Conflict, location, and politics: Siting a nuclear waste repository

International Nuclear Information System (INIS)

Jacob, G.R.

1988-01-01

Nuclear power and the management of high-level radioactive waste is examined with the goal of explaining the forces driving the formulation of the 1982 Nuclear Waste Policy Act and a subsequent decision to site a nuclear waste repository at Yucca Mountain, Nevada. The study draws upon geographic, political, economic, and organizational factors to examine the commitment to dispose of spent fuel in a geologic repository located in Nevada or in Utah, Texas, Mississippi, Louisiana, or at Hanford Washington. Special attention is given to the impact of location, science and technology on the definition of the nuclear waste problem and political agendas, public participation, and the power of the nuclear establishment. The study finds that the choice of a Yucca Mountain Nevada as the preferred site for a repository was based more on technological precedent and political-economic expediency than on the demonstrated superiority of that site's geology. Conflict over a repository location is interpreted as a symptom of more fundamental conflicts concerning: the credibility of nuclear science, the legitimacy of federal authority and administration, and the priorities of environmental protection and a nuclear economy

Upstream waves simultaneously observed by ISEE and UKS

International Nuclear Information System (INIS)

Russell, C.T.; Luhmann, J.G.; Elphic, R.C.; Southwood, D.J.; Smith, M.F.; Johnstone, A.D.

1987-01-01

Measurements obtained in the solar wind by ISEE-2 and the United Kingdom Subsatellite (UKS) have been examined for observations of upstream waves. These data reveal that the waves in the foreshock region are enhanced at all frequencies from at least 0.003 Hz to 0.5 Hz. The wave spectra generally have a spectral peak, but this peak is usually broad and the peak frequency depends on the position of the spacecraft. Generally, the spectra seen at the two spacecraft are most similar at high frequencies and least similar at low frequencies. The geometry of the interaction is displayed in the plane containing the magnetic field, the solar wind velocity, and the spacecraft location. However, this coordinate system does not order all the observed wave properties. It does not clearly explain or order the handedness of the waves, or their direction of propagation. It is clear that the upstream region is inherently three-dimensional. The position-dependent nature of the upstream waves indicates that comparisons between ground-based measurements and in-situ observations must be undertaken with some caution

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

Science.gov (United States)

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Ultraviolet-fluorescent tattoo location of cutaneous biopsy site.

Science.gov (United States)

Chuang, Gary S; Gilchrest, Barbara A

2012-03-01

Cutaneous biopsies often heal with little or no scarring. Prior studies have shown an alarming percentage of patients who incorrectly identify biopsy sites at the time of surgery. To investigate the safety and utility of an ultraviolet (UV)-fluorescent tattoo for biopsy site identification. A preclinical proof of concept was established with skin culture. An UV-fluorescent tattoo was applied to discarded neonatal foreskin in culture medium. The stability of the tattooed skin was examined clinically and histologically. One patient with a recurrent basal cell carcinoma in a difficult-to-identify location underwent tattoo application at the time of biopsy to demarcate the site. The patient was monitored for tattoo reaction and referred for surgical excision. The cultured tissue exhibited stable UV fluorescence with daily washing. Tissue histology demonstrated tattoo particles lining the skin edge under fluorescent microscopy. The patient was reluctant to undergo another surgical procedure and instead returned to our clinic at 3 months and 17 months after the biopsy for management of other tumors. The patient had no symptoms of allergic reaction to the tattoo dye. The fluorescent tattoo remains invisible under visible light and visible only under Wood's light. The present study documents the utility of an UV-fluorescent tattoo to locate a biopsy site. © 2011 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

Environmental assessment overview, Reference repository location, Hanford site, Washington

International Nuclear Information System (INIS)

1986-05-01

In February 1983, the US Department of Energy (DOE) identified a reference repository location at the Hanford Site in Washington as one of the nine potentially acceptable sites for a mined geologic repository for spent nuclear fuel and high-level radioactive waste. The site is in the Columbia Plateau, which is one of five distinct geohydrologic settings considered for the first repository. To determine their suitability, the Hanford site and the eight other potentially acceptable sites have been evaluated in accordance with the DOE's General Guidelines for the Recommendation of Sites for the Nuclear Waste Repositories. On the basis of the evaluations reported in this EA, the DOE has found that the Hanford site is not disqualified under the guidelines. On the basis of these findings, the DOE is nominating the Hanford site as one of five sites suitable for characterization. 3 figs

Location and characterisation of pollution sites by principal ...

African Journals Online (AJOL)

Location and characterisation of pollution sites by principal component analysis of trace contaminants in a slightly polluted seasonal river: a case study of the Arenales River (Salta, Argentina) ... Keywords: trace element contamination, water quality, principal component analysis, Arenales River, Salta, Argentina ...

Environmental assessment: Reference repository location, Hanford site, Washington

Energy Technology Data Exchange (ETDEWEB)

none,

1986-05-01

In February 1983, the US Department of Energy (DOE) identified a reference repository location at the Hanford Site in Washington as one of the nine potentially acceptable sites for a mined geologic repository for spent nuclear fuel and high-level radioactive waste. The site is in the Columbia Plateau, which is one of five distinct geohydrologic settings considered for the first repository. To determine their suitability, the Hanford Site and the eight other potentially acceptable sites have been evaluated in accordance with the DOE's General Guidelines for the Recommendation of Sites for the Nuclear Waste Repositories. These evaluations were reported in draft environmental assessments (EAs), which were issued for public review and comment. After considering the comments received on the draft EAs, the DOE prepared the final EAs. On the basis of the evaluations reported in this EA, the DOE has found that the Hanford site is not disqualified under the guidelines. The DOE has also found that it is suitable for site characterization because the evidence does not support a conclusion that the site will not be able to meet each of the qualifying conditions specified in the guidelines. On the basis of these findings, the DOE is nominating the Hanford site as one of five sites suitable for characterization.

Environmental assessment: Reference repository location, Hanford site, Washington

Energy Technology Data Exchange (ETDEWEB)

none,

1986-05-01

In February 1983, the US Department of Energy (DOE) identified a reference repository location at the Hanford Site in Washington as one of the nine potentially acceptable sites for a mined geologic repository for spent nuclear fuel and high-level radioactive waste. The site is in the Columbia Plateau, which is one of five distinct geohydrologic settings considered for the first repository. To determine their suitability, the Hanford site and the eight other potentially acceptable sites have been evaluated in accordance with the DOE's General Guidelines for the Recommendation of Sites for the Nuclear Waste Repositories. These evaluations were reported in draft environmental assessments (EAs), which were issued for public review and comment. After considering the comments received on the draft EAs, the DOE prepared the final EAs. On the basis of the evaluations reported in this EA, the DOE has found that the Hanford site is not disqualified under the guidelines. The DOE has also found that is is suitable for site characterization because the evidence does not support a conclusion that the site will not be able to meet each of the qualifying conditions specified in the guidelines. On the basis of these findings, the DOE is nominating the Hanford site as one of five sites available for characterization.

Environmental assessment: Reference repository location, Hanford site, Washington

International Nuclear Information System (INIS)

1986-05-01

In February 1983, the US Department of Energy (DOE) identified a reference repository location at the Hanford Site in Washington as one of the nine potentially acceptable sites for a mined geologic repository for spent nuclear fuel and high-level radioactive waste. The site is in the Columbia Plateau, which is one of five distinct geohydrologic settings considered for the first repository. To determine their suitability, the Hanford Site and the eight other potentially acceptable sites have been evaluated in accordance with the DOE's General Guidelines for the Recommendation of Sites for the Nuclear Waste Repositories. These evaluations were reported in draft environmental assessments (EAs), which were issued for public review and comment. After considering the comments received on the draft EAs, the DOE prepared the final EAs. On the basis of the evaluations reported in this EA, the DOE has found that the Hanford site is not disqualified under the guidelines. The DOE has also found that it is suitable for site characterization because the evidence does not support a conclusion that the site will not be able to meet each of the qualifying conditions specified in the guidelines. On the basis of these findings, the DOE is nominating the Hanford site as one of five sites suitable for characterization

Environmental assessment: Reference repository location, Hanford site, Washington

International Nuclear Information System (INIS)

1986-05-01

In February 1983, the US Department of Energy (DOE) identified a reference repository location at the Hanford Site in Washington as one of the nine potentially acceptable sites for a mined geologic repository for spent nuclear fuel and high-level radioactive waste. The site is in the Columbia Plateau, which is one of five distinct geohydrologic settings considered for the first repository. To determine their suitability, the Hanford site and the eight other potentially acceptable sites have been evaluated in accordance with the DOE's General Guidelines for the Recommendation of Sites for the Nuclear Waste Repositories. These evaluations were reported in draft environmental assessments (EAs), which were issued for public review and comment. After considering the comments received on the draft EAs, the DOE prepared the final EAs. On the basis of the evaluations reported in this EA, the DOE has found that the Hanford site is not disqualified under the guidelines. The DOE has also found that is is suitable for site characterization because the evidence does not support a conclusion that the site will not be able to meet each of the qualifying conditions specified in the guidelines. On the basis of these findings, the DOE is nominating the Hanford site as one of five sites available for characterization

Optimum MRS site location to minimize spent fuel transportation impacts

International Nuclear Information System (INIS)

Hoskins, R.E.

1987-01-01

A range of spent fuel transportation system parameters are examined in terms of attributes important to minimizing transportation impacts as a basis for identifying geographic regions best suited for siting a monitored retrievable storage (MRS) facility. Transportation system parameters within existing transport cask design and transportation mode capabilities were systematically analyzed. The optimum MRS location was found to be very sensitive to transportation system assumptions particularly with regard to the relative efficiencies of the reactor-to-MRS and MRS-to-repository components of the system. Moreover, dramatic improvements in the reactor-to-MRS component can be made through use of multiple cask shipment of the largest practical casks by dedicated train compared to the traditional single cask rail (70%) and truck (30%) shipments assumed the Department of Energy in their studies that defined the optimum MRS location in the vicinity of Tennessee. It is important to develop and utilize an efficient transportation system irrespective of whether or not an MRS is in the system. Assuming reasonably achievable efficiency in reactor-to-MRS spent fuel transportation and assigning equal probabilities to the three western sites selected for characterization of being the repository site, the optimum MRS location would be in the far-mid-western states. Based on various geographic criteria including barge access and location in a nuclear service area, the State of Tennessee ranks any place from 12th to the 25th at a penalty of about 30% over the minimum achievable impacts. While minimizing transportation impacts is an important factor, other criteria should also be considered in selecting an MRS site

Sites for locations of nuclear reactors; Sitios para emplazamientos de reactores nucleares

Energy Technology Data Exchange (ETDEWEB)

Balcazar, M.; Huerta, M.; Lopez, A., E-mail: miguel.balcazar@inin.gob.mx [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)

2014-10-15

A restriction on sites of nuclear energy is the history of seismic activity, in its magnitude (Richter) and intensity (Mercalli). This article delimits the areas of greatest magnitude and national seismic intensity, with restrictions of ground acceleration; the supplement areas with a low magnitude of seismic activity are shown. Potential sites for the location of these sites are introduced into a geographic information system. The set of geo-referenced data contains the location of the active volcanic manifestations; the historical record of earthquake epicenters, magnitudes and intensities; major geological faults; surface hydrology and water bodies; location of population density; protected areas; contour lines; the rock type or geology. The geographic information system allows entering normative criteria and environmental restrictions that correlate with geo-referenced data described above, forms both probable and exclusion areas for the installation of nuclear sites. (Author)

Stratigraphic Profiles for Selected Hanford Site Seismometer Stations and Other Locations

Energy Technology Data Exchange (ETDEWEB)

Last, George V. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

2014-02-01

Stratigraphic profiles were constructed for eight selected Hanford Site seismometer stations, five Hanford Site facility reference locations, and seven regional three-component broadband seismometer stations. These profiles provide interpretations of the subsurface layers to support estimation of ground motions from past earthquakes, and the prediction of ground motions from future earthquakes. In most cases these profiles terminated at the top of the Wanapum Basalt, but at selected sites profiles were extended down to the top of the crystalline basement. The composite one-dimensional stratigraphic profiles were based primarily on previous interpretations from nearby boreholes, and in many cases the nearest deep borehole is located kilometers away.

Paradox Basin site characterization report: preparation papers, Gibson Dome location

International Nuclear Information System (INIS)

1982-11-01

This document contains Part C, Identification of Pertinent Issues, of the site characterization report. The site characterization report, preparation papers, includes a description of detailed field studies and efforts to collect data to resolve key geologic and environmental issues in the Gibson Dome location within the Paradox Basin Region of Utah

Reservoir Sedimentation and Upstream Sediment Sources: Perspectives and Future Research Needs on Streambank and Gully Erosion

Science.gov (United States)

Fox, G. A.; Sheshukov, A.; Cruse, R.; Kolar, R. L.; Guertault, L.; Gesch, K. R.; Dutnell, R. C.

2016-05-01

The future reliance on water supply and flood control reservoirs across the globe will continue to expand, especially under a variable climate. As the inventory of new potential dam sites is shrinking, construction of additional reservoirs is less likely compared to simultaneous flow and sediment management in existing reservoirs. One aspect of this sediment management is related to the control of upstream sediment sources. However, key research questions remain regarding upstream sediment loading rates. Highlighted in this article are research needs relative to measuring and predicting sediment transport rates and loading due to streambank and gully erosion within a watershed. For example, additional instream sediment transport and reservoir sedimentation rate measurements are needed across a range of watershed conditions, reservoir sizes, and geographical locations. More research is needed to understand the intricate linkage between upland practices and instream response. A need still exists to clarify the benefit of restoration or stabilization of a small reach within a channel system or maturing gully on total watershed sediment load. We need to better understand the intricate interactions between hydrological and erosion processes to improve prediction, location, and timing of streambank erosion and failure and gully formation. Also, improved process-based measurement and prediction techniques are needed that balance data requirements regarding cohesive soil erodibility and stability as compared to simpler topographic indices for gullies or stream classification systems. Such techniques will allow the research community to address the benefit of various conservation and/or stabilization practices at targeted locations within watersheds.

Characterization of wind velocities in the upstream induction zone of a wind turbine using scanning continuous-wave lidars

DEFF Research Database (Denmark)

Simley, Eric; Angelou, Nikolas; Mikkelsen, Torben Krogh

2016-01-01

As a wind turbine generates power, induced velocities, lower than the freestream velocity, will be present upstream of the turbine due to perturbation of the flow by the rotor. In this study, the upstream induction zone of a 225kW horizontal axis Vestas V27 wind turbine located at the Danish...... Technical University’s Risø campus is investigated using a scanning Light Detection and Ranging (lidar) system. Three short-range continuous-wave “WindScanner” lidars are positioned in the field around the V27 turbine allowing detection of all three components of the wind velocity vectors within...... the induction zone. The time-averaged mean wind speeds at different locations in the upstream induction zone are measured by scanning a horizontal plane at hub height and a vertical plane centered at the middle of the rotor extending roughly 1.5 rotor diameters (D) upstream of the rotor. Turbulence statistics...

Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

International Nuclear Information System (INIS)

Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

1987-01-01

A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

Draft environmental assessment: reference repository location, Hanford Site, Washington. Nuclear Waste Policy Act (Section 112)

International Nuclear Information System (INIS)

1984-12-01

In February 1983, the US Department of Energy (DOE) identified a reference repository location at the Hanford Site in Washington as one of nine potentially acceptable sites for a mined geologic repository for spent nuclear fuel and high-level radioactive waste. To determine their suitability, the reference repository location at the Hanford Site and the eight other potentially acceptable sites have been evaluated in accordance with the DOE's General Guidelines for the Recommendation of Sites for Nuclear Waste Repositories. These evaluations are reported in this draft environmental assessment (EA), which is being issued for public review and comment. The DOE findings and determinations that are based on these evaluations are preliminary and subject to public review and comment. A final EA will be prepared after considering the comments received on the draft EA. The reference repository location at Hanford is located in the Columbia Plateau, one of five distinct geohydrologic settings that are being considered for the first repository. On the basis of the evaluations reported in this draft EA, the DOE has found that the reference repository location at Hanford is not disqualified under the guidelines. The DOE has also found that it is suitable for site characterization because the evidence does not support a conclusion that the site will not be able to meet each of the qualifying conditions specified in the guidelines. On the basis of these findings, the DOE is proposing to nominate the reference repository location at Hanford as one of five sites suitable for characterization. Furthermore, having performed a comparative evaluation of the five sites proposed for nomination, the DOE has determined that the reference repository location at Hanford is one of three sites preferred for site characterization

Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

Science.gov (United States)

Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

2018-04-06

The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

The Influence of Heritage Sites as Filming Locations on Tourists’ Decisions to Visit Sites and Their Perceptions of Them. Case Study: Game of Thrones

Directory of Open Access Journals (Sweden)

Emily Bowyer

2017-10-01

Full Text Available This paper provides an overview of the authors’ master thesis and addresses the effects of World Heritage Sites and heritage sites which are used as filming locations on visitor perceptions of a site and their decision to visit a site. Film-induced tourism is becoming increasingly popular and it is important to assess its impacts on World Heritage Sites and heritage sites used as locations. The integration of the different aspects of heritage and filming at a site including elements and the communication between all the different parties involved are also addressed. The case study used is the popular television series Game of Thrones focusing on various locations in Northern Ireland and Dubrovnik, Croatia. The paper aims to provide a starting platform for future research on heritage sites used as filming locations and the possible impacts that this may have.

Upstream passage, spawning, and stock identification of fall chinook in the Snake River, 1992 and 1993. Final report

International Nuclear Information System (INIS)

Blankenship, H.L.; Mendel, G.W.

1997-05-01

This final report of the 3-year study summarizes activities and results for 1993. Study objectives were to: (1) determine the source of losses (or accounting errors) for adult chinook salmon between Ice Harbor Dam (IHR) and Lower Granite Dam (LGR), and upstream of LGR in the Snake River; (2) identify spawning locations upstream of LGR for calibration of aerial redd surveys, redd habitat mapping, carcass recovery for genetic stock profile analysis, and correction of estimated adult/redd ratios; and (3) estimate passage and migration times at Snake River. 200 fall chinook salmon were radio tagged and tracked with aerial, fixed-site, and ground mobile tracking. Fish were released upstream of IHR at Charbonneau Park (CHAR). 190 of the fish were tracked or relocated away from CHAR. 59 fish descended to below IHR without crossing Lower Monumental Dam (LMO). Another 128 salmon passed upstream of LMO without falling back at IHR. Only 80 salmon passed Little Goose Dam (LGO) without falling back at a downstream dam; 66 of these fish passed LGR. Many fish that fell back reascended the dams. A total of 72 salmon released at CHAR passed upstream of LGR, including fish that had fallen back and reascended a dam. Over 80 percent of the salmon that entered Lyons Ferry Hatchery each year had reached LGO before descending to the hatchery. Extensive wandering was documented between LMO and upstream of LGR before salmon entered Lyons Ferry Hatchery or the Tucannon River. In 1993, 41 salmon were found to be of hatchery origin when recovered. These fish entered Lyons Ferry Hatchery with similar movements to unmarked salmon. Each year a few salmon have remained near the hatchery without entering, which suggests the hatchery may have inadequate attraction flows. Fall chinook passed lower Snake River dams in 2-5 days each on average. Median travel times through LMO and LGO were 1.0-1.3 days each, which was slower than for spring chinook or steelhead in 1993. 5 refs., 21 figs., 20 tabs

Library Facility Siting and Location Handbook. The Greenwood Library Management Collection.

Science.gov (United States)

Koontz, Christine M.

This handbook is a guide to the complex process of library facility siting and location. It includes relevant research and professionals' siting experiences, as well as actual case studies of closures, openings, mergers, and relocations of library facilities. While the bulk of the volume provides practical information, the work also presents an…

Facebook, Twitter Activities Sites, Location and Students' Interest in Learning

Science.gov (United States)

Igbo, J. N.; Ezenwaji, Ifeyinwa; Ajuziogu, Christiana U.

2018-01-01

This study was carried out to ascertain the influence of social networking sites activities (twitter and Facebook) on secondary school students' interest in learning It also considered the impact of these social networking sites activities on location of the students. Two research questions and two null hypotheses guided the study. Mean and…

NPL Site Locations

Data.gov (United States)

U.S. Environmental Protection Agency — The National Priorities List (NPL) is a list published by EPA of Superfund sites. A site must be added to this list before remediation can begin under Superfund. The...

Influence of Upstream and Downstream Compressor Stators on Rotor Exit Flow Field

Directory of Open Access Journals (Sweden)

Nicole L. Key

2014-01-01

Full Text Available Measurements acquired at the rotor exit plane illuminate the interaction of the rotor with the upstream vane row and the downstream vane row. The relative phase of the upstream and downstream vane rows is adjusted using vane clocking so that the effect of the upstream propagating potential field from the downstream stator can be distinguished from the effects associated with the wakes shed from the upstream stator. Unsteady absolute flow angle information shows that the downstream potential field causes the absolute flow angle to increase in the vicinity of the downstream stator leading edge. The presence of Stator 1 wake is also detected at this measurement plane using unsteady total pressure data. The rotor wakes are measured at different circumferential locations across the vane passage, and the influence of Stator 1 wake on the suction side of the rotor wake is evident. Also, the influence of the downstream stator is detected on the pressure side of the rotor wake for a particular clocking configuration. Understanding the role of the surrounding vane rows on rotor wake development will lead to improved comparison between experimental data and results from computational models.

Tumour location within the breast: Does tumour site have prognostic ability?

Science.gov (United States)

Rummel, Seth; Hueman, Matthew T; Costantino, Nick; Shriver, Craig D; Ellsworth, Rachel E

2015-01-01

Tumour location within the breast varies with the highest frequency in the upper outer quadrant (UOQ) and lowest frequency in the lower inner quadrant (LIQ). Whether tumour location is prognostic is unclear. To determine whether tumour location is prognostic, associations between tumour site and clinicopathological characteristics were evaluated. All patients enrolled in the Clinical Breast Care Project whose tumour site-UOQ, upper inner quadrant (UIQ), central, LIQ, lower outer quadrant (LOQ)-was determined by a single, dedicated breast pathologist were included in this study. Patients with multicentric disease (n = 122) or tumours spanning multiple quadrants (n = 381) were excluded from further analysis. Clinicopathological characteristics were analysed using chi-square tests for univariate analysis with multivariate analysis performed using principal components analysis (PCA) and multiple logistic regression. Significance was defined as P location, 30 had bilateral disease. Tumour location in the UOQ (51.5%) was significantly higher than in the UIQ (15.6%), LOQ (14.2%), central (10.6%), or LIQ (8.1%). Tumours in the central quadrant were significantly more likely to have higher tumour stage (P = 0.003) and size (P location as a prognostic factor revealed that although tumours in the central region are associated with less favourable outcome, these associations are not independent of location but rather driven by larger tumour size. Tumours in the central region are more difficult to detect mammographically, resulting in larger tumour size at diagnosis and thus less favourable prognosis. Together, these data demonstrate that tumour location is not an independent prognostic factor.

Identification of putative regulatory motifs in the upstream regions of co-expressed functional groups of genes in Plasmodium falciparum

Directory of Open Access Journals (Sweden)

Joshi NV

2009-01-01

Full Text Available Abstract Background Regulation of gene expression in Plasmodium falciparum (Pf remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS; this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.

Vertical view of Apollo 16 landing site located Descartes area lunar nearside

Science.gov (United States)

1971-01-01

A vertical view of the Apollo 16 landing site located in the Descartes area lunar nearside. The overlay indicates the location of the proposed touchdown point for the Apollo 16 Lunar Module. Descartes is located west of the Sea of Nectar and southwest of the Sea of Tranquility. This photograph was taken with a 500mm lens camera from lunar orbit by the Apollo 14 crew.

Assessment of local GNSS baselines at co-location sites

Science.gov (United States)

Herrera Pinzón, Iván; Rothacher, Markus

2018-01-01

As one of the major contributors to the realisation of the International Terrestrial Reference System (ITRS), the Global Navigation Satellite Systems (GNSS) are prone to suffer from irregularities and discontinuities in time series. While often associated with hardware/software changes and the influence of the local environment, these discrepancies constitute a major threat for ITRS realisations. Co-located GNSS at fundamental sites, with two or more available instruments, provide the opportunity to mitigate their influence while improving the accuracy of estimated positions by examining data breaks, local biases, deformations, time-dependent variations and the comparison of GNSS baselines with existing local tie measurements. With the use of co-located GNSS data from a subset sites of the International GNSS Service network, this paper discusses a global multi-year analysis with the aim of delivering homogeneous time series of coordinates to analyse system-specific error sources in the local baselines. Results based on the comparison of different GNSS-based solutions with the local survey ties show discrepancies of up to 10 mm despite GNSS coordinate repeatabilities at the sub-mm level. The discrepancies are especially large for the solutions using the ionosphere-free linear combination and estimating tropospheric zenith delays, thus corresponding to the processing strategy used for global solutions. Snow on the antennas causes further problems and seasonal variations of the station coordinates. These demonstrate the need for a permanent high-quality monitoring of the effects present in the short GNSS baselines at fundamental sites.

Nuclear event time histories and computed site transfer functions for locations in the Los Angeles region

Science.gov (United States)

Rogers, A.M.; Covington, P.A.; Park, R.B.; Borcherdt, R.D.; Perkins, D.M.

1980-01-01

This report presents a collection of Nevada Test Site (NTS) nuclear explosion recordings obtained at sites in the greater Los Angeles, Calif., region. The report includes ground velocity time histories, as well as, derived site transfer functions. These data have been collected as part of a study to evaluate the validity of using low-level ground motions to predict the frequency-dependent response of a site during an earthquake. For this study 19 nuclear events were recorded at 98 separate locations. Some of these sites have recorded more than one of the nuclear explosions, and, consequently, there are a total of 159, three-component station records. The location of all the recording sites are shown in figures 1–5, the station coordinates and abbreviations are given in table 1. The station addresses are listed in table 2, and the nuclear explosions that were recorded are listed in table 3. The recording sites were chosen on the basis of three criteria: (1) that the underlying geological conditions were representative of conditions over significant areas of the region, (2) that the site was the location of a strong-motion recording of the 1971 San Fernando earthquake, or (3) that more complete geographical coverage was required in that location.

Premodelling of the importance of the location of the upstream hydraulic boundary of a regional flow model of the Laxemar-Simpevarp area. Site descriptive modelling SDM-Site Laxemar

International Nuclear Information System (INIS)

Holmen, Johan G.

2008-03-01

The location of the westernmost hydraulic boundary of a regional groundwater flow model representing the Laxemar investigation area is of importance as the regional flow of groundwater is primarily from the west towards the sea (as given by the regional topography). If the westernmost boundary condition of a regional flow model is located to close to the investigation area, the regional flow model may underestimate the magnitude of the regional groundwater flow (at the investigation area), as well as overestimate breakthrough times of flow paths from the repository area, etc. Groundwater flows have been calculated by use of two mathematical (numerical) models: A very large groundwater flow model, much larger than the regional flow model used in the Laxemar site description version 1.2, and a smaller flow model that is of a comparable size to the regional model used in the site description. The models are identical except for the different horizontal extensions of the models; the large model extends to the west much further than the small model. The westernmost lateral boundary of the small model is a topographic water divide approx. 7 km from the central parts of the Laxemar investigation area, and the westernmost lateral boundary of the large model is a topographic water divide approx. 40 km from the central parts of the Laxemar investigation area. In the models the lateral boundaries are defined as no-flow boundaries. The objective of the study is to calculate and compare the groundwater flow properties at a tentative repository area at Laxemar; by use of a large flow model and a small flow model. The comparisons include the following three parameters: - Length of flow paths from the tentative repository area. - Advective breakthrough time for flow paths from the tentative repository area. - Magnitude of flow at the tentative repository area. The comparisons demonstrated the following considering the median values of the obtained distributions of flow paths

Characterization of sediment transport upstream and downstream from Lake Emory on the Little Tennessee River near Franklin, North Carolina, 2014–15

Science.gov (United States)

Huffman, Brad A.; Hazell, William F.; Oblinger, Carolyn J.

2017-09-06

Federal, State, and local agencies and organizations have expressed concerns regarding the detrimental effects of excessive sediment transport on aquatic resources and endangered species populations in the upper Little Tennessee River and some of its tributaries. In addition, the storage volume of Lake Emory, which is necessary for flood control and power generation, has been depleted by sediment deposition. To help address these concerns, a 2-year study was conducted in the upper Little Tennessee River Basin to characterize the ambient suspended-sediment concentrations and suspended-sediment loads upstream and downstream from Lake Emory in Franklin, North Carolina. The study was conducted by the U.S. Geological Survey in cooperation with Duke Energy. Suspended-sediment samples were collected periodically, and time series of stage and turbidity data were measured from December 2013 to January 2016 upstream and downstream from Lake Emory. The stage data were used to compute time-series streamflow. Suspended-sediment samples, along with time-series streamflow and turbidity data, were used to develop regression models that were used to estimate time-series suspended-sediment concentrations for the 2014 and 2015 calendar years. These concentrations, along with streamflow data, were used to compute suspended-sediment loads. Selected suspended-sediment samples were collected for analysis of particle-size distribution, with emphasis on high-flow events. Bed-load samples were also collected upstream from Lake Emory.The estimated annual suspended-sediment loads (yields) for the upstream site for the 2014 and 2015 calendar years were 27,000 short tons (92 short tons per square mile) and 63,300 short tons (215 short tons per square mile), respectively. The annual suspended-sediment loads (yields) for the downstream site for 2014 and 2015 were 24,200 short tons (75 short tons per square mile) and 94,300 short tons (292 short tons per square mile), respectively. Overall, the

The -14010*C variant associated with lactase persistence is located between an Oct-1 and HNF1a binding site and increases lactase promoter activity

DEFF Research Database (Denmark)

Jensen, Tine G K; Liebert, Anke; Lewinsky, Rikke

2011-01-01

In most people worldwide intestinal lactase expression declines in childhood. In many others, particularly in Europeans, lactase expression persists into adult life. The lactase persistence phenotype is in Europe associated with the -13910*T single nucleotide variant located 13,910 bp upstream th...

Siting locally-unwanted facilities: What can be learnt from the location of Italian power plants

International Nuclear Information System (INIS)

Garrone, Paola; Groppi, Angelamaria

2012-01-01

The reaction of communities to the development of energy facilities is based on the environmental impact of the investment, but it also reflects the ex-ante propensity of residents to engage in collective actions. In this work we have examined the requests of authorization of Italian power producers for new thermal plants with the purpose of testing the efficiency of market-based siting policies. The classical location factors, e.g., infrastructure availability, have been confirmed to play a role, and there is a weak evidence that authorization demands have targeted communities that suffer less environmental damage. However our findings have also revealed that power producers are likely to avoid potentially suitable sites if they host a highly activistic community. The paper also discusses some modifications concerning siting policies that could improve the alignment between community responses and the environmental costs of new energy facilities. - Highlights: ► We model location choices for polluting power plants by Italian producers in 1999–2006. ► The efficiency of market-based siting policies is tested (i.e., plants located where environmental damage is lower). ► More than environmental costs, voice factors prevailed on the location choices. ► We conclude that market-based siting policies does not ensure an efficient outcome. ► Developers and communities relationship may suffer from relevant transaction costs

Factors affecting food chain transfer of mercury in the vicinity of the Nyanza site, Sudbury River, Massachusetts

Science.gov (United States)

Haines, T.A.; May, T.W.; Finlayson, R.T.; Mierzykowski, S.E.

2003-01-01

The influence of the Nyanza Chemical Waste Dump Superfund Site on the Sudbury River, Massachusetts, was assessed by analysis of sediment, fish prey organisms, and predator fish from four locations in the river system. Whitehall Reservoir is an impoundment upstream of the site, and Reservoir #2 is an impoundment downstream of the site. Cedar Street is a flowing reach upstream of the site, and Sherman Bridge is a flowing reach downstream of the site. Collections of material for analysis were made three times, in May, July, and October. Sediment was analyzed for acid-volatile sulfide (AVS), simultaneously-extracted (SEM) metals (As, Cd, Cr, Hg, Pb, Sb, Zn), and total recoverable Hg. The dominant predatory fish species collected at all sites, largemouth bass (Micropterus salmoides), was analyzed for the same suite of metals as sediment. Analysis of stomach contents of bass identified small fish (yellow perch Perca flavescens, bluegill Lepomis macrochirus, and pumpkinseed Lepomis gibbosus), crayfish, and dragonfly larvae as the dominant prey organisms. Samples of the prey were collected from the same locations and at the same times as predator fish, and were analyzed for total and methyl mercury. Results of AVS and SEM analyses indicated that sediments were not toxic to aquatic invertebrates at any site. The SEM concentrations of As, Cd, and Cr were significantly higher at Reservoir #2 than at the reference sites, and SEM As and Cd were significantly higher at Sherman Bridge than at Cedar St. Sediment total Hg was elevated only at Reservoir #2. Hg was higher at site-influenced locations in all fish species except brown bullhead (Ameiurus nebulosus). Cd was higher in bluegill, black crappie (Pomoxis nigromaculatus), and brown bullhead, and Cr was higher in largemouth bass fillet samples but not in whole-body samples. There were no seasonal differences in sediment or prey organism metals, but some metals in some fish species did vary over time in an inconsistent manner

POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

Energy Technology Data Exchange (ETDEWEB)

ANDERSON,C.W.APPELLA,E.

2003-10-23

The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

Experimental investigation on the wake interference among wind turbines sited in atmospheric boundary layer winds

Institute of Scientific and Technical Information of China (English)

W. Tian; A. Ozbay; X. D. Wang; H.Hu

2017-01-01

We examined experimentally the effects of incom-ing surface wind on the turbine wake and the wake interfer-ence among upstream and downstream wind turbines sited in atmospheric boundary layer (ABL) winds. The experi-ment was conducted in a large-scale ABL wind tunnel with scaled wind turbine models mounted in different incom-ing surface winds simulating the ABL winds over typical offshore/onshore wind farms. Power outputs and dynamic loadings acting on the turbine models and the wake flow char-acteristics behind the turbine models were quantified. The results revealed that the incoming surface winds significantly affect the turbine wake characteristics and wake interference between the upstream and downstream turbines. The velocity deficits in the turbine wakes recover faster in the incoming surface winds with relatively high turbulence levels. Varia-tions of the power outputs and dynamic wind loadings acting on the downstream turbines sited in the wakes of upstream turbines are correlated well with the turbine wakes charac-teristics. At the same downstream locations, the downstream turbines have higher power outputs and experience greater static and fatigue loadings in the inflow with relatively high turbulence level, suggesting a smaller effect of wake inter-ference for the turbines sited in onshore wind farms.

Suppression of HPV-16 late L1 5′-splice site SD3632 by binding of hnRNP D proteins and hnRNP A2/B1 to upstream AUAGUA RNA motifs

Science.gov (United States)

Li, Xiaoze; Johansson, Cecilia; Glahder, Jacob; Mossberg, Ann-Kristin; Schwartz, Stefan

2013-01-01

Human papillomavirus type 16 (HPV-16) 5′-splice site SD3632 is used exclusively to produce late L1 mRNAs. We identified a 34-nt splicing inhibitory element located immediately upstream of HPV-16 late 5′-splice site SD3632. Two AUAGUA motifs located in these 34 nt inhibited SD3632. Two nucleotide substitutions in each of the HPV-16 specific AUAGUA motifs alleviated splicing inhibition and induced late L1 mRNA production from episomal forms of the HPV-16 genome in primary human keratinocytes. The AUAGUA motifs bind specifically not only to the heterogeneous nuclear RNP (hnRNP) D family of RNA-binding proteins including hnRNP D/AUF, hnRNP DL and hnRNP AB but also to hnRNP A2/B1. Knock-down of these proteins induced HPV-16 late L1 mRNA expression, and overexpression of hnRNP A2/B1, hnRNP AB, hnRNP DL and the two hnRNP D isoforms hnRNP D37 and hnRNP D40 further suppressed L1 mRNA expression. This inhibition may allow HPV-16 to hide from the immune system and establish long-term persistent infections with enhanced risk at progressing to cancer. There is an inverse correlation between expression of hnRNP D proteins and hnRNP A2/B1 and HPV-16 L1 production in the cervical epithelium, as well as in cervical cancer, supporting the conclusion that hnRNP D proteins and A2/B1 inhibit HPV-16 L1 mRNA production. PMID:24013563

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

Science.gov (United States)

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Science.gov (United States)

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

Science.gov (United States)

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

78 FR 21155 - Eastman Kodak Company, IPS-Dayton Location, Including On-site Leased Workers From Adecco, Dayton...

Science.gov (United States)

2013-04-09

... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,387] Eastman Kodak Company, IPS--Dayton Location, Including On-site Leased Workers From Adecco, Dayton, Ohio; Notice of... and former workers of Eastman Kodak Company, IPS--Dayton Location, including on-site leased workers...

Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

Science.gov (United States)

Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

2012-01-01

The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

Monitoring upstream sinkhole development by detailed sonar profiling

Energy Technology Data Exchange (ETDEWEB)

Rigbey, S. [Acres International Ltd., Niagara Falls, ON (Canada)

2004-09-01

This paper describes the development and use of a simple sonar system that has been used by engineers for routine monitoring of small sinkholes on the upstream face of a distressed earth dam. Improper construction of the dam led to the development of several sinkholes measuring 10 to 20 m in diameter upstream from the dam which is founded on deep alluvial sands and gravels. The dam has a central core of silt and leakage varies between 200 and 500 l/s, depending on the water level of the reservoir. The main issues with the upstream blanket are: improper fill placement due to the inability to dewater the area properly; omission of a filter material between the blanket and the alluvium foundation; thin placement of fill and runnelling of the blanket prior to impoundment; and, short upstream extent of the blanket. A downstream weighting toe of material was placed to address the seepage and piping that developed immediately following impounding. Other incidents continued over the years, such as downstream sinkholes, slumping of the crest and repairs about 12 years after construction. An inverter filter was also constructed to better control the seepage. Simple bathymetric surveys conducted by sounding the bottom of the reservoir from the ice surface each winter revealed the presence of several large sinkholes. Although infilling programs were conducted, sinkholes redeveloped after each program. The bathymetric surveys were found to be limited in accuracy and repeatability. Therefore, it was not possible to monitor small developments on a yearly basis. A 3-dimensional seepage model was developed to reconcile some of the unexplained piezometric patterns and to better understand the seepage patterns. However, this was also unsuccessful on its own. A trial sonar survey was then undertaken in 2002 by a Vancouver-based sonar company using an Imagenix profiling sonar head. It was successful in locating a small, previously unknown sinkhole measuring a few metres in diameter at

Location and nature of calcium-binding sites in salivary acidic proline-rich phosphoproteins

International Nuclear Information System (INIS)

Bennick, A.; McLaughlin, A.C.; Grey, A.A.; Madapallimattam, G.

1981-01-01

The location of the calcium-binding sites in the human acidic proline-rich proteins, salivary proteins A and C, was determined by equilibrium dialysis of the tryptic peptides with buffers containing 45 Ca. All the calcium-binding sites are located in the NH 2 -terminal tryptic peptide (TX peptide). The nature of the calcium binding sites in the TX peptide and native salivary proteins A and C, as well as dephosphorylated proteins was compared. Two types of sites can be distinguished in peptide TX. Type I sites have an apparent dissociation constant (K) of 38 μM and are responsible for the binding of 2.6 mol of Ca/mol of peptide. The corresponding figures for Type II sites are 780 μM and 5.3 mol of Ca/mol of peptide. In the native proteins, the amount of calcium bound at the type II sites decreases to 3.9 mol of Ca/mol of proteins A and C and K increases to 1100 μM. The amount of calcium bound at type I sites decreases to 1.5 mol/mol of protein A and 0.6 mol/mol of protein C, but there is no change in K. Dephosphorylation affects the calcium binding at both types of sites. The experiments indicate that the COOH-terminal parts of the native proteins affect the number and the nature of the protein calcium-binding sites. Proton and phosphorous NMR data demonstrate that β-COOH in aspartic acid, as well as phosphoserine, are part of the calcium-binding sites. The difference in calcium binding to salivary proteins A and C may be due at least partially to differences in the environment of one or more aspartic acids

76 FR 64943 - Proposed Cercla Administrative Cost Recovery Settlement; ACM Smelter and Refinery Site, Located...

Science.gov (United States)

2011-10-19

... Settlement; ACM Smelter and Refinery Site, Located in Cascade County, MT AGENCY: Environmental Protection... projected future response costs concerning the ACM Smelter and Refinery NPL Site (Site), Operable Unit 1..., Helena, MT 59626. Mr. Sturn can be reached at (406) 457-5027. Comments should reference the ACM Smelter...

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Directory of Open Access Journals (Sweden)

Feng-Yu Wang

Full Text Available Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2 revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292 and four putative (S124, V189, V286, I290 tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Use of Loran-C navigation system to accurately determine sampling site location in an above ground cooling reservoir

International Nuclear Information System (INIS)

Lockwood, R.E.; Blankinship, D.R.

1994-01-01

Environmental monitoring programs often require accurate determination of sampling site locations in aquatic environments. This is especially true when a open-quotes pictureclose quotes of high resolution is needed for observing a changing variable in a given area and location is assumed to be important to the distribution of that variable. Sample site location can be difficult if few visible land marks are available for reference on a large body of water. The use of navigational systems such as Global Positioning System (GPS) and its predecessor, Loran-C, provide an excellent method for sample site location. McFarland (1992) discusses the practicality of GPS for location determination. This article discusses the use of Loran-C in a sampling scheme implemented at the South Texas Project Electrical Generating Station (STPEGS), Wadsworth, Texas

The economic benefits of vegetation in the upstream area of Ciliwung watershed

Science.gov (United States)

Saridewi, T. R.; Nazaruddin

2018-04-01

Ciliwung watershed has strategic values since its entire downstream area is located in the Special Administrative Region of Jakarta (DKI Jakarta), the capital of Indonesia. This causes forest and farmland areas are converted into open areas or built-up areas. The existence of these areas provides enormous environmental and economic benefits. Economic benefit values are very important to be considered in developing a policy development plan, but they have not been calculated yet. This study aims to determine the economic benefits provided by trees and other vegetation anddevelops a development policy that takes into account simultaneously ecological and economic aspects. The study is conducted in the upstream Ciliwung watershed, by using land cover patterns in 1989, 2000, 2010 and 2014, and employs GIS and CITY green analysis. The results show that conversion of forest and farmland areas reduces the ability of Ciliwung upstream watershed to store water. Therefore, its ability to reduce the flow of surface has been decreased. This creates a decrease in the cost savings of annual stormwater, from US 15,175,721 in 1989 to US 13,317,469 in 2014. The Environmental Services Payment Policy (PES) for upstream community groups managing the watershed has been considered as a fairly effective policy.

Accumulations and sources of uranium, of its daughters and of metallic trace elements in wetlands located around old uranium mining sites

International Nuclear Information System (INIS)

Cuvier, Alicia

2015-01-01

Uranium mining and uranium ore processing increase the environmental activity of U and Th decay products and trace elements, in particular in case of releases to the adjacent rivers. Contaminants accumulate then preferentially in sedimentation areas (such as ponds or lakes) or in wetlands (peat lands, marshes or riverbanks) located downstream to the mine. Wetlands - generally located at the head of watershed - are particularly sensitive to environmental changes and anthropogenic pressure. This poses a risk of release of contaminants from these accumulation areas. The objective of the present study is to propose an easily reproducible methodology - in particular for the orphan mining sites - to identify and characterize accumulation areas. This study also aims to improve our understanding of the mechanisms of accumulation and release, in these areas. This study was performed around the former mining site of Bertholene (France). Standing and mobile in situ gamma spectrometry is used to accurately locate the accumulation areas. Soils, sediments, vegetation, water and peat are also sampled upstream and downstream of the mine, in order to (a) characterize the activities and the disequilibria of the U-Th decay chains and the associated trace elements according to the scale of observation, (b) understand the mechanisms of accumulation and release and (c) identify the potential sources using geochemical proxies and isotopic analyses. The results obtained show that radionuclides are mainly accumulated in a flooding area located downstream the mine. Strong U-238 activities (≥ 20000 Bq.kg"-"1) and strong Ra-226/U-238 and Th-230/Ra-226 activity ratios are recorded, involving preferential inputs of U-238 and Th-230 during flooding events. Trace element contamination is low, except for Mn, Ba and S. Such contaminations are potentially explained by the geochemical composition of the uranium ore and by the past and current processes of ore and water mine. Sequential extractions

Effects of Vegetation Structure on the Location of Lion Kill Sites in African Thicket.

Directory of Open Access Journals (Sweden)

Andrew B Davies

Full Text Available Predator-prey relationships are integral to ecosystem stability and functioning. These relationships are, however, difficult to maintain in protected areas where large predators are increasingly being reintroduced and confined. Where predators make kills has a profound influence on their role in ecosystems, but the relative importance of environmental variables in determining kill sites, and how these might vary across ecosystems is poorly known. We investigated kill sites for lions in South Africa's thicket biome, testing the importance of vegetation structure for kill site locations compared to other environmental variables. Kill sites were located over four years using GPS telemetry and compared to non-kill sites that had been occupied by lions, as well as to random sites within lion ranges. Measurements of 3D vegetation structure obtained from Light Detection and Ranging (LiDAR were used to calculate the visible area (viewshed around each site and, along with wind and moonlight data, used to compare kill sites between lion sexes, prey species and prey sexes. Viewshed area was the most important predictor of kill sites (sites in dense vegetation were twice as likely to be kill sites compared to open areas, followed by wind speed and, less so, moonlight. Kill sites for different prey species varied with vegetation structure, and male prey were killed when wind speeds were higher compared to female prey of the same species. Our results demonstrate that vegetation structure is an important component of predator-prey interactions, with varying effects across ecosystems. Such differences require consideration in terms of the ecological roles performed by predators, and in predator and prey conservation.

Effects of Vegetation Structure on the Location of Lion Kill Sites in African Thicket.

Science.gov (United States)

Davies, Andrew B; Tambling, Craig J; Kerley, Graham I H; Asner, Gregory P

2016-01-01

Predator-prey relationships are integral to ecosystem stability and functioning. These relationships are, however, difficult to maintain in protected areas where large predators are increasingly being reintroduced and confined. Where predators make kills has a profound influence on their role in ecosystems, but the relative importance of environmental variables in determining kill sites, and how these might vary across ecosystems is poorly known. We investigated kill sites for lions in South Africa's thicket biome, testing the importance of vegetation structure for kill site locations compared to other environmental variables. Kill sites were located over four years using GPS telemetry and compared to non-kill sites that had been occupied by lions, as well as to random sites within lion ranges. Measurements of 3D vegetation structure obtained from Light Detection and Ranging (LiDAR) were used to calculate the visible area (viewshed) around each site and, along with wind and moonlight data, used to compare kill sites between lion sexes, prey species and prey sexes. Viewshed area was the most important predictor of kill sites (sites in dense vegetation were twice as likely to be kill sites compared to open areas), followed by wind speed and, less so, moonlight. Kill sites for different prey species varied with vegetation structure, and male prey were killed when wind speeds were higher compared to female prey of the same species. Our results demonstrate that vegetation structure is an important component of predator-prey interactions, with varying effects across ecosystems. Such differences require consideration in terms of the ecological roles performed by predators, and in predator and prey conservation.

Finding erotic oases: locating the sites of men's same-sex anonymous sexual encounters.

Science.gov (United States)

Tewksbury, Richard

2008-01-01

Because anonymous sexual relations between two men are widely considered deviant many men seeking such activities look to erotic oases-natural environments appropriated for covert, often furtive sexual purposes. Previous research on erotic oases has focused on characteristics of involved men and processes of locating, negotiating with, and consummating sexual relations with others. This study draws on one major Web site listing of "cruising places" in the United States to identify common locations for erotic oases. Results show that the most common locations identified as erotic oases by users are public parks, adult bookstores, health clubs, and college campuses. Locations most likely to be listed as believed to be under law enforcement surveillance are outdoor, high traffic locations. Based on these results existing research has only begun to examine the most common locations for this highly stigmatized, deviant behavior and subculture.

Application of the maximal covering location problem to habitat reserve site selection: a review

Science.gov (United States)

Stephanie A. Snyder; Robert G. Haight

2016-01-01

The Maximal Covering Location Problem (MCLP) is a classic model from the location science literature which has found wide application. One important application is to a fundamental problem in conservation biology, the Maximum Covering Species Problem (MCSP), which identifies land parcels to protect to maximize the number of species represented in the selected sites. We...

Site location and optical properties of Eu implanted sapphire

International Nuclear Information System (INIS)

Marques, C.; Wemans, A.; Maneira, M.J.P.; Kozanecki, A.; Silva, R.C. da; Alves, E.

2005-01-01

Synthetic colourless transparent (0 0 0 1) sapphire crystals were implanted at room temperature with 100 keV europium ions to fluences up to 1 x 10 16 cm -2 . Surface damage is observed at low fluences, as seen by Rutherford backscattering spectrometry under channelling conditions. Optical absorption measurements revealed a variety of structures, most probably related to F-type defects characteristic of implantation damage. Thermal treatments in air or in vacuum up to 1000 deg. C do not produce noticeable changes both in the matrix or the europium profiles. However, the complete recovery of the implantation damage and some redistribution of the europium ions is achieved after annealing at 1300 deg. C in air. Detailed lattice site location studies performed for various axial directions allowed to assess the damage recovery and the incorporation of the Eu ions into well defined crystallographic sites, possibly in an oxide phase also inferred from optical absorption measurements

Recharge-area nuclear waste repository in southeastern Sweden. Demonstration of hydrogeologic siting concepts and techniques

International Nuclear Information System (INIS)

Provost, A.M.; Voss, C.I.

2001-11-01

Nuclear waste repositories located in regional ground-water recharge ('upstream') areas may provide the safety advantage that potentially released radionuclides would have long travel time and path length, and large path volume, within the bedrock before reaching the biosphere. Nuclear waste repositories located in ground-water discharge ('downstream') areas likely have much shorter travel time and path length and smaller path volume. Because most coastal areas are near the primary discharge areas for regional ground-water flow, coastal repositories may have a lower hydrogeologic safety margin than 'upstream' repositories located inland. Advantageous recharge-area sites may be located through careful use of regional three-dimensional, variable-density, ground-water modeling. Because of normal limitations of site-characterization programs in heterogeneous bedrock environments, the hydrogeologic structure and properties of the bedrock will generally remain unknown at the spatial scales required for the model analysis, and a number of alternative bedrock descriptions are equally likely. Model simulations need to be carried out for the full range of possible descriptions. The favorable sites are those that perform well for all of the modeled bedrock descriptions. Structural heterogeneities in the bedrock and local undulations in water-table topography, at a scale finer than considered by a given model, also may cause some locations in favored inland areas to have very short flow paths (of only hundreds of meters) and short travel times, compromising the long times and paths (of many kilometers) predicted by the analysis for these sites. However, in the absence of more detailed modeling, the favored upstream sites offer a greater chance of achieving long times and paths than do downstream discharge areas, where times and paths are expected to be short regardless of the level of detail included in the model. As an example of this siting approach, potential repository

Water Quality Sampling Locations Along the Shoreline of the Columbia River, Hanford Site, Washington

Energy Technology Data Exchange (ETDEWEB)

Peterson, Robert E.; Patton, Gregory W.

2009-12-14

As environmental monitoring evolved on the Hanford Site, several different conventions were used to name or describe location information for various sampling sites along the Hanford Reach of the Columbia River. These methods range from handwritten descriptions in field notebooks to the use of modern electronic surveying equipment, such as Global Positioning System receivers. These diverse methods resulted in inconsistent archiving of analytical results in various electronic databases and published reports because of multiple names being used for the same site and inaccurate position data. This document provides listings of sampling sites that are associated with groundwater and river water sampling. The report identifies names and locations for sites associated with sampling: (a) near-river groundwater using aquifer sampling tubes; (b) riverbank springs and springs areas; (c) pore water collected from riverbed sediment; and (d) Columbia River water. Included in the listings are historical names used for a particular site and the best available geographic coordinates for the site, as of 2009. In an effort to create more consistency in the descriptive names used for water quality sampling sites, a naming convention is proposed in this document. The convention assumes that a unique identifier is assigned to each site that is monitored and that this identifier serves electronic database management requirements. The descriptive name is assigned for the convenience of the subsequent data user. As the historical database is used more intensively, this document may be revised as a consequence of discovering potential errors and also because of a need to gain consensus on the proposed naming convention for some water quality monitoring sites.

VT Hospital Site Locations

Data.gov (United States)

Vermont Center for Geographic Information — (Link to Metadata) This data layer contains point locations of all major community, regional, comprehensive health, and healthcare provider hospitals in the state of...

Magnetosheath plasma stability and ULF wave occurrence as a function of location in the magnetosheath and upstream bow shock parameters

Science.gov (United States)

Soucek, Jan; Escoubet, C. Philippe; Grison, Benjamin

2015-04-01

We present the results of a statistical study of the distribution of mirror and Alfvén-ion cyclotron (AIC) waves in the magnetosheath together with plasma parameters important for the stability of ULF waves, specifically ion temperature anisotropy and ion beta. Magnetosheath crossings registered by Cluster spacecraft over the course of 2 years served as a basis for the statistics. For each observation we used bow shock, magnetopause, and magnetosheath flow models to identify the relative position of the spacecraft with respect to magnetosheath boundaries and local properties of the upstream shock crossing. A strong dependence of both plasma parameters and mirror/AIC wave occurrence on upstream ΘBn and MA is identified. We analyzed a joint dependence of the same parameters on ΘBn and fractional distance between shock and magnetopause, zenith angle, and length of the flow line. Finally, the occurrence of mirror and AIC modes was compared against the respective instability thresholds. We noted that AIC waves occurred nearly exclusively under mirror stable conditions. This is interpreted in terms of different characters of nonlinear saturation of the two modes.

Lattice site location of electrical dopant impurities in group-III nitrides

CERN Document Server

Amorim, Lígia; Temst, Kristiaan; Wahl, Ulrich

Dopants are impurities introduced in semiconductors in small quantities to tailor the material characteristics, the effects of which depend on the exact site the dopant occupies in the crystal lattice. The lattice location of impurities is, thus, crucial for the overall understanding of the semiconductor characteristics. In general, several techniques can be used to investigate the lattice site of an impurity, the most accurate and dedicated being emission channeling. However, a characteristic of this technique is that it requires the implantation of radioactive probes, usually created and accelerated in a radioactive ion beam facility. In some cases, emission channeling might however be the only technique capable to investigate the lattice sites occupied by the impurity atoms, provided an appropriate isotope for this technique can be used. For instance, the use of other methods such as Rutherford backscattering spectrometry, perturbed angular correlations, Mössbauer spectroscopy and extended X-ray absorptio...

Upstream cash cloud

International Nuclear Information System (INIS)

Shepherd, R.

1998-01-01

This paper focuses on the effects of the slowdown in budgetary growth on the upstream business and offshore services. The dangers facing investors, the strong growth in energy demand, oil company priorities, the dip in profits of the oil companies, new field economics, the budgets for exploration and production, and the rig market outlook are discussed. (UK)

ULF Waves Upstream from Planetary Bow Shocks: Application to the Interball-Tail Observations at the Earth

International Nuclear Information System (INIS)

Trotignon, J.G.; Rauch, J.L.; Klimov, S.; Nozdrachev, M.; Romanov, S.; Savin, S.; Skalsky, A.; Blecki, J.; Juchniewicz, J.; Amata, E.

1999-01-01

One of the outstanding problems in solar system plasma physics is the morphology of planetary and cometary foreshocks. A large variety of electron and ion velocity distribution functions, as well as electrostatic and electromagnetic waves phenomena, are indeed currently observed in these regions located upstream from, and magnetically connected to, bow shocks. Foreshocks being complex and highly dynamic, it is not easy to get a comprehensive description of them. Nevertheless, simple geometrical considerations can be of help to order foreshock structures. In light of the great number of results obtained in planetary foreshocks, which are briefly reviewed, we present an ongoing study of the upstream waves observed by the INTERBALL-TAIL magnetometers in the Ultra Low Frequency range. (author)

Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

Institute of Scientific and Technical Information of China (English)

HSU Heng; Robert L. CHURCH

2004-01-01

During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

Dopant site location in dual-implanted GaP using (111) planar channeling

International Nuclear Information System (INIS)

Parikh, N.R.; Kao, C.T.; Lee, D.R.; Muse, J.; Swanson, M.L.; Venkatasubramanian, R.; Timmons, M.

1990-01-01

Previous studies have indicated that dual implantation can efficiently introduce group IV dopant onto selected sub-lattice sites in III--V compound semiconductors, thus enhancing electrical activation. The authors have studied this phenomenon in GaP using Rutherford Backscattering Spectroscopy (RBS) to determine the lattice location of Sn atoms. The authors used single crystals of GaP (100) which had been implanted at 400 degrees C with 120 Sn + following previously implanted 69 Ga + or 31 P + . Energies were selected for equivalent projected ranges, and all species were implanted with doses of 1 x 10 15 atoms/cm 2 . Asymmetry in the angular scan of the {111} planar channel was then used to determine the sub-lattice location of the implanted Sn. RBS results indicated that for all implants Sn atoms were substituting Ga and P sites equally. However, Hall effect measurements gave p type conduction for GaP implanted with Sn alone, while those with prior implants of Ga or P resulted in n-type conduction. RBS and Hall effect results are explained by a vacancy complex model

Spatial patterns of serial murder: an analysis of disposal site location choice.

Science.gov (United States)

Lundrigan, S; Canter, D

2001-01-01

Although the murders committed by serial killers may not be considered rational, there is growing evidence that the locations in which they commit their crimes may be guided by an implicit, if limited rationality. The hypothesized logic of disposal site choice of serial killers led to predictions that (a) their criminal domains would be around their home base and relate to familiar travel distances, (b) they would have a size that was characteristic of each offender, (c) the distribution would be biased towards other non-criminal activities, and (d) the size of the domains would increase over time. Examination of the geographical distribution of the sites at which 126 US and 29 UK serial killers disposed of their victims' bodies supported all four hypotheses. It was found that rational choice and routine activity models of criminal behavior could explain the spatial choices of serial murderers. It was concluded that the locations at which serial killers dispose of their victims' bodies reflect the inherent logic of the choices that underlie their predatory activities. Copyright 2001 John Wiley & Sons, Ltd.

A mathematical model of single target site location by Brownian movement in subcellular compartments.

Science.gov (United States)

Kuthan, Hartmut

2003-03-07

The location of distinct sites is mandatory for many cellular processes. In the subcompartments of the cell nucleus, only very small numbers of diffusing macromolecules and specific target sites of some types may be present. In this case, we are faced with the Brownian movement of individual macromolecules and their "random search" for single/few specific target sites, rather than bulk-averaged diffusion and multiple sites. In this article, I consider the location of a distant central target site, e.g. a globular protein, by individual macromolecules executing unbiased (i.e. drift-free) random walks in a spherical compartment. For this walk-and-capture model, the closed-form analytic solution of the first passage time probability density function (p.d.f.) has been obtained as well as the first and second moment. In the limit of a large ratio of the radii of the spherical diffusion space and central target, well-known relations for the variance and the first two moments for the exponential p.d.f. were found to hold with high accuracy. These calculations reinforce earlier numerical results and Monte Carlo simulations. A major implication derivable from the model is that non-directed random movement is an effective means for locating single sites in submicron-sized compartments, even when the diffusion coefficients are comparatively small and the diffusing species are present in one copy only. These theoretical conclusions are underscored numerically for effective diffusion constants ranging from 0.5 to 10.0 microm(2) s(-1), which have been reported for a couple of nuclear proteins in their physiological environment. Spherical compartments of submicron size are, for example, the Cajal bodies (size: 0.1-1.0 microm), which are present in 1-5 copies in the cell nucleus. Within a small Cajal body of radius 0.1 microm a single diffusing protein molecule (with D=0.5 microm(2) s(-1)) would encounter a medium-sized protein of radius 2.5 nm within 1 s with a probability near

Ames Laboratory Site Environmental Report, Calendar year 1991

International Nuclear Information System (INIS)

Mathison, L.

1991-01-01

The summarized data and conclusions from the Ames Laboratory environmental monitoring program are presented in this Annual Site Environmental Report. This program is a working requirement of Department of Energy (DOE) Order 5484.1, ''Environmental Protection, Safety, and Health Protection Information Reporting Requirements'' and Order 5400.1, ''General Environmental Protection Program.'' Ames Laboratory is located on the campus of Iowa State University (ISU) and occupies several buildings owned by the DOE. The Laboratory also leases space in ISU-owned buildings. Laboratory research activities involve less than ten percent of the total chemical use and one percent of the radioisotope use on the ISU campus. Ames Laboratory is responsible for a small chemical burial site, located on ISU property. The site was used for the disposal of chemical and metal slags from thorium and uranium production. Samples of water from existing test wells and upstream and downstream sites on the nearby Squaw Creek show no detectable migration of the contents of the burial site. A Site Assessment plan submitted to the State of Iowa Department of Natural Resources (DNR) was approved. A Remedial Investigation/Feasibility Study work plan has been completed for additional studies at the site. This has been reviewed and approved by the DOE Chicago Field Office and the DNR. A National Environmental Policy Act (NEPA) review of the site resulted in a categorical exclusion finding which has been approved by the DOE. Ames Laboratory has an area contaminated by diesel fuel at the location of a storage tank which was removed in 1970. Soil corings and groundwater have been analyzed for contamination and an assessment written. Pollution awareness and waste minimization programs and plans were implemented in 1990. Included in this effort was the implementation of a waste white paper and green computer paper recycling program

Coral record of variability in the upstream Kuroshio Current during 1953-2004

Science.gov (United States)

Li, Xiaohua; Liu, Yi; Hsin, Yi-Chia; Liu, Weiguo; Shi, Zhengguo; Chiang, Hong-Wei; Shen, Chuan-Chou

2017-08-01

The Kuroshio Current (KC), one of the most important western boundary currents in the North Pacific Ocean, strongly affects regional hydroclimate in East Asia and upper ocean thermal structure. Limited by few on-site observations, the responses of the KC to regional and remote climate forcings are still poorly understood. Here we use monthly coral δ18O data to reconstruct a KC transport record with annual to interannual resolution for the interval 1953-2004. The field site is located in southern Taiwan on the western flank of the upstream KC. Increased (reduced) KC transport would generate strong (weak) upwelling, resulting in relatively high (low) local coral δ18O. The upstream KC transport and downstream transport, off Tatsukushi Bay, Japan, covary on interannual and decadal time scales. This suggests common forcings, such as meridional drift of the North Equatorial Current bifurcation, or zonal climatic oscillations in the Pacific. The intensities of KC transport off southeastern and northeastern Taiwan are in phase before 1990 and antiphase after 1990. This difference may be due to a poleward shift of the subtropical western boundary current as a response to global warming.Plain Language SummaryThe connection between climate and oceanic circulation has long been recognized, particularly with regard to western boundary currents such as the Gulf Stream and the Kuroshio Current (KC). These systems play a crucial role in transferring solar energy from the subtropical regions to the poles. As we begin to experience the impacts of global climate change, it is critical that we understand the affect global change has on variability leading to significant changes in the structure and heat transport of such currents. Current knowledge of the KC is limited to observations over individual 10 year periods or to paleorecords of very low resolution (one sample per roughly 1000 years). Neither data set allows for a detailed understanding of the natural variability of the KC

Evaluation of new location of Isfahan′s sanitary landfill site with Oleckno method

Directory of Open Access Journals (Sweden)

Maryam Salimi

2013-01-01

Full Text Available Aims: The objective of present study was to evaluate the new location of Isfahan solid waste sanitary landfill using Geographical Information System (GIS based on the Oleckno index method (OIM. Materials and Methods: This study was on the field- and library-based data collection and surveys of relevant data. Assessment parameters included average annual rainfall, soil type and ground water beneath and adjucent to the landfill site. To analyze data, ArcGIS version 9.3 was used. Results: In 2010 the total rainfall in the landfill location was less than 150 mm/year. The soil type was clay loam, and the average distance from the floor of the landfill to the groundwater level was 3-9 meters. As calculated results showed that, the Oleckno index (OI score in the study area was 40. Conclusion: The new Isfahan′s sanitary solid waste landfill site had a good OI and the possibility of contamination of groundwater by leachate production based on this method also was low.

77 FR 70449 - Medical Device User Fee and Modernization Act; Notice to Public of Web Site Location of Fiscal...

Science.gov (United States)

2012-11-26

... and Drug Administration (FDA) is announcing the Web site location where the Agency will post two lists... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2012-N-1021] Medical Device User Fee and Modernization Act; Notice to Public of Web Site Location of Fiscal Year 2013...

78 FR 66746 - Medical Device User Fee and Modernization Act; Notice to Public of Web Site Location of Fiscal...

Science.gov (United States)

2013-11-06

... and Drug Administration (FDA or the Agency) is announcing the Web site location where the Agency will... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2012-N-1021] Medical Device User Fee and Modernization Act; Notice to Public of Web Site Location of Fiscal Year 2014...

Identification of the unidentified deceased and locating next of kin: experience with a UID web site page, Fulton County, Georgia.

Science.gov (United States)

Hanzlick, Randy

2006-06-01

Medical examiner and coroner offices may face difficulties in trying to achieve identification of deceased persons who are unidentified or in locating next of kin for deceased persons who have been identified. The Fulton County medical examiner (FCME) has an office web site which includes information about unidentified decedents and cases for which next of kin are being sought. Information about unidentified deceased and cases in need of next of kin has been posted on the FCME web site for 3 years and 1 year, respectively. FCME investigators and staff medical examiners were surveyed about the web site's usefulness for making identifications and locating next of kin. No cases were recalled in which the web site led to making an identification. Two cases were reported in which next of kin were located, and another case involved a missing person being ruled out as one of the decedents. The web site page is visited by agencies interested in missing and unidentified persons, and employees do find it useful for follow-up because information about all unidentified decedents is located and easily accessible, electronically, in a single location. Despite low yield in making identifications and locating next of kin, the UID web site is useful in some respects, and there is no compelling reason to discontinue its existence. It is proposed that UID pages on office web sites be divided into "hot" (less than 30 days, for example) and "warm" (31 days to 1 year, for example) cases and that cases older than a year be designated as "cold cases." It is conceivable that all unidentified deceased cases nationally could be placed on a single web site designed for such purposes, to remain in public access until identity is established and confirmed.

The impact of an efficient collection sites location on the zoning phase in municipal solid waste management

Energy Technology Data Exchange (ETDEWEB)

Ghiani, Gianpaolo, E-mail: gianpaolo.ghiani@unisalento.it; Manni, Andrea, E-mail: andrea.manni@unisalento.it; Manni, Emanuele, E-mail: emanuele.manni@unisalento.it; Toraldo, Massimiliano, E-mail: massimiliano.toraldo@unisalento.it

2014-11-15

Highlights: • We study the problems of locating collection areas and zoning the service territory in a municipal waste management system. • We investigate the impact that an efficient collection sites location has on the subsequent zoning phase. • On a real-world test case, we show that the proposed approach could allow achieving significant monetary savings. - Abstract: In this paper, we study two decisional problems arising when planning the collection of solid waste, namely the location of collection sites (together with bin allocation) and the zoning of the service territory, and we assess the potential impact that an efficient location has on the subsequent zoning phase. We first propose both an exact and a heuristic approach to locate the unsorted waste collection bins in a residential town, and to decide the capacities and characteristics of the bins to be located at each collection site. A peculiar aspect we consider is that of taking into account the compatibility between the different types of bins when allocating them to collection areas. Moreover, we propose a fast and effective heuristic approach to identify homogeneous zones that can be served by a single collection vehicle. Computational results on data related to a real-life instance show that an efficient location is fundamental in achieving consistent monetary savings, as well as a reduced environmental impact. These reductions are the result of one vehicle less needed to perform the waste collection operations, and an overall traveled distance reduced by about 25% on the average.

Different papillomaviruses have different repertoires of transcription factor binding sites: convergence and divergence in the upstream regulatory region

Directory of Open Access Journals (Sweden)

Alonso Ángel

2006-03-01

Full Text Available Abstract Background Papillomaviruses (PVs infect stratified squamous epithelia in warm-blooded vertebrates and have undergone a complex evolutionary process. The control of the expression of the early ORFs in PVs depends on the binding of cellular and viral transcription factors to the upstream regulatory region (URR of the virus. It is believed that there is a core of transcription factor binding sites (TFBS common to all PVs, with additional individual differences, although most of the available information focuses only on a handful of viruses. Results We have studied the URR of sixty-one PVs, covering twenty different hosts. We have predicted the TFBS present in the URR and analysed these results by principal component analysis and genetic algorithms. The number and nature of TFBS in the URR might be much broader than thus far described, and different PVs have different repertoires of TFBS. Conclusion There are common fingerprints in the URR in PVs that infect primates, although the ancestors of these viruses diverged a long time ago. Additionally, there are obvious differences between the URR of alpha and beta PVs, despite these PVs infect similar histological cell types in the same host, i.e. human. A thorough analysis of the TFBS in the URR might provide crucial information about the differential biology of cancer-associated PVs.

Final Environmental Impact Statement for the Nevada Test Site and off- site locations in the state of Nevada: Reader's guide

International Nuclear Information System (INIS)

1996-08-01

This Reader's Guide is designed to help you find information in the US Departments of Energy's Nevada Test Site Environmental Impact Statement (NTS EIS). This Guide is divided into four sections: an introduction to the NTS EIS, specific topics, number conversions and scientific notations and public reading room locations

Method for screening the Nevada Test Site and contiguous areas for nuclear waste repository locations

International Nuclear Information System (INIS)

Sinnock, S.; Fernandez, J.A.; Neal, J.T.; Stephens, H.P.; Hartway, B.L.; Los Alamos Technical Associates, Inc., NM)

1982-01-01

This paper outlines the general concepts of a technical method for systematic screening of the Nevada Test Site (NTS), Nye County, Nevada, for potentially suitable nuclear waste repository locations. After a general discussion of the organization and the purpose of the current screening activity, the paper addresses the steps of the screening method. These steps include: hierarchically organizing technical objectives for repository performance (an objectives tree); identifying and mapping pertinent physical characteristics of a site and its setting (physical attributes); relating the physical conditions to the objectives (favorability curves); identifying alternative locations and numerically evaluating their relative merits; investigating the effects of subjective judgments on the evaluations (sensitivity analyses); documenting the assumptions, logic, and results of the method. 19 references, 10 figures

Upstream health law.

Science.gov (United States)

Sage, William M; McIlhattan, Kelley

2014-01-01

For the first time, entrepreneurs are aggressively developing new technologies and business models designed to improve individual and population health, not just to deliver specialized medical care. Consumers of these goods and services are not yet "patients"; they are simply people. As this sector of the health care industry expands, it is likely to require new forms of legal governance, which we term "upstream health law." © 2014 American Society of Law, Medicine & Ethics, Inc.

Real-time safety risk assessment based on a real-time location system for hydropower construction sites.

Science.gov (United States)

Jiang, Hanchen; Lin, Peng; Fan, Qixiang; Qiang, Maoshan

2014-01-01

The concern for workers' safety in construction industry is reflected in many studies focusing on static safety risk identification and assessment. However, studies on real-time safety risk assessment aimed at reducing uncertainty and supporting quick response are rare. A method for real-time safety risk assessment (RTSRA) to implement a dynamic evaluation of worker safety states on construction site has been proposed in this paper. The method provides construction managers who are in charge of safety with more abundant information to reduce the uncertainty of the site. A quantitative calculation formula, integrating the influence of static and dynamic hazards and that of safety supervisors, is established to link the safety risk of workers with the locations of on-site assets. By employing the hidden Markov model (HMM), the RTSRA provides a mechanism for processing location data provided by the real-time location system (RTLS) and analyzing the probability distributions of different states in terms of false positives and negatives. Simulation analysis demonstrated the logic of the proposed method and how it works. Application case shows that the proposed RTSRA is both feasible and effective in managing construction project safety concerns.

Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks

Science.gov (United States)

Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.

1989-01-01

The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.

Evaluation of geochemical properties used in area-to-location screening for a nuclear waste repository at the Nevada Test Site

International Nuclear Information System (INIS)

Purson, J.D.

1983-03-01

The area-to-location screening of a potential site for a nuclear waste repository is dependent on geologic compatibility. Specifically, the geochemical properties of candidate locations are significant in the overall site evaluation. This report describes three geochemical factors or attributes and their application to an area-to-location screening of the southwestern quadrant of the Nevada Test Site and contiguous areas. These are only 3 of 31 attributes examined in the screening process. Geochemical and rock media considerations relevant to site screening include: (1) retardation by hydraulics - a study of ground-water movement through fractures vs a permeable matrix; (2) thermal stability of minerals - a measurement of undesirable mineral assemblages in the rock; and (3) retardation by sorption - an evaluation of the total sorptive capacity at a location, based on stratigraphy and lithology. Twelve potential host rocks situated in 20 locations are examined; 2 of these have consistently fewer favorable characteristics, and 6 others have generally fewer favorable characteristics than the 4 remaining rock units. The four units that appear most favorable by geochemical measures are the tuffaceous beds of Calico Hills, granite intrusives, the densely welded Topopah Spring tuff, and the Crater Flat Tuff at Yucca Mountain

Numerical modelling of GPR electromagnetic fields for locating burial sites

Directory of Open Access Journals (Sweden)

Carcione José M.

2017-01-01

Full Text Available Ground-penetrating radar (GPR is commonly used for locating burial sites. In this article, we acquired radargrams at a site where a domestic pig cadaver was buried. The measurements were conducted with the ProEx System GPR manufactured by the Swedish company Mala Geoscience with an antenna of 500MHz. The event corresponding to the pig can be clearly seen in the measurements. In order to improve the interpretation, the electromagnetic field is compared to numerical simulations computed with the pseudo-spectral Fourier method. A geological model has been defined on the basis of assumed electromagnetic properties (permittivity, conductivity and magnetic permeability. The results, when compared with the GPR measurements, show a dissimilar amplitude behaviour, with a stronger reflection event from the bottom of the pit. We have therefore performed another simulation by decreasing the electrical conductivity of the body very close to that of air. The comparison improved, showing more reflections, which could be an indication that the body contains air or has been degraded to a certain extent that the electrical resistivity has greatly increased.

Ames Laboratory Site Environmental Report, Calendar year 1992

International Nuclear Information System (INIS)

1992-01-01

The summarized data and conclusions from the Ames Laboratory environmental monitoring program are presented in this Annual Site Environmental Report. Pollution awareness and waste minimization programs and plans implemented in 1990 are continuing to date. Ames Laboratory (AL) is responsible for a small chemical burial site, located on ISU property. The site was used for the disposal of chemical and metal slags from thorium and uranium production. Samples of water from existing test wells, and upstream and downstream sites on the nearby Squaw Creek, have not detected migration of the buried materials off site. Surface, hand auger and deep boring soil samples have been collected from the site. The analytical results are pending, Six new monitoring wells have been installed and sampled. Analytical results are pending. Ames Laboratory is responsible for an area contaminated by diesel fuel that leaked from an underground storage tank (UST) in 1970. The tank was removed that year. Soil borings and groundwater have been analyzed for contamination and a preliminary assessment written. Nine small inactive waste sites have been identified for characterization. The NEPA review for this work resulted in a CX determination. The work plans were approved by AL and CH. A subcontractor has surveyed and sampled the sites. Analytical results are pending

Risk assessment of soil-based exposures to plutonium at experimental sites located on the Nevada Test Site and adjoining areas

Energy Technology Data Exchange (ETDEWEB)

Layton, D.W.; Anspaugh, L.R.; Bogen, K.T.; Straume, T.

1993-06-01

In the late 1950s and early 1960s, a series of tests was conducted at or near the Nevada Test Site to study issues involving plutonium-bearing devices. These tests resulted in the dispersal of about 5 TBq of {sup 239,240}Pu on the surficial soils at the test locations. Access to the sites is strictly controlled; therefore, it does not constitute a threat to human health at the present time. However, because the residual {sup 239} Pu decays slowly (half-life of 24,110 y), the sites could indeed represent a long-term hazard if they are not remediated and if institutional controls are lost. To investigate the magnitude of the potential health risks for this no-remediation case, we defined three basic exposure scenarios that could bring individuals in contact with {sup 239,240}Pu at the sites: (1) a resident living in a subdivision located at a test site, (2) a resident farmer, and (3) a worker at a commercial facility. Our screening analyses indicated that doses to organs are dominated by the intemal deposition of Pu via the inhalation pathway, and thus our risk assessment focused on those factors that affect inhalation exposures and associated doses, including inhalation rates, activity patterns, tenure at a residence or occupation, indoor/outdoor air relationships, and resuspension outdoors. Cancer risks were calculated as a function of lifetime cumulative doses to the key target organs (i.e., bone surface, liver, and lungs) and risk factors for those organs. Uncertainties in the predicted cancer risks were analyzed using Monte-Carlo simulations of the probability distributions used to represent assessment parameters. The principal sources of uncertainty in the estimated risks were population mobility, the relationship between indoor and outdoor contaminant levels, and the dose and risk factors for bone, liver, and lung.

Risk assessment of soil-based exposures to plutonium at experimental sites located on the Nevada Test Site and adjoining areas

International Nuclear Information System (INIS)

Layton, D.W.; Anspaugh, L.R.; Bogen, K.T.; Straume, T.

1993-06-01

In the late 1950s and early 1960s, a series of tests was conducted at or near the Nevada Test Site to study issues involving plutonium-bearing devices. These tests resulted in the dispersal of about 5 TBq of 239,240 Pu on the surficial soils at the test locations. Access to the sites is strictly controlled; therefore, it does not constitute a threat to human health at the present time. However, because the residual 239 Pu decays slowly (half-life of 24,110 y), the sites could indeed represent a long-term hazard if they are not remediated and if institutional controls are lost. To investigate the magnitude of the potential health risks for this no-remediation case, we defined three basic exposure scenarios that could bring individuals in contact with 239,240 Pu at the sites: (1) a resident living in a subdivision located at a test site, (2) a resident farmer, and (3) a worker at a commercial facility. Our screening analyses indicated that doses to organs are dominated by the intemal deposition of Pu via the inhalation pathway, and thus our risk assessment focused on those factors that affect inhalation exposures and associated doses, including inhalation rates, activity patterns, tenure at a residence or occupation, indoor/outdoor air relationships, and resuspension outdoors. Cancer risks were calculated as a function of lifetime cumulative doses to the key target organs (i.e., bone surface, liver, and lungs) and risk factors for those organs. Uncertainties in the predicted cancer risks were analyzed using Monte-Carlo simulations of the probability distributions used to represent assessment parameters. The principal sources of uncertainty in the estimated risks were population mobility, the relationship between indoor and outdoor contaminant levels, and the dose and risk factors for bone, liver, and lung

SOLUTION FOR ICHTHYOFAUNA MIGRATION UPSTREAM- DOWNSTREAM OF THE TWO SPILLWAYS LOCATED NEAR MANASTUR DAM ON THE SOMESUL MIC RIVER IN THE CLUJ NAPOCA CITY (ROMÂNIA

Directory of Open Access Journals (Sweden)

Razvan VOICU

2015-06-01

Full Text Available Longitudinal connectivity represent the way in which organisms move the energy and material exchanges located throughout the water. Fragmentation the longitudinal connectivity of watercourses caused by dams or other hydrotechnical constructions represent a major impact on sediment transport, hydrological regime, downstream moving and biota migration. The hydromorphological elements (river continuity, as well as chemical, biological, physicochemical elements characterize the ecological status of rivers.Migratory fish species: nase (Chondrostoma nasus - protected by Bern Convention - Appendix III and barbel (Barbus barbus - rare species, protected Habitats Directive (Annex V, annex 4A of Low nr.462 and Red List of RBDD are blocked but the Hydrotechnical constructions (discharge sills, dams etc located across the watercourse Somes Mic River. One of the important think of this system is the gravitational fall of water. This solution will lead to the restoration of the longitudinal connection of the Someşul Mic River in the Manastur neighborhood. România is part of the European Union and it has the obligation to implement the provisions of the Water Framework Directive 2000/60/EC, transposed into Romanian legislation by the Water Law 107/1996 as supplemented and amended (Act 310/2004. This engineering solution for fish fauna migration upstream – downstream of the spillways supports the Water Framework Directive 2000/60/EC, transposed into Romanian legislation by the Water Law 107/1996 as supplemented and amended (Act 310/2004.

New sites of Australasian microtektites in the central Indian Ocean: Implications for the location and size of source crater

Digital Repository Service at National Institute of Oceanography (India)

ShyamPrasad, M.; Mahale, V.P.; Kodagali, V.N.

Fifteen new Australasian microtektite sites have been identified along a transect roughly N-S in the central Indian Ocean. These locations, in addition to the existing 46 sites, total to 61 microtektite sites in the oceans. We carried out regression...

Human Resource Local Content in Ghana's Upstream Petroleum Industry

Science.gov (United States)

Benin, Papa

Enactment of Ghana's Petroleum (Local Content and Local Participation) Regulations, 2013 (L.I. 2204) was intended to regulate the percentage of local products, personnel, financing, and goods and services rendered within Ghana's upstream petroleum industry value chain. Five years after the inception of Ghana's upstream oil and gas industry, a gap is evident between the requirements of L.I. 2204 and professional practice. Drawing on Lewin's change theory, a cross-sectional study was conducted to examine the extent of differences between the prevailing human resource local content and the requirements of L.I. 2204 in Ghana's upstream petroleum industry. The extent to which training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its upstream petroleum industry was also examined. Survey data were collected from 97 management, technical, and other staff in 2 multinational petroleum companies whose oil and gas development plans have been approved by the Petroleum Commission of Ghana. To answer the research questions and test their hypotheses, one-way ANOVA was performed with staff category (management, technical, and other) as the independent variable and prevalent local content as the dependent variable. Results indicated that prevailing local content in Ghana's upstream petroleum industry meets the requirements of L.I. 2204. Further, training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its offshore petroleum industry. Findings may encourage leaders within multinational oil companies and the Petroleum Commission of Ghana to organize educational seminars that equip indigenous Ghanaians with specialized skills for working in Ghana's upstream petroleum industry.

Institutional Control Program: Long Term Care and Control of Decommissioned Mine/Mill Sites Located on Crown Land

International Nuclear Information System (INIS)

Cunningham, K.

2014-01-01

Institutional Control Program: • Establishes an endpoint for mining company activities on sites located on Crown land; • Establishes funding for the long-term care and control of the closed sites; • Company responsibilities for sites under the Environmental Management and Protection Act remain; • Establishes an Institutional Control Registry; • Establishes an Institutional Control Monitoring and Maintenance Fund and an Institutional Control Unforeseen Events Fund

MPL-Net Measurements of Aerosol and Cloud Vertical Distributions at Co-Located AERONET Sites

Science.gov (United States)

Welton, Ellsworth J.; Campbell, James R.; Berkoff, Timothy A.; Spinhirne, James D.; Tsay, Si-Chee; Holben, Brent; Starr, David OC. (Technical Monitor)

2002-01-01

In the early 1990s, the first small, eye-safe, and autonomous lidar system was developed, the Micropulse Lidar (MPL). The MPL acquires signal profiles of backscattered laser light from aerosols and clouds. The signals are analyzed to yield multiple layer heights, optical depths of each layer, average extinction-to-backscatter ratios for each layer, and profiles of extinction in each layer. In 2000, several MPL sites were organized into a coordinated network, called MPL-Net, by the Cloud and Aerosol Lidar Group at NASA Goddard Space Flight Center (GSFC) using funding provided by the NASA Earth Observing System. tn addition to the funding provided by NASA EOS, the NASA CERES Ground Validation Group supplied four MPL systems to the project, and the NASA TOMS group contributed their MPL for work at GSFC. The Atmospheric Radiation Measurement Program (ARM) also agreed to make their data available to the MPL-Net project for processing. In addition to the initial NASA and ARM operated sites, several other independent research groups have also expressed interest in joining the network using their own instruments. Finally, a limited amount of EOS funding was set aside to participate in various field experiments each year. The NASA Sensor Intercomparison and Merger for Biological and Interdisciplinary Oceanic Studies (SIMBIOS) project also provides funds to deploy their MPL during ocean research cruises. All together, the MPL-Net project has participated in four major field experiments since 2000. Most MPL-Net sites and field experiment locations are also co-located with sunphotometers in the NASA Aerosol Robotic Network. (AERONET). Therefore, at these locations data is collected on both aerosol and cloud vertical structure as well as column optical depth and sky radiance. Real-time data products are now available from most MPL-Net sites. Our real-time products are generated at times of AERONET aerosol optical depth (AOD) measurements. The AERONET AOD is used as input to our

Clustering in large networks does not promote upstream reciprocity.

Directory of Open Access Journals (Sweden)

Naoki Masuda

Full Text Available Upstream reciprocity (also called generalized reciprocity is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution.

Clustering in large networks does not promote upstream reciprocity.

Science.gov (United States)

Masuda, Naoki

2011-01-01

Upstream reciprocity (also called generalized reciprocity) is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution.

Oil and gas site contamination risks : improved oversight needed

International Nuclear Information System (INIS)

2010-02-01

British Columbia has seen record levels of activities in the oil and gas sector. Upstream petroleum processes include exploration, well completion and production. Site contamination can occur during all of these activities, resulting in potential environmental and human health impacts. Although well operators are responsible by law for site restoration, there is a potential risk that some operators will not fulfill their responsibilities, thereby leaving the province liable for the site restoration costs. In British Columbia, the BC Oil and Gas Commission (OGC) is responsible for managing these risks through oversight activities designed to ensure that industry meets its obligations. The OGC also manages the orphan sites reclamation fund. This report presented an audit of the OGC in order to determine if it is providing adequate oversight of upstream oil and gas site contamination risks. The audit examined whether the agency responsibilities are clear and whether the OGC is fully aware of the environmental and financial risks associated with upstream oil and gas site contamination. The audit also examined if the OGC has established appropriate procedures to oversee the risks and to inform the public of how effectively site contamination risks are being managed. The report presented the audit background, audit expectations, findings, conclusions and recommendations. It was concluded that the OGC's oversight of the environmental and financial risks associated with oil and gas site contamination needs improving. tabs., figs.

Tier 2 guidelines and remediation of Tebuthiuron on a native prairie site

Energy Technology Data Exchange (ETDEWEB)

Bessie, K.; Harckham, N.; Dance, T. [EBA Engineering Consultants Ltd., Calgary, AB (Canada); Burk, A. [EnCana Corp., Calgary, AB (Canada); Stephenson, G. [Stantec Consulting, Guelph, ON (Canada); Corbet, B. [Access Analytical Laboratories Inc., Calgary, AB (Canada)

2009-10-01

Tebuthiuron is a sterilant used to control vegetation at upstream and midstream petroleum sites. This article discussed the remediation processes used to reclaim a native prairie site contaminated with tebuthiuron. The site was located within a dry mixed grass natural area. A literature review was conducted to establish soil eco-contact guidelines specific to tebuthiuron. A site-specific ecotoxicity assessment was then conducted using a liquid chromatograph to detect tebuthiuron limits in the contaminated soils. A soil sampling technique was used to delineate the affected areas at the site. Site soils were spiked with various concentrations of tebuthiuron ranging from 0.00003 mg/kg to 3000 mg/kg. Test species included a Folsomia candida, an earthworm, and 4 plant species. The study showed that the invertebrate species were less sensitive to tebuthiuron than the plant species. A groundwater assessment showed that tebuthiuron levels exceeded Tier 1 groundwater remediation guidelines. A multilayer hydro-geological model showed that remediation guidelines were orders of magnitude greater than Tier 1 groundwater remediation. A thermal desorption technique was used to remediate the site. 7 refs., 8 figs.

NIMBY, CLAMP, and the location of new nuclear-related facilities: U.S. national and 11 site-specific surveys.

Science.gov (United States)

Greenberg, Michael R

2009-09-01

Public and political opposition have made finding locations for new nuclear power plants, waste management, and nuclear research and development facilities a challenge for the U.S. government and the nuclear industry. U.S. government-owned properties that already have nuclear-related activities and commercial nuclear power generating stations are logical locations. Several studies and utility applications to the Nuclear Regulatory Commission suggest that concentrating locations at major plants (CLAMP) has become an implicit siting policy. We surveyed 2,101 people who lived within 50 miles of 11 existing major nuclear sites and 600 who lived elsewhere in the United States. Thirty-four percent favored CLAMP for new nuclear power plants, 52% for waste management facilities, and 50% for new nuclear laboratories. College educated, relatively affluent male whites were the strongest CLAMP supporters. They disproportionately trusted those responsible for the facilities and were not worried about existing nuclear facilities or other local environmental issues. Notably, they were concerned about continuing coal use. Not surprisingly, CLAMP proponents tended to be familiar with their existing local nuclear site. In short, likely CLAMP sites have a large and politically powerful core group to support a CLAMP policy. The challenge to proponents of nuclear technologies will be to sustain this support and expand the base among those who clearly are less connected and receptive to new nearby sites.

Effects of human activities on rivers located in protected areas of the Atlantic Forest

Directory of Open Access Journals (Sweden)

Mônica Luisa Kuhlmann

2014-03-01

Full Text Available AIM: This study evaluated the impacts of anthropogenic activities upstream of conservation areas on the Paraibuna river and its implications for freshwater biodiversity. METHODS: The study was carried out in two units, Cunha and Santa Virginia, of the Serra do Mar State Park (SP, located in the Atlantic Rain Forest. Five sampling sites were defined, four along the Paraibuna river and one in the Ipiranga river, the latter fully inserted into the protected area. Physical, chemical, microbiological and ecotoxicological data were obtained from surface water as well as aquatic macroinvertebrates. RESULTS: The results showed that the waters of the Paraibuna river have low anthropogenic interference. However, conductivity, turbidity, coliforms, iron, total phosphorus and nitrate showed a gradient improving its water quality from upstream to downstream, indicating the existence of erosion and introduction of organic debris in the basin. The BMWP index, varying from 58 to 190, also showed the good condition of the river to aquatic biota, with predominant Excellent quality diagnosis. The values of this index and the richness index (S outlined a similar gradient but with the lowest values recorded in P3. CONCLUSIONS: The results showed that the upstream activities alter the natural condition of the Paraibuna river and its biota and that the protected areas provides environmental services reducing these impacts. The ideal situation in order to ensure the conservation of the freshwater biota of the Paraibuna river would be the incorporation of parts of the upstream area into the protected area and convert occupied areas into Sustainable Use Area, that guarantee the adoption of sustainable techniques to the existing land uses and the application of aquatic life protection indicators for monitoring the water quality of the river.

Location and activity specific site-management for military locations

NARCIS (Netherlands)

Maring, L.; Hulst, M. van; Meuken, D.

2009-01-01

pace is limited in the Netherlands and military activities, that may cause nuisance or environmental hazards, should therefore be considered and evaluated during the use of military locations. The last few years TNO and Deltares have worked on a research program on environmental effects due to

Exploiting protein flexibility to predict the location of allosteric sites

Directory of Open Access Journals (Sweden)

Panjkovich Alejandro

2012-10-01

Full Text Available Abstract Background Allostery is one of the most powerful and common ways of regulation of protein activity. However, for most allosteric proteins identified to date the mechanistic details of allosteric modulation are not yet well understood. Uncovering common mechanistic patterns underlying allostery would allow not only a better academic understanding of the phenomena, but it would also streamline the design of novel therapeutic solutions. This relatively unexplored therapeutic potential and the putative advantages of allosteric drugs over classical active-site inhibitors fuel the attention allosteric-drug research is receiving at present. A first step to harness the regulatory potential and versatility of allosteric sites, in the context of drug-discovery and design, would be to detect or predict their presence and location. In this article, we describe a simple computational approach, based on the effect allosteric ligands exert on protein flexibility upon binding, to predict the existence and position of allosteric sites on a given protein structure. Results By querying the literature and a recently available database of allosteric sites, we gathered 213 allosteric proteins with structural information that we further filtered into a non-redundant set of 91 proteins. We performed normal-mode analysis and observed significant changes in protein flexibility upon allosteric-ligand binding in 70% of the cases. These results agree with the current view that allosteric mechanisms are in many cases governed by changes in protein dynamics caused by ligand binding. Furthermore, we implemented an approach that achieves 65% positive predictive value in identifying allosteric sites within the set of predicted cavities of a protein (stricter parameters set, 0.22 sensitivity, by combining the current analysis on dynamics with previous results on structural conservation of allosteric sites. We also analyzed four biological examples in detail, revealing

Participation costs can suppress the evolution of upstream reciprocity.

Science.gov (United States)

Peña, Jorge; Pestelacci, Enea; Berchtold, André; Tomassini, Marco

2011-03-21

Indirect reciprocity, one of the many mechanisms proposed to explain the evolution of cooperation, is the idea that altruistic actions can be rewarded by third parties. Upstream or generalized reciprocity is one type of indirect reciprocity in which individuals help someone if they have been helped by somebody else in the past. Although empirically found to be at work in humans, the evolution of upstream reciprocity is difficult to explain from a theoretical point of view. A recent model of upstream reciprocity, first proposed by Nowak and Roch (2007) and further analyzed by Iwagami and Masuda (2010), shows that while upstream reciprocity alone does not lead to the evolution of cooperation, it can act in tandem with mechanisms such as network reciprocity and increase the total level of cooperativity in the population. We argue, however, that Nowak and Roch's model systematically leads to non-uniform interaction rates, where more cooperative individuals take part in more games than less cooperative ones. As a result, the critical benefit-to-cost ratios derived under this model in previous studies are not invariant with respect to the addition of participation costs. We show that accounting for these costs can hinder and even suppress the evolution of upstream reciprocity, both for populations with non-random encounters and graph-structured populations. Copyright © 2011 Elsevier Ltd. All rights reserved.

Statistical handbook for Canada's upstream petroleum industry: '96 updates

International Nuclear Information System (INIS)

1997-01-01

The Statistical Handbook of CAPP is an annual compilation of useful information about the Canadian petroleum and natural gas industry. It has been published since 1955, and is a key source of upstream petroleum statistics. It presents a historical summary of the petroleum industry''s progress and provides detailed statistical information on the production and consumption of petroleum, petroleum products, natural gas and natural gas liquids, imports and exports, land sales, pipelines, reserves, drilling and refinery activities, and prices in Canada. The information, mostly in tabular form, is based on the latest available data (generally up to and including 1996). For the first time in 1997, the Handbook is also made available in CD-ROM format (EXCEL 5.0). Plans are also underway to publish the Handbook on a secure site on the Internet

The role of the ionosphere in coupling upstream ULF wave power into the dayside magnetosphere

International Nuclear Information System (INIS)

Engebretson, M.J.; Cahill, L.J. Jr.; Arnoldy, R.L.; Anderson, B.J.; Rosenberg, T.J.; Carpenter, D.L.; Inan, U.S.; Eather, R.H.

1991-01-01

A series of recent studies of Pc 3 magnetic pulsations in the dayside outer magnetosphere has given new insights into the possible mechanisms of entry of ULF wave power into the magnetosphere from a bow shock related upstream source. In this paper, the authors first review many of these new observational results by presenting a comparison of data from two 10-hour intervals on successive days in April 1986 and then present a possible model for transmission of pulsation signals from the magnetosheath into the dayside magnetosphere. Simultaneous multi-instrument observations at South Pole Station, located below the cusp/cleft ionosphere near local noon, magnetic field observations by the AMPTE CCE satellite in the dayside outer magnetosphere, and upstream magnetic field observations by the IMP 8 satellite show clear interplanetary magnetic field field magnitude control of dayside resonant harmonic pulsations and band-limited very high latitude pulsations, as well as pulsation-modulated precipitation of what appear to be magnetosheath/boundary layer electrons. They believe that this modulated precipitation may be responsible for the propagation of upstream wave power in the Pc 3 frequency band into the high-latitude ionosphere, from whence it may be transported throughout the dayside outer magnetosphere by means of an ionospheric transistor. In this model, modulations in ionospheric conductivity caused by cusp/cleft precipitation cause varying ionospheric currents with frequency spectra determined by the upstream waves; these modulations will be superimposed on the Birkeland currents, which close via these ionospheric currents. Modulated region 2 Birkeland currents will in turn provide a narrow-band source of wave energy to a wide range of dayside local times in the outer magnetosphere

Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

Science.gov (United States)

Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

2010-01-01

Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

Upstream movements of Atlantic Salmon in the Lower Penobscot River, Maine following two dam removals and fish passage modifications

Science.gov (United States)

Izzo, Lisa K.; Maynard, George A.; Zydlewski, Joseph D.

2016-01-01

The Penobscot River Restoration Project (PRRP), to be completed in 2016, involved an extensive plan of dam removal, increases in hydroelectric capacity, and fish passage modifications to increase habitat access for diadromous species. As part of the PRRP, Great Works and Veazie dams were removed, making Milford Dam the first impediment to federally endangered Atlantic Salmon Salmo salar. Upstream habitat access for Atlantic Salmon is dependent upon successful and timely passage at Milford Dam because nearly all suitable spawning habitat is located upstream. In 2014 and 2015, a total of 73 adult salmon were radio-tagged to track their upstream movements through the Penobscot River to assess potential delays at (1) the dam remnants, (2) the confluence of the Stillwater Branch and the main stem of the Penobscot River below the impassable Orono Dam, and (3) the Milford Dam fish lift (installed in 2014). Movement rates through the dam remnants and the Stillwater confluence were comparable to open river reaches. Passage efficiency of the fish lift was high in both years (95% and 100%). However, fish experienced long delays at Milford Dam, with approximately one-third of fish taking more than a week to pass in each year, well below the Federal Energy Regulatory Commission passage standard of 95% within 48 h. Telemetry indicates most fish locate the fishway entrance within 5 h of arrival and were observed at the entrance at all hours of the day. These data indicate that overall transit times through the lower river were comparable to reported movement rates prior to changes to the Penobscot River due to the substantial delays seen at Milford Dam. The results of this study show that while adult Atlantic Salmon locate the new fish lift entrance quickly, passage of these fish was significantly delayed under 2014–2015 operations.

About condition of soil ground at locations of the former Azgir nuclear test site

International Nuclear Information System (INIS)

Akhmetov, E.Z.; Adymov, Zh.I.; Ermatov, A.S.

2003-01-01

Full text: Soil condition after underground nuclear explosions at locations of the test sites is considered. The region is situated in the zone of northern deserts and characterized by prevalence of greyish-brown soils in conditions of sharply continental climate and presence of salt in soil-formative complex including tertiary clays, loess-like loam, loam sands and sands. There are small quantity of humus in such soil. During investigation of soil characteristics and ability of soil particles to form conglomerates, possessing of different properties, it is necessary to know both element and phase composition, determining, in the most extent, such physical and mechanical macro-characteristics as: density, stickiness, air and water penetrability, solubility, chemical resistance, granulometric set and others. Phase composition of soil samples can be, to a sufficient extent, determined by the X-ray diffractometry methods using ordinary X-ray experimental facilities. Phase composition of soil includes gypsum, quartz, calcium, potash feldspar hematite, kaolin, peach and mica in different quantities. Data on element composition of soil samples were obtained from the territory of technological locations of test site using the method of X-ray-fluorescent analysis. Granulometric composition of soil ground has been investigated using the methods of dry sieving and wet sieving for determination of radionuclide distribution in different fractions of soil particles. By the method of the dry sieving of soil ground samples there are taken place a sticking the small together of fine fractions and an adhesion of stuck-together particles to more large ones. Therefore, fine fractions cannot be separate completely at dry sieving. As distinct from the dry sieving an use of water jet in the sieving allows to overcome defects of the dry method and, by a sufficiently effective separation of granulometric fractions, to obtain more precise results of investigations of granulometric

Effect of an upstream bulge configuration on film cooling with and without mist injection.

Science.gov (United States)

Wang, Jin; Li, Qianqian; Sundén, Bengt; Ma, Ting; Cui, Pei

2017-12-01

To meet the economic requirements of power output, the increased inlet temperature of modern gas turbines is above the melting point of the material. Therefore, high-efficient cooling technology is needed to protect the blades from the hot mainstream. In this study, film cooling was investigated in a simplified channel. A bulge located upstream of the film hole was numerically investigated by analysis of the film cooling effectiveness distribution downstream of the wall. The flow distribution in the plate channel is first presented. Comparing with a case without bulge, different cases with bulge heights of 0.1d, 0.3d and 0.5d were examined with blowing ratios of 0.5 and 1.0. Cases with 1% mist injection were also included in order to obtain better cooling performance. Results show that the bulge configuration located upstream the film hole makes the cooling film more uniform, and enhanceslateral cooling effectiveness. Unlike other cases, the configuration with a 0.3d-height bulge shows a good balance in improving the downstream and lateral cooling effectiveness. Compared with the case without mist at M = 0.5, the 0.3d-height bulge with 1% mist injection increases lateral average effectiveness by 559% at x/d = 55. In addition, a reduction of the thermal stress concentration can be obtained by increasing the height of the bulge configuration. Copyright © 2017 Elsevier Ltd. All rights reserved.

Intrasite motions and monument instabilities at Medicina ITRF co-location site

Science.gov (United States)

Sarti, Pierguido; Abbondanza, Claudio; Legrand, Juliette; Bruyninx, Carine; Vittuari, Luca; Ray, Jim

2013-03-01

We process the total-station surveys performed at the ITRF co-location site Medicina (Northern Italy) over the decade (2001-2010) with the purpose of determining the extent of local intrasite motions and relating them to local geophysical processes, the geological setting and the design of the ground pillars. In addition, continuous observations acquired by two co-located GPS stations (MEDI and MSEL separated by ≈27 m) are analysed and their relative motion is cross-checked with the total-station results. The local ground control network extends over a small area (<100 × 100 m) but the results demonstrate significant anisotropic deformations with rates up to 1.6 mm a-1, primarily horizontal, a value comparable to intraplate tectonic deformations. The results derived from GPS and total-station observations are consistent and point to the presence of horizontal intrasite motions over very short distances possibly associated with varying environmental conditions in a very unfavourable local geological setting and unsuitable monument design, these latter being crucial aspects of the realization and maintenance of global permanent geodetic networks and the global terrestrial reference frame.

Review of Investigations on Site Selection for Nuclear Power Plants in Croatia

Energy Technology Data Exchange (ETDEWEB)

Malbasa, N [Ekonerg, Zagreb (Croatia)

2008-07-01

A review of site investigation for nuclear facilities in the Republic of Croatia that had been performed from 1964, when investigation started for the first nuclear power plant, to 1994 when the activities were stopped, is presented therein. Brief results of the main investigation were presented including the Tanja site on the Danube upstream of Vukovar. It is the best of all the investigated locations for nuclear power plant in Croatia. The review of results for site selection of low and intermediate level of radioactive waste disposal is also given. The position of nuclear power plants in the strategic documents of the Republic of Croatia was analysed. It is concluded that the status of nuclear facilities in the main strategic documents must be improved because the energy future in Croatia - as almost in all European countries - could hardly be successful without any further development of nuclear energy.(author)

Review of Investigations on Site Selection for Nuclear Power Plants in Croatia

International Nuclear Information System (INIS)

Malbasa, N.

2008-01-01

A review of site investigation for nuclear facilities in the Republic of Croatia that had been performed from 1964, when investigation started for the first nuclear power plant, to 1994 when the activities were stopped, is presented therein. Brief results of the main investigation were presented including the Tanja site on the Danube upstream of Vukovar. It is the best of all the investigated locations for nuclear power plant in Croatia. The review of results for site selection of low and intermediate level of radioactive waste disposal is also given. The position of nuclear power plants in the strategic documents of the Republic of Croatia was analysed. It is concluded that the status of nuclear facilities in the main strategic documents must be improved because the energy future in Croatia - as almost in all European countries - could hardly be successful without any further development of nuclear energy.(author)

Radium-226 in the food chain near the site of a French uranium mine

International Nuclear Information System (INIS)

Fourcade, N.; Marple, M.L.; Zettwoog, P.

1982-01-01

As part of a study of the final radiological state of a French uranium mine, the links of milk, vegetable and fish food chains were analysed for radium-226. The site chosen is located in low mountains where the radioactivity transfer vector is the water of a deeply embanked river. The mining of this site (10,000 tonnes of uranium) has now been completed, after a period of 20 years. Ore treatment residues have been stored on site in an artificial ten-hectare basin constructed behind a dam erected across the river valley. Analyses have shown great differences in concentration between the different soils and samples of animal food, the higher values being those of samples taken in the immediate vicinity of the water in zones easily flooded. Nevertheless, no major variation in concentration in milk has been noted. On the whole, the vegetables downstream show the same concentration as upstream. In the flesh of fish the concentration downstream is approximately ten times higher than upstream. This suggests that it is possible to observe radioactivity anomalies in the immediate surroundings by analysing the physical and biological media for radium-226. However, the food chains are only partly affected (milk, in which the concentration is lower than in some commercialized waters in the region, and also fish) and the incorporation levels are lower than the annual limits recommended for the public. (author)

Risks of Preterm Premature Rupture of Membranes and Preterm Birth Post Fetoscopy Based on Location of Trocar Insertion Site.

Science.gov (United States)

Chmait, Ramen H; Chon, Andrew H; Korst, Lisa M; Llanes, Arlyn; Kontopoulos, Eftichia V; Quintero, Ruben A

2018-07-01

 The objective of this study was to assess whether the location of the trocar insertion site for laser treatment of twin-twin transfusion syndrome was associated with preterm-premature rupture of membranes (PPROM) and preterm birth (PTB).  In this study trocar location was documented in the operating room. Lower uterine segment (LUS) location was defined as any insertion location was defined as ≥5 cm horizontally from the midline. Patient characteristics were tested against three outcomes: PPROM ≤ 21 days postoperative, PTB location, controlling for potential risk factors.  A total of 743 patients were studied. Patients with LUS location were twice as likely as those with a more superior location to have PPROM ≤ 21 days (OR = 2.33, 1.12-4.83, p  = 0.0236). Patients with both a LUS and Lateral location were over six times more likely to have PPROM ≤ 21 days (OR = 6.66, 2.36-18.78, p  = 0.0003). Trocar insertion site was not associated with PTB.  We found that trocar insertion in the LUS, particularly the lateral LUS, was associated with an increased risk of PPROM. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Analysis of key thresholds leading to upstream dependencies in global transboundary water bodies

Science.gov (United States)

Munia, Hafsa Ahmed; Guillaume, Joseph; Kummu, Matti; Mirumachi, Naho; Wada, Yoshihide

2017-04-01

Transboundary water bodies supply 60% of global fresh water flow and are home to about 1/3 of the world's population; creating hydrological, social and economic interdependencies between countries. Trade-offs between water users are delimited by certain thresholds, that, when crossed, result in changes in system behavior, often related to undesirable impacts. A wide variety of thresholds are potentially related to water availability and scarcity. Scarcity can occur because of the country's own water use, and that is potentially intensified by upstream water use. In general, increased water scarcity escalates the reliance on shared water resources, which increases interdependencies between riparian states. In this paper the upstream dependencies of global transboundary river basins are examined at the scale of sub-basin areas. We aim to assess how upstream water withdrawals cause changes in the scarcity categories, such that crossing thresholds is interpreted in terms of downstream dependency on upstream water availability. The thresholds are defined for different types of water availability on which a sub-basin relies: - reliable local runoff (available even in a dry year), - less reliable local water (available in the wet year), - reliable dry year inflows from possible upstream area, and - less reliable wet year inflows from upstream. Possible upstream withdrawals reduce available water downstream, influencing the latter two water availabilities. Upstream dependencies have then been categorized by comparing a sub-basin's scarcity category across different water availability types. When population (or water consumption) grows, the sub-basin satisfies its needs using less reliable water. Thus, the factors affecting the type of water availability being used are different not only for each type of dependency category, but also possibly for every sub- basin. Our results show that, in the case of stress (impacts from high use of water), in 104 (12%) sub- basins out of

Coral-inferred Variability of Upstream Kuroshio Current from 1953-2004 AD

Science.gov (United States)

Li, X.; Yi, L.; Shen, C. C.; Hsin, Y. C.

2016-12-01

The Kuroshio Current (KC), one of the most important western boundary currents in the North Pacific Ocean, strongly impacts regional climate in East Asia and upper-ocean thermal structure. However, the responses of KC to regional and remote climate forcing are poorly understood owing to lacking of long-term KC observations. Here, we present a sea surface temperature (SST) record from 1953 to 2004 AD derived from monthly skeletal δ18O data of a living coral Porites core, drilled in Nanwan, southern Taiwan (22°N, 121°E), located on the western front of the Upstream KC. The increased/reduced Kuroshio transport would generate stronger/weaker upwelling in Southern Taiwan, which can cause lower/higher SST. Agreement between dynamics of interannual coral δ18O and modern KC data shows that the regional coral δ18O can be used as a promising proxy for Upstream KC intensity. The KC-induced SST anomaly record reveals prominent interannual and decadal variability predominantly controlled by the bifurcation latitude of North Equatorial Current. We also find that the reconstructed KC intensity at east of Taiwan and south of Japan have nearly simultaneous interannual changes, suggesting the same dominant forcing(s) for the entire KC system. Additional work is needed to understand the KC system with respect to the interannual to decadal climate variability and the influences of global warming.

Polycyclic aromatic hydrocarbons in upstream riverine runoff of the Pearl River Delta, China: An assessment of regional input sources

International Nuclear Information System (INIS)

Zhang Kai; Liang Bo; Wang Jizhong; Guan Yufeng; Zeng, Eddy Y.

2012-01-01

Water samples collected from upstream tributaries of the Pearl River Delta (PRD) and from locations within the PRD (South China) were analyzed for 27 polycyclic aromatic hydrocarbons (PAHs). Average concentrations (aqueous plus particulate) of total 27 PAHs (Σ 27 PAH), 16 priority PAHs designated by the United States Environmental Protection Agency (USEPA) except naphthalene (Σ 15 PAH), and the seven carcinogenic PAHs (Σ 7 PAH) classified by the USEPA were 260 ± 410, 130 ± 310, and 15 ± 12 ng/L, respectively. Riverine PAHs were predominantly generated from coal and vegetation combustion, coke production, vehicle exhausts, and petroleum residues, accounting for 28%, 25%, 22% and 21%, respectively, on average. Upstream riverine fluxes of Σ 27 PAH and Σ 15 PAH amounted to 38.9 and 12.9 tons/year, respectively. The net contributions of Σ 27 PAH and Σ 15 PAH from sources within the PRD were estimated at 21.4 and 21.0 tons/year, respectively. - Highlights: ► Upstream PAH levels were lower than downstream PAHs and pose low ecological risk. ► Riverine PAHs are predominantly pyrogenic. ► Parent PAHs in Pearl River are mainly derived from within the PRD. ► The 15 priority PAHs were mainly generated within the Pearl River Delta. - The 15 priority PAHs are mainly generated within the PRD while the other 12 PAHs from upstream areas.

Valuating Indonesian upstream oil management scenario through system dynamics modelling

Science.gov (United States)

Ketut Gunarta, I.; Putri, F. A.

2018-04-01

Under the existing regulation in Constitution Number 22 Year 2001 (UU No 22 Tahun 2001), Production Sharing Contract (PSC) continues to be the scenario in conducting oil and gas upstream mining activities as the previous regulation (UU No. 8 Tahun 1971). Because of the high costs and risks in upstream mining activities, the contractors are dominated by foreign companies, meanwhile National Oil Company (NOC) doesn’t act much. The domination of foreign contractor companies also warned Indonesia in several issues addressing to energy independence and energy security. Therefore, to achieve the goals of energy which is independence and security, there need to be a revision in upstream oil activities regulating scenario. The scenarios will be comparing the current scenario, which is PSC, with the “full concession” scenario for National Oil Company (NOC) in managing oil upstream mining activities. Both scenario will be modelled using System Dynamics methodology and assessed furthermore using financial valuation method of income approach. Under the 2 scenarios, the author will compare which scenario is better for upstream oil management in reaching the goals mentioned before and more profitable in financial aspect. From the simulation, it is gathered that concession scenario offers better option than PSC in reaching energy independence and energy security.

Investigation of the Impact of the Upstream Induction Zone on LIDAR Measurement Accuracy for Wind Turbine Control Applications using Large-Eddy Simulation

International Nuclear Information System (INIS)

Simley, Eric; Pao, Lucy Y; Gebraad, Pieter; Churchfield, Matthew

2014-01-01

Several sources of error exist in lidar measurements for feedforward control of wind turbines including the ability to detect only radial velocities, spatial averaging, and wind evolution. This paper investigates another potential source of error: the upstream induction zone. The induction zone can directly affect lidar measurements and presents an opportunity for further decorrelation between upstream wind and the wind that interacts with the rotor. The impact of the induction zone is investigated using the combined CFD and aeroelastic code SOWFA. Lidar measurements are simulated upstream of a 5 MW turbine rotor and the true wind disturbances are found using a wind speed estimator and turbine outputs. Lidar performance in the absence of an induction zone is determined by simulating lidar measurements and the turbine response using the aeroelastic code FAST with wind inputs taken far upstream of the original turbine location in the SOWFA wind field. Results indicate that while measurement quality strongly depends on the amount of wind evolution, the induction zone has little effect. However, the optimal lidar preview distance and circular scan radius change slightly due to the presence of the induction zone

The LHCb Upstream Tracker Project

CERN Document Server

Steinkamp, Olaf

2015-01-01

The LHCb detector performs searches for New Physics in CP-violating observables and rare heavy-quark decays at the LHC. A comprehensive upgrade is planned for the long shutdown of the LHC in 2018/19. A goal of this upgrade is to abolish hardware triggers and read out the full detector at 40 MHz. This requires to replace the existing TT station upstream of the LHCb magnet by a new silicon micro-strip detector, the Upstream Tracker (UT). The UT will have a new front-end chip compatible with 40 MHz readout, silicon sensors with improved radiation hardness, finer readout granularity, and improved acceptance coverage at small polar angles. The outer region of each detection layer will be covered by p-in-n sensors with 10 cm long strips and a pitch of about 180 mum, while n-in-p sensors with half the pitch and strip length will be employed in the regions of highest particle density close to the beam pipe. The innermost sensors will have a circular cutout to optimize the forward acceptance. The front-end chip is bei...

Environmental status of algal mat sites located at the east coast of Saudi Arabia following the Gulf War

International Nuclear Information System (INIS)

Al-Thukair, A.

1993-01-01

Remote sensing techniques and ground truth verification were used to provide information on algal mat locations and damage intensity caused by the oil spill. Pre and post oil spill satellite images, ground truth assessment were compared for damage evaluation. Locations and sites status (heavily oiled, recovering, and no algal mats) were conveyed in maps. Recovered sites are found in Abu Ali and Tanajib areas. However, recovery seems to be slower in Abu Ali area as compared to Tanajib. Different types and formations of algal mats were found in both areas. This differentiation is more likely to be attributable to coastal topography and tide regimes

Bridging the gap between tribal risk perceptions and scientific decision-making for uranium legacy sites located in Native American communities

Science.gov (United States)

Joseph, C.; Waugh, W.; Glenn, E.; Chief, K.

2017-12-01

There are approximately 15,000 abandoned uranium mines (AUM) in the western United States, of which 500 AUMs are located in the Colorado Plateau Four-Corners region. Uranium mill tailings, referred to as legacy waste, compromise the largest volume of any category of radioactive waste in the nation. Today, the Department of Energy Legacy Management is responsible for long-term stewardship and maintenance of inactive uranium processing sites that have been remediated to prevent further migration and exposure of tailings to the environment and surrounding communities. In collaboration with the DOE-LM, I am investigating the impact of climate change and community adaptation on the long-term performance of disposal cell covers for uranium mill tailings located in Native American communities, as well as how these communities have adapted to and perceive these areas. I am interested in how abiotic engineered cell covers may be candidate sites for future conversion to vegetated evapotranspirative caps for arid to semi-arid climates. The objectives are to: 1) assess above-ground tissue of plants encroaching engineered cell covers for concentrations of uranium, radium, selenium, molybdenum, thorium, arsenic, lead, and manganese and compare them to control sites; 2) determine if above-cell plant tissue is accumulating to toxic levels that may create an exposure pathway, 3) identify climate scenarios for site locations and determine how short-and long-scale climate projections will influence spatial and temporal plant distribution for specific woody species; and 4) evaluate the risk perceptions of Hopi villages located five miles downstream of one site location. To date, risk perception and stakeholder outreach to the Hopi communities has been absent. This study will help inform how land use, water use, and sustenance practices may contribute to environmental health disparities for one of the few tribes that has maintained physical continuity within their ancestral homeland.

Evaluation of new location of Isfahan′s sanitary landfill site with Oleckno method

OpenAIRE

Maryam Salimi; Afshin Ebrahimi; Afsane Salimi

2013-01-01

Aims: The objective of present study was to evaluate the new location of Isfahan solid waste sanitary landfill using Geographical Information System (GIS) based on the Oleckno index method (OIM). Materials and Methods: This study was on the field- and library-based data collection and surveys of relevant data. Assessment parameters included average annual rainfall, soil type and ground water beneath and adjucent to the landfill site. To analyze data, ArcGIS version 9.3 was used. Resul...

A method for locating potential tree-planting sites in urban areas: a case study of Los Angeles, USA

Science.gov (United States)

Chunxia Wua; Qingfu Xiaoa; Gregory E. McPherson

2008-01-01

A GIS-based method for locating potential tree-planting sites based on land cover data is introduced. Criteria were developed to identify locations that are spatially available for potential tree planting based on land cover, sufficient distance from impervious surfaces, a minimum amount of pervious surface, and no crown overlap with other trees. In an ArcGIS...

Upstream migration of Pacific lampreys in the John Day River, Oregon: Behavior, timing, and habitat use

Science.gov (United States)

Robinson, T. Craig; Bayer, J.M.

2005-01-01

Adult Pacific lamprey migration and habitat preferences for over-winter holding and spawning, and larval rearing in tributaries to the Columbia River are not well understood. The John Day River is one such tributary where larval and adult stages of this species have been documented, and its free-flowing character provided the opportunity to study migration of Pacific lampreys unimpeded by passage constraints. Forty-two adult Pacific lampreys were captured in the John Day River near its mouth during their upstream migration. Pacific lampreys were surgically implanted with radio transmitters and released onsite, and tracked by fixed-site, aerial, and terrestrial telemetry methods for nearly one year. Adults moved upstream exclusively at night, with a mean rate of 11.1 ?? 6.3 km/day. They halted upstream migration by September, and held a single position for approximately six months in the lateral margins of riffles and glides, using boulders for cover. More than half of Pacific lampreys resumed migration in March before ending movement in early May. Pacific lampreys that resumed migration in spring completed a median of 87% of their upstream migration before over-winter holding. Upon completing migration. Pacific lampreys briefly held position before beginning downstream movement at the end of May. Though not directly observed, halting migration and movement downstream were likely the result of spawning and death. Gains in adult Pacific lamprey passage through the Columbia River hydrosystem and tributaries may be made by improvements that would expedite migration during spring and summer and increase the quantity and variety of cover and refuge opportunities. ?? 2005 by the Northwest Scientific Association. All rights reserved.

Final environmental impact statement for the Nevada Test Site and off-site locations in the State of Nevada. American Indian Assessments. Volume 1, Appendix G

International Nuclear Information System (INIS)

1996-08-01

The Native American Resource Document is a summary of opinions expressed by the Consolidated Group of Tribes and Organizations (CGTO) regarding the Environmental Impact Statement for the Nevada Test Site and Other Off-Site Locations within the State of Nevada (NTS EIS). The document contains (a) general concerns regarding long-term impacts of the U.S. Department of Energy's (DOE) operations on the NTS and (b) a synopsis of specific comments made by the American Indian Writers Subgroup (AIWS) for various chapters of the NTS EIS. The Native American Resource Document was produced in response to consultation required for the NTS EIS, in accordance with DOE Order 1230.2, American Indian Tribal Government Policy. The consultation focused specifically on four alternative management decisions concerning the future mission of the NTS and related off-site locations in Nevada. However, the present CGTO's response to this consultation is not limited to EIS alternatives, but also integrates relevant recommendations made by Indian people for previous DOE projects in which American Indians participated

Two DNA sites for MelR in the same orientation are sufficient for optimal MelR-dependent

OpenAIRE

Elrobh, M.; Webster, C.; Samarasinghe, S.; Durose, D.; Busby, S.

2012-01-01

The Escherichia coli melR gene encodes the MelR transcription factor that controls melibiose utilization. Expression of melR is autoregulated by MelR, which represses the melR promoter by binding to a target that overlaps the transcript start. Here, we show that MelR-dependent repression of the melR promoter can be enhanced by the presence of a second single DNA site for MelR located up to 250 base pairs upstream. Parallels with AraC-dependent repression at the araC–araBAD regulatory region a...

Meeting the challenge : capturing the upstream

International Nuclear Information System (INIS)

Bogle, E.W.

1998-01-01

The challenge facing the exploration and production sector of the petroleum industry to capture and hold onto the upstream was the main focus of this paper. The exploration and production (E and P) business was described as being highly complex, characterized by constant change and increasing competition. Some of the dynamic changes which have occurred in the Western Canada Basin (WCB) during the last five years and how they relate to the international playing field were reviewed. Significant changes to the production ranking profile as a result of acquisitions, and basin reserve endowment and maturity are the two major factors affecting current and future dynamics of upstream WCB E and P activity. Competitive pressures, contractor relationships, infrastructure access and controls, environmental issues are some of the other factors. Taking these factors into account, Talisman Energy Inc. has used its growth in the WCB to leverage its international activities, diversifying to less mature, but proven hydrocarbon basins. The company's international exploration strategy is designed to be adaptive and flexible and is guided by focus on a limited number of core areas with proven source rock and existing production, achievement of a set production level within a five-year time frame, ensuring strong relationships with host governments and partners, and selecting areas where a multiple of opportunity types are available. In general, for any upstream company it is important to recognize that the more predictable traditional order has given way to a market-driven environment where the rules change almost daily, and success depends on the ability to adapt to change.14 figs

Research on Cavitation Regions of Upstream Pumping Mechanical Seal Based on Dynamic Mesh Technique

Directory of Open Access Journals (Sweden)

Huilong Chen

2014-08-01

Full Text Available In order to study the cavitation area of the Upstream Pumping Mechanical Seal, three-dimensional microgap inner flow field of the Upstream Pumping Mechanical Seal was simulated with multiphase flow cavitation model and dynamic mesh technique based on hydrodynamic lubrication theory. Furthermore, the simulated result was compared with the experimental data. The results show that the simulated result with the Zwart-Gerber-Belamri cavitation model was much closer to the experimental data. The area of cavitation inception mainly occurred at the concave side of the spiral groove and surrounding region without spiral grooves, which was nearly covered by the inner diameter to roots of grooves; in addition, the region near the surface of the stationary ring was primary cavitation location. The area of cavitation has little relationship with the medium pressure; however, it became larger following increasing rotating speed in the range of researched operating conditions. Moreover the boundary of cavitated area was transformed from smooth to rough, which occurred in similar film thickness. When cavitation number was decreasing, which was conducive to improving the lubrication performance of sealed auxiliary, it made the sealing stability decline.

Radon impact at a remediated uranium mine site in Japan

International Nuclear Information System (INIS)

Ishimori, Yuu

2011-01-01

This paper mainly illustrates the radon impact of the closed uranium mine site remediated in 2007. The site remediated is the waste rock site located on the steep slope of a hill about 1.5 km upstream from a residential area along a main ravine. Major remedial action was to cover these waste rock yards with weathering granite soil. The radon flux density after remediation was intended to be 0.1 Bqm -2 s -1 in consideration with the natural background level around Ningyo-toge because there is no value of radon flux density regulated in Japan. Our action decreased the radon concentration in the site to natural background level, approximately from 10 to 40 Bqm -3 , although relatively high concentration in excess of 100 Bqm -3 was observed before remediation. On the other hand, our action did not decrease the radon concentrations around the site in general. This fact proved that the limited source such as waste rocks affected the radon concentrations at neighboring area only. The similar tendencies were also observed in other environmental data such as radon progeny concentrations. In conclusion, these findings proved that our remedial action was successful against radon. This fact will lead to more reasonable action plans for other closed mine sites. (author)

Spatial distribution of upstream magnetospheric ≥50 keV ions

Directory of Open Access Journals (Sweden)

G. C. Anagnostopoulos

2000-01-01

Full Text Available We present for the first time a statistical study of \\geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks

Spatial distribution of upstream magnetospheric ≥50 keV ions

Directory of Open Access Journals (Sweden)

G. Kaliabetsos

Full Text Available We present for the first time a statistical study of geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks

Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

International Nuclear Information System (INIS)

Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

2005-01-01

Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

Science.gov (United States)

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

76 FR 61367 - Medical Device User Fee and Modernization Act; Notice to Public of Web Site Location of Fiscal...

Science.gov (United States)

2011-10-04

.... ACTION: Notice. SUMMARY: The Food and Drug Administration (FDA) is announcing the Web site location where... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2007-N-0270; formerly Docket No. 2007N-0357] Medical Device User Fee and Modernization Act; Notice to Public of Web Site...

LHCb upstream tracker

CERN Multimedia

Artuso, Marina

2016-01-01

The detector for the LHCb upgrade is designed for 40MHz readout, allowing the experiment to run at an instantaneous luminosity of 2x10^33 cm$^2$s$^-1$. The upgrade of the tracker subsystem in front of the dipole magnet, the Upstream Tracker, is crucial for charged track reconstruction and fast trigger decisions based on a tracking algorithm involving also vertex detector information. The detector consists of 4 planes with a total area of about 8.5m$^2$, made of single sided silicon strip sensors read-out by a novel custom-made ASIC (SALT). Details on the performance of prototype sensors, front-end electronics, near-detector electronics and mechanical components are presented.

Spectrometric study of the folding process of i-motif-forming DNA sequences upstream of the c-kit transcription initiation site

International Nuclear Information System (INIS)

Bucek, Pavel; Gargallo, Raimundo; Kudrev, Andrei

2010-01-01

The c-kit oncogene shows a cytosine-rich DNA region upstream of the transcription initiation site which forms an i-motif structure at slightly acidic pH values (Bucek et al. ). In the present study, the pH-induced formation of i-motif - forming sequences 5'-CCC CTC CCT CGC GCC CGC CCG-3' (ckitC1, native), 5'-CCC TTC CCT TGT GCC CGC CCG-3' (ckitC2) and 5'-CCCTT CCC TTTTT CCC T CCC T-3' (ckitC3) was studied by spectroscopic techniques, such as UV molecular absorption and circular dichroism (CD), in tandem with two multivariate data analysis methods, the hard modelling-based matrix method and the soft modelling-based MCR-ALS approach. Use of the hard chemical modelling enabled us to propose the equilibrium model, which describes spectral changes as functions of solution acidity. Additionally, the intrinsic protonation constant, K in , and the cooperativity parameters, ω c , and ω a , were calculated from the fitting procedure of the coupled CD and molecular absorption spectra. In the case of ckitC2 and ckitC3, the hard model correctly reproduced the spectral variations observed experimentally. The results indicated that folding was accompanied by a cooperative process, i.e. the enhancement of protonated structure stability upon protonation. In contrast, unfolding was accompanied by an anticooperative process. Finally, folding of the native sequence, ckitC1, seemed to follow a more complex mechanism.

Inventories and upstream gasoline price dynamics

NARCIS (Netherlands)

Kuper, Gerard H.

This paper sheds new light on the asymmetric dynamics in upstream U.S. gasoline prices. The model is based on Pindyck's inventory model of commodity price dynamics. We show that asymmetry in gasoline price dynamics is caused by changes in the net marginal convenience yield: higher costs of marketing

Selection of adequate site location during early stages of construction project management: A multi-criteria decision analysis approach

Science.gov (United States)

Marović, Ivan; Hanak, Tomaš

2017-10-01

In the management of construction projects special attention should be given to the planning as the most important phase of decision-making process. Quality decision-making based on adequate and comprehensive collaboration of all involved stakeholders is crucial in project’s early stages. Fundamental reasons for existence of this problem arise from: specific conditions of construction industry (final products are inseparable from the location i.e. location has a strong influence of building design and its structural characteristics as well as technology which will be used during construction), investors’ desires and attitudes, and influence of socioeconomic and environment aspects. Considering all mentioned reasons one can conclude that selection of adequate construction site location for future investment is complex, low structured and multi-criteria problem. To take into account all the dimensions, the proposed model for selection of adequate site location is devised. The model is based on AHP (for designing the decision-making hierarchy) and PROMETHEE (for pairwise comparison of investment locations) methods. As a result of mixing basis feature of both methods, operational synergies can be achieved in multi-criteria decision analysis. Such gives the decision-maker a sense of assurance, knowing that if the procedure proposed by the presented model has been followed, it will lead to a rational decision, carefully and systematically thought out.

Location performance objectives for the NNWSI area-to-location screening activity

Energy Technology Data Exchange (ETDEWEB)

Sinnock, S.; Fernandez, J.A.

1984-01-01

Fifty-four objectives were identified to guide the screening of the Nevada Research and Development Area of the Nevada Test Site for relatively favorable locations for the disposal of nuclear waste in a mined geologic repository. The objectives were organized as a hierarchy composed of 4 upper-level, 12 middle-level, and 38 lower-level objectives. The four upper-level objectives account for broad national goals to contain and isolate nuclear waste in an environmentally sound and economically acceptable manner. The middle-level objectives correspond to topical categories that logically relate the upper-level objectives to site-specific concerns such as seismicity, sensitive species, and flooding hazards (represented by the lower-level objectives). The relative merits of alternative locations were compared by an application of decision analysis based on standard utility theory. The relative favorabilities of pertinent physical conditions at each alternative location were weighted in relation to the importance of objectives, and summed to produce maps indicating the most and the least favorable locations. Descriptions of the objectives were organized by the hierarchical format; they detail the applicability of each objective to geologic repository siting, previously published siting criteria corresponding to each objective, and the rationale for the weight assigned to each objective, and the pertinent attributes for evaluating locations with respect to each objective. 51 references, 47 figures, 4 tables.

Location performance objectives for the NNWSI area-to-location screening activity

International Nuclear Information System (INIS)

Sinnock, S.; Fernandez, J.A.

1984-01-01

Fifty-four objectives were identified to guide the screening of the Nevada Research and Development Area of the Nevada Test Site for relatively favorable locations for the disposal of nuclear waste in a mined geologic repository. The objectives were organized as a hierarchy composed of 4 upper-level, 12 middle-level, and 38 lower-level objectives. The four upper-level objectives account for broad national goals to contain and isolate nuclear waste in an environmentally sound and economically acceptable manner. The middle-level objectives correspond to topical categories that logically relate the upper-level objectives to site-specific concerns such as seismicity, sensitive species, and flooding hazards (represented by the lower-level objectives). The relative merits of alternative locations were compared by an application of decision analysis based on standard utility theory. The relative favorabilities of pertinent physical conditions at each alternative location were weighted in relation to the importance of objectives, and summed to produce maps indicating the most and the least favorable locations. Descriptions of the objectives were organized by the hierarchical format; they detail the applicability of each objective to geologic repository siting, previously published siting criteria corresponding to each objective, and the rationale for the weight assigned to each objective, and the pertinent attributes for evaluating locations with respect to each objective. 51 references, 47 figures, 4 tables

Upstream-downstream cooperation approach in Guanting Reservoir watershed.

Science.gov (United States)

Yang, Zhi-Feng; Zhang, Wen-Guo

2005-01-01

A case study is introduced and discussed concerning water dispute of misuse and pollution between up- and down-stream parts. The relations between water usage and local industrial structures are analyzed. Results show it is important to change industrial structures of the target region along with controlling water pollution by technical and engineering methods. Three manners of upstream-downstream cooperation are presented and discussed based on the actual conditions of Guangting Reservoir watershed. Two typical scenarios are supposed and studied along with the local plan on water resources development. The best solution for this cooperation presents a good way to help the upstream developing in a new pattern of eco-economy.

Upstream vertical cavity surface-emitting lasers for fault monitoring and localization in WDM passive optical networks

Science.gov (United States)

Wong, Elaine; Zhao, Xiaoxue; Chang-Hasnain, Connie J.

2008-04-01

As wavelength division multiplexed passive optical networks (WDM-PONs) are expected to be first deployed to transport high capacity services to business customers, real-time knowledge of fiber/device faults and the location of such faults will be a necessity to guarantee reliability. Nonetheless, the added benefit of implementing fault monitoring capability should only incur minimal cost associated with upgrades to the network. In this work, we propose and experimentally demonstrate a fault monitoring and localization scheme based on a highly-sensitive and potentially low-cost monitor in conjunction with vertical cavity surface-emitting lasers (VCSELs). The VCSELs are used as upstream transmitters in the WDM-PON. The proposed scheme benefits from the high reflectivity of the top distributed Bragg reflector (DBR) mirror of optical injection-locked (OIL) VCSELs to reflect monitoring channels back to the central office for monitoring. Characterization of the fault monitor demonstrates high sensitivity, low bandwidth requirements, and potentially low output power. The added advantage of the proposed fault monitoring scheme incurs only a 0.5 dB penalty on the upstream transmissions on the existing infrastructure.

Identification and characterization of a cluster of transcription start sites located in the E6 ORF of human papillomavirus type 16

DEFF Research Database (Denmark)

Rosenstierne, Maiken W; Vinther, Jeppe; Hansen, Christina N

2003-01-01

Human papillomavirus type 16 (HPV-16) is the prototype strain among the malignant types of HPV in the western world. The main promoter, P97, located in front of the E6 ORF, has been shown to control expression of the oncogenes E6 and E7. These oncogenes are expressed continuously in HPV-16......-transformed cells. In contrast to malignant HPV types, non-malignant HPV types have separate promoters driving the expression of E6 and E7. Experiments have shown that the translation of E7 is more efficient from monocistronic than bicistronic transcripts encoding both E6 and E7. Here, identification...... of a cluster of transcription start sites located in the E6 ORF of HPV-16 is presented. Transcripts from this region contain the E7 ORF as the first reading frame. The cluster consists of multiple transcription start sites located around nt 441. Additional transcription start sites were identified in a cluster...

Suspension, abandonment, decontamination, and surface land reclamation of upstream oil and gas facilities : informational letter IL 98-2

International Nuclear Information System (INIS)

1998-01-01

This release of the Alberta Energy and Utilities Board (EUB) is intended to clarify the jurisdictional roles of Alberta Environmental Protection (AEP) and the EUB with regard to their respective responsibilities for the regulation of the suspension, abandonment, decontamination and surface land reclamation of active and inactive upstream oil and gas facilities. The EUB, AEP and industrial operators all have separate roles and responsibilities when active and inactive upstream facilities are suspended or reclaimed. In the future, industry operators will have more interaction with the AEP during the decontamination of a site, while the EUB will concentrate on pollution prevention and abandonment of non-economic facilities. All oilfield waste generated from suspension, abandonment, decontamination, and surface land reclamation of an active or inactive upstream oil and gas facility will fall under the jurisdiction of the EUB. Contaminated soils, sludges, and waters that are physically removed as a result of decontamination activities are considered to be oilfield wastes. The regulatory responsibility between the AEP and the EUB remains unchanged for the reclamation process of on-lease and off-lease spills, releases or pipeline breaks. Industry operators are no longer allowed to discharge any produced liquid to earthen pits or ponds and are encouraged to reclaim existing ones. 3 figs

Remediation options and treatment for Tebuthiuron at an upstream oil and gas site

Energy Technology Data Exchange (ETDEWEB)

Lin, F. [EBA Engineering Consultants Ltd., Edmonton, AB (Canada)

2009-07-01

Sterilants are strong herbicides that contain teburithion, a substance of concern in remediation and reclamation activities. Tebuthiuron has very high to low mobility in soils, and its sorption capacity increases in relation to clay and organic matter content. There is currently no soil benchmark for sterilants. Remedial options for tebuthiuron include adsorption with amendments, thermal desorption, and soil flushing with injected solutions. A recent pilot plant successfully used thermal desorption to treat soil contaminated with tebuthiuron and bromacil to below laboratory detection limits. Surface soils at the site were contaminated to a depth of 4 m. A temperature ramping study was performed to determine optimal treatment temperatures. A total of 15,136 tonnes of soil were treated and then used as backfill on-site. Water at the site was monitored and treated with charcoal filters. Hydrocarbon-contaminated soil at the site was also successfully treated using the thermal desorption process. tabs., figs.

An archaeological predictive model for locating rock shelter sites in Hesse Germany) that contain both Final Palaeolithic archaeology and Laacher See tephra

DEFF Research Database (Denmark)

Sauer, Florian Rudolf; Hoggard, Christian Steven; Zernack, Anke Verena

of foragers and the Late Glacial environment there. In contrast, in the medial zone in Hesse only a small number of surface scatters of lithic artefacts are known. No Late Glacial sites, particularly not rock shelter and cave locations, have been excavated in this region. Yet, it is precisely such locations...... of human impacts following the eruption, a dataset of c. 800 rock shelter locations throughout the state of Hesse was used to generate an archaeological predictive model (APM). The database was compiled in the early 1990 for the purpose of discovering new and well-stratified sites (Hofbauer, 1995......). In the project presented here, a landscape-archaeological approach in GIS was employed to estimate the correspondence of the local topography of rock shelter features with the topographic and cultural framework of known Late Palaeolithic sites. Typical parameters like rock shelter orientation and distance...

Upstream magnetospheric ion flux tube within a magnetic cloud: Wind/STICS

Science.gov (United States)

Posner, Arik; Liemohn, Michael W.; Zurbuchen, Thomas H.

2003-03-01

We present a case study of a remarkable upstream O+ and N+ ion outflow event. We present observational evidence for spatially structured outflow of these Low Charge State Heavy Ions (LCSHIs) of magnetospheric origin along a small reconnected field line region within the framework of a magnetic cloud of an ICME. From the particles' in situ 3D distribution function we conclude that in this case the interaction of the outflow with the bow shock is small. We conclude further that the gyrophases of outflowing ions at the reconnection point are randomly distributed. This leads to the formation of a flux tube with a specific geometry. In particular, the outflow reveals spatial dispersion and non-gyrotropy. This result has implications for the size of the dayside reconnection site.

78 FR 66778 - Eastman Kodak Company, IPS-Dayton Location, Including On-Site Leased Workers From Adecco, Dayton...

Science.gov (United States)

2013-11-06

... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,387] Eastman Kodak Company... workers of Eastman Kodak Company, IPS-Dayton Location, including on-site leased workers from Adecco, Dayton, Ohio (hereafter referred to as ``Eastman Kodak-IPS- Dayton''). On May 18, 2012, the Department...

Russian upstream joint ventures logging progress

International Nuclear Information System (INIS)

Anon.

1992-01-01

This paper reports that Occidental Petroleum Corp. has begun exporting oil from Russia as part of an enhanced recovery joint venture in western Siberia. Oxy holds a 50% interest in the joint venture company, Vanyoganneft, and will market the oil. In other activity, two Canadian companies are marking progress with Russian upstream joint ventures

Conversion of Hanford site well locations to Washington coordinate system of 1983, South Zone 1991 (WCS83S)

International Nuclear Information System (INIS)

Burnett, R.A.; Tzemos, S.; Dietz, L.A.

1993-12-01

Past construction and survey practices have resulted in the use of multiple local coordinate systems for measuring and reporting the horizontal position of wells and other facilities and locations on the Hanford Site. This report describes the development of a coordinate transformation process and algorithm and its application to the conversion of the horizontal coordinates of Hanford site wells from the various local coordinate systems and datums to a single standard coordinate system, the Washington Coordinate system of 1983, South Zone 1991 (WCS83S). The coordinate transformation algorithm, implemented as a computer program called CTRANS, uses standard two-dimensional translation, rotation, and scaling transformation equations and can be applied to any set of horizontal point locations. For each point to be transformed, the coefficients of the transformation equations are calculated locally, using the coordinates of the three nearest registration points (points with known locations in both coordinate systems). The report contains a discussion of efforts to verify and validate both the software and the well location data, a description of the methods used to estimate transformation and registration point accuracy, instructions for using the computer program, and a summary of the Hanford well conversion results for each local coordinate system and datum. Also included are the results of using recent U.S. Army Corps of Engineers survey data to obtain estimated measures of location errors in wells for which the local coordinate data source is undocumented, unverified, and therefore of unknown accuracy

Characterization of Rous sarcoma virus polyadenylation site use in vitro

International Nuclear Information System (INIS)

Maciolek, Nicole L.; McNally, Mark T.

2008-01-01

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSV poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation

Correlation between particle multiplicity and location on virion RNA of the assembly initiation site for viruses of the tobacco mosaic virus group.

Science.gov (United States)

Fukuda, M; Meshi, T; Okada, Y; Otsuki, Y; Takebe, I

1981-07-01

The initiation site for reconstitution on genome RNA was determined by electron microscopic serology for a watermelon strain of cucumber green mottle mosaic virus (CGMMV-W), which is chemically and serologically related to tobacco mosaic virus (TMV). The initiation site was located at the same position as that of the cowpea strain, a virus that produces short rods of encapsidated subgenomic messenger RNA for the coat protein (a two-component TMV), being about 320 nucleotides away from the 3' terminus, and hence within the coat protein cistron. Although CGMMV-W was until now believed to be a single-component TMV, the location of the initiation site indicated the presence of short rods containing coat protein messenger RNA in CGMMV-W-infected tissue, as in the case for the cowpea strain. We found such short rods in CGMMV-W-infected tissue. The results confirmed our previous hypothesis that the site of the initiation region for reconstitution determines the rod multiplicity of TMV. The finding of the second two-component TMV, CGMMV, indicates that the cowpea strain of TMV is not unique in being a two-component virus and that the location of the assembly initiation site on the genome RNA can be a criterion for grouping of viruses.

The feasibility of using computer graphics in environmental evaluations : interim report, documenting historic site locations using computer graphics.

Science.gov (United States)

1981-01-01

This report describes a method for locating historic site information using a computer graphics program. If adopted for use by the Virginia Department of Highways and Transportation, this method should significantly reduce the time now required to de...

On-line soft sensing in upstream bioprocessing.

Science.gov (United States)

Randek, Judit; Mandenius, Carl-Fredrik

2018-02-01

This review provides an overview and a critical discussion of novel possibilities of applying soft sensors for on-line monitoring and control of industrial bioprocesses. Focus is on bio-product formation in the upstream process but also the integration with other parts of the process is addressed. The term soft sensor is used for the combination of analytical hardware data (from sensors, analytical devices, instruments and actuators) with mathematical models that create new real-time information about the process. In particular, the review assesses these possibilities from an industrial perspective, including sensor performance, information value and production economy. The capabilities of existing analytical on-line techniques are scrutinized in view of their usefulness in soft sensor setups and in relation to typical needs in bioprocessing in general. The review concludes with specific recommendations for further development of soft sensors for the monitoring and control of upstream bioprocessing.

Effects of secondary structure on pre-mRNA splicing: hairpins sequestering the 5' but not the 3' splice site inhibit intron processing in Nicotiana plumbaginifolia.

Science.gov (United States)

Liu, H X; Goodall, G J; Kole, R; Filipowicz, W

1995-01-16

We have performed a systematic study of the effect of artificial hairpins on pre-mRNA splicing in protoplasts of a dicot plant, Nicotiana plumbaginifolia. Hairpins with a potential to form 18 or 24 bp stems strongly inhibit splicing when they sequester the 5' splice site or are placed in the middle of short introns. However, similar 24 bp hairpins sequestering the 3' splice site do not prevent this site from being used as an acceptor. Utilization of the stem-located 3' site requires that the base of the stem is separated from the upstream 5' splice site by a minimum of approximately 45 nucleotides and that another 'helper' 3' splice site is present downstream of the stem. The results indicate that the spliceosome or factors associated with it may have a potential to unfold secondary structure present in the downstream portion of the intron, prior to or at the step of the 3' splice site selection. The finding that the helper 3' site is required for utilization of the stem-located acceptor confirms and extends previous observations, obtained with HeLa cell in vitro splicing systems, indicating that the 3' splice site may be recognized at least twice during spliceosome assembly.

Locations of the three primary binding sites for long-chain fatty acids on bovine serum albumin

International Nuclear Information System (INIS)

Hamilton, J.A.; Era, S.; Bhamidipati, S.P.; Reed, R.G.

1991-01-01

Binding of 13 C-enriched oleic acid to bovine serum albumin and to three large proteolytic fragments of albumin - two complementary fragments corresponding to the two halved of albumin and one fragment corresponding to the carboxyl-terminal domain - yielded unique patterns of NMR resonances (chemical shifts and relative intensities) that were used to identify the locations of binding of the first 5 mol of oleic acid to the multidomain albumin molecule. The first 3 mol of oleic acid added to intact albumin generated three distinct NMR resonances as a result of simultaneous binding of oleic acid to three heterogeneous sites (primary sites). This distribution suggests albumin to be a less symmetrical binding molecule than theoretical models predict. This work also demonstrates the power of NMR for the study of microenvironments of individual fatty acid binding sites in specific domain

Muscarinic acetylcholine receptors: location of the ligand binding site

International Nuclear Information System (INIS)

Hulme, E.; Wheatley, M.; Curtis, C.; Birdsall, N.

1987-01-01

The key to understanding the pharmacological specificity of muscarinic acetylcholine receptors (mAChR's) is the location within the receptor sequence of the amino acid residues responsible for ligand binding. To approach this problem, they have purified mAChR's from rat brain to homogeneity by sequential ion-exchange chromatography, affinity chromatography and molecular weight fractionation. Following labelling of the binding site with an alkylating affinity label, 3 H-propylbenzilycholine mustard aziridinium ion ( 3 H-PrBCM), the mAChR was digested with a lysine-specific endoproteinase, and a ladder of peptides of increasing molecular weight, each containing the glycosylated N-terminus, isolated by chromatography on wheat-germ agglutinin sepharose. The pattern of labelling showed that a residue in the peptides containing transmembrane helices 2 and/or 3 of the mAChR was alkylated. The linkage was cleaved by 1 M hydroxylamine, showing that 3 H-PrBCM was attached to an acidic residue, whose properties strongly suggested it to be embedded in a hydrophobic intramembrane region of the mAChR. Examination of the cloned sequence of the mAChR reveals several candidate residues, the most likely of which is homologous to an aspartic acid residue thought to protonate the retinal Schiff's base in the congeneric protein rhodopsin

Upstream structural management measures for an urban area flooding in Turkey

Science.gov (United States)

Akyurek, Z.; Bozoğlu, B.; Sürer, S.; Mumcu, H.

2015-06-01

In recent years, flooding has become an increasing concern across many parts of the world of both the general public and their governments. The climate change inducing more intense rainfall events occurring in short period of time lead flooding in rural and urban areas. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is performed. MIKE21 with flexible grid is used in 2-dimensional shallow water flow modelling. 1 × 1000-1 scaled maps with the buildings for the urbanized area and 1 × 5000-1 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of 500 m3 s-1 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The upstream structural base precautions against flooding are modelled. The effect of four main upstream catchments on the flooding in the downstream urban area are modelled as different scenarios. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in one of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed.

DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS

Energy Technology Data Exchange (ETDEWEB)

Pitňa, A.; Šafránková, J.; Němeček, Z.; Goncharov, O.; Němec, F.; Přech, L. [Charles University, Faculty of Mathematics and Physics, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); Chen, C. H. K. [Department of Physics, Imperial College London, London SW7 2AZ (United Kingdom); Zastenker, G. N., E-mail: jana.safrankova@mff.cuni.cz [Space Research Institute of Russian Academy of Sciences, Moscow, Russia, Profsoyuznaya ul. 84/32, Moscow 117997 (Russian Federation)

2016-03-01

Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those in the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.

ZFNGenome: A comprehensive resource for locating zinc finger nuclease target sites in model organisms

Directory of Open Access Journals (Sweden)

Voytas Daniel F

2011-01-01

Full Text Available Abstract Background Zinc Finger Nucleases (ZFNs have tremendous potential as tools to facilitate genomic modifications, such as precise gene knockouts or gene replacements by homologous recombination. ZFNs can be used to advance both basic research and clinical applications, including gene therapy. Recently, the ability to engineer ZFNs that target any desired genomic DNA sequence with high fidelity has improved significantly with the introduction of rapid, robust, and publicly available techniques for ZFN design such as the Oligomerized Pool ENgineering (OPEN method. The motivation for this study is to make resources for genome modifications using OPEN-generated ZFNs more accessible to researchers by creating a user-friendly interface that identifies and provides quality scores for all potential ZFN target sites in the complete genomes of several model organisms. Description ZFNGenome is a GBrowse-based tool for identifying and visualizing potential target sites for OPEN-generated ZFNs. ZFNGenome currently includes a total of more than 11.6 million potential ZFN target sites, mapped within the fully sequenced genomes of seven model organisms; S. cerevisiae, C. reinhardtii, A. thaliana, D. melanogaster, D. rerio, C. elegans, and H. sapiens and can be visualized within the flexible GBrowse environment. Additional model organisms will be included in future updates. ZFNGenome provides information about each potential ZFN target site, including its chromosomal location and position relative to transcription initiation site(s. Users can query ZFNGenome using several different criteria (e.g., gene ID, transcript ID, target site sequence. Tracks in ZFNGenome also provide "uniqueness" and ZiFOpT (Zinc Finger OPEN Targeter "confidence" scores that estimate the likelihood that a chosen ZFN target site will function in vivo. ZFNGenome is dynamically linked to ZiFDB, allowing users access to all available information about zinc finger reagents, such as the

Lattice site location and annealing behaviour of Ca and Sr implanted GaN

CERN Document Server

De Vries, Bart; Wahl, Ulrich; Correia, J G; Araújo, João Pedro; Lojkowski, W; Kolesnikov, D

2006-01-01

We report on the lattice location of ion-implanted Ca and Sr in thin films of single-crystalline wurtzite GaN. Using the emission channeling technique the angular distributions of $\\beta\\!^{-}$−particles emitted by the radioactive isotopes $^{45}$Ca(t$_{ 1/2}$=163.8 d) and $^{89}$Sr(t$_{ 1/2}$=50.53 d) were monitored with a position-sensitive detector following 60 keV room-temperature implantation. Our experiments give direct evidence that $\\sim$90% of Ca and > 60% of Sr atoms were occupying substitutional Ga sites with root mean square displacements of the order of 0.15–0.30 Å, i.e., larger than the expected thermal vibration amplitude of 0.074 Å. Annealing the Ca implanted samples at 1100–1350 °C in high-pressure N$_{2}$ atmosphere resulted in a better incorporation into the substitutional Ga site. The Sr implanted sample showed a small decrease in rms displacements for vacuum annealing up to 900 °C, while the substitutional fraction remained nearly constant. The annealing behavior of the rms disp...

Remarks on the Cogema-Areva project of storage of contaminated sludge and sediments on the Bellezane site (Haute-Vienne). Investigation performed by the CRIIRAD laboratory on its own funds

International Nuclear Information System (INIS)

2006-06-01

As sediments of several lakes are contaminated by uranium mines which are located upstream, and which have been exploited in the past by the Cogema (now Areva NC), this company asked for an authorization to use an old pit in Bellezane to deposit clearing sludge from water processing plants and from the clearing of ponds. This document describes the different problems raised by this project. It outlines that the site is not waterproof and that its legal status is not correct. It also reports and comments the radiological contamination of waters and soils due to site effluents, the chemical contamination of waters, and the existence of solid radioactive wastes at the vicinity of this site

High Sensitivity TSS Prediction: Estimates of Locations Where TSS Cannot Occur

KAUST Repository

Schaefer, Ulf

2013-10-10

Background Although transcription in mammalian genomes can initiate from various genomic positions (e.g., 3′UTR, coding exons, etc.), most locations on genomes are not prone to transcription initiation. It is of practical and theoretical interest to be able to estimate such collections of non-TSS locations (NTLs). The identification of large portions of NTLs can contribute to better focusing the search for TSS locations and thus contribute to promoter and gene finding. It can help in the assessment of 5′ completeness of expressed sequences, contribute to more successful experimental designs, as well as more accurate gene annotation. Methodology Using comprehensive collections of Cap Analysis of Gene Expression (CAGE) and other transcript data from mouse and human genomes, we developed a methodology that allows us, by performing computational TSS prediction with very high sensitivity, to annotate, with a high accuracy in a strand specific manner, locations of mammalian genomes that are highly unlikely to harbor transcription start sites (TSSs). The properties of the immediate genomic neighborhood of 98,682 accurately determined mouse and 113,814 human TSSs are used to determine features that distinguish genomic transcription initiation locations from those that are not likely to initiate transcription. In our algorithm we utilize various constraining properties of features identified in the upstream and downstream regions around TSSs, as well as statistical analyses of these surrounding regions. Conclusions Our analysis of human chromosomes 4, 21 and 22 estimates ~46%, ~41% and ~27% of these chromosomes, respectively, as being NTLs. This suggests that on average more than 40% of the human genome can be expected to be highly unlikely to initiate transcription. Our method represents the first one that utilizes high-sensitivity TSS prediction to identify, with high accuracy, large portions of mammalian genomes as NTLs. The server with our algorithm implemented is

Exploring Social Learning through Upstream Engagement in Science and Technology

DEFF Research Database (Denmark)

Mortensen, Jonas Egmose

This discussion paper deliberates on how the concept of social learning can be used for evaluating upstream engagement initiatives in science and technology.  The paper briefly introduces to the concept of upstream engagement and a concrete case, the UK Citizen Science for Sustainability project...... (SuScit), as an outset for discussing how the concept of social learning can be used for analysing and understanding relations between citizen participation, Science and research, and sustainability. A number of relevant research questions and methodological considerations are distilled...

Upstream oil and gas. Subsector no. 7: Oil and gas exploration and development 1995 to 1999

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-08-01

Prepared by the Alberta Human Resources and Employment, this report provides a summary of the lost-time injuries and disease descriptions of workers injured while employed in the upstream oil and gas industries in Alberta during the period 1995 to 1999. The report includes the characteristics of the injured worker and the risk of injury to workers in the industries in Alberta, as well as the cost of injuries and revenue by means of total premiums paid by the employers. The occupational fatalities that were accepted by the Workers Compensation Board and investigated by the Occupational Health and Safety were summarized in the report along with a brief description of the injuries. The aim was to provide information concerning health and safety issues to government, employers, workers, and health and safety officers in the industries in Alberta about health and safety issues. The focus was placed on the oil and gas exploration and development sub-sector. Defined as all upstream oil field activities of employers which generate revenue from the production and sale of crude oil and/or natural gas, the sub-sector comprises major integrated oil and gas companies and small independent producers. In those cases where the owner/producer operates its own upstream production/processing facilities, they form an integral part of this sub-section. In addition, oil and gas marketing firms are included. Oil/gas well, well head equipment; flow lines/gathering systems tied into field processing facilities; battery sites/compressors stations; crude oil separators and natural gas dehydrators/treaters; natural gas/sulfur processing plants; heavy oil projects including steam generation; and other enhanced recovery methods are all included in the sub-sector. The other sub-sectors in the upstream oil and gas industries are: exploration, oilfield maintenance and construction, well servicing with service rigs and power swivels, drilling of oil and gas wells, oilfield downhole and other

Characterization of a Non-Canonical Signal Peptidase Cleavage Site in a Replication Protein from Tomato Ringspot Virus.

Directory of Open Access Journals (Sweden)

Ting Wei

Full Text Available The NTB-VPg polyprotein from tomato ringspot virus is an integral membrane replication protein associated with endoplasmic reticulum membranes. A signal peptidase (SPase cleavage was previously detected in the C-terminal region of NTB-VPg downstream of a 14 amino acid (aa-long hydrophobic region (termed TM2. However, the exact location of the cleavage site was not determined. Using in vitro translation assays, we show that the SPase cleavage site is conserved in the NTB-VPg protein from various ToRSV isolates, although the rate of cleavage varies from one isolate to another. Systematic site-directed mutagenesis of the NTB-VPg SPase cleavage sites of two ToRSV isolates allowed the identification of sequences that affect cleavage efficiency. We also present evidence that SPase cleavage in the ToRSV-Rasp2 isolate occurs within a GAAGG sequence likely after the AAG (GAAG/G. Mutation of a downstream MAAV sequence to AAAV resulted in SPase cleavage at both the natural GAAG/G and the mutated AAA/V sequences. Given that there is a distance of seven aa between the two cleavage sites, this indicates that there is flexibility in the positioning of the cleavage sites relative to the inner surface of the membrane and the SPase active site. SPase cleavage sites are typically located 3-7 aa downstream of the hydrophobic region. However, the NTB-VPg GAAG/G cleavage site is located 17 aa downstream of the TM2 hydrophobic region, highlighting unusual features of the NTB-VPg SPase cleavage site. A putative 11 aa-long amphipathic helix was identified immediately downstream of the TM2 region and five aa upstream of the GAAG/G cleavage site. Based on these results, we present an updated topology model in which the hydrophobic and amphipathic domains form a long tilted helix or a bent helix in the membrane lipid bilayer, with the downstream cleavage site(s oriented parallel to the membrane inner surface.

Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

Energy Technology Data Exchange (ETDEWEB)

Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

1994-09-01

The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

Comparative CFD study of the effect of the presence of downstream turbines on upstream ones using a rotational speed control system

International Nuclear Information System (INIS)

Breton, S-P; Nilsson, K; Ivanell, S; Olivares-Espinosa, H; Masson, C; Dufresne, L

2014-01-01

The effect of a downstream turbine on the production of a turbine located upstream of the latter is studied in this work. This is done through the use of two CFD simulation codes, namely OpenFOAM and EllipSys3D, which solve the Navier-Stokes equations in their incompressible form using a finite volume approach. In both EllipSys3D and OpenFoam, the LES (Large Eddy Simulation) technique is used for modelling turbulence. The wind turbine rotors are modelled as actuator disks whose loading is determined through the use of tabulated airfoil data by applying the blade-element method. A generator torque controller is used in both simulation methods to ensure that the simulated turbines adapt, in terms of rotational velocity, to the inflow conditions they are submited to. Results from both simulation codes, although they differ slightly, show that the downstream turbine affects the upstream one when the spacing between the turbines is small. This is also suggested to be the case looking at measurements performed at the Lillgrund offshore wind farm, whose turbines are located unusually close to each other. However, for distances used in today's typical wind farms, this effect is shown by our calculations not to be significant

Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

Science.gov (United States)

Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

2016-11-18

Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

Final environmental impact statement for the Nevada Test Site and off-site locations in the State of Nevada. Transportation study, Volume 1, Appendix I

International Nuclear Information System (INIS)

1996-08-01

This report has been prepared to address local transportation issues concerning current and potential operations at the Nevada Test Site (NTS), to document the results of the NTS transportation risk analysis, and to provide information and supporting documentation for the Environmental Impact Statement (EIS) for the NTS and Off-Site Locations in the State of Nevada. Four alternatives are evaluated in the NTS EIS: Alternative 1, Continue Current Operations, (No Action); Alternative 2, Discontinue Operations; Alternative 3, Expanded Use; and Alternative 4, Alternate Use of Withdrawn Lands. The transportation risk analysis estimated the health risk from highway transportation of DOE-generated low-level waste, mixed waste, and defense-related nuclear materials for each of the four alternatives

Survey of Potential Hanford Site Contaminants in the Upper Sediment for the Reservoirs at McNary, John Day, The Dalles, and Bonneville Dams, 2003

Energy Technology Data Exchange (ETDEWEB)

Patton, Gregory W.; Priddy, M; Yokel, Jerel W.; Delistraty, Damon A.; Stoops, Thomas M.

2005-02-01

This report presents the results from a multi-agency cooperative environmental surveillance study. of the study looked at sediment from the pools upstream from dams on the Columbia River that are downstream from Hanford Site operations. The radiological and chemical conditions existing in the upper-level sediment found in the pools upstream from McNary Dam, John Day Dam, The Dalles Lock and Dam, and Bonneville Dam were evaluated. This study also evaluated beach sediment where available. Water samples were collected at McNary Dam to further evaluate potential Hanford contaminants in the lower Columbia River. Samples were analyzed for radionuclides, chemicals, and physical parameters. Results from this study were compared to background values from sediment and water samples collect from the pool upstream of Priest Rapids Dam (upstream of the Hanford Site) by the Hanford Site Surface Environmental Surveillance Project.

Moving Upstream in U.S. Hospital Care Toward Investments in Population Health.

Science.gov (United States)

Begun, James W; Potthoff, Sandra

The root causes for most health outcomes are often collectively referred to as the social determinants of health. Hospitals and health systems now must decide how much to "move upstream," or invest in programs that directly affect the social determinants of health. Moving upstream in healthcare delivery requires an acceptance of responsibility for the health of populations. We examine responses of 950 nonfederal, general hospitals in the United States to the 2015 American Hospital Association Population Health Survey to identify characteristics that distinguish those hospitals that are most aligned with population health and most engaged in addressing social determinants of health. Those "upstream" hospitals are significantly more likely to be large, not-for-profit, metropolitan, teaching-affiliated, and members of systems. Internally, the more upstream hospitals are more likely to organize their population health activities with strong executive-level involvement, full-time-equivalent support, and coordination at the system level.The characteristics differentiating hospitals strongly involved in population health and upstream activity are not unlike those characteristics associated with diffusion of many innovations in hospitals. These hospitals may be the early adopters in a diffusion process that will eventually include most hospitals or, at least, most not-for-profit hospitals. Alternatively, the population health and social determinants movements could be transient or could be limited to a small portion of hospitals such as those identified here, with distinctive patient populations, missions, and resources.

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

Science.gov (United States)

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Procedures for the site location of an storage centre of medium and low level radioactive wastes

International Nuclear Information System (INIS)

Pena G, P.; Garcia B, M.

2001-01-01

In order to establish the procedures for the location of a new and definitive storage center for medium and low level radioactive wastes which will be the place where confining, controlling and keeping those waste products of radioactive materials which were used in the hospitable centers, clinics and institutions (research and techniques development) as well as those obtained from industry. The site studies for nuclear facilities, require the participation of a several professionals with different specialities to be able to make use of competence in different disciplines. The result is the exclusion of unacceptable zones followed them by a pre-selection, a selection and a systematic comparison of those sites which are in the remaining zones considered as acceptable. (Author)

Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 2. Assessing Charge Site Location and Isotope Scrambling

Science.gov (United States)

Khakinejad, Mahdiar; Ghassabi Kondalaji, Samaneh; Donohoe, Gregory C.; Valentine, Stephen J.

2016-03-01

Ion mobility spectrometry (IMS) coupled with gas-phase hydrogen deuterium exchange (HDX)-mass spectrometry (MS) and molecular dynamic simulations (MDS) has been used for structural investigation of anions produced by electrospraying a sample containing a synthetic peptide having the sequence KKDDDDDIIKIIK. In these experiments the potential of the analytical method for locating charge sites on ions as well as for utilizing collision-induced dissociation (CID) to reveal the degree of deuterium uptake within specific amino acid residues has been assessed. For diffuse (i.e., more elongated) [M - 2H]2- ions, decreased deuterium content along with MDS data suggest that the D4 and D6 residues are charge sites, whereas for the more diffuse [M - 3H]3- ions, the data suggest that the D4, D7, and the C-terminus are deprotonated. Fragmentation of mobility-selected, diffuse [M - 2H]2- ions to determine deuterium uptake at individual amino acid residues reveals a degree of deuterium retention at incorporation sites. Although the diffuse [M - 3H]3- ions may show more HD scrambling, it is not possible to clearly distinguish HD scrambling from the expected deuterium uptake based on a hydrogen accessibility model. The capability of the IMS-HDX-MS/MS approach to provide relevant details about ion structure is discussed. Additionally, the ability to extend the approach for locating protonation sites on positively-charged ions is presented.

Optical power equalization for upstream traffic with injection-locked Fabry-Perot lasers in TDM-PON

Science.gov (United States)

Huang, Ting-Tsan; Sheu, Lih-Gen; Chi, Sien

2010-10-01

An optical power equalization of upstream traffic in time-division-multiplexed passive optical network (TDM-PON) based on injection-locked Fabry-Perot lasers has been experimentally investigated. The upstream transmitters with stable spectrum are achieved by using an external injection light source in the optical line terminal (OLT). The different upstream powers can be equalized by injection locking a Fabry-Perot laser diode (FP-LD) biased below threshold current in OLT. The dynamic upstream power range from - 8.5 to - 19.5 db m is reduced to a 1.6 dB maximal power variation, when the uplink signal is directly modulated at 1.25 Gb/s.

Anatomy of top 100 upstream players

International Nuclear Information System (INIS)

Burk, V.A.

1992-01-01

A brief review is given of a recent survey of the top one hundred upstream oil and gas companies which file financial data with the US Securities and Exchange Commission. The analysis indicates the increasing globalisation of the industry with exploration and development spending increasing dramatically outside the US. To survive, companies must operate as efficient low cost finders and producers of oil and gas and anticipate and meet changing market demands quickly. (UK)

75 FR 28657 - Dell Products LP-Parmer North Location, a Subsidiary of Dell, Inc., Including On-Site Leased...

Science.gov (United States)

2010-05-21

... Spherion Corporation; Round Rock, TX; Dell Products LP--Parmer North One; Austin, TX; Amended Certification... Products LP--Parmer North Location, a Subsidiary of Dell, Inc., Including On-Site Leased Workers From... Act of 1974, as amended (``Act''), 19 U.S.C. 2273, the Department of Labor issued a Certification of...

Multiple upstream modules regulate zebrafish myf5 expression

Directory of Open Access Journals (Sweden)

Weng Chih-Wei

2007-01-01

Full Text Available Abstract Background Myf5 is one member of the basic helix-loop-helix family of transcription factors, and it functions as a myogenic factor that is important for the specification and differentiation of muscle cells. The expression of myf5 is somite- and stage-dependent during embryogenesis through a delicate regulation. However, this complex regulatory mechanism of myf5 is not clearly understood. Results We isolated a 156-kb bacterial artificial chromosome clone that includes an upstream 80-kb region and a downstream 70-kb region of zebrafish myf5 and generated a transgenic line carrying this 156-kb segment fused to a green fluorescent protein (GFP reporter gene. We find strong GFP expression in the most rostral somite and in the presomitic mesoderm during segmentation stages, similar to endogenous myf5 expression. Later, the GFP signals persist in caudal somites near the tail bud but are down-regulated in the older, rostral somites. During the pharyngula period, we detect GFP signals in pectoral fin buds, dorsal rostral myotomes, hypaxial myotomes, and inferior oblique and superior oblique muscles, a pattern that also corresponds well with endogenous myf5 transcripts. To characterize the specific upstream cis-elements that regulate this complex and dynamic expression pattern, we also generated several transgenic lines that harbor various lengths within the upstream 80-kb segment. We find that (1 the -80 kb/-9977 segment contains a fin and cranial muscle element and a notochord repressor; (2 the -9977/-6213 segment contains a strong repressive element that does not include the notochord-specific repressor; (3 the -6212/-2938 segment contains tissue-specific elements for bone and spinal cord; (4 the -2937/-291 segment contains an eye enhancer, and the -2937/-2457 segment is required for notochord and myocyte expression; and (5 the -290/-1 segment is responsible for basal transcription in somites and the presomitic mesoderm. Conclusion We suggest

Multispacecraft observations of energetic ions upstream and downstream of the bow shock

International Nuclear Information System (INIS)

Scholer, M.; Mobius, E.; Kistler, L.M.; Klecker, B.; Ipavich, F.M.; Department of Physics and Astronomy, University of Maryland, College Park)

1989-01-01

We present simultaneous measurements of energetic protons and alpha particles inside and outside of the magnetopause, immediately upstream, and downstream as well as further upstream of the bow shock. A comparison between the intensity at the bow shock and further upstream results in an e-folding distance at 30 keV of similar to 6.2 R/sub E/. After transformation of the angular distribution into the solar wind frame a diffusion coefficeint of κ/sub parallel/similar to 3 R/sub E/ is obtained from the anisotropy and the intensity gradient. Immediately downstream of the bow shock the anisotropy in the shock frame is directed toward the magnetopause. After transformation into the plasma rest frame the distribution is isotropic. The intensity in the magnetosheath just outside the magnetopause is smaller than the intensity behind the bow shock. Thus, in the magnetosheath there is no gradient or streaming in the upstream direction. The spectra, intensities, and relative abundances in the magnetosheath and inside the magnetosphere are totally different. These observations are consistent with first order Fermi acceleration at the bow shock and subsequent downstream convection, and exclude a magnetospheric source for these particles. Copyright American Geophysical Union 1989

Upstream ORF affects MYCN translation depending on exon 1b alternative splicing

International Nuclear Information System (INIS)

Besançon, Roger; Puisieux, Alain; Valsesia-Wittmann, Sandrine; Locher, Clara; Delloye-Bourgeois, Céline; Furhman, Lydie; Tutrone, Giovani; Bertrand, Christophe; Jallas, Anne-Catherine; Garin, Elisabeth

2009-01-01

The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN) and one exon 1b-spliced (MYCN Δ1b ) mRNA. But nothing is known about their respective ability to translate the MYCN protein. Plasmids were prepared to enable translation from the upstream (uORF) and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCN Δ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Both are translated, but higher levels of protein were seen with MYCN Δ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCN Δ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCN Δ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCN Δ1b mRNA. Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction

Upstream waves in Saturn's foreshock

Science.gov (United States)

Bavassano Cattaneo, M. B.; Cattaneo, P.; Moreno, G.; Lepping, R. P.

1991-01-01

An analysis based on plasma and magnetic-field data obtained from Voyager 1 during its Saturn encounter is reported. The plasma data provided every 96 sec and magnetic-field data averaged over 48 sec are utilized. The evidence of upstream waves at Saturn are detected. The waves have a period, in the spacecraft frame, of about 550 sec and a relative amplitude larger than 0.3, are left- and right-hand elliptically polarized, and propagate at about 30 deg with respect to the average magnetic field. The appearance of the waves is correlated with the spacecraft being magnetically connected to the bow shock.

Land Use and Land Cover - CEMETERY_SITES_IDNR_IN: Cemetery Site Locations in Indiana (Indiana Department of Natural Resources, Division of Historic Preservation and Archaeology, 1:5,000, Point Shapefile)

Data.gov (United States)

NSGIC State | GIS Inventory — IDNR documentation states - “This dataset contains locations of cemetery sites in Indiana, regardless of age, number of graves, or size of the cemetery. Is it not...

Teaching Health Center Graduate Medical Education Locations Predominantly Located in Federally Designated Underserved Areas.

Science.gov (United States)

Barclift, Songhai C; Brown, Elizabeth J; Finnegan, Sean C; Cohen, Elena R; Klink, Kathleen

2016-05-01

Background The Teaching Health Center Graduate Medical Education (THCGME) program is an Affordable Care Act funding initiative designed to expand primary care residency training in community-based ambulatory settings. Statute suggests, but does not require, training in underserved settings. Residents who train in underserved settings are more likely to go on to practice in similar settings, and graduates more often than not practice near where they have trained. Objective The objective of this study was to describe and quantify federally designated clinical continuity training sites of the THCGME program. Methods Geographic locations of the training sites were collected and characterized as Health Professional Shortage Area, Medically Underserved Area, Population, or rural areas, and were compared with the distribution of Centers for Medicare and Medicaid Services (CMS)-funded training positions. Results More than half of the teaching health centers (57%) are located in states that are in the 4 quintiles with the lowest CMS-funded resident-to-population ratio. Of the 109 training sites identified, more than 70% are located in federally designated high-need areas. Conclusions The THCGME program is a model that funds residency training in community-based ambulatory settings. Statute suggests, but does not explicitly require, that training take place in underserved settings. Because the majority of the 109 clinical training sites of the 60 funded programs in 2014-2015 are located in federally designated underserved locations, the THCGME program deserves further study as a model to improve primary care distribution into high-need communities.

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

Science.gov (United States)

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

Directory of Open Access Journals (Sweden)

Adam G Marsh

Full Text Available Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera and an anemone (Nematostella vectensis. Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to

Analysis of an upstream weighted collocation approximation to the transport equation

International Nuclear Information System (INIS)

Shapiro, A.; Pinder, G.F.

1981-01-01

The numerical behavior of a modified orthogonal collocation method, as applied to the transport equations, can be examined through the use of a Fourier series analysis. The necessity of such a study becomes apparent in the analysis of several techniques which emulate classical upstream weighting schemes. These techniques are employed in orthogonal collocation and other numerical methods as a means of handling parabolic partial differential equations with significant first-order terms. Divergent behavior can be shown to exist in one upstream weighting method applied to orthogonal collocation

Spawning chronology, nest site selection and nest success of smallmouth bass during benign streamflow conditions

Science.gov (United States)

Dauwalter, D.C.; Fisher, W.L.

2007-01-01

We documented the nesting chronology, nest site selection and nest success of smallmouth bass Micropterus dolomieu in an upstream (4th order) and downstream (5th order) reach of Baron Fork Creek, Oklahoma. Males started nesting in mid-Apr. when water temperatures increased to 16.9 C upstream, and in late-Apr. when temperatures increased to 16.2 C downstream. Streamflows were low (77% upstream to 82% downstream of mean Apr. streamflow, and 12 and 18% of meanjun. streamflow; 47 and 55 y of record), and decreased throughout the spawning period. Larger males nested first upstream, as has been observed in other populations, but not downstream. Upstream, progeny in 62 of 153 nests developed to swim-up stage. Downstream, progeny in 31 of 73 nests developed to swim-up. Nesting densities upstream (147/km) and downstream (100/km) were both higher than any densities previously reported. Males selected nest sites with intermediate water depths, low water velocity and near cover, behavior that is typical of smallmouth bass. Documented nest failures resulted from human disturbance, angling, and longear sunfish predation. Logistic exposure models showed that water velocity at the nest was negatively related and length of the guarding male was positively related to nest success upstream. Male length and number of degree days were both positively related to nest success downstream. Our results, and those of other studies, suggest that biological factors account for most nest failures during benign (stable, low flow) streamflow conditions, whereas nest failures attributed to substrate mobility or nest abandonment dominate when harsh streamflow conditions (spring floods) coincide with the spawning season.

Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

Science.gov (United States)

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

ENHANCING THE ROLE OF STAKEHOLDERS IN THE MANAGEMENT OF UPSTREAM CILIWUNG WATERSHED

Directory of Open Access Journals (Sweden)

Iis Alviya

2016-08-01

Full Text Available Stakeholders have a ver y important role interm of the management of upstream watershed. Thus, the common understanding on the existence and role of stakeholders is an important factor in order to achieve good governance of watershed management, leading to the attainment of environmental, social and economic benefits. This paper aims to analyse the role, interests, and cooperation among stakeholders and its relationship with the condition of upper Ciliwung watershed. Stakeholder analysis was used in this study to identify stakeholders, to categorize them, and to investigate the relationship between stakeholders. The analysis showed the lack of cooperation among stakeholders both between key stakeholders with primar y stakeholders. This resulted in lack of communities' understanding on the benefits and the importance of conservation activities in the upstream Ciliwung watershed. Meanwhile, the cooperation between key stakeholders and supporting stakeholders, especially the providers of funds, was relatively better/stronger. This can be seen from a better management of inter-agency cooperation in the upstream Ciliwung watershed, although the effort was tend to be project-oriented. Therefore, communication forum need to be established, to taking role for synchronizing , collaborating and coordinating stakeholders' efforts, so that the management programs of upstream Ciliwung watershed can be integrated.

DOWNSTREAM ECOCIDE FROM UPSTREAM WATER PIRACY

OpenAIRE

Miah Muhammad Adel

2012-01-01

Upstream India and downstream Bangladesh share more than 50 international rivers. India has set up water diversion constructions in more than 50% of these rivers, the largest one being on the Bangladeshâs northwest upon the Ganges River, puts Bangladeshâs Gangetic ecosystem at stake. In some border rivers, India has set up groins on her side of river banks. Also, Indian side pumps Bangladesh river water stealthily from border-rivers. Further, India is constructing another dam and reservoir up...

Region 9 NPL Sites (Superfund Sites 2013)

Science.gov (United States)

NPL site POINT locations for the US EPA Region 9. NPL (National Priorities List) sites are hazardous waste sites that are eligible for extensive long-term cleanup under the Superfund program. Eligibility is determined by a scoring method called Hazard Ranking System. Sites with high scores are listed on the NPL. The majority of the locations are derived from polygon centroids of digitized site boundaries. The remaining locations were generated from address geocoding and digitizing. Area covered by this data set include Arizona, California, Nevada, Hawaii, Guam, American Samoa, Northern Marianas and Trust Territories. Attributes include NPL status codes, NPL industry type codes and environmental indicators. Related table, NPL_Contaminants contains information about contaminated media types and chemicals. This is a one-to-many relate and can be related to the feature class using the relationship classes under the Feature Data Set ENVIRO_CONTAMINANT.

The WW domain protein Kibra acts upstream of Hippo in Drosophila

DEFF Research Database (Denmark)

Baumgartner, Roland; Poernbacher, Ingrid; Buser, Nathalie

2010-01-01

inactivating the transcriptional coactivator Yorkie is well established, much less is known about the upstream events that regulate Hippo signaling activity. The FERM domain proteins Expanded and Merlin appear to represent two different signaling branches that feed into the Hippo pathway. Signaling...... by the atypical cadherin Fat may act via Expanded, but how Merlin is regulated has remained elusive. Here, we show that the WW domain protein Kibra is a Hippo signaling component upstream of Hippo and Merlin. Kibra acts synergistically with Expanded, and it physically interacts with Merlin. Thus, Kibra...

Impact of upstream industrial effluents on irrigation water quality ...

African Journals Online (AJOL)

Impact of upstream industrial effluents on irrigation water quality, soils and ... Knowledge of irrigation water quality is critical to predicting, managing and reducing salt ... Presence of heavy metals in concentration higher than the recommended ...

Optimal Locations for Siting Wind Energy Projects: Technical Challenges, Economics, and Public Preferences

Science.gov (United States)

Lamy, Julian V.

Increasing the percentage of wind power in the United States electricity generation mix would facilitate the transition towards a more sustainable, low-pollution, and environmentally-conscious electricity grid. However, this effort is not without cost. Wind power generation is time-variable and typically not synchronized with electricity demand (i.e., load). In addition, the highest-output wind resources are often located in remote locations, necessitating transmission investment between generation sites and load. Furthermore, negative public perceptions of wind projects could prevent widespread wind development, especially for projects close to densely-populated communities. The work presented in my dissertation seeks to understand where it's best to locate wind energy projects while considering these various factors. First, in Chapter 2, I examine whether energy storage technologies, such as grid-scale batteries, could help reduce the transmission upgrade costs incurred when siting wind projects in distant locations. For a case study of a hypothetical 200 MW wind project in North Dakota that delivers power to Illinois, I present an optimization model that estimates the optimal size of transmission and energy storage capacity that yields the lowest average cost of generation and transmission (/MWh). I find that for this application of storage to be economical, energy storage costs would have to be 100/kWh or lower, which is well below current costs for available technologies. I conclude that there are likely better ways to use energy storage than for accessing distant wind projects. Following from this work, in Chapter 3, I present an optimization model to estimate the economics of accessing high quality wind resources in remote areas to comply with renewable energy policy targets. I include temporal aspects of wind power (variability costs and correlation to market prices) as well as total wind power produced from different farms. I assess the goal of providing

An evaluation of the accuracy of modeled and computed streamflow time-series data for the Ohio River at Hannibal Lock and Dam and at a location upstream from Sardis, Ohio

Science.gov (United States)

Koltun, G.F.

2015-01-01

Between July 2013 and June 2014, the U.S. Geological Survey (USGS) made 10 streamflow measurements on the Ohio River about 1.5 miles (mi) downstream from the Hannibal Lock and Dam (near Hannibal, Ohio) and 11 streamflow measurements near the USGS Sardis gage (station number 03114306) located approximately 2.4 mi upstream from Sardis, Ohio. The measurement results were used to assess the accuracy of modeled or computed instantaneous streamflow time series created and supplied by the USGS, U.S. Army Corps of Engineers (USACE), and National Weather Service (NWS) for the Ohio River at Hannibal Lock and Dam and (or) at the USGS streamgage. Hydraulic or hydrologic models were used to create the modeled time series; index-velocity methods or gate-opening ratings coupled with hydropower operation data were used to create the computed time series. The time step of the various instantaneous streamflow time series ranged from 15 minutes to 24 hours (once-daily values at 12:00 Coordinated Universal Time [UTC]). The 15-minute time-series data, computed by the USGS for the Sardis gage, also were downsampled to 1-hour and 24-hour time steps to permit more direct comparisons with other streamflow time series.

Water Stress in Global Transboundary River Basins: Significance of Upstream Water Use on Downstream Stress

Science.gov (United States)

Munia, H.; Guillaume, J. H. A.; Mirumachi, N.; Porkka,M.; Wada, Yoshihide; Kummu, M.

2016-01-01

Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analyzed in many of these international river basins, this has not been systematically done at the global scale using coherent and comparable datasets. In this study, we aim to assess the change in downstream water stress due to upstream water use in the world's transboundary river basins. Water stress was first calculated considering only local water use of each sub-basin based on country-basin mesh, then compared with the situation when upstream water use was subtracted from downstream water availability. Wefound that water stress was generally already high when considering only local water use, affecting 0.95-1.44 billion people or 33%-51% of the population in transboundary river basins. After accounting for upstream water use, stress level increased by at least 1 percentage-point for 30-65 sub-basins, affecting 0.29-1.13 billion people. Altogether 288 out of 298 middle-stream and downstream sub-basin areas experienced some change in stress level. Further, we assessed whether there is a link between increased water stress due to upstream water use and the number of conflictive and cooperative events in the transboundary river basins, as captured by two prominent databases. No direct relationship was found. This supports the argument that conflicts and cooperation events originate from a combination of different drivers, among which upstream-induced water stress may play a role. Our findings contribute to better understanding of upstream-downstream dynamics in water stress to help address water allocation problems.

A Physico-Chemical water quality and Microbial content Analysis in Upstream of Langat River, Selangor

International Nuclear Information System (INIS)

Muhammad Barzani Gasim; Nazirah Zakaria; Roslan Umar; Roslan Umar; Ahmad Dasuki Mustafa

2015-01-01

Water quality study of the selected physico-chemical and microbial parameters of the Langat River were carried out to determine and classified their values. Sampling was carried out twice; first on 9 June 2011 and the second was on 22 February 2012. The sampling site consist of seven stations; five stations representing for Langat River branches while two stations are located in Langat River. The in-situ measurements are: dissolved oxygen, electrical conductivity, total dissolved solids, pH and temperature were performed using YSI 556 multiparameter, while the laboratory analysis were based on HACH and APHA methods. Result shows; temperature (23.4 - 27.7 degree Celsius), pH (5.07 to 6.15), EC (29.3 . 61.5 μS/ cm), TDS (19.7 - 47.0 mg/L), DO (3.68 - 5.72 mg/L), BOD (1.29 - 3.76 mg/L), COD (13.5 - 77.85 mg/L), TSS (9.5 - 86.5 mg/L), NH_3N (0.15 - 0.79 mg/L), NO_3 (0.8 - 4.9 mg/L), PO_4"3"- (0.15 - 0.7 mg/L), SO_4"2"- (0.5 - 12.5 mg/L) and biological parameters of faecal coliform (2.58 x 10"4 - 4.74 x 10"6 cfu/ 100 ml). Based on water quality index and the National Water Quality Standards classifications, they belong to the class I, II, III and V. One-way ANOVA for repeated measures and Pearson correlation test been used. The overall results showed the selected rivers in upstream of Langat River were classified as moderately polluted. (author)

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

OpenAIRE

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identifie...

Sector report: Malaysia. Upstream oil and gas industry

International Nuclear Information System (INIS)

1997-01-01

This report is one of a series designed to introduce British exporters to the opportunities offered by the Malaysian market in oil and natural gas. The report includes Malaysia's oil and gas reserves, production, exploration, major profits upstream, production sharing contracts, pipeline construction, operators in production, service sector, and Petronas. (UK)

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

International Nuclear Information System (INIS)

Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

7 CFR 1924.106 - Location.

Science.gov (United States)

2010-01-01

... 7 Agriculture 12 2010-01-01 2010-01-01 false Location. 1924.106 Section 1924.106 Agriculture... CONSTRUCTION AND REPAIR Planning and Performing Site Development Work § 1924.106 Location. (a) General. It is... will not finance development on locations that adversely affect properties which are listed or are...

Strategic human resources study of the upstream petroleum industry : the decade ahead

International Nuclear Information System (INIS)

2003-10-01

This report presents the results of a 10 month study of the human resources issues in Canada's upstream petroleum industry. The study identifies workforce demographics, skills, and supply and demand. It also discusses the impact of technology and other key challenges facing human resources issues. The upstream petroleum industry includes exploration and production, service industries, pipeline transmission, natural gas processing, and heavy oil and bitumen extracting and upgrading. The study defined four regions in Canada: Western Canada Sedimentary Basin, the oil sands, the north, and the east coast. The main influences on the management practices within the upstream petroleum industry are: globalization; cyclical economic conditions; operational excellence business models; government regulatory requirements; stakeholder expectations for involvement; technological advances; changing demographics, and workplace skills. The study also presented suggestions for changes in best practices to improve the efficiency and effectiveness of product and service delivery. refs., tabs., figs

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Distribution and speciation of metals (Cu, Zn, Cd, and Pb) in agricultural and non-agricultural soils near a stream upriver from the Pearl River, China

International Nuclear Information System (INIS)

Yang, Silin; Zhou, Dequn; Yu, Huayong; Wei, Rong; Pan, Bo

2013-01-01

The distribution and chemical speciation of typical metals (Cu, Zn, Cd and Pb) in agricultural and non-agricultural soils were investigated in the area of Nanpan River, upstream of the Pearl River. The investigated four metals showed higher concentrations in agricultural soils than in non-agricultural soils, and the site located in factory district contained metals much higher than the other sampling sites. These observations suggested that human activities, such as water irrigation, fertilizer and pesticide applications might have a major impact on the distribution of metals. Metal speciation analysis presented that Cu, Zn and Cd were dominated by the residual fraction, while Pb was dominated by the reducible fraction. Because of the low mobility of the metals in the investigated area, no remarkable difference could be observed between upstream and downstream separated by the factory site. -- Highlights: ► Agricultural soils contain higher metal concentrations than non-agricultural soils. ► The site located in the factory district has the highest metal concentration. ► Cu, Zn and Cd are dominated by residual fraction, and Pb by reducible fraction. ► Cd pollution should not be overlooked in soils upstream of Pearl River. -- The mobility of four investigated metals is low but Cd pollution should not be overlooked in soils upstream of Pearl River

Using the Multi-Criteria AHP for the Optimal Selection of Site Location and Wastewater Collection System The Case Study of Varzeghan

Directory of Open Access Journals (Sweden)

Hassan talebi

2015-11-01

Full Text Available This study investigates the use of multi-criteria decision making in waste management and selection of the site location and proper wastewater collection and processing system in Varzeqan Town. Moreover, the effect of the decision-making method employed on ranking the final alternatives will be evaluated. Different factors are involved in the selection of wastewater treatment construction sites. These factors, in turn, not only depend on the special location and time the decision is made but also have their own weights in the final decision. In this study, the environmental conditions in the study area are initially investigated to select one site from among five different alternatives proposed for the construction of the facility using the AHP method. Also, the AHP method is used to evaluate and select the suitable collection and treatment method from among the four non-conventional options including Septic Tank Effluent Gravity, Septic Tank Effluent Pressure, Vacuum Sewerage System, and Simplified Sewerage for this region based on the special geographical and geotechnical conditions. The results indicate that the barren lands between Varzeghan Town and Dizaj Safar Ali Village are the best site for constructing the treatment facility and that the simplified sewarge system is the best collection system for the region.

Enhancer elements upstream of the SHOX gene are active in the developing limb.

Science.gov (United States)

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-05-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.

Integrating smart-phone based momentary location tracking with fixed site air quality monitoring for personal exposure assessment.

Science.gov (United States)

Su, Jason G; Jerrett, Michael; Meng, Ying-Ying; Pickett, Melissa; Ritz, Beate

2015-02-15

Epidemiological studies investigating relationships between environmental exposures from air pollution and health typically use residential addresses as a single point for exposure, while environmental exposures in transit, at work, school or other locations are largely ignored. Personal exposure monitors measure individuals' exposures over time; however, current personal monitors are intrusive and cannot be operated at a large scale over an extended period of time (e.g., for a continuous three months) and can be very costly. In addition, spatial locations typically cannot be identified when only personal monitors are used. In this paper, we piloted a study that applied momentary location tracking services supplied by smart phones to identify an individual's location in space-time for three consecutive months (April 28 to July 28, 2013) using available Wi-Fi networks. Individual exposures in space-time to the traffic-related pollutants Nitrogen Oxides (NOX) were estimated by superimposing an annual mean NOX concentration surface modeled using the Land Use Regression (LUR) modeling technique. Individual's exposures were assigned to stationary (including home, work and other stationary locations) and in-transit (including commute and other travel) locations. For the individual, whose home/work addresses were known and the commute route was fixed, it was found that 95.3% of the time, the individual could be accurately identified in space-time. The ambient concentration estimated at the home location was 21.01 ppb. When indoor/outdoor infiltration, indoor sources of air pollution and time spent outdoors were taken into consideration, the individual's cumulative exposures were 28.59 ppb and 96.49 ppb, assuming a respective indoor/outdoor ratio of 1.33 and 5.00. Integrating momentary location tracking services with fixed-site field monitoring, plus indoor-outdoor air exchange calibration, makes exposure assessment of a very large population over an extended time period

Directions in locational conflict research: Voting on the location of nuclear waste disposal facilities

International Nuclear Information System (INIS)

Shelley, F.M.; Murauskas, G.T.

1985-01-01

It is clear from empirical evidence that currently significant locational conflicts concerning the siting of nuclear waste disposal facilities cannot be modeled under the standard noxious facility location paradigm that views locational conflict as conflict between regions. Rather, local populations are characterized by sharp disagreements as to whether the proposed facility is in fact salutary or noxious. Thus, conflict concerning nuclear waste disposal must be understood as a conflict among preferences and values, rather than among competing, areally defined interest groups. This has significant implications for the outcomes of political processes leading to siting decisions, as indicated in this paper. Whether intransivity occurs depends on the location and proportion of persons with different preference orderings concerning possible outcomes. Further research on this issue can and should be directed to further mathematical specification of these conditions along with empirical analysis where appropriate

Lost in Location

DEFF Research Database (Denmark)

Hansen, Lone Koefoed

2009-01-01

traversed. While becoming destination aware, the individual loses her location awareness. The article proposes that the reason people get lost when using sat-nav is due to a wrong location-performative paradigm. As an alternative, the article introduces and analyzes two performance-related examples...... that illustrate an alternative location-performative paradigm: Meredith Warner's Lost/Found knitting series and Etter and Schecht's Melodious Walkabout. In both examples, the artist's hand becomes the intermediary between alien and location. Thus, by exploring how wayfinding can be a poetically situated...... performance, the article examines how the growing locative media industry can learn from the location-aware performative strategies employed by artists who create situated and urban performances for the curious participant. The academic frames employed in the analysis draw on psychogeography, site...

Restructuring: new relationships between the oil companies and the upstream oil firms

International Nuclear Information System (INIS)

Barreau, S.

2001-11-01

Since the 1986 oil shock, international oil companies have focused on their base competencies, concentrating on activities viewed as their core businesses and steadily increasing the number of tasks to be subcontracted to the upstream oil and gas service sector. The upstream oil and gas service companies had to be restructured to face this new challenge. The strategies they launched at the end of the 80's were varied. Some firms became largely integrated (Schlumberger, Baker Hughes, Halliburton) whereas other firms chose to broaden their range of services. However generally, they opted for external investment which led to an important wave of mergers and acquisitions. The first part characterizes the upstream oil and gas sector by introducing the main oil and gas service firms and their recent strategic evolution. This concludes with both an economic valuation and a typology of attempted growth strategies. To illustrate this, a matrix has been created to characterise the dynamic paths of the oil and gas service firms. The purpose of the second part is to consider the economic theories related to industrial strategies. The strategies of innovation, market protection, vertical integration and diversification have been studied to illustrate the main conclusion which is that the aim of all these strategies was to change the relationships between the oil companies and the upstream oil and gas service firms. (author)

The upstream escape of energized solar wind protons from the bow shock

International Nuclear Information System (INIS)

Greenstadt, E.W.

1975-01-01

Recently, there have been some systematic observations of backstreaming protons at the Earth's bow shock with parallel velocity components and total energies much too high to be associated with the usual long-period upstream waves or to be produced by Sonnerup's simple reflection process (Lin et al., 1974), and these protons (30-100keV) were attributed to some unknown acceleration mechanism in the upstream region. The observations of Lof et al. involved protons in high pitch angle, and, although their reasons for favoring an upstream acceleration were quite different, it may seem intuitive that high pitch angle particles would have difficulty escaping the shock, especially at large field-normal angles. Such an inference would superficially support the notion of energization outside the bow shock. It seems worthwhile therefore to examine the extent to which the geometry of individual particle motion alone might select among reflected particles those that can escape upstream and those that cannot. In this paper the geometry of escape is described and some simple numerical examples are worked out for a few special cases. It is found that protons with rather high energies and pitch angles can escape the shock at only marginally quasi-parallel field orientations (i.e., thetasub(nB) approximately 50 0 ), even if they have quite moderate speeds parallel to B. (Auth.)

Retrotransposons. An RNA polymerase III subunit determines sites of retrotransposon integration.

Science.gov (United States)

Bridier-Nahmias, Antoine; Tchalikian-Cosson, Aurélie; Baller, Joshua A; Menouni, Rachid; Fayol, Hélène; Flores, Amando; Saïb, Ali; Werner, Michel; Voytas, Daniel F; Lesage, Pascale

2015-05-01

Mobile genetic elements are ubiquitous. Their integration site influences genome stability and gene expression. The Ty1 retrotransposon of the yeast Saccharomyces cerevisiae integrates upstream of RNA polymerase III (Pol III)-transcribed genes, yet the primary determinant of target specificity has remained elusive. Here we describe an interaction between Ty1 integrase and the AC40 subunit of Pol III and demonstrate that AC40 is the predominant determinant targeting Ty1 integration upstream of Pol III-transcribed genes. Lack of an integrase-AC40 interaction dramatically alters target site choice, leading to a redistribution of Ty1 insertions in the genome, mainly to chromosome ends. The mechanism of target specificity allows Ty1 to proliferate and yet minimizes genetic damage to its host. Copyright © 2015, American Association for the Advancement of Science.

Differences in sedge fen vegetation upstream and downstream from a managed impoundment

Science.gov (United States)

Kowalski, Kurt P.; Wilcox, Douglas A.

2003-01-01

The U.S. Fish and Wildlife Service proposed the restoration of wetlands impacted by a series of drainage ditches and pools located in an extensive undeveloped peatland in the Seney National Wildlife Refuge, Michigan. This study examined the nature and extent of degradation to the Marsh Creek wetlands caused by alteration of natural hydrology by a water-storage pool (C-3 Pool) that intersects the Marsh Creek channel. We tested the hypothesis that a reduction in moderate-intensity disturbance associated with natural water-level fluctuations below the C-3 dike contributed to lower species richness, reduced floristic quality and a larger tree and shrub component than vegetation upstream from the pool. Wetland plant communities were sampled quantitatively and analyzed for species richness, floristic quality and physiognomy. Aerial photographs, GIS databases and GPS data contributed to the characterization and analysis of the Marsh Creek wetlands. Results showed that there was lower species richness in vegetated areas downstream from the pool, but not the anticipated growth in shrubs. Wetland vegetation upstream and downstream from the pool had similar floristic quality, except for a greater number of weedy taxa above the pool. Seepage through the pool dike and localized ground-water discharge created conditions very similar to those observed around beaver dams in Marsh Creek. In essence, the dike containing the C-3 Pool affected hydrology and wetland plant communities in a manner similar to an enormous beaver dam, except that it did not allow seasonal flooding episodes to occur. Management actions to release water from the pool into the original Marsh Creek channel at certain times and in certain amounts that mimic the natural flow regime would be expected to promote greater plant species richness and minimize the negative impacts of the dike.

Upstream pressure variations associated with the bow shock and their effects on the magnetosphere

International Nuclear Information System (INIS)

Fairfield, D.H.; Baumjohann, W.; Paschmann, G.; Luehr, H.; Sibeck, D.G.

1990-01-01

Magnetic field enhancements and depressions on the time scales of minutes were frequently observed simultaneously by the AMPTE CCE, GOES 5, and GOES 6 spacecraft in the subsolar magnetosphere. The source of these perturbations has been detected in the high time resolution AMPTE IRM measurements of the kinetic pressure of the solar wind upstream of the bow shock. It is argued that these upstream pressure variations are not inherent in the solar wind but rather are associated with the bow shock. This conclusion follows from the facts that (1) the upstream field strength and the density associated with the perturbations are highly correlated with each other whereas these quantities tend to be anticorrelated in the undisturbed solar wind, and (2) the upstream perturbations occur within the foreshock or at its boundary. The results imply a mode of interaction between the solar wind and the magnetosphere whereby density changes produced in the foreshock subsequently convect through the bow shock and impinge on the magnetosphere. Also velocity decreases deep within the foreshock sometimes reach many tens of kilometers per second and may be associated with further pressure variations as a changing interplanetary field direction changes the foreshock geometry. Upstream pressure perturbations should create significant effects on the magnetopause and at the foot of nearby field lines that lead to the polar cusp ionosphere

How wireless remote technology reduces cost, boosts productivity and improves safety in upstream oil and gas operations

Energy Technology Data Exchange (ETDEWEB)

Wommack, K. [Viatran, Edmonton, AB (Canada)

2009-09-15

This article demonstrated how wireless communications can help oil and gas producers obtain the most current information on the status of their operations to help optimize operations and protect workers and equipment. Wireless communication can provide benefits at nearly every phase of upstream production. When combined with pressure, temperature, flow, level and other sensing devices, wireless communications provide an effective and economical way to deliver data on well or pipeline operations to site managers; optimize well-production, minimize workovers and prevent blowdowns at the wellhead; track oil and water production; measure differential pressure, line pressure and line temperature; and monitor the motorized choke and control valve position. Wireless technology offers significant savings through improved maintenance efficiency. With wireless systems in remote locations, there are seldom problems in the transmission path. Wireless technology makes it much easier and affordable to manage well operations from a safe distance. By eliminating the need for wires in a fracing operation, wireless can help fracing companies maintain a safe operating distance from their target wells, and move operations from well to well with ease. A wireless communication system for transmitting process data from field sensors to a field processing device consists of radio transmitters, a communications gateway and a user interface. The communications hub receives encrypted messages from the remote devices and transmits them to a flow computer, SCADA system, or Distributed Control System. Data is then transmitted to a central office. 1 fig.

Comprehensive Characterization a Tidal Energy Site (Invited)

Science.gov (United States)

Polagye, B. L.; Thomson, J. M.; Bassett, C. S.; Epler, J.; Northwest National Marine Renewable Energy Center

2010-12-01

-existing ambient noise levels and the transmission loss (or practical spreading) at frequencies of interest. Recording hydrophones deployed on the seabed are used to quantify ambient noise, but are contaminated by self-noise during periods of strong currents. An empirical estimate of transmission loss is obtained from a source of opportunity - a passenger ferry which operates for more than twelve hours each day. By comparing recorded sound pressure levels against the location of the passenger ferry and other vessels (logged by an AIS receiver), the empirical transmission loss and source level for the ferry are obtained. Measurements of current velocity and underwater noise can apply routine oceanographic instruments and techniques. More unique measurements will be more challenging, such as high resolution sampling of current structure upstream and downstream of an operating device tens of meters off the seabed. Innovative approaches are required for cost effective characterization of tidal energy sites and monitoring of operating projects.

Site Characterization of the Source Physics Experiment Phase II Location Using Seismic Reflection Data

Science.gov (United States)

Sexton, E. A.; Snelson, C. M.; Chipman, V.; Emer, D. F.; White, R. L.; Emmitt, R.; Wright, A. A.; Drellack, S.; Huckins-Gang, H.; Mercadante, J.; Floyd, M.; McGowin, C.; Cothrun, C.; Bonal, N.

2013-12-01

An objective of the Source Physics Experiment (SPE) is to identify low-yield nuclear explosions from a regional distance. Low-yield nuclear explosions can often be difficult to discriminate among the clutter of natural and man-made explosive events (e.g., earthquakes and mine blasts). The SPE is broken into three phases. Phase I has provided the first of the physics-based data to test the empirical models that have been used to discriminate nuclear events. The Phase I series of tests were placed within a highly fractured granite body. The evolution of the project has led to development of Phase II, to be placed within the opposite end member of geology, an alluvium environment, thereby increasing the database of waveforms to build upon in the discrimination models. Both the granite and alluvium sites have hosted nearby nuclear tests, which provide comparisons for the chemical test data. Phase III of the SPE is yet to be determined. For Phase II of the experiment, characterization of the location is required to develop the geologic/geophysical models for the execution of the experiment. Criteria for the location are alluvium thickness of approximately 170 m and a water table below 170 m; minimal fracturing would be ideal. A P-wave mini-vibroseis survey was conducted at a potential site in alluvium to map out the subsurface geology. The seismic reflection profile consisted of 168 geophone stations, spaced 5 m apart. The mini-vibe was a 7,000-lb peak-force source, starting 57.5 m off the north end of the profile and ending 57.5 m past the southern-most geophone. The length of the profile was 835 m. The source points were placed every 5 m, equally spaced between geophones to reduce clipping. The vibroseis sweep was from 20 Hz down to 180 Hz over 8 seconds, and four sweeps were stacked at each shot location. The shot gathers show high signal-to-noise ratios with clear first arrivals across the entire spread and the suggestion of some shallow reflectors. The data were

Multiple spacecraft observations of interplanetary shocks: characteristics of the upstream ulf turbulence

International Nuclear Information System (INIS)

Russell, C.T.; Smith, E.J.; Tsurutani, B.T.; Gosling, J.T.; Bame, S.J.

1982-01-01

All interplanetary shocks observed by ISEE-3 and either ISEE-1 or ISEE-2 or both in 1978 and 1979 are examined for evidence of upstream waves. In order to characterize the properties of these shocks it is necessary to determine accurate shock normals. We invert an overdetermined set of equations to obtain shock normals, velocities and error estimates for all these shocks. Tests of the method indicate it is quite reliable. Using these normals we then calculate the Mach number and angle between the interplanetary magnetic field and the shock normal for each shock. These parameters allow us to separate the upstream waves into two classes: whistler-mode precursors which occur at low Mach numbers and upstream turbulence whose amplitude at Mach numbers greater than 1.5 is controlled by the angle of the field to the shock normal. The former waves are right-hand circularly polarized and quite monochromatic. The latter waves are more linearly polarized and have a broadband featureless spectrum

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects.

Science.gov (United States)

Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

2017-06-01

This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L) of 192% over wild type (1.3 g/L). The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement.

E-ELT Site Chosen - World's Biggest Eye on the Sky to be Located on Armazones, Chile

Science.gov (United States)

2010-04-01

pollution and mining activities. Notes [1] The independent E-ELT Site Selection Advisory Committee (SSAC) has been analysing results from several possible sites worldwide in great detail. Similar efforts have been carried out by the Thirty-Meter Telescope (TMT) site selection team from the US. For the sake of efficiency, the sites pre-selected by the TMT team (all in North and South America) were not studied by the SSAC, as the TMT team shared their data with the SSAC. Two of the sites on the SSAC short list, including Armazones, were on the TMT list. [2] The full ESO Council Resolution reads as follow: Resolution of ESO Council on the Baseline Site for the E-ELT Recognising * the very clear recommendation from the Site Selection Advisory Committee that the E-ELT should be located on Cerro Armazones in Northern Chile * the considerable scientific synergy that would result between the E-ELT and future facilities in the Southern Hemisphere, most notably ALMA and SKA * the operational and scientific synergies with Paranal that would result and expressing its warmest appreciation for * the very generous offers from Spain and Chile to host the E-ELT * the very considerable contributions to the quality and depth of the discussion on the siting of the E-ELT made by Chile and Spain in the course of developing their offers; Council has concluded that the overriding driver for the decision on the location of the E-ELT should be the scientific quality of the site. The scientific qualities of Cerro Armazones and the positive impact that locating the E-ELT there will have on the future scientific leadership of ESO are sufficiently compelling to outweigh the very substantial offer made by Spain. Council has therefore resolved to approve the recommendation of the Director General to adopt Cerro Armazones in Chile as the baseline site for the E-ELT. Council noted that this decision is essential for the completion of the construction proposal for decision at a later date. More information

Torque fluctuations caused by upstream mean flow and turbulence

Science.gov (United States)

Farr, T. D.; Hancock, P. E.

2014-12-01

A series of studies are in progress investigating the effects of turbine-array-wake interactions for a range of atmospheric boundary layer states by means of the EnFlo meteorological wind tunnel. The small, three-blade model wind turbines drive 4-quadrant motor-generators. Only a single turbine in neutral flow is considered here. The motor-generator current can be measured with adequate sensitivity by means of a current sensor allowing the mean and fluctuating torque to be inferred. Spectra of torque fluctuations and streamwise velocity fluctuations ahead of the rotor, between 0.1 and 2 diameters, show that only the large-scale turbulent motions contribute significantly to the torque fluctuations. Time-lagged cross-correlation between upstream velocity and torque fluctuations are largest over the inner part of the blade. They also show the turbulence to be frozen in behaviour over the 2 diameters upstream of the turbine.

Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

Science.gov (United States)

Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

2017-11-01

We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

Annual and seasonal variations In the gamma activities in Sava river sediments upstream and downstream of NPP Krsko

International Nuclear Information System (INIS)

Stipe, Lulic

2006-01-01

Results of the five years monitoring of artificial and natural occurring radionuclides in the Sava river sediments are presented. Measurements were conducted as a part of the regular Krsko Nuclear Power Plant radioactivity control and the independent supervisions of the input of radionuclides into larger environment (immission). In order to estimate seasonal variations samples were taken from seven locations (one upstream and five downstream of the Krsko NPP) during four sampling period (seasonal) in each year. Selected radionuclides in the sediment fraction less than 0.5 mm were determined with gamma spectrometer equipped with BE3830 model High Purity Ge detector with 30% relative efficiency. (authors)

Annual and seasonal variations In the gamma activities in Sava river sediments upstream and downstream of NPP Krsko

Energy Technology Data Exchange (ETDEWEB)

Stipe, Lulic [Rudjer Boskovic Institute, Lab. for radioecology, Zagreb (Croatia)

2006-07-01

Results of the five years monitoring of artificial and natural occurring radionuclides in the Sava river sediments are presented. Measurements were conducted as a part of the regular Krsko Nuclear Power Plant radioactivity control and the independent supervisions of the input of radionuclides into larger environment (immission). In order to estimate seasonal variations samples were taken from seven locations (one upstream and five downstream of the Krsko NPP) during four sampling period (seasonal) in each year. Selected radionuclides in the sediment fractiess than 0.5 mm were determined with gamma spectrometer equipped with BE3830 model High Purity Ge detector with 30% relative efficiency. (authors)

Assessing potential effects of highway runoff on receiving-water quality at selected sites in Oregon with the Stochastic Empirical Loading and Dilution Model (SELDM)

Science.gov (United States)

Risley, John C.; Granato, Gregory E.

2014-01-01

In 2012, the U.S. Geological Survey and the Oregon Department of Transportation began a cooperative study to demonstrate use of the Stochastic Empirical Loading and Dilution Model (SELDM) for runoff-quality analyses in Oregon. SELDM can be used to estimate stormflows, constituent concentrations, and loads from the area upstream of a stormflow discharge site, from the site of interest and in the receiving waters downstream of the discharge. SELDM also can be used to assess the potential effectiveness of best management practices (BMP) for mitigating potential effects of runoff in receiving waters. Nominally, SELDM is a highway-runoff model, but it is well suited for analysis of runoff from other land uses as well. This report provides case studies and examples to demonstrate stochastic-runoff modeling concepts and to demonstrate application of the model. Basin characteristics from six Oregon highway study sites were used to demonstrate various applications of the model. The highway catchment and upstream basin drainage areas of these study sites ranged from 3.85 to 11.83 acres and from 0.16 to 6.56 square miles, respectively. The upstream basins of two sites are urbanized, and the remaining four sites are less than 5 percent impervious. SELDM facilitates analysis by providing precipitation, pre-storm streamflow, and other variables by region or from hydrologically similar sites. In Oregon, there can be large variations in precipitation and streamflow among nearby sites. Therefore, spatially interpolated geographic information system data layers containing storm-event precipitation and pre-storm streamflow statistics specific to Oregon were created for the study using Kriging techniques. Concentrations and loads of cadmium, chloride, chromium, copper, iron, lead, nickel, phosphorus, and zinc were simulated at the six Oregon highway study sites by using statistics from sites in other areas of the country. Water‑quality datasets measured at hydrologically similar

More Than Just a Spawning Location: Examining Fine Scale Space Use of Two Estuarine Fish Species at a Spawning Aggregation Site

Directory of Open Access Journals (Sweden)

Ross E. Boucek

2017-11-01

Full Text Available Many species that provide productive marine fisheries form spawning aggregations. Aggregations are predictable both in time and space and constitute nearly all of the reproductive activity for these species. For species that spend weeks to months on spawning aggregation sites, individuals may need to rely on a forage base at or near the spawning site to balance the high energetic cost associated with reproduction. Here, we ask: do spawning fish with protracted spawning seasons use spawning aggregation sites more or less than adjacent foraging habitats? To answer our research question, we tracked 30 Snook (Centropomus undecimalis and 29 Spotted Seatrout (Cynoscion nebulosus at a spawning site during the 2007 spawning season in Tampa Bay (FL, U.S. using acoustic telemetry. We quantified the amount of time both males and females of both species spent in various habitats with network analyses. Surprisingly, results from network analyses revealed that receivers with the highest edge densities for Snook and Seatrout occurred within the seagrass habitat, not the location of spawning. Likewise, we found that both Snook and Seatrout during the spawning season were using the seagrass habitat near the spawning site as much, or more than the location where spawning occurs. Our results show that if protected areas are formed based on only where spawning occurs, the reproductive stock will not be protected from fishing. Further, our results suggest that spawning aggregation sites and areas surrounding used by fishes, may have multiple ecological functions (i.e., larval dispersal and energy provisioning that may need to be considered in conservation actions. Our case study further supports hypotheses put forth in previous work that suggest we must consider more than just spawning sites in protected area development and ecological conservation.

Systematic identification of fragile sites via genome-wide location analysis of γ-H2AX

Science.gov (United States)

Szilard, Rachel K.; Jacques, Pierre-Étienne; Laramée, Louise; Cheng, Benjamin; Galicia, Sarah; Bataille, Alain R.; Yeung, ManTek; Mendez, Megan; Bergeron, Maxime; Robert, François; Durocher, Daniel

2011-01-01

Phosphorylation of histone H2AX is an early response to DNA damage in eukaryotes. In Saccharomyces cerevisiae, DNA damage or replication fork stalling results in histone H2A phosphorylation to yield γ-H2A (yeast γ-H2AX) in a Mec1 (ATR)- and Tel1 (ATM)- dependent manner. Here, we describe the genome-wide location analysis of γ-H2A as a strategy to identify loci prone to engage the Mec1 and Tel1 pathways. Remarkably, γ-H2A enrichment overlaps with loci prone to replication fork stalling and is caused by the action of Mec1 and Tel1, indicating that these loci are prone to breakage. Moreover, about half the sites enriched for γ-H2A map to repressed protein-coding genes, and histone deacetylases are necessary for formation of γ-H2A at these loci. Finally, our work indicates that high resolution mapping of γ-H2AX is a fruitful route to map fragile sites in eukaryotic genomes. PMID:20139982

Collisionless shocks and upstream waves and particles: Introductory remarks

International Nuclear Information System (INIS)

Kennel, C.F.

1981-01-01

We discuss more aspects of collisionless shock theory that might be pertinent to the problem of upstream waves and particles. It is hoped that our qualititive remarks may be a useful guide for the general reader as he goes through the detailed papers to come

Research on performance of upstream pumping mechanical seal with different deep spiral groove

International Nuclear Information System (INIS)

Wang, Q; Chen, H L; Liu, T; Liu, Y H; Liu, Z B; Liu, D H

2012-01-01

As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

Research on performance of upstream pumping mechanical seal with different deep spiral groove

Science.gov (United States)

Wang, Q.; Chen, H. L.; Liu, T.; Liu, Y. H.; Liu, Z. B.; Liu, D. H.

2012-11-01

As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

OpenAIRE

Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

2017-01-01

This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P...

Employee assistance programs in the upstream petroleum industry

International Nuclear Information System (INIS)

Crutcher, R.A.; Yip, R.Y.; Young, M.R.

1991-01-01

This paper is a descriptive overview of Employee Assistance Programs (EAPs) in the upstream Canadian petroleum industry. The authors review current EAP models within the occupational health setting and the Canadian health care context. This article also explores the challenging issues of EAP's emergent functions in workplace substance abuse programs, its changing role in organizational effectiveness and its professional identity

Geographic Location of a Computer Node Examining a Time-to-Location Algorithm and Multiple Autonomous System Networks

National Research Council Canada - National Science Library

Sorgaard, Duane

2004-01-01

.... A time-to-location algorithm can successfully resolve a geographic location of a computer node using only latency information from known sites and mathematically calculating the Euclidean distance...

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

Science.gov (United States)

Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

2012-12-15

Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in

Geological nominations at UNESCO World Heritage, an upstream struggle

Science.gov (United States)

Olive-Garcia, Cécile; van Wyk de Vries, Benjamin

2017-04-01

Using my 10 years experience in setting up and defending a UNESCO world Heritage Geological nomination, this presentation aims to give a personal insight into this international process and the differential use of science, subjective perception (aesthetic and 'naturality'), and politics. At this point in the process, new protocols have been tested in order to improve the dialogue, accountability and transparency between the different stake-holders. These are, the State parties, the IUCN, the scientific community, and UNESCO itself. Our proposal is the Chaîne des Puys-Limagne fault ensemble, which combines tectonic, geomorphological evolution and volcanology. The project's essence is a conjunction of inseparable geological features and processes, set in the context of plate tectonics. This very unicit yof diverse forms and processes creates the value of the site. However, it is just this that has caused a problem, as the advisory body has a categorical approach of nominations that separates items to assess them in an unconnected manner.From the start we proposed a combined approach, where a property is seen in its entirety, and the constituent elements seen as interlinked elements reflecting the joint underlying phenomena. At this point, our project has received the first ever open review by an independent technical mission (jointly set up by IUCN, UNESCO and the State party). The subsequent report was broadly supportive of the project's approach and of the value of the ensemble of features. The UNESCO committee in 2016, re-referred the nomination, acknowledging the potential Outstanding Universal Value of the site and requesting the parties to continue the upstream process (e.g. collaborative work), notably on the recommendations and conclusions of the Independent Technical mission report. Meetings are continuing, and I shall provide you with the hot-off-the-press news as this ground breaking nomination progresses.

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

Directory of Open Access Journals (Sweden)

Ana Maria Salazar-Bryam

2017-06-01

Full Text Available This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1 was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L of 192% over wild type (1.3 g/L. The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement. Keywords: Biotechnology, Microbiology

Topographic Change Detection at Select Archeological Sites in Grand Canyon National Park, Arizona, 2006-2007

Science.gov (United States)

Collins, Brian D.; Minasian, Diane L.; Kayen, Robert

2009-01-01

Topographic change of archeological sites within the Colorado River corridor of Grand Canyon National Park (GCNP) is a subject of interest to National Park Service managers and other stakeholders in the Glen Canyon Dam Adaptive Management Program. Although long-term topographic change resulting from a variety of natural processes is typical in the Grand Canyon region, a continuing debate exists on whether and how controlled releases from Glen Canyon Dam, located immediately upstream of GCNP, are impacting rates of site erosion, artifact transport, and the preservation of archeological resources. Continued erosion of archeological sites threatens both the archeological resources and our future ability to study evidence of past cultural habitation. Understanding the causes and effects of archaeological site erosion requires a knowledge of several factors including the location and magnitude of the changes occurring in relation to archeological resources, the rate of the changes, and the relative contribution of several potential causes, including sediment depletion associated with managed flows from Glen Canyon Dam, site-specific weather patterns, visitor impacts, and long-term climate change. To obtain this information, highly accurate, spatially specific data are needed from sites undergoing change. Using terrestrial lidar data collection techniques and novel TIN- and GRID-based change-detection post-processing methods, we analyzed topographic data for nine archeological sites. The data were collected using three separate data collection efforts spanning 16 months (May 2006 to September 2007). Our results documented positive evidence of erosion, deposition, or both at six of the nine sites investigated during this time interval. In addition, we observed possible signs of change at two of the other sites. Erosion was concentrated in established gully drainages and averaged 12 cm to 17 cm in depth with maximum depths of 50 cm. Deposition was concentrated at specific

Scenarios of radiological impacts in the long-term safety analysis of radioactive waste disposal at the Vector Site located in the Chernobyl exclusion zone

Energy Technology Data Exchange (ETDEWEB)

Rybalka, N.; Mykolaichuk, O. [State Nuclear Regulatory Inspectorate of Ukraine, Kyiv (Ukraine); Alekseeva, Z.; Kondratiev, S.; Nikolaev, E. [State Scientific and Technical Center for Nuclear and Radiation Safety, Kyiv (Ukraine)

2013-07-01

In Ukraine, at the Vector site in the Chernobyl exclusion zone, it is planned to dispose of large amounts of radioactive wastes, including those of Chernobyl origin, containing transuranium elements. The paper analyzes the main possible scenarios of radiological impacts of the Vector site for a long-term period after expiration of its active administrative control taking into account location of the Vector site in the exclusion zone. In the paper, assessment of total activities that can be disposed of on site is demonstrated, based on non-exceeding of admissible radiological impacts. (orig.)

Radiological impact of surface water and sediment near uranium mining sites.

Science.gov (United States)

Ivanova, K; Stojanovska, Z; Badulin, V; Kunovska, B; Yovcheva, M

2015-12-01

The aim of this study is to assess the radiological impact of surface water and sediment around uranium mining sites 20 years after their closing. The areas under observations are 31 former classical underground uranium mining and exploratory sites in Bulgaria, named as objects. The extraction and processing of uranium ores in the Republic of Bulgaria were ended in 1992. To assess the radiological impact of radionuclides field expeditions were performed to sample water and bottom sediment. The migration of uranium through surface water was examined as one of the major pathways for contamination spread. The range of uranium concentration in water flowing from the mining sites was from 0.012 to 6.8 mgU l(-1) with a geometric mean of 0.192 mgU l(-1). The uranium concentrations in water downstream the mining sites were approximately 3 times higher than the background value (upstream). The concentrations of Unat, (226)Ra, (210)Pb, and (232)Th in the sediment of downstream river were higher than those upstream by 3.4, 2.6, 2, and 1.7 times, respectively. The distribution coefficient of uranium reflects its high mobility in most of the sites. In order to evaluate the impact on people as well as site prioritization for more detailed assessment and water management, screening dose assessments were done.

Increased risk of oesophageal adenocarcinoma among upstream petroleum workers

Science.gov (United States)

Kirkeleit, Jorunn; Riise, Trond; Bjørge, Tone; Moen, Bente E; Bråtveit, Magne; Christiani, David C

2013-01-01

Objectives To investigate cancer risk, particularly oesophageal cancer, among male upstream petroleum workers offshore potentially exposed to various carcinogenic agents. Methods Using the Norwegian Registry of Employers and Employees, 24 765 male offshore workers registered from 1981 to 2003 was compared with 283 002 male referents from the general working population matched by age and community of residence. The historical cohort was linked to the Cancer Registry of Norway and the Norwegian Cause of Death Registry. Results Male offshore workers had excess risk of oesophageal cancer (RR 2.6, 95% CI 1.4 to 4.8) compared with the reference population. Only the adenocarcinoma type had a significantly increased risk (RR 2.7, 95% CI 1.0 to 7.0), mainly because of an increased risk among upstream operators (RR 4.3, 95% CI 1.3 to 14.5). Upstream operators did not have significant excess of respiratory system or colon cancer or mortality from any other lifestyle-related diseases investigated. Conclusion We found a fourfold excess risk of oesophageal adenocarcinoma among male workers assumed to have had the most extensive contact with crude oil. Due to the small number of cases, and a lack of detailed data on occupational exposure and lifestyle factors associated with oesophageal adenocarcinoma, the results must be interpreted with caution. Nevertheless, given the low risk of lifestyle-related cancers and causes of death in this working group, the results add to the observations in other low-powered studies on oesophageal cancer, further suggesting that factors related to the petroleum stream or carcinogenic agents used in the production process might be associated with risk of oesophageal adenocarcinoma. PMID:19858535

On multi-site damage identification using single-site training data

Science.gov (United States)

Barthorpe, R. J.; Manson, G.; Worden, K.

2017-11-01

This paper proposes a methodology for developing multi-site damage location systems for engineering structures that can be trained using single-site damaged state data only. The methodology involves training a sequence of binary classifiers based upon single-site damage data and combining the developed classifiers into a robust multi-class damage locator. In this way, the multi-site damage identification problem may be decomposed into a sequence of binary decisions. In this paper Support Vector Classifiers are adopted as the means of making these binary decisions. The proposed methodology represents an advancement on the state of the art in the field of multi-site damage identification which require either: (1) full damaged state data from single- and multi-site damage cases or (2) the development of a physics-based model to make multi-site model predictions. The potential benefit of the proposed methodology is that a significantly reduced number of recorded damage states may be required in order to train a multi-site damage locator without recourse to physics-based model predictions. In this paper it is first demonstrated that Support Vector Classification represents an appropriate approach to the multi-site damage location problem, with methods for combining binary classifiers discussed. Next, the proposed methodology is demonstrated and evaluated through application to a real engineering structure - a Piper Tomahawk trainer aircraft wing - with its performance compared to classifiers trained using the full damaged-state dataset.

Permitted water pollution discharges and population cancer and non-cancer mortality: toxicity weights and upstream discharge effects in US rural-urban areas.

Science.gov (United States)

Hendryx, Michael; Conley, Jamison; Fedorko, Evan; Luo, Juhua; Armistead, Matthew

2012-04-02

The study conducts statistical and spatial analyses to investigate amounts and types of permitted surface water pollution discharges in relation to population mortality rates for cancer and non-cancer causes nationwide and by urban-rural setting. Data from the Environmental Protection Agency's (EPA) Discharge Monitoring Report (DMR) were used to measure the location, type, and quantity of a selected set of 38 discharge chemicals for 10,395 facilities across the contiguous US. Exposures were refined by weighting amounts of chemical discharges by their estimated toxicity to human health, and by estimating the discharges that occur not only in a local county, but area-weighted discharges occurring upstream in the same watershed. Centers for Disease Control and Prevention (CDC) mortality files were used to measure age-adjusted population mortality rates for cancer, kidney disease, and total non-cancer causes. Analysis included multiple linear regressions to adjust for population health risk covariates. Spatial analyses were conducted by applying geographically weighted regression to examine the geographic relationships between releases and mortality. Greater non-carcinogenic chemical discharge quantities were associated with significantly higher non-cancer mortality rates, regardless of toxicity weighting or upstream discharge weighting. Cancer mortality was higher in association with carcinogenic discharges only after applying toxicity weights. Kidney disease mortality was related to higher non-carcinogenic discharges only when both applying toxicity weights and including upstream discharges. Effects for kidney mortality and total non-cancer mortality were stronger in rural areas than urban areas. Spatial results show correlations between non-carcinogenic discharges and cancer mortality for much of the contiguous United States, suggesting that chemicals not currently recognized as carcinogens may contribute to cancer mortality risk. The geographically weighted

Permitted water pollution discharges and population cancer and non-cancer mortality: toxicity weights and upstream discharge effects in US rural-urban areas

Directory of Open Access Journals (Sweden)

Hendryx Michael

2012-04-01

Full Text Available Abstract Background The study conducts statistical and spatial analyses to investigate amounts and types of permitted surface water pollution discharges in relation to population mortality rates for cancer and non-cancer causes nationwide and by urban-rural setting. Data from the Environmental Protection Agency's (EPA Discharge Monitoring Report (DMR were used to measure the location, type, and quantity of a selected set of 38 discharge chemicals for 10,395 facilities across the contiguous US. Exposures were refined by weighting amounts of chemical discharges by their estimated toxicity to human health, and by estimating the discharges that occur not only in a local county, but area-weighted discharges occurring upstream in the same watershed. Centers for Disease Control and Prevention (CDC mortality files were used to measure age-adjusted population mortality rates for cancer, kidney disease, and total non-cancer causes. Analysis included multiple linear regressions to adjust for population health risk covariates. Spatial analyses were conducted by applying geographically weighted regression to examine the geographic relationships between releases and mortality. Results Greater non-carcinogenic chemical discharge quantities were associated with significantly higher non-cancer mortality rates, regardless of toxicity weighting or upstream discharge weighting. Cancer mortality was higher in association with carcinogenic discharges only after applying toxicity weights. Kidney disease mortality was related to higher non-carcinogenic discharges only when both applying toxicity weights and including upstream discharges. Effects for kidney mortality and total non-cancer mortality were stronger in rural areas than urban areas. Spatial results show correlations between non-carcinogenic discharges and cancer mortality for much of the contiguous United States, suggesting that chemicals not currently recognized as carcinogens may contribute to cancer

Wind Predictions Upstream Wind Turbines from a LiDAR Database

Directory of Open Access Journals (Sweden)

Soledad Le Clainche

2018-03-01

Full Text Available This article presents a new method to predict the wind velocity upstream a horizontal axis wind turbine from a set of light detection and ranging (LiDAR measurements. The method uses higher order dynamic mode decomposition (HODMD to construct a reduced order model (ROM that can be extrapolated in space. LiDAR measurements have been carried out upstream a wind turbine at six different planes perpendicular to the wind turbine axis. This new HODMD-based ROM predicts with high accuracy the wind velocity during a timespan of 24 h in a plane of measurements that is more than 225 m far away from the wind turbine. Moreover, the technique introduced is general and obtained with an almost negligible computational cost. This fact makes it possible to extend its application to both vertical axis wind turbines and real-time operation.

LONG-TERM STABILITY OF THE LOCAL GROUND CONTROL NETWORK AT THE CO-LOCATION SITE OF MEDICINA

Science.gov (United States)

Abbondanza, C.; Sarti, P.; Legrand, J.

2009-12-01

ITRF combinations rely on the availability of accurate tie vectors linking reference points of space geodetic techniques. Co-located instruments are assumed to move consistently and no local relative motion is taken into account. Instabilities may degrade the quality of the co-location itself and perturb the result of ITRF combinations. This work aims to determine the stability of the local ground control network at Medicina (Italy) with independent surveying methods. The observatory hosts a co-location between a VLBI telescope and two GPS antennas, MEDI and MSEL. It is located in the Po Plain where thick layers of clays are the prevalent soil characteristics. Hence, provision of long term stability of geodetic monuments is a challenge and monitoring their stability is an issue. MEDI and the VLBI station regularly contribute to the determination of ITRF, while MSEL is part of the EUREF network. A set of five tie vectors observations linking the VLBI and MEDI reference points was acquired between 2001 and 2007. It is our main tool for performing local deformation analysis. Additionally, the GPS time series of MEDI and MSEL were used to cross check and confirm the local instability detected by terrestrial methods. To achieve a rigorous and reliable investigation of the local stability, multi-epoch terrestrial observations were homogeneously processed according to common parameterizations in a consistent reference frame. Similarly, continuous GPS observations from MEDI and MSEL were analysed according to the new EPN reprocessing strategy in order to monitor the short baseline between MEDI and MSEL; to spotlight any change in its length. Both approaches confirm differential motions at the site which can be related to monument instabilities originated by the particularly unfavourable local geological setting and the inapt design of the monuments foundation. The monuments move non homogeneously at rates reaching up to 1.6 mm/year, this value being comparable to intra

Towards a risk map of malaria for Sri Lanka: the importance of house location relative to vector breeding sites

DEFF Research Database (Denmark)

Van Der Hoek, Wim; Konradsen, Flemming; Amerasinghe, Priyanie H

2003-01-01

of house location relative to vector breeding sites for the occurrence of malaria in order to assess the usefulness of this parameter in future malaria risk maps. Such risk maps could be important tools for planning efficient malaria control measures. METHODS: In a group of seven villages in north central......BACKGROUND: In Sri Lanka, the major malaria vector Anopheles culicifacies breeds in pools formed in streams and river beds and it is likely that people living close to such breeding sites are at higher risk of malaria than people living further away. This study was done to quantify the importance...... Sri Lanka, malaria cases were compared with community controls for distance from house to breeding sites and a number of other variables, including type of housing construction and use of anti-mosquito measures. The presence of An. culicifacies in bedrooms was determined by indoor insecticide spray...

Willingness of upstream and downstream resource managers to engage in compensation schemes for environmental services

Directory of Open Access Journals (Sweden)

Chapika Sangkapitux

2009-04-01

Full Text Available Providing compensation for agricultural conservation practices adopted by upstream farmers is still an alien concept in the Thai political context. The governance of common-pool natural resources, such as forest and water, has traditionally been under the control of powerful government line agencies, while the contribution of local communities to natural resource conservation have been hardly recognized by policy-makers. Drawing on a case study in Mae Sa watershed, Chiang Mai province, northern Thailand, this paper discusses the potential of developing compensation schemes in a socio-political context where upland farmers – mostly belonging to ethnic minority groups – tend to be considered a threat to the natural resource base rather than providers of environmental services. Based on data obtained from 371 households in the upstream communities and 151 households in the downstream communities of the watershed, upstream resource managers’ willingness to accept compensation for the conservation measures and downstream resource managers’ willingness to pay for water resource improvements were estimated through the use of choice experiments. Results from the study suggest that downstream resource managers would be willing to provide on average nearly 1% of their annual income for a substantial improvement of the quantity and quality of water resources, which could be achieved by compensating upstream farmers’ change of their agricultural systems towards more environment-friendly practices. Both willingness to pay of downstream respondents and willingness of upstream resource managers to accept compensation were positively correlated with age, education, participation in environmental conservation activities and previous experiences with droughts and/or erosion. The paper concludes that there is a clear potential for establishing compensation schemes for provision of environmental services in northern Thai watersheds. The important policy

Site Selection for Surplus Plutonium Disposition Facilities at the Savannah River Site

International Nuclear Information System (INIS)

Wike, L.D.

2000-01-01

A site selection study was conducted to evaluate locations for the proposed Surplus Plutonium Disposition Facilities. Facilities to be located include the Mixed Oxide (MOX) Fuel Fabrication Facility, the Pit Disassembly and Conversion Facility (PDCF), and the Plutonium Immobilization Project (PIP) facility. Objectives of the study include: (1) Confirm that the Department of Energy (DOE) selected locations for the MOX and PDCF were suitable based on selected siting criteria, (2) Recommend a site in the vicinity of F Area that is suitable for the PIP, and (3) Identify alternative suitable sites for one or more of these facilities in the event that further geotechnical characterization or other considerations result in disqualification of a currently proposed site

Strategic Location and Territorial Integrity: The Role of Subsidiary Sites in the Classic Maya Kingdoms of the Upper Usumacinta Region

Directory of Open Access Journals (Sweden)

Armando Anaya Hernández

2006-03-01

Full Text Available The Upper Usumacinta region was the scene of an intense interaction between the different kingdoms of the Classic Maya Period. This interaction took the form of political and marriage alliances as well as warfare and is well attested in the inscribed monuments of the region, especially towards the Late Classic Period (c. AD 600-900. Through this interaction the Maya rulers would not only assert their claim to power but also ensure the boundaries of their kingdoms, with an eye to accruing a vaster domain. The definition of the political organisation and territorial extent of the Maya Lowland kingdoms is an issue that has attracted the attention of various scholars (Adams 1981; Adams and Jones 1981; Ball and Taschek 1991; Flannery 1972; Freidel 1981; Hammond 1974; 1981; Inomata and Aoyama 1996; Mathews 1988; 1991; Sanders 1981. Like these scholars, I have presented a model aimed at estimating the territorial extent of the kingdoms of the Upper Usumacinta region, taking into account the physical characteristics of the terrain (Anaya Hernández 2001. In this article I approach this issue again, focusing this time on the importance that the subsidiary centres located at strategic locations across the landscape had for the maintenance of the territorial integrity of the kingdoms of Pomoná and Piedras Negras. The political importance of these sites is reflected in the efforts that the kings of these polities went through to warrant the loyalty of the rulers of these secondary centres, as can be attested by the presence of a sculptured stela at the site of Panhalé, in the vicinity of Pomoná, and an inscribed wooden box found within the Redención del Campesino Valley that makes reference to a Piedras Negras ruler. To address this issue I took advantage of the capabilities that GIS offers to model movement across the physical setting in order to define the potential boundaries between the aforementioned kingdoms in the light of the available

Comparison of accelerated ion populations observed upstream of the bow shocks at Venus and Mars

Directory of Open Access Journals (Sweden)

M. Yamauchi

2011-03-01

Full Text Available Foreshock ions are compared between Venus and Mars at energies of 0.6~20 keV using the same ion instrument, the Ion Mass Analyser, on board both Venus Express and Mars Express. Venus Express often observes accelerated protons (2~6 times the solar wind energy that travel away from the Venus bow shock when the spacecraft location is magnetically connected to the bow shock. The observed ions have a large field-aligned velocity compared to the perpendicular velocity in the solar wind frame, and are similar to the field-aligned beams and intermediate gyrating component of the foreshock ions in the terrestrial upstream region. Mars Express does not observe similar foreshock ions as does Venus Express, indicating that the Martian foreshock does not possess the intermediate gyrating component in the upstream region on the dayside of the planet. Instead, two types of gyrating protons in the solar wind frame are observed very close to the Martian quasi-perpendicular bow shock within a proton gyroradius distance. The first type is observed only within the region which is about 400 km from the bow shock and flows tailward nearly along the bow shock with a similar velocity as the solar wind. The second type is observed up to about 700 km from the bow shock and has a bundled structure in the energy domain. A traversal on 12 July 2005, in which the energy-bunching came from bundling in the magnetic field direction, is further examined. The observed velocities of the latter population are consistent with multiple specular reflections of the solar wind at the bow shock, and the ions after the second reflection have a field-aligned velocity larger than that of the de Hoffman-Teller velocity frame, i.e., their guiding center has moved toward interplanetary space out from the bow shock. To account for the observed peculiarity of the Martian upstream region, finite gyroradius effects of the solar wind protons compared to the radius of the bow shock curvature and

Canada's upstream petroleum industry : 1997 perspective

International Nuclear Information System (INIS)

1997-06-01

A review of the trends and activities in the upstream petroleum industry during 1996 were presented, emphasizing the significance of the industry' contribution to Canada's economy. Among the areas included were highlights of Canada's hydrocarbon reserves, conventional production, frontier production, and non-conventional (oil sands) production. New market opportunities and activities in the pipeline transportation sector were also discussed. Environmental issues including health and safety received due attention. In this regard, the industry's efforts to work with government and other stakeholders to ensure that requirements for land use are balanced with the need to protect wilderness and wildlife habitat, received special mention. 16 figs

Demography and ecology of nuclear power plant location

International Nuclear Information System (INIS)

Stefanescu, P.; Ghitescu, P.

1997-01-01

To select and licence a NPP site, as well as, once built, to run it, both demography and ecology of the geographical zone are crucial factors to take into account. On the other side the location and running of a NPP is a major factor in the economic and social development of NPP site surroundings. Meanwhile the population distribution around the NPP site has a determining role on intervention and rehabilitation plans. Risk and danger studies should be done for initial situation as well as during NPP running. The character of radioactive risks and the importance of possible consequences of a hypothetical nuclear accident which could affect a big Nuclear Power Plant request a special attention to population distribution around the plant site and surroundings. Therefore safety studies to locate and licence a site should refer to demography and ecology. Available data examination will permit to locate NPP in less-populated and ecologically not-concerning zones. On-site investigation should identify the population groups to watch for in order to estimate the results of a normal evaluation. The inquires will give reference primary data before NPP construction starts. Also they evaluate the possibility of short term population retain on location in case of an accident. (authors)

How downstream sub-basins depend on upstream inflows to avoid scarcity: typology and global analysis of transboundary rivers

Science.gov (United States)

Munia, Hafsa Ahmed; Guillaume, Joseph H. A.; Mirumachi, Naho; Wada, Yoshihide; Kummu, Matti

2018-05-01

Countries sharing river basins are often dependent upon water originating outside their boundaries; meaning that without that upstream water, water scarcity may occur with flow-on implications for water use and management. We develop a formalisation of this concept drawing on ideas about the transition between regimes from resilience literature, using water stress and water shortage as indicators of water scarcity. In our analytical framework, dependency occurs if water from upstream is needed to avoid scarcity. This can be diagnosed by comparing different types of water availability on which a sub-basin relies, in particular local runoff and upstream inflows. At the same time, possible upstream water withdrawals reduce available water downstream, influencing the latter water availability. By developing a framework of scarcity and dependency, we contribute to the understanding of transitions between system regimes. We apply our analytical framework to global transboundary river basins at the scale of sub-basin areas (SBAs). Our results show that 1175 million people live under water stress (42 % of the total transboundary population). Surprisingly, the majority (1150 million) of these currently suffer from stress only due to their own excessive water use and possible water from upstream does not have impact on the stress status - i.e. they are not yet dependent on upstream water to avoid stress - but could still impact on the intensity of the stress. At the same time, 386 million people (14 %) live in SBAs that can avoid stress owing to available water from upstream and have thus upstream dependency. In the case of water shortage, 306 million people (11 %) live in SBAs dependent on upstream water to avoid possible shortage. The identification of transitions between system regimes sheds light on how SBAs may be affected in the future, potentially contributing to further refined analysis of inter- and intrabasin hydro-political power relations and strategic planning

Flood potential of Topopah Wash and tributaries, eastern part of Jackass Flats, Nevada Test Site, southern Nevada

International Nuclear Information System (INIS)

Christensen, R.C.; Spahr, N.E.

1980-01-01

Guidelines for evaluating potential surface facilities to be used for the storage of high-level radioactive wastes on the Nevada Test Site in southern Nevada include the consideration of the potential for flooding. Those floods that are considered to constitute the principal flood hazards for these facilities are the 100- and 500-year floods, and the maximum potential flood. Flood-prone areas for the three floods with present natural-channel conditions were defined for the eastern part of Jackass Flats in the southwestern part of the Nevada Test Site. The 100-year flood-prone areas would closely parallel most stream channels with very few occurrences of out-of-bank flooding between adjacent channels. Out-of-bank flooding would occur at depths of less than 2 feet with mean velocities as much as 7 feet per second. Channel flood depths would range from 1 to 9 feet and mean velocities would range from 3 to 9 feet per second. The 500-year flood would exceed the discharge capacities of all channels except for Topopah Wash and some channels in the upstream reaches of a few tributaries. Out-of-bank flows between adjacent channels would occur at depths as much as 3 feet with mean velocities of more than 7 feet per second. Channel flood depths would range from 1 to 12 feet and mean velocities would range from 3 to 13 feet per second. The maximum potential flood would inundate most of the study area. Excluded areas would be those located immediately east of the upstream reach of Topopah Wash and between upstream channel reaches of some tributaries. Out-of-bank flows between adjacent channels would occur at depths as much as 5 feet with mean velocities as much s 13 feet per second. Channel flood depth would range from 2 to 23 feet and mean velocities would range from 4 to 26 feet per second

Promoter proximal polyadenylation sites reduce transcription activity

DEFF Research Database (Denmark)

Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick

2012-01-01

Gene expression relies on the functional communication between mRNA processing and transcription. We previously described the negative impact of a point-mutated splice donor (SD) site on transcription. Here we demonstrate that this mutation activates an upstream cryptic polyadenylation (CpA) site......, which in turn causes reduced transcription. Functional depletion of U1 snRNP in the context of the wild-type SD triggers the same CpA event accompanied by decreased RNA levels. Thus, in accordance with recent findings, U1 snRNP can shield premature pA sites. The negative impact of unshielded pA sites...... on transcription requires promoter proximity, as demonstrated using artificial constructs and supported by a genome-wide data set. Importantly, transcription down-regulation can be recapitulated in a gene context devoid of splice sites by placing a functional bona fide pA site/transcription terminator within ∼500...

Environmental regulatory framework for the upstream petroleum industry

International Nuclear Information System (INIS)

1996-01-01

In order to provide its member companies with a useful reference document in environmental analysis and compliance, CAPP compiled a list of Canadian legislation, regulations and guidelines which relate to the upstream petroleum industry. Text of all federal, Alberta, British Columbia and Saskatchewan legislation, regulations, guidelines and related documents were provided. Pending legislation, regulations and government policy have been identified. Annual updates will be provided to all subscribers

Effects on the upstream flood inundation caused from the operation of Chao Phraya Dam

Directory of Open Access Journals (Sweden)

Sutham Visutimeteegorn

2007-11-01

Full Text Available During the flooding events, the operation of Chao Phraya Dam to control downstream water discharge is one of the causes of the inundation occuring over the upstream area. The purposes of this research are to study the effects of the operation of Chao Phraya Dam upon the upstream flood inundation and to find out the new measures of the flood mitigation in the upstream areas of Chao Phraya Dam by using a hydrodynamic model. The results show that Manning's n in the Chao Phraya River and its tributaries is 0.030-0.035 in the main channels and 0.050-0.070 in the flood plain areas. The backwater due to the operation of the Chao Praya dam affects as far as 110 kilometers upstream. New methods of water diversion can mitigate the flood inundation without the effect on the floating rice fields. The construction of reservoirs in the Upper Sakaekang River Basin and the Upper Yom River Basin will mitigate the flood not only in their own basins but also in the Lower Chao Phraya River Basin. The coordinated operation of the Chao Phraya Dam, the regulators and the upper basin reservoirs will efficiently mitigate the flood inundation.

Radiotracer studies in cavernous marble at Kamathikhairy Dam site, Pench Project (Maharashtra)

International Nuclear Information System (INIS)

Nath, Ravendra; Mahajan, N.M.; Vaidya, S.D.

1982-01-01

Radiotracer studies with tritiated water at Pench Project site conclusively proved that the cavernous marble upstream of the saddle dam is continuous with the marble occuring near the spillway portion of the main dam and that there is fast subterranean flow of water through the cavernous marble here. It is also established that this marble band upstream of the dam is interconnected with the marble band occuring in the vicinity of Pali village about 3 km downstream of the dam. Though big unclogged subterranean channels do not seem to exist in this region, which might have resulted in heavy leakage from the impounded reservoir, yet the possibility of some leakage of the water through the cavernous marble cannot be ruled out, due to the interconnection of the marble occuring upstream of the dam with the downstream marble band. (author)

Observations of two distinct populations of bow shock ions in the upstream solar wind

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.; Bame, S.J.; Paschmann, G.; Sckopke, N.

1978-01-01

Observations upstream of the earth's bow shock with the LASL/MPI fast plasma experiments on ISEE 1 and 2 reveal the presence of two distinct and mutually exclusive populations of low energy (< or approx. =40keV) ions apparently accelerated at the bow shock. The first of these, the ''reflected'' population, is characterized by 1) sharply peaked spectra seldom extending much above approx. 10 keV/ion and 2) relatively collimated flow coming from the direction of the shock. On the other hand, the ''diffuse'' ions are distinguished by relatively flat energy spectra above approx. 10 keV and broad angular distributions. They are by far the most commonly observed upstream ion event. A close causal association is suggested between the diffuse ion population in the upstream solar wind and energetic plasma ions observed within the magnetosheath

MESSENGER Magnetic Field Observations of Upstream Ultra-Low Frequency Waves at Mercury

Science.gov (United States)

Le, G.; Chi, P. J.; Boardsen, S.; Blanco-Cano, X.; Anderosn, B. J.; Korth, H.

2012-01-01

The region upstream from a planetary bow shock is a natural plasma laboratory containing a variety of wave particle phenomena. The study of foreshocks other than the Earth's is important for extending our understanding of collisionless shocks and foreshock physics since the bow shock strength varies with heliocentric distance from the Sun, and the sizes of the bow shocks are different at different planets. The Mercury's bow shock is unique in our solar system as it is produced by low Mach number solar wind blowing over a small magnetized body with a predominately radial interplanetary magnetic field. Previous observations of Mercury upstream ultra-low frequency (ULF) waves came exclusively from two Mercury flybys of Mariner 10. The MESSENGER orbiter data enable us to study of upstream waves in the Mercury's foreshock in depth. This paper reports an overview of upstream ULF waves in the Mercury's foreshock using high-time resolution magnetic field data, 20 samples per second, from the MESSENGER spacecraft. The most common foreshock waves have frequencies near 2 Hz, with properties similar to the I-Hz waves in the Earth's foreshock. They are present in both the flyby data and in every orbit of the orbital data we have surveyed. The most common wave phenomenon in the Earth's foreshock is the large-amplitude 30-s waves, but similar waves at Mercury have frequencies at near 0.1 Hz and occur only sporadically with short durations (a few wave cycles). Superposed on the "30-s" waves, there are spectral peaks at near 0.6 Hz, not reported previously in Mariner 10 data. We will discuss wave properties and their occurrence characteristics in this paper.

EMMPRIN, an upstream regulator of MMPs, in CNS biology.

Science.gov (United States)

Kaushik, Deepak Kumar; Hahn, Jennifer Nancy; Yong, V Wee

2015-01-01

Matrix metalloproteinases (MMPs) are engaged in pathologies associated with infections, tumors, autoimmune disorders and neurological dysfunctions. With the identification of an upstream regulator of MMPs, EMMPRIN (Extracellular matrix metalloproteinase inducer, CD147), it is relevant to address if EMMPRIN plays a role in the pathology of central nervous system (CNS) diseases. This would enable the possibility of a more upstream and effective therapeutic target. Indeed, conditions including gliomas, Alzheimer's disease (AD), multiple sclerosis (MS), and other insults such as hypoxia/ischemia show elevated levels of EMMPRIN which correlate with MMP production. In contrast, given EMMPRIN's role in CNS homeostasis with respect to regulation of monocarboxylate transporters (MCTs) and interactions with adhesion molecules including integrins, we need to consider that EMMPRIN may also serve important regulatory or protective functions. This review summarizes the current understanding of EMMPRIN's involvement in CNS homeostasis, its possible roles in escalating or reducing neural injury, and the mechanisms of EMMPRIN including and apart from MMP induction. Copyright © 2015 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

Modelling the detachment dependence on strike point location in the small angle slot divertor (SAS) with SOLPS

Science.gov (United States)

Casali, Livia; Covele, Brent; Guo, Houyang

2017-10-01

The new Small Angle Slot (SAS) divertor in DIII-D is characterized by a shallow-angle target enclosed by a slot structure about the strike point (SP). SOLPS modelling results of SAS have demonstrated divertor closure's utility in widening the range of acceptable densities for adequate heat handling. An extensive database of runs has been built to study the detachment dependence on SP location in SAS. Density scans show that lower Te at lower upstream density occur when the SP is at the critical location in the slot. The cooling front spreads across the entire target at higher densities, in agreement with experimental Langmuir probe measurements. A localized increase of the atomic and molecular density takes place near the SP, which reduces the target incident power density and facilitates detachment at lower upstream density. Systematic scans of variables such as power, transport, and viscosity have been carried out to assess the detachment sensitivity. Therein, a positive role of the viscosity is found. This work supported by DOE Contract Number DE-FC02-04ER54698.

Upstream Tracking and the Decay $B^{0} \\to K^{+}\\pi^{-}\\mu^{+}\\mu^{-}$ at the LHCb Experiment

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00388407; Serra, Nicola; Steinkamp, Olaf; Storaci, Barbara

The LHCb detector is a single-arm forward spectrometer covering the pseudorapidity range $2 < \\eta < 5$, designed to search for indirect evidence of New Physics in $C\\!P$ violation and rare decays of beauty and charm hadrons. The unique geometry takes advantage of the large $b$ and $c$ quark production in the forward region at the LHC. The detector includes a high granularity silicon-strip vertex detector, a silicon-strip detector upstream of the magnet and three stations of silicon-strip detectors and straw drift tubes downstream of the magnet. This thesis is divided into two main parts. The first part details the development of improved algorithms to perform track reconstruction using the sub-detectors upstream of the LHCb magnet. A novel idea to perform upstream tracking as an intermediate step of the track reconstruction sequence was investigated. The vast gains in tracking performance obtained when using upstream tracks led to the algorithm being adopted into the default reconstruction sequence for...

Assessing off-site impacts of wildfires on aquatic organisms using in-situ assays

Science.gov (United States)

Ré, Ana; Saraiva, MariaJoão; Puga, João; Campos, Isabel; Pereira, Joana; Keizer, Jacob; Goncalves, Fernando; Abrantes, Nelson

2017-04-01

Wildfires have been recognized as an important source of diffuse pollution to aquatic systems, particularly through the production and transport of pyrolytic substances such as polycyclic aromatic hydrocarbons (PAHs) and metals associated to ash/soil loads. However, the effects of these compounds from recently burnt areas on the aquatic biota have been largely ignored. Hence, the main goal of this study was to assess the ecotoxicological effects of wildfires in aquatic systems through the use of in situ experiments. In this sense, five sites were selected in a catchment partially burnt: two in the main water course - Ceira river (Miranda do Corvo, Portugal), being one located upstream (RUS) and the other downstream (RDS) the burnt area; two in tributary streams within the burnt area (SUS and SDS); and finally one in a stream located in the unburnt part of the catchment (CS). During the first post-fire rainfall events, distinct organisms, including the water flea Daphnia magna, the freshwater shrimp Atyaephyra desmaresti, the freshwater clam Corbicula fluminea and the mosquitofish Gambusia holbrooki were exposed in situ, in all five sites, using dedicated test chambers. After four days of field exposition, the mortality and post-exposure feeding inhibition were evaluated. Feeding depression after exposure time was selected as a sub-lethal endpoint because it is a quick, sensitive and ecologically relevant indicator of toxic stress. The results showed negligible mortality for all the species and sites, thus lethality was not sensitive to discern impacts among the assessed sites. Conversely, the sub-lethal post-exposure feeding inhibition endpoint, revealed a decrease of feeding rate, in streams within the burnt area (SUS and SDS), that seemed to be the most affected places in the study area. Conversely, the sites outside the burnt area, both on river (RUS) and on the stream (CS), showed no adverse effects in this endpoint. Hence, the current results pointed-out that

Sheet GT1-1. Investigation of the hydrogeochemical behaviour of the Bellezane site; Fiche GT1-1. Etude du fonctionnement hydrogeochimique du site de Bellezane

Energy Technology Data Exchange (ETDEWEB)

NONE

2009-07-01

This document reports the acquisition of geochemical and radiological data in waters and in the upstream and downstream environment of the ancient uranium mining site of Bellezane (France), and the continuous piezo-metric monitoring (every 6 hours) of water levels in the residues and in the mining reservoir

On the location of the H+-extruding steps in site 2 of the mitochondrial electron transport chain.

Science.gov (United States)

Alexandre, A; Galiazzo, F; Lehninger, A L

1980-11-25

The location of the H+-translocating reactions within energy-conserving Site 2 of the mitochondrial electron transport chain was evaluated from two sets of data. In the first, the H+/2e- ejection ratios and Ca2+/2e- uptake ratios were compared for electron flow from succinate dehydrogenase, whose active site is on the matrix side of the inner membrane and from glycerol phosphate dehydrogenase, whose active site is on the cytosolic side. In intact rat liver mitochondria both substrates yielded H+/2e- ejection ratios close to 4.0 and Ca2+/2e- uptake ratios close to 1.0 during antimycin-sensitive reduction of ferricyanide. With rat liver mitoplasts and ferricytochrome c as electron acceptor, both substrates again gave the same stoichiometric ratios. The second approach involved determination of the sidedness of H+ formation during electron flow from succinate to ferricyanide via bypass of the antimycin block of the cytochrome b.c1 complex provided by N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD), under conditions in which the TMPD-TMPD+ couple does not act as a membrane-penetrating protonophore. Electron flow in this system was inhibited by 2-then-oyltrifluoroacetone, indicating that TMPD probably accepts electrons from ubiquinol. The 2 H+ formed in this system were not delivered into the matrix but appeared directly in the medium in the absence of a protonophore. To accommodate the available evidence on Site 2 substrates, it is concluded that the substrate hydrogens are first transferred to ubiquinone, 2 H+ per 2e then appear in the medium by protolytic dehydrogenation of a species of ubiquinol or ubiquinol-protein having the appropriate sidedness (designated Site 2A), and the other 2 H+ are translocated from the matrix to the medium on passage of 2e- through the cytochrome b x c1 complex (designated Site 2B).

Permian Basin location recommendation report

International Nuclear Information System (INIS)

1983-09-01

Candidate study areas are screened from the Palo Duro and Dalhart Basin areas using data obtained from studies to date and criteria and specifications that consider: rock geometry; rock characteristics; human intrusion potential; surface characteristics; and environmental and socioeconomic conditions. Two preferred locations are recommended from among these areas for additional characterization to identify potential National Waste Terminal Storage (NWTS) salt repository sites. One location, in northeastern Deaf Smith County and southeastern Oldham County, is underlain by two salt units that meet the adopted screening specifications. The other location, in northcentral Swisher County, is underlain by one salt unit that meets the adopted screening specifications. Both locations have several favorable features, relative to surrounding areas, and no obviously undesirable characteristics. Both lie wholly on the Southern High Plains surface, are in relatively sparsely populated areas, contain no unique land use conflicts, and comprise large enough geographic areas to provide flexibility in site selection. Data gathered to date indicate that these locations contain salt units sufficient in thickness and in depth for the safe construction and operation of the underground facilities under consideration. 93 references, 34 figures, 6 tables

Automation and control trends in the upstream sector of the oil industry

Energy Technology Data Exchange (ETDEWEB)

Plucenio, Agustinho; Pagano, Daniel J. [Universidade Federal de Santa Catarina (UFSC), Florianopolis, SC (Brazil). Programa de Recursos Humanos da ANP em Automacao, Controle e Instrumentacao para a Industria do Petroleo e Gas, PRH-34

2004-07-01

The need to continuously improve the aspects of Health, Safety and Environment to operators, installation's security, optimization of oil reservoir recovery in wells operating with different artificial lift methods, subject to different secondary recovery techniques, has motivated the development of technologies in the automation and control for the upstream sector of the oil industry. While the application of control and automation techniques is well established in the downstream sector of the oil industry that is not the case in the downstream sector. One tendency in this sector is the utilization of control via Field bus Networks. This technology uses equipment that communicate with each other in a two wire digital network and can be programmed to execute function blocks algorithms designed to perform a designed control strategy. The most noticeable benefits are the improvements in the process performance and the equipment reusability and interoperability. Proprietary solutions can be replaced by systems composed of equipment supplied by different manufacturers connected in the same network. These equipment operate according to a strategy designed by automation and control engineers under the supervision of professionals working in computer terminals located in different company departments. Other gains are a better understanding about the industry processes, application of optimization techniques, fault detection, equipment maintenance follow-up, and improved operators working conditions and workers qualification. Other tendencies are: permanent well monitoring. Either with installation of down hole sensors based on fiber grating sensors or surface sensors using embedded electronic processors. Developments of instrumentation technology for low cost multiphase flow measurements. Application of control techniques for flow regime control and optimization of reservoir recovery through better identification, optimization and Model Based Predictive Control

Characterization of upstream sequences from the 8S globulin gene ...

African Journals Online (AJOL)

Administrator

2011-09-21

Sep 21, 2011 ... added recombinant proteins and enzymes for industries. The upstream region ... cost, eukaryotic expression and no endogenous patho- gen pollution, thus it ... developmental process (Santino et al., 1997) which may deplete nutrient ... ideal bioreactors for economic production and storage of value-added ...

Site characterization plan overview: reference repository location, Hanford Site, Washington: Consultation draft: Nuclear Waste Policy Act (Section 113)

International Nuclear Information System (INIS)

1988-01-01

As part of the process for siting the nation's first geologic repository for radioactive waste, the Department of Energy (DOE) is preparing a site characterization plan for the Hanford site in Benton County, Washington. As a step in the preparation of that plan, the DOE has provided, for information and review, a consultation draft of the plan to the State of Washington, the affected Indian Tribes - the Confederated Tribes of the Umatilla Indian Reservation, the Nez Perce Indian Tribe, and the Yakima Indian Nation - and the US Nuclear Regulatory Commission. The Hanford site is one of three sites that the DOE currently plans to characterize;the other sites are the Deaf Smith County site in Texas and the Yucca Mountain site in Nevada. After site characterization has been completed and its results evaluated, the DOE will identify from among the three characterized sites the site that is preferred for the repository. The overview presented here consists of brief summaries of important topics covered in the consulation draft of the site characterization plan;it is not a substitute for the site characterization plan. The arrangement of the overview is similar to that of the plan itself, with breif descriptions of the dispoal system - the site, the repository, and the waste package - preceding the discussion of the characterization program to be carried out at the Hanford site. It is intended primarily for the management staff of organizations involved in the DOE's repository program or other persons who might wish to understand the general scope of the site-characterization program, the activities to be conducted, and the facilities to be constructed rather than the technical details of site characterization

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

Science.gov (United States)

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Entrepreneurial Leadership in Upstream Oil and Gas Industry

OpenAIRE

Kalu, Mona Ukpai

2015-01-01

The study examined Entrepreneurial leadership in Upstream Oil and Gas industry and its ability to accelerate innovative energy technology development. The declining deliverability from existing reservoirs and ever increasing demand for energy to fuel growth in many parts of the world is driving oil and gas exploration into more difficult to access reservoirs like bituminous sands and shale gas. Accelerating new innovative technology development to access these new streams of profitable oil an...

Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

International Nuclear Information System (INIS)

Datta, K.; Dizdaroglu, M.; Jaruga, P.; Neumann, R.D.; Winters, T.A.

2003-01-01

Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125 I in a plasmid bound by a 125 I-labeled triplex forming oligonucleotide ( 125 I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125 I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125 Itarget base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the absence

Water quality and the composition of fish and macroinvertebrate communities in the Devils and Pecos Rivers within and upstream from the Amistad National Recreation Area, Texas, 2005-7

Science.gov (United States)

Moring, J. Bruce

2012-01-01

To gain a better understanding of the water quality and status of fish and macroinvertebrate communities, the U.S. Geological Survey, in cooperation with the National Park Service and Amistad National Recreation Area, completed a reconnaissance-level survey of the water quality and fish and macroinvertebrate communities in the Devils and Pecos Rivers in and upstream from the Amistad National Recreation Area in southwest Texas during 2005–7. Water-quality conditions during the spring and summer months of 2005 in the Devils and Pecos Rivers were assessed at locations just upstream from the Amistad National Recreation Area, and the composition of fish and macroinvertebrate communities were assessed during 2006 and 2007 in and upstream from the Amistad National Recreation Area and Amistad Reservoir. Water-quality samples were collected at one site on both the Devils and Pecos Rivers. Fish and macroinvertebrates were collected at the water-quality sampling site on each river and at three additional sites on each river. The water-quality constituents of primary concern were total dissolved solids, chloride, sulfate, ammonia plus organic nitrogen, nitrate plus nitrite, orthophosphate, phosphorus, selenium, and selected pesticides. During the spring and summer of 2005, the concentrations of total dissolved solids ranged from 208 to 232 milligrams per liter (mg/L) in samples from the Devils River compared to 1,460 to 2,390 mg/L in samples from the Pecos River. Total dissolved solid concentrations measured in samples collected from the Devils River and Pecos River did not exceed the proposed State of Texas water-quality standard applicable for the segments of each river where samples were collected. During the spring and summer of 2005, chloride concentrations measured in samples collected in 2005 from the Devils River ranged from 11.6 to 12.9 mg/L, compared to chloride concentrations measured in samples collected from the Pecos River, which ranged from 519 to 879 mg

Metal loading in Soda Butte Creek upstream of Yellowstone National Park, Montana and Wyoming; a retrospective analysis of previous research; and quantification of metal loading, August 1999

Science.gov (United States)

Boughton, G.K.

2001-01-01

Acid drainage from historic mining activities has affected the water quality and aquatic biota of Soda Butte Creek upstream of Yellowstone National Park. Numerous investigations focusing on metals contamination have been conducted in the Soda Butte Creek basin, but interpretations of how metals contamination is currently impacting Soda Butte Creek differ greatly. A retrospective analysis of previous research on metal loading in Soda Butte Creek was completed to provide summaries of studies pertinent to metal loading in Soda Butte Creek and to identify data gaps warranting further investigation. Identification and quantification of the sources of metal loading to Soda Butte Creek was recognized as a significant data gap. The McLaren Mine tailings impoundment and mill site has long been identified as a source of metals but its contribution relative to the total metal load entering Yellowstone National Park was unknown. A tracer-injection and synoptic-sampling study was designed to determine metal loads upstream of Yellowstone National Park.A tracer-injection and synoptic-sampling study was conducted on an 8,511-meter reach of Soda Butte Creek from upstream of the McLaren Mine tailings impoundment and mill site downstream to the Yellowstone National Park boundary in August 1999. Synoptic-sampling sites were selected to divide the creek into discrete segments. A lithium bromide tracer was injected continuously into Soda Butte Creek for 24.5 hours. Downstream dilution of the tracer and current-meter measurements were used to calculate the stream discharge. Stream discharge values, combined with constituent concentrations obtained by synoptic sampling, were used to quantify constituent loading in each segment of Soda Butte Creek.Loads were calculated for dissolved calcium, silica, and sulfate, as well as for dissolved and total-recoverable iron, aluminum, and manganese. Loads were not calculated for cadmium, copper, lead, and zinc because these elements were infrequently

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.

Directory of Open Access Journals (Sweden)

Hou Jinna

2012-12-01

Full Text Available Abstract Background Rapeseed (Brassica napus L. has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL for flowering time, qFT10-4,in a doubled haploid (DH mapping population of rapeseed derived from a cross between Tapidor (winter-type and Ningyou7 (semi-winter and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50. This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i BnFLC.A10 is the gene underlying qFT10

Selecting optimum locations for co-located wave and wind energy farms. Part I: The Co-Location Feasibility index

International Nuclear Information System (INIS)

Astariz, S.; Iglesias, G.

2016-01-01

Highlights: • New approach to identifying suitable sites for co-located wave and wind farms. • A new tool, the Co-Location Feasibility (CLF) index, is defined. • Its application is analysed by means of a case study off the Danish coast. • Hindcast and measured wave and wind data from 2005 to 2015 are used. • Third-generation models of winds and waves (WAsP and SWAN) are used. - Abstract: Marine energy is poised to play a fundamental role in meeting renewable energy and carbon emission targets thanks to the abundant, and still largely untapped, wave and tidal resources. However, it is often considered difficult and uneconomical – as is usually the case of nascent technologies. Combining various renewables, such as wave and offshore wind energy, has emerged as a solution to improve their competitiveness and in the process overcome other challenges that hinder their development. The objective of this paper is to develop a new approach to identifying suitable sites for co-located wave and wind farms based on the assessment of the available resources and technical constraints, and to illustrate its application by means of a case study off the Danish coast – an area of interest for combining wave and wind energy. The method is based on an ad hoc tool, the Co-Location Feasibility (CLF) index, and is based on a joint characterisation of the wave and wind resources, which takes into account not only the available power but also the correlation between both resources and the power variability. The analysis is carried out based on hindcast data and observations from 2005 to 2015, and using third-generation models of winds and waves – WAsP and SWAN, respectively. Upon selection and ranking, it is found that a number of sites in the study region are indeed suited to realising the synergies between wave and offshore wind energy. The approach developed in this work can be applied elsewhere.

Technological acceleration and organizational transformations in the upstream oil and gas industry

International Nuclear Information System (INIS)

Isabelle, M.

2000-12-01

The upstream oil and gas industry experienced a dramatic technological acceleration in the early 1970's. The relationships between the agents in this industry have themselves undergone deep changes since that date. This thesis shows that a tight link exists between the technological acceleration and the organizational transformations in the upstream oil and gas industry. In a first part, it focuses on the economic theory's developments concerning industrial organization. In a second part, it applies these developments to three types of relations: those between the owner-states of hydrocarbon resources and the international petroleum companies; those between the international petroleum companies and their subcontractors; and finally those between the international petroleum companies themselves. (author)

Analysis of Runoff due to The Change in Land Use at The Watershed of Upstream Ciliwung

Directory of Open Access Journals (Sweden)

Dwi Indriastuti

2016-01-01

Full Text Available Climate change has triggered extreme climate such as rising temperature, high rainfall intensity, rising sea water level, drought, and others (Thuc, 2014. Challenges of sustainable development are increases in various disasters, climate change and global crisis such as land use change, soil quality degradation, limited water and mineral, environmental pollution, and decreasing in biodiversity. The cause of flooding in Jakarta is due to the overflow of Ciliwung River. The changes of land use greatly affect Ciliwung River flow. Land degradation in upstream of Ciliwung watershed (Puncak area has triggered new problem, annual flooding, especially in downstream area. The change of surface which cannot accommodate water, increasing runoff, moreover, the change of land condition which easily saturated, greatly affected the runoff conditions in Ciliwung watershed. This research using HEC-HMS software in order to know how the land uses changes and rainfall intensity affected the runoff. By using land use maps in 2000, 2005, 2010, and rainfall data in 5 (five rainfall station near location from 1996 to 2013, it can be known how the runoff changes. Parameter calibration is done with measured discharge in Katulampa weir for each occurrence. The parameter value used in simulation later is the real value approach. Simulation by HEC HMS using CN of Spatial Planning in Ciliwung upstream area and rainfall 25 years return period gives that the highest discharge is 226.25 m3/second and water level reaches to 317 cm. If included into the alert in Katulampa weir, then the condition faces to Alert 1 for during ±6 hours.

Total Mercury and Methylmercury Contamination in Fish from Sites along the Elbe River

Directory of Open Access Journals (Sweden)

P. Maršálek

2006-01-01

Full Text Available The aim of the study was to evaluate total mercury Hg and methylmercury MeHg contamination in muscle tissues of fish collected in 2002 from the Labe (Elbe river at sites upstream of Pardubice and downstream of Pardubice and Hřensko, and in 2004 from the Labe river upstream and downstream of the Spolana factory in Neratovice, and from the Vltava river downstream of Lenora. Eighty eight fish of the following species were sampled: bream (Abramis brama L., perch (Perca fluviatilis L., chub (Leuciscus cephalus L. and barbel (Barbus barbus L.. Total mercury content in chub, perch and bream was in the range of 0.05 - 1.96 mg kg-1 w.w., 0. 09 - 1.46 mg kg-1 w.w. and 0.35 - 0.82 mg kg-1 w.w., respectively. Methylmercury content in chub, perch and bream was in the range of 0.04 - 2.11 mg kg-1 w.w., 0.1 - 1.73 mg kg-1 w.w. and 0.371 - 0.650 mg kg-1 w.w., respectively. Significant correlation (p p < 0.05 between THg and MeHg contents were found between individual sites. In 2002, for example, the most contaminated fish were found downstream of Pardubice, followed by fish from upstream of Pardubice and from Hřensko. In 2004, fish from downstream and upstream of the Spolana factory in Neratovice were more contaminated than fish from the Vltava river downstream of Lenora. The methylmercury-tototal mercury ratio in muscle tissue was close to 1.0.

Iron site location in Fe-diffused lithium niobate crystals by combined RBS-PIXE-NRA analysis

Energy Technology Data Exchange (ETDEWEB)

Zaltron, A. [University of Padova and CNISM, Via Marzolo 8, 35131 Padova (Italy); Argiolas, N., E-mail: nicola.argiolas@unipd.it [University of Padova and CNISM, Via Marzolo 8, 35131 Padova (Italy); Laboratori Nazionali di Legnaro, Istituto Nazionale Fisica Nucleare, Viale dell' Universita 2, 35020 Legnaro (Padova) (Italy); De Salvador, D.; Bazzan, M. [University of Padova and CNISM, Via Marzolo 8, 35131 Padova (Italy); Laboratori Nazionali di Legnaro, Istituto Nazionale Fisica Nucleare, Viale dell' Universita 2, 35020 Legnaro (Padova) (Italy); Ciampolillo, M.V.; Bacci, L.; Sada, C. [University of Padova and CNISM, Via Marzolo 8, 35131 Padova (Italy)

2012-03-15

Iron diffused x-cut lithium niobate samples have been studied from a structural point of view by ion beam analysis techniques in channeling conditions. The aim of this work is to determine the most probable position of iron atoms after high temperature diffusion treatment in pure oxygen atmosphere and to verify their location after an additional full reducing annealing at low temperature. The results are compared with the bulk doping case that can be considered the final equilibrium state of the diffusion process. By comparing the iron signal with niobium and lithium counterparts in angular scans along proper crystallographic directions, we demonstrate that iron occupies in any case the lithium site or a very close position regardless of the reduction degree, just as in the case of bulk doped samples.

Selected stratigraphic data for drill holes located in Frenchman Flat, Nevada Test Site. Rev. 1

International Nuclear Information System (INIS)

Drellack, S.L. Jr.

1997-02-01

Stratigraphic data are presented in tabular form for 72 holes drilled in Frenchman Flat, Nevada Test Site, between 1950 and 1993. Three pairs of data presentations are included for each hole: depth to formation tops, formation thicknesses, and formation elevations are presented in both field (English) and metric units. Also included for each hole, where available, are various construction data (hole depth, hole diameter, surface location coordinates) and certain information of hydrogeologic significance (depth to water level, top of zeolitization). The event name is given for holes associated with a particular nuclear test. An extensive set of footnotes is included, which indicates data sources and provides other information. The body of the report describes the stratigraphic setting of Frenchman Flat, gives drill-hole naming conventions and database terminology, and provides other background and reference material

Vegetative changes in boreal peatlands along salinity gradients resulting from produced water spills : implications for the environmental assessment and remediation of upstream oil and gas sites

Energy Technology Data Exchange (ETDEWEB)

Bright, D.; Harris, C.; Meier, M. [AECOM Canada Ltd., Ottawa, ON (Canada)

2010-07-01

In the province of Alberta, there are approximately 8,000 registered oil effluent and produced pipelines that have significant potential for ruptures and spills due to the highly corrosive nature of the emulsions and produced water they transport. Most releases occur in or adjacent to northern boreal wetlands. The first objective in spill response involves assessment and remediation for residuals, which involves handling and disposal of large volumes of salinized water. This presentation reported on a study that addressed the issues regarding the ecological features of semi-terrestrial and semi-aquatic components of boreal wetland environments as a basis for environmental protection at salt release sites. The fate of salt ions in such environments was examined along with the implications for secondary succession and ecological restoration. The study also examined the reasonable threshold concentration of salt ions in soils or water beyond which there is an inhibition to wetlands plants and bryophyte secondary succession; the reasonable threshold concentration of salt ions in water beyond which there may be adverse effects on invertebrates, vertebrates and other non-plant taxa; and species sensitivity distributions for floral and faunal assemblages found in boreal wetland habitats. The presentation summarized the 3 phases of a project that examined pipeline ruptures at 9 sites. Field methods and site sampling summaries were presented. It was difficult to locate study sites with residual salt contamination in surface media at concentrations above effects threshold for many species. It was concluded that the departures between surface and subsurface salinity indicates a smaller potential for effects on site vegetation. tabs., figs.

Vegetative changes in boreal peatlands along salinity gradients resulting from produced water spills : implications for the environmental assessment and remediation of upstream oil and gas sites

International Nuclear Information System (INIS)

Bright, D.; Harris, C.; Meier, M.

2010-01-01

In the province of Alberta, there are approximately 8,000 registered oil effluent and produced pipelines that have significant potential for ruptures and spills due to the highly corrosive nature of the emulsions and produced water they transport. Most releases occur in or adjacent to northern boreal wetlands. The first objective in spill response involves assessment and remediation for residuals, which involves handling and disposal of large volumes of salinized water. This presentation reported on a study that addressed the issues regarding the ecological features of semi-terrestrial and semi-aquatic components of boreal wetland environments as a basis for environmental protection at salt release sites. The fate of salt ions in such environments was examined along with the implications for secondary succession and ecological restoration. The study also examined the reasonable threshold concentration of salt ions in soils or water beyond which there is an inhibition to wetlands plants and bryophyte secondary succession; the reasonable threshold concentration of salt ions in water beyond which there may be adverse effects on invertebrates, vertebrates and other non-plant taxa; and species sensitivity distributions for floral and faunal assemblages found in boreal wetland habitats. The presentation summarized the 3 phases of a project that examined pipeline ruptures at 9 sites. Field methods and site sampling summaries were presented. It was difficult to locate study sites with residual salt contamination in surface media at concentrations above effects threshold for many species. It was concluded that the departures between surface and subsurface salinity indicates a smaller potential for effects on site vegetation. tabs., figs.

ISEE/IMP Observations of simultaneous upstream ion events

International Nuclear Information System (INIS)

Mitchel, D.G.; Roelof, E.C.; Sanderson, T.R.; Reinhard, R.; Wenzel, K.

1983-01-01

Propagation of upstream energetic (50--200 keV) ions is analyzed in sixteen events observed simulataneously by solid state detectors on ISEE 3 at approx.200 R/sub E/ and on IMP 8 at approx.35 R/sub E/ from the earth. Conclusions are based on comparisons of the pitch angle distributions observed at the two spacecraft and transformed into the solar wind frame. They are beamlike at ISEE 3 and are confined to the outward hemisphere. When IMP 8 is furtherest from the bow shock, they are also usually beamlike, or hemispheric. However, when IMP 8 is closer to the bow shock, pancakelike distributions are observed. This systematic variation in the IMP 8 pitch angle distributions delimits a scattering region l< or approx. =14 R/sub E/ upstream of the earth's bow shock (l measured along the interplanetary magnetic field) that dominates ion propagation, influences the global distribution of fluxes in the foreshock, and may play a role in acceleration of the ions. When IMP 8 is beyond lapprox.15 R/sub E/, the propagation appears to be essentially scatter-free between IMP 8 and ISEE 3; this is deduced from the absence of earthward fluxes at IMP 8 as well as the tendency for the spin-averaged fluxes to be comparable at the two spacecraft

Preliminary siting characterization Salt Disposition Facility - Site B

International Nuclear Information System (INIS)

Wyatt, D.

2000-01-01

A siting and reconnaissance geotechnical program has been completed in S-Area at the Savannah River Site in South Carolina. This program investigated the subsurface conditions for the area known as ''Salt Disposition Facility (SDF), Site B'' located northeast of H-Area and within the S-Area. Data acquired from the Site B investigation includes both field exploration and laboratory test data

Location of the higher affinity copper site on human hemoglobin by the use of the spin label technique

International Nuclear Information System (INIS)

Tabak, M.; Louro, S.R.W.

1983-11-01

Addition of copper (II) ions to Cys β-93 maleimide spin-labelled human hemoglobin A produces a dramatic decrease in the amplitude of the spin-label ESR spectra. This effect was analyzed in the framework of Leigh's theory which permits interspin distances to be deduced from the effect of dipolar coupling on the ESR spectra and led to an estimate of 9A as the distance between the label and the higher affinity copper site. Taking into account the previous results which suggest that four nitrogen atoms coordinate with copper, and that the N terminal val β-1 and His β-2 residues are involved, the location of the higher affinity copper site is proposed to be at the β 1 β 2 interface of the hemoglobin molecule, involving the N terminal of one β subunit and the C terminal of the other. (Author) [pt

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

Science.gov (United States)

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

The binding site for regulatory 14-3-3 protein in plant plasma membrane H+-ATPase: Involvement of a region promoting phosphorylation-independent interaction in addition to the phosphorylation-dependent C-terminal end

DEFF Research Database (Denmark)

Fuglsang, Anja T; Borch, Jonas; Bych, Katrine

2003-01-01

14-3-3 proteins constitute a family of well conserved proteins interacting with a large number of phosphorylated binding partners in eukaryotic cells. The plant plasma membrane H+-ATPase is an unusual target in that a unique phosphothreonine motif (946YpTV, where pT represents phosphothreonine...... of the Arabidopsis plasma membrane H+-ATPase isoform 2 (AHA2). Following site-directed mutagenesis within the 45 C-terminal residues of AHA2, we conclude that, in addition to the 946YpTV motif, a number of residues located further upstream are required for phosphorylation-independent binding of 14-3-3. Among these...

Ion acceleration at the earth's bow shock: A review of observations in the upstream region

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

1979-01-01

Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different population of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compresive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e. those near 100 keV) are accelerated at the shock or in the broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

Ion acceleration at the earth's bow shock: a review of observations in the upstream region

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

1979-01-01

Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different populations of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compressive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e., those near 100 keV) are accelerated at the shock or in broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

Characterisation of Radioactive Waste located at Shelter Industrial Site

International Nuclear Information System (INIS)

Brown, T.D.; Billon, F.; Rudko, V.M.; Batiy, V.G.; Panasyuk, N.I.

2001-04-01

As a result of the accident at the unit 4 reactor at the Chernobyl Nuclear Power Plant on the 26 April 1986 there was widespread radioactive contamination of the surrounding area. The area immediately surrounding Unit 4, referred to as the Industrial Site, was very heavily contaminated with fuel and core debris ejected from the reactor. Immediate action was undertaken to reduce the local radiation hazard and mitigate the potential of secondary contamination of the environment. This action involved (a) the removal and collection of fuel fragments (b) removal of the top layer of soil around unit 4 and (c) preparation of a new surface over the Industrial Site. This new surface is referred to colloquially as the Techno-genic Layer. This report provides an overview of a project undertaken for DG-Environment of European Commission by a Consortium consisting of SGN (France) and AEA Technology (UK) working in collaboration with the Organisation, National Academy of Sciences of Ukraine; the Interdisciplinary Scientific and Technical Centre Shelter''. The project consisted of 3 Phases and a total of 14 Tasks. The main purpose of Phase 1 was to review previous work and available information and data on the contamination of the Industrial Site, construction of the Techno-genic Layer, Buttress and Pioneer Walls. Phase 2 was directed at additional measurements being carried out on existing boreholes and core samples to improve and/or substantiate existing information and data. Estimation of likely radioactive waste arisings, recovery procedures and a generalised strategy with indicative costs for the management of the waste was also covered by Phase 2. In Phase 3 new boreholes (3 off) were drilled and subsequently investigated. The justification behind Phase 3 was the desire/need to obtain more reliable information on the so-called high-active waste buried in the Industrial Site. (author)

Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site

International Nuclear Information System (INIS)

Kassotis, Christopher D.; Iwanowicz, Luke R.; Akob, Denise M.; Cozzarelli, Isabelle M.; Mumford, Adam C.; Orem, William H.; Nagel, Susan C.

2016-01-01

Currently, > 95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby. - Highlights: • Oil and gas wastewater disposal may increase endocrine disrupting activity in water. • Tested EDC activity in surface water near oil and gas wastewater injection site. • Water downstream had significantly

Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site

Energy Technology Data Exchange (ETDEWEB)

Kassotis, Christopher D., E-mail: christopher.kassotis@duke.edu [Nicholas School of the Environment, Duke University, Durham, NC 27708 (United States); Iwanowicz, Luke R. [U.S. Geological Survey, Leetown Science Center, Fish Health Branch, 11649 Leetown Road, Kearneysville, WV 25430 (United States); Akob, Denise M.; Cozzarelli, Isabelle M.; Mumford, Adam C. [U.S. Geological Survey, National Research Program, 12201 Sunrise Valley Drive, MS 430, Reston, VA 20192 (United States); Orem, William H. [U.S. Geological Survey, Eastern Energy Resources Science Center, 12201 Sunrise Valley Drive, MS 956, Reston, VA 20192 (United States); Nagel, Susan C., E-mail: nagels@health.missouri.edu [Department of Obstetrics, Gynecology and Women' s Health, University of Missouri, Columbia, MO 65211 (United States)

2016-07-01

Currently, > 95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby. - Highlights: • Oil and gas wastewater disposal may increase endocrine disrupting activity in water. • Tested EDC activity in surface water near oil and gas wastewater injection site. • Water downstream had significantly

Automated location detection of injection site for preclinical stereotactic neurosurgery procedure

Science.gov (United States)

Abbaszadeh, Shiva; Wu, Hemmings C. H.

2017-03-01

Currently, during stereotactic neurosurgery procedures, the manual task of locating the proper area for needle insertion or implantation of electrode/cannula/optic fiber can be time consuming. The requirement of the task is to quickly and accurately find the location for insertion. In this study we investigate an automated method to locate the entry point of region of interest. This method leverages a digital image capture system, pattern recognition, and motorized stages. Template matching of known anatomical identifiable regions is used to find regions of interest (e.g. Bregma) in rodents. For our initial study, we tackle the problem of automatically detecting the entry point.

Technical and Economic Comparison MOB location versus Bergermeer Drilling Site. Justification of the Financial section in the Environmental Impact Report (MER)

International Nuclear Information System (INIS)

Dekker, W.; Azeem Khan, F.

2009-09-01

The Environmental Impact Report for the gas storage location Bergermeer has selected the MOB area (mobilization complex or storage site of the Dutch Ministry of Defense) in Bergen as the most environment-friendly alternative (MMA) for the well area. TAQA asked SGS to elaborate the technical and financial aspects of the MMA alternative and to compare them to the preferred alternative. [nl

A scheme for regulating toxic substances to water quality of Chamsil upstream water system

Energy Technology Data Exchange (ETDEWEB)

Kim, Kang Suk; Kim, Jee Hoon [Korea Environment Institute, Seoul (Korea)

1998-12-01

This study asserts to reflect a concept of toxicity thoroughly in the present water quality concept. It presents an appropriate solution to control toxic substances flowing into the Chamsil upstream water system. Although a regulation of toxic substances into major rivers in Korea other than Han river is also required urgently, it will be studied in future. It is expected that this study on Chamsil upstream would be a cornerstone for establishing a national regulation policy of toxic substances into water system. 28 refs., 1 fig., 36 tabs.

The Benefits of Franchising and Vertical Disintergration in Monopolistic Competition for Locationally Differentiated Products

OpenAIRE

Nicholas Economides

1993-01-01

A model of franchising competition in locationally differentiated products is constructed. A franchisor (upstream firm) collects a marginal transfer fee per unit of output sold by a franchisee (downstream firm). For example, the marginal transfer fee can be realized as a markup on variable inputs supplied by the franchisor. A franchisor also collects a lump-sum rent (commonly called "franchising fee") from each franchisee. Acting in the first stage, a franchisor can manipulate the degree of c...

Environmental impact of site location on macro- and microelements ...

African Journals Online (AJOL)

Human activities cause specific impact on the enveronment, which also could been monitored by mineral contents in the soil and in the plants. Two different caracteristic locations had been selected for the experiments: anthropogenic-Ada Huja contamineted industrial zone and non anthropogenic- Topcider park area.

Experimental Branch Retinal Vein Occlusion Induces Upstream Pericyte Loss and Vascular Destabilization.

Directory of Open Access Journals (Sweden)

Elisa Dominguez

Full Text Available Branch retinal vein occlusion (BRVO leads to extensive vascular remodeling and is important cause of visual impairment. Although the vascular morphological changes following experimental vein occlusion have been described in a variety of models using angiography, the underlying cellular events are ill defined.We here show that laser-induced experimental BRVO in mice leads to a wave of TUNEL-positive endothelial cell (EC apoptosis in the upstream vascular network associated with a transient edema and hemorrhages. Subsequently, we observe an induction of EC proliferation within the dilated vein and capillaries, detected by EdU incorporation, and the edema resolves. However, the pericytes of the upstream capillaries are severely reduced, which was associated with continuing EC apoptosis and proliferation. The vascular remodeling was associated with increased expression of TGFβ, TSP-1, but also FGF2 expression. Exposure of the experimental animals to hypoxia, when pericyte (PC dropout had occurred, led to a dramatic increase in endothelial cell proliferation, confirming the vascular instability induced by the experimental BRVO.Experimental BRVO leads to acute endothelial cells apoptosis and increased permeability. Subsequently the upstream vascular network remains destabilized, characterized by pericyte dropout, un-physiologically high endothelial cells turnover and sensitivity to hypoxia. These early changes might pave the way for capillary loss and subsequent chronic ischemia and edema that characterize the late stage disease.

3'UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells.

Directory of Open Access Journals (Sweden)

Yonit Hoffman

2016-02-01

Full Text Available Most mammalian genes often feature alternative polyadenylation (APA sites and hence diverse 3'UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3'UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3'UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3'UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3'UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes.

3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

Science.gov (United States)

Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

2016-01-01

Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Radionuclide contaminant analysis of small mammels, plants and sediments within Mortandad Canyon, 1994

International Nuclear Information System (INIS)

Bennett, K.; Biggs, J.; Fresquez, P.

1996-01-01

Small mammals, plants and sediments were sampled at one upstream location (Site 1) and two downstream locations (Site 2 and Site 3) from the National Pollution Discharge Elimination System outfall number-sign 051-051 in Mortandad Canyon, Los Alamos County, New Mexico. The purpose of the sampling was to identify radionuclides potentially present, to quantitatively estimate and compare the amount of radionuclide uptake at specific locations (Site 2 and Site 3) within Mortandad Canyon to an upstream site (Site 1), and to identify the primary mode (inhalation ingestion, or surface contact) of contamination to small mammals. Three composite samples of at least five animals per sample were collected at each site. Pelts and carcasses of each animal were separated and analyzed independently. In addition, three composite samples were also collected for plants and sediments at each site. Samples were analyzed for 241 Am, 90 Sr, 238 Pu, 239 Pu, and total U. With the exception of total U, all mean radionuclide concentrations in small mammal carcasses and sediments were significantly higher at Site 2 than Site 1 or Site 3. No differences were detected in the mean radionuclide concentration of plant samples between sites. However, some radionuclide concentrations found at all three sites were higher than regional background. No differences were found between mean carcass radionuclide concentrations and mean pelt radionuclide concentrations, indicating that the two primary modes of contamination may be equally occurring

Contaminant monitoring of biota downstream of a radioactive liquid waste treatment facility, Los Alamos National Laboratory

International Nuclear Information System (INIS)

Bennett, K.D.; Biggs, J.R.; Fresquez, P.R.

1996-01-01

Small mammals, plants, and sediments were sampled at one upstream location (Site 1) and two downstream locations (Site 2 and Site 3) from the National Pollution Discharge Elimination System (NPDES) outfall number-sign 051-051 in Mortandad Canyon, Los Alamos National Laboratory, Los Alamos, New Mexico. The purpose of the sampling was to identify radionuclides potentially present, to quantitatively estimate and compare the amount of radionuclide uptake at specific locations (Site 2 and Site 3) within Mortandad Canyon to an upstream site (Site 1), and to identify the primary mode (inhalation/ingestion or surface contact) of contamination to small mammals. Three composite samples of at least five animals per sample were collected at each site. The pelt was separated from the carcass of each animal and both were analyzed independently. In addition, three composite samples were also collected for plants and sediments at each site. Samples were analyzed for americium ( 241 Am), strontium ( 90 Sr), plutonium ( 238 Pu and 239 Pu), and total uranium (U). With the exception of total U, all mean radionuclide concentrations in small mammal carcasses and sediments were significantly higher at Site 2 than Site 1 or Site 3. No differences were detected in the mean radionuclide concentration of plant samples between sites. However, some radionuclide concentrations found at all three sites were higher than regional background. No differences were found between mean carcass radionuclide concentrations and mean pelt radionuclide concentrations, indicating that the two primary modes of contamination may be equally occurring

Data Validation Package - June 2015 Groundwater and Surface Water Sampling at the Green River, Utah, Disposal Site

Energy Technology Data Exchange (ETDEWEB)

Linard, Joshua [USDOE Office of Legacy Management, Washington, DC (United States); Price, Jeffrey [Navarro Research and Engineering, Inc., Las Vegas, NV (United States)

2015-08-01

Groundwater samples were collected during the 2015 sampling event from point-of-compliance (POC) wells 0171, 0173, 0176, 0179, 0181, and 0813 to monitor the disposition of contaminants in the middle sandstone unit of the Cedar Mountain Formation. Groundwater samples also were collected from alluvium monitoring wells 0188, 0189, 0192, 0194, and 0707, and basal sandstone monitoring wells 0182, 0184, 0185, and 0588 as a best management practice. Surface locations 0846 and 0847 were sampled to monitor for degradation of water quality in the backwater area of Brown’s Wash and in the Green River immediately downstream of Brown’s Wash. The Green River location 0801 is upstream from the site and is sampled to determine background-threshold values (BTVs). Sampling and analyses were conducted as specified in Sampling and Analysis Plan for U.S. Department of Energy Office of Legacy Management Sites (LMS/PRO/S04351, continually updated, http://energy.gov/lm/downloads/sampling-and- analysis-plan-us-department-energy-office-legacy-management-sites). Water levels were measured at each sampled well. The analytical data and associated qualifiers can be viewed in environmental database reports and are also available for viewing with dynamic mapping via the GEMS (Geospatial Environmental Mapping System) website at http://gems.lm.doe.gov/#. All six POC wells are completed in the middle sandstone unit of the Cedar Mountain Formation and are monitored to measure contaminant concentrations for comparison to proposed alternate concentration limits (ACLs), as provided in Table 1. Contaminant concentrations in the POC wells remain below their respective ACLs.

Characterization of a small erythromycin resistance plasmid pLFE1 from the food-isolate Lactobacillus plantarum M345

DEFF Research Database (Denmark)

Feld, Louise; Bielak, Eliza; Hammer, Karin

2009-01-01

found. A putative replication initiation site including a single-strand origin (sso) -like region succeeded by a characteristic pMV158 family double-strand origin (dso) was located upstream of the replication region. An open reading frame following a typical origin of transfer (oriT) site and coding...

PROMoter uPstream Transcripts share characteristics with mRNAs and are produced upstream of all three major types of mammalian promoters

DEFF Research Database (Denmark)

Preker, Pascal; Almvig, Kristina; Christensen, Marianne S

2011-01-01

RNAs, PROMPTs are largely nuclear and rapidly turned over by the RNA exosome. PROMPT-transcribing DNA is occupied by RNA polymerase II (RNAPII) complexes with serine 2 phosphorylated C-terminal domains (CTDs), mimicking that of the associated genic region. Thus, the inefficient elongation capacity of PROMPT...... transcription cannot solely be assigned to poor CTD phosphorylation. Conditions that reduce gene transcription increase RNAPII occupancy of the upstream PROMPT region, suggesting that they reside in a common transcription compartment. Surprisingly, gene promoters that are actively transcribed by RNAPI...

Essential roles of caspases and their upstream regulators in rotenone-induced apoptosis

International Nuclear Information System (INIS)

Lee Jihjong; Huang, M.-S.; Yang, I-C.; Lai, T.-C.; Wang, J.-L.; Pang, V.F.; Hsiao, M.; Kuo, M.Y.P.

2008-01-01

In the present study, we examined whether caspases and their upstream regulators are involved in rotenone-induced cytotoxicity. Rotenone significantly inhibited the proliferation of oral cancer cell lines in a dose-dependent manner compared to normal oral mucosal fibroblasts. Flow cytometric analysis of DNA content showed that rotenone treatment induced apoptosis following G2/M arrest. Western blotting showed activation of both the caspase-8 and caspase-9 pathways, which differed from previous studies conducted in other cell types. Furthermore, p53 protein and its downstream pro-apoptotic target, Bax, were induced in SAS cells after treatment with rotenone. Rotenone-induced apoptosis was inhibited by antioxidants (glutathione, N-acetylcysteine, and tiron). In conclusion, our results demonstrate significant involvement of caspases and their upstream regulators in rotenone-induced cytotoxicity

Accurate source location from waves scattered by surface topography: Applications to the Nevada and North Korean test sites

Science.gov (United States)

Shen, Y.; Wang, N.; Bao, X.; Flinders, A. F.

2016-12-01

Scattered waves generated near the source contains energy converted from the near-field waves to the far-field propagating waves, which can be used to achieve location accuracy beyond the diffraction limit. In this work, we apply a novel full-wave location method that combines a grid-search algorithm with the 3D Green's tensor database to locate the Non-Proliferation Experiment (NPE) at the Nevada test site and the North Korean nuclear tests. We use the first arrivals (Pn/Pg) and their immediate codas, which are likely dominated by waves scattered at the surface topography near the source, to determine the source location. We investigate seismograms in the frequency of [1.0 2.0] Hz to reduce noises in the data and highlight topography scattered waves. High resolution topographic models constructed from 10 and 90 m grids are used for Nevada and North Korea, respectively. The reference velocity model is based on CRUST 1.0. We use the collocated-grid finite difference method on curvilinear grids to calculate the strain Green's tensor and obtain synthetic waveforms using source-receiver reciprocity. The `best' solution is found based on the least-square misfit between the observed and synthetic waveforms. To suppress random noises, an optimal weighting method for three-component seismograms is applied in misfit calculation. Our results show that the scattered waves are crucial in improving resolution and allow us to obtain accurate solutions with a small number of stations. Since the scattered waves depends on topography, which is known at the wavelengths of regional seismic waves, our approach yields absolute, instead of relative, source locations. We compare our solutions with those of USGS and other studies. Moreover, we use differential waveforms to locate pairs of the North Korea tests from years 2006, 2009, 2013 and 2016 to further reduce the effects of unmodeled heterogeneities and errors in the reference velocity model.

An upstream open reading frame modulates ebola virus polymerase translation and virus replication.

Directory of Open Access Journals (Sweden)

Reed S Shabman

2013-01-01

Full Text Available Ebolaviruses, highly lethal zoonotic pathogens, possess longer genomes than most other non-segmented negative-strand RNA viruses due in part to long 5' and 3' untranslated regions (UTRs present in the seven viral transcriptional units. To date, specific functions have not been assigned to these UTRs. With reporter assays, we demonstrated that the Zaire ebolavirus (EBOV 5'-UTRs lack internal ribosomal entry site function. However, the 5'-UTRs do differentially regulate cap-dependent translation when placed upstream of a GFP reporter gene. Most dramatically, the 5'-UTR derived from the viral polymerase (L mRNA strongly suppressed translation of GFP compared to a β-actin 5'-UTR. The L 5'-UTR is one of four viral genes to possess upstream AUGs (uAUGs, and ablation of each uAUG enhanced translation of the primary ORF (pORF, most dramatically in the case of the L 5'-UTR. The L uAUG was sufficient to initiate translation, is surrounded by a "weak" Kozak sequence and suppressed pORF translation in a position-dependent manner. Under conditions where eIF2α was phosphorylated, the presence of the uORF maintained translation of the L pORF, indicating that the uORF modulates L translation in response to cellular stress. To directly address the role of the L uAUG in virus replication, a recombinant EBOV was generated in which the L uAUG was mutated to UCG. Strikingly, mutating two nucleotides outside of previously-defined protein coding and cis-acting regulatory sequences attenuated virus growth to titers 10-100-fold lower than a wild-type virus in Vero and A549 cells. The mutant virus also exhibited decreased viral RNA synthesis as early as 6 hours post-infection and enhanced sensitivity to the stress inducer thapsigargin. Cumulatively, these data identify novel mechanisms by which EBOV regulates its polymerase expression, demonstrate their relevance to virus replication and identify a potential therapeutic target.

Experience of molecular monitoring techniques in upstream oil and gas operations

Energy Technology Data Exchange (ETDEWEB)

Mitchell, Anthony F.; Anfindsen, Hilde; Liengen, Turid; Molid, Solfrid [Statoil ASA (Denmark)

2011-07-01

For a numbers of years, molecular monitoring tools have been used in upstream oil and gas operations but the results have given only limited added value. This paper discusses the various techniques available for upstream molecular monitoring which provides scope for identification of microbial influenced problems. The methodology, which consists of analyzing solid samples using traditional as well as molecular techniques, is detailed. Two cases were studied with the objective of determining if microbial contamination was contributing to the problem. The first case was a study of amorphous deposits in production wells and mainly iron sulphide was found. The second study was of amorphous deposits in water injection wells and the analysis showed typical components of drilling and completion fluids with some organic material. Two more cases, corrosion of tubing in a water injection well and flow line corrosion, are discussed and the results are given. From the study, it can be concluded that failure can be due to several factors, chemical and biological.

Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

Science.gov (United States)

Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

2017-04-15

Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

Superfund Site Information - Site Sampling Data

Data.gov (United States)

U.S. Environmental Protection Agency — This asset includes Superfund site-specific sampling information including location of samples, types of samples, and analytical chemistry characteristics of...

Role of nitric oxide in vasodilation in upstream muscle during intermittent pneumatic compression.

Science.gov (United States)

Chen, Long-En; Liu, Kang; Qi, Wen-Ning; Joneschild, Elizabeth; Tan, Xiangling; Seaber, Anthony V; Stamler, Jonathan S; Urbaniak, James R

2002-02-01

This study investigated the dosage effects of nitric oxide synthase (NOS) inhibitor N(G)-monomethyl-L-arginine (L-NMMA) on intermittent pneumatic compression (IPC)-induced vasodilation in uncompressed upstream muscle and the effects of IPC on endothelial NOS (eNOS) expression in upstream muscle. After L-NMMA infusion, mean arterial pressure increased by 5% from baseline (99.5 +/- 18.7 mmHg; P < 0.05). Heart rate and respiratory rate were not significantly affected. One-hour IPC application on legs induced a 10% dilation from baseline in 10- to 20-microm arterioles and a 10-20% dilation in 21- to 40 microm arterioles and 41- to 70-microm arteries in uncompressed cremaster muscle. IPC-induced vasodilation was dose dependently reduced, abolished, or even reversed by concurrently infused L-NMMA. Moreover, expression of eNOS mRNA in uncompressed cremaster muscle was upregulated to 2 and 2.5 times normal at the end of 1- and 5-h IPC on legs, respectively, and the expression of eNOS protein was upregulated to 1.8 times normal. These increases returned to baseline level after cessation of IPC. The results suggest that eNOS plays an important role in regulating the microcirculation in upstream muscle during IPC.

Energy flow and greenhouse gas emissions in organic and conventional sweet cherry orchards located in or close to Natura 2000 sites

International Nuclear Information System (INIS)

Litskas, Vassilios D.; Mamolos, Andreas P.; Kalburtji, Kiriaki L.; Tsatsarelis, Constantinos A.; Kiose-Kampasakali, Eleni

2011-01-01

An energy analysis in orchards is useful to deciding best management strategies. The objective of this study was to evaluate, by selecting organic and conventional sweet cherry orchards located in/or close to Natura 2000 sites (a) the energy flow between the two farming systems and (b) the effect of farming system to gas emissions (CO 2 , CH 4 and N 2 O). Twenty farms [(2-conventional and 2-organic) x 5-locations] were selected during 2003-2004. Means averaged over all locations for insecticides and fungicides application, fuel, insecticides, fungicides, non-renewable energy inputs, energy shoot outputs, energy fruit outputs, energy shoot + fruit outputs, fruit production, shoot efficiency, fruit efficiency, shoot + fruit efficiency, non-renewable energy efficiency, gas emissions were higher in conventional than in organic orchards, while fertilizer application, harvesting, fertilizers, labor, total energy inputs, renewable energy inputs, intensity and non-renewable energy consumption were higher in organic orchards. Means averaged over two farming systems for fertilizer, insecticide and fungicide application were higher in GRL2 and GRL5. The means averaged over two systems for transportation had the highest value in GRL4 and the lowest in GRL5. Finally, means averaged over two farming systems for labor had the highest value in GRL2. Non-renewable energy inputs as percent of total inputs were 82.63 and 52.42% in conventional and organic sweet cherry orchards respectively. The results show that organic farming systems could reduce non-renewable energy inputs and gas emissions in an efficient way in areas related to Natura 2000 sites.

Sodium Pick-Up Ion Observations in the Solar Wind Upstream of Mercury

Science.gov (United States)

Jasinski, J. M.; Raines, J. M.; Slavin, J. A.; Regoli, L. R.; Murphy, N.

2018-05-01

We present the first observations of sodium pick-up ions upstream of Mercury’s magnetosphere. From these observations we infer properties of Mercury’s sodium exosphere and implications for the solar wind interaction with Mercury’s magnetosphere.

ARSENIC TRANSPORT ACROSS THE GROUNDWATER – SURFACE WATER INTERFACE AT A SITE IN CENTRAL MASSACHUSETTS

Science.gov (United States)

Plow Shop Pond, located in central Massachusetts within the New England ‘arsenic belt,’ receives water from a series of interconnected upstream ponds as well as from upward-discharging groundwater. A small, shallow embayment on the southwest side of the pond is known as Red Cove...

An upstream activation element exerting differential transcriptional activation on an archaeal promoter

DEFF Research Database (Denmark)

Peng, Nan; Xia, Qiu; Chen, Zhengjun

2009-01-01

S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...

Canadian upstream oil and gas industry profitability: Historical review and future perspectives [with executive summary

International Nuclear Information System (INIS)

1991-09-01

The profitability of the Canadian upstream oil and gas industry is examined by analyzing return on equity and return on capital invested. By all measures and interpretations, the upstream industry has been unprofitable since the mid-1980s; returns generated are far below the industry's own historical cost of capital, and are inadequate relative to other sectors of the Canadian economy and to international oil and gas companies. This poor profitability is attributed to such factors as: overly optimistic price forecasts and healthy cash flows generated in the early 1980s, which led to excess capital spending; poor returns on capital reflective of the physical limitations of the Western Canadian Sedimentary Basin; high capital and operating costs; and a high royalty burden imposed by provincial governments. The consequences of low profitability include inadequate returns to equity investors, a drop in spending on upstream services such as drilling and exploration, a reduced ability of the industry to generate employment, and an adverse effect on the economy of Alberta. Forecasts indicate that the upstream sector is extremely vulnerable to a scenario of relatively flat prices due to high and increasing operating costs and depletion charges, and the significant royalty payments that still are in effect. Little scope is foreseen for industry profitability to return to acceptable levels over the first half of the 1990s. Reduced royalties have the potential to make a significant contribution to improved profitability. 52 figs., 40 tabs

Nuclear waste repository siting and locational conflict analysis: A contextual approach

International Nuclear Information System (INIS)

Murauskas, G.T.

1989-01-01

This study develops and evaluates an alternative framework that is based on contextual variables. The premise is that differences in attitudes and perceptions regarding the local siting of nuclear wastes and differences in attitudes regarding siting decision-making procedures are influenced by local political, economic, and cultural variables. This framework articulates the nature of conflict in terms of the incongruence between the use-value individuals ascribe to their present situation and the anticipated exchange-value individuals associate with the local siting of a nuclear waste repository. In order to evaluate this conceptual framework a survey was conducted of residents in four communities representing distinct societal contexts: Richton, Mississippi; Peterborough, New Hampshire; Richland, Washington; and Antigo/Waupaca, Wisconsin. Data analyses indicate substantial differences in economic expectations associated with the local siting of a high-level nuclear waste repository and in perception regarding the impacts such a repository might have on the environment, local agriculture, personal health and safety, and the quality of life

Thyroid hormone receptor binds to a site in the rat growth hormone promoter required for induction by thyroid hormone

International Nuclear Information System (INIS)

Koenig, R.J.; Brent, G.A.; Warne, R.L.; Larsen, P.R.; Moore, D.D.

1987-01-01

Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. The authors have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. They show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor

Frequency effects of upstream wake and blade interaction on the unsteady boundary layer flow

International Nuclear Information System (INIS)

Kang, Dong Jin; Bae, Sang Su

2002-01-01

Effects of the reduced frequency of upstream wake on downstream unsteady boundary layer flow were simulated by using a Navier-Stokes code. The Navier-Stokes code is based on an unstructured finite volume method and uses a low Reynolds number turbulence model to close the momentum equations. The geometry used in this paper is the MIT flapping foil experimental set-up and the reduced frequency of the upstream wake is varied in the range of 0.91 to 10.86 to study its effect on the unsteady boundary layer flow. Numerical solutions show that they can be divided into two categories. One is so called the low frequency solution, and behaves quite similar to a Stokes layer. Its characteristics is found to be quite similar to those due to either a temporal or spatial wave. The low frequency solutions are observed clearly when reduced frequency is smaller than 3.26. The other one is the high frequency solution. It is observed for the reduced frequency larger than 7.24. It shows a sudden shift of the phase angle of the unsteady velocity around the edge of the boundary layer. The shift of phase angle is about 180 degree, and leads to separation of the boundary layer flow from corresponding outer flow. The high frequency solution shows the characteristics of a temporal wave whose wave length is half of the upstream frequency. This characteristics of the high frequency solution is found to be caused by the strong interaction between unsteady vortices. This strong interaction also leads to destroy of the upstream wake stripe inside the viscous sublayer as well as the buffer layer

Ecology of common bully (Gobiomorphus cotidianus) in the Tarawera and Rangitiki rivers : isolation by inland distance or anthropogenic discharge?

International Nuclear Information System (INIS)

Bleackley, N.A.; Landman, M.J.; Ling, N.

2009-01-01

Previous research has identified distinct genetic, life-history and reproductive differences between populations of common bully (Gobiomorphus cotidianus) upstream and downstream of a pulp and paper mill outfall on the Tarawera River in the Bay of Plenty, New Zealand. This study investigated the distribution of common bully in the Tarawera River by examining fish collected from upstream (37 km inland) and downstream (20 km inland) locations and comparing them to fish from similar inland locations (40 km and 17 km inland, respectively) in the nearby Rangitaiki River. Reproductive divergence was observed between upstream and downstream sites of both rivers by differing annual trends in gonadosomatic index. Stable carbon and nitrogen isotopes confirmed residency at each sampling site and otolith microchemistry demonstrated different life-history strategies between upstream and downstream populations. Diadromous recruits dominated in both downstream river populations, with a general disappearance of diadromy upstream. A mixture of diadromous and non-diadromous fish were found in the upstream Rangitaiki River, whereas diadromous recruits were absent in the upstream Tarawera River. A reduction in oculoscapular canal structures also coincided with loss of diadromy in fish from both rivers. A behavioural study to determine whether pulp and paper mill effluent may deter fish migration within the Tarawera River demonstrated a strong avoidance of effluent, but only at concentrations (>25%) greater than those that naturally occur in the river (<15%). The results of this study suggest that combinations of influences coupled with inland distance are likely to be responsible for the isolation of common bully subpopulations within the Tarawera River. (author). 51 refs., 5 figs., 1 tab.

Transcription of human 7S K DNA in vitro and in vivo is exclusively controlled by an upstream promoter

Energy Technology Data Exchange (ETDEWEB)

Kleinert, H.; Benecke, B.J.

1988-02-25

The authors have analyzed the transcription of a recently isolated human 7S K RNA gene in vitro and in vivo. In contrast to hitherto characterized class III genes (genes transcribed by RNA polymerase III), the coding sequence of this gene is not required for faithful and efficient transcription by RNA polymerase III. In fact, a procaryotic vector DNA sequence was efficiently transcribed by RNA polymerase III under the control of the 7S K RNA gene upstream sequence in vitro and in vivo. S/sub 1/-nuclease protection analyses confirmed that the 7S K 5'flanking sequence was sufficient for accurate transcription initiation. These data demonstrate that 7S K DNA represents a novel class III gene, the promoter elements of which are located outside the coding sequence.

Wake flow behaviour behind a smaller cylinder oscillating in the wake of an upstream stationary cylinder

Energy Technology Data Exchange (ETDEWEB)

Gao, Yangyang; Sun, Zhilin [Ocean College, Zhejiang University, Hangzhou 310058 (China); Tan, Danielle S [Maritime Research Centre, Nanyang Technological University, Singapore 639798 (Singapore); Yu, Dingyong [College of Engineering, Ocean University of China, 266100 (China); Tan, Soon Keat, E-mail: yygao@zju.edu.cn [Nanyang Environment and Water Research Institute, Nanyang Technological University, Singapore 639798 (Singapore)

2014-04-01

The flow patterns around a cylinder oscillating freely in the wake of a larger cylinder upstream were investigated using the particle image velocimetry technique. The upstream cylinder was fixed at both ends while the downstream smaller cylinder was held by springs such that it was free to oscillate in the transverse direction. The flow patterns, amplitudes of oscillation and vortex shedding frequencies were compared with those of a single cylinder. In the presence of the upstream cylinder, the three parameters characterizing the oscillation response of the smaller cylinder—amplitude of oscillation, vortex shedding frequency and Reynolds stresses—were greatly reduced. While their magnitude increased with gap ratio, these three parameters were still smaller than the corresponding magnitudes for a single oscillating cylinder. The peak values of turbulence statistics such as Reynolds shear stress and normal stress behind the oscillating downstream cylinder were similarly reduced, and increased with gap ratios. (paper)

Anthropogenic Phosphorus Inputs to a River Basin and Their Impacts on Phosphorus Fluxes Along Its Upstream-Downstream Continuum

Science.gov (United States)

Zhang, Wangshou; Swaney, Dennis P.; Hong, Bongghi; Howarth, Robert W.

2017-12-01

The increasing trend in riverine phosphorus (P) loads resulting from anthropogenic inputs has gained wide attention because of the well-known role of P in eutrophication. So far, however, there is still limited scientific understanding of anthropogenic P inputs and their impacts on riverine flux in river reaches along the upstream-to-downstream continuum. Here we investigated P budgets in a series of nested watersheds draining into Hongze Lake of China and developed an empirical function to describe the relationship between anthropogenic inputs and riverine P fluxes. Our results indicated that there are obvious gradients regarding P budgets in response to changes in human activities. Fertilizer application and food and feed P import was always the dominant source of P inputs in all sections, followed by nonfood P. Further interpretation using the model revealed the processes of P loading to the lake. About 2%-9% of anthropogenic P inputs are transported from the various sections into the corresponding tributaries of the river systems, depending upon local precipitation rates. Of this amount, around 41%-95% is delivered to the main stem of the Huai River after in-stream attenuation in its tributaries. Ultimately, 55%-86% of the P loads delivered to different locations of the main stem are transported into the receiving lake of the downstream, due to additional losses in the main stem. An integrated P management strategy that considers the gradients of P loss along the upstream-to-downstream continuum is required to assess and optimize P management to protect the region's freshwater resource.

Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site

Science.gov (United States)

Kassotis, Christopher D.; Iwanowicz, Luke R.; Akob, Denise M.; Cozzarelli, Isabelle M.; Mumford, Adam; Orem, William H.; Nagel, Susan C.

2016-01-01

Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby.

Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site.

Science.gov (United States)

Kassotis, Christopher D; Iwanowicz, Luke R; Akob, Denise M; Cozzarelli, Isabelle M; Mumford, Adam C; Orem, William H; Nagel, Susan C

2016-07-01

Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby. Copyright © 2016 Elsevier B.V. All rights reserved.

Geographic information system-based healthcare waste management planning for treatment site location and optimal transportation routeing.

Science.gov (United States)

Shanmugasundaram, Jothiganesh; Soulalay, Vongdeuane; Chettiyappan, Visvanathan

2012-06-01

In Lao People's Democratic Republic (Lao PDR), a growth of healthcare centres, and the environmental hazards and public health risks typically accompanying them, increased the need for healthcare waste (HCW) management planning. An effective planning of an HCW management system including components such as the treatment plant siting and an optimized routeing system for collection and transportation of waste is deemed important. National government offices at developing countries often lack the proper tools and methodologies because of the high costs usually associated with them. However, this study attempts to demonstrate the use of an inexpensive GIS modelling tool for healthcare waste management in the country. Two areas were designed for this study on HCW management, including: (a) locating centralized treatment plants and designing optimum travel routes for waste collection from nearby healthcare facilities; and (b) utilizing existing hospital incinerators and designing optimum routes for collecting waste from nearby healthcare facilities. Spatial analysis paved the way to understand the spatial distribution of healthcare wastes and to identify hotspots of higher waste generating locations. Optimal route models were designed for collecting and transporting HCW to treatment plants, which also highlights constraints in collecting and transporting waste for treatment and disposal. The proposed model can be used as a decision support tool for the efficient management of hospital wastes by government healthcare waste management authorities and hospitals.

Ocean Disposal Site Monitoring

Science.gov (United States)

EPA is responsible for managing all designated ocean disposal sites. Surveys are conducted to identify appropriate locations for ocean disposal sites and to monitor the impacts of regulated dumping at the disposal sites.

Proton location in metal hydrides using electron spin resonance

International Nuclear Information System (INIS)

Venturini, E.L.

1979-01-01

Electron spin resonance (ESR) of dilute paramagnetic ions establishes the site symmetry of these ions. In the case of metal hydrides the site symmetry is determined by the number and location of neighboring protons. Typical ESR spectra for trivalent erbium in scandium and yttrium hydrides are presented and analyzed, and this technique is shown to be a versatile microscopic probe of the location, net charge and occupation probability of nearby protons

Instream Biological Assessment of NPDES Point Source Discharges at the Savannah River Site, 2000

International Nuclear Information System (INIS)

Specht, W.L.

2001-01-01

The Savannah River Site (SRS) currently has 31 NPDES outfalls that have been permitted by the South Carolina Department of Health and Environmental Control (SCDHEC) to discharge to SRS streams and the Savannah River. In order to determine the cumulative impacts of these discharges to the receiving streams, a study plan was developed to perform in-stream assessments of the fish assemblages, macroinvertebrate assemblages, and habitats of the receiving streams. These studies were designed to detect biological impacts due to point source discharges. Sampling was initially conducted between November 1997 and July 1998 and was repeated in the summer and fall of 2000. A total of 18 locations were sampled (Table 1, Figure 1). Sampling locations for fish and macroinvertebrates were generally the same. However, different locations were sampled for fish (Road A-2) and macroinvertebrates (Road C) in the lower portion of Upper Three Runs, to avoid interference with ongoing fisheries studies at Road C. Also, fish were sampled in Fourmile Branch at Road 4 rather than at Road F because the stream at Road F was too narrow and shallow to support many fish. Sampling locations and parameters are detailed in Sections 2 and 3 of this report. In general, sampling locations were selected that would permit comparisons upstream and downstream of NPDES outfalls. In instances where this approach was not feasible because effluents discharge into the headwaters of a stream, appropriate unimpacted reference were used for comparison purposes. This report summarizes the results of the sampling that was conducted in 2000 and also compares these data to the data that were collected in 1997 and 1998

Impacts of shape and height of upstream roof on airflow and pollutant dispersion inside an urban street canyon.

Science.gov (United States)

Huang, Yuan-Dong; He, Wen-Rong; Kim, Chang-Nyung

2015-02-01

A two-dimensional numerical model for simulating flow and pollutant dispersion in an urban street canyon is firstly developed using the FLUENT code and then validated against the wind tunnel results. After this, the flow field and pollutant dispersion inside an urban street canyon with aspect ratio W/H = 1 are examined numerically considering five different shapes (vaulted, trapezoidal, slanted, upward wedged, and downward wedged roofs) as well as three different roof height to building height ratios (Z H /H = 1/6, 1/3, and 1/2) for the upstream building roof. The results obtained reveal that the shape and height of an upstream roof have significant influences on flow pattern and pollutant distribution in an urban canyon. A large single clockwise vortex is generated in the canyon for the vaulted upstream roof at Z H /H = 1/6, 1/3, and 1/2, the trapezoidal and downward wedged roofs at Z H /H = 1/6 and 1/3, and the slanted and upward wedged roofs at Z H /H = 1/6, while a main clockwise vortex and a secondary counterclockwise vortex are established for the trapezoidal and downward wedged roofs at Z H /H = 1/2 and the slanted and upward wedged roofs at Z H /H = 1/3 and 1/2. In the one-vortex flow regime, the clockwise vortex moves upward and grows in size with increasing upstream roof height for the vaulted, trapezoidal, and downward wedged roofs. In the two-vortex flow regime, the size and rotational velocity of both upper clockwise and lower counterclockwise vortices increase with the upstream roof height for the slanted and upward wedged roofs. At Z H /H = 1/6, the pollution levels in the canyon are close among all the upstream roof shapes studied. At Z H /H = 1/3, the pollution levels in the canyon for the upward wedged roof and slanted roof are much higher than those for the vaulted, trapezoidal, and downward wedged roofs. At Z H /H = 1/2, the lowest pollution level appears in the canyon for the vaulted upstream roof, while

Gastrointestinal stromal tumours of stomach: Robot-assisted excision with the da Vinci Surgical System regardless of size and location site.

Science.gov (United States)

Furbetta, Niccolo; Palmeri, Matteo; Guadagni, Simone; Di Franco, Gregorio; Gianardi, Desirée; Latteri, Saverio; Marciano, Emanuele; Moglia, Andrea; Cuschieri, Alfred; Di Candio, Giulio; Mosca, Franco; Morelli, Luca

2018-03-23

The role of minimally invasive surgery of gastrointestinal stromal tumours (GISTs) of the stomach remains uncertain especially for large and/or difficult located tumours. We are hereby presenting a single-centre series of robot-assisted resections using the da Vinci Surgical System (Si or Xi). Data of patients undergoing robot-assisted treatment of gastric GIST were retrieved from the prospectively collected institutional database and a retrospective analysis was performed. Patients were stratified according to size and location of the tumour. Difficult cases (DCs) were considered for size if tumour was> 50 mm and/or for location if the tumour was Type II, III or IV sec. Privette/Al-Thani classification. Between May 2010 and February 2017, 12 consecutive patients underwent robot-assisted treatment of GIST at our institution. DCs were 10/12 cases (83.3%), of which 6/10 (50%) for location, 2/10 (25%) for size and 2/10 (25%) for both. The da Vinci Si was used in 8 patients, of which 6 (75%) were DC, and the da Vinci Xi in 4, all of which (100%) were DC. In all patients, excision was by wedge resection. All lesions had microscopically negative resection margins. There was no conversion to open surgery, no tumour ruptures or spillage and no intraoperative complications. Our experience suggests a positive role of the robot da Vinci in getting gastric GIST removal with a conservative approach, regardless of size and location site. Comparative studies with a greater number of patients are necessary for a more robust assessment.

[Research on the application of in-situ biological stabilization solidification technology in chromium contaminated site management].

Science.gov (United States)

Zhang, Jian-rong; Li, Juan; Xu, Wei

2013-09-01

In-situ biological stabilization solidification (SS) technology is an effective ground water risk control method for chromium contaminated sites. Through on-site engineering test, this paper has preliminarily validated the remediation effect of in-situ SS method on a southern chromium contaminated site. The engineering test site has an area of approximately 600 m2, and is located at the upstream of the contaminated area. Due to the severe contamination of chromium, the total chromium concentration reached up to 11,850 mg x kg(-1), while the hexavalent chromium concentration reached up to 349 mg x kg(-1), and the most severely contaminated soil had a depth of -0.5 - -2 m. Variations in hexavalent chromium and total chromium concentration in groundwater were observed through the injection of reducing agents and microbial regulators into the injection wells in the test site, and through the monitoring analysis at different time and different depth under the action of the injection agents. Results of the engineering test showed that the on-site SS technology significantly changed the chromium speciation in soil and then reduced the migration of chromium, thus the groundwater risk was reduced. The injected agents had a good effect of hexavalent chromium remediation in groundwater within the effective range of the injection wells, and the SS rate of hexavalent chromium into trivalent chromium reached 94%-99.9%, the SS rate of total chromium fixation reached 83.9%-99.8%. The test results are of significant reference value for the remediation of contaminated sites with features of shallow groundwater depth and soil mainly consisting of silty clay and sandy clay.

How to use Big Data technologies to optimize operations in Upstream Petroleum Industry

Directory of Open Access Journals (Sweden)

Abdelkader Baaziz

2013-12-01

Full Text Available “Big Data is the oil of the new economy” is the most famous citation during the three last years. It has even been adopted by the World Economic Forum in 2011. In fact, Big Data is like crude! It’s valuable, but if unrefined it cannot be used. It must be broken down, analyzed for it to have value. But what about Big Data generated by the Petroleum Industry and particularly its upstream segment? Upstream is no stranger to Big Data. Understanding and leveraging data in the upstream segment enables firms to remain competitive throughout planning, exploration, delineation, and field development.Oil & Gas Companies conduct advanced geophysics modeling and simulation to support operations where 2D, 3D & 4D Seismic generate significant data during exploration phases. They closely monitor the performance of their operational assets. To do this, they use tens of thousands of data-collecting sensors in subsurface wells and surface facilities to provide continuous and real-time monitoring of assets and environmental conditions. Unfortunately, this information comes in various and increasingly complex forms, making it a challenge to collect, interpret, and leverage the disparate data. As an example, Chevron’s internal IT traffic alone exceeds 1.5 terabytes a day.Big Data technologies integrate common and disparate data sets to deliver the right information at the appropriate time to the correct decision-maker. These capabilities help firms act on large volumes of data, transforming decision-making from reactive to proactive and optimizing all phases of exploration, development and production. Furthermore, Big Data offers multiple opportunities to ensure safer, more responsible operations. Another invaluable effect of that would be shared learning.The aim of this paper is to explain how to use Big Data technologies to optimize operations. How can Big Data help experts to decision-making leading the desired outcomes?Keywords:Big Data; Analytics

Investigating the Applicability of Upstream Detection Strategy at Pedestrian Signalised Crossings

Directory of Open Access Journals (Sweden)

Sitti A Hassan

2017-10-01

Full Text Available In the UK, the Puffin crossing has provision to extend pedestrian green time for those who take longer to cross. However, even at such a pedestrian friendly facility, the traffic signal control is usually designed to minimise vehicle delay while providing the crossing facility. This situation is rather contrary to the current policies to encourage walking. It is this inequity that has prompted the need to re-examine the traffic control of signalised crossings to provide more benefit to both pedestrians and vehicles. In this context, this paper explores the possibility of implementing an Upstream Detection strategy at a Puffin crossing to provide a user friendly crossing. The study has been carried out by simulating a mid-block Puffin crossing for various detector distances and a number of combinations of pedestrian and traffic flows. This paper presents the simulation results and recommends the situations at which Upstream Detection would be suitable.

Effectiveness of a physical barrier for contaminant control in an unconfined coastal plain aquifer: the case study of the former industrial site of Bagnoli (Naples, southern Italy).

Science.gov (United States)

Arienzo, Michele; Allocca, Vincenzo; Manna, Ferdinando; Trifuoggi, Marco; Ferrara, Luciano

2015-12-01

A vertical engineered barrier (VEB) coupled with a water treatment plant was surveyed in the framework of a vast remedial action at the brownfield site of the former ILVA of Bagnoli steel making facility located in western Naples, Italy. The VEB was put in place to minimize contaminant migration from the brownfield site toward the sea at the shorelines sites of Bagnoli and Coroglio. The efficiency of the VEB was monitored through 12 piezometers, 8 at the Bagnoli shoreline and 4 at the Coroglio shoreline. Concentrations of inorganic and organic pollutants were examined in upstream and downstream groundwater relative to the VEB. The mean levels of Al, As, Fe, and Mn largely exceeded the legal limits, 10-15-fold, whereas that of Hg was up to 3-fold the rules. The VEB decreased the outlet concentrations only at certain specific location of the barrier, four times for Al, 6-fold for Hg, and by 20% for Mn with means largely exceeding the rules. At the other sites, the downstream water showed marked increases of the pollutants up to 3-fold. Outstanding levels of the hydrocarbons > 12 were detected in the inlet water with means of some hundred times the limits at both sites. Likewise most of screened inorganic pollutants, the downstream water showed marked increases of the hydrocarbons up to ~113%. The treatment plant was very effective, with removal efficiencies >80% for As, Al, Fe, and Mn. The study evidenced the need to put alternative groundwater remedial actions.

Analysis of foundation type alternative and deep-excavation on candidate site location of Panjang Island, Serang

International Nuclear Information System (INIS)

Heri Syaeful; June Mellawati

2013-01-01

Panjang Island is one of the alternatives location which is being studied as NPP site candidate. Its soil surface dominated by sand and eggshell deposit to the depth of tens of meter, beside that also the interlayer of sand and clay to the depth of 120 m. Purpose of the research is to analyze the alternative of foundation type and simulation of deep-excavation during foundation construction especially related to the slope stability aspect. The methods includes data collection of the analysis result of soil/rock mechanical laboratory, measurement of shear wave velocity by PS logging method, and analysis of alternative foundation type and deep-excavation. The analysis result of foundation type that can be applied on Panjang Island candidate site is combination of raft and pile foundation. Rock with Vs > 400 m/s in depth of 44 meter could be made as base of raft foundation construction. In the bottom it connected to pile foundation which is constructed to base rock in the depth of 120 m in Vs > 900 m/s. The result of slope stability analysis on deep-excavation with slope height of 44 m, vertical angle, on normal condition yield safety factor of 0,184 and on the condition of seismic load 0,138. Simulation of anchor installation with spacing 1.25 m as much as 15 pieces yield safety factor higher than 1.0 m. (author)

Utilizing patient geographic information system data to plan telemedicine service locations.

Science.gov (United States)

Soares, Neelkamal; Dewalle, Joseph; Marsh, Ben

2017-09-01

To understand potential utilization of clinical services at a rural integrated health care system by generating optimal groups of telemedicine locations from electronic health record (EHR) data using geographic information systems (GISs). This retrospective study extracted nonidentifiable grouped data of patients over a 2-year period from the EHR, including geomasked locations. Spatially optimal groupings were created using available telemedicine sites by calculating patients' average travel distance (ATD) to the closest clinic site. A total of 4027 visits by 2049 unique patients were analyzed. The best travel distances for site groupings of 3, 4, 5, or 6 site locations were ranked based on increasing ATD. Each one-site increase in the number of available telemedicine sites decreased minimum ATD by about 8%. For a given group size, the best groupings were very similar in minimum travel distance. There were significant differences in predicted patient load imbalance between otherwise similar groupings. A majority of the best site groupings used the same small number of sites, and urban sites were heavily used. With EHR geospatial data at an individual patient level, we can model potential telemedicine sites for specialty access in a rural geographic area. Relatively few sites could serve most of the population. Direct access to patient GIS data from an EHR provides direct knowledge of the client base compared to methods that allocate aggregated data. Geospatial data and methods can assist health care location planning, generating data about load, load balance, and spatial accessibility. © The Author 2017. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Final environmental impact statement for the Nevada Test Site and off-site locations in the State of Nevada. Framework for the resource management plan, Volume 2

International Nuclear Information System (INIS)

1996-08-01

The purpose of this document is to publicize how the U.S. Department of Energy Nevada Operations Office (DOE/NV) proposes to develop and use a Resource Management Plan for the Nevada Test Site (NTS) so the public could comment on and assist in the following activities: (1) Developing the methods for creating and using the plan; (2) Identifying the values people place on manmade and natural resources found on the NTS; (3) Developing the goals the DOE/NV will use to guide the conservation and use of those resources; (4) Identifying the management actions needed to meet constraints and resource management goals; and (5) Incorporating the principles of ecosystem management into land and resource management on the NTS. This framework for the Resource Management Plan was developed in conjunction with the Environmental Impact Statement for the Nevada Test Site and off-site locations in the state of Nevada (NTS EIS) to take advantage of the extensive data collection and public participation activities associated with the National Environmental Policy Act. After public input was received during the comment period for the Draft NTS EIS, DOE/NV revised this description of the Resource Management Plan and published it with the NTS Final EIS. This revision includes the goals DOE/NV has developed for managing resources and land-use constraints. It also includes the final plans for developing the Resource Management Plan. These plans will guide DOE/NV as it develops a Resource Management Plan in the coming years

Upstream pumping of radial lip seals by tangentially deforming, rough seal surfaces

NARCIS (Netherlands)

Bavel, van P.G.M.; Ruijl, T.A.M.; Leeuwen, van H.J.; Muijderman, E.A.

1996-01-01

This paper aims at a theoretical explanation of the following two experimental observations of radial lip seals: fluid film formation and upstream pumping action. The origins of these observations are still poorly understood. A hydrodynamic analysis is presented for the fully flooded contact zone of

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

Science.gov (United States)

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

Site characterization in connection with the low level defense waste management site in Area 5 of the Nevada Test Site, Nye County, Nevada. Final report

International Nuclear Information System (INIS)

Case, C.; Davis, J.; French, R.; Raker, S.

1984-09-01

The Site Characterization Report for the Defense Low Level Waste Management Site (RWMS) in Area 5 of the Nevada Test Site deals with the FY80-FY84 DRI activities. The areas that have been studied include geology, hydrology, unsaturated flow, soil and soil water chemistry, flood hazard, and economics-demographics. During this time the site characterization effort focussed on the following items as requested by NVO: geological and hydrological limitations to greater depth disposal of radioactive waste; potential for tectonic, seismic or volcanic activity (extent and frequency which these processes significantly affect the ability of the disposal operation to meet performance objectives); the possibility of groundwater intrusion into the waste zone, and its significance; topography of the RWMS with significance to drainage and flood potential (100-year flood plain, coastal high-hazard area or wetland); upstream drainage which may require modification to avoid erosion; population growth and future development; and the presence or absence of economically significant natural resources which, if exploited, would result in failure to meet performance objectives. The items mentioned above are dealt with in the description of activities and results in the body of the report. Extensive references, 32 figures, 20 tables

Automated lake-wide erosion predictions and economic damage calculations upstream of the Moses-Saunders power dam

International Nuclear Information System (INIS)

Zuzek, P.; Baird, W.F.; International Joint Commission, Ottawa, ON

2008-01-01

This presentation discussed an automated flood and erosion prediction system designed for the upstream sections of the Moses-Saunders power dam. The system included a wave prediction component along with 3-D maps, hourly run-ups, geographic information system (GIS) tools and a hazard analysis tool. Parcel, reach, township, and county databases were used to populate the system. The prediction system was used to develop detailed study sites of shore units in the study area. Shoreline classes included sand and cohesive buffs, low banks, coarse beaches, and cobble or boulder lags. Time series plots for Lake Ontario water and wave levels were presented. Great Lakes ice cover data were also included in the system as well as erosion predictions from 1961 to 1995. The system was also used to develop bluff recession equations and cumulative recession analyses for different regulation plans. Cumulative bluff recession and protection requirements were outlined. Screenshots of the flood and erosion prediction system interface were also included. tabs., figs

Location Capability and Site Characterization Installing a Borehole VBB Seismometer: the OGS Experience in Ferrara (Italy)

Science.gov (United States)

Pesaresi, D.; Barnaba, C.

2014-12-01

The Centro di Ricerche Sismologiche (CRS, Seismological Research Centre) of the Istituto Nazionale di Oceanografia e di Geofisica Sperimentale (OGS, Italian National Institute for Oceanography and Experimental Geophysics) in Udine (Italy) after the strong earthquake of magnitude M=6.4 occurred in 1976 in the Italian Friuli-Venezia Giulia region, started to operate the Northeastern Italy Seismic Network: it currently consists of 19 very sensitive broad band and 17 simpler short period seismic stations, all telemetered to and acquired in real time at the OGS CRS data centre in Udine. The southwestern edge of the OGS seismic network stands on the Po alluvial basin: earthquake localization and characterization in this area is affected by the presence of soft alluvial deposits. Following the ML=5.9 earthquake that struck the Emilia region around Ferrara in Northern Italy on May 20, 2012, a cooperation of Istituto Nazionale di Geofisica e Vulcanologia, OGS, the Comune di Ferrara and the University of Ferrara lead to the reinstallation of a previously existing very broad band (VBB) borehole seismic station in Ferrara and to the deployment of a temporary seismographic network consisting of eight portable seismological stations, to record the local earthquakes that occurred during the seismic sequence. The aim of the OGS intervention was on one hand to extend its real time seismic monitoring capabilities toward South-West, including Ferrara and its surroundings, and on the other hand to evaluate seismic site responses in the area. We will introduce details of the Ferrara VBB borehole station and the OGS temporary seismographic network configuration and installation. We will then illustrate the location capability performances, and finally we will shortly describe seismic site characterization with surface/borehole comparisons in terms of seismic noise, site amplification and resonance frequencies.

A GIS methodology to identify potential corn stover collection locations

Energy Technology Data Exchange (ETDEWEB)

Haddad, Monica A. [Department of Community and Regional Planning, 583 College of Design, Iowa State University, Ames, IA 50011-3095 (United States); Anderson, Paul F. [Department of Landscape Architecture, 481 College of Design, Iowa State University, Ames, IA 50011 (United States); Department of Agronomy, 481 College of Design, Iowa State University, Ames, IA 50011 (United States)

2008-12-15

In this study, we use geographic information systems technology to identify potential locations in a Midwestern region for collection and storage of corn stover for use as biomass feedstock. Spatial location models are developed to identify potential collection sites along an existing railroad. Site suitability analysis is developed based on two main models: agronomic productivity potential and environmental costs. The analysis includes the following steps: (1) elaboration of site selection criteria; (2) identification of the study region and service area based on transportation network analysis; (3) reclassification of input spatial layers based on common scales; (4) overlaying the reclassified spatial layers with equal weights to generate the two main models; and (5) overlaying the main models using different weights. A pluralistic approach is adopted, presenting three different scenarios as alternatives for the potential locations. Our results suggest that there is a significant subset of potential sites that meet site selection criteria. Additional studies are needed to evaluate potential sites through field visits, assess economic and social costs, and estimate the proportion of corn producers willing to sell and transport corn stover to collection facilities. (author)

(LBA-and-WRM)-based DBA scheme for multi-wavelength upstream transmission supporting 10 Gbps and 1 Gbps in MAN

Science.gov (United States)

Zhang, Yuchao; Gan, Chaoqin; Gou, Kaiyu; Xu, Anni; Ma, Jiamin

2018-01-01

DBA scheme based on Load balance algorithm (LBA) and wavelength recycle mechanism (WRM) for multi-wavelength upstream transmission is proposed in this paper. According to 1 Gbps and 10 Gbps line rates, ONUs are grouped into different VPONs. To facilitate wavelength management, resource pool is proposed to record wavelength state. To realize quantitative analysis, a mathematical model describing metro-access network (MAN) environment is presented. To 10G-EPON upstream, load balance algorithm is designed to ensure load distribution fairness for 10G-OLTs. To 1G-EPON upstream, wavelength recycle mechanism is designed to share remained wavelengths. Finally, the effectiveness of the proposed scheme is demonstrated by simulation and analysis.

Low power consumption O-band VCSEL sources for upstream channels in PON systems

DEFF Research Database (Denmark)

Vegas Olmos, Juan José; Rodes Lopez, Roberto; Tafur Monroy, Idelfonso

2012-01-01

This paper presents an experimental validation of a low power optical network unit employing vertical-cavity surface-emitting lasers as upstream sources for passive optical networks with an increased power budget, enabling even larger splitting ratios....

Explosion Clad for Upstream Oil and Gas Equipment

Science.gov (United States)

Banker, John G.; Massarello, Jack; Pauly, Stephane

2011-01-01

Today's upstream oil and gas facilities frequently involve the combination of high pressures, high temperatures, and highly corrosive environments, requiring equipment that is thick wall, corrosion resistant, and cost effective. When significant concentrations of CO2 and/or H2S and/or chlorides are present, corrosion resistant alloys (CRA) can become the material of choice for separator equipment, piping, related components, and line pipe. They can provide reliable resistance to both corrosion and hydrogen embrittlement. For these applications, the more commonly used CRA's are 316L, 317L and duplex stainless steels, alloy 825 and alloy 625, dependent upon the application and the severity of the environment. Titanium is also an exceptional choice from the technical perspective, but is less commonly used except for heat exchangers. Explosion clad offers significant savings by providing a relatively thin corrosion resistant alloy on the surface metallurgically bonded to a thick, lower cost, steel substrate for the pressure containment. Developed and industrialized in the 1960's the explosion cladding technology can be used for cladding the more commonly used nickel based and stainless steel CRA's as well as titanium. It has many years of proven experience as a reliable and highly robust clad manufacturing process. The unique cold welding characteristics of explosion cladding reduce problems of alloy sensitization and dissimilar metal incompatibility. Explosion clad materials have been used extensively in both upstream and downstream oil, gas and petrochemical facilities for well over 40 years. The explosion clad equipment has demonstrated excellent resistance to corrosion, embrittlement and disbonding. Factors critical to insure reliable clad manufacture and equipment design and fabrication are addressed.

Explosion Clad for Upstream Oil and Gas Equipment

International Nuclear Information System (INIS)

Banker, John G.; Massarello, Jack; Pauly, Stephane

2011-01-01

Today's upstream oil and gas facilities frequently involve the combination of high pressures, high temperatures, and highly corrosive environments, requiring equipment that is thick wall, corrosion resistant, and cost effective. When significant concentrations of CO 2 and/or H 2 S and/or chlorides are present, corrosion resistant alloys (CRA) can become the material of choice for separator equipment, piping, related components, and line pipe. They can provide reliable resistance to both corrosion and hydrogen embrittlement. For these applications, the more commonly used CRA's are 316L, 317L and duplex stainless steels, alloy 825 and alloy 625, dependent upon the application and the severity of the environment. Titanium is also an exceptional choice from the technical perspective, but is less commonly used except for heat exchangers. Explosion clad offers significant savings by providing a relatively thin corrosion resistant alloy on the surface metallurgically bonded to a thick, lower cost, steel substrate for the pressure containment. Developed and industrialized in the 1960's the explosion cladding technology can be used for cladding the more commonly used nickel based and stainless steel CRA's as well as titanium. It has many years of proven experience as a reliable and highly robust clad manufacturing process. The unique cold welding characteristics of explosion cladding reduce problems of alloy sensitization and dissimilar metal incompatibility. Explosion clad materials have been used extensively in both upstream and downstream oil, gas and petrochemical facilities for well over 40 years. The explosion clad equipment has demonstrated excellent resistance to corrosion, embrittlement and disbonding. Factors critical to insure reliable clad manufacture and equipment design and fabrication are addressed.

LHCb Upstream Tracker

CERN Multimedia

Gandini, Paolo

2014-01-01

The LHCb upgrade requires replacing the silicon strip tracker between the vertex locator (VELO) and the magnet. A new design has been developed and tested based on the "stave" concept planned for the ATLAS upgrade.

LHCb Upstream Tracker

CERN Multimedia

Gandini, P

2014-01-01

The LHCb upgrade requires replacing the silicon strip tracker between the vertex locator (VELO) and the magnet. A new design has been developed and tested based on the "stave" concept planned for the ATLAS upgrade

Exploring Patterns of Upstream Internationalization: The Role of Home-region ‘Stickiness’

NARCIS (Netherlands)

A.R. Muller (Allan); R.J.M. van Tulder (Rob)

2005-01-01

textabstractRecent work has emphasized the importance of regional strategies downstream, adding new depth to the debate on ‘globalization’. This paper adds to the debate by exploring the regional dimension upstream for a sample of Triad-based Fortune 500 firms. We find support for our hypothesis

Cultural resources: Deaf Smith and Swisher County locations, Palo Duro Basin, Texas

International Nuclear Information System (INIS)

1984-12-01

Cultural resources are prehistoric and historic sites, including archeological and paleontological sites, that are important to a group of people. They are protected by both federal and state legislation. In the area covered by the Deaf Smith and Swisher County locations, four stages of cultural development have been identified: Paleo-Indian, Archaic, Ceramic (Neo-Indian or Neo-American), and Historic. Areas where undiscovered cultural resources are most likely to be found include sources of water, playa lakes, and historic trails. Because extensive surveying has not been done in either location, the number of identified sites is low. However, the potential for finding undiscovered sites is high for significant parts of both locations

Effect of longitudinal and transverse vibrations of an upstream square cylinder on vortex shedding behind two inline square cylinders

International Nuclear Information System (INIS)

Patil, Pratish P; Tiwari, Shaligram

2009-01-01

The characteristics of unsteady wakes behind a stationary square cylinder and another upstream vibrating square cylinder have been investigated numerically with the help of a developed computational code. The effect of longitudinal as well as transverse vibrations of the upstream cylinder is studied on the coupled wake between the two cylinders, which is found to control the vortex shedding behavior behind the downstream stationary cylinder. Computations are carried out for a fixed value of Reynolds number (Re = 200) and three different values of excitation frequencies of the upstream cylinder, namely less than, equal to and greater than the natural frequency of vortex shedding corresponding to flow past a stationary square cylinder. The vortex shedding characteristics of the unsteady wakes behind the vibrating and stationary cylinders are found to differ significantly for longitudinal and transverse modes of vibration of the upstream cylinder. The wake of the downstream stationary cylinder is found to depict a synchronization behavior with the upstream cylinder vibration. The spacing between the two cylinders has been identified to be the key parameter influencing the synchronization phenomenon. The effect of cylinder spacing on the wake synchronization and the hydrodynamic forces has been examined. In addition, a comparison of the drag forces for flow past transversely vibrating square and circular cylinders for similar amplitudes and frequencies of cylinder vibration has been presented while employing the tested computational code.

A patient's view on the location of the temporomandibular joint.

Science.gov (United States)

Koole, Paul; Zonnenberg, Adriaan J J; Mulder, Jan

2018-03-25

Objective A survey was held to establish whether laypeople knew the location of their temporomandibular joint. Methods A sample of 61 participants, visiting their dental office for a routine check-up, was given a three-question survey of whether they knew the location of their temporomandibular joint and could point to this location. Results Thirty-eight participants answered the question affirmatively. Only 13 pointed to the correct location. Of these, six participants received consultation for TMD in the past, three participants were healthcare providers, and four participants actually had knowledge of the exact location. Out of 23 participants who did not know the location, one accidently designated the correct position. Conclusion The location of the temporomandibular joint is not a well-known site for many patients. In the presence of orofacial pain, it seems advisable to let the patient designate and record the site of the pain on a drawing on the patient chart.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

Science.gov (United States)

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Hindrances to upstream migration of atlantic salmon (Salmo salar) in a northern Swedish river caused by a hydroelectric power-station

International Nuclear Information System (INIS)

Rivinoja, P.; Lundqvist, H.

2001-01-01

Many Baltic salmon rivers have lost their natural juvenile production due to human activities blocking or reducing access to their spawning grounds, e.g. damming, power generation, partial hinders, etc.. One such hindrance is a hydroelectric complex located in the lower reaches of River Umeaelven in northern Sweden. Water from the forbay created by the dam Norrfors is directed to the Stornorrfors power-station. At times, 100 per cent of the river is directed to the power-station. Water from the power-station then flows via a tunnel and outlet channel to the river. From the point of the tunnel's discharge into the river, the old river bed acts as a bypass channel directing migrating adult fish to a fish ladder located at the base of the dam. In this study, the effect that an additional turbine, that was installed at the power-station in 1986, had on fish passage run-time was examined. Changes in run-time were compared for two periods 1974-1985 and 1986-1995. In 1997, 55 wild and 25 hatchery salmon were captured in the Umeaelven estuary, radio tagged with uniquely coded tags, and tracked upstream. Both manual and automatic loggers were used to locate fish daily. The main findings show that only 26 per cent of the wild salmon and none of the hatchery salmon found the fish ladder. It is suggested that the salmon followed the main water discharge from the power-station outlet and are thus directed away from the entrance to the bypass channel leading to the fish ladder. Salmon respond by moving upstream or downstream depending on the current flow regimes. The bypass channel consists of partial hinders that may explain why it takes on average 52 days for the salmon to migrate 32 km from the estuary to the fish ladder. Adding a fourth turbine at the power-station did not appear to have changed the timing of the migration or the seasonal distribution of the migrating wild salmon through the fish ladder. There was no significant effect of the fourth turbine on the duration

A semelparous fish continues upstream migration when exposed to alarm cue, but adjusts movement speed and timing

Science.gov (United States)

Luhring, Thomas M; Meckley, Trevor D.; Johnson, Nicholas S.; Siefkes, Michael J.; Hume, John B.; Wagner, C. Michael

2016-01-01

Animals make trade-offs between predation risk and pursuit of opportunities such as foraging and reproduction. Trade-offs between antipredator behaviours and foraging are well suited to manipulation in laboratory and field settings and have generated a vast compendium of knowledge. However, much less is known about how animals manage trade-offs between predation risk and pursuit of reproductive opportunities in the absence of the confounding effects of foraging. In the present study, we investigated how the nonfeeding migratory life stage of sea lamprey, Petromyzon marinus, responds to odour from dead conspecifics (a cue that induces avoidance behaviours in laboratory and field studies). We released groups of PIT-tagged sea lamprey 65 m from the shore of Lake Michigan or 287 m upstream in Carp Lake River and used antennas to detect their movements in the river. As the breeding season progressed, sea lamprey initiated upstream movement earlier and were more likely to enter the river. Sea lamprey that began the night in Lake Michigan entered Carp Lake River at higher rates and accelerated upstream when exposed to high concentrations of alarm cue, consistent with animals attempting to minimize time spent in risky areas. Sea lampreys that began the night in the river delayed upstream movement when exposed to alarm cue, consistent with animals sheltering and gathering information about a source of risk. We attribute this context-specific reaction to alarm cue to differences in perceived vulnerability to predation in sheltered positions in the river versus exposed positions in the lake. Once in the river, the vast majority of sea lamprey moved upstream independent of alarm cue or Julian date. Although life-history-induced time and energy budgets place rigid constraints on the direction of migration, sea lamprey attend to predation risk by modifying movement timing and speed.

Quantitative Infrared Image Analysis Of Simultaneous Upstream and Downstream Microgravity Flame Spread over Thermally-Thin Cellulose in Low Speed Forced Flow

Science.gov (United States)

Olson, S. L.; Lee, J. R.; Fujita, O.; Kikuchi, M.; Kashiwagi, T.

2013-01-01

The effect of low velocity forced flow on microgravity flame spread is examined using quantitative analysis of infrared video imaging. The objective of the quantitative analysis is to provide insight into the mechanisms of flame spread in microgravity where the flame is able to spread from a central location on the fuel surface, rather than from an edge. Surface view calibrated infrared images of ignition and flame spread over a thin cellulose fuel were obtained along with a color video of the surface view and color images of the edge view using 35 mm color film at 2 Hz. The cellulose fuel samples were mounted in the center of a 12 cm wide by 16 cm tall flow duct and were ignited in microgravity using a straight hot wire across the center of the 7.5 cm wide by 14 cm long samples. Four cases, at 1 atm. 35%O2 in N2, at forced flows from 2 cm/s to 20 cm/s are presented here. This flow range captures flame spread from strictly upstream spread at low flows, to predominantly downstream spread at high flow. Surface temperature profiles are evaluated as a function of time, and temperature gradients for upstream and downstream flame spread are measured. Flame spread rates from IR image data are compared to visible image spread rate data. IR blackbody temperatures are compared to surface thermocouple readings to evaluate the effective emissivity of the pyrolyzing surface. Preheat lengths and pyrolysis lengths are evaluated both upstream and downstream of the central ignition point. A surface energy balance estimates the net heat flux from the flame to the fuel surface along the length of the fuel. Surface radiative loss and gas-phase radiation from soot are measured relative to the net heat feedback from the flame. At high surface heat loss relative to heat feedback, the downstream flame spread does not occur.

A cost-effective structure of a centralized-light-source WDM-PON utilizing inverse-duobinary-RZ downstream and DPSK upstream

International Nuclear Information System (INIS)

Chen Long-Quan; Qiao Yao-Jun; Ji Yue-Feng

2013-01-01

In this paper, we propose a new structure of a centralized-light-source wavelength division multiplexed passive optical network (WDM-PON) utilizing inverse-duobinary-return-to-zero (inverse-duobinary-RZ) downstream and DPSK upstream. It reuses downstream light for the upstream modulation, which retrenches lasers assembled at each optical network unit (ONU), and ultimately cuts down the cost of ONUs a great deal. Meanwhile, a 50-km-reach WDM-PON experiment with 10-Gb/s inverse-duobinary-RZ downstream and 6-Gb/s DPSK upstream is demonstrated here. It is revealed to be a novel cost-effective alternative for the next generation access network. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

Conservation of the primary structure, organization, and function of the human and mouse β-globin locus-activating regions

International Nuclear Information System (INIS)

Moon, A.M.; Ley, T.J.

1990-01-01

DNA sequences located in a region 6-18 kilobases (kb) upstream from the human ε-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the β-like globin gene cluster during erythroid development. Since the human β-globin LAR is functional in mice, the authors reasoned that critical LAR sequence elements might be conserved between mice and humans. They therefore cloned murine genomic sequences homologous to one portion of the human LAR. They found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse β-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of ∼800 base pairs. These results suggest that primary structural elements endash and the spatial organization of these elements endash are important for function of the β-globin LAR

Test of a non-physical barrier consisting of light, sound, and bubble screen to block upstream movement of sea lamprey in an experimental raceway

Science.gov (United States)

Miehls, Scott M.; Johnson, Nicholas S.; Hrodey, Pete J.

2017-01-01

Control of the invasive Sea Lamprey Petromyzon marinus is critical for management of commercial and recreational fisheries in the Laurentian Great Lakes. Use of physical barriers to block Sea Lampreys from spawning habitat is a major component of the control program. However, the resulting interruption of natural streamflow and blockage of nontarget species present substantial challenges. Development of an effective nonphysical barrier would aid the control of Sea Lampreys by eliminating their access to spawning locations while maintaining natural streamflow. We tested the effect of a nonphysical barrier consisting of strobe lights, low-frequency sound, and a bubble screen on the movement of Sea Lampreys in an experimental raceway designed as a two-choice maze with a single main channel fed by two identical inflow channels (one control and one blocked). Sea Lampreys were more likely to move upstream during trials when the strobe light and low-frequency sound were active compared with control trials and trials using the bubble screen alone. For those Sea Lampreys that did move upstream to the confluence of inflow channels, no combination of stimuli or any individual stimulus significantly influenced the likelihood that Sea Lampreys would enter the blocked inflow channel, enter the control channel, or return downstream.

Radioecological characterization of a uranium mining site located in a semi-arid region in Brazil

International Nuclear Information System (INIS)

Fernandes, Horst M.; Lamego Simoes Filho, F. Fernando; Perez, Valeska; Franklin, Mariza Ramalho; Gomiero, Luiz Alberto

2006-01-01

The work presents the radioecological characterization of the new Brazilian uranium mining and milling site located in a semi-arid region of the country. The process characterization demonstrated that in heap leach plants most of the 226 Ra remains in the leached ore. Despite the potential higher availability of radium isotopes in the soils of the studied region the lack of precipitation in that area reduces the leaching/mobilization of the radionuclides. High 226 Ra and 228 Ra concentrations were found in manioc while 21 Pb was significant in pasture. It was suggested that a range from 10 -3 to 10 -1 may conveniently encompass most of the transfer factors (TF) values for soil/plant systems (i.e. involving different cultures, different soils and natural radionuclides). Impacts due to aerial transportation of aerosols and radon generated in the mining were proved to be minimal and restricted to an area not greater than 15 km 2 . Finally, uranium complexation by carbonates was shown to be the main mechanism responding for the elevated radionuclide concentration in groundwater

Novel Strategies for Upstream and Downstream Processing of Tannin Acyl Hydrolase

Directory of Open Access Journals (Sweden)

Luis V. Rodríguez-Durán

2011-01-01

Full Text Available Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.

Novel strategies for upstream and downstream processing of tannin acyl hydrolase.

Science.gov (United States)

Rodríguez-Durán, Luis V; Valdivia-Urdiales, Blanca; Contreras-Esquivel, Juan C; Rodríguez-Herrera, Raúl; Aguilar, Cristóbal N

2011-01-01

Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.

A recommended approach to the National Pollutant Release Inventory (NPRI) for the upstream oil and gas industry : 2002 : CAC emissions

International Nuclear Information System (INIS)

2003-04-01

The National Pollutant Release Inventory (NPRI) is a database of annual releases to air, water, land and off-site transfers of 273 specified pollutants. Environment Canada requires that the NPRI be reported annually. Criteria Air Contaminants (CAC) had to be reported for the first time in 2002. Air pollutants that contribute to the formation of ground level ozone and smog are included in the definition of CAC, along with any eye or respiratory irritants to both humans and animals. The substances of special interest to the petroleum industry are: oxides of nitrogen, sulphur dioxide, carbon monoxide, volatile organic compounds, total particulate matter, and particulate matters. This guide is intended to provide member companies of Canadian Association of Petroleum Producers (CAPP), operating upstream oil and gas facilities, with readily available data to determine the amount of CAC emissions released from their processes and equipment. Companies using these guidelines will be able to compare the performance of various upstream oil and gas companies more readily because the data is consistent. The scope of the project was described in section 1, and the sources of CAC emissions were identified in section 2. The reporting threshold was discussed in section 3. Data required for collection was outlined in section 4. Section 5 outlines how CAC emission quantities are determined. Calculation examples were provided in section 6 and definitions provided in section 7. 11 tabs., 1 fig

Upstream Disaster Management to Support People Experiencing Homelessness.

Science.gov (United States)

Sundareswaran, Madura; Ghazzawi, Andrea; O'Sullivan, Tracey L

2015-08-18

The unique context of day-to-day living for people who are chronically homeless or living with housing insecurity puts them at high risk during community disasters. The impacts of extreme events, such as flooding, storms, riots, and other sources of community disruption, underscore the importance of preparedness efforts and fostering community resilience. This study is part of larger initiative focused on enhancing resilience and preparedness among high risk populations. The purpose of this study was to explore critical issues and strategies to promote resilience and disaster preparedness among people who are homeless in Canada. A sample of interviews (n=21) from key informants across Canada was analyzed to explore existing programs and supports for homeless populations. The data was selected from a larger sample of (n=43) interviews focused on programs and supports for people who are at heightened risk for negative impacts during disasters. Qualitative content analysis was used to extract emergent themes and develop a model of multi-level collaboration to support disaster resilience among people who are homeless. The results indicate there is a need for more upstream continuity planning, collaboration and communication between the emergency management sector and community service organizations that support people who are homeless. Prioritization and investment in the social determinants of health and community supports is necessary to promote resilience among this high-risk population. The findings from this study highlight the importance of acknowledging community support organizations as assets in disaster preparedness. Day-to-day resilience is an ongoing theme for people who are chronically homeless or living with housing insecurity. Upstream investment to build adaptive capacity and collaborate with community organizations is an important strategy to enhance community resilience.

Upstream particles observed in the earth's foreshock region

International Nuclear Information System (INIS)

Eastman, T.E.; Anderson, R.R.; Frank, L.A.; Parks, G.K.

1981-01-01

On the basis of primarily an extensive study of fully three-dimensional plasma data, we describe the interrelationships of the upstream particles and plasma waves observed in the earth's foreshock region. The University of Iowa LEPEDEAs detect ions and electrons from 1 eV to 45 keV over all except approx.2% of the unit sphere. Comparisons are made with high time resolution particle data obtained by the University of California (Berkeley) instruments and plasma wave data collected by the University of Iowa plasma wave instruments on the two ISEE spacecraft. The presence of ion beams or dispersed ion distributions is found to be a sufficient condition for the presence of electrostatic and electromagnetic wave emissions. Detailed correlations of ions with plasma waves down to a tenth of an ion gyroperiod indicate that ion acoustic emission is enhanced when increased anisotropies and gyrophase organization are observed. Time aliasing effects limit the interpretation of velocity distributions taken within the foreshock region. High time resolution correlations between the different instruments, however, demonstrate that time variations of a single isotropic or anisotropic distribution cannot produce the dispersed ion distributions. Detailed analysis of high time resolution data reveals that the upstream particles undergo significant spatial and temporal variations including gyrophase organization. Gyrophase organization comprises groups of ion clusters each one of which includes ions with similar pitch angles that gyrate together about a common guiding center. On the basis of our high time resolution analysis of three-dimensional plasma data combined with magnetic field and plasma wave data, we conclude that (1) ions observed in the foreshock region display gyrophase organization produced by ion clusters with a spatial scale <1 R/sub g/, and (2) dispersed ion distributions are produced primarily by direct sources at or near the bow shock

Conserved epitope on several human vitamin K-dependent proteins: location of the antigenic site and influence of metal ions on antibody binding

International Nuclear Information System (INIS)

Church, W.R.; Messier, T.; Howard, P.R.; Amiral, J.; Meyer, D.; Mann, K.G.

1988-01-01

A murine monoclonal antibody (designated H-11) produced by injecting mice with purified human protein C was found to bind several human vitamin K-dependent proteins. Using a solid-phase competitive radioimmunoassay with antibody immobilized onto microtiter plates, binding of 125 I-labeled protein C to the antibody was inhibited by increasing amounts of protein C, prothrombin, and Factors X and VII over a concentration range of 1 x 10 -8 to 1 x 10 -6 M. Chemical treatment of prothrombin with a variety of agents did not destroy the antigenic site recognized by the antibody as measured by immunoblotting of prothrombin or prothrombin derivative immobilized onto nitrocellulose. Immunoblotting of purified vitamin K-dependent polypeptides with the monoclonal antibody following sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrophoretic transfer to nitrocellulose indicated that the antigenic site was found on the light chains of protein C and Factor X. The exact location of the antigenic determinant for antibody H-11 was established using synthetic peptides. Comparison of protein sequences of bovine and human vitamin K-dependent proteins suggests that the sequence Phe-Leu-Glu-Glu-Xaa-Arg/Lys is required for antibody binding. Increasing concentrations of Ca 2+ , Mg 2+ , or Mn 2+ partially inhibited binding of 125 I-protein C to the antibody in a solid-phase assay system with half-maximal binding observed at divalent metal ion concentrations of 2, 4, and 0.6 mM, respectively. The antigenic site thus recognized by monoclonal antibody H-11 is located at the amino-terminal region in the highly conserved γ-carboxyglutamic acid-containing domains of several, but not all, vitamin K-dependent proteins

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

Science.gov (United States)

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Three-year summary report of biological monitoring at the Southwest Ocean dredged-material disposal site and additional locations off Grays Harbor, Washington, 1990--1992

Energy Technology Data Exchange (ETDEWEB)

Antrim, L.D.; Shreffler, D.K.; Pearson, W.H.; Cullinan, V.I. [Battelle Marine Research Lab., Sequim, WA (United States)

1992-12-01

The Grays Harbor Navigation Improvement Project was initiated to improve navigation by widening and deepening the federal channel at Grays Harbor. Dredged-material disposal sites were selected after an extensive review process that included inter-agency agreements, biological surveys, other laboratory and field studies, and preparation of environmental impact statements The Southwest Site, was designated to receive materials dredged during annual maintenance dredging as well as the initial construction phase of the project. The Southwest Site was located, and the disposal operations designed, primarily to avoid impacts to Dungeness crab. The Final Environmental Impact Statement Supplement for the project incorporated a Site Monitoring Plan in which a tiered approach to disposal site monitoring was recommended. Under Tier I of the Site Monitoring Plan, Dungeness crab densities are monitored to confirm that large aggregations of newly settled Dungeness crab have not moved onto the Southwest Site. Tier 2 entails an increased sampling effort to determine whether a change in disposal operations is needed. Four epibenthic surveys using beam trawls were conducted in 1990, 1991, and 1992 at the Southwest Site and North Reference area, where high crab concentrations were found in the spring of 1985. Survey results during these three years prompted no Tier 2 activities. Epibenthic surveys were also conducted at two nearshore sites where construction of sediment berms has been proposed. This work is summarized in an appendix to this report.

Risk assessment of imidacloprid use in forest settings on the aquatic macroinvertebrate community.

Science.gov (United States)

Benton, Elizabeth P; Grant, Jerome F; Nichols, Rebecca J; Webster, R Jesse; Schwartz, John S; Bailey, Joseph K

2017-11-01

The isolated effects of a single insecticide can be difficult to assess in natural settings because of the presence of numerous pollutants in many watersheds. Imidacloprid use for suppressing hemlock woolly adelgid, Adelges tsugae (Annand) (Hemiptera: Adelgidae), in forests offers a rare opportunity to assess potential impacts on aquatic macroinvertebrates in relatively pristine landscapes. Aquatic macroinvertebrate communities were assessed in 9 streams in Great Smoky Mountains National Park (southern Appalachian Mountains, USA). The streams flow through hemlock conservation areas where imidacloprid soil drench treatments were applied for hemlock woolly adelgid suppression. Sites were located upstream and downstream of the imidacloprid treatments. Baseline species presence data (pre-imidacloprid treatment) were available from previous sample collections at downstream sites. Downstream and upstream sites did not vary in numerous community measures. Although comparisons of paired upstream and downstream sites showed differences in diversity in 7 streams, higher diversity was found more often in downstream sites. Macroinvertebrate functional feeding groups and life habits were similar between downstream and upstream sites. Downstream and baseline stream samples were similar. While some functional feeding group and life habit species richness categories varied, variations did not indicate poorer quality downstream communities. Imidacloprid treatments applied according to US Environmental Protection Agency federal restrictions did not result in negative effects to aquatic macroinvertebrate communities, which indicates that risks of imidacloprid use in forest settings are low. Environ Toxicol Chem 2017;36:3108-3119. © 2017 SETAC. © 2017 SETAC.

rs2735383, located at a microRNA binding site in the 3'UTR of NBS1, is not associated with breast cancer risk

DEFF Research Database (Denmark)

Liu, Jingjing; Lončar, Ivona; Collée, J Margriet

2016-01-01

NBS1, also known as NBN, plays an important role in maintaining genomic stability. Interestingly, rs2735383 G > C, located in a microRNA binding site in the 3'-untranslated region (UTR) of NBS1, was shown to be associated with increased susceptibility to lung and colorectal cancer. However, the r...

Site Rehabilitation Completion Report with No Further Action Proposal for the Northeast Site

Energy Technology Data Exchange (ETDEWEB)

Daniel, Joe [Stoller Newport News Technology, Inc., Grand Junction, CO (United States); Tabor, Charles [Stoller Newport News Technology, Inc., Grand Junction, CO (United States); Survochak, Scott [U.S. Department of Energy, Office of Legacy Management, Grand Junction, CO (United States)

2013-05-01

The purpose of this Site Rehabilitation Completion Report is to present the post-active-remediation monitoring results for the Northeast Site and to propose No Further Action with Controls. This document includes information required by Chapter 62-780.750(4)(d), 62-780.750(6), and 62-780.600(8)(a)27 Florida Administrative Code (F.A.C.). The Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site (DOE 2009a) describes the approach for post-active-remediation monitoring. The Young - Rainey Science, Technology, and Research Center (STAR Center) is a former U.S. Department of Energy (DOE) facility constructed in the mid-1950s. The 99-acre STAR Center is located in Largo, Florida. The Northeast Site is located in the northeast corner of the STAR Center. The Northeast Site meets all the requirements for an RMO II closure—No Further Action with Controls. DOE is nearing completion of a restrictive covenant for the Northeast Site. DOE has completed post-active-remediation monitoring at the Northeast Site as of September 2012. No additional monitoring will be conducted.

Site study plan for borehole search and characterization, Deaf Smith County Site, Texas: Revision 1

International Nuclear Information System (INIS)

1987-01-01

This site study plan describes the Borehole Search and Characterization field activities to be conducted during the early stages of Site Characterization at the Deaf Smith County site, Texas. The field program has been designed to provide data useful in addressing information/data needs resulting from Federal/State/Local regulatory requirements and repository program requirements. Air and ground surveys, an extensive literature search, and landowner interviews will be conducted to locate wells within and adjacent to the proposed nuclear waste repository site in Deaf Smith County. Initially, the study will center around the planned Exploratory Shaft Facilities location and will expand outward from that location. Findings from this study may lead to preparation of a new site study plan to search suspected borehole locations, and excavate or reenter known boreholes for additional characterization or remedial action. The Salt Repository Project (SRP) Networks specify the schedule under which the program will operate. The Technical Field Services Contractor (TFSC) is responsible for conducting the field program. Data will be handled and reported in accordance with established SRP procedures. A quality assurance program will be utilized to assure that activities affecting quality are performed correctly and that appropriate documentation is maintained. 13 refs., 6 figs., 3 tabs

Location of a new ice core site at Talos Dome (East Antarctica

Directory of Open Access Journals (Sweden)

I. Tabacco

2006-06-01

Full Text Available In the frame of glaciology and palaeoclimate research, Talos Dome (72°48lS; 159°06lE, an ice dome on the East Antarctic plateau, represents the new selected site for a new deep ice core drilling. The increasing interest in this region is due to the fact that the ice accumulation is higher here than in other domes in East Antarctica. A new deep drilling in this site could give important information about the climate changes near the coast. Previous papers showed that the dome summit is situated above a sloped bedrock. A new position on a relatively flat bedrock 5-6 km far from here in the SE direction was defined as a possible new ice core site for an European (Italy, France, Swiss and United Kingdom drilling project named as TALDICE (TALos Dome Ice Core Project. This point, named as ID1 (159°11l00mE; 72°49l40mS, became the centre of the Radio Echo Sounding (RES flight plan during the 2003 Italian Antarctic expedition, with the aim of confirming the new drilling site choice. In this paper 2001 and 2003 RES data sets have been used to draw a better resolution of ice thickness, bottom morphology and internal layering of a restricted area around the dome. Based on the final results, point ID1 has been confirmed as the new coring site. Finally, the preliminary operations about the installation of the summer ice core camp (TALDICE at ID1 site carried out during the XX Italian Antarctic expedition (November 2004-December 2005 are briefly described.

Multiple phosphorylation sites at the C-terminus regulate nuclear import of HCMV DNA polymerase processivity factor ppUL44

International Nuclear Information System (INIS)

Alvisi, Gualtiero; Marin, Oriano; Pari, Gregory; Mancini, Manuela; Avanzi, Simone; Loregian, Arianna; Jans, David A.; Ripalti, Alessandro

2011-01-01

The processivity factor of human cytomegalovirus DNA polymerase, phosphoprotein ppUL44, is essential for viral replication. During viral infection ppUL44 is phosphorylated by the viral kinase pUL97, but neither the target residues on ppUL44 nor the effect of phosphorylation on ppUL44's activity are known. We report here that ppUL44 is phosphorylated when transiently expressed in mammalian cells and coimmunoprecipitates with cellular kinases. Of three potential phosphorylation sites (S413, S415, S418) located upstream of ppUL44's nuclear localization signal (NLS) and one (T427) within the NLS itself, protein kinase CK2 (CK2) specifically phosphorylates S413, to trigger a cascade of phosphorylation of S418 and S415 by CK1 and CK2, respectively. Negative charge at the CK2/CK1 target serine residues facilitates optimal nuclear accumulation of ppUL44, whereas negative charge on T427, a potential cyclin-dependent 1 phosphorylation site, strongly decreases nuclear accumulation. Thus, nuclear transport of ppUL44 is finely tuned during viral infection through complex phosphorylation events.

Examining differences in types and location of recruitment venues for young males and females from urban neighborhoods: findings from a multi-site HIV prevention study.

Science.gov (United States)

Chutuape, Kate S; Ziff, Mauri; Auerswald, Colette; Castillo, Marné; McFadden, Antionette; Ellen, Jonathan

2009-01-01

Finding and accessing members of youth subpopulations, such as young men who have sex with men (YMSM) of color or young females of color, for behavioral or disease surveillance or study recruitment, pose particular challenges. Venue-based sampling strategies--which hinge on where individuals congregate or "hang out" rather than where they live--appear to be effective alternatives. Methods used to identify venues focus on engaging members of social networks to learn where targeted populations congregate. However, it is not always clear if and how these methods differ according to gender, whether the youth accessed at a venue are actually from neighborhoods in which the venues are found, and whether the location of venues relative to neighborhoods of residence is different for young men and young women. This study illustrates the gender differences in venue type and venue location where eligible youth study participants from high-risk neighborhoods could be accessed for HIV research across 15 research sites (sites). The findings indicate that the study's method led to identifying venues where one quarter or more of the youth were eligible study participants and from the high-risk neighborhoods. Sites targeting young women of color had a higher proportion of eligible study participants who were also from the high-risk neighborhoods than sites targeting YMSM. Clubs were most commonly identified by sites targeting YMSM as recruitment venues, whereas neighborhood-based service or commercial centers were more common venues for young women of color. This study reveals how venue-based recruitment strategies can be tailored and resources maximized by understanding the key differences in the types of venues preferred by males and females and by recognizing that female-preferred venues are more likely to be closer to home.

DEVELOPMENT OF A VIRTUAL INTELLIGENCE TECHNIQUE FOR THE UPSTREAM OIL INDUSTRY

Energy Technology Data Exchange (ETDEWEB)

Iraj A. Salehi; Shahab D. Mohaghegh; Samuel Ameri

2004-09-01

The objective of the research and development work reported in this document was to develop a Virtual Intelligence Technique for optimization of the Preferred Upstream Management Practices (PUMP) for the upstream oil industry. The work included the development of a software tool for identification and optimization of the most influential parameters in upstream common practices as well as geological, geophysical and reservoir engineering studies. The work was performed in cooperation with three independent producing companies--Newfield Exploration, Chesapeake Energy, and Triad Energy--operating in the Golden Trend, Oklahoma. In order to protect data confidentiality, these companies are referred to as Company One, Two, Three in a randomly selected order. These producing companies provided geological, completion, and production data on 320 wells and participated in frequent technical discussions throughout the project. Research and development work was performed by Gas Technology Institute (GTI), West Virginia University (WVU), and Intelligent Solutions Inc. (ISI). Oklahoma Independent Petroleum Association (OIPA) participated in technology transfer and data acquisition efforts. Deliverables from the project are the present final report and a user-friendly software package (Appendix D) with two distinct functions: a characterization tool that identifies the most influential parameters in the upstream operations, and an optimization tool that seeks optimization by varying a number of influential parameters and investigating the coupled effects of these variations. The electronic version of this report is also included in Appendix D. The Golden Trend data were used for the first cut optimization of completion procedures. In the subsequent step, results from soft computing runs were used as the guide for detailed geophysical and reservoir engineering studies that characterize the cause-and-effect relationships between various parameters. The general workflow and the main

Genome-Wide Search for Translated Upstream Open Reading Frames in Arabidopsis Thaliana.

Science.gov (United States)

Hu, Qiwen; Merchante, Catharina; Stepanova, Anna N; Alonso, Jose M; Heber, Steffen

2016-03-01

Upstream open reading frames (uORFs) are open reading frames that occur within the 5' UTR of an mRNA. uORFs have been found in many organisms. They play an important role in gene regulation, cell development, and in various metabolic processes. It is believed that translated uORFs reduce the translational efficiency of the main coding region. However, only few uORFs are experimentally characterized. In this paper, we use ribosome footprinting together with a semi-supervised approach based on stacking classification models to identify translated uORFs in Arabidopsis thaliana. Our approach identified 5360 potentially translated uORFs in 2051 genes. GO terms enriched in genes with translated uORFs include catalytic activity, binding, transferase activity, phosphotransferase activity, kinase activity, and transcription regulator activity. The reported uORFs occur with a higher frequency in multi-isoform genes, and some uORFs are affected by alternative transcript start sites or alternative splicing events. Association rule mining revealed sequence features associated with the translation status of the uORFs. We hypothesize that uORF translation is a complex process that might be regulated by multiple factors. The identified uORFs are available online at:https://www.dropbox.com/sh/zdutupedxafhly8/AABFsdNR5zDfiozB7B4igFcja?dl=0. This paper is the extended version of our research presented at ISBRA 2015.

Independents in European Gas Markets after liberalisation - downstream integration of upstream oil and gas companies

International Nuclear Information System (INIS)

Eikeland, Per Ove

2005-01-01

A central objective of gas market liberalisation in Europe in the 1990s was to increase competition by opening end-use markets for independent suppliers. Upstream oil and gas companies in Europe reacted to this opportunity by announcing strategies to integrate forward in European gas markets. By late 2004, however, upstream companies still recorded generally weak downstream strategy implementation in Europe. The article concludes that this general implementation gap should be explained by political failure in EU member states to abolish gas market barriers to entry for independents. Variation between companies in degree of implementation should be explained by variation in conditions in the companies' home markets / wider business spheres and internal company factors. (Author)

Environmental characterization of two potential locations at Hanford for a new production reactor

Energy Technology Data Exchange (ETDEWEB)

Watson, E.C.; Becker, C.D.; Fitzner, R.E.; Gano, K.A.; Imhoff, K.L.; McCallum, R.F.; Myers, D.A.; Page, T.L.; Price, K.R.; Ramsdell, J.V.; Rice D.G.; Schreiber D.L.; Skumatz L.A.; Sommer D.J.; Tawil J.J.; Wallace R.W.; Watson D.G.

1984-09-01

This report describes various environmental aspects of two areas on the Hanford Site that are potential locations for a New Production Reactor (NPR). The area known as the Skagit Hanford Site is considered the primary or reference site. The second area, termed the Firehouse Site, is considered the alternate site. The report encompasses an environmental characterization of these two potential NPR locations. Eight subject areas are covered: geography and demography; ecology; meteorology; hydrology; geology; cultural resources assessment; economic and social effects of station construction and operation; and environmental monitoring. 80 refs., 68 figs., 109 tabs.

Identification of sites within the Palo Duro Basin. Volume 1. Palo Duro Location A

International Nuclear Information System (INIS)

1984-11-01

This three-volume document narrows to two sites for continued investigations for potential nuclear waste repository sites in the Palo Duro Basin of the Texas Panhandle. Volume 1 narrows a site previously identified in Deaf Smith County, Texas; Volume 2 narrows a site previously identified in Swisher County, Texas; and Volume 3 contains responses to comments received regarding the drafts of Volumes 1 and 2 (BMI/ONWI-531). These volumes discuss the methodology and logic used as well as the results that narrowed these sites. Each of the 10 site performance criteria was divided into descriptors related to site performance characteristics. Each descriptor was evaluated by a systematic logic to determine if it could be used as a discriminator. Then more- and less-preferred areas for groups of discriminators were defined and composite maps were prepared and evaluated to identify the sites

Identification of sites within the Palo Duro Basin. Volume 2. Palo Duro Location B

International Nuclear Information System (INIS)

1984-11-01

This three-volume document narrows to two sites for continued investigations for potential nuclear waste repository sites in the Palo Duro Basin of the Texas Panhandle. Volume 1 narrows a site previously identified in Deaf Smith County, Texas; Volume 2 narrows a site previously identified in Swisher County, Texas; and Volume 3 contains responses to comments received regarding the drafts of Volumes 1 and 2 (BMI/ONWI-531). These volumes discuss the methodology and logic used as well as the results that narrowed these sites. Each of the 10 site performance criteria was divided into descriptors related to site performance characteristics. Each descriptor was evaluated by a systematic logic to determine if it could be used as a discriminator. Then more- and less-preferred areas for groups of discriminators were defined and composite maps were prepared and evaluated to identify the sites

Performance of upstream interaction region detectors for the FIRST experiment at GSI

CERN Document Server

Abou-Haidar, Z; Alvarez, M A G; Anelli, M; Aumann, T; Battistoni, G; Bocci, A; Bohlen, T T; Boudard, A; Brunetti, A; Carpinelli, M; Cirrone, G A P; Cortes-Giraldo, M A; Cuttone, G; De Napoli, M; Durante, M; Fernandez-Garcia, J P; Finck, C; Gallardo, M I; Golosio, B; Iarocci, E; Iazzi, F; Ickert, G; Introzzi, R; Juliani, D; Krimmer, J; Kurz, N; Labalme, M; Leifels, Y; Le Fevre, A; Leray, S; Marchetto, F; Monaco, V; Morone, M C; Oliva, P; Paoloni, A; Patera, V; Piersanti, L; Pleskac, R; Quesada, J M; Randazzo, N; Romano, F; Rossi, D; Rosso, V; Rousseau, M; Sacchi, R; Sala, P; Sarti, A; Schuy, C; Sciubba, A; Sfienti, C; Simon, H; Sipala, V; Spiriti, E; Stuttge, L; Tropea, S; Younis, H

2012-01-01

The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at GSI has been designed to study carbon fragmentation, measuring (12)C double differential cross sections (- (2)I /- - E) for different beam energies between 100 and 1000 MeV/u. The experimental setup integrates newly designed detectors in the, so called, Interaction Region around the graphite target. The Interaction Region upstream detectors are a 250 mum thick scintillator and a drift chamber optimized for a precise measurement of the ions interaction time and position on the target. In this article we review the design of the upstream detectors along with the preliminary results of the data taking performed on August 2011 with 400 MeV/u fully stripped carbon ion beam at GSI. Detectors performances will be reviewed and compared to those obtained during preliminary tests, performed with 500 MeV electrons (at the BTF facility in the INFN Frascati Laboratories) and 80 MeV/u protons and carbon ions (at the INFN LNS Laboratories in Cata...

A C-terminal, cysteine-rich site in poliovirus 2C(ATPase) is required for morphogenesis.

Science.gov (United States)

Wang, Chunling; Ma, Hsin-Chieh; Wimmer, Eckard; Jiang, Ping; Paul, Aniko V

2014-06-01

The morphogenesis of viruses belonging to the genus Enterovirus in the family Picornaviridae is still poorly understood despite decades-long investigations. However, we recently provided evidence that 2C(ATPase) gives specificity to poliovirus encapsidation through an interaction with capsid protein VP3. The polypeptide 2C(ATPase) is a highly conserved non-structural protein of enteroviruses with important roles in RNA replication, encapsidation and uncoating. We have identified a site (K279/R280) near the C terminus of the polypeptide that is required for morphogenesis. The aim of the current project was to search for additional functional sites near the C terminus of the 2C(ATPase) polypeptide, with particular interest in those that are required for encapsidation. We selected for analysis a cysteine-rich site of the polypeptide and constructed four mutants in which cysteines or a histidine was changed to an alanine. The RNA transcripts were transfected into HeLa cells yielding two lethal, one temperature-sensitive and one quasi-infectious mutants. All four mutants exhibited normal protein translation in vitro and three of them possessed severe RNA replication defects. The quasi-infectious mutant (C286A) yielded variants with a pseudo-reversion at the original site (A286D), but some also contained one additional mutation: A138V or M293V. The temperature-sensitive mutant (C272A/H273A) exhibited an encapsidation and possibly also an uncoating defect at 37 °C. Variants of this mutant revealed suppressor mutations at three different sites in the 2C(ATPase) polypeptide: A138V, M293V and K295R. We concluded that the cysteine-rich site near the C terminus of 2C(ATPase) is involved in encapsidation, possibly through an interaction with an upstream segment located between boxes A and B of the nucleotide-binding domain. © 2014 The Authors.

Coal Mines, Reclamation Sites - Mine Drainage Treatment/Land Recycling Project Locations

Data.gov (United States)

NSGIC Education | GIS Inventory — Mine Drainage Treatment/Land Reclamation Locations are clean-up projects that are working to eliminate some form of abandoned mine. The following sub-facility types...

Site decontamination

International Nuclear Information System (INIS)

Bicker, A.E.

1981-01-01

Among the several DOE sites that have been radiologically decontaminated under the auspices of the Nevada Operations Office are three whose physical characteristics are unique. These are the Tatum Dome Test Site (TDTS) near Hattiesburg, Mississippi; a location of mountainous terrain (Pahute Mesa) on the Nevada Test Site; and the GNOME site near Carlsbad, New Mexico. In each case the contamination, the terrain, and the climate conditions were different. This presentation includes a brief description of each site, the methods used to perform radiological surveys, the logistics required to support the decontamination (including health physics and sample analysis), and the specific techniques used to reduce or remove the contamination

Locating techniques for nuclear power stations

International Nuclear Information System (INIS)

Hayashi, Masao

1983-01-01

The basic thought in locating nuclear power stations is to examine carefully the suitability of sites and the safety of plants, and in the end, to perfect the safety of public. In Japan, effort is exerted to obtain the trust of local people by carrying out investigation, research and examination from respective standpoints of the government, institutes and industries. The author has engaged in the standardization of the investigation, test and analysis regarding the aseismatic capability of ground, the verifying project in Tadotsu of the coupled vibration of ground and structures, the evaluation of the performance of large vibration tables, the future concept of new locating procedure and so on in the last more than ten years. The technological classification of ground, the technological meaning of active faults, the procedure of the aseismatic design of plants, the difference of earthquake input force according to various locating methods, 12 rules regarding the attenuation of vibration of ground, and the concept of new locating method in the 21st century are explained. As the new locating techniques applicable to central Japan, diluvial ground location, floating location in tunnels, underground location, offshore location and so on must be promoted. (Kako, I.)

Occurence of antibiotic compounds found in the water column and bottom sediments from a stream receiving two waste water treatment plant effluents in northern New Jersey, 2008

Science.gov (United States)

Gibs, Jacob; Heckathorn, Heather A.; Meyer, Michael T.; Klapinski, Frank R.; Alebus, Marzooq; Lippincott, Robert

2013-01-01

An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin-H2O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin, and

Influence of upstream stator on rotor flutter stability in a low pressure steam turbine stage

Energy Technology Data Exchange (ETDEWEB)

Huang, X.; He, L. [University of Durham (United Kingdom). School of Engineering; Bell, D. [ALSTOM Power Ltd., Rugby (United Kingdom)

2006-07-01

Conventional blade flutter prediction is normally based on an isolated blade row model, however, little is known about the influence of adjacent blade rows. In this article, an investigation is presented into the influence of the upstream stator row on the aero-elastic stability of rotor blades in the last stage of a low pressure (LP) steam turbine. The influence of the upstream blade row is computed directly by a time-marching, unsteady, Navier-Stokes flow solver in a stator-rotor coupled computational domain. The three-dimensional flutter solution is obtained, with adequate mesh resolution, in a single passage domain through application of the Fourier-Transform based Shape-Correction method. The capability of this single-passage method is examined through comparison with predictions obtained from a complete annulus model, and the results demonstrate a good level of accuracy, while achieving a speed up factor of 25. The present work shows that the upstream stator blade row can significantly change the aero-elastic behaviour of an LP steam turbine rotor. Caution is, therefore, advised when using an isolated blade row model for blade flutter prediction. The results presented also indicated that the intra-row interaction is of a strong three-dimensional nature. (author)

Remaining Sites Verification Package for the 128-B-3 Burn Pit Site, Waste Site Reclassification Form 2006-058

Energy Technology Data Exchange (ETDEWEB)

L. M. Dittmer

2006-11-17

The 128-B-3 waste site is a former burn and disposal site for the 100-B/C Area, located adjacent to the Columbia River. The 128-B-3 waste site has been remediated to meet the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling demonstrated that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results of sampling at upland areas of the site also showed that residual contaminant concentrations are protective of groundwater and the Columbia River.

Upstream Structural Management Measures for an Urban Area Flooding in Turkey and their Consequences on Flood Risk Management

Science.gov (United States)

Akyurek, Z.; Bozoglu, B.; Girayhan, T.

2015-12-01

Flooding has the potential to cause significant impacts to economic activities as well as to disrupt or displace populations. Changing climate regimes such as extreme precipitation events increase flood vulnerability and put additional stresses on infrastructure. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is done. MIKE21 with flexible grid is used in 2- dimensional shallow water flow modelling. 1/1000 scaled maps with the buildings for the urbanized area and 1/5000 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of Q5 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The effects of the available structures like bridges across the river on the flooding are presented. The upstream structural measures are studied on scenario basis. Four sub-catchments of Terme River are considered as contributing the downstream flooding. The existing circumstance of the Terme River states that the meanders of the river have a major effect on the flood situation and lead to approximately 35% reduction in the peak discharge between upstream and downstream of the river. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in at least two of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed. Flood risk is obtained by using the flood hazard maps and water depth-damage functions plotted for a variety of building types and occupancies

Telemetry location error in a forested habitat

Science.gov (United States)

Chu, D.S.; Hoover, B.A.; Fuller, M.R.; Geissler, P.H.; Amlaner, Charles J.

1989-01-01

The error associated with locations estimated by radio-telemetry triangulation can be large and variable in a hardwood forest. We assessed the magnitude and cause of telemetry location errors in a mature hardwood forest by using a 4-element Yagi antenna and compass bearings toward four transmitters, from 21 receiving sites. The distance error from the azimuth intersection to known transmitter locations ranged from 0 to 9251 meters. Ninety-five percent of the estimated locations were within 16 to 1963 meters, and 50% were within 99 to 416 meters of actual locations. Angles with 20o of parallel had larger distance errors than other angles. While angle appeared most important, greater distances and the amount of vegetation between receivers and transmitters also contributed to distance error.

Systematic data ingratiation of clinical trial recruitment locations for geographic-based query and visualization.

Science.gov (United States)

Luo, Jake; Chen, Weiheng; Wu, Min; Weng, Chunhua

2017-12-01

Prior studies of clinical trial planning indicate that it is crucial to search and screen recruitment sites before starting to enroll participants. However, currently there is no systematic method developed to support clinical investigators to search candidate recruitment sites according to their interested clinical trial factors. In this study, we aim at developing a new approach to integrating the location data of over one million heterogeneous recruitment sites that are stored in clinical trial documents. The integrated recruitment location data can be searched and visualized using a map-based information retrieval method. The method enables systematic search and analysis of recruitment sites across a large amount of clinical trials. The location data of more than 1.4 million recruitment sites of over 183,000 clinical trials was normalized and integrated using a geocoding method. The integrated data can be used to support geographic information retrieval of recruitment sites. Additionally, the information of over 6000 clinical trial target disease conditions and close to 4000 interventions was also integrated into the system and linked to the recruitment locations. Such data integration enabled the construction of a novel map-based query system. The system will allow clinical investigators to search and visualize candidate recruitment sites for clinical trials based on target conditions and interventions. The evaluation results showed that the coverage of the geographic location mapping for the 1.4 million recruitment sites was 99.8%. The evaluation of 200 randomly retrieved recruitment sites showed that the correctness of geographic information mapping was 96.5%. The recruitment intensities of the top 30 countries were also retrieved and analyzed. The data analysis results indicated that the recruitment intensity varied significantly across different countries and geographic areas. This study contributed a new data processing framework to extract and integrate

Systematic data ingratiation of clinical trial recruitment locations for geographic-based query and visualization

Science.gov (United States)

Luo, Jake; Chen, Weiheng; Wu, Min; Weng, Chunhua

2018-01-01

Background Prior studies of clinical trial planning indicate that it is crucial to search and screen recruitment sites before starting to enroll participants. However, currently there is no systematic method developed to support clinical investigators to search candidate recruitment sites according to their interested clinical trial factors. Objective In this study, we aim at developing a new approach to integrating the location data of over one million heterogeneous recruitment sites that are stored in clinical trial documents. The integrated recruitment location data can be searched and visualized using a map-based information retrieval method. The method enables systematic search and analysis of recruitment sites across a large amount of clinical trials. Methods The location data of more than 1.4 million recruitment sites of over 183,000 clinical trials was normalized and integrated using a geocoding method. The integrated data can be used to support geographic information retrieval of recruitment sites. Additionally, the information of over 6000 clinical trial target disease conditions and close to 4000 interventions was also integrated into the system and linked to the recruitment locations. Such data integration enabled the construction of a novel map-based query system. The system will allow clinical investigators to search and visualize candidate recruitment sites for clinical trials based on target conditions and interventions. Results The evaluation results showed that the coverage of the geographic location mapping for the 1.4 million recruitment sites was 99.8%. The evaluation of 200 randomly retrieved recruitment sites showed that the correctness of geographic information mapping was 96.5%. The recruitment intensities of the top 30 countries were also retrieved and analyzed. The data analysis results indicated that the recruitment intensity varied significantly across different countries and geographic areas. Conclusion This study contributed a new

Summary of investigations carried out prior to 19 October 1984 regarding the location of the Vaalputs radioactive waste disposal site for the burial of intermediate and low-level waste

International Nuclear Information System (INIS)

Hambleton-Jones, B.B.

1984-10-01

A recommendation by a specialist study group that the State set in motion a program to locate a suitable site or sites for the storage/disposal of radioactive waste in South Africa was accepted in 1978. A site-selection program was therefore duly initiated and in February 1983 culminated in the purchase of three farms, Garing, Geelpan and Stofkloof, some 100 km south-southeast of the town of Springbok in the northwestern Cape. The site, known as Vaalputs, is about 10 000 ha in extent. Detailed geological, geophysical, geohydrological, geobotanical, geomorphological and environmental investigations have been completed, with emphasis on the Geelpan Block, previously recommended as being the most suitable area for a disposal site. The final site of 0,5 X 0,7 km has now been selected

Evaluation of wind potential for an optimum choice of wind turbine generator on the sites of Lomé, Accra, and Cotonou located in the gulf of Guinea

Directory of Open Access Journals (Sweden)

Akim Adekunlé SALAMI

2016-11-01

Full Text Available This work presents the characterization and assessment of wind energy potential in annual and monthly levels of the sites of Lomé, Accra and Cotonou located in the Gulf of Guinea, and the optimal characteristics of wind turbines to be installed on these sites. Studies of characterization and the wind potential of these sites from the wind speed data collected over a period of thirteen years at a height of 10 meters above the ground, show an annual average speed of 3.52 m/s for Lomé, 3.99 m/s for Cotonou and 4.16 m/s for Accra. These studies also showed that a monthly average speed exceeding 4 m/s was observed on the sites of Cotonou and Accra during the months of February, March, April, July, August and September and during the months of July, August and September on the site of Lomé. After a series of simulation conducted using the software named PotEol that we have developed in Scilab, we have retained that the wind turbines rated speeds of ~8 to 9 m/s at the sites of Lomé and Cotonou and ~ 9 to 10 m/s on the site of Accra would be the most appropriate speeds for optimal exploitation of electric energy from wind farms at a height of 50 m above the ground. Article History: Received May 26th 2016; Received in revised form August 24th 2016; Accepted August 30th 2016; Available online How to Cite This Article: Salami, A.A., Ajavon, A.S.A , Kodjo, M.K. and Bédja, K. (2016 Evaluation of Wind Potential for an Optimum Choice of Wind Turbine Generator on the Sites of Lomé, Accra, and Cotonou Located in the Gulf of Guinea. Int. Journal of Renewable Energy Development, 5(3, 211-223. http://dx.doi.org/10.14710/ijred.5.3.211-223

Influence of upstream disturbance on the draft-tube flow of Francis turbine under part-load conditions

Science.gov (United States)

Chen, Ting; Zheng, Xianghao; Zhang, Yu-ning; Li, Shengcai

2018-02-01

Owing to the part-load operations for the enhancement of grid flexibility, the Francis turbine often suffers from severe low-frequency and large-amplitude hydraulic instability, which is mostly pertinent to the highly unsteady swirling vortex rope in the draft tube. The influence of disturbances in the upstream (e.g., large-scale vortex structures in the spiral casing) on the draft-tube vortex flow is not well understood yet. In the present paper, the influence of the upstream disturbances on the vortical flow in the draft tube is studied based on the vortex identification method and the analysis of several important parameters (e.g., the swirl number and the velocity profile). For a small guide vane opening (representing the part-load condition), the vortices triggered in the spiral casing propagate downstream and significantly affect the swirling vortex-rope precession in the draft tube, leading to the changes of the intensity and the processional frequency of the swirling vortex rope. When the guide vane opening approaches the optimum one (representing the full-load condition), the upstream disturbance becomes weaker and thus its influences on the downstream flow are very limited.

Numerical Analyses of Earthquake Induced Liquefaction and Deformation Behaviour of an Upstream Tailings Dam

Directory of Open Access Journals (Sweden)

Muhammad Auchar Zardari

2017-01-01

Full Text Available Much of the seismic activity of northern Sweden consists of micro-earthquakes occurring near postglacial faults. However, larger magnitude earthquakes do occur in Sweden, and earthquake statistics indicate that a magnitude 5 event is likely to occur once every century. This paper presents dynamic analyses of the effects of larger earthquakes on an upstream tailings dam at the Aitik copper mine in northern Sweden. The analyses were performed to evaluate the potential for liquefaction and to assess stability of the dam under two specific earthquakes: a commonly occurring magnitude 3.6 event and a more extreme earthquake of magnitude 5.8. The dynamic analyses were carried out with the finite element program PLAXIS using a recently implemented constitutive model called UBCSAND. The results indicate that the magnitude 5.8 earthquake would likely induce liquefaction in a limited zone located below the ground surface near the embankment dikes. It is interpreted that stability of the dam may not be affected due to the limited extent of the liquefied zone. Both types of earthquakes are predicted to induce tolerable magnitudes of displacements. The results of the postseismic slope stability analysis, performed for a state after a seismic event, suggest that the dam is stable during both the earthquakes.

SAP and life-cycle management in the upstream

International Nuclear Information System (INIS)

Davis, B.

1997-01-01

Business relationships today depend more than ever on changing alliances and partnerships to leverage risk in a commodity market. SAP is a fully integrated, enterprise-wide software system that uses business processes tightly integrated around a common data model to facilitate these business relationships across the oil and gas supply chain. The SAP modules contain the business processes that are needed to handle the logistics and operations maintenance for operating an oil or gas field. Each industry has unique business-process requirements that the core SAP application set may not cover. In the oil and gas business, there are unique financial requirements in the upstream for working in joint ventures. In the downstream business segment, handling bulk hydrocarbons requires additional functionality

Contribution of the Surface and Down-Hole Seismic Networks to the Location of Earthquakes at the Soultz-sous-Forêts Geothermal Site (France)

Science.gov (United States)

Kinnaert, X.; Gaucher, E.; Kohl, T.; Achauer, U.

2018-03-01

Seismicity induced in geo-reservoirs can be a valuable observation to image fractured reservoirs, to characterize hydrological properties, or to mitigate seismic hazard. However, this requires accurate location of the seismicity, which is nowadays an important seismological task in reservoir engineering. The earthquake location (determination of the hypocentres) depends on the model used to represent the medium in which the seismic waves propagate and on the seismic monitoring network. In this work, location uncertainties and location inaccuracies are modeled to investigate the impact of several parameters on the determination of the hypocentres: the picking uncertainty, the numerical precision of picked arrival times, a velocity perturbation and the seismic network configuration. The method is applied to the geothermal site of Soultz-sous-Forêts, which is located in the Upper Rhine Graben (France) and which was subject to detailed scientific investigations. We focus on a massive water injection performed in the year 2000 to enhance the productivity of the well GPK2 in the granitic basement, at approximately 5 km depth, and which induced more than 7000 earthquakes recorded by down-hole and surface seismic networks. We compare the location errors obtained from the joint or the separate use of the down-hole and surface networks. Besides the quantification of location uncertainties caused by picking uncertainties, the impact of the numerical precision of the picked arrival times as provided in a reference catalogue is investigated. The velocity model is also modified to mimic possible effects of a massive water injection and to evaluate its impact on earthquake hypocentres. It is shown that the use of the down-hole network in addition to the surface network provides smaller location uncertainties but can also lead to larger inaccuracies. Hence, location uncertainties would not be well representative of the location errors and interpretation of the seismicity

The disposal of Canada's nuclear fuel waste: site screening and site evaluation technology

International Nuclear Information System (INIS)

Davison, C.C.; Brown, A.; Everitt, R.A.; Gascoyne, M.; Kozak, E.T.; Lodha, G.S.; Martin, C.D.; Soonawala, N.M.; Stevenson, D.R.; Thorne, G.A.; Whitaker, S.H.

1994-06-01

The concept for the disposal of Canada's nuclear fuel waste is to dispose of the waste in an underground vault, nominally at 500 m to 1000 m depth, at a suitable site in plutonic rock of the Canadian Shield. The feasibility of this concept and assessments of its impact on the environment and human health, will be documented by AECL in an Environmental Impact Statement (EIS). This report is one of nine primary references for the EIS. It describes the approach and methods that would be used during the siting stage of the disposal project to identify a preferred candidate disposal site and to confirm its suitability for constructing a disposal facility. The siting stage is divided into two distinct but closely related substages, site screening and site evaluation. Site screening would mainly involve reconnaissance investigations of siting regions of the Shield to identify potential candidate areas where suitable vault locations are likely to exist. Site screening would identify a small number of candidate areas where further detailed investigations were warranted. Site evaluation would involve progressively more detailed surface and subsurface investigations of the candidate areas to first identify potentially suitable vault locations within the candidate areas, and then characterize these potential disposal sites to identify the preferred candidate location for constructing the disposal vault. Site evaluation would conclude with the construction of exploratory shafts and tunnels at the preferred vault location, and underground characterization would be done to confirm the suitability of the preferred candidate site. An integrated program of geological, geophysical, hydrogeological, geochemical and geomechanical investigations would be implemented to obtain the geoscience information needed to assess the suitability of the candidate siting areas and candidate sites for locating a disposal vault. The candidate siting areas and candidate disposal vault sites would be

Analysis of local symmetry and impurity location of Cu2+ ions doped C8H11KO8 single crystal through EPR technique for site I

Science.gov (United States)

Sheela, K. Juliet; Subbulakshmi, N.; Subramanian, P.

2018-04-01

Electron paramagnetic resonance (EPR) studies have been investigated on Cu2+ ion incorporated into the single crystals of potassium succinate-succinic acid (KSSA) at room temperature. Two magnetically in-equivalent Cu2+ sites in the lattice are identified, among them site I has been reported. The spin Hamiltonian parameters are determined with the fitting of spectra to rhombic symmetry crystalline field. The co-ordination of the Cu2+ ion in this molecule is a distorted dodecahedron. From the calculated gxx, gyy, gzz and Axx, Ayy, Azz and their directional cosines values, location of site I impurity ion Cu2+ could be identified as a substituitional one. Also the ground state wave function of the impurity ion was found to be d2z.

Final environmental impact statement for the Nevada test site and off-site locations in the State of Nevada. Public comment and response document, Volume 3, Part A comments

International Nuclear Information System (INIS)

1996-08-01

On February 2, 1996, the U.S. Department of Energy (DOE) issued the Draft Environmental Impact Statement for the Nevada Test Site and Off-Site Locations in the State of Nevada (NTS EIS) for review by the state of Nevada, Indian tribes, local governments, other federal agencies, groups and organizations, and the general public. The formal comment period lasted 90 days, ending May 3, 1996. As part of the comment process, the DOE held public hearings in St. George, Utah, and in Pahrump, Reno, and Las Vegas, Nevada. Community Workshops were held in Caliente, Tonopah, Boulder City, and North Las Vegas, Nevada, in conjunction with the University of Nevada Las Vegas to discuss the Draft NTS EIS. Volume 3 of the Final NTS EIS contains 3 chapters. Chapter 1 summarizes the major issues raised by the public. Chapter 2 contains the full text of the public comments on the Draft NTS EIS received by the DOE; it includes public hearing transcripts, written comments, and comments received via a toll-free comment open-quotes hot line.close quotes Chapter 3 contains the DOE's responses to the public comments and describes how the comments were considered in the Final NTS EIS

New records of marginal locations for American pika (Ochotona princeps) in the Western Great Basin

Science.gov (United States)

Constance I. Millar; Robert D. Westfall; Diane L. Delany

2013-01-01

We describe 46 new site records documenting occupancy by American pika (Ochotona princeps) at 21 locations from 8 mountain regions in the western Great Basin, California, and Nevada. These locations comprise a subset of sites selected from regional surveys to represent marginal, isolated, or otherwise atypical pika locations, and to provide...

LocateP: Genome-scale subcellular-location predictor for bacterial proteins

Directory of Open Access Journals (Sweden)

Zhou Miaomiao

2008-03-01

Full Text Available Abstract Background In the past decades, various protein subcellular-location (SCL predictors have been developed. Most of these predictors, like TMHMM 2.0, SignalP 3.0, PrediSi and Phobius, aim at the identification of one or a few SCLs, whereas others such as CELLO and Psortb.v.2.0 aim at a broader classification. Although these tools and pipelines can achieve a high precision in the accurate prediction of signal peptides and transmembrane helices, they have a much lower accuracy when other sequence characteristics are concerned. For instance, it proved notoriously difficult to identify the fate of proteins carrying a putative type I signal peptidase (SPIase cleavage site, as many of those proteins are retained in the cell membrane as N-terminally anchored membrane proteins. Moreover, most of the SCL classifiers are based on the classification of the Swiss-Prot database and consequently inherited the inconsistency of that SCL classification. As accurate and detailed SCL prediction on a genome scale is highly desired by experimental researchers, we decided to construct a new SCL prediction pipeline: LocateP. Results LocateP combines many of the existing high-precision SCL identifiers with our own newly developed identifiers for specific SCLs. The LocateP pipeline was designed such that it mimics protein targeting and secretion processes. It distinguishes 7 different SCLs within Gram-positive bacteria: intracellular, multi-transmembrane, N-terminally membrane anchored, C-terminally membrane anchored, lipid-anchored, LPxTG-type cell-wall anchored, and secreted/released proteins. Moreover, it distinguishes pathways for Sec- or Tat-dependent secretion and alternative secretion of bacteriocin-like proteins. The pipeline was tested on data sets extracted from literature, including experimental proteomics studies. The tests showed that LocateP performs as well as, or even slightly better than other SCL predictors for some locations and outperforms

5' diversity of human hepatic PXR (NR1I2) transcripts and identification of the major transcription initiation site.

Science.gov (United States)

Kurose, Kouichi; Koyano, Satoru; Ikeda, Shinobu; Tohkin, Masahiro; Hasegawa, Ryuichi; Sawada, Jun-Ichi

2005-05-01

The human pregnane X receptor (PXR) is a crucial regulator of the genes encoding several major cytochrome P450 enzymes and transporters, such as CYP3A4 and MDR1, but its own transcriptional regulation remains unclear. To elucidate the transcriptional mechanisms of human PXR gene, we first endeavored to identify the transcription initiation site of human PXR using 5'-RACE. Five types of 5'-variable transcripts (a, b, c, d, and e) with common exon 2 sequence were found, and comparison of these sequences with the genomic sequence suggested that their 5' diversity is derived from initiation by alternative promoters and alternative splicing. None of the exons found in our study contain any new in-frame coding regions. Newly identified introns IVS-a and IVS-b were found to have CT-AC splice sites that do not follow the GT-AG rule of conventional donor and acceptor splice sites. Of the five types of 5' variable transcripts identified, RT-PCR showed that type-a was the major transcript type. Four transcription initiation sites (A-D) for type-a transcript were identified by 5'-RACE using GeneRacer RACE Ready cDNA (human liver) constructed by the oligo-capping method. Putative TATA boxes were located approximately 30 bp upstream from the transcriptional start sites of the major transcript (C) and the longest minor transcript (A) expressed in the human liver. These results indicate that the initiation of transcription of human PXR is more complex than previously reported.

A barrier to upstream migration in the fish passage of Itaipu Dam (Canal da Piracema), Paraná River basin

Science.gov (United States)

,; Fontes Júnior, Hélio Martins; Makrakis, Sergio; Gomes, Luiz Carlos; Latini, João Dirço

2012-01-01

The majority of the fish passages built in the Neotropical region are characterised by low efficiency and high selectivity; in many cases, the benefits to fish populations are uncertain. Studies conducted in the Canal da Piracema at Itaipu dam on the Parana River indicate that the system component designated as the Discharge channel in the Bela Vista River (herein named Canal de deságue no rio Bela Vista or CABV), a 200 m long technical section, was the main barrier to the upstream migration. The aim of this study was to evaluate the degree of restriction imposed by the CABV on upstream movements of Prochilodus lineatus and Leporinus elongatus, Characiformes. Fish were tagged with passive integrated transponders (PIT tags) and released both downstream and upstream of this critical section. Individuals of both species released downstream of the CABV took much more time to reach the upper end of the system (43.6 days vs. 15.9 days), and passed in much lower proportions (18% vs. 60.8%) than those tagged upstream of this component. Although more work is needed to differentiate between fishway effects and natural variation in migratory motivation, the results clearly demonstrate passage problems at the CABV.

Remediation of the Wells G & H Superfund Site, Woburn, Massachusetts.

Science.gov (United States)

Bair, E Scott; Metheny, Maura A

2002-01-01

Remediation of ground water and soil contamination at the Wells G & H Superfund Site, Woburn, Massachusetts, uses technologies that reflect differences in hydrogeologic settings, concentrations of volatile organic compounds (VOCs), and costs of treatment. The poorly permeable glacial materials that overlie fractured bedrock at the W.R. Grace property necessitate use of closely spaced recovery wells. Contaminated ground water is treated with hydrogen peroxide and ultraviolet (UV) oxidation. At UniFirst, a deep well completed in fractured bedrock removes contaminated ground water, which is treated by hydrogen peroxide, UV oxidation, and granular activated carbon (GAC). The remediation system at Wildwood integrates air sparging, soil-vapor extraction, and ground water pumping. Air stripping and GAC are used to treat contaminated water; GAC is used to treat contaminated air. New England Plastics (NEP) uses air sparging and soil-vapor extraction to remove VOCs from the unsaturated zone and shallow ground water. Contaminated air and water are treated using separate GAC systems. After nine years of operation at W.R. Grace and UniFirst, 30 and 786 kg, respectively, of VOCs have been removed. In three years of operation, 866 kg of VOCs have been removed at Wildwood. In 15 months of operation, 36 kg of VOCs were removed at NEP. Characterization work continues at the Olympia Nominee Trust, Whitney Barrel, Murphy Waste Oil, and Aberjona Auto Parts properties. Risk assessments are being finalized that address heavy metals in the floodplain sediments along the Aberjona River that are mobilized from the Industri-Plex Superfund Site located a few miles upstream.

Prefrontal rTMS for treating depression: location and intensity results from the OPT-TMS multi-site clinical trial.

Science.gov (United States)

Johnson, Kevin A; Baig, Mirza; Ramsey, Dave; Lisanby, Sarah H; Avery, David; McDonald, William M; Li, Xingbao; Bernhardt, Elisabeth R; Haynor, David R; Holtzheimer, Paul E; Sackeim, Harold A; George, Mark S; Nahas, Ziad

2013-03-01

Motor cortex localization and motor threshold determination often guide Transcranial Magnetic Stimulation (TMS) placement and intensity settings for non-motor brain stimulation. However, anatomic variability results in variability of placement and effective intensity. Post-study analysis of the OPT-TMS Study reviewed both the final positioning and the effective intensity of stimulation (accounting for relative prefrontal scalp-cortex distances). We acquired MRI scans of 185 patients in a multi-site trial of left prefrontal TMS for depression. Scans had marked motor sites (localized with TMS) and marked prefrontal sites (5 cm anterior of motor cortex by the "5 cm rule"). Based on a visual determination made before the first treatment, TMS therapy occurred either at the 5 cm location or was adjusted 1 cm forward. Stimulation intensity was 120% of resting motor threshold. The "5 cm rule" would have placed stimulation in premotor cortex for 9% of patients, which was reduced to 4% with adjustments. We did not find a statistically significant effect of positioning on remission, but no patients with premotor stimulation achieved remission (0/7). Effective stimulation ranged from 93 to 156% of motor threshold, and no seizures were induced across this range. Patients experienced remission with effective stimulation intensity ranging from 93 to 146% of motor threshold, and we did not find a significant effect of effective intensity on remission. Our data indicates that individualized positioning methods are useful to reduce variability in placement. Stimulation at 120% of motor threshold, unadjusted for scalp-cortex distances, appears safe for a broad range of patients. Copyright © 2013 Elsevier Inc. All rights reserved.

Effects of a Guide Field on the Larmor Electric Field and Upstream Electron Temperature Anisotropy in Collisionless Asymmetric Magnetic Reconnection

Energy Technology Data Exchange (ETDEWEB)

Ek-In, Surapat; Ruffolo, David [Department of Physics, Faculty of Science, Mahidol University, Bangkok (Thailand); Malakit, Kittipat [Department of Physics, Faculty of Science and Techonology, Thammasat University, Pathum Thani (Thailand); Shay, Michael A. [Department of Physics and Astronomy, University of Delaware, Newark, DE (United States); Cassak, Paul A., E-mail: kmalakit@gmail.com [Department of Physics and Astronomy, West Virginia University, Morgantown, WV (United States)

2017-08-20

We perform the first study of the properties of the Larmor electric field (LEF) in collisionless asymmetric magnetic reconnection in the presence of an out-of-plane (guide) magnetic field for different sets of representative upstream parameters at Earth’s dayside magnetopause with an ion temperature greater than the electron temperature (the ion-to-electron temperature ratio fixed at 2) using two-dimensional particle-in-cell simulations. We show that the LEF does persist in the presence of a guide field. We study how the LEF thickness and strength change as a function of guide field and the magnetospheric temperature and reconnecting magnetic field strength. We find that the thickness of the LEF structure decreases, while its magnitude increases when a guide field is added to the reconnecting magnetic field. The added guide field makes the Larmor radius smaller, so the scaling with the magnetospheric ion Larmor radius is similar to that reported for the case without a guide field. Note, however, that the physics causing the LEF is not well understood, so future work in other parameter regimes is needed to fully predict the LEF for arbitrary conditions. We also find that a previously reported upstream electron temperature anisotropy arises in the vicinity of the LEF region both with and without a guide field. We argue that the generation of the anisotropy is linked to the existence of the LEF. The LEF can be used in combination with the electron temperature anisotropy as a signature to effectively identify dayside reconnection sites in observations.

Effects of a Guide Field on the Larmor Electric Field and Upstream Electron Temperature Anisotropy in Collisionless Asymmetric Magnetic Reconnection

International Nuclear Information System (INIS)

Ek-In, Surapat; Ruffolo, David; Malakit, Kittipat; Shay, Michael A.; Cassak, Paul A.

2017-01-01

We perform the first study of the properties of the Larmor electric field (LEF) in collisionless asymmetric magnetic reconnection in the presence of an out-of-plane (guide) magnetic field for different sets of representative upstream parameters at Earth’s dayside magnetopause with an ion temperature greater than the electron temperature (the ion-to-electron temperature ratio fixed at 2) using two-dimensional particle-in-cell simulations. We show that the LEF does persist in the presence of a guide field. We study how the LEF thickness and strength change as a function of guide field and the magnetospheric temperature and reconnecting magnetic field strength. We find that the thickness of the LEF structure decreases, while its magnitude increases when a guide field is added to the reconnecting magnetic field. The added guide field makes the Larmor radius smaller, so the scaling with the magnetospheric ion Larmor radius is similar to that reported for the case without a guide field. Note, however, that the physics causing the LEF is not well understood, so future work in other parameter regimes is needed to fully predict the LEF for arbitrary conditions. We also find that a previously reported upstream electron temperature anisotropy arises in the vicinity of the LEF region both with and without a guide field. We argue that the generation of the anisotropy is linked to the existence of the LEF. The LEF can be used in combination with the electron temperature anisotropy as a signature to effectively identify dayside reconnection sites in observations.

Demonstration of Eastman Christensen horizontal drilling system -- Integrated Demonstration Site, Savannah River Site

International Nuclear Information System (INIS)

1992-12-01

An innovative horizontal drilling system was used to install two horizontal wells as part of an integrated demonstration project at the Savannah River Site (SRS), Aiken, South Carolina. The SRS is located in south-central South Carolina in the upper Coastal Plain physiographic province. The demonstration site is located near the A/M Area, and is currently known as the Integated Demonstration Site. The Department of Energy's Office of Technology Development initiated an integrated demonstration of innovative technologies for cleanup of volatile organic compounds (VOCS) in soils and groundwater at the SRS in 1989. The overall goal of the program is to demonstrate, at a single location, multiple technologies in the fields of drilling, characterization, monitoring, and remediation. Innovative technologies are compared to one another and to baseline technologies in terms of technical performance and cost effectiveness. Transfer of successfully demonstrated technologies and systems to DOE environmental restoration organizations, to other government agencies, and to industry is a critical part of the program

Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

Science.gov (United States)

Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

1994-07-01

We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

Research on the resurrection evolution mechanism of Gendakan ancient landslide in the upstream on Lancang River, China

Science.gov (United States)

H, D.

2017-12-01

The Gendakan ancient landslide is located on the West bank of the upstream on Lancang River and about 4 km downstream from the Gushui hydropower station dam site. The ancient landslide is 850 m long and 700 m wide, the drill cores show that the maximum thickness of the landslide body is 107 m, with a mean thickness of approximately 80 m. Thus, the overall volume is about 3000×104m3. At present, the landslide has obvious deformation and failure signs, the leading edge is collapsing step by step. Once the landslide is unstable, it will affect the construction and operation of the Gushui hydropower station. In this paper, the development characteristics of the landslide accumulation body and the characteristics of the resurrection deformation are summarized in detail from the regional geological environment of the Gandakan landslide accumulation body. The three-dimensional geological model is established to analyze the stress and strain, displacement change and deformation failure characteristics and further evaluate its resurrection evolution trend , Combined with the developmental characteristics of the typical rock mass in the nearshore slope of the engineering area, analyzes the process of the resurrection and evolution of the rooted landslide accumulation. The FLAC-3D finite difference software was used to analyze the shear strain increment, displacement and plastic zone of the landslide accumulation body under natural conditions and rainfall conditions. The results show: the Gendakan landslide is stable in the natural state, and its deformation and failure are mainly caused by the tensile and shearing of the surface, under the rainfall condition, the local deformation and failure of the landslide accumulation body is obvious and the resurrection deformation Intensified. The resurrection evolutionary process of Gendakan ancient landslide includes three steps below. 1) The landslide body trailing edge creep cracking, leading edge shear deformation. 2) Sliding

Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.

Science.gov (United States)

1976-11-01

periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic

Geodetic monitoring (TLS of a steel transport trestle bridge located in an active mining exploitation site

Directory of Open Access Journals (Sweden)

Skoczylas Arkadiusz

2016-09-01

Full Text Available Underground mining exploitation causes, in general, irregular vertical and horizontal shifts in the superficial layer of the rock mass. In the case of construction objects seated on this layer, a deformation of the object’s foundation can be observed. This leads to additional loads and deformations. Identification of surface geometry changes in construction objects located within the premises of underground mining exploitation areas is an important task as far as safety of mining sites is concerned. Surveys targeting shifts and deformations in engineering objects preformed with the use of classic methods are of a selective nature and do not provide the full image of the phenomenon being the subject of the observation. This paper presents possibilities of terrestrial laser scanning technology application in the monitoring of engineering objects that allows for a complete spatial documentation of an object subjected to the influence of an active mining exploitation. This paper describes an observation of a 100 m section of a steel transport trestle bridge located on the premises of hard coal mine Lubelski Węgiel “Bogdanka” S.A. carried out in 2015. Measurements were carried out using a Z+F Imager 5010C scanner at an interval of 3.5 months. Changes in the structure’s geometry were determined by comparing the point clouds recorded during the two measurement periods. The results of the analyses showed shifts in the trestle bridge towards the exploited coal wall accompanied by object deformation. The obtained results indicate the possibility of of terrestrial laser scanning application in studying the aftereffects of underground mining exploitation on surface engineering objects.

A methodology for selection of wind energy system locations using multicriterial analysis

Energy Technology Data Exchange (ETDEWEB)

Sansevic, M.; Rabadan, Lj. Pilic [Croatia Univ., Faculty of Electrical Engineering, Mechanical Engineering and Naval Architecture, Split (Croatia)

1996-12-31

The effectiveness of a wind turbine generator depends not only on its performance but also on the site`s wind resource. Thus the problem of location selection should be approached systematically, by considering a set of relevant parameters particularly those having a significant economical and ecological impact. This paper presents the methodology used in location selection for the operation of wind energy system. It is based on a multicriterial analysis which enables comparison and ranking of locations according to a set of different parameters. Principal objectives (criteria) in location selection are: energy-economical, technical-technological, physical planning and environment and life protection objectives. For the mathematical modeling of this multicriterial problem the PROMETHEE method is chosen which is developed especially for the solution of rather ``poorly`` structured problems, thus justifying its application in the preliminary stage of site selection for the wind energy systems. The developed methodology is applied in selecting the locations in the island of Rhodes using the available database of the Geographic Information System and the wind potential data obtained by means of the AIOLOS program. (Author)

Iron-regulated transcription of the pvdA gene in Pseudomonas aeruginosa: effect of Fur and PvdS on promoter activity.

OpenAIRE

Leoni, L; Ciervo, A; Orsi, N; Visca, P

1996-01-01

The pvdA gene, encoding the enzyme L-ornithine N5-oxygenase, catalyzes a key step of the pyoverdin biosynthetic pathway in Pseudomonas aeruginosa. Expression studies with a promoter probe vector made it possible to identify three tightly iron-regulated promoter regions in the 5.9-kb DNA fragment upstream of pvdA. The promoter governing pvdA expression was located within the 154-bp sequence upstream of the pvdA translation start site. RNA analysis showed that expression of PvdA is iron regulat...

Genes involved in complex adaptive processes tend to have highly conserved upstream regions in mammalian genomes

Directory of Open Access Journals (Sweden)

Kohane Isaac

2005-11-01

Full Text Available Abstract Background Recent advances in genome sequencing suggest a remarkable conservation in gene content of mammalian organisms. The similarity in gene repertoire present in different organisms has increased interest in studying regulatory mechanisms of gene expression aimed at elucidating the differences in phenotypes. In particular, a proximal promoter region contains a large number of regulatory elements that control the expression of its downstream gene. Although many studies have focused on identification of these elements, a broader picture on the complexity of transcriptional regulation of different biological processes has not been addressed in mammals. The regulatory complexity may strongly correlate with gene function, as different evolutionary forces must act on the regulatory systems under different biological conditions. We investigate this hypothesis by comparing the conservation of promoters upstream of genes classified in different functional categories. Results By conducting a rank correlation analysis between functional annotation and upstream sequence alignment scores obtained by human-mouse and human-dog comparison, we found a significantly greater conservation of the upstream sequence of genes involved in development, cell communication, neural functions and signaling processes than those involved in more basic processes shared with unicellular organisms such as metabolism and ribosomal function. This observation persists after controlling for G+C content. Considering conservation as a functional signature, we hypothesize a higher density of cis-regulatory elements upstream of genes participating in complex and adaptive processes. Conclusion We identified a class of functions that are associated with either high or low promoter conservation in mammals. We detected a significant tendency that points to complex and adaptive processes were associated with higher promoter conservation, despite the fact that they have emerged

Duplication of an upstream silencer of FZP increases grain yield in rice.

Science.gov (United States)

Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

2017-11-01

Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

MAVEN Observation of an Obliquely Propagating Low-Frequency Wave Upstream of Mars

Science.gov (United States)

Ruhunusiri, Suranga; Halekas, J. S.; Connerney, J. E. P.; Espley, J. R.; McFadden, J. P.; Mazelle, C.; Brain, D.; Collinson, G.; Harada, Y.; Larson, D. E.;

Coordination in the upstream supply chain of the Dutch railway sector : a research agenda

NARCIS (Netherlands)

Schlicher, L.P.J.; Slikker, M.; van Houtum, G.J.J.A.N.; Pombo, J.

2016-01-01

In this paper, we present a research agenda which identifies three research directions for the upstream supply chain of the Dutch railway sector. The first research direction focusses on coordination of spare parts with criticality differences and related allocations of potential cost savings

Upstream from OPERA: extreme attention to detail

CERN Multimedia

CERN Bulletin

2011-01-01

Two weeks ago, at a seminar held at CERN, the OPERA collaboration revealed their astonishing observation: neutrinos might move faster than light. The finding is currently under scrutiny in the scientific community. While the result downstream at Gran Sasso speaks for itself, upstream at CERN things are no less intriguing, with high-tech GPS systems, novel techniques for accurately measuring the time, and unique ways keeping the initial particle beam stable. Take away one ingredient and the accuracy needed for the final measurement is spoiled.   Underground installations of the CERN Neutrinos to Gran Sasso (CNGS) project. First ingredient: a stable beam CERN produces neutrinos by sending a beam of protons to hit a target. The collisions produce a secondary beam, which mostly consists of pions and kaons that decay in flight within an evacuated tunnel. Their decay products are muons and muon-neutrinos. An absorber stops the pions and kaons that do not decay, while the resulting muons are absorb...

From Worker Health To Citizen Health: Moving Upstream

Science.gov (United States)

Sepulveda, Martin-Jose

2014-01-01

New rapid growth economies, urbanization, health systems crises and “big data” are causing fundamental changes in social structures and systems including health. These forces for change have significant consequences for occupational and environmental medicine and will challenge the specialty to think beyond workers and workplaces as the principal locus of innovation for health and performance. These trends are placing great emphasis on upstream strategies for addressing the complex systems dynamics of the social determinants of health. The need to engage systems in communities for healthier workforces is a shift in orientation from worker and workplace centric to citizen and community centric. This change for occupational and environmental medicine requires extending systems approaches in the workplace to communities which are systems of systems and which require different skills, data, tools and partnerships. PMID:24284749

Ions upstream of the earth's bow shock: a theoretical comparison of alternative source populations

International Nuclear Information System (INIS)

Schwartz, S.J.; Thomsen, M.F.; Gosling, J.T.

1983-01-01

A theoretical framework is developed for studying trajectories of ions reflected or leaked upstream from the earth's bow shock and subject solely to the Lorentz force in a steady interplanetary magnetic field B and the V x B electric field. We include the effects of a sharp shock potential rise. Expressions are derived for the guiding center motion and gyromotion in a frame (the Hoffman-Teller frame) moving parallel to the shock surface with sufficient speed to transform the incident solar wind velocity into motion entirely along the interplanetary magnetic field: the appropriate equations are also provided to transform these motions back to the observer's frame. The utility of these expressions is illustrated by comparing the predicted upstream motions for four different source models for upstream ions: magnetic moment-conserving reflection of the solar wind ions, specular reflection of solar wind ions, magnetic moment-conserving leakage of magnetosheath ions, and leakage of magnetosheath ions parallel to the shock normal. This comparison reveals that, for identical geometries, the reflection models produce higher energies and/or gyromotion than do the leakage models. We further argue that in a single simple encounter with the shock, an ion should behave in an unmagnetized manner and hence should not conserve its magnetic moment. Conservation of magnetic moment, if it is to occur, would seem to require multiple encounters with the shock. We investigate the conditions under which such multiple encounters can occur and find that under most quasi-parallel geometries neither leaked nor reflected ions should probably conserve their magnetic moments

Site Selection for the Salt Disposition Facility at the Savannah River Site

International Nuclear Information System (INIS)

Gladden, J.B.; Rueter, K.J.; Morin, J.P.

2000-01-01

A site selection study was conducted to identify a suitable location for the construction and operation of a new Salt Disposition Facility (SDF) at the Savannah River Site (SRS). The facility to be sited is a single processing facility and support buildings that could house either of three technology alternatives being developed by the High Level Waste Systems Engineering Team: Small Tank Tetraphenylborate Precipitation, Crystalline Silicotitanate Non-Elutable Ion Exchange or Caustic Side Solvent Extraction. A fourth alternative, Direct Disposal in grout, is not part of the site selection study because a location has been identified that is unique to this technology (i.e., Z-Area). Facility site selection at SRS is a formal, documented process that seeks to optimize siting of new facilities with respect to facility-specific engineering requirements, sensitive environmental resources, and applicable regulatory requirements. In this manner, the prime objectives of cost minimization, environmental protection, and regulatory compliance are achieved. The results from this geotechnical characterization indicated that continued consideration be given to Site B for the proposed SDF. Suitable topography, the lack of surface hydrology and floodplain issues, no significant groundwater contamination, the presence of minor soft zones along the northeast portion of footprint, and no apparent geological structure in the Gordon Aquitard support this recommendation

Bidirectional 3.125 Gbps downstream / 2 Gbps upstream impulse radio ultrawide-band (UWB) over combined fiber and wireless link

DEFF Research Database (Denmark)

Jensen, Jesper Bevensee; Gibbon, Timothy Braidwood; Yu, Xianbin

2010-01-01

We demonstrate bidirectional fiber and wireless transmission of impulse radio ultra-wideband at 3.125 Gbps downstream and 2 Gbps upstream. After transmission over 50 km fiber and 1.85 m wireless link both signals are recovered without errors.......We demonstrate bidirectional fiber and wireless transmission of impulse radio ultra-wideband at 3.125 Gbps downstream and 2 Gbps upstream. After transmission over 50 km fiber and 1.85 m wireless link both signals are recovered without errors....

Location of colorectal cancer: colonoscopy versus surgery. Yield of colonoscopy in predicting actual location.

Science.gov (United States)

Blum-Guzman, Juan Pablo; Wanderley de Melo, Silvio

2017-07-01

 Recent studies suggest that differences in biological characteristics and risk factors across cancer site within the colon and rectum may translate to differences in survival. It can be challenging at times to determine the precise anatomical location of a lesion with a luminal view during colonoscopy. The aim of this study is to determine if there is a significant difference between the location of colorectal cancers described by gastroenterologists in colonoscopies and the actual anatomical location noted on operative and pathology reports after colon surgery.  A single-center retrospective analysis of colonoscopies of patient with reported colonic masses from January 2005 to April 2014 (n = 380) was carried. Assessed data included demography, operative and pathology reports. Findings were compared: between the location of colorectal cancers described by gastroenterologists in colonoscopies and the actual anatomical location noted on operative reports or pathology samples.  We identified 380 colonic masses, 158 were confirmed adenocarcinomas. Of these 123 underwent surgical resection, 27 had to be excluded since no specific location was reported on their operative or pathology report. An absolute difference between endoscopic and surgical location was found in 32 cases (33 %). Of these, 22 (23 %) differed by 1 colonic segment, 8 (8 %) differed by 2 colonic segments and 2 (2 %) differed by 3 colonic segments.  There is a significant difference between the location of colorectal cancers reported by gastroenterologists during endoscopy and the actual anatomical location noted on operative or pathology reports after colon surgery. Endoscopic tattooing should be used when faced with any luminal lesions of interest.

Runway Arrested Landing Site (RALS)

Data.gov (United States)

Federal Laboratory Consortium — The Runway Arrested Landing Site includes an underground complex located on a Mod 2, Mod 3, and Mod 3+ arresting gear and are located under the runway and accurately...

Subsurface characterization and geohydrologic site evaluation West Chestnut Ridge site

International Nuclear Information System (INIS)

1984-01-01

The West Chestnut Ridge Site at the Oak Ridge National Laboratory is being considered for use as a repository for low-level radioactive waste. The purposes of this study were to provide a geohydrological characterization of the site for use in pathways analysis, and to provide preliminary geotechnical recommendations that would be used for development of a site utilization plan. Subsurface conditions were investigated at twenty locations and observation wells were installed. Field testing at each location included the Standard Penetration Test and permeability tests in soil and rock. A well pumping test was ocmpleted at one site. Laboratory testing included permeability, deformability, strength and compaction tests, as well as index and physical property tests. The field investigations showed that the subsurface conditions include residual soil overlying a weathered zone of dolomite which grades into relatively unweathered dolomite at depth. The thickness of residual soil is typically 80 ft (24 m) on the ridges, but can be as little as 10 ft (3 m) in the valleys. Trench excavations to depths of 30 ft (9 m) should not present serious slope stability problems above the water table. On-site soils can be used for liners or trench backfill but these soils may require moisture conditioning to achieve required densities. 19 figures, 8 tables

Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

Science.gov (United States)

Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

2004-02-01

The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

Final environmental impact statement for the Nevada Test Site and off-site locations in the State of Nevada. Summary

International Nuclear Information System (INIS)

1996-08-01

This sitewide EIS evaluates the potential environmental impacts of four possible land-use alternatives being considered for the Nevada Test Site (NTS), the Tonopah Test Range, and the formerly operated DOE sites in the state of Nevada: the Project Shoal Area, the Central Nevada Test Area, and portions of the Nellis Air Force Range Complex. Three additional sites in Nevada-Eldorado Valley, Dry Lake Valley, and Coyote Spring Valley-are evaluated for collocation of solar energy production facilities. The four alternatives include Continue Current Operations (No Action, continue to operate at the level maintained for the past 3 to 5 years); Discontinue Operations 1 (discontinue operations and interagency programs); Expanded Use (increased use of NTS and its resources to support defense and nondefense programs); and Alternate Use of Withdrawn Lands (discontinue all defense-related activities at NTS; continue waste management operations in support of NTS environmental restoration efforts; expand nondefense research). Environmental impacts were assessed for each alternative by analyzing, to the extent possible, the discrete and cumulative environmental impacts associated with Defense Waste Management, Environmental Restoration, Nondefense Research and Development, and Work for Others Programs. A framework for a Resource Management Plan is included as Volume 2 of this EIS and represents the development of an ecosystem based planning process closely integrated with the National Environmental Policy Act process. This EIS, among other things, analyzed the impacts of transportation of low level waste, and site characterization activities related to the Yucca Mountain Project but did not analyze the suitability of the site as a repository. This EIS does not analyze the suitability of the Yucca Mountain site as a repository as this is an action beyond the scope of the EIS. Volume 3 of this EIS contains the public comments and the responses to the comments