagener's Syndrome or Immotile Cilia Syndrome, a variant of Primary Ciliary Dyskinesia (PCD), is a rare autosomal recessive genetic disorder caused by defect in the tiny hair like structure, the cilia lining the respiratory tract (upper and lower), sinuses, eustachian tubes, middle ear and fallopian tubes. Here electron microscopy shows abnormal arrangement of ciliary tubules and patients with Kartagener's syndrome has an absence of dynein arms at the base of the cilia. The inability of cilia to move results in inadequate clearance of bacteria from the air passages, resulting in an increased risk of infection and causing bronchiectasis. Another result of ciliary immobility is infertility. A 60 years old lady was diagnosed as a case of Kartagener's syndrome. She had history of chronic cough for 20 years, irregular fever for 20 years and occasional shortness of breath for 5 years. Relevant investigations revealed dextrocardia, situs inversus, bilateral maxillary sinusitis with non pneumatised frontal sinus and bronchiectasis. She was treated with low concentration oxygen inhalation, antibiotic, bronchodilator, chest physiotherapy including postural drainage, vitamins and other supportive treatment.

  6. Loss of FTO antagonises Wnt signaling and leads to developmental defects associated with ciliopathies.

    Directory of Open Access Journals (Sweden)

    Daniel P S Osborn

    Full Text Available Common intronic variants in the Human fat mass and obesity-associated gene (FTO are found to be associated with an increased risk of obesity. Overexpression of FTO correlates with increased food intake and obesity, whilst loss-of-function results in lethality and severe developmental defects. Despite intense scientific discussions around the role of FTO in energy metabolism, the function of FTO during development remains undefined. Here, we show that loss of Fto leads to developmental defects such as growth retardation, craniofacial dysmorphism and aberrant neural crest cells migration in Zebrafish. We find that the important developmental pathway, Wnt, is compromised in the absence of FTO, both in vivo (zebrafish and in vitro (Fto(-/- MEFs and HEK293T. Canonical Wnt signalling is down regulated by abrogated β-Catenin translocation to the nucleus whilst non-canonical Wnt/Ca(2+ pathway is activated via its key signal mediators CaMKII and PKCδ. Moreover, we demonstrate that loss of Fto results in short, absent or disorganised cilia leading to situs inversus, renal cystogenesis, neural crest cell defects and microcephaly in Zebrafish. Congruently, Fto knockout mice display aberrant tissue specific cilia. These data identify FTO as a protein-regulator of the balanced activation between canonical and non-canonical branches of the Wnt pathway. Furthermore, we present the first evidence that FTO plays a role in development and cilia formation/function.

  7. Weight Loss after Sleeve Gastrectomy in Super Superobesity

    Directory of Open Access Journals (Sweden)

    J.-M. Catheline

    2012-01-01

    Full Text Available Objective. This prospective study evaluated laparoscopic sleeve gastrectomy for its safety and efficiency in excess weight loss (%EWL in super superobese patients (BMI >60 Kg/m2. Results. Thirty patients (33 women and 7 men were included, with mean age of 35 years (range 18 to 59. Mean preoperative BMI was 66 Kg/m2 (range 60 to 85. The study included one patient with complete situs inversus and 4 (14% with previous restrictive gastric banding. The mean operative time was 120 minutes (range 80 to 220 min and the mean hospital stay was 7.5 days (4 to 28 days. There was no postoperative mortality or need for a laparotomy conversion. Two subphrenic hematomas, one gastric fistula, and one pulmonary embolism, were the major complications. After 18 months 17 (77% had sufficient weight loss and six had insufficient results, leading to either re-sleeve gastrectomy (3, or gastric bypass (2. Three years after the initial laparoscopic sleeve gastrectomy, the mean EWL was 51% (range 21 to 82. Conclusion. The laparoscopic sleeve gastrectomy is a safe and efficient operating procedure for treating super superobesity. In the case of insufficient weight loss, a second-stage operation like resleeve gastrectomy or gastric bypass can be proposed.

  8. Gastric volvulus in children: the twists and turns of an unusual entity

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Sarah K.; Han, Bokyung K.; Levin, Terry L.; Blitman, Netta M. [Children' s Hospital at Montefiore Medical Center, Department of Radiology, Bronx, NY (United States); Murphy, Robyn [Morristown Memorial Hospital, Department of Radiology, Morristown, NJ (United States); Ramos, Carmen [Children' s Hospital at Montefiore Medical Center, Department of Pediatric Surgery, Bronx, NY (United States)

    2008-03-15

    Gastric volvulus in children is uncommon, and characteristic radiographic findings might not be recognized. To present the spectrum of clinical and imaging findings, correlate the type of gastric volvulus with clinical outcome, and identify imaging findings to aid in early diagnosis. Medical records and imaging findings of ten children with gastric volvulus were reviewed. Imaging included abdominal radiographs, upper gastrointestinal (UGI) series, and CT. The diagnosis (organoaxial, mesenteroaxial or mixed type) was made on the UGI series (n = 9) and CT (n = 1), and confirmed surgically in seven children. Patients were classified based on presentation: four acute, four chronic, and two neonatal. All of the acute group (three mesenteroaxial and one mixed type) had abnormal radiographic findings: three spherical gastric distension, four paucity of distal gas, three elevated left hemidiaphragm, one overlapping pylorus and gastric fundus, one unusual nasogastric tube course, and one situs inversus. All underwent emergent surgery. Three had diaphragmatic abnormalities. One had heterotaxy. Patients in the chronic group (three organoaxial, one mesenteroaxial) had long-standing symptoms. Most had associated neurologic abnormalities. In the neonatal group, organoaxial volvulus was found incidentally on the UGI series. A spectrum of findings in gastric volvulus exists. Mesenteroaxial volvulus has greater morbidity and mortality. Radiographic findings of spherical gastric dilatation, paucity of distal gas and diaphragmatic elevation are suggestive of acute volvulus, particularly in patients with predisposing factors. (orig.)

  9. Gastric volvulus in children: the twists and turns of an unusual entity

    International Nuclear Information System (INIS)

    Oh, Sarah K.; Han, Bokyung K.; Levin, Terry L.; Blitman, Netta M.; Murphy, Robyn; Ramos, Carmen

    2008-01-01

    Gastric volvulus in children is uncommon, and characteristic radiographic findings might not be recognized. To present the spectrum of clinical and imaging findings, correlate the type of gastric volvulus with clinical outcome, and identify imaging findings to aid in early diagnosis. Medical records and imaging findings of ten children with gastric volvulus were reviewed. Imaging included abdominal radiographs, upper gastrointestinal (UGI) series, and CT. The diagnosis (organoaxial, mesenteroaxial or mixed type) was made on the UGI series (n = 9) and CT (n = 1), and confirmed surgically in seven children. Patients were classified based on presentation: four acute, four chronic, and two neonatal. All of the acute group (three mesenteroaxial and one mixed type) had abnormal radiographic findings: three spherical gastric distension, four paucity of distal gas, three elevated left hemidiaphragm, one overlapping pylorus and gastric fundus, one unusual nasogastric tube course, and one situs inversus. All underwent emergent surgery. Three had diaphragmatic abnormalities. One had heterotaxy. Patients in the chronic group (three organoaxial, one mesenteroaxial) had long-standing symptoms. Most had associated neurologic abnormalities. In the neonatal group, organoaxial volvulus was found incidentally on the UGI series. A spectrum of findings in gastric volvulus exists. Mesenteroaxial volvulus has greater morbidity and mortality. Radiographic findings of spherical gastric dilatation, paucity of distal gas and diaphragmatic elevation are suggestive of acute volvulus, particularly in patients with predisposing factors. (orig.)

  10. Dupla via de saída do ventrículo direito com comunicação interventricular não relacionada: resultados da correção cirúrgica com técnica de múltiplos retalhos

    Directory of Open Access Journals (Sweden)

    Miguel BARBERO-MARCIAL

    1997-04-01

    Full Text Available Objetivo: Apresentar uma modificação técnica para a correção cirúrgica biventricular da dupla via de saída de ventrículo direito com comunicação interventricular não relacionada. Métodos: No período de abril de 1987 a fevereiro de 1996, 15 pacientes portadores desta anomalia foram submetidos à técnica de reconstrução biventricular com "tunelização" do ventrículo esquerdo para a aorta utilizando-se 2 ou mais retalhos de pericárdio bovino. A idade variou entre 2 a 13 anos (média = 4,8 anos; média = 5 anos. Treze pacientes apresentavam situs solitus e levocardia, 1 paciente situs inversus e dextrocardia e 1 paciente situs solitus e dextrocardia. A construção do túnel inicia-se no átrio direito. Sendo a CIV pequena ou restritiva, é feita a ampliação em sentido anterior e o primeiro retalho é suturado na borda póstero-inferior do defeito direcionando-o para o septo, em posição anterior e superior. A seguir, através de ventriculotomia direita o segundo, terceiro e, por vezes, o quarto retalhos são suturados direcionando o túnel para o anel aórtico. Resultados: Houve 3 óbitos (mortalidade de 20%, 2 hospitalares, 1 tardio e os 12 pacientes restantes foram seguidos por um período variável de 10 meses a 9 anos (média 33 meses encontrando-se todos em classe funcional I (NYHA. Comunicação interventricular residual, mínima, foi observada em 1 paciente, estenose pulmonar residual em 2 pacientes e insuficiência pulmonar em 1 paciente. Em nenhum dos pacientes demonstrou-se obstrução do túnel ventrículo esquerdo - aorta. Conclusão: Baseados nestes resultados, concluímos que esta técnica para reparo biventricular permite a construção de um túnel com diâmetro interno adequado, respeitando as mudanças de direção existentes entre a comunicação interventricular e a aorta. O túnel de pericárdio bovino ocupa menor espaço intraventricular causando, portanto, menor risco de obstrução da via de saída de

  11. Discinesia ciliar primária: considerações sobre seis casos da síndrome de Kartagener Primary ciliary dyskinesia: considerations regarding six cases of Kartagener syndrome

    Directory of Open Access Journals (Sweden)

    Hugo Alejandro Vega Ortega

    2007-10-01

    Full Text Available A discinesia ciliar primária (DCP, anteriormente conhecida como síndrome dos cílios imóveis, é uma doença hereditária autossômica recessiva que inclui vários padrões de defeitos em sua ultra-estrutura ciliar. Sua forma clínica mais grave é a síndrome de Kartagener (SK, a qual é encontrada em 50% dos casos de DCP. A DCP causa deficiência ou mesmo estase no transporte de secreções em todo o trato respiratório, favorecendo a proliferação de vírus e bactérias. Sua incidência varia de 1:20.000 a 1:60.000. Como conseqüência, os pacientes apresentam infecções crônicas e repetidas desde a infância e geralmente são portadores de bronquite, pneumonia, hemoptise, sinusite e infertilidade. As bronquiectasias e outras infecções crônicas podem ser o resultado final das alterações irreversíveis dos brônquios, podendo progredir para cor pulmonale crônico e suas conseqüências. Somente a metade dos pacientes afetados pela DCP apresenta todos os sintomas, condição denominada SK completa; no restante, não ocorre situs inversus, condição denominada SK incompleta. O diagnóstico é feito com base no quadro clínico e confirmado por meio da microscopia eletrônica de transmissão. Como não há tratamento especifico para a DCP, recomenda-se que, tão logo seja feito o diagnóstico, as infecções secundárias sejam tratadas com antibióticos potentes e medidas profiláticas sejam adotadas. Neste trabalho, relatamos seis casos de DCP (cinco casos de SK completa e um caso de SK incompleta e revisamos a literatura sobre o assunto, tendo como foco os aspectos diagnósticos, terapêuticos e clínicos desta doença.Primary ciliary dyskinesia (PCD, previously known as immotile cilia syndrome, is an autosomal recessive hereditary disease that includes various patterns of ciliary ultrastructural defects. The most serious form is Kartagener syndrome (KS, which accounts for 50% of all cases of PCD. The incidence of PCD ranges from 1

  12. Cep70 and Cep131 contribute to ciliogenesis in zebrafish embryos

    Directory of Open Access Journals (Sweden)

    Carl Matthias

    2009-03-01

    Full Text Available Abstract Background The centrosome is the cell's microtubule organising centre, an organelle with important roles in cell division, migration and polarity. However, cells can divide and flies can, for a large part of development, develop without them. Many centrosome proteins have been identified but the roles of most are still poorly understood. The centrioles of the centrosome are similar to the basal bodies of cilia, hair-like extensions of many cells that have important roles in cell signalling and development. In a number of human diseases, such Bardet-Biedl syndrome, centrosome/cilium proteins are mutated, leading to polycystic kidney disease, situs inversus, and neurological problems, amongst other symptoms. Results We describe zebrafish (Danio rerio embryos depleted for two uncharacterised, centrosome proteins, Cep70 and Cep131. The phenotype of these embryos resembles that of zebrafish mutants for intraflagellar transport proteins (IFTs, with kidney and ear development affected and left-right asymmetry randomised. These organs and processes are those affected in Bardet-Biedl syndrome and other similar diseases. Like these diseases, the root cause of the phenotype lies, in fact, in dysfunctional cilia, which are shortened but not eliminated in several tissues in the morphants. Centrosomes and basal bodies, on the other hand, are present. Both Cep70 and Cep131 possess a putative HDAC (histone deacetylase interacting domain. However, we could not detect in yeast two-hybrid assays any interaction with the deacetylase that controls cilium length, HDAC6, or any of the IFTs that we tested. Conclusion Cep70 and Cep131 contribute to ciliogenesis in many tissues in the zebrafish embryo: cilia are made in cep70 and cep131 morphant zebrafish embryos but are shortened. We propose that the role of these centrosomal/basal body proteins is in making the cilium and that they are involved in determination of the length of the axoneme.

  13. Ciliopathies: Genetics in Pediatric Medicine.

    Science.gov (United States)

    Oud, Machteld M; Lamers, Ideke J C; Arts, Heleen H

    2017-03-01

    Ciliary disorders , which are also referred to as ciliopathies , are a group of hereditary disorders that result from dysfunctional cilia. The latter are cellular organelles that stick up from the apical plasma membrane. Cilia have important roles in signal transduction and facilitate communications between cells and their surroundings. Ciliary disruption can result in a wide variety of clinically and genetically heterogeneous disorders with overlapping phenotypes. Because cilia occur widespread in our bodies many organs and sensory systems can be affected when they are dysfunctional. Ciliary disorders may be isolated or syndromic, and common features are cystic liver and/or kidney disease, blindness, neural tube defects, brain anomalies and intellectual disability, skeletal abnormalities ranging from polydactyly to abnormally short ribs and limbs, ectodermal defects, obesity, situs inversus , infertility, and recurrent respiratory tract infections. In this review, we summarize the features, frequency, morbidity, and mortality of each of the different ciliopathies that occur in pediatrics. The importance of genetics and the occurrence of genotype-phenotype correlations are indicated, and advances in gene identification are discussed. The use of next-generation sequencing by which a gene panel or all genes can be screened in a single experiment is highlighted as this technology significantly lowered costs and time of the mutation detection process in the past. We discuss the challenges of this new technology and briefly touch upon the use of whole-exome sequencing as a diagnostic test for ciliary disorders. Finally, a perspective on the future of genetics in the context of ciliary disorders is provided.

  14. Agnathia-holoprosencephaly associated with a 46,XY,-21,+t(21q;21q) karyotype

    Energy Technology Data Exchange (ETDEWEB)

    Niedermeyer, K.K.; McCorquodale, M.M.; Burton, B.K. [Univ. of Illinois, Chicago, IL (United States)

    1994-09-01

    We report an unusual case of agnathia-holoprosencephaly associated with Down syndrome due to a 21/21 translocation. The patient presented prenatally at 21 wks gestation. A fetal ultrasound revealed multiple CNS anomalies including hydrocephalus, compressed cerebellum, absent septum pellucidum and possible cranial meningocele or encephalocele. High resolution ultrasound & fetal karyotype were recommended. The patient refused & elected to have a pregnancy termination. Chromosomal analysis performed on products of conception revealed a 46,XY,-21,+t(21q;21q) karyotype. Fluorescence in situ hybridization was performed and confirmed the 21/21 translocation chromosome. An autopsy revealed agnathia and multiple CNS anomalies including absence of the septum pellucidum, absence of the corpus callosum, arhinencephaly, an occiptal meningoencephalocele, dilation of the lateral ventricles, and extensive dysgenesis & heterotopias of the central cerebrum & mid-brain. Additional abnormalities included a persistent left superior vena cava, atrial & ventricular septal defects, irregular length of the fingers with absence of the middle phalanges of the right 2nd and 5th & left 5th digits and bilateral simian creases. Agnathia can be an isolated abnormality but often is associated with holoprosencephaly and/or situs inversus. The majority of familial case of agnathis-holoprosencephaly was caused by an inherited unbalanced translocation resulting in duplication of 6p and monosomy of 18p. Our patient had a translocation form of trisomy 21 but did not have a phenotype consistent with Down syndrome. Trisomy 21 has not been previously reported in other cases of agnathia-holoprosencephaly. Whether the chromosomal abnormality caused the phenotypic abnormalities or if it is a coincidental finding cannot be determined.

  15. The prevalence of pulmonary tuberculosis in Jeonbug Province

    International Nuclear Information System (INIS)

    Rhee, S. J.; Moon, M. C.; Song, H. Y.; Choi, K. C.

    1981-01-01

    A photofluorographic mass survey of P-A chest had been done to the 13136 residents (male 6264, female 6872) in Jeonbug province, Korea for about 2 years from May 5, to Dec.19, 1978 and from Mar. 5, to Dec. 22, 1979. The results are as follows: 1. The prevalence rate of all active pulmonary tuberculosis is 5.3%. 2. The prevalence rate of male(8.8%) is 4.2 times higher than that of female (2.1%). 3. The prevalence rates of all old age groups above fifty years are higher than that of remainder under fifty years of age. Of these, 61-70 years old age group is highest in prevalence rate. 4. According to extent of active pulmonary tuberculosis, 77.5% is minimal, 15.4% is moderately advanced, and 7.1% is far advanced. Inactive pulmonary tuberculosis are 39 cases (0.3% to objective population). 5. In the incidence of the involved side, right side is about 2 times higher than the left, and involvement of both sides is increased in moderately and far advance pulmonary tuberculosis. In all pulmonary tuberculosis, one or both upper lung fields are most commonly involved. The incidences of cavity in moderately and far advanced pulmonary tuberculosis show no significant difference. 6. The incidences of other intrathoracic lesions are as follows: suspected hypertensive heart disease 2.4%, dextrocardia with situs inversus 0.04%, pleural calcification 0.4%, pleural thickening 0.2%, pleural effusion 0.1%, pneumonia 0.02%, bronchiectasis 0.1%, lung abscess 0.02%, C.O.P.D. 0.2%, suspected lung tumor 0.06%, pneumothorax 0.0076%, and suspected mediastinal tumor 0.02%

  16. Penerapan Web Services untuk Layanan Informasi Pekerjaan Online

    Directory of Open Access Journals (Sweden)

    Adi Wibowo

    2016-12-01

    Intisari— Situs penyedia data lowongan pekerjaan banyak tersedia di internet. Kekurangan yang terlihat pada situs-situs tersebut adalah bahwa data yang tersimpan hanya dikelola secara mandiri oleh tiap situs. Tidak ada upaya berbagi (sharing antar situs yang memungkinkan pengguna mencari data dari database yang lebih besar atau lengkap. Penelitian ini menggunakan metode SDLC untuk mengusulkan purwarupa situs data lowongan pekerjaan dengan dukungan protokol REST. Protokol REST memungkinkan sistem berbagi data lowongan pekerjaan, data pencari pekerjaan, dan login antar sistem. Hasil penelitian menunjukkan bahwa purwarupa dapat menyediakan layanan data melalui REST sesuai kebutuhan.

  17. Penerapan Prinsip Kehati-hatian dalam Penyaluran Pembiayaan dan Kredit pada Lembaga Keuangan Mikro (Studi Multi Situs pada BMT Hasanah Mlarak dan BRI Unit Mlarak, Ponorogo

    Directory of Open Access Journals (Sweden)

    Rahma Yudii Astuti

    2016-06-01

    Full Text Available Microfinance institutions like the company has a motive to obtain a return (net income are always faced with the risk, which is known as credit risk. Risks that may occur can cause great harm to financial institutions if it can not be detected and managed by microfinance semestinya.Lembaga always required to be more sensitive in detecting things that could trigger a rise in the level of non performing loan. The credit risk is the risk of potential losses resulting from the non settlement of bank loans back to the bank’s borrowers and counterparties lainnya.Penelitian a field research (field research that are normative. Data were collected through observation, documentation, and interviews, while the type of data used are primary data and secondary data. Microfinance institutions that implement the precautionary principle in the procedures of channeling financing and credit based on standard guidelines or SOP, focus on monitoring PPAP by age collectibility of the loans/loans, to restrict credit expansion, fostering the human resources, and lending/financing the early initiative procedure, analysis, disbursement and monitoring will have implications/positive impact on the business/internal as well as the impact of a great reputation with uncontrolled NPL/NPF.

  18. Pengaruh Kepercayaan, Kemudahan, dan Kualitas Informasi Terhadap Keputusan Pembelian Secara Online Di Situs Lazada.co.id Pada Mahasiswa/I Fakultas Ekonomi Dan Bisnis USU

    OpenAIRE

    Sari, Maya Puspa

    2015-01-01

    The purpose of this study was to determine and analyze the influence of the trust, easy to use, and information quality on online buying decision in lazada.co.id of the Students at Faculty of Economics and Business University of North Sumatera. This research is associative causal research aimed to analyze the relationship between one variable with another variable or how a variable affecting other variables. The population in this study is an active student who ever made a online shopping who...

  19. Pengaruh Intensitas Mengakses Facebook terhadap Penggunaan Bahasa Alay pada Remaja Usia Sekolah

    OpenAIRE

    Rahmahanti, Ayunda Sari; Herieningsih, Sri Widowati; Santosa, Hedi Pudjo; Ulfa, Nurrist Surayya

    2014-01-01

    Perkembangan media baru internet membantu masyarakat modern untuk mendekatkan jarak melalui teknologi komunikasinya. Melalui internet pula, kini banyak muncul situs sosial media, salah satunya Facebook. Facebook merupakan salah satu situs pertemanan yang beguna untuk mencari teman baru maupun berkomunikasi kembali dengan teman lama. Semakin berkembang situs ini, semakin banyak pula penggunanya terutama di kalangan remaja. Seiring meningkatnya mereka mengakses dan melakukan interaksi di Facebo...

  20. Mechano- and Chemo-Sensory Polycystins

    Science.gov (United States)

    Patel, Amanda; Delmas, Patrick; Honoré, Eric

    Polycystins belong to the superfamily of transient receptor potential (TRP) channels and comprise five PKD1-like and three PKD2-like (TRPP) subunits. In this chapter, we review the general properties of polycystins and discuss their specific role in both mechanotransduction and chemoreception. The heteromer PKD1/PKD2 expressed at the membrane of the primary cilium of kidney epithelial cells is proposed to form a mechano-sensitive calcium channel that is opened by physiological fluid flow. Dysfunction or loss of PKD1 or PKD2 polycystin genes may be responsible for the inability of epithelial cells to sense mechanical cues, thus provoking autosomal dominant polycystic kidney disease (ADPKD), one of the most prevalent genetic kidney disorders. pkd1 and pkd2 knock-out mice recapitulate the human disease. Similarly, PKD2 may function as a mechanosensory calcium channel in the immotile monocilia of the developing node transducing leftward flow into an increase in calcium and specifying the left-right axis. pkd2, unlike pkd1 knock-out embryos are characterized by right lung isomerism (situs inversus). Mechanical stimuli also induce cleavage and nuclear translocation of the PKD1 C-terminal tail, which enters the nucleus and initiates signaling processes involving the AP-1, STAT6 and P100 pathways. This intraproteolytic mechanism is implicated in the transduction of a change in renal fluid flow to a transcriptional long-term response. The heteromer PKD1L3/PKD2L1 is the basis for acid sensing in specialised sensory cells including the taste bud cells responsible for sour taste. Moreover, PKD1L3/PKD2L1 may be implicated in the chemosensitivity of neurons surrounding the spinal cord canal, sensing protons in the cerebrospinal fluid. These recent results demonstrate that polycystins fulfill a major sensory role in a variety of cells including kidney epithelial cells, taste buds cells and spinal cord neurons. Such mechanisms are involved in short- and long-term physiological

  1. Qualitative and quantitative predictions of environmental exposure to nanomaterials from nanowaste streams

    CSIR Research Space (South Africa)

    Musee, N

    2009-08-01

    Full Text Available capita SW = 3cf Market penetration= − cf: correction factor :Population ratio of SA to SW : GDP ratio of SA to SW (0.391) -2007 : 3 scenarios (0.1, 0.25, 0.40) Total NMs into Aquatic Environment , , , Re(1 ) ( )Water inputi WW Totali STPi WW Totali... STPi STPi movaliNM NM f NM f f f= • − + − • , , Re(1 )Water inputi WW Totali STPi movaliNM NM f f= • − • Untreated wastewater Treated wastewater (effluent) A B Calculation of CSTPs, PECs & PNECs 12 , , 10i WW STP WW STP percapita STP NM C C...

  2. PERSONAL BRANDING PRABOWO SUBIANTO (ANALISIS ISI KUANTITATIF PERSONAL BRANDING PRABOWO SUBIANTO DI SITUS BERITA ONLINE REPUBLIKA.CO.ID DAN TEMPO.CO.ID TANGGAL 9 JUNI - 9 JULI 2014

    Directory of Open Access Journals (Sweden)

    Hendro Agus Prakoso

    2016-09-01

    berita kedua media tersebut. Frekuensi berita berjumlah 107 di Republika.co.id dan 51 berita di Tempo.co.id Ragam berita Republika.co.id didominasi konsep Spesialisasi sebesar 22,4% dari 107 berita, sedangkan pada Tempo.co.id didominasi konsep Nama baik sebesar 23,5% dari 51 berita. Sumber berita pada Republika.co.id mayoritas berasal dari Liputan langsung sebesar 42,9% dari 107 berita sedangkan pada Tempo.co.id mayoritas berasal dari Intelektual sebesar 54,9% dari 51 berita.

  3. IMPLEMENTASI KEPEMIMPINAN KEPALA MAN DALAM MEMBANGUN BUDAYA MUTU DI KOTA MATARAM

    Directory of Open Access Journals (Sweden)

    Nurhasanah Nurhasanah

    2016-03-01

    Fokus penelitian untuk mendeskripsikan (1 mutu layanan, (2 mutu guru dan staf, dan (3 mutu sarana/prasarana. Penelitian ini menggunakan pendekatan kualitatif dengan desain studi multi situs. Data dikumpulkan dengan teknik wawancara, observasi, dan dokumentasi. Analisis data menggunakan analisis data situs tunggal dan lintas situs. Pengecekan keabsahan data: kredibilitas, dependabilitas, konfirmabilitas. Temuan (1 mutu layanan: layanan intrakulikuler (pembelajaran berbasis IT, LCD dan wifi tiap kelas; layanan ekstrakulikuler, mendapat banyak penghargaan; layanan BK baik, pelanggaran menurun; (b mutu guru dan staf, ditingkatkan melalui workshop, pelatihan, MGMP, dan supervisi; (c mutu sarana/prasarana, yang ditingkatkan: perpustakaan, laboratorium, fasilitas olahraga, mushalla, koperasi, kantin, UKS.

  4. CASE REPORT

    African Journals Online (AJOL)

    abdominal ultrasound scan, computerized axial tomography scan, a chest x ray, ... Cause of death was urethral fibrosis .... were severe anemia, bilateral pitting pedal oedema ... retinitis pigmentosa in a sickle cell patient that also had situs ...

  5. Design Tools for Integrated Asynchronous Electronic Circuits

    National Research Council Canada - National Science Library

    Martin, Alain

    2003-01-01

    ..., simulation, verification, at the logical and physical levels. Situs has developed a business model for the commercialization of the CAD tools, and has designed the prototype of the tool suite based on this business model and the Caltech approach...

  6. Desain Dan Implementasi Augmented Reality Berbasis Web Pada Aplikasi Furniture Shopping Manager Sebagai Alat Bantu Belanja Online

    OpenAIRE

    Pramono, Basworo Ardi

    2012-01-01

    Dalam penulisan jurnal ini akan dibahas mengenai pengembangan aplikasi Furniture Shopping Manager (FSM) sebagai suatu alat bantu yang dapat dimanfaatkan oleh para pemilik situs atau toko furniture secara online dalam menjual produknya. FSM dirancang sebagai sebuah aplikasi berbasis web yang terintegrasi ke dalam suatu situs belanja online dengan fitur-fitur yang diharapkan dapat memberikan pengalaman yang baru, unik dan menarik dalam kegiatan belanja furniture online. Aplikasi FSM dikembang...

  7. DESAIN DAN IMPLEMENTASI AUGMENTED REALITY BERBASIS WEB PADA APLIKASI FURNITURE SHOPPING MANAGER SEBAGAI ALAT BANTU BELANJA ONLINE

    OpenAIRE

    Basworo Ardi Pramono

    2012-01-01

    Dalam penulisan jurnal ini akan dibahas mengenai pengembangan aplikasi Furniture Shopping Manager (FSM) sebagai suatu alat bantu yang dapat dimanfaatkan oleh para pemilik situs atau toko furniture secara online dalam menjual produknya.  FSM dirancang sebagai sebuah aplikasi berbasis web yang terintegrasi ke dalam suatu situs belanja online dengan fitur-fitur yang diharapkan dapat memberikan pengalaman yang baru, unik dan menarik dalam kegiatan belanja furniture online.   Aplikasi FSM dike...

  8. Pencarian Produk yang Mirip Melalui Automatic Online Annotation dari Web dan Berbasiskan Konten dengan Color Histogram Bin dan Surf Descriptor

    Directory of Open Access Journals (Sweden)

    Putra Pandu Adikara

    2018-03-01

    Full Text Available Banyaknya situs e-commerce memberikan kemudahan bagi pengguna yang ingin mencari dan membeli suatu produk, misalnya membeli makanan, obat, alat elektronik, kebutuhan sehari-hari, dan lain-lain. Pencarian suatu produk terhadap beberapa situs e-commerce akan menjadi sulit karena banyaknya pilihan situs, banyaknya penjual (merchant/seller yang menjual barang yang sama, dan waktu yang lama karena harus berpindah-pindah situs hingga menemukan produk yang diinginkan. Selain itu dengan adanya teknologi smartphone berkamera, augmented reality, query pencarian bisa jadi hanya berupa citra, namun pencarian produk dengan menggunakan citra pada umumnya tidak diakomodasi di situs e-commerce. Dalam penelitian ini dikembangkan sistem meta search-engine yang menggunakan query berupa citra dan berbasiskan konten untuk menggabungkan hasil pencarian dari beberapa situs e-commerce. Citra query yang tidak diketahui namanya dibangkitkan tag atau kata kuncinya melalui Google reverse image search engine. Kata kunci ini kemudian diberikan ke masing-masing situs e-commerce untuk dilakukan pencarian. Fitur yang digunakan dalam pencocokan query dengan produk adalah fitur tekstual, color histogram bin, dan keberadaan citra objek yang dicari menggunakan SURF descriptor. Fitur-fitur ini digunakan untuk menentukan relevansi terhadap hasil penelusuran. Sistem ini dapat memberikan hasil yang baik dengan precision@20 dan recall hingga 1 dengan rata-rata precision@20 dan recall masing-masing sebesar 0,564 dan 0,608, namun juga bisa gagal dengan precision@20 dan recall sebesar 0. Hasil yang kurang baik ini dikarenakan tag yang dibangkitkan terlalu umum dan situs e-commerce-pun memberikan hasil yang umum juga

  9. Diprosopus with multiple craniofacial, musculoskeletal, and cardiac defects in a purebred Suffolk lamb.

    Science.gov (United States)

    Kerr, Nancy J

    2007-10-01

    A stillborn Suffolk ewe lamb with 2 heads was found to have tarsal arthrogryposis, kypholordosis, craniorachischisis totalis, cheiloschisis, palatoschisis, deviation of the right maxilla, prognathia, patent ductus arteriosus, 3 ventricular septal defects, and 4 great vessels. The lamb was born twin to a normal lamb. No definitive etiology was established.

  10. Diprosopus with multiple craniofacial, musculoskeletal, and cardiac defects in a purebred Suffolk lamb

    OpenAIRE

    Kerr, Nancy J.

    2007-01-01

    A stillborn Suffolk ewe lamb with 2 heads was found to have tarsal arthrogryposis, kypholordosis, craniorachischisis totalis, cheiloschisis, palatoschisis, deviation of the right maxilla, prognathia, patent ductus arteriosus, 3 ventricular septal defects, and 4 great vessels. The lamb was born twin to a normal lamb. No definitive etiology was established.

  11. Topical Minoxidil For the Treatment of Alopecia Areata

    Directory of Open Access Journals (Sweden)

    Vinod K Sharma

    1986-01-01

    Full Text Available One percent minoxidil solution was used topically for the treatment of 10 patients having alopecia areata (4 each having alopecia universalis and totalis and 2 patients with extensive alopecia areata . Significant hair growth did not occur even′ after 3 months of therapy.

  12. Communication beetwen health workers and laringectomic person

    OpenAIRE

    Milanović, Nataša; Momić, Jelena; Rošić, Mladenka; Sabatti, Lara

    2016-01-01

    Speach is basic simbolic and comunication activity, process of making vocal signs. Many illnesses can partially or totaly unable the speach. For patient who underwent total laryngectomy, speaking is unabled what makes comunication difficult. New state leads to many psychological and social problems. However, with improvement in medicine and continuous education of health providers, today this problem can be solved.

  13. Alopecia areata in children : treatment with diphencyprone

    NARCIS (Netherlands)

    Schuttelaar, M L; Hamstra, J J; Plinck, E P; Peereboom-Wynia, J D; Vuzevski, V D; Mulder, P G; Oranje, A P

    1996-01-01

    We assessed the efficacy of diphencyprone (DPCP) treatment in a total of 26 children with alopecia areata (AA). Sixteen children had alopecia areata totalis (AAT) and 10 had alopecia areata localis (AAL). DPCP is an absolute contact sensitizer. Twenty-five children could be sensitized with a 2% DPCP

  14. Scintillation Scanning of the Spleen with Red Cells Labelled with Cr{sup 51}; Scintigraphie de la Rate au Moyen d'Hematies Marquees au Chrome-51; Stsintillyatsionnoe skennirovanie selezenki s pomoshch'yu ehritrotsitov mechennykh Khromom-51; Exploracion Centelleografica del Bazo Mediante Eritrocitos Marcados con Cromo-51

    Energy Technology Data Exchange (ETDEWEB)

    Spinelli-Ressi, F. [Istituto di Radiologia e Medicina Nucleare, Ospedale Maggiore, Milan (Italy)

    1964-10-15

    Satisfactory scintiscans of the spleen have been obtained using chromium-51-labelled red cells, modified by two methods. Initially red cells were sensitized in vitro by coating with incomplete anti-D antibody. In this method the concentration of sensitized red cells in the spleen is proportional to the volume of anti- D serum employed in the sensitization procedure. Satisfactory scintiscans were obtained using 0.50 ml of a 1:128 dilution of anti-D serum, having an original titre of 1: 512/ml of red cells. In spite of good results, the sensitization method, utilizable only in Rh positive patients, has been replaced by the method using red cells modified by heating, which is technically easier and may be used also in Rh negative patients. The image of the spleen is clearly delineated in all the cases, without interference from hepatic radioactivity. The spleen: liver ratio ranges between 5:1 and 10:1. To date scintillation scans of the spleen have been performed in about 60 patients. No immediate or delayed clinical reactions have been observed in the patients after the injection of sensitized or heated red cells. Since the radiation dose delivered to the patient is lower than the dose delivered in many radiological and clinical examinations with radioactive isotopes, the scanning procedure has been widely used in the differential diagnosis of the masses of the left abdomen. Among the cases studied, it is worth while mentioning two cases of splenomegaly associated with a tumour of the left kidney, one case of Banti's disease in a patient, in which a neoplasm of descending colon was suspected and a case of neuroblastoma in a patient two years old, in which the scintiscan of the spleen and that of the kidneys were of great help in making the right diagnosis. Further, the scintiscan has been of unique utility to rule out an accessory spleen and to demonstrate the spleen in congenital malformations, like situs inversus viscerum. In patients affected by chronic leukaemia

  15. Instrument-mounted displays for reducing cognitive load during surgical navigation.

    Science.gov (United States)

    Herrlich, Marc; Tavakol, Parnian; Black, David; Wenig, Dirk; Rieder, Christian; Malaka, Rainer; Kikinis, Ron

    2017-09-01

    Surgical navigation systems rely on a monitor placed in the operating room to relay information. Optimal monitor placement can be challenging in crowded rooms, and it is often not possible to place the monitor directly beside the situs. The operator must split attention between the navigation system and the situs. We present an approach for needle-based interventions to provide navigational feedback directly on the instrument and close to the situs by mounting a small display onto the needle. By mounting a small and lightweight smartwatch display directly onto the instrument, we are able to provide navigational guidance close to the situs and directly in the operator's field of view, thereby reducing the need to switch the focus of view between the situs and the navigation system. We devise a specific variant of the established crosshair metaphor suitable for the very limited screen space. We conduct an empirical user study comparing our approach to using a monitor and a combination of both. Results from the empirical user study show significant benefits for cognitive load, user preference, and general usability for the instrument-mounted display, while achieving the same level of performance in terms of time and accuracy compared to using a monitor. We successfully demonstrate the feasibility of our approach and potential benefits. With ongoing technological advancements, instrument-mounted displays might complement standard monitor setups for surgical navigation in order to lower cognitive demands and for improved usability of such systems.

  16. Radiodiagnosis of cardiac and cardiovisceral malpositions

    International Nuclear Information System (INIS)

    Medeiros Sobrinho, J.H. de; Kambara, A.M.; Silva, M.V.D. da; Fontes, V.F.

    1986-01-01

    The situs or position of the heart and thoraco abdominal organs and viscera has been determined in 100 cases, having or not congenital or adquired cardiopathies or pneumopathies, by means of frontal and oblique radiographies of the thorax and superior part of the abdomen. In some of the cases the tomography or the broncography was also practiced, to study the bronchial morphology so as to determine the pulmonary situs, and consequently the atrial situs. In all the cases the relationship between the radiologic and electrocardiografic findings has been analysed. The cardiovascular malformations were confirmed by cardiac catheterism, cineangiocardiography, and in some cases, by surgery and necropsy. Research on the Howell-Jolly corpuscules in the blood was done in three cases having asplenia. Finally, the literature about other diagnostic methods has been consulted to detect the cardiac and cardiovisceral malpositions. (Author) [pt

  17. BLOKIR MALWARE BERBAHAYA MELEWATI PROXY MENGGUNAKAN ROUTER PFSENSE DAN PAKET HAVP

    Directory of Open Access Journals (Sweden)

    Dedi Irawan

    2017-12-01

    Full Text Available Dilansir dari halaman Support Apple, malware adalah perangkat lunak berbahaya, yang berisi virus, worm, trojan horse, dan program lainnya yang dapat membahayakan Mac atau privasi Anda. Malware dapat diinstal saat Anda mengunduh item dari email, pesan, dan situs web. Sumber: https://support.apple.com/kb/PH25640?locale=id_ID&viewlocale=id_ID. Program ini dapat mengubah, merusak, mencari celah, dan mencuri data pribadi seseorang yang tentu sangat merugikan. Malware dapat menghasilkan saat mengunduh data melalui email, pesan, dan situs web. Salah satu perangkat yang paling banyak digunakaan saat ini adalah smartphone sebagai perangkat untuk mengakses situs web. Meskipun semua komputer sudah terinstal antivirus, harus ditambahkan lapisan perlindungan lain ke jaringan komputer, dalam hal ini HAVP bekerja dengan sangat baik.

  18. Sebaran Potensi Budaya Prasejarah di Enrekang, Sulawesi Selatan

    Directory of Open Access Journals (Sweden)

    Bernadeta Kuswarini Wardaninggar

    2016-12-01

    Kabupaten Enrekang merupakan salah satu daerah yang terletak di bagian utara Sulawesi Selatan yang memiliki wilayah perbukitan dan pegunungan. Potensi temuan-temuan prasejarah di Enrekang diperoleh dari serangkaian kegiatan survei permukaan dengan teknik pencuplikan sampel yang menunjukkan ciri-ciri teknologi prasejarah. Temuan-temuan survei adalah lukisan cap tangan di dinding tebing karst, gua-gua dengan temuan artefak batu, tulang, tembikar dan wadah kubur dari kayu yang disebut mandu atau duni. Selain itu juga ditemukan situs megalitik di atas puncak gunung yang memiliki peninggalan seperti lumpang batu, fragmen tembikar dan susunan batu yang merupakan pembatas daerah permukiman. Secara makro, Penelitian ini bertujuan untuk mengetahui sebaran situs-situs prasejarah dalam rangka memahami karakter budaya Enrekang. Hasil penelitian menunjukkan bahwa Enrekang memiliki diversitas budaya prasejarah yang memiliki aksesibiltas dengan sumber daya alam yang sekaligus menunjang permukiman manusia masa praneolitik hingga persentuhan budaya Austronesia sekitar 3,500 tahun yang lalu dengan pemanfaatan sumber-sumber alamnya.

  19. RANCANG BANGUN APLIKASI PENGAMBILAN BERITA SECARA OTOMATIS MENGGUNAKAN CONTENT SYNDICATION BERBASIS XML DENGAN PLATFORM MICROSOFT .NET

    Directory of Open Access Journals (Sweden)

    Diana Purwitasari

    2004-01-01

    Full Text Available Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Banyaknya kebutuhan akan informasi di internet menyebabkan penyedia jasa situs berita untuk memberikan berita yang selalu yang terbaru. Salah satu alternatif solusi adalah dengan melakukan content syndication. Content syndication adalah adalah proses dimana suatu isi berita dikirimkan atau disediakan, biasanya dengan biaya tertentu, dari penyedia berita, biasanya disebut originators, ke pasar yang membutuhkan atau subscribers. RSS (Rich Site Summary adalah format yang secara umum digunakan untuk melakukannya. RSS pada dasarnya adalah suatu file yang berada di suatu situs, yang menyediakan informasi tentang isi dari situs tersebut. File tersebut biasa disebut sebagai RSS Feeds dan dapat di ambil dan diolah untuk mendapatkan informasi tentang isi situs tersebut. Dibuat sebuah aplikasi untuk pengambilan situs berita secara otomatis menggunakan content syndication yang memerlukan aplikasi pada proses background untuk mengambil RSS Feeds secara berkala pada komputer yang berfungsi sebagai server. Server yang mengambil berita dari situs penyedia terdiri dari aplikasi yang mengatur konfigurasi berita tersebut, dan sebuah windows service untuk mengambil RSS feeds kemudian mengolahnya secara otomatis. Sedangkan aplikasi

  20. On the diameter of dot-critical graphs

    Directory of Open Access Journals (Sweden)

    Doost Ali Mojdeh

    2009-01-01

    Full Text Available A graph G is \\(k\\-dot-critical (totaly \\(k\\-dot-critical if \\(G\\ is dot-critical (totaly dot-critical and the domination number is \\(k\\. In the paper [T. Burtona, D. P. Sumner, Domination dot-critical graphs, Discrete Math, 306 (2006, 11-18] the following question is posed: What are the best bounds for the diameter of a \\(k\\-dot-critical graph and a totally \\(k\\-dot-critical graph \\(G\\ with no critical vertices for \\(k \\geq 4\\? We find the best bound for the diameter of a \\(k\\-dot-critical graph, where \\(k \\in\\{4,5,6\\}\\ and we give a family of \\(k\\-dot-critical graphs (with no critical vertices with sharp diameter \\(2k-3\\ for even \\(k \\geq 4\\.

  1. Topical minoxidil in the treatment of alopecia areata.

    Science.gov (United States)

    Fenton, D A; Wilkinson, J D

    1983-01-01

    A modified double blind crossover study was performed to assess the effect of 1% topical minoxidil as compared with placebo in 30 patients with alopecia areata and alopecia totalis. The active preparation produced a highly significant incidence of hair regrowth. A cosmetically acceptable response was noted in 16 patients. No side effects were seen. The study confirmed that topical minoxidil will induce new hair growth in alopecia areata but that it is less likely to do so in more severe and extensive disease. Furthermore, patients with alopecia universalis and totalis may not respond at all. Nevertheless, as compared with other drugs minoxidil applied topically is relatively non-toxic, is easy to use, and has no systemic or local side effects. Images p1016-a PMID:6412929

  2. SIRENOMELIA: A CASE REPORT

    OpenAIRE

    Wankhede; Shrivastava

    2016-01-01

    The incidence of Sirenomelia is thought to be about 1 in 65,000 live births (Oxford Medical database, Dysmorphology). In Sirenomelia, lower limbs are fused together. Common associated malformations include absent genitalia, imperforate anus, lumbosacral vertebral pelvic abnormalities and renal agenesis. Sirenomelia with craniorachischisis totalis (CT) is a rare fetal malformation, only six cases have been reported in English literature (1-5) and none yet from Asia. Our case is of ...

  3. Content and chemical composition of Hyptis marrubioides essential oil in function of seasons

    OpenAIRE

    Botrel, Priscila Pereira; Pinto, José Eduardo Brasil Pereira; Ferraz, Vany; Bertolucci, Suzan Kelly Vilela; Figueiredo, Felipe Campos

    2010-01-01

    Os oleos essenciais sao principios odoriferos armazenados em celulas especiais da planta. O oleo essencial no genero Hyptis e usado como anestesico, antiespasmodico, antiinflamatorio e pode induzir aborto em doses elevadas. O objetivo deste trabalho foi avaliar a influencia da sazonalidade no teor e composicao do oleo essencial de Hyptis marrubioides. O delineamento experimental foi inteiramente casualizado, com quatro tratamentos (inverno, primavera, verao e outono) e seis repeticoes, totali...

  4. Tofacitinib for the treatment of severe alopecia areata and variants: A study of 90 patients.

    Science.gov (United States)

    Liu, Lucy Y; Craiglow, Brittany G; Dai, Feng; King, Brett A

    2017-01-01

    Alopecia areata (AA) is a common autoimmune disorder. There are no reliably effective therapies for AA. We sought to evaluate the safety and efficacy of the Janus kinase 1/3 inhibitor, tofacitinib, in a series of patients over an extended period of time. This is a retrospective study of patients age 18 years or older with AA with at least 40% scalp hair loss treated with tofacitinib. The primary end point was the percent change in Severity of Alopecia Tool (SALT) score during treatment. Ninety patients met inclusion criteria. Of 65 potential responders to therapy, defined as those with alopecia totalis or alopecia universalis with duration of current episode of disease of 10 years or less or alopecia areata, 77% achieved a clinical response, with 58% of patients achieving greater than 50% change in SALT score over 4 to 18 months of treatment. Patients with AA experienced a higher percent change in SALT score than did patients with alopecia totalis or alopecia universalis (81.9% vs 59.0%). Tofacitinib was well tolerated, and there were no serious adverse events. The retrospective nature of the data, the relatively small number of patients, and lack of a control group are limitations. Tofacitinib should be considered for the treatment of severe AA, alopecia totalis, and alopecia universalis; tofacitinib dose response will be better defined by randomized controlled trials. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  5. Amar Klar: A giant among scientists (1947–2017)

    Indian Academy of Sciences (India)

    Jagmohan Singh

    invertus in mice, handedness in humans and its linkage to homosexuality, schizophrenia, etc. (Klar 2003, 2004). His theories were met with dismissal and stout resistance by the aficionados. In response, Amar provided evidence on his own by showing that the situs invertus could be generated by knocking down the left right ...

  6. 26 CFR 1.404(a)-3 - Contributions of an employer to or under an employees' pension trust or annuity plan that meets...

    Science.gov (United States)

    2010-04-01

    ... THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus... foreign situs pension trust which could qualify for exemption under section 501(a) except that it is not... and methods which are reasonable in view of the provisions and coverage of the plan, the funding...

  7. Pärimuslik ajalugu ja Fr. R. Kreutzwald / Tiiu Jaago

    Index Scriptorium Estoniae

    Jaago, Tiiu, 1960-

    2005-01-01

    Pärimuslik ajalugu kui rahvapärane ajalookäsitus, mida saab uurida folkloorse jutustamise kaudu. Fr. R. Kreutzwaldi ja F. K. H. Kruse sõnavõttudest Aruküla koobaste päritolu kohta ajakirjas "Das Inland" aastast 1844

  8. IMPLEMENTASI SUBVERSION DAN REDMINE PROJECT MANAGEMENT DALAM PERANCANGAN TOKO KUE ONLINE

    Directory of Open Access Journals (Sweden)

    Xanty Adhi Parandani

    2016-04-01

    Full Text Available Belanja online telah menjadi gaya hidup konsumen saat ini. Kemudahan, mobilitas dan fleksibilitas menjadi daya tarik dari komponen e-commerce ini. Bagi penjual, metode penjualan via web merupakan salah satu metode yang sangat efisien, ekonomis dan efektif untuk meningkatkan omzet penjualan. Sebagai contoh kasus untuk penerapan konsep manajemen proyek, dibuat sebuahpurwarupa toko kue yang dirancang untuk sistem penjualan berbasis web (online. Purwarupa ini dibangun secara tim, dimana komponen dari situs ini dibuat secara terpisah- pisah oleh masing-masing anggota tim. Dengan memanfaatkan fasilitas Subversion, partisi komponen sistem disatukan menjadi sebuah sistem yang utuh. Sebagai sebuah proyek sistem informasi yang dibangun secara tim, dibuat sistem pengaturan proyek menggunakan sebuah aplikasi manajemen proyek, Redmine Project Management. Redmine merupakan proyek manajemen berbasis web yang dibangun dengan bahasa Ruby diatas Framework Rail. Pembangunan web secara berkelompok dengan tugas individu mandiri akan sangat bermanfaat dalam mengembangkan kreativitas setiap individu, sehingga situs yang dihasilkan akan lebih unik, menarik dan easy fault tracing, karena mudahnya melacak letak dan penyebab kesalahan. Dari hasil kolaborasi menggunakan fasilitas Redmine dan Subversion, diperoleh sebuah situs toko kue online yang merupakan represntasi dari beragam gagasan anggota tim, namun bisa diintegrasikan dan berfungsi dengan baik, selayaknya situs yang dibuat secara individu. Kata kunci: e-commerce, Tokokueku, Subversion, Redmine project management, ruby, framework rail.

  9. Alopecia areata in children

    International Nuclear Information System (INIS)

    Ahmed, I.; Nasreen, S.; Bhatti, R.

    2007-01-01

    To determine the clinical presentations of alopecia areata in children as well as the frequency of associated disorders. Children of either gender suffering from alopecia areata, upto 15 years of age, who fulfilled the selection criteria were included in the study. Only freshly registered cases were studied. Severity of the disease was graded as mild, moderate and severe disease, and other clinical patterns including alopecia totalis, alopecia universalis and ophiasis. Hematological and biochemical profile was evaluated. Chi-square test was applied for statistical analysis in order to determine p-value using the percentages of variables. One hundred and fourteen patients comprising 54 males (47%) and 60 females (53%), aged 4 upto 15 years, the mean age being 9.1 years, were enrolled. Family history of alopecia areata was positive in 11 patients (10%). Fifty nine patients (51%) were of age 6-10 years, 39 patients (35%), aged 11-15 years, and 16 (14%) were of age below 5 years. Mild alopecia areata (41%, p<0.05) was the most common presentation followed by moderate disease (31%, p<0.05), severe alopecia (17%, p <0.05), alopecia totalis (7%, p <0.05), alopecia universalis (2.7%, p=0.05) and ophiasis (1.7%, p=0.05). Nail changes were found in 40 patients (35%, p<0.05). Definite evidence of atopy was obtained in 23 patients (20%, p<0.05). The autoimmune disorders associated with alopecia areata included: hypothyroidism (4.3%), vitiligo (3.5%), psoriasis (1.8%), systemic lupus erythematosus (SLE 0.9%), hypoparathyroidism (0.9%) and diabetes mellitus (0.9%). The spectrum of childhood alopecia areata ranges from mild, moderate and severe alopecia, ultimately to alopecia totalis, alopecia universalis and ophiasis. Nail changes as well as atopy and autoimmune disorders are the associated disorders. (author)

  10. EXAMINING BADMINTON ATHLETES’ SELF-ESTEEM

    OpenAIRE

    EYLEM GENCER; Ekrem Levent İLHAN

    2012-01-01

    The purpose of this study is to examine badminton athletes’ self-esteem according to some variables. The research was carried out in Badminton Turkey Clubs Championship where 12 clubs and 87 athletes participated in 2009. 42 national and 14 non-national totaly 56 badminton athletes whose mean age 18.78±3.46 that participated in Badminton Turkey Clubs Championship in 2009 constitute our research sample. Rosenberg Self-Esteem Scale, that was developed by Rosenberg (1963) and adapted to Turkish ...

  11. Natural gas prices in Italy. Tariffs geographical distribution; Metano. Paese che vai, prezzo che trovi

    Energy Technology Data Exchange (ETDEWEB)

    Marrocchelli, A. [ENEA, Rome (Italy). Centro Ricerche Casaccia

    2000-11-01

    The annual report on services and activity carries at some evaluations of data concerned the natural gas market: total consumption, costs and prices in Italy and comparative evaluations with other european countries. [Italian] La relazione annuale sullo stato dei servizi e sull'attivita' svolta, presentata dal Presidente dell'Autorita' per l'energia elettrica e il gas, porta ad alcune considerazioni sui dati che riguardano il mercato del gas naturale: i consumi totali, i costi e i prezzi in Italia, il confronto con i costi e i prezzi praticati negli altri paesi europei.

  12. 46,XX Karyotype in a Male with Ambigious Genitalia: A Case Report

    Directory of Open Access Journals (Sweden)

    Mahmut Balkan

    2004-01-01

    Full Text Available 40 days old case who were diagnosed with ambigious genitalia were sentto laboratory of cytogenetics. Mother was 26 years old and have to alivechildren and case were the second child and applied to Child SurgeryDepartment due to continiously vomiting and uneasy conditions. Sexualdevelopment were as male on physical examinations. Cell culture wasapplied for chromosomal analysis. Slides were stained with GiemsaBanding Staining (GTG and 100 cells were totaly counted and karyotypingwere done with 15 metaphase. Chromosome with 46,XX karyotype. Casewere taken under consideration of congenital adrenel hyperplasia afterevalution of karyotype. Case were discussed according to by information ofpresents literatures.

  13. PERLINDUNGAN HUKUM HAK CIPTA TERHADAP PENCIPTA LAGU YANG DIUNDUH MELALUI INTERNET

    Directory of Open Access Journals (Sweden)

    Habi Kusno

    2017-04-01

    Abstrak perlindungan hukum hak cipta terhadap pencipta lagu yang diunduh melalui internet dilakukan dengan cara yaitu secara administrasi, melalui instrumen hukum pidana dan gugatan perdata. Upaya hukum yang dilakukan dalam melindungi hak cipta pencipta lagu yang diunduh melalui internet dilakukan beberapa cara yaitu Kementerian Informasi dan Teknologi untuk berperan aktif dalam melakukan pemblokiran terhadap situs-situs yang menyediakan fasilitas download lagu gratis dan menyiapkan sumber daya manusia di bidang penyidikan seperti dari Kepolisian Negara Republik Indonesia serta Penyidik Pegawai Negeri Sipil dan lainnya seperti jaksa dan hakim yang memiliki kemampuan dan pengetahuan di bidang HKI serta peran Dewan Hak Cipta untuk memberikan pengetahuan mengenai arti penting HKI.   Kata Kunci: Perlindungan Hukum, Hak Cipta, Lagu, Internet

  14. DESAIN DAN IMPLEMENTASI AUGMENTED REALITY BERBASIS WEB PADA APLIKASI FURNITURE SHOPPING MANAGER SEBAGAI ALAT BANTU BELANJA ONLINE

    Directory of Open Access Journals (Sweden)

    Basworo Ardi Pramono

    2012-07-01

    Full Text Available Dalam penulisan jurnal ini akan dibahas mengenai pengembangan aplikasi Furniture Shopping Manager (FSM sebagai suatu alat bantu yang dapat dimanfaatkan oleh para pemilik situs atau toko furniture secara online dalam menjual produknya.  FSM dirancang sebagai sebuah aplikasi berbasis web yang terintegrasi ke dalam suatu situs belanja online dengan fitur-fitur yang diharapkan dapat memberikan pengalaman yang baru, unik dan menarik dalam kegiatan belanja furniture online.   Aplikasi FSM dikembangkan dengan mengimplementasikan beberapa komponen  teknologi utama yaitu Augmented Reality (AR, engine 3D ke dalam aplikasi.  Keseluruhan komponen tersebut dirancang agar dapat  menghadirkan suasana belanja yang menarik di hadapan user secara digital. Dengan demikian user dapat mencoba apakah furniture yang di beli cocok dengan ruangan. Dengan menggunakan FSM, user dapat mencoba model 3D furniture, memilih model furniture hingga mengambil foto ruangannya dengan hasil visualisasi model furniture 3D yang disukai untuk selanjutnya dapat disimpan.

  15. Electronic Word-of-mouth (E-wom) Dan Pengaruhnya Terhadap Keputusan Pembelian Di Restoran Dan Kafe Di Surabaya

    OpenAIRE

    Ivana, Vina; Sari, Adelia; Thio, Sienny

    2014-01-01

    Penelitian ini dilakukan untuk mengetahui Electronic Word-of-Mouth (e-WOM) dan Pengaruhnya terhadap Keputusan Pembelian di Restoran dan Kafe di Surabaya. e-WOM telah menjadi fenomena yang sedang berkembang seturut dengan meningkatnya penggunaan situs jejaring sosial. Elemen-elemen yang terdapat pada e-WOM turut berperan dalam keputusan pembelian yang dilakukan oleh konsumen di restoran dan kafe di Surabaya.Teknik analisa yang digunakan dalam penelitian ini adalah kuantitatif kausal dengan me...

  16. APLIKASI MODEL LIMA KEKUATAN PORTER PADA RESTORAN DRUPADI

    OpenAIRE

    Sevenpri Candra

    2013-01-01

    Internet adalah salah satu media penyebaran informasi global, yang memberi kemudahan dalam berbisnis dan mempermudah pemakainya untuk berkomunikasi serta memperoleh informasi yang dibutuhkan dengan cepat dan akurat dengan penggunaan situs web.Untuk melihat persaingan dalam satu industry, penulis mengunakan metode analisis lima kekuatan porter (Porter Five Forces Analysis). Dengan analisis Porter, terlihat bahwa kekuatan tawar menawar dari konsumen berada dalam posisi yang kuat. Ke...

  17. Normal position and malposition of the heart

    International Nuclear Information System (INIS)

    Andresen, J.H.; Eggert Hansen, T.

    1980-01-01

    The main types of heart positions and the malpositions are described as demonstrated on plain films of the thorax. Special attention is drawn to the situs ambiguous with the poly- or asplenia which may be recognized from hypoarterial or epiarterial position of the main bronchi and their equal lengths and courses. This diagnosis is important because of the frequent accompanying congenital cardiac malformations and in respect to the planning of angiocardiography. (orig.) [de

  18. West African Journal of Industrial and Academic Research ...

    African Journals Online (AJOL)

    Prof. Osuagwwu

    If P then Q. P is the ... (p.32). About 177 AD Celsus, in his book 'The True. Word', expressed what appears to have been the consensus ... h(ic) s(itus) e(st). Tiberius .... account of John 6:42, the Jews stated that they are sure of .... illegitimate son like Confucius as Collins (2016) stated? .... writings of the Greek Scriptures (new.

  19. Komunikasi Getok Tular Pengantar Popularitas Merek

    OpenAIRE

    Harjanto, Rudy; Mulyana, Deddy

    2008-01-01

    Komunikasi getok tular (Word of mouth-WOM) adalah komunikasi berantai yang beredar dengan sendirinya di suatu komunitas tertentu, merujuk pada penyampaian informasi yang pada umumnya dilakukan secara lisan, informal dari seseorang kepada orang lain secara pribadi, antara dua individu atau lebih. Perkembangan teknologi memungkinkan komunikasi getok tular juga berkembang melalui internet, situs web, maupun halaman-halaman profil online, posting dalam blog-blog pribadi maupun pertukaran informas...

  20. Hubungan Facebook Addiction Disorder (Fad) dengan Perilaku Asertif Remaja di SMA Kristen 1 Tomohon

    OpenAIRE

    Polii, Gloria Gratia; Bidjuni, Hendro; Wowiling, Ferdinand

    2014-01-01

    : Facebook addiction berarti menghabiskan jumlah waktu yang berlebihan di facebook. Facebook merupakan situs jejaring sosial yang mudah digunakan, dan yang paling penting adalah mempunyai efek mencandu. Secara psikologis, dampak negatif kecanduan facebook dapat dibagi atas: Pribadi yang anti sosial dan Dualisme kepribadian. Tujuan penelitian ini untuk mengetahui hubungan Facebook Addiction Disorder (FAD) dengan Perilaku Asertif Remaja di SMA Kristen 1 Tomohon. Desain penelitian ini dilaksanak...

  1. Movie Review Sentimen Analisis Dengan Metode Naïve Bayes Base on Feature Selection

    OpenAIRE

    -, Andilala

    2016-01-01

    Perkembangan internet dewasa ini berkembang sangat pesat yang secara tidak langsung mendorong penciptaan konten web pribadi yang melibatkan sentimen seperti blog, tweets, web forum dan jenis-jenis media sosial. Manusia sering kali mengambil keputusan yang didasari oleh masukan dari teman, saudara, kolega dan lain-lain. Dengan didukung ketersediaan pertumbuhan dan popularitas sumber daya yang kaya akan pendapat seperti review situs online dan blog pribadi Misalnya, pengungkapan perasaan pribad...

  2. Efektivitas Email Untuk Pemasaran

    OpenAIRE

    Oetomo, Budi Sutedjo Dharma

    2009-01-01

    Lebih dari 500 juta orang dan badan USAha telah tergabung di internet. Pada umumnya, mereka telah terbiasa untuk memanfaatkan fitur dan aplikasi yang tersedia di internet, seperti email, mailing list, web, blog dan situs jejaring sosial. Diantara fitur dan aplikasi internet itu yang hampir digunakan oleh setiap orang dan badan USAha adalah email, karena mereka telah memiliki alamat email, bahkan lebih dari satu buah. Kini, fitur email telah dimanfaatkan untuk kegiatan pemasaran, khususnya pro...

  3. PENGARUH DAYA TARIK PESAN IKLAN DI JEJARING SOSIAL TERHADAP MINAT BELI PADA PEREMPUAN (Studi Eksplanatif Pengaruh Daya Tarik Pesan Iklan Zalora Indonesia di Facebook Fanpage terhadap Minat Beli pada Perempuan Dewasa Muda)

    OpenAIRE

    Melissa, Febe

    2013-01-01

    Mengkomunikasikan produk dan jasa melalui online (e-commerce) kini banyak dilakukan oleh pemasar. Salah satu media online yang efektif untuk beriklan adalah situs jejaring sosial. Hasil survei Asosiasi Penyelenggara Jasa Internet Indonesia (APJII) menyajikan data bahwa dari total 63 juta pengguna internet pada tahun 2012 (24,23% dari jumlah penduduk Indonesia), sekitar 36 juta melakukan belanja online. Hal tersebut membuktikan daya tarik iklan melalui media internet ternyata cukup efektif. Da...

  4. Karakter Pemukiman Lahan Basah Abad VI - XV Masehi di Daerah Aliran Sungai (DAS Barito

    Directory of Open Access Journals (Sweden)

    nfn Sunarningsih

    2017-07-01

    Full Text Available One of the great rivers that flow in Kalimantan region is Barito River, precisely in the southeast region. Barito drainage basin crosses two different provinces, namely South Kalimantan and Central Kalimantan. Archaeological researches of wetland ancient settlements on Barito Basin are mainly in the downstream area. The result of this research obtained a varied data, such as artifacts, settlement form, and environmental supports. There seemed to be such character differences in each site. Therefore, this article examine the factors that influence the character differences of each wetland site. The research use descriptive analytic, with inductive reasoning. The result shows that there are some characters of wetland residential sites in the Barito basin, which is influenced by the function of site, the mastery of technology, environmental carrying capacity, and the intensity interaction with outside community. Salah satu sungai besar yang mengalir di wilayah Kalimantan adalah Sungai Barito, tepatnya di wilayah Kalimantan bagian Tenggara. Daerah Aliran Sungai Barito melintasi dua wilayah propinsi yang berbeda, yaitu Kalimantan Selatan dan Kalimantan Tengah. Penelitian arkeologi terhadap pemukiman lahan basah (abad ke 6-15 M di Daerah Aliran Sungai Barito berada terutama di daerah hilir. Dari hasil penelitian tersebut didapatkan data yang beragam, baik dari artefak, bentuk pemukimannya, dan lingkungan pendukungnya. Tampaknya ada karakter yang berbeda dari masing-masing situs. Oleh karena itu, tulisanini berusaha untuk mengkaji faktor yang mempengaruhi terjadinya perbedaan karakter dari masing-masing situs di lahan basah tersebut. Metode yang digunakan adalah deskriptif-analisis, dengan penalaran induktif. Hasil penelitian menunjukkan bahwa ada beberapa macam karakter dari situs pemukiman lahan basah di DAS Barito, yang dipengaruhi oleh fungsi situs, penguasaan teknologi, daya dukung lingkungan, dan intensitas terjadinya interaksi dengan masyarakat

  5. PERKEMBANGAN TEKNOLOGI KOMUNIKASI

    Directory of Open Access Journals (Sweden)

    Yuliyanto Budi Setiawan

    2008-01-01

    Full Text Available Perkembangan teknologi komunikasi di dunia (termasuk Indonesia dapat membuat perubahan pada sikap dan perilaku penggunanya. Hal ini memunculkan dampak positif dan negatif. Untuk contoh dampak positif: jika pengguna ingin mencari informasi, mereka hanya perlu browsing di internet. Hal ini membuat aktivitas mereka menjadi lebih mudah dan sederhana. Untuk contoh dampak negatifnya: anak-anak dapat mengakses situs porno. Hal ini membuat degradasi/turunnya kepribadian mereka. Jadi, kita harus bijaksana saat menggunakan teknologi.

  6. Integrasi Chatbot Berbasis Aiml Pada Website E-commerce Sebagai Virtual Assistant Dalam Pencarian Dan Pemesanan Produk (Studi Kasus Toko Buku Online Edu4indo.com)

    OpenAIRE

    Bahartyan, Egga; Bahtiar, Nurdin; Waspada, Indra

    2014-01-01

    Perkembangan teknologi chatbot semakin canggih hingga saat ini. Mulai dari chatbot yang bernama ALICE, hingga aplikasi Siri milik Perusahaan Apple sebagai virtual assistant yang berjalan pada iPhone masih dikembangkan agar semakin cerdas dan canggih untuk mempermudah pekerjaan manusia. Chatbot dapat diintegrasikan ke berbagai layanan, aplikasi atau sumber data lainnya. Salah satunya adalah mengintegrasikan chatbot dengan situs web e-commerce untuk menggantikan tugas manusia sebagai customer s...

  7. Pornography Manifestation in Internet Media ( Content Analysis on Popular Local Porn Websites in Indonesia )

    OpenAIRE

    Sosiawan, Edwi Arif

    2009-01-01

    Pornografi yang semula hanya berupa tulisan saat ini berkembang dalam berbagai macam manifestasi seperti gambar, cerita pendek, video , film, lagu dan sebagainya. Bahkan pornografi di internet bukan lagi hanya pekerjaan orang iseng tetapi menjadi komoditi bisnis di dunia maya. Inilah yang menjadi penyebab menjamurnya situs porno di Internet. Pada sisi lain pornografi di internet juga dicap sebagai penyulut adanya kejahatan seksual, penyimpangan seksual dan bisnis seksual. Namun hingga saat in...

  8. RANCANG BANGUN APLIKASI PEMBELAJARAN AGAMA ISLAM UNTUK ANAK-ANAK BERBASIS MULTIMEDIA INTERAKTIF DAN WEB

    Directory of Open Access Journals (Sweden)

    Idhawati Hestiningsih

    2012-07-01

    Full Text Available Saat ini pembelajaran agama Islam untuk anak-anak semakin diutamakan. Orang tua dituntut untuk mengenalkan sejak dini pada anak tentang ajaran Islam. Dengan perkembangan internet yang telah memasuki aspek kehidupan manusia di berbagai sektor, anak-anak kini sudah tidak asing dengan internet. Situs web di internet memiliki konten yang jauh lebih banyak dibandingkan dengan buku cetak biasa sehingga situs web dapat menjadi media pembelajaran interaktif yang disukai oleh anak-anak. Tujuan dibuatnya media pembelajaran agama Islam untuk anak-anak berbasis multimedia interaktif dan web diantaranya adalah memberikan kemudahan bagi anak-anak dalam mendapatkan dan pengaksesan suatu informasi tentang agama Islam yang disampaikan secara terstruktur dan konsisten dalam format teks, gambar, grafik, video animasi dan suara yang dikemas dalam satu paket situs web multimedia. Aplikasi yang diberi nama Anak Sholeh ini dibangun menggunakan Adobe Flex dan Zend Frameworks dengan database MySQL dan PHP sebagai bahasa pemrogramannya. Aplikasi diuji untuk mengetahui stabilitas, aksesibilitas, dan koneksitas sistem serta tingkat kepuasan pengguna. Dari hasil pengujian aplikasi ini dapat diakses dengan peramban web Mozilla, Opera, Safari, IE, dan Chrome dan layak diterapkan sebagai panduan dalam media pembelajaran Islami untuk anak-anak

  9. RANCANG BANGUN APLIKASI PEMBELAJARAN AGAMA ISLAM UNTUK ANAK-ANAK BERBASIS MULTIMEDIA INTERAKTIF DAN WEB

    Directory of Open Access Journals (Sweden)

    Idhawati Hestiningsih

    2013-04-01

    Full Text Available Saat ini pembelajaran agama Islam untuk anak-anak semakin diutamakan. Orang tua dituntut untuk mengenalkan sejak dini pada anak tentang ajaran Islam. Dengan perkembangan internet yang telah memasuki aspek kehidupan manusia di berbagai sektor, anak-anak kini sudah tidak asing dengan internet. Situs web di internet memiliki konten yang jauh lebih banyak dibandingkan dengan buku cetak biasa sehingga situs web dapat menjadi media pembelajaran interaktif yang disukai oleh anak-anak. Tujuan dibuatnya media pembelajaran agama Islam untuk anak-anak berbasis multimedia interaktif dan web diantaranya adalah memberikan kemudahan bagi anak-anak dalam mendapatkan dan pengaksesan suatu informasi tentang agama Islam yang disampaikan secara terstruktur dan konsisten dalam format teks, gambar, grafik, video animasi dan suara yang dikemas dalam satu paket situs web multimedia. Aplikasi yang diberi nama Anak Sholeh ini dibangun menggunakan Adobe Flex dan Zend Frameworks dengan database MySQL dan PHP sebagai bahasa pemrogramannya. Aplikasi diuji untuk mengetahui stabilitas, aksesibilitas, dan koneksitas sistem serta tingkat kepuasan pengguna. Dari hasil pengujian aplikasi ini dapat diakses dengan peramban web Mozilla, Opera, Safari, IE, dan Chrome dan layak diterapkan sebagai panduan dalam media pembelajaran Islami untuk anak-anak

  10. Implicit Social Trust Dan Support Vector Regression Untuk Sistem Rekomendasi Berita

    Directory of Open Access Journals (Sweden)

    Melita Widya Ningrum

    2018-01-01

    Full Text Available Situs berita merupakan salah satu situs yang sering diakses masyarakat karena kemampuannya dalam menyajikan informasi terkini dari berbagai topik seperti olahraga, bisnis, politik, teknologi, kesehatan dan hiburan. Masyarakat dapat mencari dan melihat berita yang sedang populer dari seluruh dunia. Di sisi lain, melimpahnya artikel berita yang tersedia dapat menyulitkan pengguna dalam menemukan artikel berita yang sesuai dengan ketertarikannya. Pemilihan artikel berita yang ditampilkan ke halaman utama pengguna menjadi penting karena dapat meningkatkan minat pengguna untuk membaca artikel berita dari situs tersebut. Selain itu, pemilihan artikel berita yang sesuai dapat meminimalisir terjadinya banjir informasi yang tidak relevan. Dalam pemilihan artikel berita dibutuhkan sistem rekomendasi yang memiliki pengetahuan mengenai ketertarikan atau relevansi pengguna akan topik berita tertentu. Pada penelitian ini, peneliti membuat sistem rekomendasi artikel berita pada New York Times berbasis implicit social trust. Social trust dihasilkan dari interaksi antara pengguna dengan teman-temannya  dan bobot kepercayaan teman pengguna pada media sosial Twitter. Data yang diambil merupakan data pengguna Twitter, teman dan jumlah interaksi antar pengguna berupa retweet. Sistem ini memanfaatkan algoritma Support Vector Regression untuk memberikan estimasi penilaian pengguna terhadap suatu topik tertentu. Hasil pengolahan data dengan Support Vector Regression menunjukkan tingkat akurasi dengan MAPE sebesar 0,8243075902233644%.   Keywords : Twitter, Rekomendasi Berita, Social Trust, Support Vector Regression

  11. MENUMBUHKAN PERAN SERTA MASYARAKAT DALAM MELESTARIKAN KEBUDAYAAN DAN BENDA CAGAR BUDAYA MELALUI PEMBERDAYAAN MASYARAKAT DI KAWASAN WISATA DUSUN CETO

    Directory of Open Access Journals (Sweden)

    Emy Wuryani

    2012-12-01

    Full Text Available Hasil kebudayaan dan benda cagar budaya sebagai atraksi wisata telah banyak menarik wisatawan untuk berkunjung ke tempat itu. Benda Cagar Budaya yang banyak dikunjungi wisatawan antara lain berupa candi dan situs sejarah. Di kawasan wisata dusun Ceto, candi dan situs sejarah menjadi tujuan utama wisatawan berkunjung ke Dusun Ceto. Namun ada kekhawatiran, dari beberapa warga apabila kawasan ini nanti “dijajah” dan tergerus arus modernisasi yang dibawa wisatawan sehingga masyarakat tidak lagi melestarikan peninggalan sejarah dan budaya yang menjadi warisan leluhurnya. Untuk itu perlu ada peranserta dari warga masyarakat dalam melaksanakan program konservasi di kawasan wisata Dusun Ceto. Tujuan dari penelitian ini adalah untuk mendeskripsikan bentuk-bentuk peran serta masyarakat di kawasan wisata Dusun Ceto dalam upaya melestarikan kebudayaan dan BCB di dusun Ceto. Adapun manfaat dari penelitian ini berfungsi sebagai pemberdayaan masyarakat yang memiliki kepedulian atas peninggalan sejarah dan warisan budaya yang harus dilestarikan. Metode penelitian dengan menggunakan teknik wawancara, observasi – partisipasi, survei untuk wisatawan, studi banding ke desa wisata, dan pendampingan. Hasil penelitian menunjukkan bahwa peranserta masyarakat di kawasan wisata Dusun Ceto memiliki kepedulian yang tinggi dan berperan aktif dalam menjaga dan melestarikan peninggalan sejarah dan budayanya. Hal ini ditunjukkan melalui kegiatan kerja bakti setiap hari Minggu di situs sejarah, pertemuan rutin, menghidupkan kesenian karawitan, dan mengadakan pasraman.

  12. REBRANDING EKALOKASARI PLAZA “Pattern of Communication In Rebrandring Process Ekalokasari Plaza"

    Directory of Open Access Journals (Sweden)

    Arien Afriesta

    2016-03-01

    Full Text Available AbstrakPerkembangan pusat perbelanjaan yang semakin meningkat di Kota Bogormendorong Ekalokasari Plaza (sekarang menjadi LIPPO Plaza Bogor untukmelakukan perubahan agar dapat bersaing dengan berbagai pusat perbelanjaanmodern lainnya, khususnya yang berada di Kota Bogor.Ekalokasari Plaza yang sekarang sudah berubah menjadi LIPPO Plaza Bogormerupakan salah satu pusat perbelanjaan tertua di Kota Bogor, bahkan lebih tuadibandingkan Botani Square yang menjadi pesaing utama pusat perbelanjaan moderndi Kota Bogor. Berdasarkan sebuah situs blog yang bernama “Hello Bogor” terdapatinformasi tiga besar pusat perbelanjaan modern terbesar di Kota Bogor pada tahun2012, yaitu Botani Square, Ekalokasari Plaza (LIPPO Plaza Bogor, dan CibinongCity Mall.

  13. Manajemen Kesiswaan Pada Sekolah Inklusi

    Directory of Open Access Journals (Sweden)

    Achmad Hufron

    2016-08-01

    Full Text Available Abstract: The purpose of this study is to describe the student management at inclusion school. This study used a qualitative descriptive approach and multi-site studies design. The techniques of the study were collecting data used interviews, observation and documentation. Data analysis was divided into two phases of data analysis; those are data analysis site and site across data analysis. In checking validity of the data in this study used three kind of validities that are credibility, dependability, and confirmability. Based on those technique data analyses, it is found across the site as follows. First of all, the implementation of new admissions both regular students and students with special needs conducted in line with the new students enrollment requirements of Dikpora Kebumen. In state Elementary School 1 Surotrunan, new students who have special needs were selected and accepted, the range is for students with low till medium needs. In the other hand, State Elementary School Pecarikan using a system of promotion. Secondly, students are placed in a class, moreover, students’ grouping is based on their intelligence, academic ability and special needs. Thirdly, student treatments are given through some habitual activities, extracurricular activities, and incidental activities. Schools require guider (shadow on each ABK’s. Key Words: management, student, educational inclusion Abstrak: Tujuan penelitian adalah mendeskripsikan manajemen kesiswaan pada sekolah inklusi. Penelitian ini menggunakan pendekatan deskriptif kualitatif dengan rancangan studi multi situs. Teknik pengumpulan data dengan wawancara mendalam, observasi, dan studi dokumentasi. Analisis data terdiri atas analisis data dalam situs dan analisis data lintas situs. Pengecekan keabsahan data menggunakan tiga kriteria, yaitu kredibilitas, dependabilitas, dan konfirmabilitas. Temuan lintas situs dalam penelitrian ini sebagai berikut. Pertama, pelaksanaan PPDB baik siswa reguler

  14. CONSERVED ROLES FOR CYTOSKELETAL COMPONENTS IN DETERMINING LATERALITY

    Science.gov (United States)

    McDowell, Gary S.; Lemire, Joan M.; Paré, Jean-Francois; Cammarata, Garrett; Lowery, Laura Anne; Levin, Michael

    2016-01-01

    SUMMARY Consistently-biased left-right (LR) patterning is required for the proper placement of organs including the heart and viscera. The LR axis is especially fascinating as an example of multi-scale pattern formation, since here chiral events at the subcellular level are integrated and amplified into asymmetric transcriptional cascades and ultimately into the anatomical patterning of the entire body. In contrast to the other two body axes, there is considerable controversy about the earliest mechanisms of embryonic laterality. Many molecular components of asymmetry have not been widely tested among phyla with diverse bodyplans, and it is unknown whether parallel (redundant) pathways may exist that could reverse abnormal asymmetry states at specific checkpoints in development. To address conservation of the early steps of LR patterning, we used the Xenopus laevis (frog) embryo to functionally test a number of protein targets known to direct asymmetry in plants, fruit fly, and rodent. Using the same reagents that randomize asymmetry in Arabidopsis, Drosophila, and mouse embryos, we show that manipulation of the microtubule and actin cytoskeleton immediately post-fertilization, but not later, results in laterality defects in Xenopus embryos. Moreover, we observed organ-specific randomization effects and a striking dissociation of organ situs from effects on the expression of left side control genes, which parallel data from Drosophila and mouse. Remarkably, some early manipulations that disrupt laterality of transcriptional asymmetry determinants can be subsequently “rescued” by the embryo, resulting in normal organ situs. These data reveal the existence of novel corrective mechanisms, demonstrate that asymmetric expression of Nodal is not a definitive marker of laterality, and suggest the existence of amplification pathways that connect early cytoskeletal processes to control of organ situs bypassing Nodal. Counter to alternative models of symmetry breaking

  15. Complex integration and Cauchy's theorem

    CERN Document Server

    Watson, GN

    2012-01-01

    This brief monograph by one of the great mathematicians of the early twentieth century offers a single-volume compilation of propositions employed in proofs of Cauchy's theorem. Developing an arithmetical basis that avoids geometrical intuitions, Watson also provides a brief account of the various applications of the theorem to the evaluation of definite integrals.Author G. N. Watson begins by reviewing various propositions of Poincaré's Analysis Situs, upon which proof of the theorem's most general form depends. Subsequent chapters examine the calculus of residues, calculus optimization, the

  16. Peter M. M. G. Akkermans - Glenn M. Schwartz: The Archaeology of Syria. From Complex Hunter-Gartherers to early Urban Societies (ca. 16000-300BC).

    OpenAIRE

    Vostrovská Ivana

    2008-01-01

    Recenze představuje publikaci P. Akkermanse a G. Schwartze, ve které souhrnně přibližují archeologii Sýrie od paleolitu po rok 300BC. Mimo chronologický přehled v daných obdobích se autoři blíže věnují neolitizaci a vzniku urbánních společností. The review represents a study by P. Akkermans a G. Schwartz where totaly converge the archeology of Syria from paleolithic to 300BC. Beyond chronologically overview in given periods authors pay attention process of neolitisation and development of ...

  17. Symposium cellular response to DNA damage the role of poly(ADP-ribose) poly(ADP-ribose) in the cellular response to DNA damage

    International Nuclear Information System (INIS)

    Berger, N.A.

    1985-01-01

    Poly(ADP-ribose) polymerase is a chromatin-bound enzyme which, on activation by DNA strand breaks, catalyzes the successive transfer of ADP-ribose units from NAD to nuclear proteins. Poly(ADP-ribose) synthesis is stimulated by DNA strand breaks, and the polymer may alter the structure and/or function of chromosomal proteins to facilitate the DNA repair process. Inhibitors of Poly(ADP-ribose) polymerase or deficiencies of the substrate, NAD, lead to retardation of the DNA repair process. When DNA strand breaks are extensive or when breaks fail to be repaired, the stimulus for activation of Poly(ADP-ribose) persists and the activated enzyme is capable of totaly consuming cellular pools of NAD. Depletion of NAD and consequent lowering of cellular ATP pools, due to activation of Poly(ADP-ribose) polymerase, may account for rapid cell death before DNA repair takes place and before the genetic effects of DNA damage become manifest

  18. Influence of mineral salts upon activity of Trichoderma harzianum non-volatile metabolites on Armillaria spp. rhizomorphs

    Directory of Open Access Journals (Sweden)

    Krystyna Przybył

    2011-01-01

    Full Text Available Effect of non-volatile metabolites of Trichoderma harzianum together with certain salts containing Mg++, Fe+++, Mn++, Cu++, Al+++, Ca++, K++, Na+, PO4--- and SO3--- on the production and length of rhizomorphs of Armillaria borealis, A. gallica and A. ostoyae was studied. In pure medium, T. harzianum exhibited stimulating effect on rhizomorphs of A. borealis (both number and length and A. ostoyae (only initiation. Cu++ salt totaly inhibited the initiation of rhizomorphs of Armillaria borealis, A. gallica and A. ostoyae. Effect of other compounds on the activity of T. harzianum depended on Armillaria species. The majority of chemical compounds tested supressed the activity of non-volatile metabolites of T. harzianum. Evident stimulating effect was observed under influence of sulphate salts consisting Al++ and Fe+++ on the rhizomorph number of A. borealis and A. gallica, respectively.

  19. Alopecia areata: Treatment options

    Directory of Open Access Journals (Sweden)

    E. Kasumagić-Halilović

    2006-02-01

    Full Text Available Alopecia areata (AA is a common cause of reversible hair loss afflictingapproximately1-2%ofthegeneralpopulation. It commonly present as round patches of hair loss which can be the firstmanifestationofamoreseverealopecia totalis or universalis. The cause of AA is unknown although most evidence supports the hypothesis that AA is an immunologically mediated disease. Treatment of AA may be divided into four different categories of widely accepted therapeutic modalities: immune inhibitors (steroid or psoralen and UVA light- PUVA, topicalsensitizers (squaric acid dibutylester and diphenylcyclopropenone, non-specificirritants(anthralinandthevasodilatator minoxidil. Improved future treatments may be immunosuppressive or immunomodulatory or they may otherwise protect hair follicles from the injurious effects of inflammation.Theaimofthisarticleistoreviewavailable data on current and potential agents for the treatment of AA.

  20. Molecular signatures define alopecia areata subtypes and transcriptional biomarkers

    Directory of Open Access Journals (Sweden)

    Ali Jabbari

    2016-05-01

    Full Text Available Alopecia areata (AA is an autoimmune disease typified by nonscarring hair loss with a variable clinical course. In this study, we conducted whole genome gene expression analysis of 96 human scalp skin biopsy specimens from AA or normal control subjects. Based on gene expression profiling, samples formed distinct clusters based on the presence or absence of disease as well as disease phenotype (patchy disease compared with alopecia totalis or universalis. Differential gene expression analysis allowed us to robustly demonstrate graded immune activity in samples of increasing phenotypic severity and generate a quantitative gene expression scoring system that classified samples based on interferon and cytotoxic T lymphocyte immune signatures critical for disease pathogenesis.

  1. INDEPENDENT NON-ACUTE CARE – INDISPENSABLE PART IN COMPLETE NURSING HEALTH CARE

    Directory of Open Access Journals (Sweden)

    Andreja Peternelj

    2004-10-01

    Full Text Available First experience with organisation and operation of nurse-led intermediate care department in Slovenia is presented. Organisation of independent non-acute care department led to 5% shortening in average length of stay in acute care and 16% decrease in rehospitalization rate. Majority (61.9% of the patients admitted to the intermediate care department were discharged to their homes, 10.9% to homes for aged people, 7% to other institutional care facilities or departments for long term care, and 9.6% died. After discharge 43% of the patients were independent, 23% managed with some help, and 34% were totaly dependent from help by others. By adaptive programmes of training a success was made by involving next kins and guardians in care for the patients at home. Better economy was achieved by lowering over-head and diagnostic costs (23% of average acute – care department diagnostic cost.

  2. FUNGSI BAK AIR CIGAROKROK DAN PASIRGOMBONG KAITANNYA DENGAN TAMBANG EMAS COKOTOK ABAD XX The Function of Cigarokrok and Pasirgombong Water Tubs and Its Relation with the History of Cikotok Gold Mining in 20th Century

    Directory of Open Access Journals (Sweden)

    Effie Latifundia

    2016-07-01

    Abstrak Tujuan tulisan ini berupaya mengungkap dan mendokumentasikan bak air Cigarokrok dan bak air Pasirgombong yang dibangun pada masa kolonial dikaitkan dengan sejarah tambang emas Cikotok. Data diperoleh berdasarkan hasil penelitian  arkeologis tentang  pola persebaran situs-situs di kawasan Kecamatan Cibeber, Kabupaten Lebak, Provinsi Banten pada tahun 2007 dengan metode survei yang dilengkapi studi kepustakaan dan wawancara. Berdasarkan hasil penelitian, dua bak penampung dan pembagi air ini dibangun zaman Belanda bersamaan dengan pembangunan pabrik tambang emas Cikotok. Kedua bak air memiliki nilai sejarah dan arkeologi yang masih terus berfungsi dan dimanfaatkan oleh masyarakat sampai saat ini. Fungsi bangunan bak air Cigarokrok adalah tempat atau wadah penampung dan pembagi air untuk kebutuhan air bersih sehari-hari bagi warga yang ada di kompleks perumahan dinas perusahaan tambang emas Cikotok, perkantoran tambang emas Cikotok, dan masyarakat sekitar. Sedang fungsi bak air Pasirgombong merupakan bak atau kolam penampung air untuk dialirkan ke mesin (turbin pembangkit listrik tenaga air (PLTA, dan kemudian aliran listrik tersebut disalurkan untuk penggerak mesin-mesin yang terdapat di pabrik tambang emas Cikotok. Selain itu, listrik tersebut dimanfaatkan untuk penerang rumah-rumah penduduk masyarakat Cikotok dan sekitarnya. Bak air Cigarokrok dan bak air Pasirgombong menjadi bukti fisik bangunan masa kejayaan tambang emas Cikotok yang dibangun masa kolonial dengan bentuk dan fungsi masih bertahan dan berlanjut hingga sekarang ini sebagai warisan budaya yang perlu dilestarikan untuk dipelihara dan dilindungi.   Kata Kunci: air, bak air, tambang emas, kawasan Cikotok

  3. TEKNOLOGI BERBASIS LAYANAN MANDIRI UNTUK KASUS E-BANKING

    Directory of Open Access Journals (Sweden)

    Edy Purwo Saputro

    2010-12-01

    Full Text Available Revolusi dan evolusi perkembangan teknologi informasi dan sistem informasi memicu transformasi dalam semua bidang dan hal ini kemudian menimbulkan fenomena tentang e-lifestyle yaitu mulai dari e-mail, e-banking, e-shopping, e-book, e-wallets, e-learning, e-news, e-commerce, e-trading, e-election, e-business, e-market, e-service dan e-cards. Di satu sisi, e-lifestyle memberikan banyak kemudahan tapi di sisi lain ini menimbulkan ancaman terutama dikaitkan dengan jaminan keamanan di semua transaksi yang terkait e-lifestyle. Terkait ini, jika aspek keamanan tidak mendapatkan prioritas perhatian dari semua pihak, maka akan terjadi fenomena: ‘don’t trust anyone, don’t trust anything’ dan kepercayaan akan menjadi “blind trust”. Hal ini tentu sangat dimungkinkan karena di cyber economy ada berbagai kasus yang mendasari misalnya ‘phising’ (kegiatan pengiriman e-mail palsu yang di dalamnya terkandung link ke sebuah situs web, yang bisa mengarahkan seseorang untuk menyerahkan identitas pribadi, atau ‘clickjacking’ (yaitu kode jahat yang tersembunyi di balik tombol klik di sebuah situs yang dikunjungi oleh seseorang. Aspek keamanan menjadi sangat penting karena fakta perkembangan e-lifestyle di Indonesia pada umumnya dan adopsi e-banking khususnya masih berada pada tahap pertumbuhan

  4. ANALISIS FAKTOR-FAKTOR YANG MEMPENGARUHI KEPUASAN KONSUMEN BERBELANJA ONLINE DI PROVINSI PULAU JAWA

    Directory of Open Access Journals (Sweden)

    Januar Israhmawan Putra

    2017-11-01

    Full Text Available Penggunaan internet di Indonesia yang tumbuh dengan pesat diikuti dengan banyak ber - munculan situs e-commerce yang merubah budaya dan gaya berbelanja masyarakat menjadi serba online. Pertumbuhan pasar e-commerce ini harus dibarengi dengan pelayanan yang akan diberikan kepada konsumennya secara baik agar konsumen merasa puas ketika bertran - saksi kepada perusahaan. Tujuan penelitian ini yaitu untuk mengetahui faktor apa saja yang mempengaruhi kepuasan konsumen berbelanja online pada situs jual beli Lazada, Zalora, dan Mataharimall. Variabel independent yang digunakan dalam penelitian ini yaitu Website Design, Security, Information Quality, Payment Method, E-service Quality, Product Quality, Product Variety, Delivery Service dan variebel dependent adalah Customer Satisfaction. �e- �e- �e - sponden dalam penelitian ini adalah konsumen Lazada, Zalora, dan Mataharimall yang be - rada di wilayah Provinsi Jawa Barat, Jawa Tengah, dan Jawa Timur dengan jumlah responden sebanyak 400 orang. Teknik sampling yang digunakan adalah nonprobability sampling yaitu porposive sampling. Penelitian ini menggunakan metode kuantitatif dengan teknik analisis data regresi berganda dan teknik analisis deskriptif. Hasil peneltian ini menunjukan bahwa website design, information quality, product vaiety, delivery service berpengaruh signifikan terhadap kepuasan konsumen dalam berbelanja online.

  5. Perancangan dan Pengujian Load Balancing dan Failover Menggunakan NginX

    Directory of Open Access Journals (Sweden)

    Rahmad Dani

    2017-06-01

    Full Text Available Situs web dengan traffic yang tinggi dapat menyebabkan beban kerja yang berat di sisi server, yang pada gilirannya akan mengakibatkan turunnya kinerja server, bahkan kegagalan sistem secara keseluruhan. Salah satu solusi untuk mengatasi masalah tersebut adalah dengan menerapkan teknik load balancing dan failover. Load balancing merupakan teknologi untuk melakukan pembagian beban kepada beberapa server, memastikan tidak terjadi kelebihan beban pada salah satu server. Sementara itu, failover merupakan kemampuan suatu sistem untuk berpindah ke sistem cadangan jika sistem utama mengalami kegagalan. Dalam penelitian ini load balancing dengan teknik failover akan diimplementasikan pada sistem operasi Ubuntu. Software inti yang digunakan dalam penelitian ini adalah Nginx dan KeepAlived. Nginx akan berfungsi sebagai load balancer, sedangkan KeepAlived untuk mengimplementasikan teknik failover. Beberapa skenario telah disiapkan untuk menguji sistem load balancing yang telah dirancang. Pengujian dilakukan dengan menggunakan perangkat lunak JMeter. Berdasarkan pengujian yang telah dilakukan, sistem yang dirancang berhasil membagikan beban permintaan dan dapat terus bekerja walaupun terjadi kegagalan pada server load balancer ataupun kegagalan pada server backend. Selain itu, dalam beberapa pengujian, penggunaan load balancing terbukti mampu menurunkan waktu respon dan meningkatkan thoughput pada sistem sehingga mampu meningkatkan performa keseluruhan sistem. Mengacu pada hasil penelitian ini, sistem load balancing dan failover menggunakan Nginx dapat dijadikan salah satu solusi pada sistem web server dengan situs web yang memiliki traffic tinggi.

  6. Site attraction as a representation of heritage tourism: Case study of Gunung Padang Site, Cianjur, West - Java

    Science.gov (United States)

    Subakti, A. G.; Pratomo, Aditya; Triana, Ika; Khrisnanto, Iwan

    2018-03-01

    Heritage Tourism is used for experiencing the heritage of city, region, state or country. This travel enables the tourist to learn about local customs, traditions, history and culture. One of the tourist attractions in Cianjur, where an ancient historical megalithic site named Situs Gunung Padang could be found. Situs Gunung Padang which consists of five terraces and five levels, completely built stones. This site is the largest megalithic site in Southeast Asia. There is an enormous tourism potential owned by this site because it expresses and preserving ancient Sundanese cultural in the megalithic era. But the potential of this site seems haven’t made as a tourist attraction compared with Borobudur or Prambanan Temple. The purpose of this research is to analyze the existence of Gunung Padang site as a heritage tourism with SWOT approach to discover what factors need to be repaired. The result of this research is showing that Gunung Padang site has a huge potential if the regional governments and the locals can contribute to preserve and making this site as a tourist attraction.

  7. Complementarities of two existing intermediate conservation approaches

    Directory of Open Access Journals (Sweden)

    Sergei Volis

    2017-12-01

    Full Text Available The need for integration of ex situ and in situ approaches in conservation of plants has long been recognized. However, ex situ collections have numerous limitations that reduce their utility for conservation, necessitating the introduction of new, more appropriate, flexible and less costly approaches. Two new approaches that can be called “intermediate” between in situ and ex situ, and bridging them in some way have been proposed over the last two decades. In these approaches material collected in natural populations is planted and maintained outside the original location, but with a different purpose. While the purpose of the inter situs approach is reintroduction, the concern of the quasi in situ approach is long-term storage of species genetic diversity. I view these two approaches as complementary and necessary components of conservation-oriented restoration. In restoration of a degraded habitat using threatened species (i.e. inter situs, quasi in situ collections can serve an important role in providing long-term preservation of these species’ genetic diversity and production of seeds needed for restoration.

  8. Sumber Daya Arkeologi dalam Pembangunan Pariwisata Berkelanjutan di Provinsi Maluku

    Directory of Open Access Journals (Sweden)

    Ni Komang Ayu Astiti

    2016-11-01

     menjadikan sumberdaya  ini sebagai atraksi wisata dengan tetap menjaga keotentikan dan pelestariannya sesuai dengan karakter  yang  dimiliki. Tujuan dan kegunaan penelitian adalah untuk menjadikan sumber daya arkeologi di wilayah Maluku sebagai salah satu atraksi wisata yang memberikan manfaat tidak saja secara  ekonomi, tetapi juga sosial budaya dan lingkungan  pada generasi sekarang  dan yang akan datang.  Data yang digunakan adalah data sekunder dari hasil-hasil penelitian yang telah dilakukan sebelumnya dan hasil survey penulis ke beberapa situs arkeologi yang ada di Kota Ambon serta di olah dengan menerapkan teori dan konsep yang sesuai untuk menjawab permasalahan dan tujuan.   Sumber daya arkeologi di Maluku mempunyai keunikan, orisinalitas, otentisitas dan dapat dijadikan komoditas industri pariwisata sebagai atraksi wisata yang beragam. Pengelolaan potensi ini penting  untuk meningkatkan diversifikasi atraksi  dalam pelayanan  aktivitas wisatawan mancanegara yang  terus meningkat  dalam mengunjungi museum dan situs-situs arkeologi di Indonesia.  Pengembangan disesuaikan dengan karakter dari masing-masing situs dan kawasan situs arkeologi dalam konteks untuk memunculkan nilai penting dan makna kekinian yang mengarah pada terwujudnya pembangunan pariwisata berkelanjutan (sustainable tourism management. Memberdayakan masyarakat lokal sangat penting sebagai salah satu pilar dengan melakukan kemitraan dengan stakeholder lain, sehingga memberikan manfaat secara seimbang antara ekonomi, sosial budaya dan lingkungan secara berkelanjutan pada masayarakat sekarang maupun pada generasi-generasi yang akan datang.

  9. The forkhead transcription factor Foxl2 is sumoylated in both human and mouse: sumoylation affects its stability, localization, and activity.

    Directory of Open Access Journals (Sweden)

    Mara Marongiu

    2010-03-01

    Full Text Available The FOXL2 forkhead transcription factor is expressed in ovarian granulosa cells, and mutated FOXL2 causes the blepharophimosis, ptosis and epicanthus inversus syndrome (BPES and predisposes to premature ovarian failure. Inactivation of Foxl2 in mice demonstrated its indispensability for female gonadal sex determination and ovary development and revealed its antagonism of Sox9, the effector of male testis development. To help to define the regulatory activities of FOXL2, we looked for interacting proteins. Based on yeast two-hybrid screening, we found that FOXL2 interacts with PIAS1 and UBC9, both parts of the sumoylation machinery. We showed that human FOXL2 is sumoylated in transfected cell lines, and that endogenous mouse Foxl2 is comparably sumoylated. This modification changes its cellular localization, stability and transcriptional activity. It is intriguing that similar sumoylation and regulatory consequences have also been reported for SOX9, the male counterpart of FOXL2 in somatic gonadal tissues.

  10. Alternatif Solusi Konflik Separatisme dalam Cerita “Calon Arang”

    Directory of Open Access Journals (Sweden)

    Sukatman Sukatman

    2016-06-01

    Full Text Available Penelitian ini bertujuan memaparkan (a cerita Calon Arang sebagai mitos otonomi, (b konteks historis cerita Calon Arang, (c tradisi otonomi “Duplang Kamal-Pandak” zaman kerajaan, dan (d implikasi cerita Calon Arang bagi solusi konflik separatisme pada abad modern. Penelitian dilaksanakan dengan menerapkan pendekatan sastra lisan. Sasaran penelitian ini adalah konsep otonomi dalam cerita “Calon Arang” dan relevansinya dengan situs sejarah Rajegwesi-Blambangan kuno di Lawang Seketheng dan situs “Duplang Kamal-Pandak” di Arjasa Jember. Data penelitian ini dikumpulkan dengan metode (a dokumentasi, (b observasi, dan (c wawancara bebas-mendalam. Analisis data dilakukan dengan menggunakan metode heuristik. Hasil penelitian menunjukkan bahwa cerita rakyat “Calon Arang” merupakan mitos ilmu pengetahuan tentang cara mengatasi konflik separatisme di Jawa pada zaman dahulu. Situs Duplang di Arjasa Jember merupakan bukti solusi konflik yang terjadi pada zaman pemerintahan raja Airlangga dengan otonomi daerah. Pengetahuan tentang otonomi dalam cerita Calon Arang relevan untuk dipertimbangkan sebagai solusi alternatif dalam menyelesaikan konflik separatisme. Kata-Kata Kunci: separatisme, otonomi, cerita “Calon Arang” Abstract: This study aims to explain (a Calon Arang as a myth of autonomy, (b the historical con-text of Calon Arang, (c the tradition of “Duplang Kamal-Pandak autonomy, and (d the implica-tions of Calon Arang as a solution to overcome separatist conflict in the modern age. This research was conducted by applying the oral literature approach. The target of this research is the concept of autonomy in the story of "Calon Arang" and its relevance to the historical sites of Rajegwesi in Lawang Seketheng and "Duplang Kamal-Pandak" in Arjasa Jember. The data were collected by (a documentation, (b observation, and (c in-depth interviews. Data analysis was performed using heuristic methods. The results showed that “Calon Arang

  11. KOMPONEN WEB DATA ANALYZER PADA IE STUDI KASUS: AKSES WEB TERFAVORIT LABORATORIUM IBS TEKNIK INFORMATIKA - ITS

    Directory of Open Access Journals (Sweden)

    Darlis Heru Murti

    2005-07-01

    Full Text Available Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Perkembangan dunia internet baik dari segi teknologi maupun jumlah pengguna yang mengakses kian lama semakin bertambah. Hal ini juga berdampak dengan munculnya berbagai situs internet yang menawarkan berbagai hal serta tujuan yang berbeda. Untuk mengakses situs-situs tersebut diperlukan suatu alat yang disebut browser. Salah satu browser yang paling terkenal dan banyak digunakan saat ini adalah Microsoft Internet Explorer (IE. Kalau diperhatikan sebenarnya browser Internet Explorer telah menyediakan fitur khusus bernama Favorites (dapat diakses melalui menu atau toolbar untuk mencatat dan mengorganisasi web-web yang menjadi favorit user. Tetapi fitur Favorites ini kurang fleksibel karena pemasukan data maupun pengorganisasiannya masih bersifat manual oleh user. Untuk itu perlu diimplementasikan perangkat lunak dengan fitur Favorites yang bersifat otomatis dan dinamis sehingga untuk periode waktu maupun lokasi akses workstation tertentu bisa memiliki informasi favorit website yang berbeda-beda. Sebagai solusi yang dapat digunakan adalah dengan memanfaatkan teknologi rekayasa perangkat lunak yaitu pembuatan komponen yang melekat pada browser Internet Explorer atau lebih dikenal dengan istilah plugin Internet

  12. The use of time-of-flight camera for navigating robots in computer-aided surgery: monitoring the soft tissue envelope of minimally invasive hip approach in a cadaver study.

    Science.gov (United States)

    Putzer, David; Klug, Sebastian; Moctezuma, Jose Luis; Nogler, Michael

    2014-12-01

    Time-of-flight (TOF) cameras can guide surgical robots or provide soft tissue information for augmented reality in the medical field. In this study, a method to automatically track the soft tissue envelope of a minimally invasive hip approach in a cadaver study is described. An algorithm for the TOF camera was developed and 30 measurements on 8 surgical situs (direct anterior approach) were carried out. The results were compared to a manual measurement of the soft tissue envelope. The TOF camera showed an overall recognition rate of the soft tissue envelope of 75%. On comparing the results from the algorithm with the manual measurements, a significant difference was found (P > .005). In this preliminary study, we have presented a method for automatically recognizing the soft tissue envelope of the surgical field in a real-time application. Further improvements could result in a robotic navigation device for minimally invasive hip surgery. © The Author(s) 2014.

  13. Roentgenologic examinations on the larynx of the horse

    International Nuclear Information System (INIS)

    Bargheer, K.W.

    1979-01-01

    The euqine larynx was radiographed from 56 living animals and from 64 isolated specimen. The age of the horses ranged between 10th gestational month and 29 years. Due to the anatomical situs it was impossible to show the entire picture of the larynx. However, the X-rays obtained went conform with those of the dissected specimen. A current appearance in all horses is the ossification of the hyaline larynx. There could not be observed any influence due to race or sex. In 38 cases of roaring, no progress in ossifications was apparent. After surgical intervention at the larynx in 4 cases pathological ossification was found. It was assumed that it was due to the traumatisation of the cartilage during the surgical intervention and ensuing inflammation. This type of ossification differs even macroscopically from the other types by exaggerated bony growth. Animals with pathologic ossification of the larynx are unfit for sporting purpose. (orig./MG) [de

  14. MR imaging of congenital heart disease

    International Nuclear Information System (INIS)

    Kersting-Sommerhoff, B.A.; Diethelm, L.; Teitel, D.F.; Sommerhoff, C.P.; Higgins, C.B.

    1988-01-01

    Sensitivity and specificity of MR imaging for the evaluation of congenital heart disease was assessed in 51 patients (31 male and 20 female, aged 3-69 years), with a total of 115 congenital heart lesions. The true diagnosis was established by angiocardiography, catheterization, or surgery. Sensitivity at a specificity level of 90% was determined by means of receiver operating characteristic curves for great vessel relationships (100%), thoracic aorta anomalies (94%), atrial (91%) and ventricular (100%) septal defects, visceroatrial situs (100%), loop (100%), right ventricular outflow obstructions (95%), aortic valve (52%), mitral valve (62%), and tricuspid valve (76%). Spin-echo MR imaging is a reliable method for the noninvasive evaluation of congenital heart disease but is limited in the assessment of some valvular anomalies

  15. Digital video subtraction fluorography (DVSF) in the diagnosis of bronchial abnormality associated with congenital heart diseases

    International Nuclear Information System (INIS)

    Sano, Tetsuya; Arisawa, Jun; Nakajima, Toru

    1990-01-01

    To assess bronchial morphology and abnormality, 14 children with congenital heart diseases including 2 postoperative patients (age, 2 m.-4 yr) were studied by digital video subtraction fluorography (DVSF) using digital subtraction and image processing system (Philips, DVI-2). This newly developed technique clearly defined bronchial anatomy in all 14 patients. Bronchial situs could be determined in all 8 patients with complex heart anomalies. Out of 8 patients with respiratory distress in this study, obvious bronchial stenosis or obstruction was found by DVSF in 5 patients. Thus, DVSF image defined anatomies of main and lobar bronchi more clearly than previous noninvasive methods. Moreover, DVSF is noninvasive and easily performed even for small infants and critically ill patients. In conclusion, DVSF may be a useful technique to assess bronchial morphology and abnormality in patients with congenital heart diseases. (author)

  16. PENGARUH GOOD CORPORATE GOVERNANCE DAN LEVERAGE TERHADAP KINERJA KEUANGAN (STUDI PADA PERUSAHAAN MANUFAKTUR YANG TERDAFTAR DI BEI TAHUN 2011-2012

    Directory of Open Access Journals (Sweden)

    Wuryaningsih Dwi Lestari

    2016-08-01

    Full Text Available Penelitian ini bertujuan untuk menganalisis pengaruh good corporategovernance terdiri dari kepemilikan institusional, proporsi dewan komisaris independen, komite audit dan leverage terhadapkinerja keuangan pada perusahaan manufaktur yang terdaftar di BEI tahun 2011-2012.Sampel penelitian ini adalah 134 perusahaan manufaktur yang terdaftar di BEI tahun 2011-2012. Data laporan keuangan diperoleh dari annual report masing-masing perusahaan yang didapat dari situs resmi Bursa Efek Indonesia (www.idx.co.id dan Indonesian Capital Market Directory (ICMD. Metode pengambilan sampel yang digunakan adalah purposive sampling.Sedangkan Metode analisis yang digunakan adalah metode analisis regresi linear berganda. Hasil pengujian hipotesis menunjukkan bahwa kepemilikan institusional berpengaruh terhadap kinerja keuangan. Proporsi dewan komisaris independen dan komite audit tidak berpengaruh terhadap kinerja keuangan. Serta leverage berpengaruh terhadap kinerja keuangan

  17. TINGGALAN LUMPANG BATU DI TEPIAN DANAU RANAU : Refleksi Subsistensi Masyarakat Pendukung Stone Mortar In Ranau Area: A Reflection In Subsistence Of Ranau Community

    Directory of Open Access Journals (Sweden)

    Nurul Laili

    2014-06-01

    Abstrak Tepian Danau Ranau di Kabupaten Lampung Barat terdapat beberapa situs megalitik dengan beragam tinggalan. Salah satu bentuk tinggalan budaya megalitik adalah lumpang batu. Permasalahan yang dikemukakan dalam makalah ini adalah apa fungsi dan peranan lumpang batu pada masyarakat Danau Ranau masa lampau. Tujuan dari permasalahan ini adalah untuk mengetahui fungsi dan peranan lumpang batu pada masyarakat pendukung di tepian Ranau. Untuk menyelesaikan permasalahan yang dikedepankan maka tulisan ini menggunakan pendekatan kebudayaan materi kemudian akan dianalogikan dengan data sejenis di lokasi lain sehingga akan diketahui fungsi dan peranan lumpang batu pada masyarakat tepian Danau Ranau masa lampau. Lumpang batu di sekitar Ranau berfungsi sebagai piranti untuk menumbuk bahan pangan hasil bercocok tanam. Adapun peranan lumpang batu berkait dengan kepentingan praktis yaitu untuk memenuhi kebutuhan sehari-hari.   Kata kunci: Megalitik, Religi, Subsistensi

  18. KAJIAN LITERATUR: MANAKAH YANG LEBIH EFEKTIF? TRADITIONAL WORD OF MOUTH ATAU ELECTRONIC WORD OF MOUTH

    Directory of Open Access Journals (Sweden)

    Putu Adriani Prayustika

    2016-12-01

    Full Text Available Word of Mouth telah diakui sebagai salah satu strategi komunikasi yang paling efektif dalam transisi informasi perusahaan kepada konsumen. Perusahaan memanfaatkan komunikasi word of mouth untuk kepentingan pemasaran produk dan layanan. Namun, komunikasi WOM konvensional hanya efektif dalam batasan kontak sosial terbatas. Kemajuan teknologi informasi dan munculnya situs jaringan sosial online telah mengubah cara informasi ditransmisikan dan telah melampaui keterbatasan tradisional WOM. Komunikasi word of mouth dengan memanfaatkan teknologi ini sering disebut electronic word of mouth (eWOM, dimana komunikasi ini memanfaatkan media baru, seperti misalnya media sosial. Makalah ini akan membahas kajian literatur dari beberapa penelitian yang telah dilakukan sebelumnya dalam membandingkan efektivitas traditional word of mouth dan electronic word of mouth. Hasil penelitian menunjukkan bahwa secara umum dapat dikatakan dengan perkembangan teknologi seperti sekarang, eWOM jauh lebih efektif daripada traditional WOM.

  19. Right circumflex retro-oesophageal aortic arch with coarctation of a high-positioned right arch

    International Nuclear Information System (INIS)

    Ahn, Kyung-Sik; Yong, Hwan Seok; Woo, Ok Hee; Kang, Eun-Young; Lee, Joo-Won

    2007-01-01

    We present a rare case of right circumflex retro-oesophageal aortic arch with coarctation of a high-positioned right arch. A 7-month-old boy presented with a cardiac murmur. Cardiac situs was normal and there was no evidence of an intracardiac shunt or patent ductus arteriosus. MR aortography revealed a right aortic arch that was high-positioned, tortuous and narrowed. This right aortic arch crossed the midline behind the oesophagus and continued as a left-sided descending aorta. The left common carotid and subclavian arteries arose from a large branching vascular structure that derived from the top of the left-sided descending aorta. The right common carotid artery arose from the ascending aorta. The proximal portion of the right common carotid artery showed very severe stenosis and poststenotic dilatation. The right subclavian artery originated distal to the narrowed and tortuous segment of the aortic arch. (orig.)

  20. E-mail: Outlook Express

    Directory of Open Access Journals (Sweden)

    Zainul Bakri

    2012-10-01

    Full Text Available Salah satu layanan Internet yang sangat penting adalah electronic mail atau sering hanya disebut sebagai e-mail. Untuk menggunakan e-mail, diperlukan piranti lunak khusus supaya pengguna dapat mengirim dan menerima e-mail. Jenis piranti lunak e-mail diantaranya adalah Outlook Express yang merupakan satu paket yang didistribusikan bersama Internet Explorer versi 4. Piranti lunak ini dijalankan pada PC yang mempunyai sistem operasi Windows 95 atau 98. Jenis piranti lunak e-mail yang lain adalah Eudora, Pegasus dan sebagainya. Bahkan ada yang diintegrasikan dengan Web Browser (alat untuk menelusuri situs Web misalnya IE,dan Netscape.Sebagai layaknya pelayanan pos, maka setiap pengguna e-mail mempunyai alamat tertentu yang tidak mungkin dipunyai oleh pengguna lainnya diseluruh dunia. Untuk keperluan pendistribusian, maka e-mail mempunyai semacam kantor pos yang ditempatkan dalam sebuah komputer server (mail server atau sering disebut sebagai host. 

  1. Administration of biliary contrast media in computed tomography

    International Nuclear Information System (INIS)

    Huebener, K.-H.; Treugut, H.

    1981-01-01

    Biliary contrast media have 2 main uses in computed tomography (CT) of the liver and bile ducts: 1. Labelling of extrahepatic bile ducts in order to aid in the identification of the common bile ducts and the papilla of Vater, particularly in cases of complex, mostly postoperative situs. 2. Differentiation between normal and abnormal liver tissue in cases of focal nodular hyperplasia with proliferation of tumorous bile ducts. The applicability of biliary contrast media is rather limited as far as the improvement of spatial resolution by an increase of contrast is concerned, because the attainable enhancement today remains small. The possibility of interpretation of the liver function is likewise insufficient, because the standard deviation of the time-dependent enhancement is too great in the normal collective in order to register deviations reliably. In cases of liver cirrhosis, a rise of density of at least 40-60 Hounsfield Units (HU) would be desirable. (Auth.)

  2. Isolated persistent left-sided superior vena cava, giant coronary sinus, atrial tachycardia and heart failure in a child

    Directory of Open Access Journals (Sweden)

    Nagaraja Moorthy

    2013-09-01

    Full Text Available Persistence of a left-sided superior vena cava (PLSVC with absent right superior vena cava (isolated PLSVC is a very rare venous malformation and commonly associated with congenital heart disease or alterations of the cardiac situs. We describe an unusual case of a young boy presenting with persistent atrial tachycardia and congestive heart failure. He was detected to have unexplained grossly dilated right atrium, right ventricle with systolic dysfunction and a giant coronary sinus (CS. The dilated CS closely mimicked a pseudo cor-triatriatum on echocardiography. Contrast echocardiography from both arms revealed opacification of the CS before the right atrium. Bilateral upper limb venography confirmed the presence of absent right SVC and isolated persistent left SVC draining into the giant coronary sinus.

  3. Childhood kidney tumors - the relevance of imaging

    International Nuclear Information System (INIS)

    Schenk, J.-P.; Schrader, C.; Ley, S.; Troeger, J.; Guenther, P.; Furtwaengler, R.; Graf, N.; Leuschner, I.; Edelhaeuser, M.

    2005-01-01

    Kidney tumors represent 6.2% of malignant tumors in children. History, clinical course and radiological findings are necessary elements in the differential diagnosis of the different renal tumors. In the case of nephroblastoma, chemotherapy is based solely on the radiological diagnosis without prior histology. In therapy-optimizing studies of the Society of Pediatric Oncology and Hematology, preoperative chemotherapy is performed. Therapy monitoring is performed in the course of and after preoperative chemotherapy to verify tumor response. Radiological staging plays a significant role in deciding on further treatment and in operative planning. Three-dimensional visualization of the abdominal situs can assist preoperative planning. In summary, diagnostic imaging in renal tumors in children plays a role in differential diagnosis, staging, monitoring of therapy, and surgical planning. (orig.) [de

  4. Anomalous Origin of Left Coronary Artery from Pulmonary Artery (ALCAPA)

    International Nuclear Information System (INIS)

    Younus, Z.; Ahmed, I.; Iftikhar, R.

    2013-01-01

    Anomalous origin of the left coronary artery from the pulmonary artery also recognized as Bland White Garland syndrome is a very rare congenital condition. A two-months old baby boy presented with dyspnoea for two weeks and a pansystolic murmur on auscultation. The base line investigations showed cardiomegaly and bilateral basal haze on X-ray chest. ECG showed ST elevation in leads l and AVl and echocardiography showed situs solitus, levocardia, hypokinetic intraventricular septum, ejection fraction of 30%, mitral regurgitation of grade-I and an anomalous origin of the left coronary artery from pulmonary artery was diagnosed. Patient was in left heart failure. It was rectified surgically by creating a transpulmonary tunnel (Takeuchi repair). Postoperative course was uneventful and he was finally discharged in stable condition. (author)

  5. In situ protocol for butterfly pupal wings using riboprobes.

    Science.gov (United States)

    Ramos, Diane; Monteiro, Antonia

    2007-01-01

    Here we present, in video format, a protocol for in situ hybridizations in pupal wings of the butterfly Bicyclus anynana using riboprobes. In situ hybridizations, a mainstay of developmental biology, are useful to study the spatial and temporal patterns of gene expression in developing tissues at the level of transcription. If antibodies that target the protein products of gene transcription have not yet been developed, and/or there are multiple gene copies of a particular protein in the genome that cannot be differentiated using available antibodies, in situs can be used instead. While an in situ technique for larval wing discs has been available to the butterfly community for several years, the current protocol has been optimized for the larger and more fragile pupal wings.

  6. ANALISA DAN PERANCANGAN WEB SITE SOCIAL-COMMERCE UMKM

    Directory of Open Access Journals (Sweden)

    Endang Supriyati

    2016-04-01

    Full Text Available Pertumbuhan internet mengubah perilaku konsumen dalam mengambil keputusan. Pertukaran informasi melalui media sosial menjadi referensi penting bagi konsumen dalam mengambil keputusan pembelian. Transaksi bisnis secara online dan kesuksesan e-commerce tergantung pada ketepatan desain dari sebuah produk. Setiap situs social commerce, paling tidak mempunyai satu set minimal fitur desain social commerce. UMKM merupakan salah satu tiang ekonomi bangsa. Salah satu permasalahan pada UMKM adalah pemasaran produk. Untuk membangun UMKM yang lebih kuat dalam pemasaran maka perlu dibuat website yang mampu memasarkan produk secara lebih luas. Dengan adanya social commerce, akan mampu memasarkan produk, merekomendasi produk dan menampilkan berbagai informasi produk-produk UMKM. Sebelum membangun sistem, didahului dengan perancangan sistem, perancangan ini menggunakan UML (Unified Modeling Language. Hasil penelitian ini berupa rancangan website social commerce untuk UMKM. Kata kunci: social commerce, UMKM, UML.

  7. Genital Tuberculosis as the Cause of Tuboovarian Abscess in an Immunosuppressed Patient

    Directory of Open Access Journals (Sweden)

    M. Ilmer

    2009-01-01

    Full Text Available Background. Although tuberculosis (TB is a major health problem worldwide, primary extrapulmonary tuberculosis (EPTB, and in particular female genital tract infection, remains a rare event. Case Report. A 35-year-old human immunodeficiency virus (HIV seropositive woman of African descent with lower abdominal pain and fever of two days duration underwent surgery due to left adnexal mass suggesting pelvic inflammatory disease. The surgical situs showed a four quadrant peritonitis, consistent with the clinical symptoms of the patient, provoked by a tuboovarian abscess (TOA on the left side. All routine diagnostic procedures failed to determine the causative organism/pathogen of the infection. Histopathological evaluation identified a necrotic granulomatous salpingitis and specific PCR analysis corroborated Mycobacterium tuberculosis (M. Tb. Consequently, antituberculotic therapy was provided. Conclusion. In the differential diagnosis of pelvic inflammatory disease, internal genital tuberculosis should be considered. Moreover, physicians should consider tuberculous infections early in the work-up of patients when immunosuppressive conditions are present.

  8. STRUKTUR PUNDEN BERUNDAK GUNUNG PADANG DAN ADAPTASI LINGKUNGAN Structure of Gunung Padang Stone Terrace and Enviromental Adaptation

    Directory of Open Access Journals (Sweden)

    Lutfi Yondri

    2016-06-01

    Abstrak Situs Gunung Padang merupakan hasil temuan kembali pada tahun 1979. Sebelumnya temuan ini pernah dicatat oleh N.J. Krom pada tahun 1914. Sejak penemuan kembali pada tahun 1979, berturut-turut telah dilakukan penelitian oleh tim baik dari Direktorat Purbakala, PUSPAN (saat sekarang bernama Pusat Penelitian dan Pengembangan Arkeologi Nasional, Balai Arkeologi Bandung, Pemerintah Daerah, serta berbagai kelompok masyarakat yang mencoba menggali nilai-nilai lain yang terkandung dalam tinggalan tersebut. Dalam tulisan ini dibahas tentang fisik dan pola susun balok-balok batu penyusun struktur punden berundak dengan menerapkan metode deskriptif. Melalui penerapan metode ini diharapkan dapat diuraikan tentang refleksi adaptasi terhadap kondisi lingkungan dari masyarakat pendukung tradisi budaya pengagungan arwah nenek moyang (megalitik yang terjadi pada masa lalu.   Kata kunci: Gunung Padang, budaya megalitik, konstruksi, pola susun, adaptasi

  9. TRANSPOSITION OF GREAT ARTERIES: NEW INSIGHTS INTO THE PATHOGENESIS

    Directory of Open Access Journals (Sweden)

    Marta eUnolt

    2013-06-01

    Full Text Available Transposition of great arteries (TGA is one of the most common and severe congenital heart diseases (CHD. It is also one of the most mysterious CHD because it has no precedent in phylogenetic and ontogenetic development, it does not represent an alternative physiological model of blood circulation and its etiology and morphogenesis are still largely unknown. However, recent epidemiologic, experimental and genetic data suggest new insights into the pathogenesis. TGA is very rarely associated with the most frequent genetic syndromes, such as Turner, Noonan, Williams or Marfan syndromes, and in Down syndrome, it is virtually absent. The only genetic syndrome with a strong relation with TGA is Heterotaxy. Moreover, TGA is rather frequent in cases of isolated dextrocardia with situs solitus, showing link with defect of visceral situs. In lateralization defects TGA is frequently associated with asplenia syndrome. Nowadays, the most reliable method to induce TGA consists in treating pregnant mice with retinoic acid or with retinoic acid inhibitors. Following such treatment not only cases of TGA with d-ventricular loop have been registered, but also some cases of congenitally corrected transposition of great arteries (CCTGA. In another experiment, the embryos of mice treated with retinoic acid in day 6.5 presented Heterotaxy, suggesting a relationship among these morphologically different CHD. In some families, beside TGA cases, there were first-degree relatives with CCTGA. This data suggest that monogenic inheritance with a variable phenotypic expression could explain the familial aggregation of TGA and CCTGA. In some of these families we previously found multiple mutations in laterality genes including Nodal and ZIC3, confirming a pathogenetic relation between TGA and Heterotaxy. These overall data suggest to include TGA in the pathogenetic group of laterality defects instead of conotruncal abnormalities due to ectomesenchymal tissue migration.

  10. 3D-visualization by MRI for surgical planning of Wilms tumors

    International Nuclear Information System (INIS)

    Schenk, J.P.; Wunsch, R.; Jourdan, C.; Troeger, J.; Waag, K.-L.; Guenther, P.; Graf, N.; Behnisch, W.

    2004-01-01

    Purpose: To improve surgical planning of kidney tumors in childhood (Wilms tumor, mesoblastic nephroma) after radiologic verification of the presumptive diagnosis with interactive colored 3D-animation in MRI. Materials and Methods: In 7 children (1 boy, 6 girls) with a mean age of 3 years (1 month to 11 years), the MRI database (DICOM) was processed with a raycasting-based 3D-volume-rendering software (VG Studio Max 1.1/Volume Graphics). The abdominal MRI-sequences (coronal STIR, coronal T1 TSE, transverse T1/T2 TSE, sagittal T2 TSE, transverse and coronal T1 TSE post contrast) were obtained with a 0.5T unit in 4-6 mm slices. Additionally, phase-contrast-MR-angiography was applied to delineate the large abdominal and retroperitoneal vessels. A notebook was used to demonstrate the 3D-visualization for surgical planning before surgery and during the surgical procedure. Results: In all 7 cases, the surgical approach was influenced by interactive 3D-animation and the information found useful for surgical planning. Above all, the 3D-visualization demonstrates the mass effect of the Wilms tumor and its anatomical relationship to the renal hilum and to the rest of the kidney as well as the topographic relationship of the tumor to the critical vessels. One rupture of the tumor capsule occurred as a surgical complication. For the surgeon, the transformation of the anatomical situation from MRI to the surgical situs has become much easier. Conclusion: For surgical planning of Wilms tumors, the 3D-visualization with 3D-animation of the situs helps to transfer important information from the pediatric radiologist to the pediatric surgeon and optimizes the surgical preparation. A reduction of complications is to be expected. (orig.)

  11. [3D-visualization by MRI for surgical planning of Wilms tumors].

    Science.gov (United States)

    Schenk, J P; Waag, K-L; Graf, N; Wunsch, R; Jourdan, C; Behnisch, W; Tröger, J; Günther, P

    2004-10-01

    To improve surgical planning of kidney tumors in childhood (Wilms tumor, mesoblastic nephroma) after radiologic verification of the presumptive diagnosis with interactive colored 3D-animation in MRI. In 7 children (1 boy, 6 girls) with a mean age of 3 years (1 month to 11 years), the MRI database (DICOM) was processed with a raycasting-based 3D-volume-rendering software (VG Studio Max 1.1/Volume Graphics). The abdominal MRI-sequences (coronal STIR, coronal T1 TSE, transverse T1/T2 TSE, sagittal T2 TSE, transverse and coronal T1 TSE post contrast) were obtained with a 0.5T unit in 4 - 6 mm slices. Additionally, a phase-contrast-MR-angiography was applied to delineate the large abdominal and retroperitoneal vessels. A notebook was used to demonstrate the 3D-visualization for surgical planning before surgery and during the surgical procedure. In all 7 cases, the surgical approach was influenced by interactive 3D-animation and the information found useful for surgical planning. Above all, the 3D-visualization demonstrates the mass effect of the Wilms tumor and its anatomical relationship to the renal hilum and to the rest of the kidney as well as the topographic relationship of the tumor to the critical vessels. One rupture of the tumor capsule occurred as a surgical complication. For the surgeon, the transformation of the anatomical situation from MRI to the surgical situs has become much easier. For surgical planning of Wilms tumors, the 3D-visualization with 3D-animation of the situs helps to transfer important information from the pediatric radiologist to the pediatric surgeon and optimizes the surgical preparation. A reduction of complications is to be expected.

  12. 3D-visualization by MRI for surgical planning of Wilms tumors; 3-D-Visualisierung in der MRT zur Operationsplanung von Wilms-Tumoren

    Energy Technology Data Exchange (ETDEWEB)

    Schenk, J.P.; Wunsch, R.; Jourdan, C.; Troeger, J. [Universitaetsklinik Heidelberg (Germany). Abteilung Paediatrische Radiologie; Waag, K.-L.; Guenther, P. [Universitaetsklinik Heidelberg (Germany). Abteilung Kinderchirurgie; Graf, N. [Universitaetsklinik Homburg (Germany). Abteilung Paediatrische Haematologie und Onkologie; Behnisch, W. [Universitaetsklinik Heidelberg (Germany). Abteilung Paediatrische Haematologie und Onkologie

    2004-10-01

    Purpose: To improve surgical planning of kidney tumors in childhood (Wilms tumor, mesoblastic nephroma) after radiologic verification of the presumptive diagnosis with interactive colored 3D-animation in MRI. Materials and Methods: In 7 children (1 boy, 6 girls) with a mean age of 3 years (1 month to 11 years), the MRI database (DICOM) was processed with a raycasting-based 3D-volume-rendering software (VG Studio Max 1.1/Volume Graphics). The abdominal MRI-sequences (coronal STIR, coronal T1 TSE, transverse T1/T2 TSE, sagittal T2 TSE, transverse and coronal T1 TSE post contrast) were obtained with a 0.5T unit in 4-6 mm slices. Additionally, phase-contrast-MR-angiography was applied to delineate the large abdominal and retroperitoneal vessels. A notebook was used to demonstrate the 3D-visualization for surgical planning before surgery and during the surgical procedure. Results: In all 7 cases, the surgical approach was influenced by interactive 3D-animation and the information found useful for surgical planning. Above all, the 3D-visualization demonstrates the mass effect of the Wilms tumor and its anatomical relationship to the renal hilum and to the rest of the kidney as well as the topographic relationship of the tumor to the critical vessels. One rupture of the tumor capsule occurred as a surgical complication. For the surgeon, the transformation of the anatomical situation from MRI to the surgical situs has become much easier. Conclusion: For surgical planning of Wilms tumors, the 3D-visualization with 3D-animation of the situs helps to transfer important information from the pediatric radiologist to the pediatric surgeon and optimizes the surgical preparation. A reduction of complications is to be expected. (orig.)

  13. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

    Science.gov (United States)

    Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

    2017-10-15

    Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

  14. [Scimitar syndrome. Correlation anatomo-embryological].

    Science.gov (United States)

    Muñoz-Castellanos, Luis; Kuri-Nivon, Magdalena

    2016-01-01

    To describe morphologically a toracoabdominal visceral block of a scimitar's syndrome case. We propose a pathogenetic theory wich explains the development of the pulmonary venous connection in this syndrome. The anatomic specimen was described with the segmental sequential system. The situs was solitus, the connections between the cardiac segments and the associated anomalies were determined. The anatomy of both lungs, including the venous pulmonary connection, was described. A pathogenetic hypothesis was made, which explains the pulmonary venous connection throw a correlation between the pathology of this syndrome and the normal development of the pulmonary veins. The situs was solitus, the connections of the cardiac chambers were normal; there were hypoplasia and dysplasia of the right lung with sequestration of the inferior lobe; the right pulmonary veins were connected with a curved collector which drainaged into the suprahepatic segment of the inferior vena cava; the left pulmonary veins were open into the left atrium. The sequestered inferior lobe of the right lung received irrigation throw a collateral aortopulmonary vessel. There was an atrial septal defect. The pathogenetic hypothesis propose that the pulmonary venous connection in this syndrome represent the persistent of the Streeter's horizon xiv (28-30 days of development), period in which the sinus of the pulmonary veins has double connection, with the left atrium and with a primitive collector into the right viteline vein which forms the suprahepatic segment of the inferior vena cava. Copyright © 2015 Instituto Nacional de Cardiología Ignacio Chávez. Published by Masson Doyma México S.A. All rights reserved.

  15. Exomic sequencing of immune-related genes reveals novel candidate variants associated with alopecia universalis.

    Directory of Open Access Journals (Sweden)

    Seungbok Lee

    Full Text Available Alopecia areata (AA is a common autoimmune disorder mostly presented as round patches of hair loss and subclassified into alopecia totalis/alopecia universalis (AT/AU based on the area of alopecia. Although AA is relatively common, only 5% of AA patients progress to AT/AU, which affect the whole scalp and whole body respectively. To determine genetic determinants of this orphan disease, we undertook whole-exome sequencing of 6 samples from AU patients, and 26 variants in immune-related genes were selected as candidates. When an additional 14 AU samples were genotyped for these candidates, 6 of them remained at the level of significance in comparison with 155 Asian controls (p<1.92×10(-3. Linkage disequilibrium was observed between some of the most significant SNPs, including rs41559420 of HLA-DRB5 (p<0.001, OR 44.57 and rs28362679 of BTNL2 (p<0.001, OR 30.21. While BTNL2 was reported as a general susceptibility gene of AA previously, HLA-DRB5 has not been implicated in AA. In addition, we found several genetic variants in novel genes (HLA-DMB, TLR1, and PMS2 and discovered an additional locus on HLA-A, a known susceptibility gene of AA. This study provides further evidence for the association of previously reported genes with AA and novel findings such as HLA-DRB5, which might represent a hidden culprit gene for AU.

  16. National originality of the architecture of Khreshchatyk as a unique ensemble of the period of totalitarianism

    Science.gov (United States)

    Oliynyk, Olena

    2018-03-01

    Khreschatyk is a page apart in the history of world architecture. While it has a number of distinct characteristics of totalitarian architecture, Khreschatyk is the only architectural ensemble of the period to combine na-tional tradition with the exalted sentiment of Soviet architecture of the Stalin era. Also, it uniquely matched architecture and landscape. The façades has elements of Ukrainian baroque, which sets Khreschatyk apart from similar ensembles of the 1940s-1950s in other countries that mainly drew upon Ne-oclassicism or Modernism. While period architecture in other countries is typically marked by its grand scale and heavily accentuated civic spirit - complete with a denigration of the individual at the expense of the manifest greatness of Authority, Khreschatyk stand out for its pronounced harmony as an environment based on the careful preservation of old heritage, the skill-ful use of the landscape, and the introduction of traditional motifs, alongside an almost total lack of Soviet symbols. Unlike the grim grandness of totali-tarian architecture in other countries, the facades of the residential buildings that line Khreschatyk emanate joie de vivre and admiration for the fertility of Ukrainian soil.

  17. Bacteriological and mycological surveys along Otranto coastal areas; La situazione igienica del litorale salentino

    Energy Technology Data Exchange (ETDEWEB)

    Montagna, M.T. [Bari Univ., Bari (Italy). Ist. di Igiene; De Donno, A.; Bagordo, F. [Lecce Univ., Lecce (Italy). Dipt. di Biologia, Lab. di Igiene; Carrozzini, F. [ASL LE/2, Lecce (Italy). Direzione Sanitaria

    2000-01-01

    Bacteriological and mycological surveys were carried out on water samples collected from 6 seaside resorts and 2 affluent along Otranto coastal areas. The following parameters were tested: total coliforms, fecal coliforms, fecal streptococci, Salmonella, P. aeruginosa and S. aureus, Vibrio species and yeasts. Results show fecal pollution in three seaside resorts and in one drain, whereas Salmonella research always resulted negative. P. aeruginosa and S. aureus were isolated from both affluents. V. alginolyticus was the most isolated vibrio specie (90%). Among isolated yeasts Torulopsis inconspicua (70%) was the most frequent one. [Italian] E' stata condotta una indagine batteriologica e micologica su campioni di acqua provenienti da 6 stabilimenti balneari e da 2 affluenti che sfociano nel litorale di Otranto. Sono stati esaminati i seguenti parametri: coliformi totali, coliformi fecali, streptococchi fecali, salmonelle, P. aeruginosa, S. aureus, vibrioni e miceti. Dall'indagine e' emerso che indici di contaminazione fecale sono stati evidenziati in tre stazioni balneari e in un affluente mentre la ricerca delle salmonelle e' risultata sempre negativa. P. aeruginosa e S. aureus sono stati isolati in entrambi gli affluenti. Per quanto riguarda la ricerca dei vibrioni, V. alginolyticus e' apparsa la specie piu' frequente (90%). Tra i lieviti isolati, quello piu' frequente e' risultato Torulopsis inconspicua (70%).

  18. Meckel Gruber syndrome, A case report

    Science.gov (United States)

    Aslan, Kiper; Külahçı Aslan, Elif; Orhan, Adnan; Atalay, Mehmet Aral

    2015-01-01

    ABSTRACT. Introduction: Meckel-Gruber Syndrome was first described by J R Meckel in 1822. It is an autosomal recessive disorder, and is caused by the failure of mesodermal induction. The typical triad of Meckel-Gruber Syndrome (MGS) involves meningo-encephalocele, polycystic kidneys and postaxial polydactyly. The worldwide incidence varies from 1 in 1.300 to 1 in 140.000 live births. Case: In this report, we present a case of MGS in which the diagnosis was made at 19 weeks of gestation based on ultrasonographic findings of the typical triad of the disease (encephalocele, polycystic kidneys, and polydactyly) These features were suggestive of the diagnosis of Meckel Gruber Syndrome (MGS). She had also placenta previa totalis. The patient was counselled regarding the lethal outcome of MGS. Unfortunately, the family did not approve the termination of pregnancy. At the 32nd week, she referred to hospital with complaints of vaginal bleeding and uterine contractions. An emergency cesarean section was perfomed due to plasental malposition. A 1380 gr, female fetus was delivered. First and 5th minute Apgar scores were 1 and 0, respectively. Consequently, the baby died after 45 minutes of neonatal resuscitation. Conclusıon: MGS is a lethal disorder. One cannot speak about survival of the fetus because of the pulmonary hypoplasia. The parents should be counseled about prognosis of the fetus and the outcome. Counselers should strictly give information about the recurrence risk for the next pregnancies. PMID:26037304

  19. The progress and efficiency on SFR

    International Nuclear Information System (INIS)

    Li Shisen.

    1985-01-01

    The study comprehends an analysis of construction management at the work site of SFR, the final repository for low and medium level nuclear waste, situated in Forsmark. The period of analysis is 1985. During this year, the most intensive part of the rock excavation work of totaly 430,000 solid cubic metres took place. Many tunnels and big chambers as well as a huge silo were driven. Many drawings and figures are given to show how the project was going on and how the construction efficiency was during the year of 1985. SFR is a highly mechanized underground project. Based on the analysis of the composition of the construction costs in SFR, the work study points out that the machine costs is the biggest part in the construction costs, and that there is a close relation between the construction costs and machine management. Some experience in reducing construction costs and some experience in construction management are introduced in detail. In order to improve the machine management, attention should be paid to increase the utilization ratio of machines. A preliminary study of time utilization ratio of drill jumbo and bolting rig is given. (orig./HP)

  20. Physical characteristics of some wheat genotypes cultivated in Lake District of Turkey

    Directory of Open Access Journals (Sweden)

    Hülya GÜL

    2012-12-01

    Full Text Available This study was carried out to determine the physical characteristics of wheat genotypes cultivated in lakes district of Turkey. The genotypes were collected from the center of Isparta and Burdur province, districts and selected five different villages in this district at harvest in 2011. Totaly 19 genotypes named as; Hard Wheat, Red Kazmalı Wheat, Lavanta, Red Wheat, Burgaz, Osmaniye and Yunak (Landraces, Kızıltan-91, İzmir 85, Bezostoya, Ankara 98, Sönmez 2001, Çeşit-1252, Hatay 86, Mirzabey, Kunduru-1149, Gerek-79, Gediz-75 and Cumhuriyet-75 (Wheat registered cultivars were collected from these districts. Physical characteristics of the wheat samples brought to laboratory were analyzed as completely randomized design with three replications. Foreign matters of wheats were determined according to TS 2974 standards. 4 genotypes were found at second degree, 5 genotypes were at third degree and remaining 10 genotypes were found out of these rating. Highest thousand kernel weight and hectoliter weight were determined on Mirzabey and Sönmez 2001 respectively in bread wheat varieties while highest thousand kernel weight and hectoliter weight were determeined on Kunduru 1149 and Burgaz respectively in durum wheat varieties.

  1. Organic tanks safety program FY95 waste aging studies

    International Nuclear Information System (INIS)

    Camaioni, D.M.; Samuels, W.D.; Clauss, S.A.; Lenihan, B.D.; Wahl, K.L.; Campbell, J.A.; Shaw, W.J.

    1995-09-01

    This report gives the second year's findings of a study of how thermal and radiological processes may change the composition of organic compounds in the underground tanks at Hanford. Efforts were focused on the global reaction kinetics in a simulated waste exposed to γ rays and the reactions of organic radicals with nitrite ion. The gas production is predominantly radiolytic. Decarboxylation of carboxylates is probably an aging pathway. TBP was totaly consumed in almost every run. Radiation clearly accelerated consumption of the other compounds. EDTA is more reactive than citrate. Oximes and possibly organic nitro compounds are key intermediates in the radiolytic redox reactions of organic compounds with nitrate/nitrite. Observations are consistent with organic compounds being progressively degraded to compounds with greater numbers of C-O bonds and fewer C-H and C-C bonds, resulting in an overall lower energy content. If the radwaste tanks are adequately ventilated and continually dosed by radioactivity, their total energy content should have declined. Level of risk depends on how rapidly carboxylate salts of moderate energy content (including EDTA fragments) degrade to low energy oxalate and formate

  2. Can venous ProBNP levels predict placenta accreta?

    Science.gov (United States)

    Ersoy, Ali Ozgur; Oztas, Efser; Ozler, Sibel; Ersoy, Ebru; Erkenekli, Kudret; Uygur, Dilek; Caglar, Ali Turhan; Danisman, Nuri

    2016-12-01

    Placenta previa (PP) is a potential life-threatening pregnancy complication. Pro-brain natriuretic peptide (ProBNP), creatine kinase (CK), cardiac form of CK (CK-MB) and Troponin I are circulatory biomarkers related to cardiac functions. We aimed to determine whether these biomarkers are related to PP and placenta accreta. In this case-control study, fifty-four pregnant women who attended our tertiary care center for perinatology with the diagnosis of PP totalis, and of them, 14 patients with placenta accreta were recruited as the study groups. Forty-six uncomplicated control patients who were matched for age, BMI were also included. Maternal venous ProBNP, CK, CK-MB and Troponin I levels were compared between the three groups. Obstetric history characteristics were comparable among groups, generally. CK and CK-MB levels were similar among three groups. Troponin I levels in the previa and accreta groups were significantly higher than the controls. ProBNP levels in the accreta group were significantly higher than other two groups. The multivariate regression model revealed that ProBNP could predict placental adhesion anomalies. Troponin I and ProBNP levels in PP cases were higher than controls and ProBNP could predict placenta accreta.

  3. Evaluation of serum homocysteine, high-sensitivity CRP, and RBC folate in patients with alopecia areata

    Directory of Open Access Journals (Sweden)

    Maryam Yousefi

    2014-01-01

    Full Text Available Introduction: Alopecia areata (AA is a common type of hair loss with an autoimmune basis. As the role of homocysteine (Hcys, folate, and CRP has been considered in some autoimmune diseases. Objectives: To evaluate homocysteine, folate and CRP level in AA. Methods: This study was performed on 29 patients who had AA for at least 6 months affecting more than 20% of scalp, and 32 healthy controls. Levels of serum Hcys, blood high-sensitivity CRP, and RBC folate were measured in all subjects. Results: The mean level of RBC folate was significantly lower in the patient group than that in controls (P < 0.001. Also, the level of RBC folate was significantly lower in patients with extensive forms of disease (alopecia totalis/alopecia universalis in comparison with more localized form (patchy hair loss (P < 0.05. Patients with higher "Severity of Alopecia Total" (SALT score had lower RBC folate, as well. Serum Hcys and blood high-sensitivity CRP levels did not show a significant difference in two groups. Conclusion: Patients with alopecia areata have lower level of RBC folate which is in negative correlation with both severity and extension of AA.

  4. 308-nm excimer laser for the treatment of alopecia areata.

    Science.gov (United States)

    Al-Mutairi, Nawaf

    2007-12-01

    Alopecia areata is loss of hair from localized or diffuse areas of hair-bearing area of the skin. Recently there are reports of efficacy of the 308-nm excimer radiation for this condition. To study the effect of the 308-nm excimer laser in the treatment of alopecia areata. Eighteen patients with 42 recalcitrant patches (including 1 adult with alopecia totalis) were enrolled in this study. The lesions were treated with the 308-nm excimer laser twice a week for a period of 12 weeks; one lesion on each patient was left as a control for comparison. There were 7 males and 11 females in this study. Regrowth of hair was observed in 17 (41.5%) patches. Thirteen of the 18 lesions in scalp showed a complete regrowth of hair. The extremity regions failed to show a response. Atopic diatheses had an unfavorable effect on the outcome in our patients. The 308-nm excimer laser is an effective therapeutic option for patchy alopecia areata of the scalp and for some cases with patchy alopecia areata of the beard area. It does not work for patchy alopecia areata of the extremities.

  5. 308-nm excimer laser for the treatment of alopecia areata in children.

    Science.gov (United States)

    Al-Mutairi, Nawaf

    2009-01-01

    Alopecia areata (AA) is a common skin disease which is characterized by nonscarring localized or diffused hair loss. In this study we assessed the efficacy of 308-nm Excimer laser in the treatment of alopecia areata in children. A total of 9 children with 30 recalcitrant patches alopecia areata and two children with alopecia areata totalis were enrolled in this study which included seven male and four female patients, aged between 4 and 14 years and the durations of their disease were between 7 and 25 months. All of these patients had more than one lesion of alopecia areata and at least one of them was left as a control for comparison. The lesions were treated with the 308-nm Excimer laser twice a week for a period of 12 weeks. Regrowth of hair was observed in 18 (60%) alopecia patches in the scalp, while there was no response in the control patches and over the extremities. Only four patients with scalp lesions showed a recurrence of alopecia after 6 months post laser therapy. So, 308-nm Excimer laser is considered an effective safe therapeutic option for patchy alopecia areata in children.

  6. Moessbauer study of the fast magnetization reversal forced in permalloy and invar by an external rf magnetic field

    International Nuclear Information System (INIS)

    Kopcewicz, M.

    1978-01-01

    The effect of fast magnetization reversal leading to fast relaxation of the hyperfine field (collapse effect) forced by an external rf magnetic field is studied using the Moessbauer technique for permalloy and invar. The rf collapse and sideband effects are investigated as a function of external rf field, frequency, and intensity. The collapse of the hfs spectrum through unresolved hfs spectrum, triangular shape to a single line, as well as the formation of sidebands is observed. The rf collapse effect is attributed to the rf forced uniform rotation of internal magnetization which causes fast magnetization reversal leading to fast relaxation of the hyperfine field as a result of which the average field at the Moessbauer nuclei is reduced to zero. The difference of the magnetization reversal process in permalloy and invar are discussed. It is shown that the origin of collapse and sideband effects is totaly different: the collapse effect being of purely magnetic origin while the formation of sidebands is due to the rf induced mechanical vibrations of iron atoms within the sample. It is possible to damp sidebands without affecting the collapse effect. The results obtained show that the application of the rf field to ferromagnetic materials gives a unique possibility to force, simulate, and control the relaxation effects in ferromagnetic materials. (author)

  7. Economic costs and benefits of the renewable energy sources; Costi e benefici economici delle fonti rinnovabili

    Energy Technology Data Exchange (ETDEWEB)

    De Leo, G. A. [Parma Univ., Parma (Italy). Dipt. di Scienze Ambientali; Rizzi, L. [Milan Politecnico, Milan (Italy). Dipt. di Elettronica; Caizzi, A. [Cesi Spa, Business Unit Ambiente, Milan (Italy)

    2001-08-01

    In this work it has been analysed the potential diffusion of renewable energy sources and co-generation in the Italian market on the basis of the level of maturation of the different technologies, predicted market growth and environmental impacts associated to them. A sensitivity analysis on external costs generated by global climate changes has allowed everybody to assess how possible errors in estimating the potential impact of greenhouse gasses can affect the estimate of the economic performances of different scenarios of energetic development. On the basis of these considerations, it can be outlined a potential doubling of energy production by renewable energies in the next 10 years, with specific reference of small hydroelectric, biogass and eolic power plants. [Italian] Viene analizzata la capacita' di penetrazione delle fonti di energia rinnovabile e della cogenerazione nel mercato italiano sulla base dello stato di maturazione delle varie tecnologie e gli impatti ambientali ad esse associate. L'articolo mostra che il rispetto del vincolo di Kyoto comporterebbe in ultima analisi non un aggravio dei costi per la collettivita', ma addirittura un risparmio di 11 lire per ogni kWh prodotto, ovvero oltre il 10% rispetto ai costi totali.

  8. SUMOylation of the Forkhead transcription factor FOXL2 promotes its stabilization/activation through transient recruitment to PML bodies.

    Directory of Open Access Journals (Sweden)

    Adrien Georges

    Full Text Available BACKGROUND: FOXL2 is a transcription factor essential for ovarian development and maintenance. It is mutated in the genetic condition called Blepharophimosis Ptosis Epicantus inversus Syndrome (BPES and in cases of isolated premature ovarian failure. We and others have previously shown that FOXL2 undergoes several post-translational modifications. METHODS AND PRINCIPAL FINDINGS: Here, using cells in culture, we show that interference with FOXL2 SUMOylation leads to a robust inhibition of its transactivation ability, which correlates with a decreased stability. Interestingly, FOXL2 SUMOylation promotes its transient recruitment to subnuclear structures that we demonstrate to be PML (Promyelocytic Leukemia Nuclear Bodies. Since PML bodies are known to be sites where post-translational modifications of nuclear factors take place, we used tandem mass spectrometry to identify new post-translational modifications of FOXL2. Specifically, we detected four phosphorylated, one sulfated and three acetylated sites. CONCLUSIONS: By analogy with other transcription factors, we propose that PML Nuclear Bodies might transiently recruit FOXL2 to the vicinity of locally concentrated enzymes that could be involved in the post-translational maturation of FOXL2. FOXL2 acetylation, sulfation, phosphorylation as well as other modifications yet to be discovered might alter the transactivation capacity of FOXL2 and/or its stability, thus modulating its global intracellular activity.

  9. A gene prenature ovarian failure associated with eyelid malformation maps to chromosomes 3q22-q23

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-05-01

    Premature ovarian failure and XX gonadal dysgenesis leading to female infertility have been reported in association with an autosomal dominantly inherited malformation of the eyelids: blepharophimosis-ptosis-epicanthus inversus syndrome (BPES; MIM 110100). This association distinguishes BPES type I from BPES type II, in which affected females are fertile and the transmission occurs through both sexes. Recently, a gene responsible for BPES type II has been mapped to chromosome 3q22-q23, and the critical region for the gene location has been reduced to the interval between loci D3S1615 and D3S1316. Hitherto, however, no information regarding the localization of the gene for BPES type I, in which female ovarian failure is associated with eyelid malformation, has been available. We have studied two independent families affected with BPES type I, including a total of 12 affected individuals (6 infertile women) and 6 healthy relatives. The diagnostic criteria for the ophthalmological anomaly included (1) reduced horizontal diameter of palpebral fissures, (2) drooping of the upper eyelids, and (3) an abnormal skinfold running from the lower lids. Telecanthus and a flat nasal bridge were present in most cases. In both families the disease was transmitted only by the male, and no affected woman of childbearing age was fertile. 12 refs., 2 figs., 1 tab.

  10. Left-right asymmetry defect in the hippocampal circuitry impairs spatial learning and working memory in iv mice.

    Directory of Open Access Journals (Sweden)

    Kazuhiro Goto

    Full Text Available Although left-right (L-R asymmetry is a fundamental feature of higher-order brain function, little is known about how asymmetry defects of the brain affect animal behavior. Previously, we identified structural and functional asymmetries in the circuitry of the mouse hippocampus resulting from the asymmetrical distribution of NMDA receptor GluR ε2 (NR2B subunits. We further examined the ε2 asymmetry in the inversus viscerum (iv mouse, which has randomized laterality of internal organs, and found that the iv mouse hippocampus exhibits right isomerism (bilateral right-sidedness in the synaptic distribution of the ε2 subunit, irrespective of the laterality of visceral organs. To investigate the effects of hippocampal laterality defects on higher-order brain functions, we examined the capacity of reference and working memories of iv mice using a dry maze and a delayed nonmatching-to-position (DNMTP task, respectively. The iv mice improved dry maze performance more slowly than control mice during acquisition, whereas the asymptotic level of performance was similar between the two groups. In the DNMTP task, the iv mice showed poorer accuracy than control mice as the retention interval became longer. These results suggest that the L-R asymmetry of hippocampal circuitry is critical for the acquisition of reference memory and the retention of working memory.

  11. Taxonomy, ecology, and geographical distribution of the species of the genus Thermocyclops Kiefer, 1927 (Copepoda, Cyclopoida in São Paulo State, Brazil, with description of a new species

    Directory of Open Access Journals (Sweden)

    W. M. Silva

    Full Text Available The taxonomy and ecology of the cyclopoid copepod genus Thermocyclops were studied. Samples were collected in 207 water bodies located in the 22 hydrographic basins of São Paulo State, Brazil, including large reservoirs, small and shallow lakes, and ponds and rivers. The genus Thermocyclops inhabits mainly water bodies within a limnetic region. Four species were found, of which one is new: Thermocyclops iguapensis, which occurred in the reservoirs of the Ribeira do Iguape and Paraíba do Sul basins. The description of the new species and the geographical distribution of all four species in São Paulo State are presented. Thermocyclops decipiens was the most frequent species, occurring in 71% of the water bodies within a limnetic region. This species is characteristic of eutrophic environments where it can occur in great abundance, whereas Thermocyclops minutus is characteristic in oligotrophic systems. Thermocyclops inversus and Thermocyclops iguapensis n. sp. were not common but can occur together with Thermocyclops decipiens.

  12. FOXL2 Is an Essential Activator of SF-1-Induced Transcriptional Regulation of Anti-Müllerian Hormone in Human Granulosa Cells.

    Directory of Open Access Journals (Sweden)

    Hanyong Jin

    Full Text Available Anti-Müllerian hormone (AMH is required for proper sexual differentiation by regulating the regression of the Müllerian ducts in males. Recent studies indicate that AMH could be an important factor for maintaining the ovarian reserve. However, the mechanisms of AMH regulation in the ovary are largely unknown. Here, we provide evidence that AMH is an ovarian target gene of steroidogenic factor-1 (SF-1, an orphan nuclear receptor required for proper follicle development. FOXL2 is an evolutionally conserved transcription factor, and its mutations cause blepharophimosis, ptosis, and epicanthus inversus syndrome (BPES, wherein affected females display eyelid defects and premature ovarian failure (POF. Notably, we found that functional FOXL2 is essential for SF-1-induced AMH regulation, via protein-protein interactions between FOXL2 and SF-1. A BPES-inducing mutant of FOXL2 (290-291delCA was unable to interact with SF-1 and failed to mediate the association between SF-1 and the AMH promoter. Therefore, this study identified a novel regulatory circuit for ovarian AMH production; specifically, through the coordinated interplay between FOXL2 and SF-1 that could control ovarian follicle development.

  13. Progressive Salafism in Online Fatwa

    Directory of Open Access Journals (Sweden)

    R. Rusli

    2015-04-01

    Full Text Available This paper deals with the construction of progressive Salafism in online fatwa, particularly in the site of Islam Online. This website is established by Yūsuf al-Qarāḍāwī and his colleagues within the European Council for Fatwa and Research, which has been influenced by reformist-salafists, such as al-Shawkānī, al-Afghānī, ‘Abduh, and Riḍā, who underline the role of text and modernity. The site’s approach is progressive-substantialist (combining teks and reality, which is built on the principles of Islamic law on minorities (fiqh al-aqalliyyāt, like taysīr (facilitation, wasaṭiyyah (moderation, and i’tidāl (equilibrium, that are seen as universal values contributing to the creation of a global-pluralist society. Because of its moderate nature, the language used by the site tends to emphasize not on prohibiting and labelling “heretic”, but on a solution to the problems people encounter. In relation to socio-political language, the concept of ummah is understood in an inclusive way. Ummah is built and based on the principles of belief (īmān and Islam, and tied by the solidarity of the Quranic messages about Islamic monotheism (tawḥīd and divine justice (‘adl. The concept of ummah refers to the Quranic concepts such as ummah wasaṭ or ummah muqtaṣidah, which means “moderate community”.[Artikel ini membahas tentang konstruksi Salafisme progresif dalam fatwa online, terutama situs Islam Online. Website ini didorong oleh Yūsuf al-Qarāḍāwī dan para koleganya dalam European Council for Fatwa and Research, yang dipengaruhi oleh salafi-reformis, seperti al-Shawkānī, al-Afghānī, ‘Abduh, dan Riḍā, yang menghargai teks dan modernitas. Pendekatan situs ini adalah progresif-substansialis (menggabungkan teks dan realitas, yang dibangun pada prinsip-prinsip fikih minoritas (fiqh al-aqalliyyāt, seperti taysīr (memberikan kemudahan, wasaṭiyyah (moderat, dan i’tidāl (keseimbangan,yang dilihat sebagai

  14. Analisis Kepuasan Pelanggan dalam Belanja Online: Sebuah Studi Tentang Penyebab (Antecedents dan Konsekuensi (Consequents

    Directory of Open Access Journals (Sweden)

    Asmai Ishak

    2014-07-01

    Full Text Available AbstractThis study is aimed to analyze customer satisfaction in online shopping and its antecedentsand consequences emerged. 300 consumers, who have shopped online and been selected throughconvenience sampling method, involved in the study. Questionnaires were adapted from theestablished research instrument and were tested before being spread to the respondents. StructuralEquation Modeling was used to hypotheses. The results indicate that all of hypotheses aresupported. This means that site characteristics of the online retailing such as the ShoppingConvenience, the Site Design, the Informativeness, the Security, and the Communication drive theCustomer Satisfaction which in turn affects positively the Commitment and the Word of MouthCommunication. The study also finds that the Word of Mouth Communication is not only driven bythe Customer Satisfaction but also is encouraged by the Commitment. These findings strengthenand are consistent with the previous studies. The results of this study are very valuable marketers,especially who work in online retail business, in encouraging the word of mouth communicationsamong their customers.Keywords: Customer Satisfaction, Site Design, Informativeness, Security, Communication,Commitment, Communication Word of Mouth (WOM.AbstrakStudi ini bertujuan untuk menganalisa kepuasan konsumen dalam belanja online denganfaktor-faktor penyebab dan konsekuensi yang akan ditimbulkan dengan menggunakan konsumenritel online sebagai subyek penelitian. Sampel penelitan ini berjumlah 300 responden. Instrumenpenelitian berupa kuesioner, dikembangkan berdasarkan instrumen yang sudah dipakai olehpeneliti lain dan diuji validitas dan realibilitasnya sebelum diedarkan kepada responden penelitianini. Structural Equation Modeling (SEM dipergunakan untuk menguji hipotesa. Hasil analisismenunjukkan bahwa semua hipotesa penelitian ini terbukti. Dengan kata lain karakteristik situsseperti Kemudahan, Desain Situs, Keinformatifan, Keamanan

  15. Intraoperative use of an open midfield MR scanner in the surgical treatment of cerebral gliomas; Intraoperative Nutzung eines offenen Mittelfeld-MRT waehrend der chirurgischen Therapie zerebraler Gliome

    Energy Technology Data Exchange (ETDEWEB)

    Schneider, J.P.; Schulz, T.; Dietrich, J.; Kahn, T. [Klinik und Poliklinik fuer Diagnostische Radiologie, Univ. Leipzig (Germany); Trantakis, C. [Klinik und Poliklinik fuer Neurochirurgie, Univ. Leipzig (Germany)

    2003-07-01

    The aim of the present study was to evaluate the effectiveness of intraoperative MRI guidance in achieving more gross-total resection in case of primary brain tumors. We studied 12 patients with low-grade glioma and 19 patients with high-grade glioma who underwent surgery within a vertically open 0.5T MR system. After initial imaging, the resection was stopped at the point in which the neurosurgeon considered the resection complete by viewing the operation field. At this time, intraoperative MRI was repeated (''first control'') to identify any residual tumor. Areas of tumor-suspected tissue were localized and resected, with the exception of tissue adjacent to eloquent areas. Final imaging was carried out before closing the craniotomy. Comparison of ''first control'' and final imaging revealed a decrease of residual tumor volume from 32% to 4.3% in low-grade gliomas, and from 29% to 10% in high-grade gliomas. Intraoperative MRI allows a clear optimization of microsurgical resection of both low-grade and high-grade gliomas. (orig.) [German] Ziel der Untersuchung war es, die Effektivitaet des Einsatzes der intraoperativen MRT bei der Resektion gliogener Hirntumoren zu pruefen. 12 Patienten mit niedriggradigem Gliom und 19 Patienten mit Glioblastom wurden in einem vertikal offenen 0,5-T-MRT operiert. Nach der initialen Bildgebung erfolgte die Resektion bis zu dem Zeitpunkt, an dem der Neurochirurg kein Tumorgewebe mehr im OP-Situs abgrenzen konnte. Zu diesem Zeitpunkt erfolgte eine erneute MRT (''= erste Kontrolle'') zur Visualisierung nur MR-tomographisch darstellbaren Resttumors. Solche Areale wurden im OP-Situs lokalisiert und mit Ausnahme von Strukturen in der Naehe eloquenter Hirnareale reseziert. Vor Verschluss des Schaedels erfolgte eine abschliessende MR-Kontrolle. Durch Einsatz der intraoperativen MRT konnte eine Absenkung des relativen Resttumorvolumens von 32% auf 4,3% bei niediggradigen Gliomen und

  16. PERENCANAAN PENGEMBANGAN KURIKULUM PADA KULLIYATUL MU’ALLIMIEN AL-ISLAMIYAH

    Directory of Open Access Journals (Sweden)

    Nur Widia Wardani

    2016-05-01

    Full Text Available Curriculum Development Planning Kulliyatul Mu'allimien Al-Islamiyah. The purpose of this study are: (1 identify curriculum development planning; (2 identify curriculum development process; (3 determine the factors supporting and curriculum development planning; and (4 determine the strategy to overcome the inhibiting factors  curriculum development planning. This study used a qualitative approach to describe the planning of curriculum development at Kulliyatul Mu'allimien Al-Islamiyah. The design of the study is a multi-site study means combining multiple sites, subject, background, and the scene is different. The key instrument is the researchers themselves, with the source of the research that led cottage, a team of curriculum developers, teachers, and students. Data obtained through observation, interviews, and documentation. The validity of the data that has been analyzed using the criteria of the credibility of the data with the triangulation of data sources. The results of the research, that the planning of curriculum development at KMI is aimed at character building through micro teaching, improvement of skills of students and teacher competence that leads to the career development of teachers. Perencanaan Pengembangan Kurikulum Kulliyatul Mu’allimien Al-Islamiyah. Tujuan penelitian ini adalah: (1 mengidentifikasi perencanaan pengembangan kurikulum;(2 mengidentifikasi proses pengembangan kurikulum ; (3 mengetahui faktor pendukung dan penghambat perencanaan pengembangan kurikulum; dan (4 mengetahui strategi mengatasi faktor penghambat perencanaan pengembangan kurikulum. Penelitian ini menggunakan pendekatan kualitatif untuk mendeskripsikan tentang perencanaan pengembangan kurikulum pada Kulliyatul Mu’allimien Al-Islamiyah. Rancangan penelitian yang digunakan adalah studi multi situs yang berarti menggabungkan beberapa situs, subyek, latar, dan tempat kejadian yang berlainan. Instrumen kunci adalah adalah peneliti sendiri, dengan

  17. Arkeologi Kepulauan Maluku

    Directory of Open Access Journals (Sweden)

    Lucas Wattimena

    2016-04-01

    , menhir, kesultanan, kapata/folklore adalah struktur dasar pemahaman akan kebudayaan di Kepulauan Maluku. Tujuannya adalah untuk mengetahui dan memahami tinggalan-tinggalan arkeologis mampu merekonstruksi kebudayaan masyarakat manusia Kepulauan Maluku. Pendekatan penelitian menggunakan studi kepustakaan. Dari hasil penelitian bahwa sumberdaya budaya arkeologi merupakan suatu interprestasi interaksi simbolik suatu kelompok manusia masyarakat pada daerah tertentu. Situs-situs kajian penulis yang menjadi sampel membuktikan bahwa sumberdaya budaya arkeologi sebagai cerminan masyarakat Maluku Umumnya dan daerah tertentu di Maluku pada khususnya.

  18. AN ANALYSIS ON CUSTOMER SATISFACTION, TRUST AND LOYALTY TOWARD ONLINE SHOP (A CASE STUDY OF TOKOPEDIA.COM

    Directory of Open Access Journals (Sweden)

    Ayudya Dhiranty

    2017-05-01

    Full Text Available In reference to the results of national research conducted by the Association of Internet Service Providers Indonesia (APJII in cooperation with PusKaKom UI, the number of internet users (88.1 million and its penetration (34.9% in Indonesia has gradually increased. Also, the research identifies the issues of satisfaction, trust and loyalty in online shopping. The presence of actors in e-commerce business benefits the customers to personally choose the site to shop. The strategies to keep customer satisfaction trust and loyalty on one site challenge the actors in the business. In this regard, this paper examines customer satisfaction, trust and loyalty in online shopping in reference to the Quality User Interface (UIQ, Information Quality (IQ, Perceived Security Risk (PSR and Perceived Privacy (PP variables with case studies On Tokopedia.com. The study was conducted with 211 respondents by using self-administrated questionnaires in Survey Monkey platform in Jakarta and Bogor. The data were analyzed by using Structural Equation Modeling (SEM. Thus, the results show that the variables of UIQ, IQ, PSR and PP have an influence on satisfaction and trust. The variable of satisfaction has an influence on trust. However, these variables have no direct influence on loyalty.Keywords: e-commerce, satisfaction, trust, loyalty, SEMABSTRAKHasil riset nasional yang dilakukan oleh Asosiasi Penyelenggara Jasa Internet Indonesia (APJII bekerjasama dengan PusKaKom UI, pengguna internet Indonesia (88.1 juta dan penetrasinya (34.9% mengalami peningkatan. Namun, dari riset juga ditemukan bahwa adanya isu-isu kepuasan, kepercayaan dan loyalitas dalam berebelanja online. Adanya banyak pelaku dalam bisnis ecommerce membuat konsumen memiliki keuntungan untuk memilih situs yang menjadi tempat berbelanja. Bagaimana membuat konsumen terpuaskan dan percaya sampai dengan setia pada satu situs menjadi tantangan para pelaku bisnis. Sehubungan dengan hal tersebut, tulisan ini

  19. Arkeologi Pulau Kobror Kepulauan Aru

    Directory of Open Access Journals (Sweden)

    Marlon NR Ririmasse

    2016-04-01

    wilayah ini. Tulisan ini mencoba untuk mengisi ruang dimaksud dengan memberi perhatian pada tinjauan atas potensi arkeologis yang ada di Pulau Kobror Kepulauan Aru. Sebagai sebuah kajian yang bersifat inisiasi, pendekatan yang digunakan adalah survei penjajakan guna merekam segenap data arkeologis yang ada di wilayah Kobror. Kajian pustaka juga dilakukan untuk menemukan kerangka historis wilayah kajian. Hasil penelitian menemukan aspek penting dalam tinjauan sejarah budaya di Kepulauan Aru: pertama adalah jejak budaya prasejarah yang teramati lewat situs lukisan cadas dan kedua, ragam tradisi berlanjut sebagaimana terekam dalam situs penguburan kuno yang tekait dengan aplikasi perahu sebagai simbol dan religi tradisional.

  20. [Linee guida italiane per il trattamento dell'alcolismo].

    Science.gov (United States)

    Ceccanti, Mauro; Iannitelli, Angela; Fiore, Marco

    2018-01-01

    RIASSUNTO. L'Europa è la regione con il più forte consumo di alcol al mondo, con la più elevata percentuale di malattie totali e morti premature alcol-correlate. In Italia, questo fenomeno coinvolge circa il 13% della popolazione oltre i 18 anni e oltre il 25% dei pazienti ospedalizzati. Sfortunatamente, solo il 5% di questi pazienti vengono riconosciuti come persone affette da disturbo da uso di alcol (DUA). Una scarsa conoscenza della malattia, la mancanza di accesso alle cure e le poche risorse messe a disposizione nella gestione del problema sono tra le principali cause di ritardo nella diagnosi, alla fine con conseguenze cliniche molto più importanti e costose da gestire. Alla luce di ciò, abbiamo deciso di dedicare questo numero speciale della Rivista di psichiatria a una serie di articoli riguardanti le linee guida italiane per il trattamento della dipendenza da alcol. Realizzate in collaborazione con numerosi esperti e importanti società scientifiche italiane come il Centro di Riferimento Alcologico della Regione Lazio (CRARL), la Società Italiana Tossicodipendenze (SITD), la Società italiana per il Trattamento dell'Alcolismo e le sue Complicanze (SITAC), la Società Italiana Psichiatria delle Dipendenze (SIPDip), la Società Italiana Patologie da Dipendenza (SIPaD) e l'Istituto di Biologia Cellulare e Neurobiologia (IBCN-CNR), queste linee guida forniscono agli operatori una serie di raccomandazioni basate su prove di efficacia volte ad aumentare la conoscenza e un uso appropriato dei farmaci per le persone affette da DUA. Con la possibilità di un continuo aggiornamento, l'obiettivo principale di queste linee guida sarà quello di garantire l'omogeneità dei trattamenti e un incremento qualitativo nell'assistenza dei pazienti affetti da DUA, così da ridurre le conseguenze psicosociali e sulla salute pubblica di questa importante malattia psichiatrica.

  1. Kombinierte Hoch-/Niedrig-Dosis-Therapie mit systemischen Glukokor-tikoiden bei schweren Verlaufsformen der Alopecia areata im Kindesalter.

    Science.gov (United States)

    Jahn-Bassler, Karin; Bauer, Wolfgang Michael; Karlhofer, Franz; Vossen, Matthias G; Stingl, Georg

    2017-01-01

    Schwere Verlaufsformen der Alopecia areata (AA) im Kindesalter sind aufgrund limitierter Optionen therapeutisch herausfordernd. Systemische, hochdosierte Glukokortikoide weisen die schnellste Ansprechrate auf, nach dem Absetzen kommt es allerdings zu Rezidiven. Eine längerfristige Hochdosis-Anwendung ist aufgrund der zu erwartenden Nebenwirkungen nicht empfehlenswert. Eine dauerhafte Steroiderhaltungstherapie unterhalb der Cushing-Schwellen-Dosis nach Bolustherapie könnte die Krankheitsaktivität ohne Nebenwirkungen längerfristig unterdrücken. Im Rahmen einer offenen Anwendungsbeobachtung wurden 13 Kinder mit schweren Formen der AA in diese Studie eingeschlossen. Bei sieben Kindern lag eine AA totalis/universalis vor, bei sechs eine multifokale AA mit Befall von mehr als 50 % der Kopfhaut. Das Therapieregime sah eine initiale Prednisolon-Dosierung von 2 mg/kg Körpergeweicht (KG) vor und wurde innerhalb von neun Wochen auf eine Erhaltungsdosierung unter der individuellen Cushing-Schwelle reduziert. Der Nachbeobachtungszeitraum betrug ein bis drei Jahre. Wir beobachteten in 62 % aller Fälle ein komplettes Nachwachsen der Haare. Die mittlere Dauer bis zum Ansprechen lag bei 6,6 Wochen und konnte mit der Erhaltungstherapie über den gesamten Beobachtungszeitraum aufrechterhalten werden. An Nebenwirkungen wurden ausschließlich eine Gewichtszunahme (1-3 kg) bei allen Behandelten sowie eine milde Steroidakne in 23 % der Fälle beobachtet. Die kombinierte Hoch-/Niedrig-Dosis-Therapie mit systemischen Glukokortikoiden mittels Prednisolon zeigte eine hohe, dauerhafte Ansprechrate ohne signifikante Nebenwirkungen. © 2017 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.

  2. [About Cryptophthalmos (2nd Czech Study)].

    Science.gov (United States)

    Krásný, J; Čakrtová, M; Kletenský, J; Novák, V; Šach, J

    To get acquainted with the 2nd Czech study about cryptophthamos and with self-surgical methods. The boy with unilateral complete cryptophthalmos of left eye was treated from 2 to 20 years. The girls was treated from 4 month to 5 year yet for right abortive cryptophthalmos with microblepharon and left complete type still waiting for solutions.Surgical methods and results: Authors present a surgical procedures for correction of the upper and lower eyelids and ocular anomalies both patients studied. Successful reconstruction of palpebral fissure took place in several stages at the boy. The surgical procedure gradually contained: the insertion of gradually increased convex concave circular-shaped implant (silicone ruber) due a modeling of palpebral fissure, an enucleation of rudimentary eye, a reconstruction of bottom palpebral fissure by retro-auricular skin graf and a releasing of the lower transitory fold by the cul-de-sac method. An adequate depth of palpebral fissure to allow perfect position of an aesthetic protesis. Enucleated eye was atypically shaped, remiding partly sand-glass clock. The cornea was replaced by thick fibrous membrane, the iris and the lens were not revealed. Gliomatic retina was detached nearly totaly and the optic nerv was rudimental. The repairing the upper lid coloboma of girl by a lid rotation flap reconstruction using the inferior eyelid was performed at the age 17 month. Corneal dermoid simultaneously removed (histologically verified). Upper conjunctival fornix was formed using the spherical covering foil (silicone rubber) before and after the reconstruction of the lid. Plastic reconstructions required the need for patient access without trying immediate effect. An important role played silicone rubber implants (elastomer medical grade) which used temporarily. cryptophthalmos, microblepharon, relief surgery, silicon ruber implants.

  3. Psychiatric morbidity in dermatology patients: Frequency and results of consultations

    Directory of Open Access Journals (Sweden)

    Seyhan Muammer

    2006-01-01

    Full Text Available BACKGROUND: Dermatological patients quite commonly depict psychiatric morbidity. PURPOSES: To study the psychiatric morbidity among skin patients of our clinic. METHODS: In the present study, the patients who were treated in the Dermatology Clinic of Inonu University Medical Faculty were evaluated retrospectively. The age, gender, marital status, habits, dermatological and systemic diseases, previously used drugs, current therapy and psychiatric diagnosis of each patient were recorded. FINDINGS: Of 636 patients involved in the study, 15.3% had psychopathological problems, which were depression (32.0%, adjustment difficulty (15.5%, anxiety (13.4%, psychosomatic disorders (10.3%, obsessive-compulsive disorder and conversion (5.1%, dysthymic disorder (4.1%, attention deficit and hyperactivity disorder (2.1%, panic attack (1.0%, premenstrual syndrome, schizophrenia, somatization disorder, insomnia, alcohol dependency, bipolar affective disorder, mental retardation, agoraphobia, social phobia and dementia. The dermatological diseases defined for the patients with psychopathology diagnosis were chronic urticaria (25.8%; psoriasis (15.5%; alopecia areata, totalis and iniversalis (11.3%; acute urticaria, neurodermatitis and Behcet′s disease (5.1%; atopic dermatitis and drug eruptions (4.1%; pemphigus (3.1%; angioedema, contact dermatitis and generalized pruritus (2.1%; folliculitis and the others (1.0%. CONCLUSIONS: Psychiatric morbidity has an affect on the course of dermatological diseases. When required, psychiatric consultation should be sought by dermatology clinics and patients should be followed with the cooperation of dermatologists and psychiatrists. LIMITATION: The indoor-based study had not included any control group and any domicillary patient.

  4. Analysis of premature births for the period from 2009. to 2013. in Health Center Kosovska Mitrovica

    Directory of Open Access Journals (Sweden)

    Adžić V.

    2015-01-01

    Full Text Available Delivery before 37th week of gestation is defined as preterm, independently of body mass of babies, according to the World Health Organization. Premature birth is the current problem in the world due to the high risk of neonatal morbidity and mortality and incompletely clear etiology. In our country the frequency of preterm delivery is 6%. We have retrospectively analyzed early deliveries in Health Center Kosovska Mitrovica in the period from 2009 to 2013. In this five-year period, there were totaly 3398 deliveries, of which 148 or 4.35 % were preterm delivery. The aim of this study was to investigate the incidence of premature birth in the five-year period in relation to: the total number of births in a given period, the age of the patients, the manner of completion of delivery, gestational week of pregnancy, parity and the most common causes that led to the PTP. In the analysis we have included the body weight and Apgar score of premature infants. We have used protocols of births, maternal history of disease, neonatal protocols and lists of newborns. Most of them were multiparas (41.2 %,56.7 % of pregnant women were aged of 21-30 years and pregnancy in 79.9 % of cases ended with 33 to 37 ng. Vaginal deliveries were completed in 84.4% of premature births, and caesarean in 15.6%. Twin pregnancies with preterm deliveries were represented in 10.2%. The most common weight of premature infants ranged from 2000 to 2500 grams (48.6 %. The most common causes that led to the PTP were PPROM (22.9 %, unknown causes (27. 1 %, multiple pregnancy (18.2 %, genital infection (8.7 %, cervical incompetence (6.7 %, IUGR (5.4%, PIH (4.2%, placental abruption and placenta previa (2.1 % and other (4.7% .

  5. Efficacy of Intrauterine Bakri Balloon Tamponade in Cesarean Section for Placenta Previa Patients.

    Directory of Open Access Journals (Sweden)

    Hee Young Cho

    Full Text Available The aims of this study were to analyze the predictive factors for the use of intrauterine balloon insertion and to evaluate the efficacy and factors affecting failure of uterine tamponade with a Bakri balloon during cesarean section for abnormal placentation.We reviewed the medical records of 137 patients who underwent elective cesarean section for placenta previa between July 2009 and March 2014. Cesarean section and Bakri balloon insertion were performed by a single qualified surgeon. The Bakri balloon was applied when blood loss during cesarean delivery exceeded 1,000 mL.Sixty-four patients (46.7% required uterine balloon tamponade during cesarean section due to postpartum bleeding from the lower uterine segment, of whom 50 (78.1% had placenta previa totalis. The overall success rate was 75% (48/64 for placenta previa patients. Previous cesarean section history, anterior placenta, peripartum platelet count, and disseminated intravascular coagulopathy all significantly differed according to balloon success or failure (all p<0.05. The drainage amount over 1 hour was 500 mL (20-1200 mL in the balloon failure group and 60 mL (5-500 mL in the balloon success group (p<0.01.Intrauterine tamponade with a Bakri balloon is an adequate adjunct management for postpartum hemorrhage following cesarean section for placenta previa to preserve the uterus. This method is simple to apply, non-invasive, and inexpensive. However, possible factors related to failure of Bakri balloon tamponade for placenta previa patients such as prior cesarean section history, anterior placentation, thrombocytopenia, presence of DIC at the time of catheter insertion, and catheter drainage volume more than 500 mL within 1 hour of catheter placement should be recognized, and the next-line management should be prepared in advance.

  6. Sistem Informasi Geografis Lokasi Lembaga Pendidikan Berbasis Islam (RA s.d. Pesantren di Kabupaten Cilacap

    Directory of Open Access Journals (Sweden)

    Isti Qomariyah Kumala Dewi

    2016-01-01

    Full Text Available Lembaga pendidikan berbasis Islam di Kabupaten Cilacap berjumlah cukup banyak dan tersebar di seluruh wilayah Kabupaten Cilacap. Namun, informasi tentang lembaga pendidikan berbasis Islam di Kabupaten Cilacap masih sedikit diketahui oleh masyarakat. Salah satu faktor yang menyebabkan hal ini adalah ketersediaan data yang sedikit dan tidak lengkap, sedangkan kebutuhan informasi masyarakat cukup tinggi. Oleh karena itu, sistem informasi geografis ini dirancang dan dibangun untuk menyediakan informasi lokasi dan profil tentang lembaga pendidikan berbasis Islam yang ada di Kabupaten Cilacap secara lebih lengkap. Perancangan dan pembangunan sistem informasi geografis pada penelitian ini menggunakan model proses waterfall. Analisis kebutuhan dilakukan dengan cara observasi dan membaca dokumen hasil survai. Perancangan sistem dibuat dengan mendefinisikan spesifikasi teknis dan pemodelan dengan ERD, DFD, dan Kamus Data. Sistem informasi geografis dibangun berbasis web dengan menggunakan bahasa pemrograman PHP, basis data MySQL, dan basis peta Google Maps API. Pengujian perangkat lunak dilakukan menggunakan metode black-box. Hasil yang diperoleh dari penelitian ini adalah SIG sekolah Islam dapat menampilkan peta penunjuk lokasi dan data sekolah Islam untuk pengguna dengan cepat dan praktis jika dibandingkan dengan pencarian melalui peta konvensional dan pencarian manual melalui mesin pencari di internet. SIG sekolah Islam dapat dijangkau dengan mudah karena berbasis situs web. Data sekolah dalam SIG sekolah Islam dapat diperbarui sewaktu-waktu dengan mudah karena aplikasi ini mempunyai halaman admin. Aplikasi SIG sekolah Islam dapat menjadi salah satu rekomendasi dan alternatif solusi penyedia informasi tentang sekolah Islam di Kabupaten Cilacap.

  7. Komunikasi Getok Tular Pengantar Popularitas Merek

    Directory of Open Access Journals (Sweden)

    Rudy Harjanto

    2008-12-01

    Full Text Available Komunikasi getok tular (Word of mouth-WOM adalah komunikasi berantai yang beredar dengan sendirinya di suatu komunitas tertentu, merujuk pada penyampaian informasi yang pada umumnya dilakukan secara lisan, informal dari seseorang kepada orang lain secara pribadi, antara dua individu atau lebih. Perkembangan teknologi memungkinkan komunikasi getok tular juga berkembang melalui internet, situs web, maupun halaman-halaman profil online, posting dalam blog-blog pribadi maupun pertukaran informasi melalui e-mail. Mereka memperkaya isi percakapan dengan informasi pandangan, pengetahuan, dan sebagainya, secara terus-menerus. Komunikasi getok tular tumbuh subur dalam masyarakat kolektivis, seperti di Indonesia, karena dalam masyarakat kolektivis, diri (self tidak bersifat unik atau otonom, melainkan lebur dalam kelompok (keluarga, klan, kelompok kerja, sukubangsa, bangsa, dsb. Secara tradisional, komunikasi getok tular terjadi pada saat orang-orang sangat berminat pada topik yang diperbincangkan. Komunikasi getok tular dapat dikembangkan sebagai saluran referensi untuk mempopularkan merek (produk, karena khalayak sasaran lebih percaya pada pesan yang disampaikan oleh orang yang mereka kenal, dan mereka hargai.

  8. JARI SELAYAK DURI

    Directory of Open Access Journals (Sweden)

    Aulia Puspaning Galih

    2017-12-01

     Media sosial, seperti namanya, adalah media bagi masyarakat untuk bersosialisasidengan orang lain tanpa dibatasi ruang dan waktu melalui jaringan internet. Salah satu bentuk media sosial yang paling banyak digunakan saat ini, terutama oleh masyarakat Indonesia, adalah jejaring sosial Facebook. Masyarakat Indonesia melakukan banyak kegiatan di situs jejaring sosial tersebut, seperti mengunggah tulisan dan berkomentar pada suatu unggahan. Salah satu fitur yang digemari di Facebook adalah fitur bagikan yang berfungsi agar pengguna dapat membagi tautan dari orang lain keakun pribadi mereka dengan pengaturan tertentu. Adanya kemudahan dalam menggunakan fitur bagikan tersebut, ternyata malah menimbulkan banyak kasus. Kasus ungkapan kemarahan pemain bulutangkis asal Denmark terhadap ancaman pembunuhan yang ditujukan kepada mereka, hingga kasus penghinaan Presiden Indonesia menjadi contoh nyata dari efek fitur tersebut. Tidak jarang masalah yang ada di jejaring sosial berujung pada hukuman sosial,bahkan dapat masuk dalam ranah hukum pidana. Undang-Undang Informasi dan Transaksi Elektronik yang telah direvisi pada akhir tahun 2016, ternyata tidak dapat mengatasi masalah sosial yang terlanjur terjadi di internet. Faktanya, Undang-undang saja tidak akan cukup untuk mengatasi masalah sosial. Sebenarnya, yang lebih dibutuhkan masyarakat adalah pengetahuan tentang literasi digital.

  9. CT and histopathologic characteristics of lung adenocarcinoma with pure ground-glass nodules 10 mm or less in diameter

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Fang [Chinese PLA General Hospital, Department of Radiology, Beijing (China); Capital Medical University, Department of Radiology, Xuanwu Hospital, Beijing (China); Tian, Shu-ping [Navy General Hospital, Department of Radiology, Beijing (China); Jin, Xin; Jing, Rui; Yang, Yue-qing; Jin, Mei; Zhao, Shao-hong [Chinese PLA General Hospital, Department of Radiology, Beijing (China)

    2017-10-15

    To evaluate CT and histopathologic features of lung adenocarcinoma with pure ground-glass nodule (pGGN) ≤10 mm in diameter. CT appearances of 148 patients (150 lesions) who underwent curative resection of lung adenocarcinoma with pGGN ≤10 mm (25 atypical adenomatous hyperplasias, 42 adenocarcinoma in situs, 38 minimally invasive adenocarcinomas, and 45 invasive pulmonary adenocarcinomas) were analyzed for lesion size, density, bubble-like sign, air bronchogram, vessel changes, margin, and tumour-lung interface. CT characteristics were compared among different histopathologic subtypes. Univariate and multivariate analysis were used to assess the relationship between CT characteristics of pGGN and lesion invasiveness, respectively. There were statistically significant differences among histopathologic subtypes in lesion size, vessel changes, and tumour-lung interface (P<0.05). Univariate analysis revealed significant differences of vessel changes, margin and tumour-lung interface between preinvasive and invasive lesions (P<0.05). Logistic regression analysis showed that the vessel changes, unsmooth margin and clear tumour-lung interface were significant predictive factors for lesion invasiveness, with odds ratios (95% CI) of 2.57 (1.17-5.62), 1.83 (1.25-2.68) and 4.25 (1.78-10.14), respectively. Invasive lesions are found in 55.3% of subcentimeter pGGNs in our cohort. Vessel changes, unsmooth margin, and clear lung-tumour interface may indicate the invasiveness of lung adenocarcinoma with subcentimeter pGGN. (orig.)

  10. Melindungi Aplikasi dari Serangan Cross Site Scripting dengan Metode Metacharacter

    Directory of Open Access Journals (Sweden)

    Yulianingsih Yulianingsih

    2017-04-01

    Full Text Available Kebutuhan masyarakat atas penggunaan jasa internet semakin meluas dan mencakup berbagai bidang kehidupan hal ini mengakibatkan turut meningkatkannya kejahatan dalam dunia internet. Keamaanan aplikasi yang tidak baik mengakibatkan data penting dan kerahasiaan pengguna menjadi terancam. Hal ini tentu saja merugikan bagi pihak pengguna maupun penyelenggara. Untuk itu perlu dikedepankan metode–metode terbaik dalam keamanan berinternet dan untuk menentukan tindakan penanggulangan yang tepat terlebih dahulu harus dipahami cara kerja dari jenis kejahatan tersebut. Cross Site Scripting merupakan jenis serangan injection terhadap situs dengan mengandalkan kelemahan dari target atau pengguna internet. Penyerang akan memanfaatkan kelemahan pengguna melalui ajakan atau bujukan untuk mengikuti arahan menuju suatu kondisi tertentu yang telah dimuati oleh usaha untuk pencurian data, kerahasiaan atau perintah tertentu melalui code scripting oleh penyerang.Dalam penelitian ini dilakukan Sejumlah Eksperimen untuk mencari pengaruh perlakuan tertentu terhadap yang lain dalam kondisi yang terkendalikan, yaitu dengan menanamkan metacharacter kedalam code scripting sebelum dan sesudah proses berjalan. Tujuan yang hendak dicapai melalui penelitian ini adalah pembuktian terhadap fungsi metacharacter dalam menutup celah kerentanan keamanan aplikasi

  11. Digital atlas of fetal brain MRI

    International Nuclear Information System (INIS)

    Chapman, Teresa; Weinberger, E.; Matesan, Manuela; Bulas, Dorothy I.

    2010-01-01

    Fetal MRI can be performed in the second and third trimesters. During this time, the fetal brain undergoes profound structural changes. Interpretation of appropriate development might require comparison with normal age-based models. Consultation of a hard-copy atlas is limited by the inability to compare multiple ages simultaneously. To provide images of normal fetal brains from weeks 18 through 37 in a digital format that can be reviewed interactively. This will facilitate recognition of abnormal brain development. T2-W images for the atlas were obtained from fetal MR studies of normal brains scanned for other indications from 2005 to 2007. Images were oriented in standard axial, coronal and sagittal projections, with laterality established by situs. Gestational age was determined by last menstrual period, earliest US measurements and sonogram performed on the same day as the MR. The software program used for viewing the atlas, written in C, permits linked scrolling and resizing the images. Simultaneous comparison of varying gestational ages is permissible. Fetal brain images across gestational ages 18 to 37 weeks are provided as an interactive digital atlas and are available for free download. Improved interpretation of fetal brain abnormalities can be facilitated by the use of digital atlas cataloging of the normal changes throughout fetal development. Here we provide a description of the atlas and a discussion of normal fetal brain development. (orig.)

  12. Digital atlas of fetal brain MRI.

    Science.gov (United States)

    Chapman, Teresa; Matesan, Manuela; Weinberger, Ed; Bulas, Dorothy I

    2010-02-01

    Fetal MRI can be performed in the second and third trimesters. During this time, the fetal brain undergoes profound structural changes. Interpretation of appropriate development might require comparison with normal age-based models. Consultation of a hard-copy atlas is limited by the inability to compare multiple ages simultaneously. To provide images of normal fetal brains from weeks 18 through 37 in a digital format that can be reviewed interactively. This will facilitate recognition of abnormal brain development. T2-W images for the atlas were obtained from fetal MR studies of normal brains scanned for other indications from 2005 to 2007. Images were oriented in standard axial, coronal and sagittal projections, with laterality established by situs. Gestational age was determined by last menstrual period, earliest US measurements and sonogram performed on the same day as the MR. The software program used for viewing the atlas, written in C#, permits linked scrolling and resizing the images. Simultaneous comparison of varying gestational ages is permissible. Fetal brain images across gestational ages 18 to 37 weeks are provided as an interactive digital atlas and are available for free download from http://radiology.seattlechildrens.org/teaching/fetal_brain . Improved interpretation of fetal brain abnormalities can be facilitated by the use of digital atlas cataloging of the normal changes throughout fetal development. Here we provide a description of the atlas and a discussion of normal fetal brain development.

  13. ANALISIS SENTIMENT PADA SOSIAL MEDIA TWITTER MENGGUNAKAN NAIVE BAYES CLASSIFIER TERHADAP KATA KUNCI “KURIKULUM 2013”

    Directory of Open Access Journals (Sweden)

    Dyarsa Singgih Pamungkas

    2015-11-01

    Full Text Available Twitter salah satu situs sosial media yang memungkinkan penggunanya untuk menulis tentang berbagai hal yang terjadi dalam sehari-hari. Banyak pengguna mentweet sebuah produk atau layanan yang mereka gunakan. Tweet tersebut dapat digunakan sebagai sumber data untuk menilai sentimen pada Twitter. Pengguna sering menggunakan singkatan kata dan ejaan kata yang salah, dimana dapat menyulitkan fitur yang diambil serta mengurangi ketepatan klasifikasi. Dalam penelitian ini menggunakan Twitter Search API untuk mengambil data dari twitter, penulis menerapkan proses n-gram karakter untuk seleksi fitur serta menggunakan algoritma Naive Bayes Classifier untuk mengklasifikasi sentimen secara otomatis. Penulis menggunakan 3300 data tweet tentang sentimen kepada kata kunci “kurikulum 2013”. Data tersebut diklasifikasi secara manual dan dibagi kedalam masing-masing 1000 data untuk sentimen positif, negatif dan netral. Untuk proses latih di gunakan 3000 data tweet dan 1000 tweet tiap kategori sentimentnya. Hasil penelitian ini menghasilkan sebuah sistem yang dapat mengklasifikasi sentimen secara otomatis dengan hasil pengujian 3000 data latih dan 100 tweet data ujicoba mencapai 91 %. Kata kunci : Twitter, Twitter Search API, sosial media, tweet, analisis sentimen, sentimen, N-gram, Naive Bayes Classifier.

  14. Hubungan Kekerabatan Sapi Aceh dengan Menggunakan Daerah Displacement-loop

    Directory of Open Access Journals (Sweden)

    Mohd. Agus Nashri Abdullah

    2008-10-01

    Full Text Available Relationship of aceh cattle using displacement-loop region ABSTRACT. The aims of this study were to describe relationship of D-loop of mtDNA Aceh cattle which is useful database for conducting conservation programme. The whole blood samples were collected (8 samples for D-loop analysis from four locations which were Aceh Besar, Pidie, North Aceh regencies and Banda Aceh city. Out group whole blood samples were collected from two samples from Bali cattles (Bali Island, Madura cattle (Madura Island, Pesisir cattle (West Sumatera respectively and one sample from PO cattle (West Java. Amplification of D-loop sequences of mtDNA with BIDLF and BIDLR primary have PCR product 980 bp. The Data were analyzed using Squint 1.02 and MEGA 4.0 programme. Result of analysis indicate that Aceh cattle have nearer relationship with zebu and there is items inset of genetik Bali cattle (Bos javanicus at the end sequences start ke-354 situs up to 483, so that the origin Aceh cattle was from Bos indicus which have hybridization with Bos javanicus.

  15. Digital atlas of fetal brain MRI

    Energy Technology Data Exchange (ETDEWEB)

    Chapman, Teresa; Weinberger, E. [Department of Radiology, Seattle Children' s Hospital, Seattle, WA (United States); Matesan, Manuela [University of Washington, Department of Radiology, Seattle, WA (United States); Bulas, Dorothy I. [Division of Diagnostic Imaging and Radiology, Children' s National Medical Center, Washington, DC (United States)

    2010-02-15

    Fetal MRI can be performed in the second and third trimesters. During this time, the fetal brain undergoes profound structural changes. Interpretation of appropriate development might require comparison with normal age-based models. Consultation of a hard-copy atlas is limited by the inability to compare multiple ages simultaneously. To provide images of normal fetal brains from weeks 18 through 37 in a digital format that can be reviewed interactively. This will facilitate recognition of abnormal brain development. T2-W images for the atlas were obtained from fetal MR studies of normal brains scanned for other indications from 2005 to 2007. Images were oriented in standard axial, coronal and sagittal projections, with laterality established by situs. Gestational age was determined by last menstrual period, earliest US measurements and sonogram performed on the same day as the MR. The software program used for viewing the atlas, written in C, permits linked scrolling and resizing the images. Simultaneous comparison of varying gestational ages is permissible. Fetal brain images across gestational ages 18 to 37 weeks are provided as an interactive digital atlas and are available for free download. Improved interpretation of fetal brain abnormalities can be facilitated by the use of digital atlas cataloging of the normal changes throughout fetal development. Here we provide a description of the atlas and a discussion of normal fetal brain development. (orig.)

  16. Penerapan Metode UCD (User Centered Design Pada E-Commerce Putri Intan Shop Berbasis Web

    Directory of Open Access Journals (Sweden)

    Intan Sandra Yatana Saputri

    2017-09-01

    Full Text Available Pertumbuhan pesat pangsa pasar e-commerce di Indonesia memang sudah tidak bisa diragukan lagi. Dengan jumlah pengguna internet yang mencapai angka 82 juta orang atau sekitar 30% dari total penduduk di Indonesia, pasar e-commerce menjadi tambang emas yang sangat menggoda bagi sebagian orang yang bisa melihat potensi ke depannya. Pertumbuhan ini didukung dengan data yang menyebutkan bahwa nilai transaksi e-commerce pada tahun 2013 mencapai angka Rp130 triliun.. Ada banyak e-commerce yang sukses mendapatkan keuntungan, ada juga yang tidak. Menurut penelitian yang dilakukan oleh User Interface Engineering, Inc. diketahui 59% waktu terbuang karena orang tidak bisa menemukan informasi yang ingin didapat dan hal ini berdampak pada penurunan produktifitas dan meningkatkan frustasi. Sebuah laporan menunjukkan bahwa 39% dari pembeli tes dan gagal dalam upaya pembelian mereka karena navigasi pada situs yang sulit. Untuk membuat sebuah e-commerce yang user-friendly dengan tingkat usability yang tinggi pada e-commerce tersebut, salah satu solusinya melakukan pengembangan e-commerce menggunakan metode User Centered Design (UCD. Sistem yang telah dibangun dengan menerapkan metode UCD ini mendapatkan hasil 98.3% menyatakan akan berbelanja di e-commerce Putri Intan Shop.

  17. A Case of Multiple Cardiovascular and Tracheal Anomalies Presented with Wolff-Parkinson-White Syndrome in a Middle-aged Adult.

    Science.gov (United States)

    Shi, Hyejin; Sohn, Sungmin; Wang, SungHo; Park, Sungrock; Lee, SangKi; Kim, Song Yi; Jeong, Sun Young; Kim, Changhwan

    2017-12-01

    Congenital cardiovascular anomalies, such as dextrocardia, persistent left superior vena cava (SVC), and pulmonary artery (PA) sling, are rare disorders. These congenital anomalies can occur alone, or coincide with other congenital malformations. In the majority of cases, congenital anomalies are detected early in life by certain signs and symptoms. A 56-year-old man with no previous medical history was admitted due to recurrent wide QRS complex tachycardia with hemodynamic collapse. A chest radiograph showed dextrocardia. After synchronized cardioversion, an electrocardiogram revealed Wolff-Parkinson-White (WPW) syndrome. Persistent left SVC, PA sling, and right tracheal bronchus were also detected by a chest computed tomography (CT) scan. He was diagnosed with paroxysmal supraventricular tachycardia (PSVT) associated with WPW syndrome, and underwent radiofrequency ablation. We reported the first case of situs solitus dextrocardia coexisting with persistent left SVC, PA sling and right tracheal bronchus presented with WPW and PSVT in a middle-aged adult. In patients with a cardiovascular anomaly, clinicians should consider thorough evaluation of possibly combined cardiovascular and airway malformations and cardiac dysrhythmia. © 2017 The Korean Academy of Medical Sciences.

  18. „3D-augmented-reality“-Visualisierung für die navigierte Osteosynthese von Beckenfrakturen

    Science.gov (United States)

    Befrui, N.; Fischer, M.; Fuerst, B.; Lee, S.-C.; Fotouhi, J.; Weidert, S.; Johnson, A.; Euler, E.; Osgood, G.; Navab, N.; Böcker, W.

    2018-01-01

    Zusammenfassung Hintergrund Trotz großer Fortschritte in der Entwicklung der Hard- und Software von Navigationssystemen finden diese aufgrund ihrer vermeintlichen Komplexität, umständlichen Integration in klinische Arbeitsabläufe und fraglichen Vorteilen gegenüber konventionellen bildgebenden Verfahren bisher wenig Einsatz in den heutigen Operationssälen. Ziel der Arbeit Entwicklung einer „Augmented-reality“(AR)-Darstellung zur chirurgischen Navigation ohne Infrarot(„IR“)-Tracking-Marker und Vergleich zum konventioneller Röntgen in einem simulierten Eingriff. Material und Methoden Navigationssystem bestehend aus „Cone-beam-CT“(CBCT)-fähigem C-Bogen und „Red-green-blue-depth“(RGBD)-Kamera. Testung durch Kirschner(K)-Draht-Platzierung in Modellen unter Berücksichtigung der benötigten Zeit, der Strahlendosis und der Benutzerfreundlichkeit der Systeme. Ergebnisse Eine signifikante Reduktion der benötigten Zeit, der Röntgenbilder und der gesamten Strahlendosis bei der AR-Navigation gegenüber dem konventionellen Röntgen bei gleichbleibender Präzision. Schlussfolgerung Die AR-Navigation mithilfe der RGBD-Kamera bietet flexible und intuitive Darstellungsmöglichkeiten des Operations-situs für navigierte Osteosynthesen ohne Tracking-Marker. Hiermit ist es möglich, Operationen schneller, einfacher und mit geringerer Strahlenbelastung für Patient und OP-Personal durchzuführen. PMID:29500506

  19. Exclusive double outlet right ventricle with atrioventricular concordance and pulmonary stenosis. Results of reconstructive surgery.

    Science.gov (United States)

    Busquet, J; Fontan, F; Choussat, A; Caianiello, G; Fernandez, G

    1988-01-01

    Double outlet right ventricle associated with atrioventricular concordance, pulmonary stenosis and situs solitus of the atria is a subset of double outlet right ventricle related through the surgical treatment. From 1974 to 1985, 14 patients, 5 males, 9 females (mean age 8.9 years, range 13 months-22 years) were operated upon. All patients had infundibular stenosis and normal or large pulmonary arteries. The apex of the heart was to the right in 2 patients, the right and left ventricles were superior and inferior in 2 patients and 1 patient had both anomalies. The ventricular septal defect was subaortic in 11 patients (aorto-mitral discontinuity in 5) and non-committed in 3 patients. Three patients had 2 ventricular septal defects. The aorta was anterior in 3 patients and to the right of the pulmonary artery in 11 patients. All patients, through a transventricular and transatrial approach, had a reconstructive surgery. In 3 patients, an aortic homograft valved conduit was used. One patient had the ventricular septal defect enlarged. There was one early death (7.1%) from high residual right ventricle pressure and no late death. One patient had a transient atrioventricular block. One patient was reoperated upon for a residual ventricular septal defect. All survivors had a good clinical result. Re-evaluation in 8 patients confirmed excellent haemodynamics: the right ventricle to pulmonary artery pressure gradient decreased from 80 mm Hg (range 60-95) preoperatively to 24 mm Hg (range 3-32) postoperatively.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Experimental study of 103Pd stents for preventing the restenosis of biliary duct

    International Nuclear Information System (INIS)

    Gao Qinyi; Shu Qiang; Lu Xiangdong; Li Yaming; He Guijin; Pei Zhuguo; Xu Shuhe

    2004-01-01

    Objective: To explore the feasibility of preventing biliary duct restenosis with the stent treated with 103 Pd and to elucidate the mechanisms of the inhibition of the smooth muscle cell proliferation and the increase of apoptosis. Methods: The experimental dogs were randomly divided into common-stent group and 103 Pd stent group, each of 6 animals. Pathohistology, cell apoptosis, immunohistochemistry for proliferating cell nuclear antigen (PCNA), the expression of gene p53 by in situs hybridization, the test of the peripheral blood and measurement of radiation of tissue around the stent were studied. Results: The utmost intimal thickness of biliary duct in the 103 Pd stent group was found to be obviously less compared to that in common-stent group after 30 d, the percentages of the stenosis of the biliary duct were (54.73 ± 21.64)% and (17.61 ± 14.52)%, respectively, there was a significant difference between two groups (P 103 Pd stent group, and decreased in the common-stent group; the expression of PCNA of biliary smooth muscle cells of 103 Pd group was weaker compared with that in the common-group. Conclusion: 103 Pd stent may inhibit the proliferation of smooth muscle cells and prevent the restenosis of biliary duct. (authors)

  1. A dosimetric comparison of IORT techniques in limited-stage breast cancer

    International Nuclear Information System (INIS)

    Nairz, O.; Deutschmann, H.; Kopp, M.; Wurstbauer, K.; Kametriser, G.; Fastner, G.; Merz, F.; Sedlmayer, F.; Reitsamer, R.; Menzel, C.

    2006-01-01

    Background and purpose: for intraoperative radiotherapy (IORT) during breast-conserving treatment four different techniques have been addressed: interstitial brachytherapy, an inflatable balloon with a central high-dose-rate source (MammoSite), a miniature orthovolt system (Intrabeam), and linac-based electron radiotherapy (IOERT). The dosimetric properties of these methods are compared. Material and methods: planning target volumes (PTVs) of the same size but of different shapes are assumed, corresponding to the technique's specific situs. Dose distributions for the PTVs and for surrounding tissues are demonstrated by dose-volume histograms and a list of physical parameters. A dose inhomogeneity index (DII) is introduced to describe the deviation of a delivered from the prescribed dose, reaching its minimal value 0 in case of perfect homogeneity. Results: in terms of DII, IOERT reaches the lowest value followed by the MammoSite, the Intrabeam and interstitial implants. The surrounding tissues receive the smallest average dose with IOERT, closely followed by the orthovolt system. Conclusion: when comparing simplified geometric figures, IOERT delivers the most homogeneous dose distributions. However, in clinical reality PTVs often present asymmetric shapes instead of ideal geometries. Due to a strictly centric dose fall-off, any system with a round central applicator will have technical limits. During IOERT margin-directed applicator guidance is possible and interstitial brachytherapy allows for polygonal dose shaping. These techniques seem to be superior for asymmetric PTV irradiation. (orig.)

  2. Primary ciliary dyskinesia: a report from ATS 2001, May 18–23, San Francisco

    Directory of Open Access Journals (Sweden)

    Noone Peadar G

    2001-06-01

    Full Text Available Abstract Primary ciliary dyskinesia (PCD is a genetic disorder of abnormal ciliary structure and function that leads to defective mucociliary clearance, resulting in oto-sino-pulmonary disease, and infertility. The disease is currently under intense investigation by a number of research groups worldwide. At the recent American Thoracic Society meeting in San Francisco in May 2001, two sessions focused on PCD; a symposium session on May 21 with several featured expert speakers was followed by a mini-symposium on Tuesday May 22, with one featured speaker and presentation of nine abstracts covering a range of research topics. Mattias Salathe (University of Miami, USA and Stephen Brody (Washington University, St Louis, USA chaired the symposium session. Presentations focused on the clinical spectrum of PCD, the genetics of PCD, a proteomics approach to detail the structure of cilia, the role of cilia in the embryology of situs laterality, and airway epithelial cell biology. The mini-symposium was chaired by Peadar Noone (University of North Carolina, USA and Malcolm King (University of Alberta, USA and included presentations on the use of PCD as a human disease model, accurate definition of the phenotype using clinical and cell biologic markers, and molecular studies. The latter reports ranged from isolation of a protein involved in ciliary structure and function to genetic studies using linkage analysis and the candidate gene approach. Clinicians and scientists alike displayed considerable interest at both sessions, and there were several lively question–answer sessions.

  3. MENIMBANG KONVENSI INTERNASIONAL NO. 11806 UNTUK PENGELOLAAN SUMBERDAYA BUDAYA DI INDONESIA Considering International Convention No. 11806 for Cultural Resource Management in Indonesia

    Directory of Open Access Journals (Sweden)

    Sarjiyanto Sarjiyanto

    2016-07-01

    Abstrak Tulisan ini didasarkan pada rasa keprihatinan akan berlangsungnya berbagai kasus hilangnya benda cagar budaya baik yang ada di situs maupun yang tersimpan di museum yang ada di Indonesia. Banyak pihak yang meyakini bahwa benda-benda warisan leluhur tersebut banyak berpindah tangan ke wilayah luar Indonesia baik di Asia maupun Eropa. Undang-undang tentang perlindungan cagar budaya yang ada sepertinya tidak mampu mencegah atau menangani bahkan mengembalikan benda-benda yang sudah dibawa ke luar negeri, yang berujung pada penyalahan atas minimnya anggaran, peralatan, sumber daya manusia dan sebagainya. Oleh karena itu, perlu dikaji aspek perundangan lain seperti konvensi internasional, yang mungkin dapat diadopsi pasal-pasalnya untuk memperkuat perundangan yang ada di Indonesia. Perlu juga diperhatikan perundangan lain yang terkait termasuk mendorong masuknya pasal tentang pelanggaran BCB dalam Kitab Undang-Undang Hukum Pidana yang pernah diwacanakan untuk diamandemen. Penjabaran secara lebih detail dari pasal yang ada dalam Undang-Undang Tentang Cagar Budaya melalui peraturan di tingkat bawahnya menyesuaikan dengan situasi terkini juga perlu diselesaikan segera.   Kata Kunci: konvensi internasional, cagar budaya, produk perundang-undangan, situasi nasional dan internasional

  4. 1993 recreational vehicle (RV) park census in Beatty and Pahrump, Nevada

    International Nuclear Information System (INIS)

    Levy, L.E.; Housel, M.D.

    1994-01-01

    This paper reports on the second annual study of seasonal nonpermanent residents in the towns of Beatty and Pahrump in southern Nye County, Nevada, situs county of the Yucca Mountain Site Characterization Project. The study used a census of recreational vehicle (RV) park managers to enumerate and characterize in demographic terms nonpermanent residents staying in RV parks. The questionnaire sought information from RV park managers which ordinarily would come from a household survey. The main objective was to study open-quotes snowbirdsclose quotes, the households of older couples who stay for a month or more each winter. The findings suggest that snowbirds are a majority of the seasonal influx of nonpermanent residents to RV parks in Pahrump. In contrast, a group called open-quotes seasonal travelersclose quotes, similar demographically but who stay less than a month, dominate the seasonal nonpermanent population in Beatty's RV parks. The study also tentatively identified the seasonality of nonpermanent resident occupancy. Because only RV parks were contacted, the study left unanswered the question of how many snowbirds live in other types of accommodations in Beatty and Pahrump

  5. Ultra-high frequency ultrasound biomicroscopy and high throughput cardiovascular phenotyping in a large scale mouse mutagenesis screen

    Science.gov (United States)

    Liu, Xiaoqin; Francis, Richard; Tobita, Kimimasa; Kim, Andy; Leatherbury, Linda; Lo, Cecilia W.

    2013-02-01

    Ultrasound biomicroscopy (UBM) is ideally suited for phenotyping fetal mice for congenital heart disease (CHD), as imaging can be carried out noninvasively to provide both hemodynamic and structural information essential for CHD diagnosis. Using the UBM (Vevo 2100; 40Hz) in conjunction with the clinical ultrasound system (Acuson Sequioa C512; 15Hz), we developed a two-step screening protocol to scan thousands fetuses derived from ENU mutagenized pedigrees. A wide spectrum of CHD was detected by the UBM, which were subsequently confirmed with follow-up necropsy and histopathology examination with episcopic fluorescence image capture. CHD observed included outflow anomalies, left/right heart obstructive lesions, septal/valvular defects and cardiac situs anomalies. Meanwhile, various extracardiac defects were found, such as polydactyly, craniofacial defects, exencephaly, omphalocele-cleft palate, most of which were associated with cardiac defects. Our analyses showed the UBM was better at assessing cardiac structure and blood flow profiles, while conventional ultrasound allowed higher throughput low-resolution screening. Our study showed the integration of conventional clinical ultrasound imaging with the UBM for fetal mouse cardiovascular phenotyping can maximize the detection and recovery of CHD mutants.

  6. Apparent X-linked primary ciliary dyskinesia associated with retinitis pigmentosa and a hearing loss.

    Science.gov (United States)

    Krawczyński, Maciej R; Dmeńska, Hanna; Witt, Michał

    2004-01-01

    Three brothers, one 10-year-old and a pair of 14-year-old dizygotic twins--expressed the classical, early-onset retinitis pigmentosa (RP) with typical ophthalmoscopic findings, night blindness, visual field constricted to 10 degrees and flat ERG response. All three brothers were also diagnosed with primary ciliary dyskinesia (PCD) and had recurrent respiratory infections, chronic sinusitis and bronchiectasis. In all of them, resection of the middle lobe of the right lung was performed. A similar clinical picture of coexisting RP and PCD was noted in the brother of the probands' mother. All probands displayed situs solitus. Consistent with the X-linked mode of RP inheritance, there were also three obligatory female carriers of the disorder in this family: the mother of the affected boys, her mother and a daughter of her brother. In all of them, retinitis pigmentosa "sine pigmento" was found with milder but clinically significant symptoms (mild night blindness, visual field constricted to 30 degrees, and scotopic and photopic ERG responses reduced to 30-60%). No extraocular symptoms were detected in any of the heterozygous female carriers. This family presents an example of two rare phenomena: X-linked dominant retinitis pigmentosa (with milder expression in females) and a rare combination of RP with recurrent respiratory infections due to PCD.

  7. SISTEM INFORMASI UJIAN BERBASIS WEB SERVER SMK BINA ISLAM MANDIRI (BISMA KERSANA BREBES TEGAL

    Directory of Open Access Journals (Sweden)

    M. Rifqi Tsani

    2016-09-01

    Full Text Available Seiring dengan berkembangnya kemajuan teknologi informasi, mungkin akan sangat terbantu dengan adanya internet. Dengan internet, kita akan mudah menghadirkan layanan yang dapat diakses dari manapun dan kapanpun di dunia ini. Saat ini hampir setiap orang melakukan pengaksesan informasi, salah satunya dengan situs website. SMK BISMA Kersana merupakan sekolah swasta yang cukup terkenal di daerah Kersana. Dalam tiap tahunnya selalu mengalami kesulitan dalam menyajikan soal-soal yang akan diberikan kepada murid-muridnya. Begitu juga dalam melakukan sistem pengolahan nilai, pada SMK BISMA Kersana masih begitu sederhana sehingga memerlukan waktu yang lama. Untuk mengatasi masalah tersebut, maka diperlukan suatu sistem yang terkomputerisasi untuk mendukung kemajuan dan perkembangan sekolah tersebut. Maka dirancanglah sistem ujian online dan penilaian siswa berbasis web server. Dimana para guru langsung mengolah soal-soal ujian siswa. Begitu juga para siswa setelah melakukan ujian akan bisa langsung melihat hasil ujiannya. Dalam pembuatan sistem informasi ujian berbasis web server ini metode perancangan yang digunakan adalah ADDIE (Analysis, Design, Development or Production, Implementation or Delivery and Evaluations. Dengan menggunakan sistem informasi berbasis web server ini dapat membantu guru dalam memberikan nilai pada anak didiknya yang telah melaksanakn ujian di karenakan sistem ini langsung memberikan hasil berupa nilai ujian setelah siswa melaksanakan ujian.

  8. PENGARUH INTERNET DALAM PENGEMBANGAN BAHASA DAN BUDAYA DI KALANGAN REMAJA KOTA PADANG

    Directory of Open Access Journals (Sweden)

    Lilimiwirdi Lilimiwirdi

    2016-10-01

    Full Text Available Penggunaan internet di kalangan remaja berpengaruh terhadap bahasa dan budayanya. Dia menggunakan internet untuk berbagai ranah kehidupan. Metode yang digunakan adalah metode simak. Pengambilan data dilakukan dengan penyimakan data bahasa yang dituturkan oleh remaja dan disesuaikan dengan data yang ditampilkan oleh internet. Hasilnya, yaitu banyaknya kosakata di bidang komputer dalam bahasa Inggris yang masuk ke dalam bahasa Indonesia, baik dalam bentuk pemungutan, penyesuaian atau adaptasi, dan pengambilan secara lansung atau adopsi. Bahkan, remaja ini lebih kenal istilah dalam bahasa Inggris daripada bahasa Indonesia karena istilah dalam bidang komputer dan internet yang mereka gunakan masih dalam bahasa Inggris. Melalui internet, juga terbangun kemampuan berbahasa Indonesia dengan baik karena meningkatnya budaya menulis atau mengetik, membaca, bercerita, dan mengekspos diri. Dengan adanya peningkatan budaya tadi, lahirlah bahasa-bahasa gaul di kalangan netizen atau remaja. Keberadaan internet ini juga membangun budaya, baik positif maupun negatif. Budaya positifnya adalah menulis atau mengetik, membaca, mencari informasi dengan secara cepat, belajar secara online, berkirim surat secara online, tes online, adanya situs pemerintahan secara online, berbelanja online, toko online, budaya pertemanan, mengekspos diri, dan sebagainya. Kemudian, ada juga budaya negatif, seperti budaya kriminal, menimbulkan kecanduan ketika bermain game, membuka video porno, membuka facebook orang, mengurangi produktivitas, merusak otak, sulit tidur, kurangnya berinteraksi dengan lingkungan, dan sebagainya.

  9. Kajian Algoritma Sequential Pattern Mining Dan Market Basket Analysis Dalam Pengenalan Pola Belanja Customer Untuk Layout Toko

    Directory of Open Access Journals (Sweden)

    Rusito Rusito

    2016-01-01

    Full Text Available Penelitian ini membahas tentang keterkaitan antar item yang dibeli oleh customer dalam toko ritel. Pengetahuan keterkaitan item yang dibeli dapat digunakan untuk  menentukan tata letak barang dagangan toko ritel. Hal ini penting agar konsumen dapat mudah mendapatkan barang yang dibutuhkan. Sehingga dapat meningkatkan omzet penjualan toko ritel sehingga akhirnya menambah keuntungan bagi pemilik toko ritel. Teknik yang digunakan untuk menyelesaikan penggalian data dan keterkaitan pembelian tersebut menggunakan pendekatan Association rule dan Market Basket Analysis. Sedangkan untuk mencari keterkaitan item tersebut digunakan algoritma Sequential Pattern Mining. Digunakan karena mampu menangani jumlah database yang besar dan sangat baik disisi kecepatan pemrosesan. Berbagai aplikasi telah diidentifikasi, termasuk misalnya, cross-selling, analisis situs Web, pendukung keputusan, evaluasi kredit, acara prediksi kriminal, analisis perilaku pelanggan  dan deteksi penipuan. Dari penelitian yang telah dilakukan diperoleh  pola-pola belanja customer untuk membentuk suatu layout display dalam toko ritel. Penelitian ini juga menyajikan suatu kerja algoritma yang lebih efektif dari algoritma asli karena terdapat pembatasan perulangan. Untuk kombinasi maksimal 5 item dengan waktu eksekusi 421.06 detik untuk 200 nota.   Kata kunci : Data Mining, Algoritma Sequential Pattern Mining, Market Basket Analysis, Apriori, Layout, Toko Ritel

  10. PERANCANGAN DAN IMPLEMENTASI PAPERLESS OFFICE BERBASIS WORDPRESS DI ITTC UAD

    Directory of Open Access Journals (Sweden)

    Kartika Firdausy

    2012-04-01

    Full Text Available Perlu dilakukan satu upaya untuk mengurangi limbah kertas yang dihasilkan oleh perkantoran. Era kemajuan teknologi informasi dan komunikasi memiliki peluang dikembangkannya komunikasi secara online melalui jaringan komputer, sehingga dapat mengurangi penggunaan kertas untuk surat menyurat dan pembuatan dokumen. Untuk keperluan administrasi perkantoran dapat dilakukan dengan cara menerapkan paperless office system. Tujuan penelitian ini adalah merancang suatu sistem paperless office berbasis WordPress yang dapat diterapkan dalam lingkup perkantoran, khususnya di ITTC UAD. Penelitian ini mengambil subjek tentang sistem pengelolaan dokumen elektronik berbasis WordPress yang menyediakan sarana pengelolaan dokumen dalam format digital, sehingga diharapkan dapat mengurangi pemakaian kertas. Beberapa plug in ditambahkan seperti themes, bookmark, dan pengamanan pada situs, yaitu: Post Protect Quiet, dan Password Protect WordPress Blog. Selain admin, ada beberapa level user yang memiliki wewenang yang berbeda-beda pada sistem ini, yaitu: author, editor, dan contributor. Dokumen digital yang dikelola dalam sistem ini adalah surat-menyurat, informasi pelatihan, tutorial, dan Surat Keputusan (SK, yang dapat didistribusikan melalui media e-mail maupun jejaring sosial. Sistem diuji untuk setiap level user. Hasil pengujian menunjukkan bahwa semua fitur/menu pada sistem dapat berjalan dengan baik. Hasil rata-rata persentase dari pengujian diperoleh responden yang menyatakan sangat setuju = 26,5%, setuju = 71%, kurang setuju = 2,5%, dan tidak setuju = 0%.

  11. WHAT ARE THE CHALLENGES OF INCREASING THE SUSTAINABILITY OF URBAN LIVELIHOODS?

    Directory of Open Access Journals (Sweden)

    Neil Whittingham

    2009-01-01

    Full Text Available AbstraCT. This article places the challenge of rapid urbanisation throughout the world into a perspective that acknowledges inequalities due to economic history. As well as a brief exploration of the site-specific nature of challenges faced, this article seeks to outline the economic and structural obstacles that act as a backdrop to the lives of the poor. Such a perspective can inform attempts to improve the lot of the poor and help in outlining the moral obligation for the powerful to help the poor and vulnerable face up to the issue of Climate Change.   Key words: Urbanisation, economic disadvantage, planning, sustainable urban management     AbstraK. Tulisan ini menempatkan tantangan dari urbanisasi yang sangat cepat di seluruh dunia ke dalam perspektif yang diketahui tidak sejajar dengan sejarah ekonomi. Seperti halnya dengan eksplorasi sepintas dari situs khusus alam dari tantangan yang dihadapi, tulisan ini mencoba untuk melihat halangan ekonomi dan struktural bagi masyarakat menengah bawah. Perspektif seperti itu  dapat  menjadi sebuah informasi untuk meningkatkan taraf hidup masyarkat miskin dan membantu dalam merumuskan obligasi moral bagi penguasa. Hal ini tentunya dapat membantu masyarakat miskin dalam menghadapi isu-isu perubahan iklim.   Kata Kunci: Urbanisasi, kerugian ekonomi, perencanaan, keberlanjutan manajemen perkotaan

  12. New U-Pb zircon ages and the duration and division of Devonian time

    Science.gov (United States)

    Tucker, R.D.; Bradley, D.C.; Ver Straeten, C.A.; Harris, A.G.; Ebert, J.R.; McCutcheon, S.R.

    1998-01-01

    Newly determined U-Pb zircon ages of volcanic ashes closely tied to biostratigraphic zones are used to revise the Devonian time-scale. They are: 1) 417.6 ?? 1.0 Ma for an ash within the conodont zone of Icriodus woschmidti/I. w. hesperius Lochkovian); 2) 408.3 ?? 1.9 Ma for an ash of early Emsian age correlated with the conodont zones of Po. dehiscens--Lower Po. inversus; 3) 391.4 ?? 1.8 Ma for an ash within the Po. c. costatus Zone and probably within the upper half of the zone (Eifelian); and 4) 381.1 ?? 1.3 Ma for an ash within the range of the Frasnian conodont Palmatolepis punctata (Pa. punctata Zone to Upper Pa. hassi Zone). U-Pb zircon ages for two rhyolites bracketing a palyniferous bed of the pusillites-lepidophyta spore zone, are dated at 363.8 ?? 2.2 Ma and 363 ?? 2.2 Ma and 363.4 ?? 1.8 Ma, respectively, suggesting an age of ~363 Ma for a level within the late Famennian Pa. g. expansa Zone. These data, together with other published zircon ages, suggest that the base and top of the Devonian lie close to 418 Ma and 362 Ma, respectively, thus lengthening the period of ~20% over current estimates. We suggest that the duration of the Middle Devonian (Eifelian and Givitian) is rather brief, perhaps no longer than 11.5 Myr (394 Ma-382.5 Ma), and that the Emsian and Famennian are the longest stages in the period with estimated durations of ~15.5 Myr and 14.5 Myr, respectively.

  13. Lichen Planus Pigmentosus: The Controversial Consensus

    Science.gov (United States)

    Ghosh, Aparajita; Coondoo, Arijit

    2016-01-01

    A pigmented variant of lichen planus (LP) was first reported from India in 1974 by Bhutani et al. who coined the term LP pigmentosus (LPP) to give a descriptive nomenclature to it. LP has a number of variants, one of which is LPP. This disease has also later been reported from the Middle East, Latin America, Korea, and Japan, especially in people with darker skin. It has an insidious onset. Initially, small, black or brown macules appear on sun-exposed areas. They later merge to form large hyperpigmented patches. The disease principally affects the sun-exposed areas of the body such as the face, trunk, and upper extremities. The oral mucosa may rarely be involved. However, the palms, soles, and nails are not affected. Histologically, the epidermis is atrophic along with vacuolar degeneration of basal cell layer. The dermis exhibits incontinence of pigment with scattered melanophages and a sparse follicular or perivascular infiltrate. There is a considerable similarity in histopathological findings between LPP and erythema dyschromicum perstans. However, there are immunologic and clinical differences between the two. These observations have led to a controversy regarding the identity of the two entities. While some dermatologists consider them to be the same, others have opined that the two should be considered as distinctly different diseases. A number of associations such as hepatitis C virus infection, frontal fibrosing alopecia, acrokeratosis of Bazex and nephrotic syndrome have been reported with LPP. A rare variant, LPP inversus, with similar clinical and histopathological findings was reported in 2001. As opposed to LPP, this variant occurs in covered intertriginous locations such as groins and axillae and mostly affects white-skinned persons. PMID:27688435

  14. The Peculiarities of Territorial Distribution and Abundance of Birds of Prey in Kharkiv Region, Ukraine

    Directory of Open Access Journals (Sweden)

    Stanislav G. Viter

    2014-11-01

    Full Text Available This study investigates the features of the spatial distribution and abundance of birds of prey in the Kharkov region, Ukraine. Investigations were carried out in 2003–2013 years. Totaly we found 1569 nest sites of Falconiformes. There are 29 species of raptors in avifauna of Kharkiv region. Nine of them are wintering species and 16 – nesting. The highest number of nest sites we found in agricultural landscapes – 677 pairs. However, population density here is low, and high number of nest sites can be explained by large extension of this type of habitat. Also significant populations of birds of prey inhabit forest-steppe areas of Central Russian Upland (East European Plain – 468 pairs, steppe areas of Central Russian Upland – at least 279 pairs (notable that the size of steppe areas are 4 times smaller then forest-steppe areas, and gully forests on the spurs of Donets Ridge – 205 pairs (the size of this habitat in Kharkiv region is no more than 3 000 km2. The other habitats includes highlands in the forest-steppe zone covered with oak forests – 431 pairs, and floodplain forests in the valley of river Siverskyi Donets – 148 pairs (with rather small area of this habitat. These last two habitats are refuge for local populations of Booted Eagle (Hieraaetus pennata and Honey Buzzard (Pernis apivorus because these areas held the most stable nest sites and the highest density of these two species. The same could be said about gully forests on the spurs of Donets Ridge. The estimate number of breeding pairs of Falconiformes in gully forests is around 290 pairs. In this study, we also assessed the total number of breeding Birds of Prey in Kharkiv region. Here are our estimates: Honey Buzzard – 142–156 pairs, Black Kite (Milvus migrans – 133–148 pairs, White-Tailed Eagle (Haliaeetus albicilla – 26–28 pairs, Montagu’s Harrier (Circus pygargus – 174–191, Marsh Harrier (C. aeruginosus – 344–359, Northern Goshawk

  15. Localização encefálica da blastomicose sul-americana. Considerações a propósito de 9 casos

    Directory of Open Access Journals (Sweden)

    Walter C. Pereira

    1965-06-01

    Full Text Available Lesões encefálicas produzidas pelo Paracoccidioides brasiliensis têm sido registradas na literatura com relativa freqüência. Os autores chamam a atenção para a dificuldade diagnóstica dêstes processos que, na quase totali- dade, constituem-se de achados cirúrgicos ou de necropsia. A síndrome de hipertensão intracraniana é a manifestação mais comum, levando quase sempre ao diagnóstico de tumor intracraniano. Os exames complementares, inclusive o líquido cefalorraqueano, são pobres em dados específicos; o encontro do parasita, assim como a positividade das reações de fixação de complemento e de precipitação nesse humor, são raramente verificadas. A natureza da afecção só tem sido suspeitada quando existem lesões paracocci-dióicas conhecidas em outros órgãos. Nove casos de blastomicose sul-americana com localização encefálica são estudados. Sete foram submetidos a intervenções cirúrgicas, dêstes, 3 tiveram boa evolução, sendo os únicos que sobreviveram de tôda a série. Nos três casos foi empregada, em épocas diversas depois da intervenção cirúrgica, anfotericina B pelas vias intravenosa ou intratecal. Os autores consideram a excição cirúrgica dos granulomas encefálicos imprescindível, mormente quando existem sinais de compressão bem localizadas. Após o ato cirúrgico a administração de anfotericina B, pelas vias intravenosa ou intratecal, deve ser prescrita a fim de evitar possíveis recidivas da moléstia.

  16. Childhood alopecia areata: A study of 89 patients

    Directory of Open Access Journals (Sweden)

    Sibel Doğan

    2014-09-01

    Full Text Available Background and Design: Alopecia areata (AA is a frequent type of acquired hair loss with a sudden onset. The aim of this study was to investigate the epidemiological and clinical features of AA and diseases associated with AA in the Turkish pediatric population. Materials and Methods: We retrospectively evaluated the medical data of patients under 16 years of age who were admitted to the pediatric dermatology outpatient clinic at Hacettepe University Hospital between 2006 and 2011 with a diagnosis of AA, alopecia totalis (AT and alopecia universalis (AU. Results: A total of 89 patients (34 females and 55 males, were included in this study. The mean age of the subjects was 9.8±3.4 years (range: 18 months-16 years. 9% (n=8 patients had other autoimmune diseases: Hashimoto's thyroiditis in 5, vitiligo in 1, juvenile rheumatoid arthiritis (JRA in 1 and morphea in 1 patient. AA was located on the scalp in 86.5% (n=77 of the patients, 7.9% (n=7 of the patients had AA on the scalp together with eyelashes, eyebrows and the body. AT was noted in 1, AU was noted in 4 patients. Severity of hair loss was <25% in 94.3% (n=84 of the patients according to the involved area. Hashimoto's thyroiditis was diagnosed in 5 patients; these patients had normal thyroid function tests (TFT. TFT abnormalities were detected in 27% (n=24 of the patients. 24.7% (n=22 of these patients were diagnosed with clinically insignificant thyroid disorder, 2 patients had compansated hypothyroidism (n=2. Eight patients (9% patients were found to be positive for anti-thyroid peroxidase antibody (Anti-TPO ab. Antithyroglobulin antibody (Anti-TG Ab elevation was noted in 3.3% (n=3 and antinuclear antibody (ANA positivity was noted in 9% (n=8. Nail changes were detected in 12.3% (n=11 of the patients as leukonychia (n=2, longitudinal striation (n=2, trachyonychia (n=1, onychoschizia (n=1 and pitting (n=1. Conclusion: Childhood AA usually causes limited hair loss. TFT anomalies can

  17. Determination of Optimum Cross-section for Oran Highway Revetment

    Science.gov (United States)

    Velioglu, Deniz; Sogut, Erdinc; Guler, Isikhan

    2017-04-01

    Revetments are shore parallel, sloping coastal structures which are built to provide protection from the negative effects of the sea. The revetment mentioned in this study is located in the City of Oran, Algeria and is currently under construction. This study investigates the determination of the optimum revetment cross section for Oran highway, considering both the hydraulic stability of the revetment and economy. The existence of cliffs in the region and the settlement of the City of Oran created a necessity to re-align Oran highway; therefore, it was shifted towards the Gulf of Oran. Approximately 1 km of the highway is to be constructed on the Mediterranean Sea due to the new alignment. In order to protect the sea side of the road from the adverse effects of the sea, a revetment was designed. The proposed cross section had an armour layer composed of 23 tons of antifer units and regular placement of armour units was recommended. In order to check the hydraulic stability of the proposed section, physical model tests were performed in the laboratory of LEM (Laboratoire d'Etudes Maritimes) in Algeria, using the pre-determined design wave conditions. The physical model tests revealed that the trunk of the revetment was totaly damaged. Accordingly, the proposed section was found insufficient and certain modifications were required. The first modification was made in the arrangement of armour units, changing them from regular to irregular. After testing the new cross section, it was observed that the revetment was vulnerable to breaking wave attack due to the toe geometry and thus the toe of the revetment had to be re-shaped. Therefore, the second option was to reduce the toe elevation. It was observed that even though the revetment trunk was safe, the damage in the toe was not in acceptable limits. The new cross section was found insufficient and as the final option, the weight of the antifer units used in the armour layer was increased, the toe length of the

  18. Gli infortuni lavorativi in minori: risultati di uno studio multicentrico italiano

    Directory of Open Access Journals (Sweden)

    G. Aggazzotti

    2003-05-01

    Full Text Available

    Obiettivi: gli infortuni lavorativi, in particolare quelli subiti da minorenni, rappresentano un problema di notevole importanza sociale: in Italia, da dati INPS, risultano lavorare circa 68 adolescenti su 1000. L’obiettivo di questo studio è stato quello di raccogliere informazioni sugli infortuni lavorativi avvenuti a minori (14-17 anni in 14 città italiane nel periodo gennaio-giugno 2000. Metodi: si tratta di uno studio epidemiologico descrittivo, basato sulle informazioni raccolte consultando direttamente le cartelle cliniche presso centri di Pronto Soccorso (PS attivi nelle città coinvolte. Sono stati presi in considerazione tutti gli infortuni avvenuti a minori: tra questi sono stati considerati come lavorativi quelli accaduti nel corso di attività descritta come lavorativa e quelli occorsi “in itinere”. Le analisi statistiche sono state condotte con SPSS; è stata effettuata una cluster analysis per evidenziare eventuali sottogruppi omogenei. Risultati: la popolazione residente nelle aree indagate di età tra 14 e 17 anni è stata stimata in circa 850.000 soggetti, pari al 31% della popolazione italiana della stessa età: gli infortuni totali sono risultati 13423 di cui 317 lavorativi (2.4%. I soggetti di sesso maschile, diciassettenni, impiegati nel comparto industriale sono risultati il gruppo maggiormente coinvolto: la prognosi è risultata per lo più inferiore a 8 giorni. Sono apparse due diverse tipologie di infortunio: una riguarda i casi avvenuti in itinere, con caratteristiche molto simili agli incidenti stradali, e un’altra, più specifica, riguarda gli eventi sul posto di lavoro, dove si registrano lesioni al polso, alle mani, al capo e agli occhi con frequenza superiore rispetto agli infortuni in genere.

    Conclusioni: il fenomeno è risultato non trascurabile, soprattutto tenendo conto del fatto che si riferisce solamente al lavoro minorile regolarmente

  19. Retrospective evaluation of childhood alopecia areata cases

    Directory of Open Access Journals (Sweden)

    Munise Daye

    2013-09-01

    Full Text Available Background and design: Approximately 20% of alopecia areata (AA cases are children. There is limited information about childhood AA.We aimed to examine demographic features,treatments and diseases prognosis of child cases of AA that were followed in our clinic. Material and methods: Datas of 110 AA patients who are 16 and under 16 years old were examined retrospectively.The age,gender,disease onset age,duration of disease,types of AA and onset area,nail involvement, accompanying systemic and dermatological diseases,laboratory tests,treatments and the prognosis were evaluated in their follow-up time.Results: Female cases were 46,4%, male cases were 53,6%.The mean age was 10,35 years.The age of disease onset was 8,65 years.Primary onset areas of AA cases were scalp in 83,6%, eyebrows in 5,4%, body hair in 5,4%, eyelashes in 2,7%, eyebrows and eyelashes in 2,7%.Types of disease were AA in 73,4% cases,alopecia totalis in 19% cases, alopecia universalis in 5,4% cases,ophiaisis in 1,8% cases.Nail involvement was established in 36,3% cases. Nevus flammeus was established in 2,7% cases.Mean disease duration was 17,02 months.Accompaying dermatosis were vitiligo in 2,7% cases,atopic dermatitis in 6,3% cases. The accompaying systemic diseases were autoimmune thyroiditis in 1,8% cases and Down's Syndrome in 2,7% cases.Thyroid autoantibodies were high in 0,9% cases.We have treated 24,5% of cases with topical corticosteroid lotion, 30,9% of cases with anthralin, 0,9%of cases with 2% minoxidil lotion, 0,9% of cases with calcipotriol lotion, 1,8% of cases with topical calcineurin inhibitors, 10% of cases with intralesional corticosteroids.We have treated 15,4% of cases with systemic corticosteroids and PUVA therapy who were resistant to topical treatment.We have treated 14,5% of cases with different combinations of topical treatments.Remission was observed in 34,5% of cases.The mean remission duration was 12.2 months.Relapse was observed at a average of two

  20. Comparison of Indoie-aikafoids in Vinca major L, V. minor L. and Vinca herbacea L

    Directory of Open Access Journals (Sweden)

    Hassan Ebrahimzadeh

    1995-08-01

    Full Text Available Eleven main alkaloids was observed in the leaf of Vinca major, of these, eight is determined: Ajmaline,Vindo[ine, Catharantine, Serpentine, Vincamine, Vincristine, Ajmalicine and Vinblastine. The known main alkaloids formed totally 41.5% and the unknown main alkaloids about 50.6% of the total alkaloid. The amount of the total alkaloid was 2.3 mg per gr of the fresh weight. Vincamine which was not present in V.rosea, was seen in V.major (8.2%."nFurthermore, Vindoline, Catharantine and Serpentine had a lesser amount in V.major, in comparison with V.rosea, respectively 3.7%, 18.1% and 6.3%. The mentioned eight known alkaloids and nine unknown alkaloids was observed in the leaf of V.minor. The known main alkaloids formed totally 37.1% and the unknown main alkaloids about 56.4% of the total alkaloids. The amount of the total alkaloid was 0.5 mg per gr of the fresh weight.All of alkaloids had a lesser amount in V.major, in comparison with alkaloids of similar to itself. Vincamine had the most percent (16.1% and Vindoline (6.6% and Serpentine (7.8% were set after it."nIt was observed, in addition to mentioned eight known alkaloids, eight unknown alkaloids in the leaf of V. herbacea. The known main alkaloids formed totaly 52.5% and the unknown main alkaloids about 41.5% of the total alkaloid."nThe amount of the total alkaloid was 4.7 mg per gr of the fersh weight of the leaf. This amount is more than the amount which was observed in V.rosea (0.75, V.major (2,3, and V.minor (0.5.Vincamine had a high percent (39.8 and Serpentine a low percent (8.7. In short, V.herbacea is a good source for Vincamine and Serpentine, specially the last compound which easily is changed into Ajmalicine. V. rosea and V.major are a good source for Vindoline and Catharantine that can be used for providing Vinblastine and Vincristine.

  1. KONSERVASI SAUJANA BUDAYA KAWASAN BOROBUDUR - ZONASI ULANG DENGAN PENDEKATAN EKOSISTEM (Conservation of the Borobudur Cultural Landscape: Rezoning of area Management by Ecosystem Approach

    Directory of Open Access Journals (Sweden)

    Amiluhur Soeroso

    2007-11-01

    Full Text Available ABSTRAK Dalam banyak aspek, nilai saujana budaya Borubudur memiliki arti penting bagi masyarakat yang hidup di sekitamya. Namun demikian, sejak selesainya proyek restorasi, dan kemudian Candi Borobudur dijadikan sebagai pus aka dunia pada tabun 1991, saujana budayanya menghadapi berbagai konftik kepentingan yang disebabkan oleh ketidak-tepatan zonasi lama (karena hanya berorientasi kepada candi, monumen atau artifak sehingga menafikan ekosistem dan pengelolaan yang dilakukan oleh banyak institusi. Masalah ini mengakibatkan risiko degradasi kualitas saujana budaya (polusi fisik, visual dan kebudayaan yang berpengaruh terhadap eksistensi situs Borobudur di masa depan. Berkaitan dengan kelangkaan sumberdaya lingkungan yang dimilikinya, dibutuhkan studi mendalam dengan fokus mengkonsolidasikan dan melindungi integritas saujana budaya tersebut. Data zonasi ulang dengan tujuan untuk pengelolaan dilakukan dengan menampalkan peta-peta tematik berdasarkan pendekatan ekosistem. Hasilnya adalah: (1 zonasi konservasi Kawasan Borobudur dialokasikan menjadi empat bagi!ln (Mandala, (2 pentingnya konservasi pusaka sebaiknya dikomunikasikan melalui sarana pendidikan terhadap para pengguna dan menempatkan masyarakat di sekitamya sebagai titik penting dalam pengelolaan kawasan Borobudur. Dengan demikian, kelestarian Borobudur di masa depan tergantung pada kebijakan pembangunan yang berkelanjutan. Manajemen Kawasan Borobudur tidak dapat hanya fokus pada situs, material atau artifak semata tetap harus bergeser untuk memperhatikan ruang dan kawasan tempat manusia hidup.   ABSTRACT  The Borobudur cultural landscape values have conferred important meanings in many aspects for those who live in its surrounding neighborhood. Nevertheless, since the beginning of Borobudur restoration project and the acknowledgement of Borobudur Temple as the world's heritage in 1991, its cultural landscape is continually facing out of the ordinary kinds of conflicts caused by

  2. Karakter Geoarkeologis dan Proses Budaya Prasejarah Zona Poros Ponjong – Rongkop di Blok Tengah

    Directory of Open Access Journals (Sweden)

    Jarwo Susetyo Edy Yuwono

    2016-09-01

    Full Text Available ABSTRAK Penelitian ini dilakukan di Zona Poros Ponjong - Rongkop, yaitu bagian dari Blok Tengah Gunungsewu di Pegunungan Selatan Jawa, yang posisinya diapit oleh dua depresi bekas danau purba, yaitu Ledok Wonosari dan Ledok Baturetno. Morfologinya berupa punggungan perbukitan karst berarah utara-selatan antara daerah Ponjong dan Rong-kop, membentuk semacam poros hampir tegak lurus terhadap bentangan umum Gunungsewu. Bagian paling utara ber-batasan dengan pegunungan non-karst dan memiliki topografi tertinggi di Blok Tengah Gunungsewu, sehingga menjadi wilayah hulu bagi sungai-sungai bawahtanah di Gunungkidul. Melalui beberapa survei ditemukan sejumlah 56 gua yang memiliki potensi arkeologis, tujuh di antaranya sudah diekskavasi dan terbukti menyimpan jejak-jejak hunian prase-jarah dari Kala Pleistosen Akhir - Holosen Awal. Pendekatan geoarkeologis sebagai studi gabungan antara arkeologi dan geomorfologi, dilakukan untuk membangun model-model integral mengenai hubungan sistematik antara manusia dengan bentanglahan karst Gunungsewu di area penelitian. Dua hal yang menjadi tujuan utama penelitian ini adalah: Pertama, menjelaskan karakter geoarkeologis Zona Poros Ponjong - Rongkop sebagai perpaduan antara aspek-aspek geomorfologis (morfologi, morfogenesis, morfokronologi, dan morfoaransemen dan aspek-aspek arkeologis (distri-busi gua dan potensi arkeologisnya. Tujuan ini dicapai melalui penilaian dan pemetaan distribusi potensi gua sebagai situs arkeologis, kemudian menganalisis hubungannya dengan aspek-aspek geomorfologis setempat. Kedua, menjelas-kan proses budaya prasejarah, yaitu bentuk dinamis dari budaya penghunian gua beserta faktor-faktor yang mempen-garuhinya. Metode untuk mencapai tujuan ini adalah dengan menganalisis konteks data arkeologis dan stratigrafi lantai gua yang pernah diekskavasi. Sintesis kajian atas kedua capaian tujuan ini memberikan penjelasan integral atas karakter geoarkeologis dan proses budaya prasejarah di area

  3. 53. Bilateral ductal stenting for nonconfluent pulmonary arteries in a newborn

    Directory of Open Access Journals (Sweden)

    K. Al Dhahri

    2016-07-01

    Full Text Available Bilateral PDA dependent pulmonary circulation with right and left pulmonary artery discontinuity is very rare. Limited data available for bilateral PDA stenting. Bilateral PDA stenting in nonconfluent pulmonary arteries is challenging procedure but can be considered as an option in the management of complex conditions like this. 12 days old Preterm (36 weeks gestation male baby with birth weight of 2.6 kg developed respiratory distress with severe cyanosis and desaturation upto 50%. Baby was intubated and started on Prostaglandin 0.05 mic/kg/mt. His saturation improved to 80%. Echocardiogram showed complex cyanotic heart disease, Situs ambiguous, dextrocardia, complete unbalanced AV septal defect, pulmonary atresia , nonconfluent small branch pulmonary arteries supplied by the bilateral patent ductus arteriosus (PDA from right aortic arch and all four pulmonary veins form a confluence and drain into superior vena cava(SVC through vertical vein with no obstruction. Baby was taken up for PDA stenting. descending aortogram showed right aortic arch with vertical tortuous duct to right pulmonary artery (RPA and another short duct with acute angle from left subclavian artery to left pulmonary artery (LPA . Both ducti stented with coronary stents. Vertical vein angiogram showed both lungs drain to a confluence and then to SVC via ascending vertical vein with no obstruction. After stenting lung perfusion improved and the baby was stable and maintained 80% saturation on room air. Bilateral PDA dependent pulmonary circulation with right and left pulmonary artery discontinuity is very rare. Our case is unique with Heterotaxy, TAPVC, Dextrocardia and double ducti. Eventhough bilateral ductal stenting is technically challenging it is successful through femoral artery approach.

  4. Real-time monitoring for detection of retained surgical sponges and team motion in the surgical operation room using radio-frequency-identification (RFID) technology: a preclinical evaluation.

    Science.gov (United States)

    Kranzfelder, Michael; Zywitza, Dorit; Jell, Thomas; Schneider, Armin; Gillen, Sonja; Friess, Helmut; Feussner, Hubertus

    2012-06-15

    Technical progress in the surgical operating room (OR) increases constantly, facilitating the development of intelligent OR systems functioning as "safety backup" in the background of surgery. Precondition is comprehensive data retrieval to identify imminent risky situations and inaugurate adequate security mechanisms. Radio-frequency-identification (RFID) technology may have the potential to meet these demands. We set up a pilot study investigating feasibility and appliance reliability of a stationary RFID system for real-time surgical sponge monitoring (passive tagged sponges, position monitoring: mayo-stand/abdominal situs/waste bucket) and OR team tracking (active transponders, position monitoring: right/left side of OR table). In vitro: 20/20 sponges (100%) were detected on the mayo-stand and within the OR-phantom, however, real-time detection accuracy declined to 7/20 (33%) when the tags were moved simultaneously. All retained sponges were detected correctly. In vivo (animal): 7-10/10 sterilized sponges (70%-100%) were detected correctly within the abdominal cavity. OR-team: detection accuracy within the OR (surveillance antenna) and on both sides of the OR table (sector antenna) was 100%. Mean detection time for position change (left to right side and contrariwise) was 30-60 s. No transponder failure was noted. This is the first combined RFID system that has been developed for stationary use in the surgical OR. Preclinical evaluation revealed a reliable sponge tracking and correct detection of retained textiles (passive RFID) but also demonstrated feasibility of comprehensive data acquisition of team motion (active RFID). However, detection accuracy needs to be further improved before implementation into the surgical OR. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Koreografi Lingkungan’ Masyarakat Plempoh, Prambanan, Daerah Istimewa Yogyakarta

    Directory of Open Access Journals (Sweden)

    Hendro Martono

    2014-11-01

    Full Text Available Desa Plempoh, yang berada di wilayah Prambanan Daerah Istimewa Yogyakarta,diharapkan sebagai penyangga pariwisata situs purbakala candi Boko. Akan tetapi,kenyataannya desa yang terletak di lereng bukit Boko menjelang masuk area candi,tidak menampilkan wujud sebagaimana yang diharapkan. Untuk itu, penulisdan sekaligus koreografer menawarkan alternatif solusi yang dapat memenuhikepentingan masyarakat. Masyarakat diberdayakan dalam pelatihan seni tari,nyanyi, dan teater. Metode yang digunakan adalah ‘Koreografi Lingkungan’,yaitu sebuah proses kreatif bekerja bersama antara tim perancangan seni denganmasyarakat untuk mewujudkan sebuah tari rakyat yang mengangkat legendasetempat, yaitu Jonggrang. Koreografinya mengungkapkan kearifan lokal denganpendekatan masa kini dan menggunakan versi rakyat yang membedakannya dengansendratari Rara Jonggrang yang sudah seringkali ditampilkan selama ini. Environmental Choreography of Plempoh society, Prambanan, Yogyakarta.Plempoh village, located in the region of Prambanan Yogyakarta, is expected as a bufferof Boko temple archaeological tourism sites. However, the fact that the village is locatedon the hillside of the entrance of the temple area, does not display the form as it isexpected. Therefore, the writer, also a choreographer, offers an alternative solution to meetthe interests of the community. The people of this society were empowered by the trainingsof dancing, singing, and theater. The method used in the research was ‘EnvironmentalChoreography’ which was a creative process of group working between the design teamand the society to create a public art with a folk dance which raised the local legend,Jonggrang. The choreography revealed the local wisdom with the present approach, andused the version distinguishing people with Rara Jonggrang ballet that has often beenshown lately.

  6. Hemiazygos continuation of v.cava inferior: a case report

    International Nuclear Information System (INIS)

    Incedayi, M.; Aribal, S.; Sivrioglu, A.; Kara, K.

    2012-01-01

    Full text: A 78-year-old female patient was suffering from dyspnoea and tachypnoea in our hospital's orthopaedic clinic. Because she had an operation of right femoral mid-diaphizer fracture a week ago, we decided to perform a pulmonary computerized tomography angiography (CTA) examination with her clinicians in order to evaluate a possible pulmonary embolism and to make a further evaluation. In her CTA exam there were no pulmonary embolism was seen. There were some chronic changes in her lungs, bilateral pleural effusion and hilar lymphadenomagalies. A dilated and tortiozed vascular structure which was retrocrural and retroaortic placed at the level of the thorachoabdominal transition and joined to left brachiocephalic vein was seen. Then we realized that the liver was symmetrical and transverse localization the upper abdomen and the stomach and spleen was in the right upper quadrant. Because the cardiac apex was left-sided we decided that a kind of situs ambiguous. After that the patient was underwent a abdominal contrast enhanced CT which was including the both arterial and venous phases. In this examination the suprarenal part of the inferior vena cava (IVC) was interrupted and it was continuing as hemiazygos vein to the thorax something like the previous CT exam. The hepatic veins were drained into a short segment vein and then the right atrium. Multiple nodular parenchymal images which were enhanced like spleen in all phases were seen in right upper quadrant of the abdomen (polysplenia). And also partial agenesis of the pancreas and annular pancreas configuration was seen. Anomalies of the IVC occur rarely and the patient are usually asymptomatic. Non-invasive imaging modalities such as CT and MRI allow better identification of these anomalies. In these cases different organ anomalies accompanies the IVC anomalies

  7. ANALISIS PERAN POLA ASUHAN DAN PROSES SOSIALISASI OLAHRAGA BELADIRI DITINJAU DARI PERSPEKTIF KESETARAAN GENDER

    Directory of Open Access Journals (Sweden)

    Berliana Berliana

    2014-10-01

    Full Text Available Abstrak: Penelitian ini berangkat dari pemikiran bahwa peluang yang diberikan pada anak perem- puan untuk melakukan aktivitas publik belum sepenuhnya. Keengganan orang tua memberikan izin kepada anak perempuan menggeluti cabang olahraga berat, masih dipengaruhi oleh konteks masyarakat dan budaya. Masalah pokok dan fokus kajian berkaitan dengan pola pengasuhan anak pada keluarga, klub, dan sekolah dalam menggiring mereka mengambil keputusan sebagai atlet dalam olahraga kompetitif. Sekaitan dengan itu, situs penelitian lapangan dilakukan pada atlet, keluarga, pelatih, dan sekolah, selain ditambah data yang digali dari suami, rekan tempat bekerja, dan lingkungan masyarakat. Observasi partisipasi sebagai upaya memotret data dilakukan peneliti selama enam bulan lama. Penelitian ini menyimpulkan bahwa pola asuh yang diterapkan pada anak perempuan akan menggiring mereka untuk menggeluti olahraga prestasi sejak kecil dan menumbuhkan kemandirian yang memperkokoh konteks pandangan perempuan terhadap dirinya sebagai sumberdaya manusia yang berkualitas. Kata Kunci: pola asuh, atlit perempuan, perspektif gender AN ANALYSIS OF THE CHILD REARING PRACTICE AND THE MARTIAL ARTS SOCIALIZATION PROCESS VIEWED FROM THE GENDER EQUALITY PERSPECTIVE Abstract: This study started from the idea that girls were not given sufficient opportunities to do public activities. The parents’ reluctance to give permission to their daughters to do heavy sports was influenced by the community’s contexts and culture. The core problem and the focus of this study was related to the child rearing practice in the family, in the club, and in schools by encouraging the girls to make a decision as competitive sports athletes. Accordingly, the field study was focused on the athletes, the family, the coach, and schools. The data were also obtained from husbands, colleagues, and community environment. The researcher conducted participant observation for six months. The findings showed that

  8. E-PELAYANAN KONSULTASI KESEHATAN PEDULI REMAJA PADA PUSKESMAS BEKASI

    Directory of Open Access Journals (Sweden)

    Heru Purwanto

    2018-04-01

    Full Text Available Aktivitas dengan intesitas yang tinggi memberikan keterbatasan dalam membagi waktu dan kesempatan untuk berkumpul dan bercerita bersama keluarga. Pemanfaatan internet memberikan kesempatan untuk mendapatkan informasi yang terkini dimanapun dan kapanpun, salah satunya ialah kegiatan konsultasi kesehatan khususnya bagi remaja. Ini merupakan peluang sebagai kesempatan untuk menjembatani adanya komunikasi yang dapat dilakukan secara online. Dengan mensinergikan Program Pelayanan Kesehatan Peduli Remaja (PKPR melalui sistem informasi konsultasi berbasis web secara online  menjadi  wadah  informasi  bagi  remaja  dalam  pelayanan  seputar  konseling  kesehatan  dan pendidikan ketrampilan hidup sehat yang disampaikan dengan cara menyenangkan serta tetap menghargai dan menjaga kerahasian user.Metode Waterfall digunakan untuk perancangan sistem aplikasi online. Teknis perancangan sistem dengan menggunakan UseCase Diagram dan Activity Diagram serta Entity Relationship   Diagram   (ERD.Aplikasi   MySql   Server,   Webserver   digunakan   untuk   mendukung pembuatan Basis Data. Potensi pengembangan penyuluhan dan konsultasi menjadi acuan untuk analisis berikutnya dengan menggunakan metode Critical Succes Factor (CSF dalam mendukung pemetaan strategi yang lebih efektif dan efisien. Metode pendekatan Customer Relationship Management (CRM melalui operasional, analitik dan collaborative  menjadi tolak ukur dalam pembuatan situs E-Pelayanan agar sesuai dengan kebutuhan dalam mendapatkan hubungan yang baik dengan Anggota. Hasil dari penelitian ini, dapat memberikan masukan dan manfaat, khususnya pada kegiatan pelayanan kesehatan dan penyuluhan remaja (PKPR di puskesmas wilayah Bekasi dan sekitarnya. Pengujian T test dengan Uji statistik t hit  (n t 0,05;25 = 2,060 menunjukan ada pengaruh anggota untuk dapat meningkatkan cara hidup sehat melalui informasi konsultasi kesehatan   berbasis web.   Kata kunci: konsultasi, e

  9. Nye County Nevada local perspective of the yucca mountain project (YMP)

    International Nuclear Information System (INIS)

    Swanson, D.

    2008-01-01

    Nye County, Nevada, is host of the proposed Yucca Mountain nuclear waste repository. The Department of Energy (DOE) Nevada Test Site (NTS) and the Department of Defense Nevada Test and Training Range occupy a large portion of Nye County. The NTS has been the site of numerous nuclear device detonations; hosts two low-level nuclear waste landfills; and was (and is) the site of various nuclear physics experiments and tests that have resulted in the distribution of radionuclides into the environment. The Nuclear Waste Policy Act Amendments of 1987 designated Yucca Mountain as the only site, of the three sites approved for characterisation, to be evaluated as a repository. The Act includes provisions for local involvement in program oversight. Nye County and each county surrounding Nye is designated an affected unit of local government (AULG). Nye, being the situs county, also is provided the opportunity to have an on-site representative. This function is a day-to-day opportunity to interact with DOE staff and be actively involved in the DOE decision-making process. DOE has recognised Nye County unique status and special needs and has provided additional funding for various studies via co-operative agreements. The most notable program is the County Independent Science Investigation Program (ISIP). This unique program allows Nye County to contract with subject matter experts, primarily hydrological and geotechnical experts, to conduct studies and advise the county regarding their results and the technical results of DOE investigations. Through the ISIP, Nye has developed a co-operative and credible relationship with numerous research facilities including the national laboratories, government agencies, and universities. Nye County has no viable means to reject the YMP. Hence, current County policy is of a pragmatic nature in that our objectives are to assure that public health, safety and the environment are adequately protected, that the YMP is a success in every way

  10. APLIKASI UJIAN ONLINE PADA SMK MA’ARIF BANDUNG BERBASIS WEB

    Directory of Open Access Journals (Sweden)

    Ade Mubarok

    2016-03-01

    Full Text Available Abstract - System test conducted by SMK Ma'Arif Bandung , the implementation is still in the conventional manner in which any midterm or final exams spent five reams of paper and time correction test results require a minimum of 3 days . So SMK Maarif should use different test systems . System exam in question is an online exam system where paper used can be reduced 90 % and a time correction of exam results of 100 % . The method used is a method WSDM ( Web Site Design Method that is user -centered approach to the development of the website with the application model based on the information needs of user groups. With the online test this system , vocational Ma'Arif could reduce the budget and the time it takes relatively little that is more effective and efficient Keywords : Online Exams, WSDM, Application Model, Website. Abstrak - Sistem ujian yang dilakukan oleh SMK Ma’arif Bandung, pada pelaksanaannya masih dengan cara konvensional dimana setiap ujian tengah semester ataupun ujian akhir semester menghabiskan 5 rim kertas dan waktu pengkoreksian hasil ujian memerlukan minimal 3 hari. Sehingga SMK Ma’arif harus menggunakan sistem ujian yang berbeda. System ujian yang dimaksud adalah system ujian online dimana kertas yang digunakan dapat dikurangi 90% dan waktu pengkoreksian hasil ujian sebesar 100%. Metode yang digunakan adalah metode WSDM (Web Site Design Method yaitu pendekatan terpusat pada pengguna untuk pengembangan situs web dengan model aplikasi yang berdasarkan pada kebutuhan informasi dari kelompok pengguna. Dengan adanya system ujian secara online ini, SMK Ma’arif bisa mengurangi anggaran dan waktu yang dibutuhkan relatif sedikit sehingga lebih efektif dan efisien. Kata kunci : Ujian online, WSDM, Model aplikasi, Website.

  11. ADAPTIVE WEB SITE DENGAN METODE FUZZY CLUSTERING

    Directory of Open Access Journals (Sweden)

    Muchammad Husni

    2004-01-01

    Full Text Available Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Ledakan pertumbuhan dan perkembangan informasi dalam dunia maya menjadikan personalisasian informasi menjadi isu yang penting. Personalisasi informasi yang akan diberikan oleh situs web akan sangat mempengaruhi pola dan perilaku pengguna dalam pencarian informasi, terutama pada perdagangan elektronis (e-commerce. Salah satu pendekatan yang memungkinkan dalam personalisasian web adalah mencari profil pengguna (user profile dari data historis yang sangat besar di file web log. Pengklasifikasian data tanpa pengawasan (unsupervised clasification atau metode metode clustering cukup baik untuk menganalisa data log akses pengguna yang semi terstruktur. Pada metode ini, didefinisikan "user session" dan juga ukuran perbedaan (dissimilarity diantara dua web session yang menggambarkan pengorganisasian sebuah web site. Untuk mendapatkan sebuah profil akses pengguna, dilakukan pembagian user session berdasarkan pasangan ketidaksamaan menggunakan algoritma Fuzzy Clustering. Kata kunci : Adaptive Website, Fuzzy Clustering, personalisasi informasi.

  12. Keragaman Genetik Gen Hormon Pertumbuhan (GH|MboII pada Itik Sikumbang Janti Menggunakan Penciri PCR-RFLP

    Directory of Open Access Journals (Sweden)

    T.D. Nova

    2016-02-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui keragaman gen hormon pertumbuhan (GH dengan enzim MboII pada itik Sikumbang Janti dengan menggunakan penciri PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism. Penelitian ini menggunakan sebanyak 50 sampel darah itik Sikumbang Janti. Sampel darah itik Sikumbang Janti diambil melalui vena achilaris sebanyak ± 1 ml. DNA sampel darah diisolasi menggunakan protocol Genomik DNA Purification Kit (Promega. DNA total diamplifikasi menggunakan sepasang primer F : 5’-CTG GAG CAG GCA GGA AAA TT-3’ dan R: 5’-TCC AGG GAC AGT GAC TCA AC-3’ yang menghasilkan fragmen exon 1 gen GH dengan panjang 801 bp. Produk amplifikasi direstriksi dengan menggunakan MboII yang mengenali situs pemotongan GAAGA (N/8↓ . Dari 46 sampel hasil restriksi diperoleh dua posisi. Pada posisi 618 bp dengan genotip yaitu genotip heterozigot (+/- yang terdiri dari 3 pita (266 bp, 535 bp dan 801 bp, genotip homozigot (+/+ yang terdiri dari 3 pita (109 bp, 266 bp, 426 bp dan genotip homozigot (-/- yang terdiri dari 1 pita ( 801 dan terdapat dua tipe alel, yaitu alel (+ dan all (-, all (+ sebesar 0,79 dan alel (- sebesar 0,21. Sedangkan pada posisi 727 bp memiliki genotip yaitu genotip heterozigot (+/- yang terdiri dari 3 pita (109 bp, 266 bp, 426 bp, dan genotip homozigot (-/- yang terdiri dari 3 pita dan terdapat dua tipe alel, yaitu frekuensi alel (+ sebesar 0,61 dan frekuensi alel (- sebesar 0,39. Dari hasil penelitian ini dapat disimpulkan bahwa gen GH-MboII memiliki keragamanan yang tinggi serta menunjukkan adanya keseimbangan atau tidak menyimpang dari keseimbangan Hardy Weinberg pada posisi keragaman 618 bp dan pada posisi 727 dalam ketidakseimbangan Hardy Weinberg.

  13. Data derandomizer and method of operation for radiation imaging detection systems

    International Nuclear Information System (INIS)

    Hatch, K.F.

    1977-01-01

    A nuclear imaging system includes an analog signal processor which features analog data derandomization for minimizing data loss due to pulse pile-up. A scintillation detector provides a sequence of analog data pulses to the signal processor, the data pulses characterizing the energy level and situs of respective radiation events striking the detector. The signal processor includes sets of novel peak detectors and of sample and hold circuits which are serially connected and are operated to derandomize or space the sequence of analog data pulses so that the system can process pulses corresponding to photopeak events occurring only 1.5 microseconds apart. The analog data pulses are stored in analog pulse form in the peak detectors and are selectively transferred into the sample and hold circuitry from which they are transferred to the display mechanism. The signal processor is multiplexed with several data input channels for accommodating dual isotope operation. A control unit is provided which controls the data processing cycle according to a predetermined processing time, or according to signals from external system apparatus. The control unit provides automatic resetting for assurance that the signal processor does not become locked into an inoperative, nondata processing state. The novel peak detectors are controlled by the control unit and feature input biasing for increased detection sensitivity, proportional dumping for discharging the stored peak value at a rate proportional to the value of the stored peak, and selective input data gating so that only the peak containing portion of the input signal is input into the detector. 28 claims, 10 figures

  14. MR study of the intrinsic acromial angle in 74 symptomatic patients; Studio RM dell'angolo intrinseco dell'acromion in 74 pazienti sintomatici

    Energy Technology Data Exchange (ETDEWEB)

    Di Mario, Mario; Fraracci, Lucio [Ospedale Fondazione Santa Lucia IRCCS, Roma (Italy). Servizio di radiologia

    2005-09-15

    e totali della cuffia i valori dell'angolo sono sempre risultati compresi tra 8{sup o} e 17{sup o}. Non si sono osservate rotture per valori angolari inferiori a 8{sup o}; nelle rotture totali l'angolo era sempre inferiore o uguale a 12{sup o}. La distanza acromion-omerale espressa in millimetri e stata calcolata oscillare tra 2 e 10 mm; nelle rotture della cuffia la distanza non e stata mai valutabile perche quasi sempre vicino allo zero, mentre nell'impingement senza rottura la distanza oscillava tra 5 e 10 mm. Il quadro di impingement senza rottura si e evidenziato in 31 casi con valore angolare compreso tra 10{sup o} e 17{sup o}. Conclusioni. Il nostro studio ha dimostrato la efficienza di due parametri quantitativi (il valore dell'angolo intrinseco dell'acromiom e la distanza acromion-omerale) che risultano essere dei fattori eziopatogenetici importanti nella sindrome da impingement. Tali parametri sono risultati compatibili e confrontabili con la classificazione di Bigliani, la quale, a nostro avviso, e suggestiva per la rilevazione morfologia qualitativa ma non risponde pienamente alla esigenza quantitativa. Il nostro studio suggerisce una correlazione inversamente proporzionale tra la misura della distanza acromion-omerale e la sindrome, mentre esiste un rapporto direttamente proporzionale tra il valore dell'angolo intrinseco dell'acromion e la sindrome da impingement. Tali parametri facilmente rilevabili con la RM possono rappresentare un ausilio oggettivo per il Radiologo e di conseguenza per il Clinico, nella determinazione dei soggetti affetti da sindrome da inpingement aspecifico.

  15. ANALISIS FAKTOR INTEGRATIF NYAMA BALI-NYAMA SELAM, UNTUK MENYUSUN BUKU PANDUAN KERUKUNAN MASYARAKAT DI ERA OTONOMI DAERAH

    Directory of Open Access Journals (Sweden)

    I Made Pageh

    2014-02-01

    Full Text Available Penelitian ini bertujuan untuk (1 memahami latar belakang sejarah Enclave Nyama Bali–Nyama Selam di Bali; (2 menganalisis faktor integratif Enclave Nyama Bali-Nyama Selam, untuk mengembangkan kerukunan antarumat beragama di Bali; (3 mendapatkan materi penenulisan Model Buku Panduan integrasi sosial pada Enclave Nyama Selam-Nyama Bali di Era Otonomi Daerah. Penelitian ini menggunakan metode penelitian ilmu sosial dengan pendekatan sejarah sosial. Dengan demikian prosedur penelitian ini mengikuti prosedur ilmu sosial (etnografi koneksitas antar situs, dari penentuan informan, pengumpulan data sampai analisis data,  dengan teknik analisis deskriptif kualitatif. Hasil penelitian menunjukkan. latar belakang sejarah kearifan enclave Nyama Bali- Nyama Selam, terutama yang berkaitan dengan menumbuhkembangkan integrasi dan harmoni sosial di era otonomi daerah, tidak dapat dilepaskan dari sejarah masuknya agama Islam ke Bali terkait perdagangan di pinggir pantai, seperti Islam di pinggir pelabuhan Buleleng, Sangsit, Temukus kemudian menyebar ke pedalaman bertani seperti Islam di Pancasari, Tegalinggah, dan Batu Gambir, beberapa islam di pedalaman Karangasem. Enclave Islam  terkait dengan politik kerajaan, tinggal di sekitar kerajaan dan atau di pedalaman membentuk enclave tersendiri (Nyama Selam Pegarayaman, Karangasem, Kepaon, Serangan, Loloan Negara, hubungan nyama selam dengan kerajaan adalah hubungan “patro-klient, tautan kaula gusti. dan migrasi berantai dalam perdagangan sektor informal. Faktor Integratif Enclaves Nyama Bali- Nyama Islam dengan kerajaan, dapat dipahami dari latar belakang sejarah politik kerajaan, dengan menempatkan penduduk muslim mengelilingi puri, sebagai benteng, kasus ini dapat dijumpai pada masa kerajaan Karangasem, Klungkung, Badung, Buleleng dan Jemberana, diikuti dengan perkawinan politik (kasus badung dengan enclave Kepaon. Bentuknya di Bidang Sosial (Perkawinan lintas agama, meminjam identitas etnik magibung, ngejot

  16. The Concept of Historical Landscape Design at Watugong Archaeological Site Area in Malang City

    Science.gov (United States)

    Setyabudi, I.; Alfian, R.; Hastutiningtyas, W. R.

    2017-10-01

    Malang city has the high historical value. It showed by many archaeological situses found, such as: The Dutch Colonial Building until kingdom era on classical history period. Generally, it could be seen at urban affairs like government building even the ancient house. But the last kingdom archaeological site only found at the village. The oldest archaeological site in Malang city was found on Kanjuruhan Kingdom, which is concentrated in Tlogomas. The Watu Gong Hamlet that was located in Tlogomas Political District had an archaeological site. It was a big stone in which the stone looked like a traditional music instrument, it was called Gong. As the archaeological site in megalithicum, before the Hindu and Budha came in from India, that stone was predicted as the foundation structure of the big building. The Watu Gong Hamlet was located in Tlogomas archeological site area, also Merjosari and Karang Besuki. Three of them are the archeological sites for Kanjuruhan Kingdom at eigth century, until Kahuripan Kingdom around the eleventh century, as the heir of the Ancient Mataram Kingdom. The urban government has a program to improve the village required to their region potential and it was possible to revitalize the Tlogomas village, so that the historical character can be seen well. The modernity of a hamlet has impact on the local identity blured. In which, they did not think about economic only and it can be minimized, also the hamlet will be a characterized tourism object. The revitalization purposed to continuing the past, then it’s connected to present. It’s performed as corridored garden planning. The landscape development appropriated to promote about the characters of Kacapiring flower, Rose, Jasmine and Puring. They are the special plants from Kanjuruhan Kingdom, beside the other furniture street model. This research was descriptive explorative and discussed about the concept with architecture design approach, started from data collecting, precedent study

  17. MORN5 expression during craniofacial development and its interaction with the BMP and TGFB pathways

    Directory of Open Access Journals (Sweden)

    Petra Cela

    2016-08-01

    Full Text Available MORN5 (MORN repeat containing 5 is encoded by a locus positioned on chromosome 17 in the chicken genome. The MORN motif is found in multiple copies in several proteins including junctophilins or phosphatidylinositol phosphate kinase family and the MORN proteins themselves are found across the animal and plant kingdoms. MORN5 protein has a characteristic punctate pattern in the cytoplasm in immunofluorescence imaging. Previously, MORN5 was found among differentially expressed genes in a microarray profiling experiment of the chicken embryo head. Here, we provided in situ hybridization to analyse, in detail, the MORN5 expression in chick craniofacial structures. The expression of MORN5 was first observed at stage HH17-18 (E2.5. MORN5 expression gradually appeared on either side of the primitive oral cavity, within the maxillary region. At stage HH20 (E3, prominent expression was localised in the mandibular prominences lateral to the midline. From stage HH20 up to HH29 (E6, there was strong expression in restricted regions of the maxillary and mandibular prominences. The frontonasal mass (in the midline of the face expresses MORN5, starting at HH27 (E5. The expression was concentrated in the corners or globular processes, which will ultimately fuse with the cranial edges of the maxillary prominences. MORN5 expression was maintained in the fusion zone up to stage HH29. In sections in situs, MORN5 expression was localised preferentially in the mesenchyme. We examined signals that regulate MORN5 expression in the face based on a previous microarray study. Here we validated the array results with in situ hybridization and QPCR. MORN5 was downregulated 24h after Noggin and/or RA treatment. We also determined that BMP pathway genes are downstream of MORN5 following siRNA knockdown. Based on these results, we conclude that MORN5 is both regulated by and required for BMP signalling. The restricted expression of MORN5 in the lip fusion zone shown here

  18. Pengaruh persepsi resiko dan kualitas e-commerce terhadap keputusan konsumen membeli fashion online

    Directory of Open Access Journals (Sweden)

    Lucky Lhaura Van FC

    2017-11-01

    Full Text Available AbstrakPenelitian ini bertujuan untuk mengetahui pengaruh persepsi konsumen tentang resiko terhadap keputusan pembelian produk fashion toko online ,kedua pengaruh media e-Commerce terhadap keputusan pembelian produk fashion.. pengaruh persepsi konsumen tentang resiko dan kualitas pelayanan secara bersama-sama terhadap keputusan pembelian produk fashion toko online , penelitian ini termasuk penelitian kuantitatif. Populasi penelitian adalah mahasiswa/wi dan dosen fakultas Ilmu Komputer yang pernah melakukan pembelian online. Pengumpulan data dilakukan dengan angket ,dimana analisis data menggunakan metode non probability sampling yang telah didapat sebanyak 110 sampel penelitian,  analisis data menggunakan fitur cronbach’s alfa.Hasil dari pPeneltian ini adalah sSemakin rendah resiko yang dipersepsikan oleh konsumen, maka semakin tinggi tingkat keputusan konsumen untuk membeli fashion secara online. Semakin berkualitas pelayanan e-commerce yang disediakan para pengelola situs belanja fashion online, maka semakin tinggi tingkat keputusan konsumen untuk membeli fashion secara online. Rendahnya persepsi resiko dan tingginya kualitas pelayanan elektronik secara bersamaan akan mampu meningkatkan keputusan konsumen untuk membeli fashion secara online. Kata Kunci : Persepsi Resiko, kualitas e-commerce, metode non probability sampling, cronbach’s alfa  AbstractThis research is perceived risk and quality of e-commerce on fashion product online buying decision in faculty of Computer Science  . This study includes quantitative research. The population of research is students  and faculty lecturer of Computer Science who ever made online purchasing. Data collection is done by questionnaire, where data analysis using non probabity sampling method has been obtained as many as 110 research samples, data analysis using cronbach's alpha feature. Result from Peneltian This is the lower the risk perceived by the consumer, the higher the level of consumer

  19. Culture Jamming Versus Popular Culture

    Directory of Open Access Journals (Sweden)

    Leonardia Acynthia Putri

    2013-11-01

    Full Text Available Abstract: This literature study researched Adbusters, the anti-commercial organization, and described the organization’s activities and media usage, mainly in the period of 2007-2010, which critized the populer culture. Adbusters is an organization which performs “Culture Jamming”; a rebellious act reacting towards commercialism domination in many aspects including popular culture. Compared to other similar organizations, Adbusters has been executing more various activisms using several media which other organizations do not use. This study used the Adbusters’ official website and blogs as main data sources. The data of Adbusters’ activities and media usage were categorized and analyzed, thus the tendency of its development can be described. This study also analyzed Adbusters’ activity using Media Hegemony Theory and Political Economy Media Theory. The media has been dominated by a certain group that owns politic and economic power, so the information flow has been dominated by them. Media and its contents have been commercialized, thus capitalism and commercialism have been considered as a common system that should run the world. Adbusters has been trying to stop the domination and change the society’s way of thinking into a more critical way of thinking.   Abstrak: Studi literatur ini meneliti tentang Adbusters, sebuah organisasi anti komersial, dengan mendeskripsikan aktivitas serta penggunaan media organisasi tersebut dari tahun 2007-2010 dalam mengkritisi budaya populer. Adbusters adalah organisasi yang melakukan Culture Jamming, aksi perlawanan terhadap dominasi komersialisme di segala aspek termasuk popular culture. Dibandingkan dengan organisasi lain yang serupa, aktivitas Adbusters lebih bervariasi dan menggunakan media-media yang tidak biasa digunakan organisasi lain. Penelitian ini menggunakan situs online resmi Adbusters sebagai sumber data utama. Data mengenai aktivitas dan

  20. PUBLIC ACCESS TO PRIVATE LAND IN SCOTLAND

    Directory of Open Access Journals (Sweden)

    David L Carey Miller

    2012-08-01

    Full Text Available This article attempts to understand the radical reform of Scottish land law in its provision for a general right of public access to private land introduced in 2003 as part of land reform legislation, an important aspect of the initial agenda of the Scottish Parliament revived in 1999. The right is to recreational access for a limited period and the right to cross land. Access can be taken only on foot or by horse or bicycle. As a starting point clarification of the misunderstood pre-reform position is attempted. The essential point is that Scots common law does not give civil damages for a simple act of trespass (as English law does but only a right to obtain removal of the trespasser. Under the reforms the longstanding Scottish position of landowners allowing walkers access to the hills and mountains becomes a legal right. A critical aspect of the new right is that it is one of responsible access; provided a landowner co-operates with the spirit and system of the Act access can be denied on the basis that it is not being exercised responsibly. But the onus is on the landowner to show that the exercise of the right is not responsible.Although the right applies to all land a general exception protects the privacy of a domestic dwelling. Early case law suggests that the scope of this limit depends upon particular circumstances although reasonable 'garden ground' is likely to be protected. There are various particular limits such as school land.Compliance with the protection of property under the European Convention on Human Rights is discussed. The article emphasises the latitude, open to nations, for limitations to the right of ownership in land in the public interest. The extent of the Scottish access inroad illustrates this. This leads to the conclusion that 'land governance' – the subject of the Potchefstroom Conference at which the paper was initially presented – largely remains a matter for domestic law; the lex situs concept is alive

  1. Implementasi Kurikulum Kulliyatul Mu’alimin Al-Islamiyah (KMI Di Pondok Pesantren Tarbiyatul Mu’allimien Al-Islamiyah (TMI Al-Amien Prenduan Dan Ma’hadul Mu’allimien Al-Islamiyah (MMI Mathlabul Ulum Jambu Sumenep

    Directory of Open Access Journals (Sweden)

    Fajriyah Fajriyah

    2017-07-01

    Full Text Available Tujuan penelitian ini mendeskripsikan dan memahami: Kurikulum kulliyatul mu’allimin al-islamiyah; Implementasi kurikulum kulliyatul mu’allimin al-islamiyah; Faktor pendukung dan faktor penghambat kurikulum kulliyatul mu’allimin al-islamiyah; dan Strategi mengatasi faktor penghambat kurikulum kulliyatul mu’allimin al-islamiyah. Penelitian ini menggunakan pendekatan kualitatif dengan rancangan penelitian studi multi situs. Hasil penelitian ini yaitu: kurikulum KMI di TMI dan MMI perumusan kurikulum KMI didasarkan filosofi yang tercermin dari visi dan misi yang diturunkan dalam tujuan dan disusun dalam langkah yang opersional. Faktor pendukung: terdapat kedisiplinan yang ditanamkan kepada guru dan santri; SDM yang berkompeten; kepedulian orang tua dan masyarakat; dan  strategi mengatasi faktor penghambat kurikulum KMI di TMI dan MMI, memaksimalkan penggunaan teknologi informasi (IT dalam proses pembelajaran, peningkatan kualitas SDM dengan mengikutsertakan guru dalam pelatihan dan pendidikan di pesantren maupun di luar pesantren. guru berperan aktif. Kata Kunci: Implementasi, Kurikuilum, KMI.   Abstract:   While the purpose of this research are to describe: The curriculum of  kulliyatul mu’allimin al-islamiyah; Implementation of  curriculum of kulliyatul mu’allimin al-islamiyah; Factor of support and factor pursuer of curriculum of kulliyatul mu’allimin al-islamiyah; and Strategy to overcome factor of pursuer of curriculum of kulliyatul mu’allimin al-islamiyah. Results of this research are: curriculum KMI in TMI and MMI: the first, curriculum formulating of KMI based philosophy that taken by vision and mission applied the aim and arranged  in step operational, the curriculum implementation KMI and MMI boarding house as formal education institution and non formal to do learning process for 24 hour, support factor and pursuer factor of curriculum KMI in TMI and MMI,pursuer factor are: minimize boarding house facility; limited

  2. Síndrome toracoabdominal. Presentación de un caso Thoracoabdominal síndrome. A case report

    Directory of Open Access Journals (Sweden)

    Sergio Piloña Ruíz

    2007-03-01

    Full Text Available Se trata un caso de un recién nacido de la raza blanca, primogénito, nacido a las 39 semanas de gestación en parto eutócico, que ingresó en el Servicio de Cuidados Intensivos Neonatales por un defecto óseo y músculo aponeurótico, cubierto por piel desde el tercio medio distal del esternón que se extendía hasta el ombligo, siendo portador de una Ectopia Cordis Toracoabdominal, un Onfalocele minor y una persistencia del conducto arterioso sin repercusión hemodinámica, que evolucionó de forma favorable, colocándosele material sintético en el tórax (gorotex como medio de protección. Fue egresado a los 16 días y reingresado a los 2 meses para la reparación del Onfalocele, falleciendo en un cuadro de fallo multiorgánico por sepsis. El fenotipo constatado en el propósitus se consideró compatible con el Síndrome Toracoabdominal, de patrón de herencia dominante ligada al X (MIM: 313850, reportado por Carmi et al en 1990, constituyendo el segundo caso esporádico reconocido en Pinar del Río (Cuba en dos familias no relacionadas.A Caucasian male newborn, first born, delivered at 39 weeks of pregnancy in an eutocic labor was admitted at the Intensive Neonatal Care Unit, presenting an osseous defect and aponeurotic muscle covered by skin of the distal median third of the sternum extended to the navel. He was a carrier of a Thoracoabdominal Ectopia Cordis, a minor Omphalocele and a Patent Ductus Arteriosus without hemodynamic repercussion evolving favorably with the placement of a synthetic material in the thorax (Gorotex as a protection. The patient was discharged from the hospital at 16 days old and readmitted at 2 months old to restore the Omphalocele, dying of multiple organ failure due to sepsis. The phenotype observed on the propositus was compatible with the Thoracoabdominal Syndrome, which has a dominant trait pattern linked to X -chromosome (MIM: 313850 reported by carmi et al. In 1990. This was the second sporadic case

  3. STRATEGY FORMULATION FOR DEVELOPING BATIK TULIS

    Directory of Open Access Journals (Sweden)

    Indah Eko Suryani

    2015-01-01

    yang dapat direkomendasikan kepada Rolla Junior yaitu 1 peningkatan permodalan melalui program Kredit Usaha Rakyat (KUR, 2 melakukan ekspansi ke luar daerah Jember, 3 membuat situs web/blog untuk mempromosikan dan transaksi jual beli produk, 4 peningkatan kuantitas keikutesertaan dalam acara pameran atau EXPO baik di tingkat regional maupun nasiona, 5 melakukan penelitian untuk mengatasai kendala pewarnaan yang membutuhkan sinar matahari, 6 melakukan kegiatan kerja sama dengan pemasok bahan baku (integrasi ke belakan, dan 7 mencari alternatif daerah pemasok bahan baku khususnya yang lebih dekat dengan kabupaten Jember.Kata kunci: strategi pengembangan, batik tulis Rolla Junior, SWOT, QSPM

  4. SISTEM OTENTIKASI UNTUK SQUID BERBASIS WEB

    Directory of Open Access Journals (Sweden)

    Febriliyan Samopa

    2006-07-01

    Full Text Available Dalam sebuah jaringan komputer terdapat bermacam-macam tipe user dengan berbagi tingkatan yang berbeda yang juga dibutuhkan perlakuan yang berbeda pada tiap user yang disesuaikan dengan kebutuhan dalam menggunakan akses web, baik berupa http, ftp, gopher, dan lain-lain. Dimana masing-masing user memiliki skala prioritas dalam penggunaan bandwidth, jumlah koneksi maksimum, waktu koneksi, ukuran file maksimum, situs yang tidak boleh diakses dan lain-lain. Tujuan dari penelitian ini adalah membuat sebuah perangkat lunak yang dapat melakukan otentikasi user berdasarkan data konfigurasi yang disimpan dalam basisdata. Selain itu, perangkat lunak yang dibuat dapat memproses request dari client berdasarkan data konfigurasi dengan lebih cepat. Permasalahan yang mucul adalah bagaimana merancang dan membuat suatu perangkat lunak yang dapat melakukan otentikasi user berdasarkan data konfigurasi yang diambil dari basisdata, serta dapat memproses request dari client dengan lebih cepat berdasarkan hak akses yang dimilikinya.Dalam penelitian ini didesain dan diimplementasikan suatu sistem otentikasi user dengan mengambil data user yang tersimpan dalam basisdata MySQL. Disamping itu, dilakukan rekayasa pada beberapa rutin proses yang terdapat dalam squid proxy, supaya proses-proses dapat melakukan pengambilan data konfigurasi yang dialihkan dan disimpan dalam basisdata MySQL. Data konfigurasi ini didasarkan pada pembagian hak akses yang dimiliki oleh masing-masing grup user. Antarmuka berbasis web digunakan sebagai salah satu layanan bagi admin untuk mempermudah pengelolaan dan pengolahan data konfigurasi yang dibuat.Berdasarkan uji coba yang telah dilakukan, terbukti sistem yang dibuat dapat bekerja dengan baik dan tidak melenceng dari fungsi asli sebelum dilakukan perubahan. Bahkan pada penanganan request client yang berukuran besar, kinerja squid mengalami peningkatan dalam hal kecepatan proses yang dibutuhkan. Sebagai contoh, request client pada  file

  5. STRATEGI KOMUNIKASI PEMASARAN ONLINE PRODUK BUSANA MUSLIM QUEENOVA

    Directory of Open Access Journals (Sweden)

    Dian Sarastuti

    2017-05-01

    dan Below The Line, dengan fokus pada promosi penjualan dan pemasangan iklan banner ad di facebook. Kesimpulannya strategi pemasaran fokus pada pada promosi penjualan dan pemasangan iklan banner ad di situs facebook. Faktor komunikasi visual dan rekomendasi juga memiliki pengaruh terhadap meningkatnya brand awareness. Saran meningkatkan hubungan dengan fans yang sudah dimiliki dibuatkan suatu bentuk aktivitas untuk menjalin hubungan dengan konsumen. Diusulkan memiliki person in charge yang khusus mengurus media online.

  6. SUPERVISI DALAM PENINGKATAN KOMPETENSI GURU MELALUI GUGUS SEKOLAH

    Directory of Open Access Journals (Sweden)

    Enis Purnawanti

    2016-02-01

    Full Text Available Penelitian ini bertujuan untuk menggambarkan: (1 teknik yang digunakan, (2 faktor pendukung dan pendayagunaan, (3 kendala dan cara mengatasi nya. Penelitian ini menggunakan pendekatan kualitatif dengan rancangan studi multi situs di gugus sekolah I dan gugus Sekolah II Unit Dinas Pendidikan dan Kebudayaan Kecamatan Munjungan melalui teknik observasi, wawancara, dan dokumentasi. Analisis data melalui dua tahap: (1 analisis data tiap gugus, (2 analisis lintas gugus. Hasil penelitian: Teknik yang digunakan adalah teknik kelompok. Faktor pendukung dan pendayagunaan, yaitu (1 kesetiakawanan antar guru dan lembaga cukup tinggi pendayagunaan nya dengan menjalin komunikasi yang efektif antar personil dan antar lembaga; (2 Adanya dana sertifikasi dengan mewajibkan guru mengikuti kegiatan KKG dengan biaya swadaya; (3 wilayah gugus yang tidak luas pendayagunaan dengan melaksanakan koordinasi antar sekolah dan antar personil secara intens. Kendala dan cara mengatasinya yaitu: (1 tidak ada aturan yang resmi dari pemerintah tentang pelaksanaan KKG dan pengelolaan gugus solusinya dengan melaksanakan kegiatan berdasarkan RKAG; (2 komitmen guru masih rendah cara mengatasinya dengan melibatkan semua unsur yang ada di gugus dalam perencanaan, pengawasan dan evaluasi kegiatan; (3 minimnya sarana prasarana penunjang kegiatan, adapun solusinya dengan memanfaatkan fasilitas dari sekolah inti dan lembaga lain. This study aims to describe: (1 the techniques used, (2 supporting factors and utilization, (3 problems and how to resolve it. This study used a qualitative approach with a multi-site study design in school cluster I and group II Unit School Department of Education and Culture District of Munjungan through observation, interviews, and documentation. Analysis of the data in two steps: (1 analysis of the data of each group, (2 analysis across the group. RESULTS: The technique used is the technique of the group. Factors supporting and utilization, namely: (1

  7. HIPERPORNOGRAFI PEREMPUAN DALAM IKLAN

    Directory of Open Access Journals (Sweden)

    Ervan Ismail

    2015-05-01

    Full Text Available Research by the author is using the critical paradigm is based on the notion that a variety of issues related to the hyper-pornography emerged from the audience understandings of social reality constructed by advertising. Type of research is a descriptive study using semiotic analysis. Data was collected to make a second record Geliga Muscle Cream ads and Malkis Abon as primary data. Secondary data obtained through the study of literature in the form of books, journals and internet sites.In the second survey results revealed the ad has a depth of meaning that leads to hyper-pornography completely after carefully using the theory of Jean Baudrillard was found that the two ads is the result of the simulation and produce effects that lead women toward kekecenderungan hiperpornografi, based on the results of the study, the second theme ad lifting sensation will be a sign that women's sexuality is the most dominant in the second ad. This advertising system refers to Hollywood movies, one movie Devil Wear Prada and also a novel by Tami Hoag "Luck's Lady". Genre film and the novel is fiction fantasy and romantic drama-crafted by a writer or a director and writer. Penelitian yang dilakukan penulis adalah menggunakan paradigma kritis didasarkan pada pemikiran bahwa berbagai hal yang berkaitan dengan hiper-pornografi muncul dari pemahaman-pemahan sosial khalayak yang terkonstruksi oleh realitas iklan. Jenis penelitian yang dilakukan adalah penelitian deskriptif dengan menggunakan analisis semiotika. Teknik pengumpulan data dilakukan dengan membuat rekaman kedua iklan Krim Otot Geliga dan Malkis Abon sebagai data primer. Data sekunder didapat melalui studi literatur berupa buku, jurnal dan situs internet.Pada hasil penelitian diketahui pada kedua iklan memiliki kedalaman makna yang mengarah kepada hiper-pornografi seutuhnya setelah di teliti menggunakan teori Jean Baudrillard didapati bahwa kedua iklan adalah hasil dari simulasi dan menghasilkan efek yang

  8. PERANGKAT LUNAK PEMINDAI CELAH KEAMANAN JARINGAN PADA BERBAGAI SISTEM OPERASI

    Directory of Open Access Journals (Sweden)

    Febriliyan Samopa

    2003-07-01

    Full Text Available Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Keamanan jaringan merupakan tantangan yang besar dalam pengembangan layanan Internet yang dewasa ini tumbuh demikian cepat. Salah satu bentuk masalah keamanan yang paling menonjol adalah intrusi dari cracker yang memanfaatkan celah-celah keamanan yang ada sebagai kompensasi dari layanan yang diberikan oleh sebuah server. Cracker akan berusaha mengakses ports yang sedang digunakan oleh layanan suatu server dan berusaha mengekspoitasi kelemahan port tersebut untuk melakukan Denial of Service (DoS, defacing situs internet, maupun Information Retrieval terhadap data-data sensitif. Tugas akhir ini berusaha menyajikan sebuah perangkat lunak yang dapat mencari celah-celah keamanan yang mungkin timbul pada sebuah komputer yang terhubung ke jaringan. Celah keamanan yang dapat dideteksi oleh perangkat lunak ini antara lain ARP Poisoning, Open Ports, NetBIOS Null Session, DCOM RPC dan IIS Unicode. Sebagai tambahan, perangkat lunak ini juga dapat memberikan estimasi mengenai sistem operasi apa yang dimiliki oleh komputer tersebut. Dari hasil uji coba, perangkat lunak ini dapat menjalankan fungsi-fungsinya dengan baik. Namun demikian, terdapat sedikit kekurangan-kekurangan antara lain antisipasi terhadap firewall yang belum

  9. REKONSTRUKSI ARSITEKTUR ISTANA KOTA PIRING

    Directory of Open Access Journals (Sweden)

    Totok Roesmanto

    2004-01-01

    -penelitian berikutnya.. Dinding dan pola halaman yang pernah ada dianalisis berdasarkan temuan sisa pondasi di lapangan. Dengan pendekatan kesejarahan berdasarkan teks kuno "Tuhfat Al Nafis" abad ke-19, bangunan-bangunan penting yang ada di dalam kompleks Istana Kota Piring dapat diketahui. Penelusuran jenis dan bentuk bangunannya didasarkan pada pendekatan arsitektural terhadap bangunan tradisional Melayu yang ada di Kesultanan Johor dan Pahang yang semasa. Untuk mengetahui seluruh bagian bangunan Istana Kota Piring yang masih terdapat di bawah permukaan tanah harus dilakukan kegiatan ekskavasi. Kegiatan ekskavasi secara menyeluruh hanya dapat dilakukan setelah seluruh bangunan baru yang ada di situs bersejarah ini direlokasi. Kata kunci: Istana Kota Piring, Pulau Biram Dewa, Tanjungpinang, rekonstruksi arsitektur.

  10. PENGARUH PENERAPAN PERIKLANAN DI INTERNET DAN PEMASARAN MELALUI E-MAIL PRODUK UMKM DI WILAYAH DEPOK

    Directory of Open Access Journals (Sweden)

    Mujiyana Mujiyana

    2013-03-01

    Full Text Available Dewasa ini peran internet bukan hanya sebagai sarana mencari informasi, tapi juga mempunyai potensi besar sebagai media pemasaran dan perdagangan, khususnya periklanan. Bagi usaha mikro kecil dan menengah (UMKM, media periklanan melalui internet di Indonesia belum dimanfaatkan secara maksimal bahkan masih relatif kecil dan cenderung jauh dari sentuhan teknologi informasi yang mendukung kegiatan dan operasional perusahaan. Metode penelitian yang digunakan adalah deskriptif dan verifikatif. Konsep model penelitian ini adalah menguji kebenaran daru suatu hipotesis. Dalam penelitian ini telah dilakukan tiga tahapan selama tiga tahun berturut-turut, tahun pertama menguji manfaat penggunaan internet untuk periklanan bagi UMKM, tahun kedua membangun dan  mengembangkan portal situs web untuk periklanan produk UMKM, dan tahun ketiga mengukur pengaruh periklanan melalui internet bagi UMKM. Hasil penetilian dan kajian ini adalah produk teknologi infomasi yang dapat dimanfaatkan dalam pengelolaan usaha kecil, baik dari sisi kepentingan pelaku usaha maupun pihak terkait dalam pemberdayaan usaha kecil, dalam bentuk portal E-marketing yang dikelola oleh instansi pemerintah dan pihak asosiasi usaha kecil di wilayah kota Depok. Portal yang telah dibangun dapat diakses melalui http://www.gunadarma.ukmdepok.com Kata kunci : periklanan, e-commerce dan e-marketing, pemasaran melalui e-mail   Abstract Today the role of the Internet not only as a means of finding information, but it also has great potential as a medium of marketing and trade, particularly advertising. For micro small and medium enterprises (MSMEs, media advertising over the internet in Indonesia is not fully utilized even still relatively small and likely to be far from the touch of the information technology that supports the activities and operations of the company. The research method used is descriptive and verification. The concept model of this study was to test the truth of a hypothesis

  11. Pengembangan Aplikasi Antarmuka Layanan Big Data Analysis

    Directory of Open Access Journals (Sweden)

    Gede Karya

    2017-11-01

    aplikasi antarmuka layanan big data analysis yang terintegrasi dengan Hadoop-Cluster. Penelitian diawali dengan mencari metode dan teknik yang tepat untuk menjadwalkan job, memanggil (call modul aplikasi Java Map-Reduce (MR yang sudah jadi, dan teknik untuk input/ output tunneling serta konstruksi meta data permintaan layanan (input dan hasil layanan (output. Metode dan teknik di atas, kemudian dikembangkan menjadi aplikasi layanan berbasis web, serta modul eksekutor yang berjalan di atas lingkungan pemrograman berbasis Java 2 Enterprise Edition (J2EE dan dapat mengakses Hadoop-Cluster di Lab Komputer FTIS. Aplikasi yang dihasilkan dapat diakses oleh publik melalui situs http://bigdata.unpar.ac.id. Berdasarkan hasil pengujian, aplikasi telah berfungsi dengan baik sesuai dengan spesifikasi dan dapat digunakan untuk melakukan big data analysis. Kata kunci: layanan berbasis web, big data analysis, Hadoop, J2EE

  12. PENGARUH ELECTRONIC WORD OF MOUTH (eWOM TWITTER @batikair TERHADAP BRAND IMAGE

    Directory of Open Access Journals (Sweden)

    Cherry Kartika

    2015-05-01

    valence of opinion terhadap brand image. Semakin tinggi jumlah pendapat konsumen baik positif atau negatif mengenai produk, jasa dan brand akan berpengaruh terhadap brand image @batikair. (3 Terdapat pengaruh eWOM twitter @batikair ditinjau dari dimensi content terhadap brand image. Semakin baik informasi yang tersedia dari situs jejaring sosial berkaitan dengan produk dan jasa akan berpengaruh positif terhadap peningkatan brand image @batikair.

  13. SPONTANEOUS FALLOPIAN TUBE EVISCERATION IN PROCIDENTIA AND PERFORATING CARCINOMATOUS VAGINAL WALL ULCER – CASE REPORT

    Directory of Open Access Journals (Sweden)

    Marijan Lužnik

    2018-02-01

    Full Text Available Background. Total prolapse of female pelvic organs is not only painful and troublesome because of difficulties with micturition and defecation but it could be very dangerous since prolapsed vagina presents a predilection area for ulcer and/or rupture of different etiology and with evisceration of abdominal content. Eviscerations usually occur rarely, but when they do occur, it is important to intervene quickly. Most frequent is the evisceration of small bowel, rarely omentum and sporadically other abdominal structures. Neither in literature nor on the internet there were not any examples of primary eviscerated fallopian tube which was not a consequence of preceeding gynecological-surgical procedure found. Methods. 77-year-old woman was appointed to our out patient department with diagnosis of Prolapsus uteri totalis and Dolores abdominalis. In history there was prevulvar bulge in the size of an apple, which persisted for 20 years, and almost disappeared when lying supine. Three days before admission to the hospital the bulge was exceedingly enlarged by straining and did not diminish when lying supine. The patient walked only hardly and could not sit. Micturition and defecation was possible only in the upright position. There were also difficulties while placing the patient on a gynecologic chair, because between her legs there was a bulge in the size of 14 × 10 × 9 cm3 with fallopian tube hanging out (Figure 1. On the outermost part of total uterovaginal prolapse the outer ostium of the cervical canal was recognizable. The bulge was fully stretched, painful and unreponible. Around a hole where a fallopian tube exits, vagina was eritematous, rough folded – swollen and vulnerable (Figure 2. In outpatient department eviscerated fallopian tube and prolapsed vagina with its contents were aseptically treated and Dalacin and Orho Gynest crème were applicated. Foley catheter was inserted. Prolapsed vagina with uterus and other contents remained

  14. Caracterização física e química dos frutos da umbu-cajazeira (Spondias spp em cinco estádios de maturação, da polpa congelada e néctar Physical and chemical characterization on the fruits of umbu-cajazeira (Spondias spp in five ripening stages, frozen pulp and nectar

    Directory of Open Access Journals (Sweden)

    ELIZA DOROTEA POZZOBON DE ALBUQUERQUE LIMA

    2002-08-01

    Full Text Available A umbu-cajazeira, no Brasil, apresenta boas potencialidades de cultivo e perspectivas de comercialização, o que objetivou este trabalho de avaliação da qualidade física e química dos frutos em cinco estádios de maturação classificados de acordo com o grau de cor da casca descritos como: fruto totalmente verde (1FTV, frutos com início de pigmentação (2FIP, frutos parcialmente amarelos (3FPA, frutos totalmente amarelos (4FTA, frutos totalmente amarelo-alaranjados (5FTAA, da polpa congelada e do néctar. As variáveis estudadas foram os atributos físicos: peso, diâmetro longitudinal, diâmetro transversal e rendimento em polpa, e químicos: vitamina C, acidez total titulável sólidos solúveis totais, pH e a relação sólidos solúveis totais/acidez total titulável. Os frutos, no estádio de maturação comercial (4FTA, apresentaram os seguintes valores mé ;dio: rendimento de polpa de 55,75%; pH de 2,08; SST de 11,25 °Brix; ATT de 1,77 g de ácido citrico/100g de polpa; SST/ATT de 6,39 e teor de vitamina C total de 17,75 mg/100g. A polpa congelada e o néctar mantiveram-se em condições estáveis em relaç ;ão ao pH, SST, ATT e SST/ATT, durante 60 dias de armazenamento. Quanto ao teor de vitamina C total, a polpa congelada apresentou um decréscimo signi ficativo, o que não ocorreu com o néctar.In Brazil some tropical fruits present great potential for cultivation and perspective of commercialization, one of them is the "umbu-cajazeira". A research has been developed aiming to measure the physical and chemical quality of the frozen pulp and the nectar obtained from "umbu-cajazeira" fruits, which were classified in distinct maturation stages. The fruits were divided according to shell colour in five groups: fruit completely green (1FCG, fruit starting to change shell's colour (2FSCC, fruit partially yellow (3FPY, fruit totally yellow (4FTY, fruit totaly orange-like yellow. The variables analysed comprised the physical

  15. Preoperative blood transfusion for gynecological operation of a patient with Bernard-Soulier syndrome: Case report

    Directory of Open Access Journals (Sweden)

    Pešić-Stevanović Ivana

    2011-01-01

    , the patient was admitted because of a large bleeding. Haematological parameters: Hgb 63 g/L, Rbc 2,61 x 1012/l, MCV 76fL, Plt 22 x 109/l. Biochemical parameters in referential values. Global tests of haemostasis preoperativly: PT 13,4s (9-12,6s, INR 1,02, APTT 20,7s (24-35s, fib 2,08 g/L (1,69-5,15 g/L, TT 18,9s (18-25s, 3 doses of deplasmatic erythrocytes and 2 x 7 doses of platelet concentrate with preoperativly used of methylprednisone (80 mg. Operation: Hysterectomia totalis abdominalis classica cum adnexectomiam lateralis dextri. Pre-operative and post-operative period regular. Therapy: antibiotics, analgetics, infusion solutions and 5 x 7 doses of platelet concentrate with methylprednisone (80 mg. Wound healing per primam. The patient was discharged from the Clinic well recovered, with a plan for a treatment and a future care needs.

  16. Modelli di valutazione ambientale per i Bovidi (Capra ibex, Rupicapra rupicapra e i Cervidi (Capreolus capreolus, Cervus elaphus nel Parco Nazionale del Gran Paradiso

    Directory of Open Access Journals (Sweden)

    C. Oppio

    2003-10-01

    del chi-quadrato sono state confrontate le percentuali di casi classificati nei due sets. Per le altre specie i modelli formulati sono stati applicati al territorio del parco e la validità dei modelli è stata valutata dalla percentuale di casi originali riclassificati correttamente. Per i bovidi il modello a maggior capacità predittiva è stato quello discriminante (classificazioni corrette: 73.0% per stambecco e 82.8% per camoscio. La non significatività del test Χ² (P=0.470 indica che non esistono differenze significative tra la distribuzione reale dello stambecco e quella ottenuta dal modello. L'81.1% del territorio del Parco è idoneo al camoscio alpino e l'area vocata include il 93.6% del territorio realmente occupato dalla specie. Per il capriolo il modello logistico è stato quello a maggior capacità predittiva (88.1% dei casi originali classificati correttamente, individuando il 50.7% del territorio realmente occupato dalla specie. Anche per il cervo quello logistico è preferibile per la maggiore percentuale di casi totali classificati correttamente (AFD: 74.9%; ARL: 76.0%.

  17. Wastewater disinfection with peracetic acid and UV; La disinfezione di acque reflue con acido peracetico e raggi ultravioletti

    Energy Technology Data Exchange (ETDEWEB)

    Caretti, C.; Lubello, C. [Florence Univ., Florence (Italy). Dipt. di Ingegneria Civile

    2001-06-01

    Was investigated the synergy between UV and peracetic acid (PAA) through a five months on-site experimental study in a pilot plant fed by the secondary effluent of the central wastewater treatment plant of Pistoia, Italy. This experiment is a part of a larger research project on advanced treatment for municipal wastewater reuse in agriculture. Because of Italy's strict limits on unrestricted wastewater reuse in agriculture (2 CFU total coliform/100 ml), a very high degree of disinfection is necessary. In the investigated experimental conditions, it has been impossible to meet such values through an exclusive use of UV irradiation (the UV unit reaches at most 4 Log inactivation). Low levels of PAA greatly enhance the decline of indicator levels, but higher unsustainable doses are required to hit the Italian limit. Through a poor amount of information on the subject was available in literature, it was tried to find out how the disinfection efficiency could improve by simultaneously using UV and PAA. It was found out that a combined treatment is satisfactory and that it is more advantage of the hydroxyl radicals formation due to the PAA photo lysis. The application of 2 ppm of PAA with an UV dose of 192 mWscm{sup -}2 is enough to meet the Italian limit. [Italian] Nel presente articolo si riportano i risultati di uno studio sulla sinergia tra acido peracetico (PAA) e raggi ultravioletti nella disinfezione delle acque reflue secondarie; le prove sono state effettuate su scala pilota, presso l'impianto centrale di Pistoia. Tale sperimentazione fa parte di un piu' ampio progetto di ricerca sulla possibilita' di riutilizzare le acque reflue a scopo irriguo; per rispettare i limiti estremamente stringenti imposti dalla normativa italiana per l'irrigazione (2 CFU Coliformi totali/100 ml, nel caso di irrigazione illimitata), e' necessario garantire efficienze di disinfezione molto elevate. Nelle condizioni sperimentali considerate, non e

  18. I mammiferi dell'area di Capo Feto (Trapani

    Directory of Open Access Journals (Sweden)

    Massimiliano Di Vittorio

    2003-10-01

    campionamento sono stati analizzati attraverso l?Indice di concentrazione di Dominanza. Complessivamente, nei tre periodi, sono stati catturati e marcati un totale di 70 micromammiferi, di cui 29 Rattus norvegicus, 17 Mus musculus, 10 R. rattus e 14 Crocidura sicula. Scorporando i risultati delle catture nei diversi periodi e per i diversi transetti, si possono evincere alcune variazioni nei popolamenti dell?area in funzione delle stagioni. Durante i diversi periodi in cui sono stati effettuati i campionamenti, infatti, l?area di Capo Feto ha mostrato differenze importanti inerenti l?umidità del suolo, che avrebbe avuto conseguenze nella composizione vegetazionale e quindi nei popolamenti dei mammiferi studiati. Sono state rilevate variazioni nei popolamenti dell?intera area, più evidenti nei riguardi di R. norvegicus e R. rattus, di minore entità riguardo il M. musculus, mentre la C. sicula si mantiene entro valori quasi costanti. I risultati totali dei trappolamenti, in cui si ha la preponderanza di R. norvegicus e M. musculus, confermerebbero il degrado dell?area in questione. Inoltre, l?area di Capo Feto sembrerebbe caratterizzata da una bassa produttività, conseguenza dell?alterazione dell?habitat, e necessita, pertanto, di immediati e profondi interventi di ripristino ambientale.

  19. PENELITIAN/PENGEMBANGAN MODEL/SISTEM SURVEILANS DAMPAK KESEHATAN PERUBAHAN IKLIM

    Directory of Open Access Journals (Sweden)

    Athena Athena

    2014-05-01

    variables in a particular period while GIS maps were displayed in the website. A surveillance model/system of the health impact of climate change has been developed. It is a system which process, analyze, and interpret data systematically and continuously, which also includes the distribution of information. The system is expected to provide information about how the condition of diseases in regard of climate change is.Keywords : climate change, surveillance, rainfall, temperature, DHF, malaria, diarrhea, penumonida, influenza like illness/ ILIAbstrakTelah dilakukan penelitian dan pengembangan Model/Sistem Surveilans Dampak Perubahan Iklim tahun 2011. Tujuan penelitian/pengembangan ini adalah diperolehnya sistem surveilans untuk dampak kesehatan dari perubahan iklim yang cocok untuk Indonesia. Disain penelitian adalah riset operasional. Tahapan kegiatan dimulai dengan analisis situasi, review program surveilans, dan penyusunan draft model sistem surveilans. Analisis situasi dan review program surveilans dilakukan untuk mendapatkan gambaran bagaimana sistem surveilans yang berjalan selama ini, dilakukan dengan cara melakukan rapid assessment di 6 dinas kabupaten/kota 6 provinsi. Penyusunan draft model sistem surveilans yang meliputi identifikasi data/variabel yang perlu dikumpulkan, sumber dan frekuensi pengumpulan data, petugas pengumpul data, pengolahan dan analisis data, cara pemetaan data penyakit dan distribusi informasinya dilakukan dengan diskusi bersama lintas sektor, lintas program dan para pakar. Hasil penelitian berupa model/sistem surveilans dampak kesehatan perubahan iklim yang dilengkapi dengan software pengolahan data dan situs web. Jenis data penyakit yang dikumpulkan adalah DBD, malaria, diare, pneumonia, dan ILI yang merupakan pengembangan dari sistem EWARS (sistem kewaspadaan dini yang dikembangkan oleh Direktorat Surveilans, Imunisasi, Karantina, dan Kesehatan Matra, Ditjen PP/PL, Kementerian Kesehatan. Data iklim adalah suhu, curah hujan, hari hujan, dan

  20. Dental modifications: a perspective of Indonesian chronology and the current applications

    Directory of Open Access Journals (Sweden)

    Rusyad Adi Suriyanto

    2010-06-01

    of about ten thousand years ago until now. This knowledge can be used for either practical purposes of medicine and dentistry even forensic. Thus, it is also useful in forensic identification, as guidance with cultural background such as certain patterns of dental modifications cannot be disregarded. In the same way, patterns of modifications either intentional or unintentional can give a guidance to strengthen identification.Latar belakang: Modifikasi gigi geligi adalah salah satu bentuk ritus inisiasi. Tradisi ini dapat ditemukan di seluruh wilayah Indonesia, bahkan di Asia Tenggara pada masa lalu. Persoalan-persoalan kecantikan dan dentistri sebagai produk budaya termasuk modifikasi dan dekorasi tubuh dan gigi geligi telah muncul pada masa kini, contohnya tatto tubuh atau dekorasi gigi geligi dengan ornament hiasan dari emas, intan berlian dan juga bahan lainnya. Tujuan awal dari penelitian ini adalah untuk mendeskripsikan bagaimana fungsi modifikasi gigi geligi mewakili afinitas kultural dan afinitas biologis dari suatu populasi yang saling berkaitan dari waktu ke waktu, dimulai dari masa prasejarah hingga masa kini, terutama di wilayah Indonesia. tujuan penelitian yang kedua adalah untuk menyumbangkan pemikiran yang aplikatif yang berguna untuk bidang kesehatan terutama dentistri. Metode: Bahan penelitian adalah gigi geligi dari tengkorak dewasa Jawa, Bali dan Nusa Tenggara yang berasal dari situs-situs paleoantropologis-arkeologis, demikian pula sampel gigi geligi permanen individual dari populasi Bali saat ini/modern. Metode yang digunakan adalah deskriptif komparatif visual, dan penelusuran literatur etnografi dan arkeologi klasik. Hasil: Secara kronologis, modifikasi gigi geligi adalah rujukan bagi migrasi pada masa lalu dan dominasi budaya masa lalu. Kenyataan ini menunjukkan adanya afinitas biologis dan menunjukkan bagaimana budaya yang satu dapat mempengaruhi budaya yang lain. Simpulan: Beberapa efek dari praktek modifikasi gigi geligi adalah timbulnya

  1. ASPHYXIA, INTRACRANIAL HEMORRHAGES AND BRAIN EDEMA OF RISK CHILDREN IN THE ADVISORY INSTITUTE IN BITOLA FROM 1989-1994

    Directory of Open Access Journals (Sweden)

    M. ILIEVSKA,

    1997-09-01

    Full Text Available 3986 files have been examined in the Advisory Institute for a five year period in relation to the present risk factors in the pre, peri and postnatal period, the occurrence of asphyxia, I.H. (intracranial hemorrhages and brain edema and their outcome for the children. There were 958 or 32% risk children, out of them 206 or 22% were with asphyxia, 25 or 3% were with brain edema and 14 or 1,5% were with intracranial hemorrhages.The analysis for the risk factors shows that 119 of them were abortive , and from them 15% were born with asphyxia; 124 were SFD and 21% of them with asphyxia; 272 children weighed over 4500 gr., 7% of them with asphyxia and 0.4% with I.H., there were 68 twins, 12% of them with asphyxia. Out of the children with no risk registered, 6 were born with I.H., or 0,2%.Mothers under the age of 18 gave birth to 13% children with asphyxia; treated for sterility and anemia during pregnancy 15%; with increased blood pressure 14%; and 5% with maintained pregnancy.The highest delivery risk is present with children born with vacuum extraction (30% or every third child is with asphyxia and 3% with I.H. and with children delivered by caesarean section (14% with asphyxia.As for the position of the fetus-Citus pedalicus gave 55% children with asphyxia, and Situs pelvicus 12%.The worst damage is suffered by infants with premature amnion disruption (62% are with asphyxia; with the umbilical cord round the neck-56% with asphyxia and 6% with I.H.; and with muddled amniotic fluid and placenta pelvia-50%.The order of risk factors related to asphyxia, I.H. and brain edema is as follows: the first is premature amnion disruption, then follows the umbilical cord round the neck, the muddled amniotic fluid, and placenta previa and Citus pedalicus-which are obstetric problems. The next are the vacuum extraction and S.C. As for the gestatory period the order is as follows: first the abortive, then the twins and hypertrofic infants. The outcome of the

  2. Magnetic resonance maging of epidural and subdural spinal hematomas; Magnetresonanztomographie bei epiduralen und subduralen spinalen Haematomen

    Energy Technology Data Exchange (ETDEWEB)

    Felber, S. [Universitaetskliniken Innsbruck (Austria). Klinik fuer Neurologie]|[Universitaetskliniken Innsbruck (Austria). Inst. fuer Magnetresonanz]|[Universitaetskliniken des Saarlandes, Homburg/Saar (Germany). Inst. fuer Neuroradiologie; Langmaier, J. [Universitaetskliniken Innsbruck (Austria). Klinik fuer Neurochirurgie; Judmaier, W. [Universitaetskliniken Innsbruck (Austria). Inst. fuer Magnetresonanz]|[Universitaetskliniken Innsbruck (Austria). Klinik fuer Radiologie; Dessl, A. [Universitaetskliniken Innsbruck (Austria). Klinik fuer Radiologie; Ortler, M. [Universitaetskliniken Innsbruck (Austria). Klinik fuer Neurochirurgie; Birbamer, G. [Universitaetskliniken Innsbruck (Austria). Klinik fuer Neurologie]|[Universitaetskliniken Innsbruck (Austria). Inst. fuer Magnetresonanz; Piepgras, U. [Universitaetskliniken des Saarlandes, Homburg/Saar (Germany). Inst. fuer Neuroradiologie

    1994-11-01

    wurde. Wir berichten ueber 9 Patienten, die primaer magnetresonanztomographisch diagnostiziert wurden. Bei allen Patienten wurden T1, Spindichte und T2-gewichtete Bilder erzeugt. Zusaetzlich wurden T2*-gewichtete Gradientenechosequenzen angewendet. Die Magnetresonanztomographien wurden mit dem intraoperativen Situs korreliert. Computertomographische Befunde waren bei 4 und myelographische Befunde waren bei 2 Patienten vorhanden. Die Haematome komprimierten in 2 Faellen das Zervikalmark, bei 6 Patienten das Thorakalmark und bei 2 Patienten Konus und Cauda. Die Magnetresonanztomographie ergab 6 epidurale und 3 subdurale Haematome, operativ handelte es sich um 5 epidural und 4 subdurale Blutungen. In einem Fall konnte die Kernspintomographie nicht zwischen epi- und subduraler Lokalisation unterscheiden. Perakute Haematome (<24 h) waren isointens auf T1-gewichteten Bildern und hatten gemischte Signalintensitaet auf T2- und T*-gewichteten Bildern (n=3). Akute Blutungen (24 h bis 3 Tage) waren ebenfalls isointens auf T1 aber hypointens auf T- und T2*-gewichteten Bildern (n=4). Erst nach 7 Tagen fand sich die methaemoglobintypische Hyperintensitaet auf T1- und T2-gewichteten Bildern (n=2). Diese Ergebnisse unterstreichen, dass die Magnetresonanztomographie perakute und akute spinale Blutungen adaequat diagnostizieren kann. Die exakte Beurteilung der kraniokaudalen Ausdehnung verbessert die Operationsplanung. (orig.)

  3. Studi Hubungan Budaya dengan Aglomerasi Ekonomi (North-South Corridor Di Jawa Timur

    Directory of Open Access Journals (Sweden)

    Rachmad Kresna Sakti

    2012-05-01

    Full Text Available ABSTRACT   There are two things that commonly identify economic activitivities spacially such as concentration and imbalance.  East Java has two concentration poles of Java economic activities spacially. One of the concentration areas in East Java is in Surabaya, and that concentration activity is called North-South Corridor which is close to temple/ archeological site in East Java. Based on the fact, this research answers some questions like (1 Is there any interaction between culture dimension (the people and economic dimension? (2 How does culture dimension interacts with economic dimension? The aims of the research are (a To know the interaction between culture dimension (the people and economic dimension partially and cumulatively, so there will be North-South Corridor in East Java; (b To know the flow of mechanism from the detail of culture dimension interacting with economic dimension. The research was done outside North-South Corridor  area in East Java. The result of the research shows (1 there is a relationship between culture and economic dimension. It can be showed from the difference of each economic subject both inside and outside North-South Corridor in facing Hofstede Culture; (2 the difference of culture is formed by the environment of area inside and outside North-South Corridor.   Keywords: North-South Corridor, culture, economic concentration   ABSTRAKS   Terdapat dua hal yang seringkali menjadi ciri menonjol dari kegiatan perekonomian secara spasial, yaitu adanya konsentrasi dan ketimpangan. Di Pulau Jawa Terdapat dua kutub konsentrasi kegiatan ekonomi di Jawa secara spasial. Salah satunya wilayah konsentrasi kegiatan ekonomi di Surabaya Jawa Timur. Konsentrasi kegiatan tersebut dikenal dengan koridor utara – selatan. Menariknya koridor Utara-Selatan berhimpit dengan letak situs purbakala/candi di Jawa Timur.  Berpijak pada kesenjangan realita tersebut, penelitan ini berusaha menjawab pertanyaan berikut, (1 apakah

  4. PROTOTIPE PEMESANAN BAHAN PUSTAKA MELALUI WEB MENGGUNAKAN ACTIVE SERVER PAGE (ASP

    Directory of Open Access Journals (Sweden)

    Djoni Haryadi Setiabudi

    2002-01-01

    Full Text Available Electronic commerce is one of the components in the internet that growing fast in the world. In this research, it is developed the prototype for library service that offers library collection ordering especially books and articles through World Wide Web. In order to get an interaction between seller and buyer, there is an urgency to develop a dynamic web, which needs the technology and software. One of the programming languages is called Active Server Pages (ASP and it is combining with database system to store data. The other component as an interface between application and database is ActiveX Data Objects (ADO. ASP has an advantage in the scripting method and it is easy to make the configuration with database. This application consists of two major parts those are administrator and user. This prototype has the facilities for editing, searching and looking through ordering information online. Users can also do downloading process for searching and ordering articles. Paying method in this e-commerce system is quite essential because in Indonesia not everybody has a credit card. As a solution to this situation, this prototype has a form for user who does not have credit card. If the bill has been paid, he can do the transaction online. In this case, one of the ASP advantages will be used. This is called "session" when data in process would not be lost as long as the user still in that "session". This will be used in user area and admin area where the users and the admin can do various processes. Abstract in Bahasa Indonesia : Electronic commerce adalah satu bagian dari internet yang berkembang pesat di dunia saat ini. Pada penelitian ini dibuat suatu prototipe program aplikasi untuk pengembangan jasa layanan perpustakaan khususnya pemesanan artikel dan buku melalui World Wide Web. Untuk membangun aplikasi berbasis web diperlukan teknologi dan software yang mendukung pembuatan situs web dinamis sehingga ada interaksi antara pembeli dan penjual

  5. PENGARUH FAKTOR-FAKTOR PEMBENTUK LOYALITAS MAHASISWA UNIVERSITAS TERBUKA

    Directory of Open Access Journals (Sweden)

    Devi Ayuni

    2015-12-01

    rendahnya loyalitas atau retensi mahasiswa.Tujuan utama dari penelitian ini adalah menguji relasi-relasi diantara anteseden loyalitas, yaitu kualitas jasa, komitmen, kepuasan, dan reputasi.Populasi penelitian ini adalah peserta tuton masa registrasi 2015.1 yang berasal dari 4 fakultas dan 1 program pascasarjana.Metode nonprobability sampling dengan teknik judgemental sampling digunakan dalam penelitian ini. Adapun ukuran sampel yang diperlukan minimum 200 responden. Pengumpulan data dilakukan  secara survei dengan mengundang responden melalui surel untuk mengisi kuesioner online dalam situs google. Kemudian data dianalisis baik secara deskriptif maupun kuantitatif menggunakan analisis deskriptif dan analisis Structural Equation Modelling (SEM. Hasil pengujian hipotesis menunjukkan 6 dari 7 hipotesis diterima dengan hasil yang signifikan. Keenam hipotesis tersebut adalah pengaruh kualitas jasa terhadap kepuasan; pengaruh kualitas jasa terhadap reputasi; pengaruh komitmen terhadap kepuasan mahasiswa; pengaruh kepuasan terhadap reputasi; pengaruh kepuasan terhadap loyalitas; dan pengaruh reputasi terhadap loyalitas. Adapun satu hipotesis yang ditolak adalah pengaruh komitmen terhadap reputasi.

  6. WARNA SEBAGAI IDENTITAS MEREK PADA WEBSITE

    Directory of Open Access Journals (Sweden)

    Wirania Swasty

    2017-02-01

    Full Text Available Abstrak Website merupakan salah satu alat komunikasi berupa pemasaran-online interaktif yang dirancang untuk melibatkan pelanggan agar dapat meningkatkan kesadaran dan citra merek, atau memicu penjualan produk dan jasa. Website relatif terjangkau terutama bagi Usaha Mikro Kecil dan Menengah (UMKM. Permasalahan yang dihadapi UMKM di antaranya lemahnya kegiatan branding dan promosi serta kurang ahli dalam penguasaan teknologi. Menjembatani hal ini, maka diperlukan studi mengenai identitas merek pada website. Studi ini bertujuan untuk memberikan pemahaman akan pemanfaatan warna dalam identitas merek yang diaplikasikan pada website perusahaan. Diharapkan studi ini dapat berguna bagi UMKM dalam membangun merek dan melakukan program pemasaran dengan memanfaatkan warna identitas.Studi diawali dengan pengumpulan data melalui tinjauan literatur terkait dengan warna dan desain antarmuka website. Observasi kemudian dilakukan pada tiga website (zananachips.com, sneaklinid.com, dan kandurastudio.com sebagai studi kasus, yang merupakan situs resmi UMKM dari Bandung. UMKM yang digunakan sebagai studi kasus dipilih secara acak dari berbagai industri (makanan, layanan, dan kerajinan. Kuesioner yang dibagikan kepada responden secara acak kepada warga Kota Bandung dan sekitarnya. Dari studi ini terungkap bahwa Zanana dinilai telah berhasil memanfaatkan peranan warna dalam membangun merek. Studi ini juga menyarankan bahwa penerapan warna yang konsisten juga dapat menjadi faktor penentu suatu sistem identitas visual. Kata Kunci: identitas, merek, UMKM, warna, website Abstract Website is one of communication tool in the form of interactive online marketing which is designed to engage the customer in order to increase awareness and brand image, or trigger sales of products and services. Website relatively affordable, especially for Small and Medium Enterprises (SMEs. The problem faced by SMEs are weak branding and promotional activities as well as the lack of experts

  7. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  8. Multiphasic helical Computed Tomography of hepatocellular carcinoma. Evaluation after various percutaneous ablation procedures; Tomografia Computerizzata spirale multifasica dell'epatocarcinoma. Valutazione dopo differenti procedure ablative percutanee

    Energy Technology Data Exchange (ETDEWEB)

    Catalano, O.; Esposito, M.; Lobianco, R.; Cusati, B.; Altei, F.; Siani, A. [Ospedale S. Maria delle Grazie, Pozzuoli, NA (Italy). Servizio di Radiologia

    1999-12-01

    quella venosa e infine in quella arteriosa; nell'acquisizione diretta l'8% delle lesini non e' risultato riconoscibile. E' stato documentato tessuto neoplastico residuo nel 44% dei noduli e quantitativamente e' risultato del 100% nell'1% delle lesioni totali, >75% nel 3%, >50% nel 4%, >25% nel 12%, <25% nel 23%. Era localizzato centralmente nel 6% dei casi, perifericamente nel 12% ed eccentricamente nell'82%; la sua forma e' risultata semilunare nel 65% dei casi, ovalare nel 19% e con diverso aspetto nel 16%. La TC spirale multifasica consente ottimale valutazione del nodulo epatico primitivo sottoposto a procedure interventistiche percutanee e svolge un ruolo centrale nell'analisi dell'efficacia terapeutica. In relazione con il tipo di procedura si ha che nella termoablazione con radiofrequenza e nell'alcolizzazione con seduta singola le modificazioni sia del nodulo trattato che del parenchima sano sono piu' marcate mentre nell'alcolizzazione multissessione molti aspetti sono meno definiti nel loro(abstract truncated)

  9. PERAN KONTEKSTUAL TERHADAP KEJADIAN BALITA PENDEK DI INDONESIA (THE CONTEXTUAL ROLE OF OCCURRENCE STUNTED ON CHILDREN UNDER FIVE IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Sihadi Suhadi

    2013-07-01

    Full Text Available ABSTRAK Latar Belakang: Prevalensi anak balita pendek di Indonesia sebesar 36,8 persen. Anak yang balita pendek yang berat mempunyai IQ 11 point lebih rendah dibandingkan anak balita yang tidak pendek. Analisis ini mencari faktor penyebab anak balita pendek dari level individu, rumah tangga, dan provinsi terhadap terjadinya balita pendek. Tujuan: Diketahui faktor penyebab dari level individu, rumah tangga, dan provinsi terhadap kejadian balita pendek. Metodologi: Data yang digunakan bersumber data sekunder dari data Riskesdas 2010, data tersier dari BPS, IPKM, dan IPM. Jumlah sampel yang dianalisis sebesar 9 897 anak balita. Analisis statistik dengan menggunakan multilevel statistical model binary logistic regression.  Hasil:            Level provinsi mempunyai kontribusi 51,9 persen, individu 34,9 persen, dan rumah tangga 13,2 persen terhadap terjadinya anak balita pendek. Proporsi balita pendek 44,5 persen dapat diturunkan menjadi 42,5 persen bila konsumsi energi balita diperbaiki, menjadi 40,8 persen bila konsumsi energi rumah tangga diperbaiki, menjadi 43,2 persen bila ekonomi rumah tangga diperbaiki, menjadi 32,6 persen bila pola asuh diperbaiki, menjadi 35,8 persen bila ibu tidak pendek, menjadi 39,4 persen bila pendidikan ibu diperbaiki, dan menjadi 41,4 persen bila kemiskinan di tingkat provinsi diperbaiki. Simak Baca secara fonetik Kamus - Lihat kamus yang lebih detail Terjemahkan situs web mana pun NouvelObs-PrancisLa Información-SpanyolZamalek Fans-ArabSueddeutsche.de-JermanNews.de-JermanFocus Online-JermanNord-Cinema-PrancisTelegraph.co.uk-InggrisOneIndia-HindiMachu Picchu-SpanyolGuardian.co.uk-InggrisEl Confidencial-Spanyol Lakukan banyak hal dengan Google Terjemahan Cari resep sushi terbaik di dunia, tentunya dalam bahasa Jepang! Bebaskan kekuatan Penelusuran yang Diterjemahkan Google.Tetap berhubungan dengan sahabat pena Anda di Paris. Aktifkan terjemahan otomatis untuk email dan ngobrol di Gmail.Apa sih artinya