Site-specific deletions of chromosomally located DNA segments with the multimer resolution system of broad-host-range plasmid RP4

DEFF Research Database (Denmark)

Sternberg, Claus; Eberl, Leo; Sanchezromero, Juan M.

1995-01-01

The multimer resolution system (mrs) of the broad-host-range plasmid RP4 has been exploited to develop a general method that permits the precise excision of chromosomal segments in a variety of gram-negative bacteria. The procedure is based on the site-specific recombination between two directly ...

Roles of CcrA and CcrB in Excision and Integration of Staphylococcal Cassette Chromosome mec, a Staphylococcus aureus Genomic Island▿

OpenAIRE

Wang, Lei; Archer, Gordon L.

2010-01-01

The gene encoding resistance to methicillin and other β-lactam antibiotics in staphylococci, mecA, is carried on a genomic island, SCCmec (for staphylococcal cassette chromosome mec). The chromosomal excision and integration of types I to IV SCCmec are catalyzed by the site-specific recombinases CcrA and CcrB, the genes for which are encoded on each element. We sought to identify the relative contributions of CcrA and CcrB in the excision and integration of SCCmec. Purified CcrB but not CcrA ...

Retroviral DNA integration: ASLV, HIV, and MLV show distinct target site preferences.

Directory of Open Access Journals (Sweden)

Rick S Mitchell

2004-08-01

Full Text Available The completion of the human genome sequence has made possible genome-wide studies of retroviral DNA integration. Here we report an analysis of 3,127 integration site sequences from human cells. We compared retroviral vectors derived from human immunodeficiency virus (HIV, avian sarcoma-leukosis virus (ASLV, and murine leukemia virus (MLV. Effects of gene activity on integration targeting were assessed by transcriptional profiling of infected cells. Integration by HIV vectors, analyzed in two primary cell types and several cell lines, strongly favored active genes. An analysis of the effects of tissue-specific transcription showed that it resulted in tissue-specific integration targeting by HIV, though the effect was quantitatively modest. Chromosomal regions rich in expressed genes were favored for HIV integration, but these regions were found to be interleaved with unfavorable regions at CpG islands. MLV vectors showed a strong bias in favor of integration near transcription start sites, as reported previously. ASLV vectors showed only a weak preference for active genes and no preference for transcription start regions. Thus, each of the three retroviruses studied showed unique integration site preferences, suggesting that virus-specific binding of integration complexes to chromatin features likely guides site selection.

Pure chromosome-specific PCR libraries from single sorted chromosomes

NARCIS (Netherlands)

VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.

1994-01-01

Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted

Retrotransposons. An RNA polymerase III subunit determines sites of retrotransposon integration.

Science.gov (United States)

Bridier-Nahmias, Antoine; Tchalikian-Cosson, Aurélie; Baller, Joshua A; Menouni, Rachid; Fayol, Hélène; Flores, Amando; Saïb, Ali; Werner, Michel; Voytas, Daniel F; Lesage, Pascale

2015-05-01

Mobile genetic elements are ubiquitous. Their integration site influences genome stability and gene expression. The Ty1 retrotransposon of the yeast Saccharomyces cerevisiae integrates upstream of RNA polymerase III (Pol III)-transcribed genes, yet the primary determinant of target specificity has remained elusive. Here we describe an interaction between Ty1 integrase and the AC40 subunit of Pol III and demonstrate that AC40 is the predominant determinant targeting Ty1 integration upstream of Pol III-transcribed genes. Lack of an integrase-AC40 interaction dramatically alters target site choice, leading to a redistribution of Ty1 insertions in the genome, mainly to chromosome ends. The mechanism of target specificity allows Ty1 to proliferate and yet minimizes genetic damage to its host. Copyright © 2015, American Association for the Advancement of Science.

Chromosomal instability can be induced by the formation of breakage-prone chromosome rearrangement junctions

International Nuclear Information System (INIS)

Allen, R.N.; Ritter, L.; Moore, S.R.; Grosovsky, A.J.

2003-01-01

Full text: Studies in our lab have led to the hypothesis that chromosomal rearrangements can generate novel breakage-prone sites, resulting in chromosomal instability acting predominantly in cis. For example, specific breakage of large blocks of centromeric region heterochromatin on chromosome 16q by treatment with 2,6-diaminopurine (DAP) is associated with repeated rearrangement of chromosome 16q during outgrowth of DAP-treated clones, thereby establishing a link between the initial site of damage and the occurrence of persistent chromosomal instability. Similarly, karyotypic analysis of gamma ray induced instability demonstrated that chromosomal rearrangements in sub-clones were significantly clustered near the site of previously identified chromosomal rearrangement junctions in unstable parental clones. This study investigates the hypothesis that integration of transfected sequences into host chromosomes could create breakage-prone junction regions and persistent genomic instability without exposure to DNA-damage agents. These junctions may mimic the unstable chromosomal rearrangements induced by DAP or radiation, and thus provide a test of the broader hypothesis that instability can to some extent be attributed to the formation of novel chromosomal breakage hot spots. These experiments were performed using human-hamster hybrid AL cells containing a single human chromosome 11, which was used to monitor instability in a chromosomal painting assay. AL cells were transfected with a 2.5 Kb fragment containing multiple copies of the 180 bp human alpha heterochromatic repeat, which resulted in chromosomal instability in 41% of the transfected clones. Parallel exposure to gamma-radiation resulted in a similar level of chromosomal instability, although control transfections with plasmid alone did not lead to karyotypic instability. Chromosomal instability induced by integration of alpha heterochromatic repeats was also frequently associated with delayed reproductive

Complete Genome Sequence of Germline Chromosomally Integrated Human Herpesvirus 6A and Analyses Integration Sites Define a New Human Endogenous Virus with Potential to Reactivate as an Emerging Infection

Science.gov (United States)

Tweedy, Joshua; Spyrou, Maria Alexandra; Pearson, Max; Lassner, Dirk; Kuhl, Uwe; Gompels, Ursula A.

2016-01-01

Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated “CiHHV-6A/B”. These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, implying functional non-defective genomes. To further define the relationship between HHV-6A and CiHHV-6A we used next-generation sequencing to characterize genomes from three CiHHV-6A cardiac patients. Comparisons to known exogenous HHV-6A showed CiHHV-6A genomes formed a separate clade; including all 85 non-interrupted genes and necessary cis-acting signals for reactivation as infectious virus. Greater single nucleotide polymorphism (SNP) density was defined in 16 genes and the direct repeats (DR) terminal regions. Using these SNPs, deep sequencing analyses demonstrated superinfection with exogenous HHV-6A in two of the CiHHV-6A patients with recurrent cardiac disease. Characterisation of the integration sites in twelve patients identified the human chromosome 17p subtelomere as a prevalent site, which had specific repeat structures and phylogenetically related CiHHV-6A coding sequences indicating common ancestral origins. Overall CiHHV-6A genomes were similar, but distinct from known exogenous HHV-6A virus, and have the capacity to reactivate as emerging virus infections. PMID:26784220

Retroviral DNA integration: viral and cellular determinants of target-site selection.

Directory of Open Access Journals (Sweden)

Mary K Lewinski

2006-06-01

Full Text Available Retroviruses differ in their preferences for sites for viral DNA integration in the chromosomes of infected cells. Human immunodeficiency virus (HIV integrates preferentially within active transcription units, whereas murine leukemia virus (MLV integrates preferentially near transcription start sites and CpG islands. We investigated the viral determinants of integration-site selection using HIV chimeras with MLV genes substituted for their HIV counterparts. We found that transferring the MLV integrase (IN coding region into HIV (to make HIVmIN caused the hybrid to integrate with a specificity close to that of MLV. Addition of MLV gag (to make HIVmGagmIN further increased the similarity of target-site selection to that of MLV. A chimeric virus with MLV Gag only (HIVmGag displayed targeting preferences different from that of both HIV and MLV, further implicating Gag proteins in targeting as well as IN. We also report a genome-wide analysis indicating that MLV, but not HIV, favors integration near DNase I-hypersensitive sites (i.e., +/- 1 kb, and that HIVmIN and HIVmGagmIN also favored integration near these features. These findings reveal that IN is the principal viral determinant of integration specificity; they also reveal a new role for Gag-derived proteins, and strengthen models for integration targeting based on tethering of viral IN proteins to host proteins.

HHV-6A/B Integration and the Pathogenesis Associated with the Reactivation of Chromosomally Integrated HHV-6A/B.

Science.gov (United States)

Collin, Vanessa; Flamand, Louis

2017-06-26

Unlike other human herpesviruses, human herpesvirus 6A and 6B (HHV-6A/B) infection can lead to integration of the viral genome in human chromosomes. When integration occurs in germinal cells, the integrated HHV-6A/B genome can be transmitted to 50% of descendants. Such individuals, carrying one copy of the HHV-6A/B genome in every cell, are referred to as having inherited chromosomally-integrated HHV-6A/B (iciHHV-6) and represent approximately 1% of the world's population. Interestingly, HHV-6A/B integrate their genomes in a specific region of the chromosomes known as telomeres. Telomeres are located at chromosomes' ends and play essential roles in chromosomal stability and the long-term proliferative potential of cells. Considering that the integrated HHV-6A/B genome is mostly intact without any gross rearrangements or deletions, integration is likely used for viral maintenance into host cells. Knowing the roles played by telomeres in cellular homeostasis, viral integration in such structure is not likely to be without consequences. At present, the mechanisms and factors involved in HHV-6A/B integration remain poorly defined. In this review, we detail the potential biological and medical impacts of HHV-6A/B integration as well as the possible chromosomal integration and viral excision processes.

Lipofection of purified adeno-associated virus Rep68 protein: toward a chromosome-targeting nonviral particle.

Science.gov (United States)

Lamartina, S; Roscilli, G; Rinaudo, D; Delmastro, P; Toniatti, C

1998-09-01

Adeno-associated virus (AAV) integrates very efficiently into a specific site (AAVS1) of human chromosome 19. Two elements of the AAV genome are sufficient: the inverted terminal repeats (ITRs) and the Rep78 or Rep68 protein. The incorporation of the AAV integration machinery in nonviral delivery systems is of great interest for gene therapy. We demonstrate that purified recombinant Rep68 protein is functionally active when directly delivered into human cells by using the polycationic liposome Lipofectamine, promoting the rescue-replication of a codelivered ITR-flanked cassette in adenovirus-infected cells and its site-specific integration in noninfected cells. The sequencing of cloned virus-host DNA junctions confirmed that lipofected Rep68 protein triggers site-specific integration at the same sites in chromosome 19 already characterized in cells latently infected with AAV.

Retroviral integration: Site matters

Science.gov (United States)

Demeulemeester, Jonas; De Rijck, Jan

2015-01-01

Here, we review genomic target site selection during retroviral integration as a multistep process in which specific biases are introduced at each level. The first asymmetries are introduced when the virus takes a specific route into the nucleus. Next, by co‐opting distinct host cofactors, the integration machinery is guided to particular chromatin contexts. As the viral integrase captures a local target nucleosome, specific contacts introduce fine‐grained biases in the integration site distribution. In vivo, the established population of proviruses is subject to both positive and negative selection, thereby continuously reshaping the integration site distribution. By affecting stochastic proviral expression as well as the mutagenic potential of the virus, integration site choice may be an inherent part of the evolutionary strategies used by different retroviruses to maximise reproductive success. PMID:26293289

Microsatellite and single nucleotide polymorphisms in the β-globin locus control region-hypersensitive Site 2: SPECIFICITY of Tunisian βs chromosomes.

Science.gov (United States)

Ben Mustapha, Maha; Moumni, Imen; Zorai, Amine; Douzi, Kaïs; Ghanem, Abderraouf; Abbes, Salem

2012-01-01

The diversity of sickle cell disease severity is attributed to several cis acting factors, among them the single nucleotide polymorphisms (SNPs) and (AT) rich region in the β-locus control region (β-LCR). This contains five DNase I hypersensitive sites (HS) located 6 to 22 kb upstream to the ϵ gene. The most important of these is the HS2 (5' β-LCR-HS2), characterized by the presence of three different SNPs and a microsatellite region known to be in association with β(S) chromosomes in various populations. The aim of this study was to present the molecular investigation of the 5' β-LCR-HS2 site in normal and sickle cell disease individuals in order to determine if there is any correlation or specificity between these molecular markers, the β(S) Tunisian chromosomes and phenotypical expression of sickle cell disease. One hundred and twenty-four chromosomes from Tunisian individuals (49 β(S) carriers and 13 normal individuals) were screened by polymerase chain reaction (PCR) and sequencing for the polymorphic short tandem microsatellite repeats (AT)(X)N(12)(AT)(Y) and the three SNPs (rs7119428, rs9736333 and rs60240093) of the 5' β-LCR-HS2. Twelve configurations of the microsatellite motif were found with an ancestral configuration elaborated by ClustalW software. Normal and mutated alleles were observed at the homozygous and heterozygous states for the three SNPs. Correlation between microsatellites and SNPs suggests that mutant SNP alleles were mainly associated, in the homozygous sickle cell disease phenotype, with the (AT)(8)N(12)GT(AT)(7) configuration, whereas, normal SNP alleles were associated with the (AT)(X)N(12)(AT)(11) configurations in normal β(A) chromosomes. The correlation of these various configurations with Hb F expression was also investigated. The principal component analysis (PCA) showed the correlation between the homozygous sickle cell disease phenotype, mutated SNP alleles and the Benin microsatellite configuration (AT)(8)N(12)GT

Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish

Directory of Open Access Journals (Sweden)

Atsuo Kawahara

2016-05-01

Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

Slit scan flow cytometry of isolated chromosomes following fluorescence hybridization: an approach of online screening for specific chromosomes and chromosome translocations

NARCIS (Netherlands)

Hausmann, M.; Dudin, G.; Aten, J. A.; Heilig, R.; Diaz, E.; Cremer, C.

1991-01-01

The recently developed methods of non radioactive in situ hybridization of chromosomes offer new aspects for chromosome analysis. Fluorescent labelling of hybridized chromosomes or chromosomal subregions allows to facilitate considerably the detection of specific chromosomal abnormalities. For many

Molecular analysis of an integrative conjugative element, ICEH, present in the chromosome of different strains of Mycoplasma hyopneumoniae

Directory of Open Access Journals (Sweden)

Paulo Marcos Pinto

2007-01-01

Full Text Available Diversification of bacterial species and pathotypes is largely caused by lateral gene transfer (LGT of diverse mobile DNA elements such as plasmids, phages, transposons and genomic islands. Thus, acquisition of new phenotypes by LGT is very important for bacterial evolution and relationship with hosts. This paper reports a 23 kb region containing fourteen CDSs with similarity to the previous described Integrative Conjugal Element of Mycoplasma fermentans (ICEF. This element, named ICEH, is present as one copy at distinct integration sites in the chromosome of 7448 and 232 pathogenic strains and is absent in the type strain J (non-pathogenic. Notable differences in the nucleotide composition of the insertion sites were detected, and could be correlated to a lack of specificity of the ICEH integrase. Although present in strains of the same organism, the ICEH elements are more divergent than the typical similarity between other chromosomal locus of Mycoplasma hyopneunomiae, suggesting an accelerated evolution of these constins or an ongoing process of degeneration, while maintaining conservation of the tra genes. An extrachromosomal form of this element had been detected in the 7448 strain, suggesting a possible involvement in its mobilization and transference of CDSs to new hosts.

High-Affinity Sites Form an Interaction Network to Facilitate Spreading of the MSL Complex across the X Chromosome in Drosophila

NARCIS (Netherlands)

Ramírez, Fidel; Lingg, Thomas; Toscano, Sarah; Lam, Kin Chung; Georgiev, Plamen; Chung, Ho-Ryun; Lajoie, Bryan R; de Wit, Elzo; Zhan, Ye; de Laat, Wouter; Dekker, Job; Manke, Thomas; Akhtar, Asifa

2015-01-01

Dosage compensation mechanisms provide a paradigm to study the contribution of chromosomal conformation toward targeting and spreading of epigenetic regulators over a specific chromosome. By using Hi-C and 4C analyses, we show that high-affinity sites (HAS), landing platforms of the male-specific

Exchange of core chromosomes and horizontal transfer of lineage-specific chromosomes in Fusarium oxysporum

NARCIS (Netherlands)

Vlaardingerbroek, I.; Beerens, B.; Rose, L.; Fokkens, L.; Cornelissen, B.J.C.; Rep, M.

2016-01-01

Horizontal transfer of supernumerary or lineage-specific (LS) chromosomes has been described in a number of plant pathogenic filamentous fungi. So far it was not known whether transfer is restricted to chromosomes of certain size or properties, or whether 'core' chromosomes can also undergo

Cascade of chromosomal rearrangements caused by a heterogeneous T-DNA integration supports the double-stranded break repair model for T-DNA integration.

Science.gov (United States)

Hu, Yufei; Chen, Zhiyu; Zhuang, Chuxiong; Huang, Jilei

2017-06-01

Transferred DNA (T-DNA) from Agrobacterium tumefaciens can be integrated into the plant genome. The double-stranded break repair (DSBR) pathway is a major model for T-DNA integration. From this model, we expect that two ends of a T-DNA molecule would invade into a single DNA double-stranded break (DSB) or independent DSBs in the plant genome. We call the later phenomenon a heterogeneous T-DNA integration, which has never been observed. In this work, we demonstrated it in an Arabidopsis T-DNA insertion mutant seb19. To resolve the chromosomal structural changes caused by T-DNA integration at both the nucleotide and chromosome levels, we performed inverse PCR, genome resequencing, fluorescence in situ hybridization and linkage analysis. We found, in seb19, a single T-DNA connected two different chromosomal loci and caused complex chromosomal rearrangements. The specific break-junction pattern in seb19 is consistent with the result of heterogeneous T-DNA integration but not of recombination between two T-DNA insertions. We demonstrated that, in seb19, heterogeneous T-DNA integration evoked a cascade of incorrect repair of seven DSBs on chromosomes 4 and 5, and then produced translocation, inversion, duplication and deletion. Heterogeneous T-DNA integration supports the DSBR model and suggests that two ends of a T-DNA molecule could be integrated into the plant genome independently. Our results also show a new origin of chromosomal abnormalities. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

Energy Technology Data Exchange (ETDEWEB)

Warburton, P.E.; Gosden, J.; Lawson, D. [Western General Hospital, Edinburgh (United Kingdom)] [and others

1996-04-15

Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize and spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.

Hybrid lentivirus-phiC31-int-NLS vector allows site-specific recombination in murine and human cells but induces DNA damage.

Directory of Open Access Journals (Sweden)

Nicolas Grandchamp

Full Text Available Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

Integration of replication-defective R68.45-like plasmids into the Pseudomonas aeruginosa chromosome.

Science.gov (United States)

Reimmann, C; Rella, M; Haas, D

1988-06-01

R68.45 and other similar broad-host-range (IncP) plasmids carrying a tandem repeat of the 2.1 kb insertion element IS21 mobilize the chromosome of many different Gram-negative bacteria. To analyse the structure of R68.45-chromosome cointegrates, whose involvement in the mobilization process had been postulated previously, we selected for the stable integration of R68.45-like plasmids into the Pseudomonas aeruginosa chromosome. Two plasmids were chosen: pME28, a transfer-deficient, mobilizable RP1 derivative with an inactive replication control (trfA) gene, and pME487, an R68.45 derivative with a trfA(ts) mutation causing temperature-sensitive replication. Chromosomally integrated pME28 and pME487 were found to be flanked by single IS21 elements. This structure is in agreement with a 'cut-and-paste' mode of R68.45 transposition. pME28 and pME487 showed a low specificity of insertion but rarely (less than 0.1%) induced auxotrophic mutations. Hfr (high-frequency-of-recombination) donors of P. aeruginosa could be obtained by chromosomal integration of pME487 or pME28; in the latter case, the transfer functions lacking from pME28 had to be provided in trans on an autonomous plasmid. Hfr donors gave higher conjugational linkage and transferred longer stretches of the P. aeruginosa chromosome than did R68.45 donors. This suggests that the integration of R68.45 into the donor chromosome is short-lived in P. aeruginosa.

Beyond the chromosome: the prevalence of unique extra-chromosomal bacteriophages with integrated virulence genes in pathogenic Staphylococcus aureus.

Directory of Open Access Journals (Sweden)

Bryan Utter

Full Text Available In Staphylococcus aureus, the disease impact of chromosomally integrated prophages on virulence is well described. However, the existence of extra-chromosomal prophages, both plasmidial and episomal, remains obscure. Despite the recent explosion in bacterial and bacteriophage genomic sequencing, studies have failed to specifically focus on extra-chromosomal elements. We selectively enriched and sequenced extra-chromosomal DNA from S. aureus isolates using Roche-454 technology and uncovered evidence for the widespread distribution of multiple extra-chromosomal prophages (ExPΦs throughout both antibiotic-sensitive and -resistant strains. We completely sequenced one such element comprised of a 43.8 kbp, circular ExPΦ (designated ФBU01 from a vancomycin-intermediate S. aureus (VISA strain. Assembly and annotation of ФBU01 revealed a number of putative virulence determinants encoded within a bacteriophage immune evasion cluster (IEC. Our identification of several potential ExPΦs and mobile genetic elements (MGEs also revealed numerous putative virulence factors and antibiotic resistance genes. We describe here a previously unidentified level of genetic diversity of stealth extra-chromosomal elements in S. aureus, including phages with a larger presence outside the chromosome that likely play a prominent role in pathogenesis and strain diversity driven by horizontal gene transfer (HGT.

DNA deformability changes of single base pair mutants within CDE binding sites in S. Cerevisiae centromere DNA correlate with measured chromosomal loss rates and CDE binding site symmetries

Directory of Open Access Journals (Sweden)

Marx Kenneth A

2006-03-01

Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also

Integrating Multi-omic features exploiting Chromosome Conformation Capture data

Directory of Open Access Journals (Sweden)

Ivan eMerelli

2015-02-01

Full Text Available The representation, integration and interpretation of omic data is a complex task, in particular considering the huge amount of information that is daily produced in molecular biology laboratories all around the world. The reason is that sequencing data regarding expression profiles, methylation patterns, and chromatin domains is difficult to harmonize in a systems biology view, since genome browsers only allow coordinate-based representations, discarding functional clusters created by the spatial conformation of the DNA in the nucleus. In this context, recent progresses in high throughput molecular biology techniques and bioinformatics have provided insights into chromatin interactions on a larger scale and offer a formidable support for the interpretation of multi-omic data. In particular, a novel sequencing technique called Chromosome Conformation Capture (3C allows the analysis of the chromosome organization in the cell’s natural state. While performed genome wide, this technique is usually called Hi-C. Inspired by service applications such as Google Maps, we developed NuChart, an R package that integrates Hi-C data to describe the chromosomal neighbourhood starting from the information about gene positions, with the possibility of mapping on the achieved graphs genomic features such as methylation patterns and histone modifications, along with expression profiles. In this paper we show the importance of the NuChart application for the integration of multi-omic data in a systems biology fashion, with particular interest in cytogenetic applications of these techniques. Moreover, we demonstrate how the integration of multi-omic data can provide useful information in understanding why genes are in certain specific positions inside the nucleus and how epigenetic patterns correlate with their expression.

Karyotype characterization of Crotalaria juncea (L. by chromosome banding and physical mapping of 18S-5.8S-26S and 5S rRNA gene sites

Directory of Open Access Journals (Sweden)

Mateus Mondin

2007-01-01

Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.

Flagellar region 3b supports strong expression of integrated DNA and the highest chromosomal integration efficiency of the Escherichia coli flagellar regions.

Science.gov (United States)

Juhas, Mario; Ajioka, James W

2015-07-01

The Gram-negative bacterium Escherichia coli is routinely used as the chassis for a variety of biotechnology and synthetic biology applications. Identification and analysis of reliable chromosomal integration and expression target loci is crucial for E. coli engineering. Chromosomal loci differ significantly in their ability to support integration and expression of the integrated genetic circuits. In this study, we investigate E. coli K12 MG1655 flagellar regions 2 and 3b. Integration of the genetic circuit into seven and nine highly conserved genes of the flagellar regions 2 (motA, motB, flhD, flhE, cheW, cheY and cheZ) and 3b (fliE, F, G, J, K, L, M, P, R), respectively, showed significant variation in their ability to support chromosomal integration and expression of the integrated genetic circuit. While not reducing the growth of the engineered strains, the integrations into all 16 target sites led to the loss of motility. In addition to high expression, the flagellar region 3b supports the highest efficiency of integration of all E. coli K12 MG1655 flagellar regions and is therefore potentially the most suitable for the integration of synthetic genetic circuits. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Integrating chromosomal aberrations and gene expression profiles to dissect rectal tumorigenesis

Directory of Open Access Journals (Sweden)

Eilers Paul HC

2008-10-01

Full Text Available Abstract Background Accurate staging of rectal tumors is essential for making the correct treatment choice. In a previous study, we found that loss of 17p, 18q and gain of 8q, 13q and 20q could distinguish adenoma from carcinoma tissue and that gain of 1q was related to lymph node metastasis. In order to find markers for tumor staging, we searched for candidate genes on these specific chromosomes. Methods We performed gene expression microarray analysis on 79 rectal tumors and integrated these data with genomic data from the same sample series. We performed supervised analysis to find candidate genes on affected chromosomes and validated the results with qRT-PCR and immunohistochemistry. Results Integration of gene expression and chromosomal instability data revealed similarity between these two data types. Supervised analysis identified up-regulation of EFNA1 in cases with 1q gain, and EFNA1 expression was correlated with the expression of a target gene (VEGF. The BOP1 gene, involved in ribosome biogenesis and related to chromosomal instability, was over-expressed in cases with 8q gain. SMAD2 was the most down-regulated gene on 18q, and on 20q, STMN3 and TGIF2 were highly up-regulated. Immunohistochemistry for SMAD4 correlated with SMAD2 gene expression and 18q loss. Conclusion On basis of integrative analysis this study identified one well known CRC gene (SMAD2 and several other genes (EFNA1, BOP1, TGIF2 and STMN3 that possibly could be used for rectal cancer characterization.

Chromosome breakage at sites of oncogenes in a population accidentally exposed to radioactive chemical pollution

International Nuclear Information System (INIS)

Ilyinskikh, N.N.; IIlyinskikh, I.N.; Ilyinskikh, E.N.

2003-01-01

The purpose of the present study was to investigate the level of aberrations at fragile sites of chromosomes in peripheral blood lymphocytes of the population of an area polluted with radionuclides, following an accident at the Siberian Chemical Plant (SCP). We carried out the micro-nucleus test to screen people with radiation-related cytogenetic effects. Of the 1246 examined inhabitants of the settlement of Samus, 148 showed a significantly increased frequency of micro-nucleated erythrocytes and were selected for the chromosome analysis as a radiation-exposed group. Additional analysis was carried out on 40 patients with gastric cancer and atrophic gastritis with stage II-III epithelial dysplasia. Eighty six individuals from a non-polluted area were used as a control group. Chromosomal breaks and exchanges occurred preferentially in chromosomes 3 and 6 among radiation-exposed persons and patients. The regions 3p14-3p25 and 6p23 were damaged most often. There was a tendency towards preferential involvement at q21-q25 of chromosome 6 in patients with gastric cancer and atrophic gastritis. Specific damage at certain chromosome sites was observed in the radiation-exposed population as well as in patients with gastric cancer. Most often this damage were located near oncogene loci which could imply that chromosome damage induced by radiation is likely to be a predisposing factor to the expression of oncogenes and malignant transformation of cells in exposed individuals. (author)

Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

Science.gov (United States)

Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

2017-04-15

Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

Integration of aerial imaging and variable-rate technology for site-specific aerial herbicide application

Science.gov (United States)

As remote sensing and variable rate technology are becoming more available for aerial applicators, practical methodologies on effective integration of these technologies are needed for site-specific aerial applications of crop production and protection materials. The objectives of this study were to...

Chromosomal aberrations in Sigmodon hispidus from a Superfund site

International Nuclear Information System (INIS)

Bowers, B.; McBee, K.; Lochmiller, R.; Burks, S.; Qualls, C.

1995-01-01

Cotton rats (Sigmodon hispidus) were collected from an EPA Superfund site located on an abandoned oil refinery. Three trapping grids were located on the refinery and three similar grids were located at uncontaminated localities which served as reference sites. Bone marrow metaphase chromosome preparations were examined for chromosomal damage. For each individual, 50 cells were scored for six classes of chromosomal lesions. For the fall 1991 trapping period, mean number of aberrant cells per individual was 2.33, 0.85, and 1.50 for the three Superfund grids., Mean number of aberrant cells per individual was 2.55, 2.55, and 2.12 from the reference grids. Mean number of lesions per cell was 2.77, 0.86, and 1.9 from the Superfund grids, and 3.55, 2.77, and 2.50 from the reference grids. For the spring 1992 trapping period, more damage was observed in animals from both Superfund and reference sites; however, animals from Superfund grids had more damage than animals from reference grids. Mean number of aberrant cells per individual was 3.50, 3.25, and 3.70 from the Superfund grids, and 2.40, 2.11, and 1.40 from the reference grids. Mean number of lesions per cell was 4.80, 4.25, and 5.50 from the Superfund grids, and 2.60, 2.33, and 1.50 from the reference grids. These data suggest animals may be more susceptible to chromosomal damage during winter months, and animals from the Superfund grids appear to be more severely affected than animals from reference grids

Comprehensive mapping of the human papillomavirus (HPV) DNA integration sites in cervical carcinomas by HPV capture technology.

Science.gov (United States)

Liu, Ying; Lu, Zheming; Xu, Ruiping; Ke, Yang

2016-02-02

Integration of human papillomavirus (HPV) DNA into the host genome can be a driver mutation in cervical carcinoma. Identification of HPV integration at base resolution has been a longstanding technical challenge, largely due to sensitivity masking by HPV in episomes or concatenated forms. The aim was to enhance the understanding of the precise localization of HPV integration sites using an innovative strategy. Using HPV capture technology combined with next generation sequencing, HPV prevalence and the exact integration sites of the HPV DNA in 47 primary cervical cancer samples and 2 cell lines were investigated. A total of 117 unique HPV integration sites were identified, including HPV16 (n = 101), HPV18 (n = 7), and HPV58 (n = 9). We observed that the HPV16 integration sites were broadly located across the whole viral genome. In addition, either single or multiple integration events could occur frequently for HPV16, ranging from 1 to 19 per sample. The viral integration sites were distributed across almost all the chromosomes, except chromosome 22. All the cervical cancer cases harboring more than four HPV16 integration sites showed clinical diagnosis of stage III carcinoma. A significant enrichment of overlapping nucleotides shared between the human genome and HPV genome at integration breakpoints was observed, indicating that it may play an important role in the HPV integration process. The results expand on knowledge from previous findings on HPV16 and HPV18 integration sites and allow a better understanding of the molecular basis of the pathogenesis of cervical carcinoma.

Site-specific weed control technologies

DEFF Research Database (Denmark)

Christensen, Svend; Søgaard, Henning Tangen; Kudsk, Per

2009-01-01

Site-specific weed control technologies are defined as machinery or equipment embedded with technologies that detect weeds growing in a crop and, taking into account predefined factors such as economics, takes action to maximise the chances of successfully controlling them. In the article, we...... describe the basic parts of site specific weed control technologies, comprising of weed sensing systems, weed management models and precision weed control implements. A review of state-of-the-art technologies shows that several weed sensing systems and precision implements have been developed over the last...... of knowledge about the economic and environmental potential for increasing the resolution of weed control. The integration of site-specific information on weed distribution, weed species composition and density, and the effect on crop yield, is decisive for successful site-specific weed management.   Keywords...

Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

Science.gov (United States)

Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-08-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM.

Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

Directory of Open Access Journals (Sweden)

Anupam Paliwal

2013-08-01

Full Text Available Allele-specific DNA methylation (ASM is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons, one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs, each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS peaks near CTCF binding sites with ASM.

Sex chromosome-specific regulation in the Drosophila male germline but little evidence for chromosomal dosage compensation or meiotic inactivation.

Directory of Open Access Journals (Sweden)

Colin D Meiklejohn

2011-08-01

Full Text Available The evolution of heteromorphic sex chromosomes (e.g., XY in males or ZW in females has repeatedly elicited the evolution of two kinds of chromosome-specific regulation: dosage compensation--the equalization of X chromosome gene expression in males and females--and meiotic sex chromosome inactivation (MSCI--the transcriptional silencing and heterochromatinization of the X during meiosis in the male (or Z in the female germline. How the X chromosome is regulated in the Drosophila melanogaster male germline is unclear. Here we report three new findings concerning gene expression from the X in Drosophila testes. First, X chromosome-wide dosage compensation appears to be absent from most of the Drosophila male germline. Second, microarray analysis provides no evidence for X chromosome-specific inactivation during meiosis. Third, we confirm the previous discovery that the expression of transgene reporters driven by autosomal spermatogenesis-specific promoters is strongly reduced when inserted on the X chromosome versus the autosomes; but we show that this chromosomal difference in expression is established in premeiotic cells and persists in meiotic cells. The magnitude of the X-autosome difference in transgene expression cannot be explained by the absence of dosage compensation, suggesting that a previously unrecognized mechanism limits expression from the X during spermatogenesis in Drosophila. These findings help to resolve several previously conflicting reports and have implications for patterns of genome evolution and speciation in Drosophila.

Repetitive, Marker-Free, Site-Specific Integration as a Novel Tool for Multiple Chromosomal Integration of DNA

DEFF Research Database (Denmark)

Petersen, Kia Vest; Martinussen, Jan; Jensen, Peter Ruhdal

2013-01-01

of a minimal bacterial attachment site (attBmin), two mutated loxP sequences (lox66 and lox71) allowing for removal of undesirable vector elements (antibiotic resistance marker), and a counterselection marker (oroP) for selection of loxP recombination on the pKV6 vector. When transformed into L. lactis...

Engineering of Systematic Elimination of a Targeted Chromosome in Human Cells.

Science.gov (United States)

Sato, Hiroshi; Kato, Hiroki; Yamaza, Haruyoshi; Masuda, Keiji; Nguyen, Huong Thi Nguyen; Pham, Thanh Thi Mai; Han, Xu; Hirofuji, Yuta; Nonaka, Kazuaki

2017-01-01

Embryonic trisomy leads to abortion or congenital genetic disorders in humans. The most common autosomal chromosome abnormalities are trisomy of chromosomes 13, 18, and 21. Although alteration of gene dosage is thought to contribute to disorders caused by extra copies of chromosomes, genes associated with specific disease phenotypes remain unclear. To generate a normal cell from a trisomic cell as a means of etiological analysis or candidate therapy for trisomy syndromes, we developed a system to eliminate a targeted chromosome from human cells. Chromosome 21 was targeted by integration of a DNA cassette in HeLa cells that harbored three copies of chromosome 21. The DNA cassette included two inverted loxP sites and a herpes simplex virus thymidine kinase (HSV-tk) gene. This system causes missegregation of chromosome 21 after expression of Cre recombinase and subsequently enables the selection of cells lacking the chromosome by culturing in a medium that includes ganciclovir (GCV). Cells harboring only two copies of chromosome 21 were efficiently induced by transfection of a Cre expression vector, indicating that this approach is useful for eliminating a targeted chromosome.

Appearance and evolution of the specific chromosomal rearrangements associated with malignant transformation of mouse m5S cells

International Nuclear Information System (INIS)

Kodama, S.; Okumura, Y.; Komatsu, K.; Sasaki, M.S.

1991-01-01

Chromosomal alterations were studied during the acquisition of malignant phenotypes in two karyotypically distinct cells isolated from transformed foci induced by x-irradiation in mouse m5S cells. Because the transformants, despite foci origin, showed low ability to grow in agar, they were cultured in vitro with serial transfer schedules to allow further cell generations and assayed for anchorage independence (AI) at each passage level. The AI frequency increased with the cell doubling numbers. Chromosome analysis showed that a focus was one cell origin, but the transformants showed karyotypic instability during cell proliferation, giving rise to the rearrangements clustered in the distal region of the specific chromosomes. These rearrangements appeared to be directed toward the acquisition of malignant phenotypes. Analysis of the types and sites of rearrangements indicated that a mechanism exists that induces frequent rearrangements of the specific region of a chromosome during the process of transformation into the malignant state

Site-specific integration of CAR gene into Jurkat T cells with a linear close-ended AAV-based DNA vector for CAR-T engineering.

Science.gov (United States)

Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun

2016-09-01

To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.

Heterochromatin and rDNA sites distribution in the holocentric chromosomes of Cuscuta approximata Bab. (Convolvulaceae).

Science.gov (United States)

Guerra, Marcelo; García, Miguel A

2004-02-01

Cuscuta is a widely distributed genus of holoparasitic plants. Holocentric chromosomes have been reported only in species of one of its subgenera (Cuscuta subg. Cuscuta). In this work, a representative of this subgenus, Cuscuta approximata, was investigated looking for its mitotic and meiotic chromosome behaviour and the heterochromatin distribution. The mitotic chromosomes showed neither primary constriction nor Rabl orientation whereas the meiotic ones exhibited the typical quadripartite structure characteristic of holocentrics, supporting the assumption of holocentric chromosomes as a synapomorphy of Cuscuta subg. Cuscuta. Chromosomes and interphase nuclei displayed many heterochromatic blocks that stained deeply with hematoxylin, 4',6-diamidino-2-phenylindole (DAPI), or after C banding. The banded karyotype showed terminal or subterminal bands in all chromosomes and central bands in some of them. The single pair of 45S rDNA sites was observed at the end of the largest chromosome pair, close to a DAPI band and a 5S rDNA site. Two other 5S rDNA site pairs were found, both closely associated with DAPI bands. The noteworthy giant nuclei of glandular cells of petals and ovary wall exhibited large chromocentres typical of polytenic nuclei. The chromosomal location of heterochromatin and rDNA sites and the structure of the endoreplicated nuclei of C. approximata seemed to be similar to those known in monocentric nuclei, suggesting that centromeric organization has little or no effect on chromatin organization.

Dual-In/Out strategy for genes integration into bacterial chromosome: a novel approach to step-by-step construction of plasmid-less marker-less recombinant E. coli strains with predesigned genome structure

Directory of Open Access Journals (Sweden)

Biryukova Irina V

2008-08-01

Full Text Available Abstract Background The development of modern producer strains with metabolically engineered pathways poses special problems that often require manipulating many genes and expressing them individually at different levels or under separate regulatory controls. The construction of plasmid-less marker-less strains has many advantages for the further practical exploitation of these bacteria in industry. Such producer strains are usually constructed by sequential chromosome modifications including deletions and integration of genetic material. For these purposes complex methods based on in vitro and in vivo recombination processes have been developed. Results Here, we describe the new scheme of insertion of the foreign DNA for step-by-step construction of plasmid-less marker-less recombinant E. coli strains with chromosome structure designed in advance. This strategy, entitled as Dual-In/Out, based on the initial Red-driven insertion of artificial φ80-attB sites into desired points of the chromosome followed by two site-specific recombination processes: first, the φ80 system is used for integration of the recombinant DNA based on selective marker-carrier conditionally-replicated plasmid with φ80-attP-site, and second, the λ system is used for excision of inserted vector part, including the plasmid ori-replication and the marker, flanked by λ-attL/R-sites. Conclusion The developed Dual-In/Out strategy is a rather straightforward, but convenient combination of previously developed recombination methods: phages site-specific and general Red/ET-mediated. This new approach allows us to detail the design of future recombinant marker-less strains, carrying, in particular, rather large artificial insertions that could be difficult to introduce by usually used PCR-based Recombineering procedure. The developed strategy is simple and could be particularly useful for construction of strains for the biotechnological industry.

FLP recombinase-mediated site-specific recombination in silkworm, Bombyx mori.

Directory of Open Access Journals (Sweden)

Ding-Pei Long

Full Text Available A comprehensive understanding of gene function and the production of site-specific genetically modified mutants are two major goals of genetic engineering in the post-genomic era. Although site-specific recombination systems have been powerful tools for genome manipulation of many organisms, they have not yet been established for use in the manipulation of the silkworm Bombyx mori genome. In this study, we achieved site-specific excision of a target gene at predefined chromosomal sites in the silkworm using a FLP/FRT site-specific recombination system. We first constructed two stable transgenic target silkworm strains that both contain a single copy of the transgene construct comprising a target gene expression cassette flanked by FRT sites. Using pre-blastoderm microinjection of a FLP recombinase helper expression vector, 32 G3 site-specific recombinant transgenic individuals were isolated from five of 143 broods. The average frequency of FLP recombinase-mediated site-specific excision in the two target strains genome was approximately 3.5%. This study shows that it is feasible to achieve site-specific recombination in silkworms using the FLP/FRT system. We conclude that the FLP/FRT system is a useful tool for genome manipulation in the silkworm. Furthermore, this is the first reported use of the FLP/FRT system for the genetic manipulation of a lepidopteran genome and thus provides a useful reference for the establishment of genome manipulation technologies in other lepidopteran species.

Engineering of Systematic Elimination of a Targeted Chromosome in Human Cells

Directory of Open Access Journals (Sweden)

Hiroshi Sato

2017-01-01

Full Text Available Embryonic trisomy leads to abortion or congenital genetic disorders in humans. The most common autosomal chromosome abnormalities are trisomy of chromosomes 13, 18, and 21. Although alteration of gene dosage is thought to contribute to disorders caused by extra copies of chromosomes, genes associated with specific disease phenotypes remain unclear. To generate a normal cell from a trisomic cell as a means of etiological analysis or candidate therapy for trisomy syndromes, we developed a system to eliminate a targeted chromosome from human cells. Chromosome 21 was targeted by integration of a DNA cassette in HeLa cells that harbored three copies of chromosome 21. The DNA cassette included two inverted loxP sites and a herpes simplex virus thymidine kinase (HSV-tk gene. This system causes missegregation of chromosome 21 after expression of Cre recombinase and subsequently enables the selection of cells lacking the chromosome by culturing in a medium that includes ganciclovir (GCV. Cells harboring only two copies of chromosome 21 were efficiently induced by transfection of a Cre expression vector, indicating that this approach is useful for eliminating a targeted chromosome.

Hanford Integrated Planning Process: 1993 Hanford Site-specific science and technology plan

International Nuclear Information System (INIS)

1993-12-01

This document is the FY 1993 report on Hanford Site-specific science and technology (S ampersand T) needs for cleanup of the Site as developed via the Hanford Integrated Planning Process (HIPP). It identifies cleanup problems that lack demonstrated technology solutions and technologies that require additional development. Recommendations are provided regarding allocation of funding to address Hanford's highest-priority technology improvement needs, technology development needs, and scientific research needs, all compiled from a Sitewide perspective. In the past, the S ampersand T agenda for Hanford Site cleanup was sometimes driven by scientists and technologists, with minimal input from the ''problem owners'' (i.e., Westinghouse Hanford Company [WHC] staff who are responsible for cleanup activities). At other times, the problem-owners made decisions to proceed with cleanup without adequate scientific and technological inputs. Under both of these scenarios, there was no significant stakeholder involvement in the decision-making process. One of the key objectives of HIPP is to develop an understanding of the integrated S ampersand T requirements to support the cleanup mission, (a) as defined by the needs of the problem owners, the values of the stakeholders, and the technology development expertise that exists at Hanford and elsewhere. This requires a periodic, systematic assessment of these needs and values to appropriately define a comprehensive technology development program and a complementary scientific research program. Basic to our success is a methodology that is defensible from a technical perspective and acceptable to the stakeholders

Plasmid integration in a wide range of bacteria mediated by the integrase of Lactobacillus delbrueckii bacteriophage mv4.

Science.gov (United States)

Auvray, F; Coddeville, M; Ritzenthaler, P; Dupont, L

1997-01-01

Bacteriophage mv4 is a temperate phage infecting Lactobacillus delbrueckii subsp. bulgaricus. During lysogenization, the phage integrates its genome into the host chromosome at the 3' end of a tRNA(Ser) gene through a site-specific recombination process (L. Dupont et al., J. Bacteriol., 177:586-595, 1995). A nonreplicative vector (pMC1) based on the mv4 integrative elements (attP site and integrase-coding int gene) is able to integrate into the chromosome of a wide range of bacterial hosts, including Lactobacillus plantarum, Lactobacillus casei (two strains), Lactococcus lactis subsp. cremoris, Enterococcus faecalis, and Streptococcus pneumoniae. Integrative recombination of pMC1 into the chromosomes of all of these species is dependent on the int gene product and occurs specifically at the pMC1 attP site. The isolation and sequencing of pMC1 integration sites from these bacteria showed that in lactobacilli, pMC1 integrated into the conserved tRNA(Ser) gene. In the other bacterial species where this tRNA gene is less or not conserved; secondary integration sites either in potential protein-coding regions or in intergenic DNA were used. A consensus sequence was deduced from the analysis of the different integration sites. The comparison of these sequences demonstrated the flexibility of the integrase for the bacterial integration site and suggested the importance of the trinucleotide CCT at the 5' end of the core in the strand exchange reaction. PMID:9068626

Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

Science.gov (United States)

Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

2017-07-15

Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

Protocol for chromosome-specific probe construction using PRINS, micromanipulation and DOP-PCR techniques

Directory of Open Access Journals (Sweden)

PAULO Z. PASSAMANI

2017-12-01

Full Text Available ABSTRACT Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS, micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR. Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.

A Family of Zinc Finger Proteins Is Required forChromosome-specific Pairing and Synapsis during Meiosis in C.elegans

Energy Technology Data Exchange (ETDEWEB)

Phillips, Carolyn M.; Dernburg, Abby F.

2006-06-07

Homologous chromosome pairing and synapsis are prerequisitefor accurate chromosome segregation during meiosis. Here, we show that afamily of four related C2H2 zinc-finger proteins plays a central role inthese events in C. elegans. These proteins are encoded within a tandemgene cluster. In addition to the X-specific HIM-8 protein, threeadditional paralogs collectively mediate the behavior of the fiveautosomes. Each chromosome relies on a specific member of the family topair and synapse with its homolog. These "ZIM" proteins concentrate atspecial regions called meiotic pairing centers on the correspondingchromosomes. These sites are dispersed along the nuclear envelope duringearly meiotic prophase, suggesting a role analogous to thetelomere-mediated meiotic bouquet in other organisms. To gain insightinto the evolution of these components, wecharacterized homologs in C.briggsae and C. remanei, which revealed changes in copy number of thisgene family within the nematode lineage.

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

Science.gov (United States)

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

Directory of Open Access Journals (Sweden)

Teruhiko Suzuki

Full Text Available Human artificial chromosomes (HACs are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

Human papilloma viruses and cervical tumours: mapping of integration sites and analysis of adjacent cellular sequences

International Nuclear Information System (INIS)

Klimov, Eugene; Vinokourova, Svetlana; Moisjak, Elena; Rakhmanaliev, Elian; Kobseva, Vera; Laimins, Laimonis; Kisseljov, Fjodor; Sulimova, Galina

2002-01-01

In cervical tumours the integration of human papilloma viruses (HPV) transcripts often results in the generation of transcripts that consist of hybrids of viral and cellular sequences. Mapping data using a variety of techniques has demonstrated that HPV integration occurred without obvious specificity into human genome. However, these techniques could not demonstrate whether integration resulted in the generation of transcripts encoding viral or viral-cellular sequences. The aim of this work was to map the integration sites of HPV DNA and to analyse the adjacent cellular sequences. Amplification of the INTs was done by the APOT technique. The APOT products were sequenced according to standard protocols. The analysis of the sequences was performed using BLASTN program and public databases. To localise the INTs PCR-based screening of GeneBridge4-RH-panel was used. Twelve cellular sequences adjacent to integrated HPV16 (INT markers) expressed in squamous cell cervical carcinomas were isolated. For 11 INT markers homologous human genomic sequences were readily identified and 9 of these showed significant homologies to known genes/ESTs. Using the known locations of homologous cDNAs and the RH-mapping techniques, mapping studies showed that the INTs are distributed among different human chromosomes for each tumour sample and are located in regions with the high levels of expression. Integration of HPV genomes occurs into the different human chromosomes but into regions that contain highly transcribed genes. One interpretation of these studies is that integration of HPV occurs into decondensed regions, which are more accessible for integration of foreign DNA

Condensin-driven remodelling of X chromosome topology during dosage compensation

Science.gov (United States)

Crane, Emily; Bian, Qian; McCord, Rachel Patton; Lajoie, Bryan R.; Wheeler, Bayly S.; Ralston, Edward J.; Uzawa, Satoru; Dekker, Job; Meyer, Barbara J.

2015-07-01

The three-dimensional organization of a genome plays a critical role in regulating gene expression, yet little is known about the machinery and mechanisms that determine higher-order chromosome structure. Here we perform genome-wide chromosome conformation capture analysis, fluorescent in situ hybridization (FISH), and RNA-seq to obtain comprehensive three-dimensional (3D) maps of the Caenorhabditis elegans genome and to dissect X chromosome dosage compensation, which balances gene expression between XX hermaphrodites and XO males. The dosage compensation complex (DCC), a condensin complex, binds to both hermaphrodite X chromosomes via sequence-specific recruitment elements on X (rex sites) to reduce chromosome-wide gene expression by half. Most DCC condensin subunits also act in other condensin complexes to control the compaction and resolution of all mitotic and meiotic chromosomes. By comparing chromosome structure in wild-type and DCC-defective embryos, we show that the DCC remodels hermaphrodite X chromosomes into a sex-specific spatial conformation distinct from autosomes. Dosage-compensated X chromosomes consist of self-interacting domains (~1 Mb) resembling mammalian topologically associating domains (TADs). TADs on X chromosomes have stronger boundaries and more regular spacing than on autosomes. Many TAD boundaries on X chromosomes coincide with the highest-affinity rex sites and become diminished or lost in DCC-defective mutants, thereby converting the topology of X to a conformation resembling autosomes. rex sites engage in DCC-dependent long-range interactions, with the most frequent interactions occurring between rex sites at DCC-dependent TAD boundaries. These results imply that the DCC reshapes the topology of X chromosomes by forming new TAD boundaries and reinforcing weak boundaries through interactions between its highest-affinity binding sites. As this model predicts, deletion of an endogenous rex site at a DCC-dependent TAD boundary using

Ten alien chromosome additions of Gossypium hirsutum-Gossypium bickii developed by integrative uses of GISH and species-specific SSR markers.

Science.gov (United States)

Tang, Dong; Feng, Shouli; Li, Sai; Chen, Yu; Zhou, Baoliang

2018-03-27

Gossypium bickii: (2n = 26, G 1 G 1 ), a wild diploid cotton, carries many favourable traits. However, these favourable traits cannot be directly transferred into G. hirsutum (2n = 52, AADD) cultivars due to the differences in genomes. Monosomic alien addition lines (MAALs) are considered an invaluable tool for the introgression of genes of interest from wild relatives into cultivated crops. In this study, the G. hirsutum-G. bickii amphidiploid (2n = 78, AADDG 1 G 1 ) was backcrossed with G. hirsutum to develop alien additions containing individual G. bickii chromosomes in a G. hirsutum background. Genomic in situ hybridization was employed to detect the number of alien chromosomes added to the backcross progenies. A total of 183 G. bickii-specific DNA markers were developed to discriminate the identities of the G. bickii chromosomes added to G. hirsutum and assess the alien chromosome transmissibility. Chromosomes 4G b and 13G b showed the highest transmissibility, while chromosomes 1G b , 7G b and 11G b showed the lowest. Ten of the 13 possible G. hirsutum-G. bickii MAALs were isolated and characterized, which will lay the foundation for transferring resistance genes of G. bickii into G. hirsutum, as well as for gene assignment, physical mapping, and selective isolation and mapping of cDNAs for particular G. bickii chromosomes. The strategies of how to use MAALs to develop varieties with the trait of interest from wild species (such as glanded plant-glandless seed) were proposed and discussed.

Using RAD-seq to recognize sex-specific markers and sex chromosome systems.

Science.gov (United States)

Gamble, Tony

2016-05-01

Next-generation sequencing methods have initiated a revolution in molecular ecology and evolution (Tautz et al. ). Among the most impressive of these sequencing innovations is restriction site-associated DNA sequencing or RAD-seq (Baird et al. ; Andrews et al. ). RAD-seq uses the Illumina sequencing platform to sequence fragments of DNA cut by a specific restriction enzyme and can generate tens of thousands of molecular genetic markers for analysis. One of the many uses of RAD-seq data has been to identify sex-specific genetic markers, markers found in one sex but not the other (Baxter et al. ; Gamble & Zarkower ). Sex-specific markers are a powerful tool for biologists. At their most basic, they can be used to identify the sex of an individual via PCR. This is useful in cases where a species lacks obvious sexual dimorphism at some or all life history stages. For example, such tests have been important for studying sex differences in life history (Sheldon ; Mossman & Waser ), the management and breeding of endangered species (Taberlet et al. ; Griffiths & Tiwari ; Robertson et al. ) and sexing embryonic material (Hacker et al. ; Smith et al. ). Furthermore, sex-specific markers allow recognition of the sex chromosome system in cases where standard cytogenetic methods fail (Charlesworth & Mank ; Gamble & Zarkower ). Thus, species with male-specific markers have male heterogamety (XY) while species with female-specific markers have female heterogamety (ZW). In this issue, Fowler & Buonaccorsi () illustrate the ease by which RAD-seq data can generate sex-specific genetic markers in rockfish (Sebastes). Moreover, by examining RAD-seq data from two closely related rockfish species, Sebastes chrysomelas and Sebastes carnatus (Fig. ), Fowler & Buonaccorsi () uncover shared sex-specific markers and a conserved sex chromosome system. © 2016 John Wiley & Sons Ltd.

Site specific information in site selection

International Nuclear Information System (INIS)

Aeikaes, T.; Hautojaervi, A.

1998-01-01

based on site specific information and evaluate the uncertainty is an important part of the discussion in the integrated work between site characterisation and safety assessment

Genetic integrity of the human Y chromosome exposed to groundwater arsenic

Directory of Open Access Journals (Sweden)

Ali Sher

2010-08-01

Full Text Available Abstract Background Arsenic is a known human carcinogen reported to cause chromosomal deletions and genetic anomalies in cultured cells. The vast human population inhabiting the Ganges delta in West Bengal, India and Bangladesh is exposed to critical levels of arsenic present in the groundwater. The genetic and physiological mechanism of arsenic toxicity in the human body is yet to be fully established. In addition, lack of animal models has made work on this line even more challenging. Methods Human male blood samples were collected with their informed consent from 5 districts in West Bengal having groundwater arsenic level more than 50 μg/L. Isolation of genomic DNA and preparation of metaphase chromosomes was done using standard protocols. End point PCR was performed for established sequence tagged sites to ascertain the status of recombination events. Single nucleotide variants of candidate genes and amplicons were carried out using appropriate restriction enzymes. The copy number of DYZ1 array per haploid genome was calculated using real time PCR and its chromosomal localization was done by fluorescence in-situ hybridization (FISH. Results We studied effects of arsenic exposure on the human Y chromosome in males from different areas of West Bengal focusing on known recombination events (P5-P1 proximal; P5-P1 distal; gr/gr; TSPY-TSPY, b1/b3 and b2/b3, single nucleotide variants (SNVs of a few candidate Y-linked genes (DAZ, TTY4, BPY2, GOLGA2LY and the amplicons of AZFc region. Also, possible chromosomal reorganization of DYZ1 repeat arrays was analyzed. Barring a few microdeletions, no major changes were detected in blood DNA samples. SNV analysis showed a difference in some alleles. Similarly, DYZ1 arrays signals detected by FISH were found to be affected in some males. Conclusions Our Y chromosome analysis suggests that the same is protected from the effects of arsenic by some unknown mechanisms maintaining its structural and functional

Rapid and efficient introduction of a foreign gene into bacterial artificial chromosome-cloned varicella vaccine by Tn7-mediated site-specific transposition

International Nuclear Information System (INIS)

Somboonthum, Pranee; Koshizuka, Tetsuo; Okamoto, Shigefumi; Matsuura, Masaaki; Gomi, Yasuyuki; Takahashi, Michiaki; Yamanishi, Koichi; Mori, Yasuko

2010-01-01

Using a rapid and reliable system based on Tn7-mediated site-specific transposition, we have successfully constructed a recombinant Oka varicella vaccine (vOka) expressing the mumps virus (MuV) fusion protein (F). The backbone of the vector was our previously reported vOka-BAC (bacterial artificial chromosome) genome. We inserted the transposon Tn7 attachment sequence, LacZα-mini-attTn7, into the region between ORF12 and ORF13 to generate a vOka-BAC-Tn genome. The MuV-F expressing cassette was transposed into the vOka-BAC genome at the mini-attTn7 transposition site. MuV-F protein was expressed in recombinant virus, rvOka-F infected cells. In addition, the MuV-F protein was cleaved in the rvOka-F infected cells as in MuV-infected cells. The growth of rvOka-F was similar to that of the original recombinant vOka without the F gene. Thus, we show that Tn7-mediated transposition is an efficient method for introducing a foreign gene expression cassette into the vOka-BAC genome as a live virus vector.

Identification of Cyclin-dependent Kinase 1 Specific Phosphorylation Sites by an In Vitro Kinase Assay.

Science.gov (United States)

Cui, Heying; Loftus, Kyle M; Noell, Crystal R; Solmaz, Sozanne R

2018-05-03

Cyclin-dependent kinase 1 (Cdk1) is a master controller for the cell cycle in all eukaryotes and phosphorylates an estimated 8 - 13% of the proteome; however, the number of identified targets for Cdk1, particularly in human cells is still low. The identification of Cdk1-specific phosphorylation sites is important, as they provide mechanistic insights into how Cdk1 controls the cell cycle. Cell cycle regulation is critical for faithful chromosome segregation, and defects in this complicated process lead to chromosomal aberrations and cancer. Here, we describe an in vitro kinase assay that is used to identify Cdk1-specific phosphorylation sites. In this assay, a purified protein is phosphorylated in vitro by commercially available human Cdk1/cyclin B. Successful phosphorylation is confirmed by SDS-PAGE, and phosphorylation sites are subsequently identified by mass spectrometry. We also describe purification protocols that yield highly pure and homogeneous protein preparations suitable for the kinase assay, and a binding assay for the functional verification of the identified phosphorylation sites, which probes the interaction between a classical nuclear localization signal (cNLS) and its nuclear transport receptor karyopherin α. To aid with experimental design, we review approaches for the prediction of Cdk1-specific phosphorylation sites from protein sequences. Together these protocols present a very powerful approach that yields Cdk1-specific phosphorylation sites and enables mechanistic studies into how Cdk1 controls the cell cycle. Since this method relies on purified proteins, it can be applied to any model organism and yields reliable results, especially when combined with cell functional studies.

Site-specific integration in CHO cells mediated by CRISPR/Cas9 and homology-directed DNA repair pathway

DEFF Research Database (Denmark)

Lee, Jae Seong; Beuchert Kallehauge, Thomas; Pedersen, Lasse Ebdrup

2015-01-01

gene integration into site-specific loci in CHO cells using CRISPR/Cas9 genome editing system and compatible donor plasmid harboring a gene of interest (GOI) and short homology arms. This strategy has enabled precise insertion of a 3.7-kb gene expression cassette at defined loci in CHO cells following...

Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

Science.gov (United States)

Roa, Fernando; Guerra, Marcelo

2015-01-01

5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.

Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

Science.gov (United States)

Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

2018-07-01

Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

A large-scale chromosome-specific SNP discovery guideline.

Science.gov (United States)

Akpinar, Bala Ani; Lucas, Stuart; Budak, Hikmet

2017-01-01

Single-nucleotide polymorphisms (SNPs) are the most prevalent type of variation in genomes that are increasingly being used as molecular markers in diversity analyses, mapping and cloning of genes, and germplasm characterization. However, only a few studies reported large-scale SNP discovery in Aegilops tauschii, restricting their potential use as markers for the low-polymorphic D genome. Here, we report 68,592 SNPs found on the gene-related sequences of the 5D chromosome of Ae. tauschii genotype MvGB589 using genomic and transcriptomic sequences from seven Ae. tauschii accessions, including AL8/78, the only genotype for which a draft genome sequence is available at present. We also suggest a workflow to compare SNP positions in homologous regions on the 5D chromosome of Triticum aestivum, bread wheat, to mark single nucleotide variations between these closely related species. Overall, the identified SNPs define a density of 4.49 SNPs per kilobyte, among the highest reported for the genic regions of Ae. tauschii so far. To our knowledge, this study also presents the first chromosome-specific SNP catalog in Ae. tauschii that should facilitate the association of these SNPs with morphological traits on chromosome 5D to be ultimately targeted for wheat improvement.

Human Chromosome 7: DNA Sequence and Biology

OpenAIRE

Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.

2003-01-01

DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...

Formation of radiation induced chromosome aberrations: involvement of telomeric sequences and telomerase

International Nuclear Information System (INIS)

Pirzio, L.

2004-07-01

As telomeres are crucial for chromosome integrity; we investigated the role played by telomeric sequences in the formation and in the transmission of radio-induced chromosome rearrangements in human cells. Starting from interstitial telomeric sequences (ITS) as putative region of breakage, we showed that the radiation sensitivity is not equally distributed along chromosomes and. is not affected by ITS. On the contrary, plasmid integration sites are prone to radio-induced breaks, suggesting a possible integration at sites already characterized by fragility. However plasmids do not preferentially insert at radio-induced breaks in human cells immortalized by telomerase. These cells showed remarkable karyotype stability even after irradiation, suggesting a role of telomerase in the genome maintenance despite functional telomeres. Finally, we showed that the presence of more breaks in a cell favors the repair, leading to an increase of transmissible rearrangements. (author)

Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

Energy Technology Data Exchange (ETDEWEB)

D' Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. (Universita di Bari (Italy)); Antonacci, R. (Instituto Anatomia Umana Normale, Modena (Italy))

1993-11-01

The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

Hanford Site Environmental Management Specification

International Nuclear Information System (INIS)

DAILY, J.L.

2001-01-01

The US Department of Energy, Richland Operations Office (RL) has established a document hierarchy as part of its integrated management system. The Strategic Plan defines the vision, values, missions, strategic goals, high-level outcomes, and the basic strategies in achieving those outcomes. As shown in Figure 1-1, the Site Specification derives requirements from the Strategic Plan and documents the top-level mission technical requirements for the work involved in the RL Hanford Site cleanup and infrastructure activities under the responsibility of the U.S. Department of Energy, Office of Environmental Management (EM). It also provides the basis for all contract technical requirements. Since this is limited to the EM work, neither the Fast Flux Test Facility (FFTF) nor the Pacific Northwest National Laboratory (PNNL) non-EM science activities are included. Figure 1-1 also shows the relationship between this Site Specification and the other Site management and planning documents. Similarly, the documents, orders, and laws referenced in this document represent only the most salient sources of requirements. Current and contractual reference data contain a complete set of source documents

Reactivation of chromosomally integrated human herpesvirus-6 by telomeric circle formation.

Directory of Open Access Journals (Sweden)

Bhupesh K Prusty

Full Text Available More than 95% of the human population is infected with human herpesvirus-6 (HHV-6 during early childhood and maintains latent HHV-6 genomes either in an extra-chromosomal form or as a chromosomally integrated HHV-6 (ciHHV-6. In addition, approximately 1% of humans are born with an inheritable form of ciHHV-6 integrated into the telomeres of chromosomes. Immunosuppression and stress conditions can reactivate latent HHV-6 replication, which is associated with clinical complications and even death. We have previously shown that Chlamydia trachomatis infection reactivates ciHHV-6 and induces the formation of extra-chromosomal viral DNA in ciHHV-6 cells. Here, we propose a model and provide experimental evidence for the mechanism of ciHHV-6 reactivation. Infection with Chlamydia induced a transient shortening of telomeric ends, which subsequently led to increased telomeric circle (t-circle formation and incomplete reconstitution of circular viral genomes containing single viral direct repeat (DR. Correspondingly, short t-circles containing parts of the HHV-6 DR were detected in cells from individuals with genetically inherited ciHHV-6. Furthermore, telomere shortening induced in the absence of Chlamydia infection also caused circularization of ciHHV-6, supporting a t-circle based mechanism for ciHHV-6 reactivation.

Chromosome damage in Chinese hamster cells produced by 125I-UdR at the site of its incorporation

International Nuclear Information System (INIS)

Hughes, W.L.; Weinblatt, A.C.; Prensky, W.

1978-01-01

Metaphase chromosomal aberrations were produced by 125 I-labeled iododeoxyuridine ( 125 I-UdR) incorporated into Chinese hamster Don cells at the end of the S-period of the cell cycle. Chromosome damage and the number of autoradiographic silver grains were recorded for whole cells, for chromosome pairs 4 and 5 and for the X and the Y chromosomes. The X and the Y chromosomes, which label late in S, were at least twice as heavily labeled as chromosome pairs 4 and 5 - two readily recognizable autosomes of similar size. The incidence of chromosome damage was at least six times that which would have been expected from equivalent doses of X-rays and the incidence of damage was directly related to the number of silver grains over each chromosome. It is estimated that it takes four to ten disintegrations to produce a visible chromosome aberration. The finding that chromosome damage is localized at the site of the 125 I decay is most readily explained by the high flux of low energy Auger electrons occurring at the site of the decay of the incorporated 125 I atom. (Auth.)

Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss B. Fedtsch,1915 (Apiaceae

Directory of Open Access Journals (Sweden)

R. K. Chahota

2011-11-01

Full Text Available The fluorescent in situ hybridization (FISH technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in B. persicum, an endangered medicinal plant of North Western Himalayas.

Sex chromosome differentiation and the W- and Z-specific loci in Xenopus laevis.

Science.gov (United States)

Mawaribuchi, Shuuji; Takahashi, Shuji; Wada, Mikako; Uno, Yoshinobu; Matsuda, Yoichi; Kondo, Mariko; Fukui, Akimasa; Takamatsu, Nobuhiko; Taira, Masanori; Ito, Michihiko

2017-06-15

Genetic sex-determining systems in vertebrates include two basic types of heterogamety; XX (female)/XY (male) and ZZ (male)/ZW (female) types. The African clawed frog Xenopus laevis has a ZZ/ZW-type sex-determining system. In this species, we previously identified a W-specific sex (female)-determining gene dmw, and specified W and Z chromosomes, which could be morphologically indistinguishable (homomorphic). In addition to dmw, we most recently discovered two genes, named scanw and ccdc69w, and one gene, named capn5z in the W- and Z-specific regions, respectively. In this study, we revealed the detail structures of the W/Z-specific loci and genes. Sequence analysis indicated that there is almost no sequence similarity between 278kb W-specific and 83kb Z-specific sequences on chromosome 2Lq32-33, where both the transposable elements are abundant. Synteny and phylogenic analyses indicated that all the W/Z-specific genes might have emerged independently. Expression analysis demonstrated that scanw and ccdc69w or capn5z are expressed in early differentiating ZW gonads or testes, thereby suggesting possible roles in female or male development, respectively. Importantly, the sex-determining gene (SDG) dmw might have been generated after allotetraploidization, thereby indicating the construction of the new sex-determining system by dmw after species hybridization. Furthermore, by direct genotyping, we confirmed that diploid WW embryos developed into normal female frogs, which indicate that the Z-specific region is not essential for female development. Overall, these findings indicate that sex chromosome differentiation has started, although no heteromorphic sex chromosomes are evident yet, in X. laevis. Homologous recombination suppression might have promoted the accumulation of mutations and transposable elements, and enlarged the W/Z-specific regions, thereby resulting in differentiation of the W/Z chromosomes. Copyright © 2016 Elsevier Inc. All rights reserved.

Construction of physical maps for the sex-specific regions of papaya sex chromosomes

Directory of Open Access Journals (Sweden)

Na Jong-Kuk

2012-05-01

Full Text Available Abstract Background Papaya is a major fruit crop in tropical and subtropical regions worldwide. It is trioecious with three sex forms: male, female, and hermaphrodite. Sex determination is controlled by a pair of nascent sex chromosomes with two slightly different Y chromosomes, Y for male and Yh for hermaphrodite. The sex chromosome genotypes are XY (male, XYh (hermaphrodite, and XX (female. The papaya hermaphrodite-specific Yh chromosome region (HSY is pericentromeric and heterochromatic. Physical mapping of HSY and its X counterpart is essential for sequencing these regions and uncovering the early events of sex chromosome evolution and to identify the sex determination genes for crop improvement. Results A reiterate chromosome walking strategy was applied to construct the two physical maps with three bacterial artificial chromosome (BAC libraries. The HSY physical map consists of 68 overlapped BACs on the minimum tiling path, and covers all four HSY-specific Knobs. One gap remained in the region of Knob 1, the only knob structure shared between HSY and X, due to the lack of HSY-specific sequences. This gap was filled on the physical map of the HSY corresponding region in the X chromosome. The X physical map consists of 44 BACs on the minimum tiling path with one gap remaining in the middle, due to the nature of highly repetitive sequences. This gap was filled on the HSY physical map. The borders of the non-recombining HSY were defined genetically by fine mapping using 1460 F2 individuals. The genetically defined HSY spanned approximately 8.5 Mb, whereas its X counterpart extended about 5.4 Mb including a 900 Kb region containing the Knob 1 shared by the HSY and X. The 8.5 Mb HSY corresponds to 4.5 Mb of its X counterpart, showing 4 Mb (89% DNA sequence expansion. Conclusion The 89% increase of DNA sequence in HSY indicates rapid expansion of the Yh chromosome after genetic recombination was suppressed 2–3 million years ago. The

Distribution of X-ray-induced chromosome breakpoints in Down syndrome lymphocytes

International Nuclear Information System (INIS)

Shafik, H.M.; Au, W.W.; Whorton, E.B. Jr.; Legator, M.S.

1990-01-01

Down syndrome (DS) individuals are known to be predisposed to develop leukemia and their lymphocytes are highly sensitive to the induction of chromosome aberrations by X-rays. A study was conducted to identify the chromosome breakpoints and to evaluate whether site specificity for chromosome breakage and rearrangement may exist which may explain the predisposition phenomenon. DS lymphocytes at the G1 phase of the cell cycle were irradiated with 300, 450, and 600 rad of X-rays. Cells were harvested after 3 days in culture and 193 G-banded karyotypes were analyzed to identify the induced chromosome abnormalities. Out of 273 breakpoints identified, 122 were involved in the formation of stable chromosome rearrangements and 151 in the formation of unstable abnormalities. The Poisson analysis of these breakpoints demonstrated that 16 chromosome bands located in chromosomes 1, 3, 7, 12, 17, 19 and X were preferentially involved in breakage and rearrangement (P less than 0.05). These 16 bands are also found to be locations of cancer breakpoints, oncogenes, or fragile sites. Many abnormal cells were observed to carry stable chromosome rearrangements only. Therefore, these cells are presumed to be compatible with survival and to be initiated in the transformation process. We propose that similar stable and site-specific chromosome rearrangements may exist in proliferating cells in DS individuals after exposure to clastogens and that this abnormality predisposes them to develop leukemia

Radiation hybrids from human chromosome 3: A basis for the construction of region and specific sublibraries

International Nuclear Information System (INIS)

Atchison, L.; Cosmis, R.L.; Atchison, M.L.

1990-01-01

The authors are interested in identifying genes on human chromosome involved in disease processes. To date at least 20 different loci on this chromosome are implicated with various disease states. DNA libraries containing clones derived from a small chromosomal subregion implicated in a particular disease would greatly assist these studies. They have utilized the radiation hybrid (RH) technique to generate a series of somatic cell hybrids that contain small segments of human chromosome 3 as the only human genetic material. A Chinese hamster-human cell hybrid (Q314-2) containing only human chromosome 3 was used to prepare radiation hybrids. Cells were lethally X-irradiated with 6,000 rads and fused to Urd(??) Chinese hamster cells by PEG 1000 treatment. The majority of hybrids (>72%) analyzed retained portions of chromosome 3. The amount of chromosome 3 in each hybrid ranged from nearly all of the chromosome to very little. Currently these hybrids are being further characterized with single copy probes of known map location in order to isolate regions of chromosome 3 that contain specific disease locus. These reduced hybrids can then be used for the construction of region specific libraries and for the generation of new DNA probes from the specific region of interest

Tissue-specific features of the X chromosome and nucleolus spatial dynamics in a malaria mosquito, Anopheles atroparvus.

Science.gov (United States)

Bondarenko, Semen M; Artemov, Gleb N; Sharakhov, Igor V; Stegniy, Vladimir N

2017-01-01

Spatial organization of chromosome territories is important for maintenance of genomic stability and regulation of gene expression. Recent studies have shown tissue-specific features of chromosome attachments to the nuclear envelope in various organisms including malaria mosquitoes. However, other spatial characteristics of nucleus organization, like volume and shape of chromosome territories, have not been studied in Anopheles. We conducted a thorough analysis of tissue-specific features of the X chromosome and nucleolus volume and shape in follicular epithelium and nurse cells of the Anopheles atroparvus ovaries using a modern open-source software. DNA of the polytene X chromosome from ovarian nurse cells was obtained by microdissection and was used as a template for amplification with degenerate oligo primers. A fluorescently labeled X chromosome painting probe was hybridized with formaldehyde-fixed ovaries of mosquitoes using a 3D-FISH method. The nucleolus was stained by immunostaining with an anti-fibrillarin antibody. The analysis was conducted with TANGO-a software for a chromosome spatial organization analysis. We show that the volume and position of the X chromosome have tissue-specific characteristics. Unlike nurse cell nuclei, the growth of follicular epithelium nuclei is not accompanied with the proportional growth of the X chromosome. However, the shape of the X chromosome does not differ between the tissues. The dynamics of the X chromosome attachment regions location is tissue-specific and it is correlated with the process of nucleus growth in follicular epithelium and nurse cells.

ATM promotes the obligate XY crossover and both crossover control and chromosome axis integrity on autosomes.

Directory of Open Access Journals (Sweden)

Marco Barchi

2008-05-01

Full Text Available During meiosis in most sexually reproducing organisms, recombination forms crossovers between homologous maternal and paternal chromosomes and thereby promotes proper chromosome segregation at the first meiotic division. The number and distribution of crossovers are tightly controlled, but the factors that contribute to this control are poorly understood in most organisms, including mammals. Here we provide evidence that the ATM kinase or protein is essential for proper crossover formation in mouse spermatocytes. ATM deficiency causes multiple phenotypes in humans and mice, including gonadal atrophy. Mouse Atm-/- spermatocytes undergo apoptosis at mid-prophase of meiosis I, but Atm(-/- meiotic phenotypes are partially rescued by Spo11 heterozygosity, such that ATM-deficient spermatocytes progress to meiotic metaphase I. Strikingly, Spo11+/-Atm-/- spermatocytes are defective in forming the obligate crossover on the sex chromosomes, even though the XY pair is usually incorporated in a sex body and is transcriptionally inactivated as in normal spermatocytes. The XY crossover defect correlates with the appearance of lagging chromosomes at metaphase I, which may trigger the extensive metaphase apoptosis that is observed in these cells. In addition, control of the number and distribution of crossovers on autosomes appears to be defective in the absence of ATM because there is an increase in the total number of MLH1 foci, which mark the sites of eventual crossover formation, and because interference between MLH1 foci is perturbed. The axes of autosomes exhibit structural defects that correlate with the positions of ongoing recombination. Together, these findings indicate that ATM plays a role in both crossover control and chromosome axis integrity and further suggests that ATM is important for coordinating these features of meiotic chromosome dynamics.

Site-Specific ecological risk assessment. Case-study 2

DEFF Research Database (Denmark)

Jensen, John

“Development of a decision support system for sustainable management of contaminated land by linking bioavailability, ecological risk and ground water pollution of organic pollutants”or in short “LIBERATION”. The presentation includes examples on how to scale and integrate the results from various scientific......The decision supporting and integrating assessment tool, TRIAD, is used site-specific on PAH- and heavy metal contaminated sites in Denmark. The various aspects of the TRIAD approach are used on a set of chemistry-, ecotoxicology- and ecology related data collected among others in the EU project...

Report of the Fourth international workshop on human chromosome 18 mapping 1996

International Nuclear Information System (INIS)

Silverman, G.A.; Overhauser, J.; Gerken, S.; Aburomia, R.; O'Connell, P.; Krauter, K.S.; Detera-Wadleigh, S.D.; Yoshikawa, T.; Collins, A.R.; Geurts van Kessel, A.

1996-01-01

The fourth international workshop on human chromosome 18 mapping was held in Boston, Massachusetts, USA on October 7-9, 1996. The workshop was attended by 34 participants from 7 countries. The goals of the workshop were to (1) generate integrated genetic and physical maps, (2) update the transcriptional map, (3) assess the syntenic relationships between human chromosome 18 and the mouse genome, and (4) establish a chromosome 18 web site

Complete Genome Sequence of Germline Chromosomally Integrated Human Herpesvirus 6A and Analyses Integration Sites Define a New Human Endogenous Virus with Potential to Reactivate as an Emerging Infection.

OpenAIRE

Tweedy, J; Spyrou, MA; Pearson, M; Lassner, D; Kuhl, U; Gompels, UA

2016-01-01

Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated "CiHHV-6A/B". These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, imp...

Use of the integration elements encoded by the temperate lactococcal bacteriophage TP901-1

DEFF Research Database (Denmark)

Brøndsted, Lone; Hammer, Karin

1999-01-01

Previously we showed that only one phage-expressed protein (Orf1), a 425-bp region upstream of the orf1 gene (presumably encoding a promoter), and the attP region are necessary and also sufficient for integration of the bacteriophage TP901-1 genome into the chromosome of Lactococcus lactis subsp......P region seem to be necessary for site-specific integration of the temperate bacteriophage TP901-1. By use of the integrative elements (attP and orf1) expressed by the temperate lactococcal bacteriophage TP901-1, a system for obtaining stable chromosomal single-copy transcriptional fusions in L. lactis...

Improvement of Fibrinolytic Activity of Bacillus subtilis 168 by Integration of a Fibrinolytic Gene into the Chromosome.

Science.gov (United States)

Jeong, Seon-Ju; Park, Ji Yeong; Lee, Jae Yong; Lee, Kang Wook; Cho, Kye Man; Kim, Gyoung Min; Shin, Jung-Hye; Kim, Jong-Sang; Kim, Jeong Hwan

2015-11-01

Fibrinolytic enzyme genes (aprE2, aprE176, and aprE179) were introduced into the Bacillus subtilis 168 chromosome without any antibiotic resistance gene. An integration vector, pDG1662, was used to deliver the genes into the amyE site of B. subtilis 168. Integrants, SJ3-5nc, SJ176nc, and SJ179nc, were obtained after two successive homologous recombinations. The integration of each fibrinolytic gene into the middle of the amyE site was confirmed by phenotypes (Amy(-), Spec(S)) and colony PCR results for these strains. The fibrinolytic activities of the integrants were higher than that of B. subtilis 168 by at least 3.2-fold when grown in LB broth. Cheonggukjang was prepared by inoculating each of B. subtilis 168, SJ3-5nc, SJ176nc, and SJ179nc, and the fibrinolytic activity of cheonggukjang was 4.6 ± 0.7, 10.8 ± 0.9, 7.0 ± 0.6, and 8.0 ± 0.2 (U/g of cheonggukjang), respectively at 72 h. These results showed that construction of B. subtilis strains with enhanced fibrinolytic activities is possible by integration of a strong fibrinolytic gene via a marker-free manner.

System specification for the integrated monitoring and surveillance system

International Nuclear Information System (INIS)

1997-09-01

This System Specification establishes the requirements for the Plutonium Focus Area (PFA) Integrated Monitoring and Surveillance System (IMSS). In this document, ''Integrated Monitoring and Surveillance System'' is used to describe the concept of integrated sensors, computers, personnel, and systems that perform the functions of sensing conditions, acquiring data, monitoring environmental safety and health, controlling and accounting for materials, monitoring material stability, monitoring container integrity, transferring data, and analyzing, reporting, and storing data. This concept encompasses systems (e.g. sensors, personnel, databases, etc.) that are already in place at the sites but may require modifications or additions to meet all identified surveillance requirements. The purpose of this System Specification is to provide Department of Energy (DOE) sites that store plutonium materials with a consolidation of all known requirements for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides. This compilation may be used (1) as a baseline for surveillance system design specifications where 3013 packages of stabilized plutonium metals and oxides will be stored and monitored; (2) as a checklist for evaluating existing surveillance systems to ensure that all requirements are met for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides; and (3) as a baseline for preparing procurement specifications tailored for site specific storage and surveillance of 3013 packages of stabilized plutonium metals and oxides

Identification of Bacillus anthracis specific chromosomal sequences by suppressive subtractive hybridization

Directory of Open Access Journals (Sweden)

Redkar Rajendra

2004-02-01

Full Text Available Abstract Background Bacillus anthracis, Bacillus thuringiensis and Bacillus cereus are closely related members of the B. cereus-group of bacilli. Suppressive subtractive hybridization (SSH was used to identify specific chromosomal sequences unique to B. anthracis. Results Two SSH libraries were generated. Genomic DNA from plasmid-cured B. anthracis was used as the tester DNA in both libraries, while genomic DNA from either B. cereus or B. thuringiensis served as the driver DNA. Progressive screening of the libraries by colony filter and Southern blot analyses identified 29 different clones that were specific for the B. anthracis chromosome relative not only to the respective driver DNAs, but also to seven other different strains of B. cereus and B. thuringiensis included in the process. The nucleotide sequences of the clones were compared with those found in genomic databases, revealing that over half of the clones were located into 2 regions on the B. anthracis chromosome. Conclusions Genes encoding potential cell wall synthesis proteins dominated one region, while bacteriophage-related sequences dominated the other region. The latter supports the hypothesis that acquisition of these bacteriophage sequences occurred during or after speciation of B. anthracis relative to B. cereus and B. thuringiensis. This study provides insight into the chromosomal differences between B. anthracis and its closest phylogenetic relatives.

Data Mining Empowers the Generation of a Novel Class of Chromosome-specific DNA Probes

Energy Technology Data Exchange (ETDEWEB)

Zeng, Hui; Weier, Heinz-Ulrich G.; Kwan, Johnson; Wang, Mei; O' Brien, Benjamin

2011-03-08

Probes that allow accurate delineation of chromosome-specific DNA sequences in interphase or metaphase cell nuclei have become important clinical tools that deliver life-saving information about the gender or chromosomal make-up of a product of conception or the probability of an embryo to implant, as well as the definition of tumor-specific genetic signatures. Often such highly specific DNA probes are proprietary in nature and have been the result of extensive probe selection and optimization procedures. We describe a novel approach that eliminates costly and time consuming probe selection and testing by applying data mining and common bioinformatics tools. Similar to a rational drug design process in which drug-protein interactions are modeled in the computer, the rational probe design described here uses a set of criteria and publicly available bioinformatics software to select the desired probe molecules from libraries comprised of hundreds of thousands of probe molecules. Examples describe the selection of DNA probes for the human X and Y chromosomes, both with unprecedented performance, but in a similar fashion, this approach can be applied to other chromosomes or species.

Tus-Ter as a tool to study site-specific DNA replication perturbation in eukaryotes

DEFF Research Database (Denmark)

Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

2014-01-01

The high-affinity binding of the Tus protein to specific 21-bp sequences, called Ter, causes site-specific, and polar, DNA replication fork arrest in E coli. The Tus-Ter complex serves to coordinate DNA replication with chromosome segregation in this organism. A number of recent and ongoing studies...... have demonstrated that Tus-Ter can be used as a heterologous tool to generate site-specific perturbation of DNA replication when reconstituted in eukaryotes. Here, we review these recent findings and explore the molecular mechanism by which Tus-Ter mediates replication fork (RF) arrest in the budding...... yeast, S. cerevisiae. We propose that Tus-Ter is a versatile, genetically tractable, and regulatable RF blocking system that can be utilized for disrupting DNA replication in a diverse range of host cells....

Tus-Ter as a tool to study site-specific DNA replication perturbation in eukaryotes.

Science.gov (United States)

Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

2014-01-01

The high-affinity binding of the Tus protein to specific 21-bp sequences, called Ter, causes site-specific, and polar, DNA replication fork arrest in E coli. The Tus-Ter complex serves to coordinate DNA replication with chromosome segregation in this organism. A number of recent and ongoing studies have demonstrated that Tus-Ter can be used as a heterologous tool to generate site-specific perturbation of DNA replication when reconstituted in eukaryotes. Here, we review these recent findings and explore the molecular mechanism by which Tus-Ter mediates replication fork (RF) arrest in the budding yeast, S. cerevisiae. We propose that Tus-Ter is a versatile, genetically tractable, and regulatable RF blocking system that can be utilized for disrupting DNA replication in a diverse range of host cells.

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

Science.gov (United States)

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable

The Human Proteome Organization Chromosome 6 Consortium: integrating chromosome-centric and biology/disease driven strategies.

Science.gov (United States)

Borchers, C H; Kast, J; Foster, L J; Siu, K W M; Overall, C M; Binkowski, T A; Hildebrand, W H; Scherer, A; Mansoor, M; Keown, P A

2014-04-04

The Human Proteome Project (HPP) is designed to generate a comprehensive map of the protein-based molecular architecture of the human body, to provide a resource to help elucidate biological and molecular function, and to advance diagnosis and treatment of diseases. Within this framework, the chromosome-based HPP (C-HPP) has allocated responsibility for mapping individual chromosomes by country or region, while the biology/disease HPP (B/D-HPP) coordinates these teams in cross-functional disease-based groups. Chromosome 6 (Ch6) provides an excellent model for integration of these two tasks. This metacentric chromosome has a complement of 1002-1034 genes that code for known, novel or putative proteins. Ch6 is functionally associated with more than 120 major human diseases, many with high population prevalence, devastating clinical impact and profound societal consequences. The unique combination of genomic, proteomic, metabolomic, phenomic and health services data being drawn together within the Ch6 program has enormous potential to advance personalized medicine by promoting robust biomarkers, subunit vaccines and new drug targets. The strong liaison between the clinical and laboratory teams, and the structured framework for technology transfer and health policy decisions within Canada will increase the speed and efficacy of this transition, and the value of this translational research. Canada has been selected to play a leading role in the international Human Proteome Project, the global counterpart of the Human Genome Project designed to understand the structure and function of the human proteome in health and disease. Canada will lead an international team focusing on chromosome 6, which is functionally associated with more than 120 major human diseases, including immune and inflammatory disorders affecting the brain, skeletal system, heart and blood vessels, lungs, kidney, liver, gastrointestinal tract and endocrine system. Many of these chronic and persistent

An integrated genetic, physical, and transcriptional map of chromosome 13

Energy Technology Data Exchange (ETDEWEB)

Scheffer, H.; Kooy, R.F.; Wijngaard, A. [Univ. of Groningen (Netherlands)] [and others

1994-09-01

In this study a genetic map containing 20 markers and typed in 40 CEPH families is presented. It includes 7 thusfar untyped microsatellite markers, 7 that have previously been mapped on a subset of 8 CEPH families, one reference marker, D13S71, and three telomeric VNTR markers. Also, 4 intragenic RB1 markers were typed. The markers have an average heterozygosity of 73% (80%, excluding the three RFLPs). The total sex average length of the map is 140 cM. The mean female to male ratio is 1.54. For the non-telomeric part of the chromosome between the markers D13S221 in 13q12 and D13S173 in 13q33-q34, this ratio is 1.99. This ratio is reversed in the telomeric part of the chromosome between D13S173 and D13S234 in distal 13q34, where it is 0.47. A high new mutation frequency of 1% was detected in the (CTTT(T)){sub n} repeat in intron 20 of the RB1 gene. The map has been integrated with 7 microsatellite markers and 2 RFLP markers from CEPH database version 7.0, resulting in a map with 32 markers (28 loci) of chromosome 13q. In addition, a deletion hybrid breakpoint map ordering 50 markers in 18 intervals is constructed. It includes 32 microsatellite markers, 4 genes, 5 STSs, and 9 ESTs. Each of 18 intervals contains at least one microsatellite marker included in the extended genetic map. These data allow a correlation between the genetic and physical map of chromosome 13. New ESTs are currently being identified and localized at this integrated map.

Y-chromosome-specific microsatellite mutation rates re-examined using a minisatellite, MSY1.

Science.gov (United States)

Jobling, M A; Heyer, E; Dieltjes, P; de Knijff, P

1999-10-01

Polymorphic Y-chromosome-specific microsatellites are becoming increasingly used in evolutionary and forensic studies and, in particular, in dating the origins of Y-chromosomal lineages. Previously, haplotyping of Y chromosomes from males belonging to a set of deep-rooting pedigrees was used to estimate a conservative average Y-chromosomal microsatellite mutation rate of 2.1 x 10(-3)per locus per generation. A number of males showed multiple differences in haplotypes compared with other males within their pedigrees, and these were excluded from the calculation of this estimate, on the grounds that non-paternity was a more probable explanation than multiple mutation within a lineage. Here we reanalyse the pedigrees using an independent highly polymorphic system, the Y-specific minisatellite, MSY1. This supports the hypothesis of non-paternity where more than one microsatellite difference was observed, provides further support for the previously deduced microsatellite mutation rate and throws light on the mutation dynamics of MSY1 itself, suggesting that single-step changes are not the only mode of mutation.

Abnormalities of chromosome No. 1: significance in malignant transformation

Energy Technology Data Exchange (ETDEWEB)

Rowley, J D

1978-01-01

Studies of human hematologic malignancies have provided sufficient data not only for the identification of nonrandom abnormalities of whole chromosomes, but also for determination of the specific chromosome regions involved. In clonal aberrations leading to an excess of chromosome No. 1, or a partial excess of No. 1, trisomy for bands 1q25 to 1q32 was noted in the myeloid cells obtained from every one of 35 patients who had various disorders, such as acute leukemia, polycythemia vera, or myelofibrosis. Similar chromosome changes were a consistent finding in various solid tumors as well. This rearrangement was not the result of a particularly fragile site in that region of the chromosome, since the break points in reciprocal translocations that involve No. 1 occurred almost exclusively in the short arm. The nonrandom chromosome changes found in neoplastic cells can now be correlated with the gene loci on these chromosomes or chromosome segments as an attempt is made to identify specific genes that might be related to malignancy.

Chromosomal integrity of freeze-dried mouse spermatozoa after 137Cs γ-ray irradiation

International Nuclear Information System (INIS)

Kusakabe, Hirokazu; Kamiguchi, Yujiroh

2004-01-01

This study demonstrated that freeze-dried mouse spermatozoa possess strong resistance to 137 Cs γ-ray irradiation at doses of up to 8 Gy. Freeze-dried mouse spermatozoa were rehydrated and injected into mouse oocytes with an intracytoplasmic sperm injection (ICSI) technique. Most oocytes can be activated after ICSI by using spermatozoa irradiated with γ-rays before and after freeze-drying. Sperm chromosome complements were analyzed at the first cleavage metaphase. Chromosome aberrations increased in a dose-dependent manner in the spermatozoa irradiated before freeze-drying. However, no increase in oocytes with chromosome aberrations was observed when fertilized by spermatozoa that had been irradiated after freeze-drying, as compared with freeze-dried spermatozoa that had not been irradiated. These results suggest that both the chromosomal integrity of freeze-dried spermatozoa, as well as their ability to activate oocytes, were protected from γ-ray irradiation at doses at which chromosomal damage is found to be strongly induced in spermatozoa suspended in solution

Development of chromosome-arm-specific microsatellite markers in Triticum aestivum (Poaceae) using NGS technology

Czech Academy of Sciences Publication Activity Database

Nie, X.; Li, B.; Wang, L.; Liu, P.; Biradar, S. S.; Li, T.; Doležel, Jaroslav; Edwards, D.; Luo, M.; Weining, S.

2012-01-01

Roč. 99, č. 9 (2012), e369-e371 ISSN 0002-9122 Institutional research plan: CEZ:AV0Z50380511 Keywords : chromosome-arm-specific DNA * flow-sorted chromosomes * next-generation sequencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.586, year: 2012

Physical Mapping of Bread Wheat Chromosome 5A: An Integrated Approach

Directory of Open Access Journals (Sweden)

Delfina Barabaschi

2015-11-01

Full Text Available The huge size, redundancy, and highly repetitive nature of the bread wheat [ (L.] genome, makes it among the most difficult species to be sequenced. To overcome these limitations, a strategy based on the separation of individual chromosomes or chromosome arms and the subsequent production of physical maps was established within the frame of the International Wheat Genome Sequence Consortium (IWGSC. A total of 95,812 bacterial artificial chromosome (BAC clones of short-arm chromosome 5A (5AS and long-arm chromosome 5A (5AL arm-specific BAC libraries were fingerprinted and assembled into contigs by complementary analytical approaches based on the FingerPrinted Contig (FPC and Linear Topological Contig (LTC tools. Combined anchoring approaches based on polymerase chain reaction (PCR marker screening, microarray, and sequence homology searches applied to several genomic tools (i.e., genetic maps, deletion bin map, neighbor maps, BAC end sequences (BESs, genome zipper, and chromosome survey sequences allowed the development of a high-quality physical map with an anchored physical coverage of 75% for 5AS and 53% for 5AL with high portions (64 and 48%, respectively of contigs ordered along the chromosome. In the genome of grasses, [ (L. Beauv.], rice ( L., and sorghum [ (L. Moench] homologs of genes on wheat chromosome 5A were separated into syntenic blocks on different chromosomes as a result of translocations and inversions during evolution. The physical map presented represents an essential resource for fine genetic mapping and map-based cloning of agronomically relevant traits and a reference for the 5A sequencing projects.

Localization of introduced genes on the chromosomes of transgenic barley, wheat and triticale by fluorescence in situ hybridization

DEFF Research Database (Denmark)

Pedersen, C.; Zimny, J.; Becker, D.

1997-01-01

Using fluorescence in situ hybridization (FISH) we localized introduced genes on metaphase chromosomes of barley, wheat, and triticale transformed by microprojectile bombardment of microspores and scutellar tissue with the pDB1 plasmid containing the uidA and bar genes. Thirteen integration sites...... of single-copy integrations. There was a slight tendency towards the localization of transgenes in distal chromosome regions. Using the GAA-satellite sequence for chromosome banding, the chromosomes containing the inserted genes were identified in most cases. Two barley lines derived from the same...... transformant showed a totally different integration pattern. Southern analysis confirmed that the inserted genes were segregating independently, resulting in different integration patterns among the progeny lines. The application of the FISH technique for the analysis of transgenic plants is discussed....

Delineation and analysis of chromosomal regions specifying Yersinia pestis.

Science.gov (United States)

Derbise, Anne; Chenal-Francisque, Viviane; Huon, Christèle; Fayolle, Corinne; Demeure, Christian E; Chane-Woon-Ming, Béatrice; Médigue, Claudine; Hinnebusch, B Joseph; Carniel, Elisabeth

2010-09-01

Yersinia pestis, the causative agent of plague, has recently diverged from the less virulent enteropathogen Yersinia pseudotuberculosis. Its emergence has been characterized by massive genetic loss and inactivation and limited gene acquisition. The acquired genes include two plasmids, a filamentous phage, and a few chromosomal loci. The aim of this study was to characterize the chromosomal regions acquired by Y. pestis. Following in silico comparative analysis and PCR screening of 98 strains of Y. pseudotuberculosis and Y. pestis, we found that eight chromosomal loci (six regions [R1pe to R6pe] and two coding sequences [CDS1pe and CDS2pe]) specified Y. pestis. Signatures of integration by site specific or homologous recombination were identified for most of them. These acquisitions and the loss of ancestral DNA sequences were concentrated in a chromosomal region opposite to the origin of replication. The specific regions were acquired very early during Y. pestis evolution and were retained during its microevolution, suggesting that they might bring some selective advantages. Only one region (R3pe), predicted to carry a lambdoid prophage, is most likely no longer functional because of mutations. With the exception of R1pe and R2pe, which have the potential to encode a restriction/modification and a sugar transport system, respectively, no functions could be predicted for the other Y. pestis-specific loci. To determine the role of the eight chromosomal loci in the physiology and pathogenicity of the plague bacillus, each of them was individually deleted from the bacterial chromosome. None of the deletants exhibited defects during growth in vitro. Using the Xenopsylla cheopis flea model, all deletants retained the capacity to produce a stable and persistent infection and to block fleas. Similarly, none of the deletants caused any acute flea toxicity. In the mouse model of infection, all deletants were fully virulent upon subcutaneous or aerosol infections. Therefore

Spatial organization of the budding yeast genome in the cell nucleus and identification of specific chromatin interactions from multi-chromosome constrained chromatin model.

Science.gov (United States)

Gürsoy, Gamze; Xu, Yun; Liang, Jie

2017-07-01

Nuclear landmarks and biochemical factors play important roles in the organization of the yeast genome. The interaction pattern of budding yeast as measured from genome-wide 3C studies are largely recapitulated by model polymer genomes subject to landmark constraints. However, the origin of inter-chromosomal interactions, specific roles of individual landmarks, and the roles of biochemical factors in yeast genome organization remain unclear. Here we describe a multi-chromosome constrained self-avoiding chromatin model (mC-SAC) to gain understanding of the budding yeast genome organization. With significantly improved sampling of genome structures, both intra- and inter-chromosomal interaction patterns from genome-wide 3C studies are accurately captured in our model at higher resolution than previous studies. We show that nuclear confinement is a key determinant of the intra-chromosomal interactions, and centromere tethering is responsible for the inter-chromosomal interactions. In addition, important genomic elements such as fragile sites and tRNA genes are found to be clustered spatially, largely due to centromere tethering. We uncovered previously unknown interactions that were not captured by genome-wide 3C studies, which are found to be enriched with tRNA genes, RNAPIII and TFIIS binding. Moreover, we identified specific high-frequency genome-wide 3C interactions that are unaccounted for by polymer effects under landmark constraints. These interactions are enriched with important genes and likely play biological roles.

Human Herpesvirus 6B Induces Hypomethylation on Chromosome 17p13.3, Correlating with Increased Gene Expression and Virus Integration.

Science.gov (United States)

Engdahl, Elin; Dunn, Nicky; Niehusmann, Pitt; Wideman, Sarah; Wipfler, Peter; Becker, Albert J; Ekström, Tomas J; Almgren, Malin; Fogdell-Hahn, Anna

2017-06-01

Human herpesvirus 6B (HHV-6B) is a neurotropic betaherpesvirus that achieves latency by integrating its genome into host cell chromosomes. Several viruses can induce epigenetic modifications in their host cells, but no study has investigated the epigenetic modifications induced by HHV-6B. This study analyzed methylation with an Illumina 450K array, comparing HHV-6B-infected and uninfected Molt-3 T cells 3 days postinfection. Bisulfite pyrosequencing was used to validate the Illumina results and to investigate methylation over time in vitro Expression of genes was investigated using quantitative PCR (qPCR), and virus integration was investigated with PCR. A total of 406 CpG sites showed a significant HHV-6B-induced change in methylation in vitro Remarkably, 86% (351/406) of these CpGs were located integration in Molt-3 cell DNA 3 days after infection. The telomere at 17p has repeatedly been described as an integration site for HHV-6B, and we show for the first time that HHV-6B induces hypomethylation in this region during acute infection, which may play a role in the integration process, possibly by making the DNA more accessible. IMPORTANCE The ability to establish latency in the host is a hallmark of herpesviruses, but the mechanisms differ. Human herpesvirus 6B (HHV-6B) is known to establish latency through integration of its genome into the telomeric regions of host cells, with the ability to reactivate. Our study is the first to show that HHV-6B specifically induces hypomethylated regions close to the telomeres and that integrating viruses may use the host methylation machinery to facilitate their integration process. The results from this study contribute to knowledge of HHV-6B biology and virus-host interaction. This in turn will lead to further progress in our understanding of the underlying mechanisms by which HHV-6B contributes to pathological processes and may have important implications in both disease prevention and treatment. Copyright © 2017 American

Chromosome-specific staining to detect genetic rearrangements

Energy Technology Data Exchange (ETDEWEB)

Gray, Joe W.; Pinkel, Daniel; Tkachuk, Douglas; Westbrook, Carol

2013-04-09

Methods and compositions for staining based upon nucleic acid sequence that employ nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyzes. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acid probes are typically of a complexity greater than 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML) and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar but genetically different diseases, and for many prognostic and diagnostic applications.

CTCF-mediated transcriptional regulation through cell type-specific chromosome organization in the β-globin locus

OpenAIRE

Junier, Ivan; Dale, Ryan K.; Hou, Chunhui; Képès, François; Dean, Ann

2012-01-01

International audience; The principles underlying the architectural landscape of chromatin beyond the nucleosome level in living cells remains largely unknown despite its potential to play a role in mammalian gene regulation. We investigated the three-dimensional folding of a 1 Mbp region of human chromosome 11 containing the β-globin genes by integrating looping interactions of the CCCTC-binding insulator protein CTCF determined comprehensively by chromosome conformation capture (3C) into a ...

Lack of spontaneous and radiation-induced chromosome breakage at interstitial telomeric sites in murine scid cells.

Science.gov (United States)

Wong, H-P; Mozdarani, H; Finnegan, C; McIlrath, J; Bryant, P E; Slijepcevic, P

2004-01-01

Interstitial telomeric sites (ITSs) in chromosomes from DNA repair-proficient mammalian cells are sensitive to both spontaneous and radiation-induced chromosome breakage. Exact mechanisms of this chromosome breakage sensitivity are not known. To investigate factors that predispose ITSs to chromosome breakage we used murine scid cells. These cells lack functional DNA-PKcs, an enzyme involved in the repair of DNA double-strand breaks. Interestingly, our results revealed lack of both spontaneous and radiation-induced chromosome breakage at ITSs found in scid chromosomes. Therefore, it is possible that increased sensitivity of ITSs to chromosome breakage is associated with the functional DNA double-strand break repair machinery. To investigate if this is the case we used scid cells in which DNA-PKcs deficiency was corrected. Our results revealed complete disappearance of ITSs in scid cells with functional DNA-PKcs, presumably through chromosome breakage at ITSs, but their unchanged frequency in positive and negative control cells. Therefore, our results indicate that the functional DNA double-strand break machinery is required for elevated sensitivity of ITSs to chromosome breakage. Interestingly, we observed significant differences in mitotic chromosome condensation between scid cells and their counterparts with restored DNA-PKcs activity suggesting that lack of functional DNA-PKcs may cause a defect in chromatin organization. Increased condensation of mitotic chromosomes in the scid background was also confirmed in vivo. Therefore, our results indicate a previously unanticipated role of DNA-PKcs in chromatin organisation, which could contribute to the lack of ITS sensitivity to chromosome breakage in murine scid cells. Copyright 2003 S. Karger AG, Basel

Implications for x-chromosome regulation from studies of human x-chromosome DNA

International Nuclear Information System (INIS)

Wolf, S.F.; Migeon, B.R.

1983-01-01

It is clear that there must be multiple events involved in the regulation of the mammalian X chromosome. The initial event, occurring about the time of implantation results in inactivation of all but a single X chromosome in diploid cells. A popular working hypothesis is that DNA modification, such as methylation or sequence rearrangement, might be responsible for maintenance of the inactive state. Methylation is particularly attractive, since the preference for methylating half-methylated sites might result in perpetuation of the differentiated state. In this paper we discuss several facets of our studies of X inactivation; specifically, our general strategy, studies of X DNA methylation, and studies of loci that escape inactivation. 47 references, 8 figures, 2 tables

Karyotypic relationships among Equus grevyi, Equus burchelli and domestic horse defined using horse chromosome arm-specific probes.

Science.gov (United States)

Musilova, P; Kubickova, S; Zrnova, E; Horin, P; Vahala, J; Rubes, J

2007-01-01

Using laser microdissection we prepared a set of horse chromosome arm-specific probes. Most of the probes were generated from horse chromosomes, some of them were derived from Equus zebra hartmannae. The set of probes were hybridized onto E. grevyi chromosomes in order to establish a genome-wide chromosomal correspondence between this zebra and horse. The use of arm-specific probes provided us with more information on the mutual arrangement of the genomes than we could obtain by means of whole-chromosome paints generated by flow sorting, even if we used reciprocal painting with probe sets from both species. By comparison of our results and results of comparative mapping in E. burchelli, we also established the chromosomal correspondence between E. grevyi and E. burchelli, providing evidence for a very close karyotypic relationship between these two zebra species. Establishment of the comparative map for E. grevyi contributes to the knowledge of the karyotypic phylogeny in the Equidae family.

A- or C-chromosomes, does it matter for the transfer of transgenes from ¤Brassica napus¤

DEFF Research Database (Denmark)

Tomiuk, J.; Hauser, T.P.; Bagger Jørgensen, Rikke

2000-01-01

of herbicide-tolerant plants was explained by selection against the C-chromosomes of B. napus in favor of the homeologous ii-chromosomes. Obviously, such C-chromosomes could be potential candidates as safe integration sites for transgenes. We considered these safety aspects using a simple population genetic...... model. Theory and experiments, however, do not favor the chromosomes of B. napus as safe candidates with respect to the introgression of transgenes into wild populations of B. rapa....

Chromosome microdissection and cloning in human genome and genetic disease analysis

International Nuclear Information System (INIS)

Kao, Faten; Yu, Jingwei

1991-01-01

A procedure has been described for microdissection and microcloning of human chromosomal DNA sequences in which universal amplification of the dissected fragments by Mbo I linker adaptor and polymerase chain reaction is used. A very large library comprising 700,000 recombinant plasmid microclones from 30 dissected chromosomes of human chromosome 21 was constructed. Colony hybridization showed that 42% of the clones contained repetitive sequences and 58% contained single or low-copy sequences. The insert sizes generated by complete Mbo I cleavage ranged from 50 to 1,100 base pairs with a mean of 416 base pairs. Southern blot analysis of microclones from the library confirmed their human origin and chromosome 21 specificity. Some of these clones have also been regionally mapped to specific sites of chromosome 21 by using a regional mapping panel of cell hybrids. This chromosome microtechnology can generate large numbers of microclones with unique sequences from defined chromosomal regions and can be used for processes such as (i) isolating corresponding yeast artificial chromosome clones with large inserts, (ii) screening various cDNA libraries for isolating expressed sequences, and (iii) constructing region-specific libraries of the entire human genome. The studies described here demonstrate the power of this technology for high-resolution genome analysis and explicate their use in an efficient search for disease-associated genes localized to specific chromosomal regions

Development of inter-specific chromosomes segment substitution libraries (CSSL) in rice

Science.gov (United States)

Six libraries of inter-specific Chromosome Segment Substitution Lines (CSSLs) of rice are being developed as pre-breeding materials and genetic stocks. Three accessions of O. rufipogon were selected as donors, based on phylogenetic, geographical and morphological divergence, and crossed with two rec...

Genetic modification of Lactobacillus plantarum by heterologous gene integration in a not functional region of the chromosome.

Science.gov (United States)

Rossi, Franca; Capodaglio, Alessandro; Dellaglio, Franco

2008-08-01

This report describes the vector-free engineering of Lactobacillus plantarum by chromosomal integration of an exogenous gene without inactivation of physiological traits. The integrative plasmid vector pP7B6 was derived from pGIP73 by replacing the cbh site, encoding the L. plantarum conjugated bile salt hydrolase, with the prophage fragment P7B6, from L. plantarum Lp80 (DSM 4229). Plasmid pP7B6NI was obtained by inserting the nisin immunity gene nisI of Lactococcus lactis subsp. lactis DSM 20729, preceded by the constitutive promoter P32 from the same strain, in a unique XbaI site of fragment P7B6 and was used to electrotransform L. plantarum Lp80. A food grade recombinant L. plantarum Lp80NI, with 480-fold higher immunity to nisin than the wild type, was derived by integration of pP7B6NI followed by the excision of pP7B6. Polymerase chain reaction tests demonstrated that the integration of nisI in the prophage region had occurred and that the erythromycin resistance marker from pP7B6 was lost. Fifteen among 31 L. plantarum strains tested hybridized with P7B6, indicating that the integration of pP7B6-derived vectors might occur in some other L. plantarum strains. This was experimentally confirmed by constructing the recombinant strain L. plantarum LZNI from the dairy isolate L. plantarum LZ (LMG 24600).

Comparative Genomic Hybridization of Human Malignant Gliomas Reveals Multiple Amplification Sites and Nonrandom Chromosomal Gains and Losses

Science.gov (United States)

Schròck, Evelin; Thiel, Gundula; Lozanova, Tanka; du Manoir, Stanislas; Meffert, Marie-Christine; Jauch, Anna; Speicher, Michael R.; Nürnberg, Peter; Vogel, Siegfried; Janisch, Werner; Donis-Keller, Helen; Ried, Thomas; Witkowski, Regine; Cremer, Thomas

1994-01-01

Nine human malignant gliomas (2 astrocytomas grade III and 7 glioblastomas) were analyzed using comparative genomic hybridization (CGH). In addition to the amplification of the EGFR gene at 7p12 in 4 of 9 cases, six new amplification sites were mapped to 1q32, 4q12, 7q21.1, 7q21.2-3, 12p, and 22q12. Nonrandom chromosomal gains and losses were identified with overrepresentation of chromosome 7 and underrepresentation of chromosome 10 as the most frequent events (1 of 2 astrocytomas, 7 of 7 glioblastomas). Gain of a part or the whole chromosome 19 and losses of chromosome bands 9pter-23 and 22q13 were detected each in five cases. Loss of chromosome band 17p13 and gain of chromosome 20 were revealed each in three cases. The validity of the CGH data was confirmed using interphase cytogenetics with YAC clones, chromosome painting in tumor metaphase spreads, and DNA fingerprinting. A comparison of CGH data with the results of chromosome banding analyses indicates that metaphase spreads accessible in primary tumor cell cultures may not represent the clones predominant in the tumor tissue ImagesFigure 1Figure 4Figure 6 PMID:8203461

Lack of specificity of chromosome breaks resulting from radiation-induced genomic instability in Chinese hamster cells

International Nuclear Information System (INIS)

Trott, K.-R.; Teibe, A.

1998-01-01

In V79 Chinese hamster cells, radiation-induced genomic instability results in a persistently increased frequency of micronuclei, dicentric chromosomes and apoptosis and in decreased colony-forming ability. These manifestations of radiation-induced genomic instability may be attributed to an increased rate of chromosome breakage events many generations after irradiation. This chromosomal instability does not seem to be a property which has been inflicted on individual chromosomes at the time of irradiation. Rather, it appears to be secondary to an increased level of non-specific clastogenic factors in the progeny of most if not all irradiated cells. This conclusion is drawn from the observations presented here, that all the chromosomes in surviving V79 cells are involved in the formation of dicentric chromosome aberrations 1 or 2 weeks after irradiation with about equal probability if corrections are made for chromosome length. (orig.)

Custom-Designed Molecular Scissors for Site-Specific Manipulation of the Plant and Mammalian Genomes

Science.gov (United States)

Kandavelou, Karthikeyan; Chandrasegaran, Srinivasan

Zinc finger nucleases (ZFNs) are custom-designed molecular scissors, engineered to cut at specific DNA sequences. ZFNs combine the zinc finger proteins (ZFPs) with the nonspecific cleavage domain of the FokI restriction enzyme. The DNA-binding specificity of ZFNs can be easily altered experimentally. This easy manipulation of the ZFN recognition specificity enables one to deliver a targeted double-strand break (DSB) to a genome. The targeted DSB stimulates local gene targeting by several orders of magnitude at that specific cut site via homologous recombination (HR). Thus, ZFNs have become an important experimental tool to make site-specific and permanent alterations to genomes of not only plants and mammals but also of many other organisms. Engineering of custom ZFNs involves many steps. The first step is to identify a ZFN site at or near the chosen chromosomal target within the genome to which ZFNs will bind and cut. The second step is to design and/or select various ZFP combinations that will bind to the chosen target site with high specificity and affinity. The DNA coding sequence for the designed ZFPs are then assembled by polymerase chain reaction (PCR) using oligonucleotides. The third step is to fuse the ZFP constructs to the FokI cleavage domain. The ZFNs are then expressed as proteins by using the rabbit reticulocyte in vitro transcription/translation system and the protein products assayed for their DNA cleavage specificity.

Directed chromosomal integration and expression of porcine rotavirus outer capsid protein VP4 in Lactobacillus casei ATCC393.

Science.gov (United States)

Yin, Ji-Yuan; Guo, Chao-Qun; Wang, Zi; Yu, Mei-Ling; Gao, Shuai; Bukhari, Syed M; Tang, Li-Jie; Xu, Yi-Gang; Li, Yi-Jing

2016-11-01

Using two-step plasmid integration in the presence of 5-fluorouracil (5-FU), we developed a stable and markerless Lactobacillus casei strain for vaccine antigen expression. The upp of L. casei, which encodes uracil phosphoribosyltransferase (UPRTase), was used as a counterselection marker. We employed the Δupp isogenic mutant, which is resistant to 5-FU, as host and a temperature-sensitive suicide plasmid bearing upp expression cassette as counterselectable integration vector. Extrachromosomal expression of UPRTase complemented the mutated chromosomal upp allele and restored sensitivity to 5-FU. The resultant genotype can either be wild type or recombinant. The efficacy of the system was demonstrated by insertion and expression of porcine rotavirus (PRV) VP4. To improve VP4 expression, we analyzed L. casei transcriptional profiles and selected the constitutive highly expressed enolase gene (eno). The VP4 inserted after the eno termination codon were screened in the presence of 5-FU. Using genomic PCR amplification, we confirmed that VP4 was successfully integrated and stably inherited for at least 50 generations. Western blot demonstrated that VP4 was steadily expressed in medium with different carbohydrates. RT-qPCR and ELISA analysis showed that VP4 expression from the chromosomal location was similar to that achieved by a plasmid expression system. Applying the recombinant strain to immunize BALB/c mice via oral administration revealed that the VP4-expressing L. casei could induce both specific local and systemic humoral immune responses in mice. Overall, the improved gene replacement system represents an efficient method for chromosome recombination in L. casei and provides a safe tool for vaccine production.

A mitosis-specific and R loop-driven ATR pathway promotes faithful chromosome segregation.

Science.gov (United States)

Kabeche, Lilian; Nguyen, Hai Dang; Buisson, Rémi; Zou, Lee

2018-01-05

The ataxia telangiectasia mutated and Rad3-related (ATR) kinase is crucial for DNA damage and replication stress responses. Here, we describe an unexpected role of ATR in mitosis. Acute inhibition or degradation of ATR in mitosis induces whole-chromosome missegregation. The effect of ATR ablation is not due to altered cyclin-dependent kinase 1 (CDK1) activity, DNA damage responses, or unscheduled DNA synthesis but to loss of an ATR function at centromeres. In mitosis, ATR localizes to centromeres through Aurora A-regulated association with centromere protein F (CENP-F), allowing ATR to engage replication protein A (RPA)-coated centromeric R loops. As ATR is activated at centromeres, it stimulates Aurora B through Chk1, preventing formation of lagging chromosomes. Thus, a mitosis-specific and R loop-driven ATR pathway acts at centromeres to promote faithful chromosome segregation, revealing functions of R loops and ATR in suppressing chromosome instability. Copyright © 2018, American Association for the Advancement of Science.

Genome-wide analysis of host-chromosome binding sites for Epstein-Barr Virus Nuclear Antigen 1 (EBNA1

Directory of Open Access Journals (Sweden)

Wang Pu

2010-10-01

Full Text Available Abstract The Epstein-Barr Virus (EBV Nuclear Antigen 1 (EBNA1 protein is required for the establishment of EBV latent infection in proliferating B-lymphocytes. EBNA1 is a multifunctional DNA-binding protein that stimulates DNA replication at the viral origin of plasmid replication (OriP, regulates transcription of viral and cellular genes, and tethers the viral episome to the cellular chromosome. EBNA1 also provides a survival function to B-lymphocytes, potentially through its ability to alter cellular gene expression. To better understand these various functions of EBNA1, we performed a genome-wide analysis of the viral and cellular DNA sites associated with EBNA1 protein in a latently infected Burkitt lymphoma B-cell line. Chromatin-immunoprecipitation (ChIP combined with massively parallel deep-sequencing (ChIP-Seq was used to identify cellular sites bound by EBNA1. Sites identified by ChIP-Seq were validated by conventional real-time PCR, and ChIP-Seq provided quantitative, high-resolution detection of the known EBNA1 binding sites on the EBV genome at OriP and Qp. We identified at least one cluster of unusually high-affinity EBNA1 binding sites on chromosome 11, between the divergent FAM55 D and FAM55B genes. A consensus for all cellular EBNA1 binding sites is distinct from those derived from the known viral binding sites, suggesting that some of these sites are indirectly bound by EBNA1. EBNA1 also bound close to the transcriptional start sites of a large number of cellular genes, including HDAC3, CDC7, and MAP3K1, which we show are positively regulated by EBNA1. EBNA1 binding sites were enriched in some repetitive elements, especially LINE 1 retrotransposons, and had weak correlations with histone modifications and ORC binding. We conclude that EBNA1 can interact with a large number of cellular genes and chromosomal loci in latently infected cells, but that these sites are likely to represent a complex ensemble of direct and indirect EBNA

Chromosome region-specific libraries for human genome analysis. Final progress report, 1 March 1991--28 February 1994

Energy Technology Data Exchange (ETDEWEB)

Kao, F.T.

1994-04-01

The objectives of this grant proposal include (1) development of a chromosome microdissection and PCR-mediated microcloning technology, (2) application of this microtechnology to the construction of region-specific libraries for human genome analysis. During this grant period, the authors have successfully developed this microtechnology and have applied it to the construction of microdissection libraries for the following chromosome regions: a whole chromosome 21 (21E), 2 region-specific libraries for the long arm of chromosome 2, 2q35-q37 (2Q1) and 2q33-q35 (2Q2), and 4 region-specific libraries for the entire short arm of chromosome 2, 2p23-p25 (2P1), 2p21-p23 (2P2), 2p14-p16 (wP3) and 2p11-p13 (2P4). In addition, 20--40 unique sequence microclones have been isolated and characterized for genomic studies. These region-specific libraries and the single-copy microclones from the library have been used as valuable resources for (1) isolating microsatellite probes in linkage analysis to further refine the disease locus; (2) isolating corresponding clones with large inserts, e.g. YAC, BAC, P1, cosmid and phage, to facilitate construction of contigs for high resolution physical mapping; and (3) isolating region-specific cDNA clones for use as candidate genes. These libraries are being deposited in the American Type Culture Collection (ATCC) for general distribution.

Inter-chromosomal heterogeneity in the formation of radiation induced chromosomal aberrations

International Nuclear Information System (INIS)

Natarajan, A.T.; Vermeulen, S.; Boei, J.J.W.A.

1997-01-01

It is generally assumed that radiation induced chromosomal lesions are distributed randomly and repaired randomly among the genome. Recent studies using fluorescent in situ hybridization (FISH) and chromosome specific DNA libraries indicate that some chromosomes are more sensitive for radiation induced aberration formation than others. Chromosome No. 4 in human and chromosome No. 8 in Chinese hamster have been found to involve more in exchange aberrations than others, when calculated on the basis of their DNA content. Painting with arm specific chromosome libraries indicate that the frequencies of radiation induced intra-chromosome exchanges (i.e., between the arms of a chromosome, such as centric rings and inversions) are far in excess than one would expect on the basis of the frequencies of observed inter-chromosomal exchanges. The possible factors leading to the observed heterogeneity will be discussed

Microdissection and molecular manipulation of single chromosomes in woody fruit trees with small chromosomes using pomelo (Citrus grandis) as a model. II. Cloning of resistance gene analogs from single chromosomes.

Science.gov (United States)

Huang, D; Wu, W; Lu, L

2004-05-01

Amplification of resistance gene analogs (RGAs) is both a useful method for acquiring DNA markers closely linked to disease resistance (R) genes and a potential approach for the rapid cloning of R genes in plants. However, the screening of target sequences from among the numerous amplified RGAs can be very laborious. The amplification of RGAs from specific chromosomes could greatly reduce the number of RGAs to be screened and, consequently, speed up the identification of target RGAs. We have developed two methods for amplifying RGAs from single chromosomes. Method 1 uses products of Sau3A linker adaptor-mediated PCR (LAM-PCR) from a single chromosome as the templates for RGA amplification, while Method 2 directly uses a single chromosomal DNA molecule as the template. Using a pair of degenerate primers designed on the basis of the conserved nucleotide-binding-site motifs in many R genes, RGAs were successfully amplified from single chromosomes of pomelo using both these methods. Sequencing and cluster analysis of RGA clones obtained from single chromosomes revealed the number, type and organization of R-gene clusters on the chromosomes. We suggest that Method 1 is suitable for analyzing chromosomes that are unidentifiable under a microscope, while Method 2 is more appropriate when chromosomes can be clearly identified.

The ΦBT1 large serine recombinase catalyzes DNA integration at pseudo-attB sites in the genus Nocardia

Directory of Open Access Journals (Sweden)

Marion Herisse

2018-05-01

Full Text Available Plasmid vectors based on bacteriophage integrases are important tools in molecular microbiology for the introduction of foreign DNA, especially into bacterial species where other systems for genetic manipulation are limited. Site specific integrases catalyze recombination between phage and bacterial attachment sites (attP and attB, respectively and the best studied integrases in the actinomycetes are the serine integrases from the Streptomyces bacteriophages ΦC31 and ΦBT1. As this reaction is unidirectional and highly stable, vectors containing phage integrase systems have been used in a number of genetic engineering applications. Plasmids bearing the ΦBT1 integrase have been used to introduce DNA into Streptomyces and Amycolatopsis strains; however, they have not been widely studied in other actinobacterial genera. Here, we show that vectors based on ΦBT1 integrase can stably integrate into the chromosomes of a range of Nocardia species, and that this integration occurs despite the absence of canonical attB sites in these genomes. Furthermore, we show that a ΦBT1 integrase-based vector can insert at multiple pseudo-attB sites within a single strain and we determine the sequence of a pseudo-attB motif. These data suggest that ΦBT1 integrase-based vectors can be used to readily and semi-randomly introduce foreign DNA into the genomes of a range of Nocardia species. However, the precise site of insertion will likely require empirical determination in each species to avoid unexpected off-target effects.

The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes

NARCIS (Netherlands)

Skaletsky, Helen; Kuroda-Kawaguchi, Tomoko; Minx, Patrick J.; Cordum, Holland S.; Hillier, LaDeana; Brown, Laura G.; Repping, Sjoerd; Pyntikova, Tatyana; Ali, Johar; Bieri, Tamberlyn; Chinwalla, Asif; Delehaunty, Andrew; Delehaunty, Kim; Du, Hui; Fewell, Ginger; Fulton, Lucinda; Fulton, Robert; Graves, Tina; Hou, Shun-Fang; Latrielle, Philip; Leonard, Shawn; Mardis, Elaine; Maupin, Rachel; McPherson, John; Miner, Tracie; Nash, William; Nguyen, Christine; Ozersky, Philip; Pepin, Kymberlie; Rock, Susan; Rohlfing, Tracy; Scott, Kelsi; Schultz, Brian; Strong, Cindy; Tin-Wollam, Aye; Yang, Shiaw-Pyng; Waterston, Robert H.; Wilson, Richard K.; Rozen, Steve; Page, David C.

2003-01-01

The male-specific region of the Y chromosome, the MSY, differentiates the sexes and comprises 95% of the chromosome's length. Here, we report that the MSY is a mosaic of heterochromatic sequences and three classes of euchromatic sequences: X-transposed, X-degenerate and ampliconic. These classes

Next-generation site-directed transgenesis in the malaria vector mosquito Anopheles gambiae: self-docking strains expressing germline-specific phiC31 integrase.

Directory of Open Access Journals (Sweden)

Janet M Meredith

Full Text Available Diseases transmitted by mosquitoes have a devastating impact on global health and the situation is complicated due to difficulties with both existing control measures and the impact of climate change. Genetically modified mosquitoes that are refractory to disease transmission are seen as having great potential in the delivery of novel control strategies. The Streptomyces phage phiC31 integrase system has been successfully adapted for site-directed transgene integration in a range of insects, thus overcoming many limitations due to size constraints and random integration associated with transposon-mediated transformation. Using this technology, we previously published the first site-directed transformation of Anopheles gambiae, the principal vector of human malaria. Mosquitoes were initially engineered to incorporate the phiC31 docking site at a defined genomic location. A second phase of genetic modification then achieved site-directed integration of an anti-malarial effector gene. In the current publication we report improved efficiency and utility of the phiC31 integrase system following the generation of Anopheles gambiae self-docking strains. Four independent strains, with docking sites at known locations on three different chromosome arms, were engineered to express integrase under control of the regulatory regions of the nanos gene from Anopheles gambiae. The resulting protein accumulates in the posterior oocyte to provide integrase activity at the site of germline development. Two self-docking strains, exhibiting significantly different levels of integrase expression, were assessed for site-directed transgene integration and found to demonstrate greatly improved survival and efficiency of transformation. In the fight against malaria, it is imperative to establish a broad repertoire of both anti-malarial effector genes and tissue-specific promoters to regulate their expression, enabling those offering maximum effect with minimum fitness

Altered expression of testis-specific genes, piRNAs, and transposons in the silkworm ovary masculinized by a W chromosome mutation

Science.gov (United States)

2012-01-01

Background In the silkworm, Bombyx mori, femaleness is strongly controlled by the female-specific W chromosome. Originally, it was presumed that the W chromosome encodes female-determining gene(s), accordingly called Fem. However, to date, neither Fem nor any protein-coding gene has been identified from the W chromosome. Instead, the W chromosome is occupied with numerous transposon-related sequences. Interestingly, the silkworm W chromosome is a source of female-enriched PIWI-interacting RNAs (piRNAs). piRNAs are small RNAs of 23-30 nucleotides in length, which are required for controlling transposon activity in animal gonads. A recent study has identified a novel mutant silkworm line called KG, whose mutation in the W chromosome causes severe female masculinization. However, the molecular nature of KG line has not been well characterized yet. Results Here we molecularly characterize the KG line. Genomic PCR analyses using currently available W chromosome-specific PCR markers indicated that no large deletion existed in the KG W chromosome. Genetic analyses demonstrated that sib-crosses within the KG line suppressed masculinization. Masculinization reactivated when crossing KG females with wild type males. Importantly, the KG ovaries exhibited a significantly abnormal transcriptome. First, the KG ovaries misexpressed testis-specific genes. Second, a set of female-enriched piRNAs was downregulated in the KG ovaries. Third, several transposons were overexpressed in the KG ovaries. Conclusions Collectively, the mutation in the KG W chromosome causes broadly altered expression of testis-specific genes, piRNAs, and transposons. To our knowledge, this is the first study that describes a W chromosome mutant with such an intriguing phenotype. PMID:22452797

Genomic regulatory landscapes and chromosomal rearrangements

DEFF Research Database (Denmark)

Ladegaard, Elisabete L Engenheiro

2008-01-01

The main objectives of the PhD study are to identify and characterise chromosomal rearrangements within evolutionarily conserved regulatory landscapes around genes involved in the regulation of transcription and/or development (trans-dev genes). A frequent feature of trans-dev genes is that they ......The main objectives of the PhD study are to identify and characterise chromosomal rearrangements within evolutionarily conserved regulatory landscapes around genes involved in the regulation of transcription and/or development (trans-dev genes). A frequent feature of trans-dev genes...... the complex spatio-temporal expression of the associated trans-dev gene. Rare chromosomal breakpoints that disrupt the integrity of these regulatory landscapes may be used as a tool, not only to make genotype-phenotype associations, but also to link the associated phenotype with the position and tissue...... specificity of the individual CNEs. In this PhD study I have studied several chromosomal rearrangements with breakpoints in the vicinity of trans-dev genes. This included chromosomal rearrangements compatible with known phenotype-genotype associations (Rieger syndrome-PITX2, Mowat-Wilson syndrome-ZEB2...

Haploids in Conifer Species: Characterization and Chromosomal Integrity of a Maritime Pine Cell Line

Directory of Open Access Journals (Sweden)

José Antonio Cabezas

2016-11-01

Full Text Available Haploids are a valuable tool for genomic studies in higher plants, especially those with huge genome size and long juvenile periods, such as conifers. In these species, megagametophyte cultures have been widely used to obtain haploid callus and somatic embryogenic lines. One of the main problems associated with tissue culture is the potential genetic instability of the regenerants. Because of this, chromosomal stability of the callus and/or somatic embryos should also be assessed. To this end, chromosome counting, flow cytometry and genotyping using microsatellites have been reported. Here, we present an overview of the work done in conifers, with special emphasis on the production of a haploid cell line in maritime pine (Pinus pinaster L. and the use of a set of molecular markers, which includes Single Nucleotide Polymorphisms (SNPs and microsatellites or Single Sequence Repeats (SSRs, to validate chromosomal integrity confirming the presence of all chromosomic arms.

Intrinsic bent DNA sites in the chromosomal replication origin of Xylella fastidiosa 9a5c

Directory of Open Access Journals (Sweden)

F. Gimenes

2008-04-01

Full Text Available The features of the nucleotide sequences in both replication and promoter regions have been investigated in many organisms. Intrinsically bent DNA sites associated with transcription have been described in several prokaryotic organisms. The aim of the present study was to investigate intrinsic bent DNA sites in the segment that holds the chromosomal replication origin, oriC, of Xylella fastidiosa 9a5c. Electrophoretic behavior analyses, as well as in silico analyses of both the 2-D projection and helical parameters, were performed. The chromosomal segment analyzed contains the initial sequence of the rpmH gene, an intergenic region, the dnaA gene, the oriC sequence, and the 5' partial sequence of the dnaN gene. The analysis revealed fragments with reduced electrophoretic mobility, which indicates the presence of curved DNA segments. The analysis of the helical parameter ENDS ratio revealed three bent DNA sites (b1, b2, and b3 located in the rpmH-dnaA intergenic region, the dnaA gene, and the oriC 5' end, respectively. The chromosomal segment of X. fastidiosa analyzed here is rich in phased AT tracts and in CAnT motifs. The 2-D projection indicated a segment whose structure was determined by the cumulative effect of all bent DNA sites. Further, the in silico analysis of the three different bacterial oriC sequences indicated similar negative roll and twist >34.00° values. The DnaA box sequences, and other motifs in them, may be associated with the intrinsic DNA curvature.

Characterization of joining sites of a viral histone H4 on host insect chromosomes.

Directory of Open Access Journals (Sweden)

Sunil Kumar

Full Text Available A viral histone H4 (CpBV-H4 is encoded in a polydnavirus, Cotesia plutellae bracovirus (CpBV. It plays a crucial role in parasitism of an endoparasitoid wasp, C. plutellae, against diamondback moth, Plutella xylostella, by altering host gene expression in an epigenetic mode by its N-terminal tail after joining host nucleosomes. Comparative transcriptomic analysis between parasitized and nonparasitized P. xylostella by RNA-Seq indicated that 1,858 genes were altered at more than two folds in expression levels at late parasitic stage, including 877 up-regulated genes and 981 down-regulated genes. Among parasitic factors altering host gene expression, CpBV-H4 alone explained 16.3% of these expressional changes. To characterize the joining sites of CpBV-H4 on host chromosomes, ChIP-Seq (chromatin immunoprecipitation followed by deep sequencing was applied to chromatins extracted from parasitized larvae. It identified specific 538 ChIP targets. Joining sites were rich (60.2% in AT sequence. Almost 40% of ChIP targets included short nucleotide repeat sequences presumably recognizable by transcriptional factors and chromatin remodeling factors. To further validate these CpBV-H4 targets, CpBV-H4 was transiently expressed in nonparasitized host at late larval stage and subjected to ChIP-Seq. Two kinds of ChIP-Seqs shared 51 core joining sites. Common targets were close (within 1 kb to genes regulated at expression levels by CpBV-H4. However, other host genes not close to CpBV-H4 joining sites were also regulated by CpBV-H4. These results indicate that CpBV-H4 joins specific chromatin regions of P. xylostella and controls about one sixth of the total host genes that were regulated by C. plutellae parasitism in an epigenetic mode.

Design and integration of components for site specific control of fertilizer application

NARCIS (Netherlands)

Bergeijk, van J.

2001-01-01

Keywords: Precision Agriculture, Site Specific Agriculture, Global Positioning System, GPS, Fertilizer Application, Information System.

Spatial and temporal variability in soil, crop and climate characteristics results in non optimal use of fertilizers when the application

Fidelity of target site duplication and sequence preference during integration of xenotropic murine leukemia virus-related virus.

Directory of Open Access Journals (Sweden)

Sanggu Kim

Full Text Available Xenotropic murine leukemia virus (MLV-related virus (XMRV is a new human retrovirus associated with prostate cancer and chronic fatigue syndrome. The causal relationship of XMRV infection to human disease and the mechanism of pathogenicity have not been established. During retrovirus replication, integration of the cDNA copy of the viral RNA genome into the host cell chromosome is an essential step and involves coordinated joining of the two ends of the linear viral DNA into staggered sites on target DNA. Correct integration produces proviruses that are flanked by a short direct repeat, which varies from 4 to 6 bp among the retroviruses but is invariant for each particular retrovirus. Uncoordinated joining of the two viral DNA ends into target DNA can cause insertions, deletions, or other genomic alterations at the integration site. To determine the fidelity of XMRV integration, cells infected with XMRV were clonally expanded and DNA sequences at the viral-host DNA junctions were determined and analyzed. We found that a majority of the provirus ends were correctly processed and flanked by a 4-bp direct repeat of host DNA. A weak consensus sequence was also detected at the XMRV integration sites. We conclude that integration of XMRV DNA involves a coordinated joining of two viral DNA ends that are spaced 4 bp apart on the target DNA and proceeds with high fidelity.

Frequencies of X-ray and fast neutron induced chromosome translocations in human peripheral blood lymphocytes as detected by in situ hybridization using chromosome specific DNA libraries

International Nuclear Information System (INIS)

Natarajan, A.T.; Darroudi, F.; Vermeulen, S.; Wiegant, J.

1992-01-01

DNA libraries of six human chromosomes were used to detect translocations in human lymphocytes induced by different doses of X-rays and fast neutrons. Results show that with X-rays, one can detect about 1.5 to 2.0 fold more translocations in comparison to dicentrics, whereas following fast neutron irradiation, the difference between these two classes of aberrations are significantly different at high doses. In addition, triple fluorescent in situ hybridization technique was used to study the frequencies of radiation-induced translocations involving a specific chromosome. Chromosome number 1 was found to be involved in translocations more frequently than chromosomes number 2, 3, 4, 8 and X. (author). 10 refs., 1 fig., 2 tabs

Radiation hybrid mapping of human chromosome 18

International Nuclear Information System (INIS)

Francke, U.; Moon, A.J.; Chang, E.; Foellmer, B.; Strauss, B.; Haschke, A.; Chihlin Hsieh; Geigl, E.M.; Welch, S.

1990-01-01

The authors have generated a Chinese hamster V79/380-6 HPRT minus x human leukocyte hybrid cell line (18/V79) with chromosome 18 as the only human chromosome that is retained at high frequency without specific selection. Hybrid cells were selected in HAT medium, and 164 individual colonies were isolated. Of 110 colonies screened for human DNA by PCR amplification using a primer specific for human Alu repeats 67 (61%) were positive. These were expanded in culture for large-scale DNA preparations. Retesting expanded clones by PCR with Alu and LINE primers has revealed unique patterns of amplification products. In situ hybridization of biotin labelled total human DNA to metaphase spreads from various hybrids revealed the presence of one or more human DNA fragments integrated in hamster chromosomes. The authors have generated a resource that should allow the construction of a radiation map, to be compared with the YAC contig map also under construction in their laboratory

The probability to initiate X chromosome inactivation is determined by the X to autosomal ratio and X chromosome specific allelic properties.

Directory of Open Access Journals (Sweden)

Kim Monkhorst

Full Text Available In female mammalian cells, random X chromosome inactivation (XCI equalizes the dosage of X-encoded gene products to that in male cells. XCI is a stochastic process, in which each X chromosome has a probability to be inactivated. To obtain more insight in the factors setting up this probability, we studied the role of the X to autosome (X ratio A ratio in initiation of XCI, and have used the experimental data in a computer simulation model to study the cellular population dynamics of XCI.To obtain more insight in the role of the XratioA ratio in initiation of XCI, we generated triploid mouse ES cells by fusion of haploid round spermatids with diploid female and male ES cells. These fusion experiments resulted in only XXY triploid ES cells. XYY and XXX ES lines were absent, suggesting cell death related either to insufficient X-chromosomal gene dosage (XYY or to inheritance of an epigenetically modified X chromosome (XXX. Analysis of active (Xa and inactive (Xi X chromosomes in the obtained triploid XXY lines indicated that the initiation frequency of XCI is low, resulting in a mixed population of XaXiY and XaXaY cells, in which the XaXiY cells have a small proliferative advantage. This result, and findings on XCI in diploid and tetraploid ES cell lines with different X ratio A ratios, provides evidence that the X ratio A ratio determines the probability for a given X chromosome to be inactivated. Furthermore, we found that the kinetics of the XCI process can be simulated using a probability for an X chromosome to be inactivated that is proportional to the X ratio A ratio. These simulation studies re-emphasize our hypothesis that the probability is a function of the concentration of an X-encoded activator of XCI, and of X chromosome specific allelic properties determining the threshold for this activator.The present findings reveal that the probability for an X chromosome to be inactivated is proportional to the X ratio A ratio. This finding

AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

Science.gov (United States)

Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

2017-06-01

Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

Rearrangement of a common cellular DNA domain on chromosome 4 in human primary liver tumors

International Nuclear Information System (INIS)

Pasquinelli, C.; Garreau, F.; Bougueleret, L.; Cariani, E.; Thiers, V.; Croissant, O.; Hadchouel, M.; Tiollais, P.; Brechot, C.; Grzeschik, K.H.

1988-01-01

Hepatitis B virus (HBV) DNA integration has been shown to occur frequently in human hepatocellular carcinomas. The authors have investigated whether common cellular DNA domains might be rearranged, possibly by HBV integration, in human primary liver tumors. Unique cellular DNA sequences adjacent to an HBV integration site were isolated from a patient with hepatitis B surface antigen-positive hepatocellular carcinoma. These probes detected rearrangement of this cellular region of chromosomal DNA in 3 of 50 additional primary liver tumors studied. Of these three tumor samples, two contained HBV DNA, without an apparent link between the viral DNA and the rearranged allele; HBV DNA sequences were not detected in the third tumor sample. By use of a panel of somatic cell hybrids, these unique cellular DNA sequences were shown to be located on chromosome 4. Therefore, this region of chromosomal DNA might be implicated in the formation of different tumors at one step of liver cell transformation, possible related to HBV integration

Stress induced by premature chromatin condensation triggers chromosome shattering and chromothripsis at DNA sites still replicating in micronuclei or multinucleate cells when primary nuclei enter mitosis.

Science.gov (United States)

Terzoudi, Georgia I; Karakosta, Maria; Pantelias, Antonio; Hatzi, Vasiliki I; Karachristou, Ioanna; Pantelias, Gabriel

2015-11-01

Combination of next-generation DNA sequencing, single nucleotide polymorphism array analyses and bioinformatics has revealed the striking phenomenon of chromothripsis, described as complex genomic rearrangements acquired in a single catastrophic event affecting one or a few chromosomes. Via an unproven mechanism, it is postulated that mechanical stress causes chromosome shattering into small lengths of DNA, which are then randomly reassembled by DNA repair machinery. Chromothripsis is currently examined as an alternative mechanism of oncogenesis, in contrast to the present paradigm that considers a stepwise development of cancer. While evidence for the mechanism(s) underlying chromosome shattering during cancer development remains elusive, a number of hypotheses have been proposed to explain chromothripsis, including ionizing radiation, DNA replication stress, breakage-fusion-bridge cycles, micronuclei formation and premature chromosome compaction. In the present work, we provide experimental evidence on the mechanistic basis of chromothripsis and on how chromosomes can get locally shattered in a single catastrophic event. Considering the dynamic nature of chromatin nucleoprotein complex, capable of rapid unfolding, disassembling, assembling and refolding, we first show that chromatin condensation at repairing or replicating DNA sites induces the mechanical stress needed for chromosome shattering to ensue. Premature chromosome condensation is then used to visualize the dynamic nature of interphase chromatin and demonstrate that such mechanical stress and chromosome shattering can also occur in chromosomes within micronuclei or asynchronous multinucleate cells when primary nuclei enter mitosis. Following an aberrant mitosis, chromosomes could find themselves in the wrong place at the wrong time so that they may undergo massive DNA breakage and rearrangement in a single catastrophic event. Specifically, our results support the hypothesis that premature chromosome

Hanford Site environmental management specification

Energy Technology Data Exchange (ETDEWEB)

Grygiel, M.L.

1998-06-10

The US Department of Energy, Richland Operations Office (RL) uses this Hanford Site Environmental Management Specification (Specification) to document top-level mission requirements and planning assumptions for the prime contractors involved in Hanford Site cleanup and infrastructure activities under the responsibility of the US Department of Energy, Office of Environmental Management. This Specification describes at a top level the activities, facilities, and infrastructure necessary to accomplish the cleanup of the Hanford Site and assigns this scope to Site contractors and their respective projects. This Specification also references the key National Environmental Policy Act of 1969 (NEPA), Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA), and safety documentation necessary to accurately describe the cleanup at a summary level. The information contained in this document reflects RL`s application of values, priorities, and critical success factors expressed by those involved with and affected by the Hanford Site project. The prime contractors and their projects develop complete baselines and work plans to implement this Specification. These lower-level documents and the data that support them, together with this Specification, represent the full set of requirements applicable to the contractors and their projects. Figure 1-1 shows the relationship of this Specification to the other basic Site documents. Similarly, the documents, orders, and laws referenced in this specification represent only the most salient sources of requirements. Current and contractual reference data contain a complete set of source documents.

Hanford Site environmental management specification

International Nuclear Information System (INIS)

Grygiel, M.L.

1998-01-01

The US Department of Energy, Richland Operations Office (RL) uses this Hanford Site Environmental Management Specification (Specification) to document top-level mission requirements and planning assumptions for the prime contractors involved in Hanford Site cleanup and infrastructure activities under the responsibility of the US Department of Energy, Office of Environmental Management. This Specification describes at a top level the activities, facilities, and infrastructure necessary to accomplish the cleanup of the Hanford Site and assigns this scope to Site contractors and their respective projects. This Specification also references the key National Environmental Policy Act of 1969 (NEPA), Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA), and safety documentation necessary to accurately describe the cleanup at a summary level. The information contained in this document reflects RL's application of values, priorities, and critical success factors expressed by those involved with and affected by the Hanford Site project. The prime contractors and their projects develop complete baselines and work plans to implement this Specification. These lower-level documents and the data that support them, together with this Specification, represent the full set of requirements applicable to the contractors and their projects. Figure 1-1 shows the relationship of this Specification to the other basic Site documents. Similarly, the documents, orders, and laws referenced in this specification represent only the most salient sources of requirements. Current and contractual reference data contain a complete set of source documents

Site-Specific Innovation

DEFF Research Database (Denmark)

Reeh, Henrik; Hemmersam, Peter

2015-01-01

Currently, cities across the Northern European region are actively redeveloping their former industrial harbours. Indeed, harbours areas are essential in the long-term transition from industrial to information and experience societies; harbours are becoming sites for new businesses and residences...... question is how innovation may contribute to urban life and site-specific qualities....

Alternative Lengthening of Telomeres: Recurrent Cytogenetic Aberrations and Chromosome Stability under Extreme Telomere Dysfunction

Directory of Open Access Journals (Sweden)

Despoina Sakellariou

2013-11-01

Full Text Available Human tumors using the alternative lengthening of telomeres (ALT exert high rates of telomere dysfunction. Numerical chromosomal aberrations are very frequent, and structural rearrangements are widely scattered among the genome. This challenging context allows the study of telomere dysfunction-driven chromosomal instability in neoplasia (CIN in a massive scale. We used molecular cytogenetics to achieve detailed karyotyping in 10 human ALT neoplastic cell lines.We identified 518 clonal recombinant chromosomes affected by 649 structural rearrangements. While all human chromosomes were involved in random or clonal, terminal, or pericentromeric rearrangements and were capable to undergo telomere healing at broken ends, a differential recombinatorial propensity of specific genomic regions was noted.We show that ALT cells undergo epigenetic modifications rendering polycentric chromosomes functionally monocentric, and because of increased terminal recombinogenicity, they generate clonal recombinant chromosomes with interstitial telomeric repeats. Losses of chromosomes 13, X, and 22, gains of 2, 3, 5, and 20, and translocation/deletion events involving several common chromosomal fragile sites (CFSs were recurrent. Long-term reconstitution of telomerase activity in ALT cells reduced significantly the rates of random ongoing telomeric and pericentromeric CIN. However, the contribution of CFS in overall CIN remained unaffected, suggesting that in ALT cells whole-genome replication stress is not suppressed by telomerase activation. Our results provide novel insights into ALT-driven CIN, unveiling in parallel specific genomic sites that may harbor genes critical for ALT cancerous cell growth.

Allele-specific marker generation and linkage mapping on the Xiphophorus sex chromosomes.

Science.gov (United States)

Woolcock, B; Kazianis, S; Lucito, R; Walter, R B; Kallman, K D; Morizot, D C; Vielkind, J R

2006-01-01

There is great interest in the sex chromosomes of Xiphophorus fishes because both WY/YY and XX/XY sex-determining mechanisms function in these species, with at least one taxon possessing all three types of sex chromosomes, and because in certain interspecific hybrids melanoma arises as a consequence of inheritance of the sex-linked macromelanophore determining locus (MDL). Representational difference analysis (RDA) has been used to clone two sequences from the sex-determining region of X. maculatus, including a cholinergic receptor, nicotinic, delta polypeptide (CHRND) orthologue. Allele-specific assays for these sequences, as well as for the sex-linked XMRK1 and XMRK2 genes, were developed to distinguish W, X, and Y chromosomes derived from a X. maculatus (XX/XY) strain and a X. helleri (WY/YY) strain. Linkage mapping localized these markers to linkage group (LG) 24. No recombinants were observed between XMRK2 and MDL, confirming a role for XMRK2 in macromelanophore development. Although the master sex-determining (SD) locus certainly resides on Xiphophorus LG 24, autosomal loci are probably involved in sex determination as well, as indicated by the abnormal sex ratios in the backcross hybrids that contrast theoretical predictions based on LG 24 genotyping. Marker development and allelic discrimination on the Xiphophorus sex chromosomes should prove highly useful for studies that utilize this genus as an animal model.

Chromosomal imbalances in four new uterine cervix carcinoma derived cell lines

International Nuclear Information System (INIS)

Hidalgo, Alfredo; Monroy, Alberto; Arana, Rosa Ma; Taja, Lucía; Vázquez, Guelaguetza; Salcedo, Mauricio

2003-01-01

Uterine cervix carcinoma is the second most common female malignancy worldwide and a major health problem in Mexico, representing the primary cause of death among the Mexican female population. High risk human papillomavirus (HPV) infection is considered to be the most important risk factor for the development of this tumor and cervical carcinoma derived cell lines are very useful models for the study of viral carcinogenesis. Comparative Genomic Hybridization (CGH) experiments have detected a specific pattern of chromosomal imbalances during cervical cancer progression, indicating chromosomal regions that might contain genes that are important for cervical transformation. We performed HPV detection and CGH analysis in order to initiate the genomic characterization of four recently established cervical carcinoma derived cell lines from Mexican patients. All the cell lines were HPV18 positive. The most prevalent imbalances in the cell lines were gains in chromosomes 1q23-q32, 3q11.2-q13.1, 3q22-q26.1, 5p15.1-p11.2, this alteration present as a high copy number amplification in three of the cell lines, 7p15-p13, 7q21, 7q31, 11q21, and 12q12, and losses in 2q35-qter, 4p16, 6q26-qter, 9q34 and 19q13.2-qter. Analysis of our present findings and previously reported data suggest that gains at 1q31-q32 and 7p13-p14, as well as losses at 6q26-q27 are alterations that might be unique for HPV18 positive cases. These chromosomal regions, as well as regions with high copy number amplifications, coincide with known fragile sites and known HPV integration sites. The general pattern of chromosomal imbalances detected in the cells resembled that found in invasive cervical tumors, suggesting that the cells represent good models for the study of cervical carcinoma

Painting of fourth and chromosome-wide regulation of the 4th chromosome in Drosophila melanogaster.

Science.gov (United States)

Johansson, Anna-Mia; Stenberg, Per; Bernhardsson, Carolina; Larsson, Jan

2007-05-02

Drosophila melanogaster exhibits two expression-regulating systems that target whole, specific chromosomes: the dosage compensation system whereby the male-specific lethal complex doubles transcription of genes on the male X-chromosome and the chromosome 4-specific protein Painting of fourth, POF. POF is the first example of an autosome-specific protein and its presence raises the question of the universality of chromosome-specific regulation. Here we show that POF and heterochromatin protein 1 (HP1) are involved in the global regulation of the 4th chromosome. Contrary to previous conclusions, Pof is not essential for survival of diplo-4th karyotype flies. However, Pof is essential for survival of haplo-4th individuals and expression of chromosome 4 genes in diplo-4th individuals is decreased in the absence of Pof. Mapping of POF using chromatin immunoprecipitation suggested that it binds within genes. Furthermore, we show that POF binding is dependent on heterochromatin and that POF and HP1 bind interdependently to the 4th chromosome. We propose a balancing mechanism involving POF and HP1 that provides a feedback system for fine-tuning expression status of genes on the 4th chromosome.

Cytogenetic evaluation of chromosomal disorders in Down Syndrome

International Nuclear Information System (INIS)

Shafik, H.M.

1987-01-01

Down Syndrome (DS) patients are at high risk to develop leukemia. They are also highly sensitive to the induction of chromosomal aberrations when their GO lymphocytes are irradiated in vitro. The objective of this study was to further investigate the differential radiosensitivity of DS lymphocytes at the different stages of the cell cycle, as damage to proliferating cells is more relevant to health problems than damage to non-dividing cells. In addition, the proliferation kinetics and stage of differentiation of circulating DS lymphocytes was studied in an attempt to understand the mechanism for the enhanced chromosomal radiosensitivity. Moreover, the x-ray induced specific chromosomal breakpoints were identified and correlated with the locations of oncogene and fragile sites in order to investigate cytogenetically the early stages of leukemogenesis

Cell Culture Systems To Study Human Herpesvirus 6A/B Chromosomal Integration.

Science.gov (United States)

Gravel, Annie; Dubuc, Isabelle; Wallaschek, Nina; Gilbert-Girard, Shella; Collin, Vanessa; Hall-Sedlak, Ruth; Jerome, Keith R; Mori, Yasuko; Carbonneau, Julie; Boivin, Guy; Kaufer, Benedikt B; Flamand, Louis

2017-07-15

Human herpesviruses 6A/B (HHV-6A/B) can integrate their viral genomes in the telomeres of human chromosomes. The viral and cellular factors contributing to HHV-6A/B integration remain largely unknown, mostly due to the lack of efficient and reproducible cell culture models to study HHV-6A/B integration. In this study, we characterized the HHV-6A/B integration efficiencies in several human cell lines using two different approaches. First, after a short-term infection (5 h), cells were processed for single-cell cloning and analyzed for chromosomally integrated HHV-6A/B (ciHHV-6A/B). Second, cells were infected with HHV-6A/B and allowed to grow in bulk for 4 weeks or longer and then analyzed for the presence of ciHHV-6. Using quantitative PCR (qPCR), droplet digital PCR, and fluorescent in situ hybridization, we could demonstrate that HHV-6A/B integrated in most human cell lines tested, including telomerase-positive (HeLa, MCF-7, HCT-116, and HEK293T) and telomerase-negative cell lines (U2OS and GM847). Our results also indicate that inhibition of DNA replication, using phosphonoacetic acid, did not affect HHV-6A/B integration. Certain clones harboring ciHHV-6A/B spontaneously express viral genes and proteins. Treatment of cells with phorbol ester or histone deacetylase inhibitors triggered the expression of many viral genes, including U39 , U90 , and U100 , without the production of infectious virus, suggesting that the tested stimuli were not sufficient to trigger full reactivation. In summary, both integration models yielded comparable results and should enable the identification of viral and cellular factors contributing to HHV-6A/B integration and the screening of drugs influencing viral gene expression, as well as the release of infectious HHV-6A/B from the integrated state. IMPORTANCE The analysis and understanding of HHV-6A/B genome integration into host DNA is currently limited due to the lack of reproducible and efficient viral integration systems. In the

Development of a high efficiency integration system and promoter library for rapid modification of Pseudomonas putida KT2440

Energy Technology Data Exchange (ETDEWEB)

Elmore, Joshua R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division; Furches, Anna [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division; Wolff, Gara N. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division; Gorday, Kent [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division; Guss, Adam M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division

2017-04-15

Pseudomonas putida strains are highly robust bacteria known for their ability to efficiently utilize a variety of carbon sources, including aliphatic and aromatic hydrocarbons. Recently, P. putida has been engineered to valorize the lignin stream of a lignocellulosic biomass pretreatment process. Nonetheless, when compared to platform organisms such as Escherichia coli, the toolkit for engineering P. putida is underdeveloped. Heterologous gene expression in particular is problematic. Plasmid instability and copy number variance provide challenges for replicative plasmids, while use of homologous recombination for insertion of DNA into the chromosome is slow and laborious. Furthermore, heterologous expression efforts to date typically rely on overexpression of exogenous pathways using a handful of poorly characterized promoters. In order to improve the P. putida toolkit, we developed a rapid genome integration system using the site-specific recombinase from bacteriophage Bxb1 to enable rapid, high efficiency integration of DNA into the P. putida chromosome. We also developed a library of synthetic promoters with various UP elements, -35 sequences, and -10 sequences, as well as different ribosomal binding sites. We tested these promoters using a fluorescent reporter gene, mNeonGreen, to characterize the strength of each promoter, and identified UP-element-promoter-ribosomal binding sites combinations capable of driving a ~150-fold range of protein expression levels. One additional integrating vector was developed that confers more robust kanamycin resistance when integrated at single copy into the chromosome. This genome integration and reporter systems are extensible for testing other genetic parts, such as examining terminator strength, and will allow rapid integration of heterologous pathways for metabolic engineering.

Mouse TRIP13/PCH2 Is Required for Recombination and Normal Higher-Order Chromosome Structure during Meiosis

NARCIS (Netherlands)

Roig, I.; Dowdle, J.A.; Toth, A.; de Rooij, D.G.; Jasin, M.; Keeney, S.

2010-01-01

Accurate chromosome segregation during meiosis requires that homologous chromosomes pair and become physically connected so that they can orient properly on the meiosis I spindle. These connections are formed by homologous recombination closely integrated with the development of meiosis-specific,

Origin of specific chromosome aberration in radiation-induced leukemia

International Nuclear Information System (INIS)

Ban, Nobuhiko; Kai, Michiaki; Masuno, Yoko

2005-01-01

The theme in the title is discussed from the four aspects of specific chromosome aberration (sAb) patterns in radiation-induced leukemia (RIL), possibility for radiation to induce the sAb in RIL, any evidence for participation of delayed aberration to form sAb and the proportion of such healthy humans as having the specifically rearranged genome. Data of sAb observed in leukemia of 25 A-bomb survivors and of 38 patients post radiotherapy of cancers give a rather common pattern. However, many inconsistent results are obtained for sAb in patients post radiotherapy, A-bomb survivors, residents living in radio-contaminated houses in Taipei, in vitro exposure, and Chernobyl residents. At present, any clear evidence is available neither for sAb derived from the delayed aberration nor for estimating the proportion with the specifically rearranged gene. As above, it is unlikely that radiation induces such a translocation abnormality as BCR-ABL specifically seen in leukemia, and this aspect will be important for studies on the genesis of RIL and its risk assessment. (S.I.)

Integrating Risk Analyses and Tools at the DOE Hanford Site

International Nuclear Information System (INIS)

LOBER, R.W.

2002-01-01

Risk assessment and environmental impact analysis at the U.S. Department of Energy (DOE) Hanford Site in Washington State has made significant progress in refining the strategy for using risk analysis to support closing of several hundred waste sites plus 149 single-shell tanks at the Hanford Site. A Single-Shell Tank System Closure Work Plan outlines the current basis for closing the single-shell tank systems. An analogous site approach has been developed to address closure of aggregated groups of similar waste sites. Because of the complexity, decision time frames, proximity of non-tank farm waste sites to tank farms, scale, and regulatory considerations, various projects are providing integrated assessments to support risk analyses and decision-making. Projects and the tools that are being developed and applied at Hanford to support retrieval and cleanup decisions include: (1) Life Cycle Model (LCM) and Risk Receptor Model (RRM)--A site-level set of tools to support strategic analyses through scoping level risk management to assess different alternatives and options for tank closure. (2) Systems Assessment Capability for Integrated Groundwater Nadose Zone (SAC) and the Site-Wide Groundwater Model (SWGM)--A site-wide groundwater modeling system coupled with a risk-based uncertainty analysis of inventory, vadose zone, groundwater, and river interactions for evaluating cumulative impacts from individual and aggregate waste sites. (3) Retrieval Performance Evaluation (RPE)--A site-specific, risk-based methodology developed to evaluate performance of waste retrieval, leak detection and closure on a tank-specific basis as a function of past tank Leaks, potential leakage during retrieval operations, and remaining residual waste inventories following completion of retrieval operations. (4) Field Investigation Report (FIR)--A corrective action program to investigate the nature and extent of past tank leaks through characterization activities and assess future impacts to

Integration of HIV in the Human Genome: Which Sites Are Preferential? A Genetic and Statistical Assessment

Science.gov (United States)

Gonçalves, Juliana; Moreira, Elsa; Sequeira, Inês J.; Rodrigues, António S.; Rueff, José; Brás, Aldina

2016-01-01

Chromosomal fragile sites (FSs) are loci where gaps and breaks may occur and are preferential integration targets for some viruses, for example, Hepatitis B, Epstein-Barr virus, HPV16, HPV18, and MLV vectors. However, the integration of the human immunodeficiency virus (HIV) in Giemsa bands and in FSs is not yet completely clear. This study aimed to assess the integration preferences of HIV in FSs and in Giemsa bands using an in silico study. HIV integration positions from Jurkat cells were used and two nonparametric tests were applied to compare HIV integration in dark versus light bands and in FS versus non-FS (NFSs). The results show that light bands are preferential targets for integration of HIV-1 in Jurkat cells and also that it integrates with equal intensity in FSs and in NFSs. The data indicates that HIV displays different preferences for FSs compared to other viruses. The aim was to develop and apply an approach to predict the conditions and constraints of HIV insertion in the human genome which seems to adequately complement empirical data. PMID:27294106

Chromosome Banding in Amphibia. XXXII. The Genus Xenopus (Anura, Pipidae).

Science.gov (United States)

Schmid, Michael; Steinlein, Claus

2015-01-01

Mitotic chromosomes of 16 species of the frog genus Xenopus were prepared from kidney and lung cell cultures. In the chromosomes of 7 species, high-resolution replication banding patterns could be induced by treating the cultures with 5-bromodeoxyuridine (BrdU) and deoxythymidine (dT) in succession, and in 6 of these species the BrdU/dT-banded chromosomes could be arranged into karyotypes. In the 3 species of the clade with 2n = 20 and 4n = 40 chromosomes (X. tropicalis, X. epitropicalis, X. new tetraploid 1), as well as in the 3 species with 4n = 36 chromosomes (X. laevis, X. borealis, X. muelleri), the BrdU/dT-banded karyotypes show a high degree of homoeology, though differences were detected between these groups. Translocations, inversions, insertions or sex-specific replication bands were not observed. Minor replication asynchronies found between chromosomes probably involve heterochromatic regions. BrdU/dT replication banding of Xenopus chromosomes provides the landmarks necessary for the exact physical mapping of genes and repetitive sequences. FISH with an X. laevis 5S rDNA probe detected multiple hybridization sites at or near the long-arm telomeric regions in most chromosomes of X. laevis and X. borealis, whereas in X. muelleri, the 5S rDNA sequences are located exclusively at the long-arm telomeres of a single chromosome pair. Staining with the AT base pair-specific fluorochrome quinacrine mustard revealed brightly fluorescing heterochromatic regions in the majority of X. borealis chromosomes which are absent in other Xenopus species.

Genome-wide mapping of Painting of fourth on Drosophila melanogaster salivary gland polytene chromosomes.

Science.gov (United States)

Johansson, Anna-Mia; Larsson, Jan

2014-12-01

The protein Painting of fourth (POF) in Drosophila melanogaster specifically targets and stimulates expression output from the heterochromatic 4th chromosome, thereby representing an autosome specific protein [1,2]. Despite the high specificity for chromosome 4 genes, POF is occasionally observed binding to the cytological region 2L:31 in males and females [3] and two loci on the X-chromosome, PoX1 and PoX2 only in females [4]. Here we provide a detailed description of the experimental design and analysis of the tiling array data presented by Lundberg and colleagues in G3: Genes, Genomes, Genetics 2013 [4], where the female specific POF binding to PoX1 and PoX2 loci on the X chromosome was reported. We show the genome-wide high resolution binding profile of the POF protein where these different POF binding sites are detected. The complete data set is available at http://www.ncbi.nlm.nih.gov/geo/ (accession: GSE45402).

High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

Science.gov (United States)

van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

2010-11-01

The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

Integrated Site Model Process Model Report

International Nuclear Information System (INIS)

Booth, T.

2000-01-01

The Integrated Site Model (ISM) provides a framework for discussing the geologic features and properties of Yucca Mountain, which is being evaluated as a potential site for a geologic repository for the disposal of nuclear waste. The ISM is important to the evaluation of the site because it provides 3-D portrayals of site geologic, rock property, and mineralogic characteristics and their spatial variabilities. The ISM is not a single discrete model; rather, it is a set of static representations that provide three-dimensional (3-D), computer representations of site geology, selected hydrologic and rock properties, and mineralogic-characteristics data. These representations are manifested in three separate model components of the ISM: the Geologic Framework Model (GFM), the Rock Properties Model (RPM), and the Mineralogic Model (MM). The GFM provides a representation of the 3-D stratigraphy and geologic structure. Based on the framework provided by the GFM, the RPM and MM provide spatial simulations of the rock and hydrologic properties, and mineralogy, respectively. Functional summaries of the component models and their respective output are provided in Section 1.4. Each of the component models of the ISM considers different specific aspects of the site geologic setting. Each model was developed using unique methodologies and inputs, and the determination of the modeled units for each of the components is dependent on the requirements of that component. Therefore, while the ISM represents the integration of the rock properties and mineralogy into a geologic framework, the discussion of ISM construction and results is most appropriately presented in terms of the three separate components. This Process Model Report (PMR) summarizes the individual component models of the ISM (the GFM, RPM, and MM) and describes how the three components are constructed and combined to form the ISM

Untangling the Contributions of Sex-Specific Gene Regulation and X-Chromosome Dosage to Sex-Biased Gene Expression in Caenorhabditis elegans

Science.gov (United States)

Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc

2016-01-01

Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611

Construction of reference chromosome-scale pseudomolecules for potato: integrating the potato genome with genetic and physical maps.

Science.gov (United States)

Sharma, Sanjeev Kumar; Bolser, Daniel; de Boer, Jan; Sønderkær, Mads; Amoros, Walter; Carboni, Martin Federico; D'Ambrosio, Juan Martín; de la Cruz, German; Di Genova, Alex; Douches, David S; Eguiluz, Maria; Guo, Xiao; Guzman, Frank; Hackett, Christine A; Hamilton, John P; Li, Guangcun; Li, Ying; Lozano, Roberto; Maass, Alejandro; Marshall, David; Martinez, Diana; McLean, Karen; Mejía, Nilo; Milne, Linda; Munive, Susan; Nagy, Istvan; Ponce, Olga; Ramirez, Manuel; Simon, Reinhard; Thomson, Susan J; Torres, Yerisf; Waugh, Robbie; Zhang, Zhonghua; Huang, Sanwen; Visser, Richard G F; Bachem, Christian W B; Sagredo, Boris; Feingold, Sergio E; Orjeda, Gisella; Veilleux, Richard E; Bonierbale, Merideth; Jacobs, Jeanne M E; Milbourne, Dan; Martin, David Michael Alan; Bryan, Glenn J

2013-11-06

The genome of potato, a major global food crop, was recently sequenced. The work presented here details the integration of the potato reference genome (DM) with a new sequence-tagged site marker-based linkage map and other physical and genetic maps of potato and the closely related species tomato. Primary anchoring of the DM genome assembly was accomplished by the use of a diploid segregating population, which was genotyped with several types of molecular genetic markers to construct a new ~936 cM linkage map comprising 2469 marker loci. In silico anchoring approaches used genetic and physical maps from the diploid potato genotype RH89-039-16 (RH) and tomato. This combined approach has allowed 951 superscaffolds to be ordered into pseudomolecules corresponding to the 12 potato chromosomes. These pseudomolecules represent 674 Mb (~93%) of the 723 Mb genome assembly and 37,482 (~96%) of the 39,031 predicted genes. The superscaffold order and orientation within the pseudomolecules are closely collinear with independently constructed high density linkage maps. Comparisons between marker distribution and physical location reveal regions of greater and lesser recombination, as well as regions exhibiting significant segregation distortion. The work presented here has led to a greatly improved ordering of the potato reference genome superscaffolds into chromosomal "pseudomolecules".

Specific gene expression profiles and chromosomal abnormalities are associated with infant disseminated neuroblastoma

Directory of Open Access Journals (Sweden)

Kushner Brian

2009-02-01

Full Text Available Abstract Background Neuroblastoma (NB tumours have the highest incidence of spontaneous remission, especially among the stage 4s NB subgroup affecting infants. Clinical distinction of stage 4s from lethal stage 4 can be difficult, but critical for therapeutic decisions. The aim of this study was to investigate chromosomal alterations and differential gene expression amongst infant disseminated NB subgroups. Methods Thirty-five NB tumours from patients diagnosed at Results All stage 4s patients underwent spontaneous remission, only 48% stage 4 patients survived despite combined modality therapy. Stage 4 tumours were 90% near-diploid/tetraploid, 44% MYCN amplified, 77% had 1p LOH (50% 1p36, 23% 11q and/or 14q LOH (27% and 47% had 17q gain. Stage 4s were 90% near-triploid, none MYCN amplified and LOH was restricted to 11q. Initial comparison analyses between stage 4s and 4 P P = 0.0054, 91% with higher expression in stage 4. Less definite expression profiles were observed between stage 4s and 4 P P = 0.005 was maintained. Distinct gene expression profiles but no significant association with specific chromosomal region localization was observed between stage 4s and stage 4 Conclusion Specific chromosomal aberrations are associated with distinct gene expression profiles which characterize spontaneously regressing or aggressive infant NB, providing the biological basis for the distinct clinical behaviour.

Integrating risks at contaminated sites

International Nuclear Information System (INIS)

MacDonell, M.; Habegger, L.; Nieves, L.; Schreiber, Z.; Travis, C.

2000-01-01

The U.S. Department of Energy (DOE) is responsible for a number of large sites across the country that were radioactively and chemically contaminated by past nuclear research, development, and production activities. Multiple risk assessments are being conducted for these sites to evaluate current conditions and determine what measures are needed to protect human health and the environment from today through the long term. Integrating the risks associated with multiple contaminants in different environmental media across extensive areas, over time periods that extend beyond 1,000 years, and for a number of different impact categories--from human health and ecological to social and economic--represents a considerable challenge. A central element of these integrated analyses is the ability to reflect key interrelationships among environmental resources and human communities that may be adversely affected by the actions or inactions being considered for a given site. Complicating the already difficult task of integrating many kinds of risk is the importance of reflecting the diverse values and preferences brought to bear by the multiple parties interested in the risk analysis process and outcome. An initial conceptual framework has been developed to provide an organized structure to this risk integration, with the aim of supporting effective environmental management decisions. This paper highlights key issues associated with comprehensive risk integration and offers suggestions developed from preliminary work at a complex DOE site

Positioning of NORs and NOR-bearing chromosomes in relation to nucleoli.

Science.gov (United States)

Kalmárová, Markéta; Smirnov, Evgeny; Masata, Martin; Koberna, Karel; Ligasová, Anna; Popov, Alexey; Raska, Ivan

2007-10-01

It is widely accepted that chromosomes occupy more or less fixed positions in mammalian interphase nucleus. However, relation between large-scale order of chromosome positioning and gene activity remains unclear. We used the model of the human ribosomal genes to address specific aspects of this problem. Ribosomal genes are organized at particular chromosomal sites in clusters termed nucleolus organizer regions (NORs). Only some NORs, called competent are generally accepted to be transcriptionally active during interphase. Importantly in this respect, the regularities in distribution of competent, and non-competent NORs among the specific chromosomes were already established in two human-derived cell lines: transformed HeLa and primary LEP cells. In the present study, using FISH and immunocytochemistry, we found that in HeLa and LEP cells the large-scale positioning of the NOR-bearing chromosomes with regard to nucleoli is linked to the transcription activity of rDNA. Namely, the tendency of rDNA-bearing chromosomes to associate with nucleoli correlates with the number of transcriptionally competent NORs in the respective chromosome homologs. Regarding the position of NORs, we found that not only competent but also most of the non-competent NORs are included in the nucleoli. Some intranucleolar NORs (supposedly non-competent) are situated on elongated chromatin protrusions connecting nucleoli with respective chromosome territories spatially distanced from nucleoli.

CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool.

Science.gov (United States)

Yang, Fayu; Liu, Changbao; Chen, Ding; Tu, Mengjun; Xie, Haihua; Sun, Huihui; Ge, Xianglian; Tang, Lianchao; Li, Jin; Zheng, Jiayong; Song, Zongming; Qu, Jia; Gu, Feng

2017-06-16

Cre-loxP, as one of the site-specific genetic manipulation tools, offers a method to study the spatial and temporal regulation of gene expression/inactivation in order to decipher gene function. CRISPR/Cas9-mediated targeted genome engineering technologies are sparking a new revolution in biological research. Whether the traditional site-specific genetic manipulation tool and CRISPR/Cas9 could be combined to create a novel genetic tool for highly specific gene editing is not clear. Here, we successfully generated a CRISPR/Cas9-loxP system to perform gene editing in human cells, providing the proof of principle that these two technologies can be used together for the first time. We also showed that distinct non-homologous end-joining (NHEJ) patterns from CRISPR/Cas9-mediated gene editing of the targeting sequence locates at the level of plasmids (episomal) and chromosomes. Specially, the CRISPR/Cas9-mediated NHEJ pattern in the nuclear genome favors deletions (64%-68% at the human AAVS1 locus versus 4%-28% plasmid DNA). CRISPR/Cas9-loxP, a novel site-specific genetic manipulation tool, offers a platform for the dissection of gene function and molecular insights into DNA-repair pathways. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Molecular cytogenetic analysis of Inv Dup(15) chromosomes, using probes specific for the Pradar-Willi/Angelman syndrome region: Clinical implications

Energy Technology Data Exchange (ETDEWEB)

Leana-Cox, J. (Univ. of Maryland School of Medicine, Baltimore, MD (United States)); Jenkins, L. (Kaiser Permanente Medical Group, San Jose, CA (United States)); Palmer, C.G.; Plattner, R. (Indiana School of Medicine, Indianapolis, IN (United States)); Sheppard, L. (Palo Verde Laboratory, Inc., Chandler, AZ (United States)); Flejter, W.L. (Univ. of Michigan, Ann Arbor, MI (United States)); Zackowski, J. (Univ. of Florida Health Science Center, Gainsville, FL (United States)); Tsien, F. (Tulane Univ. School of Medicine, New Orleans, LA (United States)); Schwartz, S. (Case Western Reserve Univ., Cleveland, OH (United States))

1994-05-01

Twenty-seven cases of inverted duplications of chromosome 15 (inv dup[15]) were investigated by FISH with two DNA probes specific for the Prader-Willi syndrome/Angelman syndrome (PWS/AS) region on proximal 15q. Sixteen of the marker chromosomes displayed two copies of each probe, while in the remaining 11 markers no hybridization was observed. A significant association was found between the presence of this region and an abnormal phenotype (P<.01). This is the largest study to date of inv dup(15) chromosomes, that uses molecular cytogenetic methods and is the first to report a significant association between the presence of a specific chromosomal region in such markers and an abnormal phenotype. 30 refs., 1 fig., 4 tabs.

Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system.

Science.gov (United States)

Pyeon, Hye-Rim; Nah, Hee-Ju; Kang, Seung-Hoon; Choi, Si-Sun; Kim, Eung-Soo

2017-05-31

Heterologous expression of biosynthetic gene clusters of natural microbial products has become an essential strategy for titer improvement and pathway engineering of various potentially-valuable natural products. A Streptomyces artificial chromosomal conjugation vector, pSBAC, was previously successfully applied for precise cloning and tandem integration of a large polyketide tautomycetin (TMC) biosynthetic gene cluster (Nah et al. in Microb Cell Fact 14(1):1, 2015), implying that this strategy could be employed to develop a custom overexpression scheme of natural product pathway clusters present in actinomycetes. To validate the pSBAC system as a generally-applicable heterologous overexpression system for a large-sized polyketide biosynthetic gene cluster in Streptomyces, another model polyketide compound, the pikromycin biosynthetic gene cluster, was preciously cloned and heterologously expressed using the pSBAC system. A unique HindIII restriction site was precisely inserted at one of the border regions of the pikromycin biosynthetic gene cluster within the chromosome of Streptomyces venezuelae, followed by site-specific recombination of pSBAC into the flanking region of the pikromycin gene cluster. Unlike the previous cloning process, one HindIII site integration step was skipped through pSBAC modification. pPik001, a pSBAC containing the pikromycin biosynthetic gene cluster, was directly introduced into two heterologous hosts, Streptomyces lividans and Streptomyces coelicolor, resulting in the production of 10-deoxymethynolide, a major pikromycin derivative. When two entire pikromycin biosynthetic gene clusters were tandemly introduced into the S. lividans chromosome, overproduction of 10-deoxymethynolide and the presence of pikromycin, which was previously not detected, were both confirmed. Moreover, comparative qRT-PCR results confirmed that the transcription of pikromycin biosynthetic genes was significantly upregulated in S. lividans containing tandem

Formation and Expansion of Leukemia-Specific Chromosome Aberrations in Hematopoietic Cells of X-ray Irradiated Mice

International Nuclear Information System (INIS)

Ban, N.; Kai, M.; Kusama, T.

2004-01-01

C3H/He mice develop acute myeloid leukemia (AML) after whole-body irradiation, and typical chromosome 2 deletions are found in the leukemia cells. To investigate a process of the formation and the expansion of the AML-specific deletions, we have examined its frequency in primitive hematopoietic cells that could be the target of the leukemogenesis. Male C3H/He mice were exposed to 3Gy x-rays and sacrificed after certain periods of time. Bone marrow cells were collected from the femora and a single-cell suspension from each animal was divided into two parts. One part of the cell suspension was cultured in methylcellulose medium and metaphase spreads were prepared from each growing colony. The other part was sorted to obtain Lin+ and Lin Scal cells and those cells were scored with FISH for the AML-specific deletions. Karyotyping of the cultured cells detected signs of the delayed chromosomal instability, but an aberration involving chromosome 2 has not been found so far. FISH to the sorted cells, however, revealed the ANL-specific deletions could be produced in the primitive hematopoietic cells as an early event of radiation exposure. (Author) 16 refs

Discrimination of chromosome by autoradiography

International Nuclear Information System (INIS)

Masubuchi, Masanori

1975-01-01

This paper describes discrimination of chromosome by autoradiography. In this method, the difference in DNA synthetic phase between each chromosome was used as a standard, and the used chromosome was in metaphase, as morphological characteristics were markedly in this phase. Cell cycle and autoradiography with 3 H-thymidine were also examined. In order to discriminate chromosome by autoradiography, it was effective to utilize the labelled pattern in late DNA synthetic phase, where asynchronous replication of chromosome appeared most obviously. DNA synthesis in chromosome was examined in each DNA synthetic phase by culturing the chromosome after the treatment with 3 H-thymidine and altering the time to prepare chromosome specimen. Discrimination of chromosome in plants and animals by autoradiography was also mentioned. It was noticed as a structural and functional discrimination of chromosome to observe amino acid uptake into chromosome protein and to utilize the difference in labelled pattern between the sites of chromosome. (K. Serizawa)

A dominant control region from the human β-globin locus conferring integration site-independent gene expression.

OpenAIRE

Talbot, D.; Collis, P.; Antoniou, Michael; Vidal, M.; Grosveld, Frank; Greaves, David

1989-01-01

textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell lines and transgenic animals has turned out to be at a low level relative to that of endogenous genes, and influenced by the chromosomal site of insertion of the exogenous construct. We have previo...

Chromosomally Integrated Human Herpesvirus 6: Models of Viral Genome Release from the Telomere and Impacts on Human Health.

Science.gov (United States)

Wood, Michael L; Royle, Nicola J

2017-07-12

Human herpesvirus 6A and 6B, alongside some other herpesviruses, have the striking capacity to integrate into telomeres, the terminal repeated regions of chromosomes. The chromosomally integrated forms, ciHHV-6A and ciHHV-6B, are proposed to be a state of latency and it has been shown that they can both be inherited if integration occurs in the germ line. The first step in full viral reactivation must be the release of the integrated viral genome from the telomere and here we propose various models of this release involving transcription of the viral genome, replication fork collapse, and t-circle mediated release. In this review, we also discuss the relationship between ciHHV-6 and the telomere carrying the insertion, particularly how the presence and subsequent partial or complete release of the ciHHV-6 genome may affect telomere dynamics and the risk of disease.

Microgravitational effects on chromosome behavior (7-IML-1)

Science.gov (United States)

Bruschi, Carlo

1992-01-01

The effects of the two major space-related conditions, microgravity and radiation, on the maintenance and transmission of genetic information have been partially documented in many organisms. Specifically, microgravity acts at the chromosomal level, primarily on the structure and segregation of chromosomes, in producing major abberations such as deletions, breaks, nondisjunction, and chromosome loss, and to a lesser degree, cosmic radiation appears to affect the genic level, producing point mutations and DNA damage. To distinguish between the effects from microgravity and from radiation, it is necessary to monitor both mitotic and meiotic genetic damage in the same organism. The yeast Saccharomyces cerevisiae is used to monitor at high resolution the frequency of chromosome loss, nondisjunction, intergenic recombination, and gene mutation in mitotic and meiotic cells, to a degree impossible in other organisms. Because the yeast chromosomes are small, sensitive measurements can be made that can be extrapolated to higher organisms and man. The objectives of the research are: (1) to quantitate the effects of microgravity and its synergism with cosmic radiation on chromosomal integrity and transmission during mitosis and meiosis; (2) to discriminate between chromosomal processes sensitive to microgravity and/or radiation during mitosis and meiosis; and (3) to relate these findings to anomalous mitotic mating type switching and ascosporogenesis following meiosis.

HPV genotyping and site of viral integration in cervical cancers in Indian women.

Directory of Open Access Journals (Sweden)

Poulami Das

Full Text Available Persistent HPV infection plays a major role in cervical cancer. This study was undertaken to identify HPV types in a cohort of Indian women with locally advanced cervical cancer as well as to determine the physical state and/or site of viral integration in the host genome. Pretreatment biopsies (n = 270 from patients were screened for HPV infection by a high throughput HPV genotyping assay based on luminex xMAP technology as well as MY09/11 PCR and SPF1/2 PCR. Overall HPV positivity was observed to be 95%, with HPV16 being most common (63% followed by infection with HPV18. Integration status of the virus was identified using Amplification of Papillomavirus Oncogene Transcripts (APOT assay in a subset of samples positive for HPV16 and/or HPV18 (n = 86 and with an adequate follow-up. The data was correlated with clinical outcome of the patients. Integration of the viral genome was observed in 79% of the cases and a preference for integration into the chromosomal loci 1p, 3q, 6q, 11q, 13q and 20q was seen. Clinical data revealed that the physical state of the virus (integrated or episomal could be an important prognostic marker for cervical cancer.

Cell-laden hydrogel/titanium microhybrids: Site-specific cell delivery to metallic implants for improved integration.

Science.gov (United States)

Koenig, Geraldine; Ozcelik, Hayriye; Haesler, Lisa; Cihova, Martina; Ciftci, Sait; Dupret-Bories, Agnes; Debry, Christian; Stelzle, Martin; Lavalle, Philippe; Vrana, Nihal Engin

2016-03-01

Porous titanium implants are widely used in dental, orthopaedic and otorhinolaryngology fields to improve implant integration to host tissue. A possible step further to improve the integration with the host is the incorporation of autologous cells in porous titanium structures via cell-laden hydrogels. Fast gelling hydrogels have advantageous properties for in situ applications such as localisation of specific cells and growth factors at a target area without dispersion. The ability to control the cell types in different regions of an implant is important in applications where the target tissue (i) has structural heterogeneity (multiple cell types with a defined spatial configuration with respect to each other); (ii) has physical property gradients essential for its function (such as in the case of osteochondral tissue transition). Due to their near immediate gelation, such gels can also be used for site-specific modification of porous titanium structures, particularly for implants which would face different tissues at different locations. Herein, we describe a step by step design of a model system: the model cell-laden gel-containing porous titanium implants in the form of titanium microbead/hydrogel (maleimide-dextran or maleimide-PVA based) microhybrids. These systems enable the determination of the effect of titanium presence on gel properties and encapsulated cell behaviour as a miniaturized version of full-scale implants, providing a system compatible with conventional analysis methods. We used a fibroblast/vascular endothelial cell co-cultures as our model system and by utilising single microbeads we have quantified the effect of gel microenvironment (degradability, presence of RGD peptides within gel formulation) on cell behaviour and the effect of the titanium presence on cell behaviour and gel formation. Titanium presence slightly changed gel properties without hindering gel formation or affecting cell viability. Cells showed a preference to move towards

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

Science.gov (United States)

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

Characterization of X chromosome inactivation using integrated analysis of whole-exome and mRNA sequencing.

Directory of Open Access Journals (Sweden)

Szabolcs Szelinger

Full Text Available In females, X chromosome inactivation (XCI is an epigenetic, gene dosage compensatory mechanism by inactivation of one copy of X in cells. Random XCI of one of the parental chromosomes results in an approximately equal proportion of cells expressing alleles from either the maternally or paternally inherited active X, and is defined by the XCI ratio. Skewed XCI ratio is suggestive of non-random inactivation, which can play an important role in X-linked genetic conditions. Current methods rely on indirect, semi-quantitative DNA methylation-based assay to estimate XCI ratio. Here we report a direct approach to estimate XCI ratio by integrated, family-trio based whole-exome and mRNA sequencing using phase-by-transmission of alleles coupled with allele-specific expression analysis. We applied this method to in silico data and to a clinical patient with mild cognitive impairment but no clear diagnosis or understanding molecular mechanism underlying the phenotype. Simulation showed that phased and unphased heterozygous allele expression can be used to estimate XCI ratio. Segregation analysis of the patient's exome uncovered a de novo, interstitial, 1.7 Mb deletion on Xp22.31 that originated on the paternally inherited X and previously been associated with heterogeneous, neurological phenotype. Phased, allelic expression data suggested an 83∶20 moderately skewed XCI that favored the expression of the maternally inherited, cytogenetically normal X and suggested that the deleterious affect of the de novo event on the paternal copy may be offset by skewed XCI that favors expression of the wild-type X. This study shows the utility of integrated sequencing approach in XCI ratio estimation.

Y-chromosome and mtDNA variation confirms independent domestications and directional hybridization in South American camelids.

Science.gov (United States)

Marín, J C; Romero, K; Rivera, R; Johnson, W E; González, B A

2017-10-01

Investigations of genetic diversity and domestication in South American camelids (SAC) have relied on autosomal microsatellite and maternally-inherited mitochondrial data. We present the first integrated analysis of domestic and wild SAC combining male and female sex-specific markers (male specific Y-chromosome and female-specific mtDNA sequence variation) to assess: (i) hypotheses about the origin of domestic camelids, (ii) directionality of introgression among domestic and/or wild taxa as evidence of hybridization and (iii) currently recognized subspecies patterns. Three male-specific Y-chromosome markers and control region sequences of mitochondrial DNA are studied here. Although no sequence variation was found in SRY and ZFY, there were seven variable sites in DBY generating five haplotypes on the Y-chromosome. The haplotype network showed clear separation between haplogroups of guanaco-llama and vicuña-alpaca, indicating two genetically distinct patrilineages with near absence of shared haplotypes between guanacos and vicuñas. Although we document some examples of directional hybridization, the patterns strongly support the hypothesis that llama (Lama glama) is derived from guanaco (Lama guanicoe) and the alpaca (Vicugna pacos) from vicuña (Vicugna vicugna). Within male guanacos we identified a haplogroup formed by three haplotypes with different geographical distributions, the northernmost of which (Peru and northern Chile) was also observed in llamas, supporting the commonly held hypothesis that llamas were domesticated from the northernmost populations of guanacos (L. g. cacilensis). Southern guanacos shared the other two haplotypes. A second haplogroup, consisting of two haplotypes, was mostly present in vicuñas and alpacas. However, Y-chromosome variation did not distinguish the two subspecies of vicuñas. © 2017 Stichting International Foundation for Animal Genetics.

High-resolution YAC-cosmid-STS map of human chromosome 13.

Science.gov (United States)

Cayanis, E; Russo, J J; Kalachikov, S; Ye, X; Park, S H; Sunjevaric, I; Bonaldo, M F; Lawton, L; Venkatraj, V S; Schon, E; Soares, M B; Rothstein, R; Warburton, D; Edelman, I S; Zhang, P; Efstratiadis, A; Fischer, S G

1998-01-01

We have assembled a high-resolution physical map of human chromosome 13 DNA (approximately 114 Mb) from hybridization, PCR, and FISH mapping data using a specifically designed set of computer programs. Although the mapping of 13p is limited, 13q (approximately 98 Mb) is covered by an almost continuous contig of 736 YACs aligned to 597 contigs of cosmids. Of a total of 10,789 cosmids initially selected from a chromosome 13-specific cosmid library (16,896 colonies) using inter-Alu PCR probes from the YACs and probes for markers mapped to chromosome 13, 511 were assembled in contigs that were established from cross-hybridization relationships between the cosmids. The 13q YAC-cosmid map was annotated with 655 sequence tagged sites (STSs) with an average spacing of 1 STS per 150 kb. This set of STSs, each identified by a D number and cytogenetic location, includes database markers (198), expressed sequence tags (93), and STSs generated by sequencing of the ends of cosmid inserts (364). Additional annotation has been provided by positioning 197 cosmids mapped by FISH on 13q. The final (comprehensive) map, a list of STS primers, and raw data used in map assembly are available at our Web site (genome1.ccc.columbia.edu/ approximately genome/) and can serve as a resource to facilitate accurate localization of additional markers, provide substrates for sequencing, and assist in the discovery of chromosome 13 genes associated with hereditary diseases.

SITE-94. Site specific base data for the performance assessment

International Nuclear Information System (INIS)

Geier, J.; Tiren, S.; Dverstorp, B.; Glynn, P.

1996-06-01

This report documents the site specific base data that were available, and the utilization of these data within SITE-94. A brief summary is given of SKB's preliminary site investigations for the Aespoe Hard Rock Laboratory (HRL), which were the main source of site-specific data for SITE-94, and an overview is given of the field methods and instrumentation for the preliminary investigations. A compilation is given of comments concerning the availability and quality of the data for Aespoe, and specific recommendations are given for future site investigations. It was found that the HRL pre-investigations produced a large quantity of data which were, for the most part, of sufficient quality to be valuable for a performance assessment. However, some problems were encountered regarding documentation, procedural consistency, positional information, and storage of the data from the measurements. 77 refs, 4 tabs

SPEER-SERVER: a web server for prediction of protein specificity determining sites.

Science.gov (United States)

Chakraborty, Abhijit; Mandloi, Sapan; Lanczycki, Christopher J; Panchenko, Anna R; Chakrabarti, Saikat

2012-07-01

Sites that show specific conservation patterns within subsets of proteins in a protein family are likely to be involved in the development of functional specificity. These sites, generally termed specificity determining sites (SDS), might play a crucial role in binding to a specific substrate or proteins. Identification of SDS through experimental techniques is a slow, difficult and tedious job. Hence, it is very important to develop efficient computational methods that can more expediently identify SDS. Herein, we present Specificity prediction using amino acids' Properties, Entropy and Evolution Rate (SPEER)-SERVER, a web server that predicts SDS by analyzing quantitative measures of the conservation patterns of protein sites based on their physico-chemical properties and the heterogeneity of evolutionary changes between and within the protein subfamilies. This web server provides an improved representation of results, adds useful input and output options and integrates a wide range of analysis and data visualization tools when compared with the original standalone version of the SPEER algorithm. Extensive benchmarking finds that SPEER-SERVER exhibits sensitivity and precision performance that, on average, meets or exceeds that of other currently available methods. SPEER-SERVER is available at http://www.hpppi.iicb.res.in/ss/.

Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering.

Science.gov (United States)

Karimova, Madina; Splith, Victoria; Karpinski, Janet; Pisabarro, M Teresa; Buchholz, Frank

2016-07-22

Precise genome engineering is instrumental for biomedical research and holds great promise for future therapeutic applications. Site-specific recombinases (SSRs) are valuable tools for genome engineering due to their exceptional ability to mediate precise excision, integration and inversion of genomic DNA in living systems. The ever-increasing complexity of genome manipulations and the desire to understand the DNA-binding specificity of these enzymes are driving efforts to identify novel SSR systems with unique properties. Here, we describe two novel tyrosine site-specific recombination systems designated Nigri/nox and Panto/pox. Nigri originates from Vibrio nigripulchritudo (plasmid VIBNI_pA) and recombines its target site nox with high efficiency and high target-site selectivity, without recombining target sites of the well established SSRs Cre, Dre, Vika and VCre. Panto, derived from Pantoea sp. aB, is less specific and in addition to its native target site, pox also recombines the target site for Dre recombinase, called rox. This relaxed specificity allowed the identification of residues that are involved in target site selectivity, thereby advancing our understanding of how SSRs recognize their respective DNA targets.

[Late-replicating regions in salivary gland polytene chromosomes of Drosophila melanogaster].

Science.gov (United States)

Kolesnikov, T D; Andreenkova, N G; Beliaeva, E S; Goncharov, F P; Zykova, T Iu; Boldyreva, L V; Pokholkova, g V; Zhimulev, I F

2013-01-01

About 240 specific regions that are replicated at the very end of the S-phase have been identified in D. melanogaster polytene chromosomes. These regions have a repressive chromatine state, low gene density, long intergenic distances and are enriched in tissue specific genes. In polytene chromosomes, about a quarter of these regions have no enough time to complete replication. As a result, underreplication zones represented by fewer DNA copy number, appear. We studied 60 chromosome regions that demonstrated the most pronounced under-replication. By comparing the location of these regions on a molecular map with syntenic blocks found earlier for Drosophila species by von Grotthuss et al., 2010, we have shown that across the genus Drosophila, these regions tend to have conserved gene order. This forces us to assume the existence of evolutionary mechanisms aimed at maintaining the integrity of these regions.

Heat integration and analysis of decarbonised IGCC sites

Energy Technology Data Exchange (ETDEWEB)

Ng, K.S.; Lopez, Y.; Campbell, G.M.; Sadhukhan, J. [University of Manchester, Manchester (United Kingdom). School of Chemical Engineering & Analytical Science

2010-02-15

Integrated gasification combined cycle (IGCC) power generation systems have become of interest due to their high combined heat and power (CHP) generation efficiency and flexibility to include carbon capture and storage (CCS) in order to reduce CO{sub 2} emissions. However, IGCC's biggest challenge is its high cost of energy production. In this study, decarbonised coal IGCC sites integrated with CCS have been investigated for heat integration and economic value analyses. It is envisaged that the high energy production cost of an IGCC site can be offset by maximising site-wide heat recovery and thereby improving the cost of electricity (COE) of CHP generation. Strategies for designing high efficiency CHP networks have been proposed based on thermodynamic heuristics and pinch theory. Additionally, a comprehensive methodology to determine the COE from a process site has been developed. In this work, we have established thermodynamic and economic comparisons between IGCC sites with and without CCS and a trade-off between the degree of decarbonisation and the COE from the heat integrated IGCC sites. The results show that the COE from the heat integrated decarbonised IGCC sites is significantly lower compared to IGCC sites without heat integration making application of CCS in IGCC sites economically competitive.

ParABS Systems of the Four Replicons of Burkholderia cenocepacia: New Chromosome Centromeres Confer Partition Specificity†

Science.gov (United States)

Dubarry, Nelly; Pasta, Franck; Lane, David

2006-01-01

Most bacterial chromosomes carry an analogue of the parABS systems that govern plasmid partition, but their role in chromosome partition is ambiguous. parABS systems might be particularly important for orderly segregation of multipartite genomes, where their role may thus be easier to evaluate. We have characterized parABS systems in Burkholderia cenocepacia, whose genome comprises three chromosomes and one low-copy-number plasmid. A single parAB locus and a set of ParB-binding (parS) centromere sites are located near the origin of each replicon. ParA and ParB of the longest chromosome are phylogenetically similar to analogues in other multichromosome and monochromosome bacteria but are distinct from those of smaller chromosomes. The latter form subgroups that correspond to the taxa of their hosts, indicating evolution from plasmids. The parS sites on the smaller chromosomes and the plasmid are similar to the “universal” parS of the main chromosome but with a sequence specific to their replicon. In an Escherichia coli plasmid stabilization test, each parAB exhibits partition activity only with the parS of its own replicon. Hence, parABS function is based on the independent partition of individual chromosomes rather than on a single communal system or network of interacting systems. Stabilization by the smaller chromosome and plasmid systems was enhanced by mutation of parS sites and a promoter internal to their parAB operons, suggesting autoregulatory mechanisms. The small chromosome ParBs were found to silence transcription, a property relevant to autoregulation. PMID:16452432

Meiosis-specific cohesin component, Stag3 is essential for maintaining centromere chromatid cohesion, and required for DNA repair and synapsis between homologous chromosomes.

Science.gov (United States)

Hopkins, Jessica; Hwang, Grace; Jacob, Justin; Sapp, Nicklas; Bedigian, Rick; Oka, Kazuhiro; Overbeek, Paul; Murray, Steve; Jordan, Philip W

2014-07-01

Cohesins are important for chromosome structure and chromosome segregation during mitosis and meiosis. Cohesins are composed of two structural maintenance of chromosomes (SMC1-SMC3) proteins that form a V-shaped heterodimer structure, which is bridged by a α-kleisin protein and a stromal antigen (STAG) protein. Previous studies in mouse have shown that there is one SMC1 protein (SMC1β), two α-kleisins (RAD21L and REC8) and one STAG protein (STAG3) that are meiosis-specific. During meiosis, homologous chromosomes must recombine with one another in the context of a tripartite structure known as the synaptonemal complex (SC). From interaction studies, it has been shown that there are at least four meiosis-specific forms of cohesin, which together with the mitotic cohesin complex, are lateral components of the SC. STAG3 is the only meiosis-specific subunit that is represented within all four meiosis-specific cohesin complexes. In Stag3 mutant germ cells, the protein level of other meiosis-specific cohesin subunits (SMC1β, RAD21L and REC8) is reduced, and their localization to chromosome axes is disrupted. In contrast, the mitotic cohesin complex remains intact and localizes robustly to the meiotic chromosome axes. The instability of meiosis-specific cohesins observed in Stag3 mutants results in aberrant DNA repair processes, and disruption of synapsis between homologous chromosomes. Furthermore, mutation of Stag3 results in perturbation of pericentromeric heterochromatin clustering, and disruption of centromere cohesion between sister chromatids during meiotic prophase. These defects result in early prophase I arrest and apoptosis in both male and female germ cells. The meiotic defects observed in Stag3 mutants are more severe when compared to single mutants for Smc1β, Rec8 and Rad21l, however they are not as severe as the Rec8, Rad21l double mutants. Taken together, our study demonstrates that STAG3 is required for the stability of all meiosis-specific cohesin

Meiosis-specific cohesin component, Stag3 is essential for maintaining centromere chromatid cohesion, and required for DNA repair and synapsis between homologous chromosomes.

Directory of Open Access Journals (Sweden)

Jessica Hopkins

2014-07-01

Full Text Available Cohesins are important for chromosome structure and chromosome segregation during mitosis and meiosis. Cohesins are composed of two structural maintenance of chromosomes (SMC1-SMC3 proteins that form a V-shaped heterodimer structure, which is bridged by a α-kleisin protein and a stromal antigen (STAG protein. Previous studies in mouse have shown that there is one SMC1 protein (SMC1β, two α-kleisins (RAD21L and REC8 and one STAG protein (STAG3 that are meiosis-specific. During meiosis, homologous chromosomes must recombine with one another in the context of a tripartite structure known as the synaptonemal complex (SC. From interaction studies, it has been shown that there are at least four meiosis-specific forms of cohesin, which together with the mitotic cohesin complex, are lateral components of the SC. STAG3 is the only meiosis-specific subunit that is represented within all four meiosis-specific cohesin complexes. In Stag3 mutant germ cells, the protein level of other meiosis-specific cohesin subunits (SMC1β, RAD21L and REC8 is reduced, and their localization to chromosome axes is disrupted. In contrast, the mitotic cohesin complex remains intact and localizes robustly to the meiotic chromosome axes. The instability of meiosis-specific cohesins observed in Stag3 mutants results in aberrant DNA repair processes, and disruption of synapsis between homologous chromosomes. Furthermore, mutation of Stag3 results in perturbation of pericentromeric heterochromatin clustering, and disruption of centromere cohesion between sister chromatids during meiotic prophase. These defects result in early prophase I arrest and apoptosis in both male and female germ cells. The meiotic defects observed in Stag3 mutants are more severe when compared to single mutants for Smc1β, Rec8 and Rad21l, however they are not as severe as the Rec8, Rad21l double mutants. Taken together, our study demonstrates that STAG3 is required for the stability of all meiosis-specific

Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

Directory of Open Access Journals (Sweden)

Joseph C Sanchez

2017-10-01

Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

Science.gov (United States)

Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J

2017-10-01

A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

Cytogenetic analysis of quinoa chromosomes using nanoscale imaging and spectroscopy techniques

Science.gov (United States)

Yangquanwei, Zhong; Neethirajan, Suresh; Karunakaran, Chithra

2013-11-01

Here we present a high-resolution chromosomal spectral map derived from synchrotron-based soft X-ray spectromicroscopy applied to quinoa species. The label-free characterization of quinoa metaphase chromosomes shows that it consists of organized substructures of DNA-protein complex. The analysis of spectra of chromosomes using the scanning transmission X-ray microscope (STXM) and its superposition of the pattern with the atomic force microscopy (AFM) and scanning electron microscopy (SEM) images proves that it is possible to precisely locate the gene loci and the DNA packaging inside the chromosomes. STXM has been successfully used to distinguish and quantify the DNA and protein components inside the quinoa chromosomes by visualizing the interphase at up to 30-nm spatial resolution. Our study represents the successful attempt of non-intrusive interrogation and integrating imaging techniques of chromosomes using synchrotron STXM and AFM techniques. The methodology developed for 3-D imaging of chromosomes with chemical specificity and temporal resolution will allow the nanoscale imaging tools to emerge from scientific research and development into broad practical applications such as gene loci tools and biomarker libraries.

Persistence of Breakage in Specific Chromosome Bands 6 Years after Acute Exposure to Oil.

Directory of Open Access Journals (Sweden)

Alexandra Francés

Full Text Available The identification of breakpoints involved in chromosomal damage could help to detect genes involved in genetic disorders, most notably cancer. Until now, only one published study, carried out by our group, has identified chromosome bands affected by exposure to oil from an oil spill. In that study, which was performed two years after the initial oil exposure in individuals who had participated in clean-up tasks following the wreck of the Prestige, three chromosomal bands (2q21, 3q27, 5q31 were found to be especially prone to breakage. A recent follow-up study, performed on the same individuals, revealed that the genotoxic damage had persisted six years after oil exposure.To determine whether there exist chromosome bands which are especially prone to breakages and to know if there is some correlation with those detected in the previous study. In addition, to investigate if the DNA repair problems detected previously persist in the present study.Follow-up study performed six years after the Prestige oil spill.Fishermen cooperatives in coastal villages.Fishermen highly exposed to oil spill who participated in previous genotoxic study six years after the oil.Chromosome damage in peripheral lymphocytes. For accurate identification of the breakpoints involved in chromosome damage of circulating lymphocytes, a sequential stain/G-banding technique was employed. To determine the most break-prone chromosome bands, two statistical methods, the Fragile Site Multinomial and the chi-square tests (where the bands were corrected by their length were used. To compare the chromosome lesions, structural chromosome alterations and gaps/breaks between two groups of individuals we used the GEE test which takes into account a possible within-individual correlation. Dysfunctions in DNA repair mechanisms, expressed as chromosome damage, were assessed in cultures with aphidicolin by the GEE test.Cytogenetic analyses were performed in 47 exposed individuals. A total of

Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system

Science.gov (United States)

Karimova, Madina; Abi-Ghanem, Josephine; Berger, Nicolas; Surendranath, Vineeth; Pisabarro, Maria Teresa; Buchholz, Frank

2013-01-01

Targeted genome engineering has become an important research area for diverse disciplines, with site-specific recombinases (SSRs) being among the most popular genome engineering tools. Their ability to trigger excision, integration, inversion and translocation has made SSRs an invaluable tool to manipulate DNA in vitro and in vivo. However, sophisticated strategies that combine different SSR systems are ever increasing. Hence, the demand for additional precise and efficient recombinases is dictated by the increasing complexity of the genetic studies. Here, we describe a novel site-specific recombination system designated Vika/vox. Vika originates from a degenerate bacteriophage of Vibrio coralliilyticus and shares low sequence similarity to other tyrosine recombinases, but functionally carries out a similar type of reaction. We demonstrate that Vika is highly specific in catalyzing vox recombination without recombining target sites from other SSR systems. We also compare the recombination activity of Vika/vox with other SSR systems, providing a guideline for deciding on the most suitable enzyme for a particular application and demonstrate that Vika expression does not cause cytotoxicity in mammalian cells. Our results show that Vika/vox is a novel powerful and safe instrument in the ‘genetic toolbox’ that can be used alone or in combination with other SSRs in heterologous hosts. PMID:23143104

Regulated expression of genes inserted at the human chromosomal β-globin locus by homologous recombination

International Nuclear Information System (INIS)

Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.

1988-01-01

The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation

Absence of Non-histone Protein Complexes at Natural Chromosomal Pause Sites Results in Reduced Replication Pausing in Aging Yeast Cells

Directory of Open Access Journals (Sweden)

Marleny Cabral

2016-11-01

Full Text Available There is substantial evidence that genomic instability increases during aging. Replication pausing (and stalling at difficult-to-replicate chromosomal sites may induce genomic instability. Interestingly, in aging yeast cells, we observed reduced replication pausing at various natural replication pause sites (RPSs in ribosomal DNA (rDNA and non-rDNA locations (e.g., silent replication origins and tRNA genes. The reduced pausing occurs independent of the DNA helicase Rrm3p, which facilitates replication past these non-histone protein-complex-bound RPSs, and is independent of the deacetylase Sir2p. Conditions of caloric restriction (CR, which extend life span, also cause reduced replication pausing at the 5S rDNA and at tRNA genes. In aged and CR cells, the RPSs are less occupied by their specific non-histone protein complexes (e.g., the preinitiation complex TFIIIC, likely because members of these complexes have primarily cytosolic localization. These conditions may lead to reduced replication pausing and may lower replication stress at these sites during aging.

Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

Directory of Open Access Journals (Sweden)

Wang Zhen

2011-11-01

Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation.

Directory of Open Access Journals (Sweden)

Guray Kuzu

2016-07-01

Full Text Available Dosage compensation is an essential process that equalizes transcript levels of X-linked genes between sexes by forming a domain of coordinated gene expression. Throughout the evolution of Diptera, many different X-chromosomes acquired the ability to be dosage compensated. Once each newly evolved X-chromosome is targeted for dosage compensation in XY males, its active genes are upregulated two-fold to equalize gene expression with XX females. In Drosophila melanogaster, the CLAMP zinc finger protein links the dosage compensation complex to the X-chromosome. However, the mechanism for X-chromosome identification has remained unknown. Here, we combine biochemical, genomic and evolutionary approaches to reveal that expansion of GA-dinucleotide repeats likely accumulated on the X-chromosome over evolutionary time to increase the density of CLAMP binding sites, thereby driving the evolution of dosage compensation. Overall, we present new insight into how subtle changes in genomic architecture, such as expansions of a simple sequence repeat, promote the evolution of coordinated gene expression.

Cyc17, a meiosis-specific cyclin, is essential for anaphase initiation and chromosome segregation in Tetrahymena thermophila.

Science.gov (United States)

Yan, Guan-Xiong; Dang, Huai; Tian, Miao; Zhang, Jing; Shodhan, Anura; Ning, Ying-Zhi; Xiong, Jie; Miao, Wei

2016-07-17

Although the role of cyclins in controlling nuclear division is well established, their function in ciliate meiosis remains unknown. In ciliates, the cyclin family has undergone massive expansion which suggests that diverse cell cycle systems exist, and this warrants further investigation. A screen for cyclins in the model ciliate Tetrahymena thermophila showed that there are 34 cyclins in this organism. Only 1 cyclin, Cyc17, contains the complete cyclin core and is specifically expressed during meiosis. Deletion of CYC17 led to meiotic arrest at the diakinesis-like metaphase I stage. Expression of genes involved in DNA metabolism and chromosome organization (chromatin remodeling and basic chromosomal structure) was repressed in cyc17 knockout matings. Further investigation suggested that Cyc17 is involved in regulating spindle pole attachment, and is thus essential for chromosome segregation at meiosis. These findings suggest a simple model in which chromosome segregation is influenced by Cyc17.

TU-A-201-02: Treatment Site-Specific Considerations for Clinical IGRT

Energy Technology Data Exchange (ETDEWEB)

Wijesooriya, K. [University of Virginia Health Systems (United States)

2016-06-15

Recent years have seen a widespread proliferation of available in-room image guidance systems for radiation therapy target localization with many centers having multiple in-room options. In this session, available imaging systems for in-room IGRT will be reviewed highlighting the main differences in workflow efficiency, targeting accuracy and image quality as it relates to target visualization. Decision-making strategies for integrating these tools into clinical image guidance protocols that are tailored to specific disease sites like H&N, lung, pelvis, and spine SBRT will be discussed. Learning Objectives: Major system characteristics of a wide range of available in-room imaging systems for IGRT. Advantages / disadvantages of different systems for site-specific IGRT considerations. Concepts of targeting accuracy and time efficiency in designing clinical imaging protocols.

Myeloid- and lymphoid-specific breakpoint cluster regions in chromosome band 13q14 in acute leukemia.

Science.gov (United States)

Coignet, L J; Lima, C S; Min, T; Streubel, B; Swansbury, J; Telford, N; Swanton, S; Bowen, A; Nagai, M; Catovsky, D; Fonatsch, C; Dyer, M J

1999-07-01

Abnormalities of chromosome band 13q14 occur in hematologic malignancies of all lineages and at all stages of differentiation. Unlike other chromosomal translocations, which are usually specific for a given lineage, the chromosomal translocation t(12;13)(p12;q14) has been observed in both B-cell and T-cell precursor acute lymphoblastic leukemia (BCP-, TCP-ALL), in differentiated and undifferentiated acute myeloblastic leukemia (AML), and in chronic myeloid leukemia (CML) at progression to blast crisis. The nature of these translocations and their pathologic consequences remain unknown. To begin to define the gene(s) involved on chromosome 13, we have performed fluorescence in situ hybridization (FISH) using a panel of YACs from the region, on a series of 10 cases of acute leukemia with t(12;13)(p12;q14) and 1 case each with "variant" translocations including t(12;13)(q21;q14), t(10;13)(q24;q14) and t(9;13)(p21;q14). In 8/13 cases/cell lines, the 13q14 break fell within a single 1.4 Mb CEPH MegaYAC. This YAC fell immediately telomeric of the forkhead (FKHR) gene, which is disrupted in the t(2;13)(q35;q14) seen in pediatric alveolar rhabdomyosarcoma. Seven of the 8 cases with breaks in this YAC were AML. In 4/13 cases, the 13q14 break fell within a 1.7-Mb YAC located about 3 Mb telomeric of the retinoblastoma (RB1) gene: all 4 cases were ALL. One case of myelodysplastic syndrome exhibited a break within 13q12, adjacent to the BRCA2 gene. These data indicate the presence of myeloid- and lymphoid-specific breakpoint cluster regions within chromosome band 13q14 in acute leukemia.

Human interphase chromosomes: a review of available molecular cytogenetic technologies

Directory of Open Access Journals (Sweden)

Yurov Yuri B

2010-01-01

Full Text Available Abstract Human karyotype is usually studied by classical cytogenetic (banding techniques. To perform it, one has to obtain metaphase chromosomes of mitotic cells. This leads to the impossibility of analyzing all the cell types, to moderate cell scoring, and to the extrapolation of cytogenetic data retrieved from a couple of tens of mitotic cells to the whole organism, suggesting that all the remaining cells possess these genomes. However, this is far from being the case inasmuch as chromosome abnormalities can occur in any cell along ontogeny. Since somatic cells of eukaryotes are more likely to be in interphase, the solution of the problem concerning studying postmitotic cells and larger cell populations is interphase cytogenetics, which has become more or less applicable for specific biomedical tasks due to achievements in molecular cytogenetics (i.e. developments of fluorescence in situ hybridization -- FISH, and multicolor banding -- MCB. Numerous interphase molecular cytogenetic approaches are restricted to studying specific genomic loci (regions being, however, useful for identification of chromosome abnormalities (aneuploidy, polyploidy, deletions, inversions, duplications, translocations. Moreover, these techniques are the unique possibility to establish biological role and patterns of nuclear genome organization at suprachromosomal level in a given cell. Here, it is to note that this issue is incompletely worked out due to technical limitations. Nonetheless, a number of state-of-the-art molecular cytogenetic techniques (i.e multicolor interphase FISH or interpahase chromosome-specific MCB allow visualization of interphase chromosomes in their integrity at molecular resolutions. Thus, regardless numerous difficulties encountered during studying human interphase chromosomes, molecular cytogenetics does provide for high-resolution single-cell analysis of genome organization, structure and behavior at all stages of cell cycle.

Development of a Set of Chromosome-Specific Cytogenetic DNA Markers in Sunflower Using BAC-FISH

Science.gov (United States)

In diploid sunflower (2n=34), conventional karyotypes and various genetic linkage maps have been established. However, the relationship between genetic linkage groups and individual chromosomes of sunflower remains unknown. Recently, a set of linkage group-specific BAC and BIBAC clones were identifi...

Molecular analysis of the distribution of chromosomal breakpoints: characterization of a 'hot' region for breaks in human chromosome 11

International Nuclear Information System (INIS)

Vannais, D.B.; Hirai, Y.; Cologne, J.B.; Waldren, C.A.; Ueno, A.

2003-01-01

Full text: Ionizing radiation randomly damages DNA and chromosomes whereas subsequent chromosome breaks are non-random. Assuming, as an ideal and naive but useful proposition, that breaks are equally likely anywhere in the chromosome and that a deletion always occurs between two breaks, the frequency of fragments would decrease linearly with increasing fragment size. This simple distribution is not, however, observed. To shed light on the 'real' situation of break formation we mapped breakpoints in the human chromosome no. 11 of 353 independent CD59- mutants isolated from human/hamster hybrid AL cells exposed to radiations (high and low dose-rate gamma rays, high LET carbon or nitrogen ions, protons) or chemicals (arsenic or irradiated, mutagenic histidine) or unexposed. The number of breaks per unit length of DNA differed significantly in different regions of chromosome 11.The highest level of breaks (140/mbp) were in the 0.8 mbp segment between CD59 and Catalase (CAT). Finer mapping of break points was carried out using 26 PCR primer pairs spread across this interval in 15 independent mutants. In two mutants, the break point was in a 107 bp fragment; in the other 13 the breaks were in a single 35 mbp fragment, but not all were at exactly the same site; 4 of 13 occurred in 3 different 3 mbp sub-segments. We are sequencing these fragments to look for such features as repeats: 'colder' regions like that between CD59 and WT will also be analyzed. But, since at least some breaks occurred at different sites and the frequency and distribution of breaks was about the same for all treatments, our we postulate that hot (and cold spots) may be due more to structural features or specific repair than to sequence or type of damage

Centralspindlin and Chromosomal Passenger Complex Behavior During Normal and Rappaport Furrow Specification in Echinoderm Embryos

Science.gov (United States)

Argiros, Haroula; Henson, Lauren; Holguin, Christiana; Foe, Victoria; Shuster, Charles Bradley

2014-01-01

The chromosomal passenger (CPC) and Centralspindlin complexes are essential for organizing the anaphase central spindle and providing cues that position the cytokinetic furrow between daughter nuclei. However, echinoderm zygotes are also capable of forming “Rappaport furrows” between asters positioned back-to-back without intervening chromosomes. To understand how these complexes contribute to normal and Rappaport furrow formation, we studied the localization patterns of Survivin and mitotic-kinesin-like-protein1 (MKLP1), members respectively of the CPC and the Centralspindlin complex, and the effect of CPC inhibition on cleavage in mono- and binucleate echinoderm zygotes. In zygotes, Survivin initially localized to metaphase chromosomes, upon anaphase onset relocalized to the central spindle and then, together with MKLP1 spread towards the equatorial cortex in an Aurora-dependent manner. Inhibition of Aurora kinase activity resulted in disruption of central spindle organization and furrow regression, although astral microtubule elongation and furrow initiation were normal. In binucleate cells containing two parallel spindles MKLP1 and Survivin localized to the plane of the former metaphase plate, but were not observed in the secondary cleavage plane formed between unrelated spindle poles, except when chromosomes were abnormally present there. However, the secondary furrow was sensitive to Aurora inhibition, indicating that Aurora kinase may still contribute to furrow ingression without chromosomes nearby. Our results provide insights that reconcile classic micromanipulation studies with current molecular understanding of furrow specification in animal cells. PMID:22887753

Construction of a DNA library representing 15q11-13 by subtraction of two flow sorted marker chromosome-specific libraries

Energy Technology Data Exchange (ETDEWEB)

Blennow, E.; Werelius, B.; Nordenskjoeld, M. [Karolinska Hospital, Stockholm (Sweden)] [and others

1994-09-01

Constitutional extra {open_quotes}marker chromosomes{close_quotes} are found in {approx}0.5/1000 of newborns. Of these, 50% are inverted duplications of the pericentromeric region of chromosome 15, including two variants; (1) inv dup(15)(pter{yields}q11:q11{yields}pter) and (2) inv dup(15) (pter{yields}q12-13::q12-13{yields}pter). Variant (1) is found in phenotypically normal individuals, whereas variant (2) will produce a typical clinical picture including mental retardation, autism, hyperactivity and discrete dysmorphic features. Fluorescence in situ hybridization (FISH) using single copy probes from the Prader-Willi region confirms these observations as well as chromosome painting using a flow-sorted marker chromosome-specific library from a variant (1) marker, hybridized to the chromosomes of a patient with a variant (2) marker chromosome. Followingly, a flow-sorted biotinylated variant (1) library was subtracted from a non-labeled variant (2) library using magnetic beads and subsequent amplification by degenerate oligonucleotide-primed PCR (DOP-PCR). The successful result was demonstrated by using the amplified material for chromosome painting on chromosome slides from variant (1) and variant (2) patients. We have constructed a library from 15q11-13. This region contains genes producing a specific abnormal phenotype when found in a tri- or tetrasomic state. The region also contains the genes responsible for the Prader-Willi and Angelman syndromes when the paternal/maternal copy is missing, respectively. It is therefore a region where parental imprinting plays an important role. The isolated library may be used to isolate single copy clones which will allow further investigations of this region.

Structure-specific endonucleases

DEFF Research Database (Denmark)

Minocherhomji, Sheroy; Hickson, Ian D

2014-01-01

Fragile sites are conserved loci predisposed to form breaks in metaphase chromosomes. The inherent instability of these loci is associated with chromosomal rearrangements in cancers and is a feature of cells from patients with chromosomal instability syndromes. One class of fragile sites, the com...

[Chromomeric organization of interphase chromosomes in Drosophila melanogaster].

Science.gov (United States)

Zhuimulev, I F; Beliaeva, E S; Zykova, T Iu; Semeshin, V F; Demakov, S A; Demakova, O V; Goncharov, F P; Khoroshko, V A; Boldyreva, L V; Kokoza, E B; Pokholkiova, G V

2013-01-01

As a result of treatment of bioinformatic data on the genome localization of structural proteins, histone modifications, DNase-hypersensitive regions, replication origins (taken from modENCODE) and their cytological localization to polytene chromosome structures, it is shown here that two types of interphase chromosomes -polytene chromosomes from salivary glands and from mitotically dividing cells cultures - demonstrate identical pictures of interband/band, i. e. the same localization and length on physical map and the same sets of proteins. In the interbands of both chromosome types we find the proteins that control initiation of transcription (RNA-polymerase II, transcription factors), replication (ORC2) as well as proteins modifying nucleosome structure (WDS, NURF) and proteins of insulators (BEAF). The nucleosome density and H1 histone concentration in the interbands are depleted; localization of DNase-hypersensitive regions corresponds strictly to the interbands. So, we conclude that both polytene and cell line interphase chromosomes are arranged according to general principle and polytene chromosomes represent precise model of interphase chromosomes. The interbands play a critical role in the initiation of transcription and replication. The interbands of interphase chromosomes are the sites of 5' parts of genes, while the 3' gene ends are located in the adjacent bands. The constancy of interbands decondensation results in the conclusion that the "interbands" genes are constantly active, i. e. they contain "house-keeping" genes. The large late replicating bands contain genes that do not have direct contact to the adjoining interbands are usually polygenic and contain tissue-specific genes.

Designing of plant artificial chromosome (PAC) by using the Chlorella smallest chromosome as a model system.

Science.gov (United States)

Noutoshi, Y; Arai, R; Fujie, M; Yamada, T

1997-01-01

As a model for plant-type chromosomes, we have been characterizing molecular organization of the Chlorella vulgaris C-169 chromosome I. To identify chromosome structural elements including the centromeric region and replication origins, we constructed a chromosome I specific cosmid library and aligned each cosmid clones to generate contigs. So far, more than 80% of the entire chromosome I has been covered. A complete clonal physical reconstitution of chromosome I provides information on the structure and genomic organization of plant genome. We propose our strategy to construct an artificial chromosome by assembling the functional chromosome structural elements identified on Chrorella chromosome I.

Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells

Science.gov (United States)

Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Lu, Fengmin

2017-01-01

Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis‐activate the expression of proto‐oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV‐integrated haplotype, and a long‐range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long‐range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence‐associated acidic β‐gal activity in HeLa cells. These data indicate a long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. PMID:28470669

High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

Science.gov (United States)

Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

2011-01-01

Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

Importance of No. 21 chromosome in translocation t(8:21) in acute myelocytic leukemia (AML) to the genesis of the disease

Energy Technology Data Exchange (ETDEWEB)

Ishihara, T; Minamihisamatsu, M

1986-05-01

The results are reported of the chromosome analysis of 17 cases of acute myelocytic leukemia (AML), mostly belonging to M2 of the FAB classification, especially on the translocation t(8:21) and its variant translocations. The presence of two cases with simple variant translocation not involving No. 8 chromosome seems to suggest that No. 21 chromosome is more important to the genesis of AML than the No. 8 chromosome. This assumption appears to be supported by findings on cases with complex translocation: In two cases with complex translocation, the portion translocated from No. 21 chromosome onto No. 8 was firmly maintained in the specific site (q21) on No. 8 whereas the portion translocated from No. 8 chromosome onto No. 21 was involved in further translocation with another chromosome, onto which it was re-translocated. The results of the present cytogenetic study indicate that the analysis of variant translocations in various specific chromosome translocations in leukemia and other malignant disorders is very useful to elucidate the problem as to whether the genesis of such disorders lies in either one or both of the pair of chromosomes involved in the specific translocations of the respective diseases.

Use of M-FISH analysis of α-particle-induced chromosome aberrations for the assessment of chromosomal breakpoint distribution and complex aberration formation

International Nuclear Information System (INIS)

Anderson, R.M.; Sumption, N.D.; Papworth, D.G.; Goodhead, D.T.

2003-01-01

Double strand breaks (dsb) of varying complexity are an important class of damage induced after exposure to ionising radiation and are considered to be the critical lesion for the formation of radiation-induced chromosome aberrations. Assuming the basic principles of the 'Breakage and Reunion' theory, dsb represent 'breakage' and aberrations are produced from the illegitimate repair (reunion) of the resulting dsb free-'ends'. Numerous questions relate to this process, in particular, (1) do chromosomal breakpoint 'hot-spots' that represent sensitive sites for breakage and/or regions of preferential repair/mis-repair, exist? (2) Considering that individual chromosomes and chromosome regions occupy discrete territories in the interphase nucleus, could rearrangements between specific chromosomes reflect domain organisation at the time of damage? (3) Assuming the topological constraints imposed on chromatin are not dramatically influenced by the presence of dsb, then how do multiple 'ends' from different chromosomes proximally associate for mis-repair as complex chromosome aberrations? To address these questions, we have analysed the chromosome aberrations induced in peripheral blood lymphocytes after exposure to 0.5 Gy α -particles (mean of 1 α -particle/cell) using the technique of M-FISH. This technique 'paints' all the human chromosomes (excluding homologues) uniquely, allowing chromosomal mis-repair to be visualised as differential colour-junctions and in addition, enhanced DAPI banding enables gross breakpoint assignation of these colour junctions. To test for non-randomness, we are comparing the frequency of occurrence of breakpoints obtained up to now with the F98 glioma model our knowledbased on chromosome length. Similarly, the involvement of each chromosome relative to other chromosomes within individual rearrangements can be determined by assuming the volume of chromosome domains is also proportional to their length. The current data to be presented will

Microdissection and chromosome painting of the alien chromosome in an addition line of wheat--Thinopyrum intermedium.

Science.gov (United States)

Deng, Chuanliang; Bai, Lili; Fu, Shulan; Yin, Weibo; Zhang, Yingxin; Chen, Yuhong; Wang, Richard R-C; Zhang, Xiangqi; Han, Fangpu; Hu, Zanmin

2013-01-01

In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat--Thinopyrum intermedium addition line, and the chromosomes of the three different genomes of Th. Intermedium. The smallest alien chromosome of TAi-27 was microdissected and its DNA amplified by DOP-PCR was used as a probe to hybridize with metaphase chromosomes of TAi-27 and Th. intermedium. Results showed that hybridization signals were observed in all regions of a pair of the smallest alien chromosomes and the pericentromeric area of another pair of alien chromosomes in TAi-27, indicating that the probe from microdissected chromosome is species specific. In Th. intermedium, 14 chromosomes had wide and strong hybridization signals distributed mainly on the pericentromere area and 9 chromosomes with narrow and weak signals on the pericentromere area. The remaining chromosomes displayed a very weak or no signal. Sequential FISH/GISH on Th. intermedium chromosomes using the DNAs of microdissected chromosome, Pseudoroegneria spicata (St genome) and pDbH12 (a J(s) genome specific probe) as the probes indicated that the microdissected chromosome belonged to the St genome, three genomes (J(s) , J and St) in Th. intermedium could be distinguished, in which there is no hybridization signal on J genome that is similar to the genome of Th. bessarabicum. Our results showed that the smallest alien chromosomes may represent a truncated chromosome and the repetitive sequence distribution might be similar in different chromosomes within the St genome. However, the repetitive sequence distributions are different within the J(s) genome, within a single chromosome, and among different genomes in Th. intermedium. Our results suggested that chromosome painting could be feasible in some plants and useful in detecting chromosome variation and repetitive sequence distribution in different genomes of polyploidy plants, which is helpful for understanding the evolution of different

Microdissection and Chromosome Painting of the Alien Chromosome in an Addition Line of Wheat - Thinopyrum intermedium

Science.gov (United States)

Yin, Weibo; Zhang, Yingxin; Chen, Yuhong; Wang, Richard R.-C.; Zhang, Xiangqi; Han, Fangpu; Hu, Zanmin

2013-01-01

In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat - Thinopyrum intermedium addition line, and the chromosomes of the three different genomes of Th. Intermedium. The smallest alien chromosome of TAi-27 was microdissected and its DNA amplified by DOP-PCR was used as a probe to hybridize with metaphase chromosomes of TAi-27 and Th . intermedium . Results showed that hybridization signals were observed in all regions of a pair of the smallest alien chromosomes and the pericentromeric area of another pair of alien chromosomes in TAi-27, indicating that the probe from microdissected chromosome is species specific. In Th . intermedium , 14 chromosomes had wide and strong hybridization signals distributed mainly on the pericentromere area and 9 chromosomes with narrow and weak signals on the pericentromere area. The remaining chromosomes displayed a very weak or no signal. Sequential FISH/GISH on Th . intermedium chromosomes using the DNAs of microdissected chromosome, Pseudoroegneria spicata (St genome) and pDbH12 (a Js genome specific probe) as the probes indicated that the microdissected chromosome belonged to the St genome, three genomes (Js, J and St) in Th . intermedium could be distinguished, in which there is no hybridization signal on J genome that is similar to the genome of Th . bessarabicum . Our results showed that the smallest alien chromosomes may represent a truncated chromosome and the repetitive sequence distribution might be similar in different chromosomes within the St genome. However, the repetitive sequence distributions are different within the Js genome, within a single chromosome, and among different genomes in Th . intermedium . Our results suggested that chromosome painting could be feasible in some plants and useful in detecting chromosome variation and repetitive sequence distribution in different genomes of polyploidy plants, which is helpful for understanding the evolution of different

Different structure of polytene chromosome of phaseolus coccineus suspensors during early embryogenesis

International Nuclear Information System (INIS)

Tagliasacchi, A.M.; Forino, L.M.C.; Cionini, P.G.; Cavallini, A.; Durante, M.; Cremonini, R.; Avanzi, S.

1984-01-01

Different regions of polytene chromosomes pair VI have been characterized by: 1. morphological observations, 2. incorporation of 3 H-thymidine and 3 H-uridine, 3. cytophotometry of DNA and associated proteins, 4. hybridization with satellite DNA and highly repeated DNA sequences. The collected data indicate that DNA and RNA puffs are organized by heterochromatic segments. DNA puffs show often a clustered pattern of labeling by 3 H-thymidine and RNA puffs are always labeled by 3 H-urindine. Each heterochromatic segment is characterized by a definite ratio between DNA and associated fastgreen stainable proteins. Satellite DNA binds mostly to heterochromatic blocks at centromers, highly repeated DNA sequences bind, with approximately the same frequency, to centromeric heterochromatin and to the main intercalary heterochromatic band. The telomeric portions of euchromatin seem to be also enriched in highly repeated DNA sequences. The results indicate that heterochromatic chromosome segments might be sites of intense localized DNA replication. The same chromosome regions are also engaged in an active transcription process. The response to hybridization suggests that heterochromatic blocks of chromosome pair VI are heterogeneous in nucleotide sequences. The present studies also indicate that DNA and RNA puffs organized by different chromosome sites are specific of particular steps of embryo differentiation. The observed metabolic aspects of the suspensior's polytene chromosomes are discussed in relation to the synthesis of growth regulators which is known to occur in the suspensor. (Author)

Incidence of genome structure, DNA asymmetry, and cell physiology on T-DNA integration in chromosomes of the phytopathogenic fungus Leptosphaeria maculans.

Science.gov (United States)

Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry

2012-08-01

The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.

Chromosome mapping by FISH to metaphase and interphase nuclei. Final report

Energy Technology Data Exchange (ETDEWEB)

Trask, B.

1997-08-01

The overall specific aims of this project were: (1) to determine the large-scale structure of interphase and metaphase chromosomes, in order to establish new capabilities for genome mapping by fluorescence in situ hybridization (FISH); (2) to detect chromosome abnormalities associated with genetic disease and map DNA sequences relative to them in order to facilitate the identification of new genes with disease-causing mutations; (3) to establish medium resolution physical maps of selected chromosomal regions using a combined metaphase and interphase mapping strategy and to corroborate physical and genetic maps and integrate these maps with the cytogenetic map; (4) to analyze the polymorphism and sequence evolution of subtelomeric regions of human chromosomes; (5) to establish a state-of-the-art FISH and image processing facility in the Department of Molecular Biotechnology, University of Washington, in order to map DNA sequences rapidly and accurately to benefit the Human Genome Project.

"European" race-specific metacentrics in East Siberian common shrews (Sorex araneus): a description of two new chromosomal races, Irkutsk and Zima.

Science.gov (United States)

Pavlova, Svetlana V; Borisov, Sergei A; Timoshenko, Alexander F; Sheftel, Boris I

2017-01-01

Karyotype studies of common shrews in the vicinity of Lake Baikal (Irkutsk Region, Eastern Siberia) resulted in the description of two new chromosomal races of Sorex araneus Linnaeus, 1758 (Lypotyphla, Mammalia), additional to 5 races formerly found in Siberia. In the karyotypes of 12 specimens from 3 locations, the polymorphism of metacentric and acrocentric chromosomes of the Robertsonian type was recorded and two distinct groups of karyotypes interpreted as the chromosomal races were revealed. They are geographically distant and described under the racial names Irkutsk (Ir) and Zima (Zi). Karyotypes of both races were characterized by species-specific (the same for all 74 races known so far) metacentric autosomes af, bc, tu and jl , and the typical sex chromosome system - XX/XY 1 Y 2 . The race-specific arm chromosome combinations include three metacentrics and four acrocentrics in the Irkutsk race ( gk, hi, nq, m, o, p, r ) and four metacentrics and two acrocentrics in the Zima race ( gm, hi, ko, nq, p, r ). Within the races, individuals with polymorphic chromosomes were detected ( g/m, k/o, n/q, p/r ). The presence of the specific metacentric gk allowed us to include the Irkutsk race into the Siberian Karyotypic Group (SKG), distributed in surrounding regions. The Zima race karyotype contained two metacentrics, gm and ko , which have been never found in the Siberian part of the species range, but appear as the common feature of chromosomal races belonging to the West European Karyotypic Group (WEKG). Moreover, the metacentrics of that karyotype are almost identical to the Åkarp race (except the heterozygous pair p/r ) locally found in the southern Sweden. One of two Siberian races described here for the first time, the Zima race, occurs in an area considerably distant from Europe and shares the common metacentrics ( gm, hi, ko ) with races included in WEKG. This fact may support a hypothesis of independent formation of identical arm chromosome combinations

29 CFR 1926.752 - Site layout, site-specific erection plan and construction sequence.

Science.gov (United States)

2010-07-01

... 29 Labor 8 2010-07-01 2010-07-01 false Site layout, site-specific erection plan and construction... Steel Erection § 1926.752 Site layout, site-specific erection plan and construction sequence. (a... strength or sufficient strength to support the loads imposed during steel erection. (c) Site layout. The...

Gonadal sex chromosome complement in individuals with sex chromosomal and/or gonadal disorders

Energy Technology Data Exchange (ETDEWEB)

Bridge, J.A.; Sanger, W.G.; Seemayer, T. [Univ. of Nebraska Medical Center, Omaha, NE (United States)] [and others

1994-09-01

Gonadal abnormalities are characteristically seen in patients with sex chromosomal aneuploidy. Morphologically these abnormalities can be variable and are hypothesized to be dependent on the sex chromosomal consititution of the gonad (independent of the chromosomal complement of other tissues, such as peripheral blood lymphocytes). In this study, the gonadal sex chromosome complement was evaluated for potential mosaicism and correlated with the histopathology from 5 patients with known sex chromosomal and/or gonadal disorders. FISH techniques using X and Y chromosome specific probes were performed on nuclei extracted from paraffin embedded tissue. Gonadal tissue obtained from case 1 (a true hemaphroditic newborn) consisted of ovotestes and epididymis (left side) and ovary with fallopian tube (right side). Cytogenetic and FISH studies performed on blood, ovotestes and ovary revealed an XX complement. Cytogenetic analysis of blood from case 2, a 4-year-old with suspected Turner syndrome revealed 45,X/46,X,del(Y)(q11.21). FISH analysis of the resected gonads (histologically = immature testes) confirmed an X/XY mosaic complement. Histologically, the gonadal tissue was testicular. Severe autolysis prohibited successful analysis in the 2 remaining cases. In summary, molecular cytogenetic evaluation of gonadal tissue from individuals with sex chromosomal and/or gonadal disorders did not reveal tissue-specific anomalies which could account for differences observed pathologically.

Virus evolution reveals an exclusive role for LEDGF/p75 in chromosomal tethering of HIV.

Directory of Open Access Journals (Sweden)

Anneleen Hombrouck

2007-03-01

Full Text Available Retroviruses by definition insert their viral genome into the host cell chromosome. Although the key player of retroviral integration is viral integrase, a role for cellular cofactors has been proposed. Lentiviral integrases use the cellular protein LEDGF/p75 to tether the preintegration complex to the chromosome, although the existence of alternative host proteins substituting for the function of LEDGF/p75 in integration has been proposed. Truncation mutants of LEDGF/p75 lacking the chromosome attachment site strongly inhibit HIV replication by competition for the interaction with integrase. In an attempt to select HIV strains that can overcome the inhibition, we now have used T-cell lines that stably express a C-terminal fragment of LEDGF/p75. Despite resistance development, the affinity of integrase for LEDGF/p75 is reduced and replication kinetics in human primary T cells is impaired. Detection of the integrase mutations A128T and E170G at key positions in the LEDGF/p75-integrase interface provides in vivo evidence for previously reported crystallographic data. Moreover, the complementary inhibition by LEDGF/p75 knockdown and mutagenesis at the integrase-LEDGF/p75 interface points to the incapability of HIV to circumvent LEDGF/p75 function during proviral integration. Altogether, the data provide a striking example of the power of viral molecular evolution. The results underline the importance of the LEDGF/p75 HIV-1 interplay as target for innovative antiviral therapy. Moreover, the role of LEDGF/p75 in targeting integration will stimulate research on strategies to direct gene therapy vectors into safe landing sites.

Site Specific Vendor's License

Data.gov (United States)

Montgomery County of Maryland — This dataset contains information of a site-specific vendor's license which is required if an individual sells or offers to sell goods or services from a stationary...

Human Chromosome 21: Mapping of the chromosomes and cloning of cDNAs

Energy Technology Data Exchange (ETDEWEB)

Antonarakis, S.E.

1991-09-01

The objective of the research funded by DOE grant DE-FG02-89ER60857 from 6/15/89 to 8/31/91 was to contribute to the physical mapping of human chromosome 21 (HC21) by cloning large fragments of DNA into Yeast Artificial Chromosomes (YACs) and identify YACs that map on HC21. A total of 54 sequence tagged sites (STS) have been developed and mapped in our laboratory to HC21 and can be used as initial reference points for YAC identification and construction of overlapping clones. A small YAC library was constructed which is HC21 specific. DNA from somatic cell hybrid WAV17 or from flow-sorted HC21 was partially digested with EcoRI, ligated into vectors PJS97, PJS98, and YACs have been obtained with average size insert of more than 300 kb. This library has been deposited in D. Patterson's lab for the Joint YAC screening effort. Additional YAC libraries from ICI Pharmaceuticals or from Los Alamos National Laboratories have been screened with several STS and positive YACs have been identified. Work in progress includes screening of YAC libraries in order to construct overlapping clones, characterization of the cloning ends of YACs, characterization of additional STS and cloning of HC21 specific cDNAs. 15 refs., 2 figs., 5 tabs.

Musite, a tool for global prediction of general and kinase-specific phosphorylation sites.

Science.gov (United States)

Gao, Jianjiong; Thelen, Jay J; Dunker, A Keith; Xu, Dong

2010-12-01

Reversible protein phosphorylation is one of the most pervasive post-translational modifications, regulating diverse cellular processes in various organisms. High throughput experimental studies using mass spectrometry have identified many phosphorylation sites, primarily from eukaryotes. However, the vast majority of phosphorylation sites remain undiscovered, even in well studied systems. Because mass spectrometry-based experimental approaches for identifying phosphorylation events are costly, time-consuming, and biased toward abundant proteins and proteotypic peptides, in silico prediction of phosphorylation sites is potentially a useful alternative strategy for whole proteome annotation. Because of various limitations, current phosphorylation site prediction tools were not well designed for comprehensive assessment of proteomes. Here, we present a novel software tool, Musite, specifically designed for large scale predictions of both general and kinase-specific phosphorylation sites. We collected phosphoproteomics data in multiple organisms from several reliable sources and used them to train prediction models by a comprehensive machine-learning approach that integrates local sequence similarities to known phosphorylation sites, protein disorder scores, and amino acid frequencies. Application of Musite on several proteomes yielded tens of thousands of phosphorylation site predictions at a high stringency level. Cross-validation tests show that Musite achieves some improvement over existing tools in predicting general phosphorylation sites, and it is at least comparable with those for predicting kinase-specific phosphorylation sites. In Musite V1.0, we have trained general prediction models for six organisms and kinase-specific prediction models for 13 kinases or kinase families. Although the current pretrained models were not correlated with any particular cellular conditions, Musite provides a unique functionality for training customized prediction models

Large-scale polymorphism near the ends of several human chromosomes analyzed by using fluorescence in situ hybridization (FISH)

Energy Technology Data Exchange (ETDEWEB)

Trask, B.J.; Friedman, C. [Univ. of Washington, Seattle, WA (United States); Giorgi, D. [CNRS, Montpelier (France)] [and others

1994-09-01

We have discovered a large DNA segment that is polymorphically present at the ends of several human chromosomes. The segment, f7501, was originally derived form a human chromosome 19-specific cosmid library. FISH was used to determine the cosmid`s chromosomal distribution on 44 unrelated humans and several closely related primates. The human subjects represent a diversity of reproductively isolated ethnic populations. FISH analysis revealed that sequences highly homologous to the cosmid`s insert are present on both homologs at 3q, 15q,. and 19p in almost all individuals (88, 85, and 87 of 88 homologs, respectively). Other chromosomes sites were labeled much more rarely in the sampled individuals. For example, 56 of the 88 analyzed chromosomes 11 were labeled (18+/+, 6-/-, and 20+/- individuals). In contrast, 2q was labeled on only 1/88 sampled chromosomes. The termini of 2q, 5q, 6p, 6q, 7p, 8p, 9p, 9q, 11p, 12q, 16p, 19q, and 20q and an interstitial site at 2q13-14 were labeled in at least one individual of the set. EcoR1-fragments derived from the cosmid showed the same hybridization pattern as the entire cosmid, indicating that at least 40 kbp is shared by these chromosome ends. Ethnic differences in the allele frequency of these polymorphic variants was observed. For example, signals were observed on 8/10 and 7/10 of the chromosomes 7p and 16q, respectively, derived form Biakan Pygmies, but these sites were infrequently labeled in non-Pygmy human populations (2/68, respectively). This region has undergone significant changes in chromosome location during human evolution. Strong signal was seen on chimpanzee and gorilla chromosome 3, which is homologous to human chromosome 4, a chromosome unlabeled in any of the humans we have analyzed.

Site-Specific Atmospheric Dispersion Characteristics of Korean Nuclear Power Plant Sites

International Nuclear Information System (INIS)

Han, M. H.; Kim, E. H.; Suh, K. S.; Hwang, W. T.; Choi, Y. G.

2001-01-01

Site-specific atmospheric dispersion characteristics have been analyzed. The northwest and the southwest wind prevail on nuclear sites of Korea. The annual isobaric surface averaged for twenty years around Korean peninsula shows that west wind prevails. The prevailing west wind is profitable in the viewpoint of radiation protection because three of four nuclear sites are located in the east side. Large scale field tracer experiments over nuclear sites have been conducted for the purpose of analyzing the atmospheric dispersion characteristics and validating a real-time atmospheric dispersion and dose assessment system FADAS. To analyze the site-specific atmospheric dispersion characteristics is essential for making effective countermeasures against a nuclear emergency

Reconstructing spatial organizations of chromosomes through manifold learning.

Science.gov (United States)

Zhu, Guangxiang; Deng, Wenxuan; Hu, Hailin; Ma, Rui; Zhang, Sai; Yang, Jinglin; Peng, Jian; Kaplan, Tommy; Zeng, Jianyang

2018-02-02

Decoding the spatial organizations of chromosomes has crucial implications for studying eukaryotic gene regulation. Recently, chromosomal conformation capture based technologies, such as Hi-C, have been widely used to uncover the interaction frequencies of genomic loci in a high-throughput and genome-wide manner and provide new insights into the folding of three-dimensional (3D) genome structure. In this paper, we develop a novel manifold learning based framework, called GEM (Genomic organization reconstructor based on conformational Energy and Manifold learning), to reconstruct the three-dimensional organizations of chromosomes by integrating Hi-C data with biophysical feasibility. Unlike previous methods, which explicitly assume specific relationships between Hi-C interaction frequencies and spatial distances, our model directly embeds the neighboring affinities from Hi-C space into 3D Euclidean space. Extensive validations demonstrated that GEM not only greatly outperformed other state-of-art modeling methods but also provided a physically and physiologically valid 3D representations of the organizations of chromosomes. Furthermore, we for the first time apply the modeled chromatin structures to recover long-range genomic interactions missing from original Hi-C data. © The Author(s) 2018. Published by Oxford University Press on behalf of Nucleic Acids Research.

Electochemical detection of chromosome translocation

DEFF Research Database (Denmark)

Kwasny, Dorota; Dimaki, Maria; Silahtaroglu, Asli

2014-01-01

Cytogenetics is a study of the cell structure with a main focus on chromosomes content and their structure. Chromosome abnormalities, such as translocations may cause various genetic disorders and heametological malignancies. Chromosome translocations are structural rearrangements of two...... chromosomes that results in formation of derivative chromosomes with a mixed DNA sequence. The method currently used for their detection is Fluorescent In Situ Hybridization, which requires a use of expensive, fluorescently labeled probes that target the derivative chromosomes. We present here a double...... hybridization approach developed for label-free detection of the chromosome translocations. For specific translocation detection it is necessary to determine that the two DNA sequences forming a derivative chromosome are connected, which is achieved by two subsequent hybridization steps. The electrochemical...

Analysis of phage Mu DNA transposition by whole-genome Escherichia coli tiling arrays reveals a complex relationship to distribution of target selection protein B, transcription and chromosome architectural elements.

Science.gov (United States)

Ge, Jun; Lou, Zheng; Cui, Hong; Shang, Lei; Harshey, Rasika M

2011-09-01

Of all known transposable elements, phage Mu exhibits the highest transposition efficiency and the lowest target specificity. In vitro, MuB protein is responsible for target choice. In this work, we provide a comprehensive assessment of the genome-wide distribution of MuB and its relationship to Mu target selection using high-resolution Escherichia coli tiling DNA arrays. We have also assessed how MuB binding and Mu transposition are influenced by chromosome-organizing elements such as AT-rich DNA signatures, or the binding of the nucleoid-associated protein Fis, or processes such as transcription. The results confirm and extend previous biochemical and lower resolution in vivo data. Despite the generally random nature of Mu transposition and MuB binding, there were hot and cold insertion sites and MuB binding sites in the genome, and differences between the hottest and coldest sites were large. The new data also suggest that MuB distribution and subsequent Mu integration is responsive to DNA sequences that contribute to the structural organization of the chromosome.

Statistical and Economic Techniques for Site-specific Nematode Management.

Science.gov (United States)

Liu, Zheng; Griffin, Terry; Kirkpatrick, Terrence L

2014-03-01

Recent advances in precision agriculture technologies and spatial statistics allow realistic, site-specific estimation of nematode damage to field crops and provide a platform for the site-specific delivery of nematicides within individual fields. This paper reviews the spatial statistical techniques that model correlations among neighboring observations and develop a spatial economic analysis to determine the potential of site-specific nematicide application. The spatial econometric methodology applied in the context of site-specific crop yield response contributes to closing the gap between data analysis and realistic site-specific nematicide recommendations and helps to provide a practical method of site-specifically controlling nematodes.

Site-Specific Seismic Site Response Model for the Waste Treatment Plant, Hanford, Washington

Energy Technology Data Exchange (ETDEWEB)

Rohay, Alan C.; Reidel, Steve P.

2005-02-24

This interim report documents the collection of site-specific geologic and geophysical data characterizing the Waste Treatment Plant site and the modeling of the site-specific structure response to earthquake ground motions.

Long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele-specific MYC expression in HeLa cells.

Science.gov (United States)

Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Chen, Xiangmei; Lu, Fengmin

2017-08-01

Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis-activate the expression of proto-oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV-integrated haplotype, and a long-range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long-range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence-associated acidic β-gal activity in HeLa cells. These data indicate a long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

The X chromosome in space.

Science.gov (United States)

Jégu, Teddy; Aeby, Eric; Lee, Jeannie T

2017-06-01

Extensive 3D folding is required to package a genome into the tiny nuclear space, and this packaging must be compatible with proper gene expression. Thus, in the well-hierarchized nucleus, chromosomes occupy discrete territories and adopt specific 3D organizational structures that facilitate interactions between regulatory elements for gene expression. The mammalian X chromosome exemplifies this structure-function relationship. Recent studies have shown that, upon X-chromosome inactivation, active and inactive X chromosomes localize to different subnuclear positions and adopt distinct chromosomal architectures that reflect their activity states. Here, we review the roles of long non-coding RNAs, chromosomal organizational structures and the subnuclear localization of chromosomes as they relate to X-linked gene expression.

Binding of doa kinase to specific loci in polytene chromosomes of Drosophila melanogaster

Czech Academy of Sciences Publication Activity Database

Kováčiková, M.; Raška, Ivan; Mateášik, A.; Chase, B. A.; Farkaš, R.

2006-01-01

Roč. 40, č. 1 (2006), s. 21-27 ISSN 1210-0668 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/02/0342 Grant - others:VEGA(SK) 2/3025/23; SAV(SK) APVT-51-027402; NSF(US) IBN-97-24006; US-SK(SK) 13/029/01 Institutional research plan: CEZ:AV0Z50110509 Keywords : specific protein kinases * DOA * polytene chromosomes Subject RIV: EB - Genetics ; Molecular Biology

Microdissection and chromosome painting of the alien chromosome in an addition line of wheat--Thinopyrum intermedium.

Directory of Open Access Journals (Sweden)

Chuanliang Deng

Full Text Available In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat--Thinopyrum intermedium addition line, and the chromosomes of the three different genomes of Th. Intermedium. The smallest alien chromosome of TAi-27 was microdissected and its DNA amplified by DOP-PCR was used as a probe to hybridize with metaphase chromosomes of TAi-27 and Th. intermedium. Results showed that hybridization signals were observed in all regions of a pair of the smallest alien chromosomes and the pericentromeric area of another pair of alien chromosomes in TAi-27, indicating that the probe from microdissected chromosome is species specific. In Th. intermedium, 14 chromosomes had wide and strong hybridization signals distributed mainly on the pericentromere area and 9 chromosomes with narrow and weak signals on the pericentromere area. The remaining chromosomes displayed a very weak or no signal. Sequential FISH/GISH on Th. intermedium chromosomes using the DNAs of microdissected chromosome, Pseudoroegneria spicata (St genome and pDbH12 (a J(s genome specific probe as the probes indicated that the microdissected chromosome belonged to the St genome, three genomes (J(s , J and St in Th. intermedium could be distinguished, in which there is no hybridization signal on J genome that is similar to the genome of Th. bessarabicum. Our results showed that the smallest alien chromosomes may represent a truncated chromosome and the repetitive sequence distribution might be similar in different chromosomes within the St genome. However, the repetitive sequence distributions are different within the J(s genome, within a single chromosome, and among different genomes in Th. intermedium. Our results suggested that chromosome painting could be feasible in some plants and useful in detecting chromosome variation and repetitive sequence distribution in different genomes of polyploidy plants, which is helpful for understanding the evolution of

Mycobacterial nonhomologous end joining mediates mutagenic repair of chromosomal double-strand DNA breaks.

Science.gov (United States)

Stephanou, Nicolas C; Gao, Feng; Bongiorno, Paola; Ehrt, Sabine; Schnappinger, Dirk; Shuman, Stewart; Glickman, Michael S

2007-07-01

Bacterial nonhomologous end joining (NHEJ) is a recently described DNA repair pathway best characterized in mycobacteria. Bacterial NHEJ proteins LigD and Ku have been analyzed biochemically, and their roles in linear plasmid repair in vivo have been verified genetically; yet the contributions of NHEJ to repair of chromosomal DNA damage are unknown. Here we use an extensive set of NHEJ- and homologous recombination (HR)-deficient Mycobacterium smegmatis strains to probe the importance of HR and NHEJ in repairing diverse types of chromosomal DNA damage. An M. smegmatis Delta recA Delta ku double mutant has no apparent growth defect in vitro. Loss of the NHEJ components Ku and LigD had no effect on sensitivity to UV radiation, methyl methanesulfonate, or quinolone antibiotics. NHEJ deficiency had no effect on sensitivity to ionizing radiation in logarithmic- or early-stationary-phase cells but was required for ionizing radiation resistance in late stationary phase in 7H9 but not LB medium. In addition, NHEJ components were required for repair of I-SceI mediated chromosomal double-strand breaks (DSBs), and in the absence of HR, the NHEJ pathway rapidly mutates the chromosomal break site. The molecular outcomes of NHEJ-mediated chromosomal DSB repair involve predominantly single-nucleotide insertions at the break site, similar to previous findings using plasmid substrates. These findings demonstrate that prokaryotic NHEJ is specifically required for DSB repair in late stationary phase and can mediate mutagenic repair of homing endonuclease-generated chromosomal DSBs.

Practical Application of Site-Specific Earthquake Early Warning (EEW) System

International Nuclear Information System (INIS)

Kanda, Katsuhisa

2014-01-01

The development of an on-site warning system was reported. This system improves the timing of warnings and reduces the number of false alarms by improving the method of estimating the JMA seismic intensity using earthquake early warning system information based on site-specific data. Moreover, the development of an application for practical use in a construction company and an integrated system for realizing system shutdown was also reported. The concept of this system is based on the following. Seismic intensity is not distributed concentrically, and the attenuation relationship cannot explain the distribution of seismic intensity precisely. The standard method of seismic intensity prediction is construed as 'attenuation relationship + soil amplification factor', but this may be improved in the reformulation 'original attenuation relationship for each site + correction factors dependent on the epicenter location and depth' using a seismic intensity database that includes data on recent and historical earthquakes. (authors)

Cytogenetic and molecular markers for detecting Aegilops uniaristata chromosomes in a wheat background.

Science.gov (United States)

Gong, Wenping; Li, Guangrong; Zhou, Jianping; Li, Genying; Liu, Cheng; Huang, Chengyan; Zhao, Zhendong; Yang, Zujun

2014-09-01

Aegilops uniaristata has many agronomically useful traits that can be used for wheat breeding. So far, a Triticum turgidum - Ae. uniaristata amphiploid and one set of Chinese Spring (CS) - Ae. uniaristata addition lines have been produced. To guide Ae. uniaristata chromatin transformation from these lines into cultivated wheat through chromosome engineering, reliable cytogenetic and molecular markers specific for Ae. uniaristata chromosomes need to be developed. Standard C-banding shows that C-bands mainly exist in the centromeric regions of Ae. uniaristata but rarely at the distal ends. Fluorescence in situ hybridization (FISH) using (GAA)8 as a probe showed that the hybridization signal of chromosomes 1N-7N are different, thus (GAA)8 can be used to identify all Ae. uniaristata chromosomes in wheat background simultaneously. Moreover, a total of 42 molecular markers specific for Ae. uniaristata chromosomes were developed by screening expressed sequence tag - sequence tagged site (EST-STS), expressed sequence tag - simple sequence repeat (EST-SSR), and PCR-based landmark unique gene (PLUG) primers. The markers were subsequently localized using the CS - Ae. uniaristata addition lines and different wheat cultivars as controls. The cytogenetic and molecular markers developed herein will be helpful for screening and identifying wheat - Ae. uniaristata progeny.

Microarray Analysis of Copy Number Variants on the Human Y Chromosome Reveals Novel and Frequent Duplications Overrepresented in Specific Haplogroups.

Directory of Open Access Journals (Sweden)

Martin M Johansson

Full Text Available The human Y chromosome is almost always excluded from genome-wide investigations of copy number variants (CNVs due to its highly repetitive structure. This chromosome should not be forgotten, not only for its well-known relevance in male fertility, but also for its involvement in clinical phenotypes such as cancers, heart failure and sex specific effects on brain and behaviour.We analysed Y chromosome data from Affymetrix 6.0 SNP arrays and found that the signal intensities for most of 8179 SNP/CN probes in the male specific region (MSY discriminated between a male, background signals in a female and an isodicentric male containing a large deletion of the q-arm and a duplication of the p-arm of the Y chromosome. Therefore, this SNP/CN platform is suitable for identification of gain and loss of Y chromosome sequences. In a set of 1718 males, we found 25 different CNV patterns, many of which are novel. We confirmed some of these variants by PCR or qPCR. The total frequency of individuals with CNVs was 14.7%, including 9.5% with duplications, 4.5% with deletions and 0.7% exhibiting both. Hence, a novel observation is that the frequency of duplications was more than twice the frequency of deletions. Another striking result was that 10 of the 25 detected variants were significantly overrepresented in one or more haplogroups, demonstrating the importance to control for haplogroups in genome-wide investigations to avoid stratification. NO-M214(xM175 individuals presented the highest percentage (95% of CNVs. If they were not counted, 12.4% of the rest included CNVs, and the difference between duplications (8.9% and deletions (2.8% was even larger.Our results demonstrate that currently available genome-wide SNP platforms can be used to identify duplications and deletions in the human Y chromosome. Future association studies of the full spectrum of Y chromosome variants will demonstrate the potential involvement of gain or loss of Y chromosome sequence in

Characterizing the Prevalence of Chromosome Instability in Interval Colorectal Cancer

Directory of Open Access Journals (Sweden)

A.L. Cisyk

2015-03-01

Full Text Available A substantial proportion of colorectal cancers (CRCs are interval CRCs (I-CRCs; i.e., CRCs diagnosed soon after a colonoscopy. Chromosomal instability (CIN is defined as an increase in the rate of which whole chromosomes/large chromosomal fragments are gained or lost and is observed in 85% of non-hereditary CRCs. The contribution of CIN to the etiology of I-CRCs remains unknown. We established a fluorescence in situ hybridization (FISH approach to characterize CIN by enumerating specific chromosomes and determined the prevalence of numerical CIN in a population-based cohort of I-CRCs and control (sporadic CRCs. Using the population-based Manitoba Health administrative databases and Manitoba Cancer Registry, we identified an age, sex, and colonic site of CRC matched cohort of I-CRCs and controls and retrieved their archived paraffin-embedded tumor samples. FISH chromosome enumeration probes specifically recognizing the pericentric regions of chromosomes 8, 11, and 17 were first used on cell lines and then CRC tissue microarrays to detect aneusomy, which was then used to calculate a CIN score (CS. The 15th percentile CS for control CRC was used to define CIN phenotype. Mean CSs were similar in the control CRCs and I-CRCs; 82% of I-CRCs exhibited a CIN phenotype, which was similar to that in the control CRCs. This study suggests that CIN is the most prevalent contributor to genomic instability in I-CRCs. Further studies should evaluate CIN and microsatellite instability (MSI in the same cohort of I-CRCs to corroborate our findings and to further assess concomitant contribution of CIN and MSI to I-CRCs.

Meiotic double-strand breaks at the interface of chromosome movement, chromosome remodeling, and reductional division

Science.gov (United States)

Storlazzi, Aurora; Tessé, Sophie; Gargano, Silvana; James, Françoise; Kleckner, Nancy; Zickler, Denise

2003-01-01

Chromosomal processes related to formation and function of meiotic chiasmata have been analyzed in Sordaria macrospora. Double-strand breaks (DSBs), programmed or γ-rays-induced, are found to promote four major events beyond recombination and accompanying synaptonemal complex formation: (1) juxtaposition of homologs from long-distance interactions to close presynaptic coalignment at midleptotene; (2) structural destabilization of chromosomes at leptotene/zygotene, including sister axis separation and fracturing, as revealed in a mutant altered in the conserved, axis-associated cohesin-related protein Spo76/Pds5p; (3) exit from the bouquet stage, with accompanying global chromosome movements, at zygotene/pachytene (bouquet stage exit is further found to be a cell-wide regulatory transition and DSB transesterase Spo11p is suggested to have a new noncatalytic role in this transition); (4) normal occurrence of both meiotic divisions, including normal sister separation. Functional interactions between DSBs and the spo76-1 mutation suggest that Spo76/Pds5p opposes local destabilization of axes at developing chiasma sites and raise the possibility of a regulatory mechanism that directly monitors the presence of chiasmata at metaphase I. Local chromosome remodeling at DSB sites appears to trigger an entire cascade of chromosome movements, morphogenetic changes, and regulatory effects that are superimposed upon a foundation of DSB-independent processes. PMID:14563680

High degree of sex chromosome differentiation in stickleback fishes

Directory of Open Access Journals (Sweden)

Shimada Yukinori

2011-09-01

Full Text Available Abstract Background Studies of closely related species with different sex chromosome systems can provide insights into the processes of sex chromosome differentiation and evolution. To investigate the potential utility of molecular markers in studying sex chromosome differentiation at early stages of their divergence, we examined the levels and patterns of genetic differentiation between sex chromosomes in nine-spined (Pungitius pungitius and three-spined sticklebacks (Gasterosteus aculeatus using microsatellite markers. Results A set of novel microsatellite markers spanning the entire length of the sex chromosomes were developed for nine-spined sticklebacks using the sequenced genomes of other fish species. Sex-specific patterns of genetic variability and male-specific alleles were identified at most of these loci, indicating a high degree of differentiation between the X and Y chromosomes in nine-spined sticklebacks. In three-spined sticklebacks, male-specific alleles were detected at some loci confined to two chromosomal regions. In addition, male-specific null alleles were identified at several other loci, implying the absence of Y chromosomal alleles at these loci. Overall, male-specific alleles and null alleles were found over a region spanning 81% of the sex chromosomes in three-spined sticklebacks. Conclusions High levels but distinct patterns of sex chromosome differentiation were uncovered in the stickleback species that diverged 13 million years ago. Our results suggest that the Y chromosome is highly degenerate in three-spined sticklebacks, but not in nine-spined sticklebacks. In general, the results demonstrate that microsatellites can be useful in identifying the degree and patterns of sex chromosome differentiation in species at initial stages of sex chromosome evolution.

Structural Fingerprints of Transcription Factor Binding Site Regions

Directory of Open Access Journals (Sweden)

Peter Willett

2009-03-01

Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.

Intruder scenarios for site-specific waste classification

International Nuclear Information System (INIS)

Kennedy, W.E. Jr.

1988-01-01

The US Department of Energy (DOE) is currently revising its low-level radioactive waste (LLW) management requirements and guidelines for waste generated at its facilities that support defense missions. Specifically, draft DOE 5820.2A, Chapter 3, describes the purpose, policy, and requirements necessary for the management of defense LLW. The draft DOE policy calls for DOE LLW operations to be managed to protect the health and safety of the public, preserve the environment, and ensure that no remedial action will be necessary after termination of operations. The requirements and guidelines apply to radioactive wastes but are also intended to apply to mixed hazardous and radioactive wastes as defined in draft DOE 5400.5, Hazardous and Radioactive Mixed Waste. The basic approach used by DOE is to establish overall performance objectives in terms of ground-water protection and public radiation dose limits and to require site-specific performance assessments to determine compliance. As a result of these performance assessments, each site shall develop waste acceptance criteria that define the allowable quantities and concentrations of specific radioisotopes. Additional limitations on waste disposal design, waste form, and waste treatment shall also be developed on a site-specific basis. As a key step in the site-specific performance assessments, an evaluation must be conducted of potential radiation doses to intruders who may inadvertently move onto a closed DOE LLW disposal site after loss of institutional controls must be conducted. This paper describes the types of intruder scenarios that should be considered when performing this step of the site-specific performance assessment

DOE site-specific threat assessment

International Nuclear Information System (INIS)

West, D.J.; Al-Ayat, R.A.; Judd, B.R.

1985-01-01

A facility manager faced with the challenges of protecting a nuclear facility against potential threats must consider the likelihood and consequences of such threats, know the capabilities of the facility safeguards and security systems, and make informed decisions about the cost-effectivness of safeguards and security upgrades. To help meet these challenges, the San Francisco Operations Office of the Department of Energy, in conjunction with the Lawrence Livermore Laboratory, has developed a site-specific threat assessment approach and a quantitative model to improve the quality and consistency of site-specific threat assessment and resultant security upgrade decisions at sensitive Department of Energy facilities. 5 figs

Specific down-regulation of spermatogenesis genes targeted by 22G RNAs in hybrid sterile males associated with an X-Chromosome introgression.

Science.gov (United States)

Li, Runsheng; Ren, Xiaoliang; Bi, Yu; Ho, Vincy Wing Sze; Hsieh, Chia-Ling; Young, Amanda; Zhang, Zhihong; Lin, Tingting; Zhao, Yanmei; Miao, Long; Sarkies, Peter; Zhao, Zhongying

2016-09-01

Hybrid incompatibility (HI) prevents gene flow between species, thus lying at the heart of speciation genetics. One of the most common HIs is male sterility. Two superficially contradictory observations exist for hybrid male sterility. First, an introgression on the X Chromosome is more likely to produce male sterility than on autosome (so-called large-X theory); second, spermatogenesis genes are enriched on the autosomes but depleted on the X Chromosome (demasculinization of X Chromosome). Analysis of gene expression in Drosophila hybrids suggests a genetic interaction between the X Chromosome and autosomes that is essential for male fertility. However, the prevalence of such an interaction and its underlying mechanism remain largely unknown. Here we examine the interaction in nematode species by contrasting the expression of both coding genes and transposable elements (TEs) between hybrid sterile males and its parental nematode males. We use two lines of hybrid sterile males, each carrying an independent introgression fragment from Caenorhabditis briggsae X Chromosome in an otherwise Caenorhabditis nigoni background, which demonstrate similar defects in spermatogenesis. We observe a similar pattern of down-regulated genes that are specific for spermatogenesis between the two hybrids. Importantly, the down-regulated genes caused by the X Chromosome introgressions show a significant enrichment on the autosomes, supporting an epistatic interaction between the X Chromosome and autosomes. We investigate the underlying mechanism of the interaction by measuring small RNAs and find that a subset of 22G RNAs specifically targeting the down-regulated spermatogenesis genes is significantly up-regulated in hybrids, suggesting that perturbation of small RNA-mediated regulation may contribute to the X-autosome interaction. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.

A genome-wide screen in human embryonic stem cells reveals novel sites of allele-specific histone modification associated with known disease loci

LENUS (Irish Health Repository)

Prendergast, James G D

2012-05-19

AbstractBackgroundChromatin structure at a given site can differ between chromosome copies in a cell, and such imbalances in chromatin structure have been shown to be important in understanding the molecular mechanisms controlling several disease loci. Human genetic variation, DNA methylation, and disease have been intensely studied, uncovering many sites of allele-specific DNA methylation (ASM). However, little is known about the genome-wide occurrence of sites of allele-specific histone modification (ASHM) and their relationship to human disease. The aim of this study was to investigate the extent and characteristics of sites of ASHM in human embryonic stem cells (hESCs).ResultsUsing a statistically rigorous protocol, we investigated the genomic distribution of ASHM in hESCs, and their relationship to sites of allele-specific expression (ASE) and DNA methylation. We found that, although they were rare, sites of ASHM were substantially enriched at loci displaying ASE. Many were also found at known imprinted regions, hence sites of ASHM are likely to be better markers of imprinted regions than sites of ASM. We also found that sites of ASHM and ASE in hESCs colocalize at risk loci for developmental syndromes mediated by deletions, providing insights into the etiology of these disorders.ConclusionThese results demonstrate the potential importance of ASHM patterns in the interpretation of disease loci, and the protocol described provides a basis for similar studies of ASHM in other cell types to further our understanding of human disease susceptibility.

MUS81 promotes common fragile site expression

DEFF Research Database (Denmark)

Ying, Songmin; Minocherhomji, Sheroy; Chan, Kok Lung

2013-01-01

Fragile sites are chromosomal loci with a propensity to form gaps or breaks during early mitosis, and their instability is implicated as being causative in certain neurological disorders and cancers. Recent work has demonstrated that the so-called common fragile sites (CFSs) often impair the fait......Fragile sites are chromosomal loci with a propensity to form gaps or breaks during early mitosis, and their instability is implicated as being causative in certain neurological disorders and cancers. Recent work has demonstrated that the so-called common fragile sites (CFSs) often impair...... the faithful disjunction of sister chromatids in mitosis. However, the mechanisms by which CFSs express their fragility, and the cellular factors required to suppress CFS instability, remain largely undefined. Here, we report that the DNA structure-specific nuclease MUS81-EME1 localizes to CFS loci in early...

Structure, organization, and sequence of alpha satellite DNA from human chromosome 17: evidence for evolution by unequal crossing-over and an ancestral pentamer repeat shared with the human X chromosome.

Science.gov (United States)

Waye, J S; Willard, H F

1986-09-01

The centromeric regions of all human chromosomes are characterized by distinct subsets of a diverse tandemly repeated DNA family, alpha satellite. On human chromosome 17, the predominant form of alpha satellite is a 2.7-kilobase-pair higher-order repeat unit consisting of 16 alphoid monomers. We present the complete nucleotide sequence of the 16-monomer repeat, which is present in 500 to 1,000 copies per chromosome 17, as well as that of a less abundant 15-monomer repeat, also from chromosome 17. These repeat units were approximately 98% identical in sequence, differing by the exclusion of precisely 1 monomer from the 15-monomer repeat. Homologous unequal crossing-over is suggested as a probable mechanism by which the different repeat lengths on chromosome 17 were generated, and the putative site of such a recombination event is identified. The monomer organization of the chromosome 17 higher-order repeat unit is based, in part, on tandemly repeated pentamers. A similar pentameric suborganization has been previously demonstrated for alpha satellite of the human X chromosome. Despite the organizational similarities, substantial sequence divergence distinguishes these subsets. Hybridization experiments indicate that the chromosome 17 and X subsets are more similar to each other than to the subsets found on several other human chromosomes. We suggest that the chromosome 17 and X alpha satellite subsets may be related components of a larger alphoid subfamily which have evolved from a common ancestral repeat into the contemporary chromosome-specific subsets.

Lack of a Y-Chromosomal Complement in the Majority of Gestational Trophoblastic Neoplasms

Directory of Open Access Journals (Sweden)

Kai Lee Yap

2010-01-01

Full Text Available Gestational trophoblastic neoplasms (GTNs are a rare group of neoplastic diseases composed of choriocarcinomas, placental site trophoblastic tumors (PSTTs and epithelioid trophoblastic tumors (ETTs. Since these tumors are derivatives of fetal trophoblastic tissue, approximately 50% of GTN cases are expected to originate from a male conceptus and carry a Y-chromosomal complement according to a balanced sex ratio. To investigate this hypothesis, we carried out a comprehensive analysis by genotyping a relatively large sample size of 51 GTN cases using three independent sex chromosome genetic markers; Amelogenin, Protein Kinase and Zinc Finger have X and Y homologues that are distinguishable by their PCR product size. We found that all cases contained the X-chromosomal complement while only five (10% of 51 tumors harbored the Y-chromosomal complement. Specifically, Y-chromosomal signals were detected in one (5% of 19 choriocarcinomas, one (7% of 15 PSTTs and three (18% of 17 ETTs. The histopathological features of those with a Y-chromosome were similar to those without. Our results demonstrate the presence of a Y-chromosomal complement in GTNs, albeit a low 10% of cases. This shortfall of Y-chromosomal complements in GTNs may reinforce the notion that the majority of GTNs are derived from previous molar gestations.

FANCD2 binding identifies conserved fragile sites at large transcribed genes in avian cells

DEFF Research Database (Denmark)

Pentzold, Constanze; Shah, Shiraz Ali; Hansen, Niels Richard

2018-01-01

Common Chromosomal Fragile Sites (CFSs) are specific genomic regions prone to form breaks on metaphase chromosomes in response to replication stress. Moreover, CFSs are mutational hotspots in cancer genomes, showing that the mutational mechanisms that operate at CFSs are highly active in cancer c...

Natural Selection Reduced Diversity on Human Y Chromosomes

Science.gov (United States)

Wilson Sayres, Melissa A.; Lohmueller, Kirk E.; Nielsen, Rasmus

2014-01-01

The human Y chromosome exhibits surprisingly low levels of genetic diversity. This could result from neutral processes if the effective population size of males is reduced relative to females due to a higher variance in the number of offspring from males than from females. Alternatively, selection acting on new mutations, and affecting linked neutral sites, could reduce variability on the Y chromosome. Here, using genome-wide analyses of X, Y, autosomal and mitochondrial DNA, in combination with extensive population genetic simulations, we show that low observed Y chromosome variability is not consistent with a purely neutral model. Instead, we show that models of purifying selection are consistent with observed Y diversity. Further, the number of sites estimated to be under purifying selection greatly exceeds the number of Y-linked coding sites, suggesting the importance of the highly repetitive ampliconic regions. While we show that purifying selection removing deleterious mutations can explain the low diversity on the Y chromosome, we cannot exclude the possibility that positive selection acting on beneficial mutations could have also reduced diversity in linked neutral regions, and may have contributed to lowering human Y chromosome diversity. Because the functional significance of the ampliconic regions is poorly understood, our findings should motivate future research in this area. PMID:24415951

The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome.

Science.gov (United States)

González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred; Llosa, Matxalen

2017-06-15

Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific

[Chromosomal localization of foreign genes in transgenic mice using dual-color fluorescence in situ hybridization].

Science.gov (United States)

Lin, Dan; Gong, Xiu-li; Li, Wei; Guo, Xin-bing; Zhu, Yi-wen; Huang, Ying

2008-02-01

To establish a highly sensitive and specific dual-color fluorescence in situ hybridization (D-FISH) method used for chromosomal localization of foreign genes in double transgenic mice. Two strains of double transgenic mice were used in this experiment, one was integrated with the herpes simplex virus thymidine kinase (HSV-tk) and the enhanced green fluorescence protein (eGFP), the other was with the short hairpin RNA interference(RNAi) and beta(654). Splenic cells cultured in vitro were arrested in metaphase by colchicine and hybridized with digoxigenin-labeled and biotinylated DNA probes, then detected by rhodamine-conjugated avidin and FITC-conjugated anti-digoxigenin. Dual-color fluorescence signals were detected on the same metaphase in both transgenic mice strains. In HSV-tk/eGFP double transgenic mice, strong green fluorescence for HSV-tk and red for eGFP were observed and localized at 2E5-G3 and 8A2-A4 respectively. In beta(654)/RNAi mice, beta(654) was detected as red fluorescence on chromosome 7D3-E2, and RNAi showed random integration on chromosomes. It was detected as green fluorescence on chromosome 12B1 in one mouse, while on 1E2.3-1F and 3A3 in the other. Highly sensitive and specific D-FISH method was established using the self-prepared DNA probes, and chromosomal localization of the foreign genes was also performed in combination with G-banding in double transgenic mice. This technology will facilitate the researches in transgenic animals and gene therapy models.

Integrated gene mapping and synteny studies give insights into the evolution of a sex proto-chromosome in Solea senegalensis.

Science.gov (United States)

Portela-Bens, Silvia; Merlo, Manuel Alejandro; Rodríguez, María Esther; Cross, Ismael; Manchado, Manuel; Kosyakova, Nadezda; Liehr, Thomas; Rebordinos, Laureana

2017-03-01

The evolution of genes related to sex and reproduction in fish shows high plasticity and, to date, the sex determination system has only been identified in a few species. Solea senegalensis has 42 chromosomes and an XX/XY chromosome system for sex determination, while related species show the ZZ/ZW system. Next-generation sequencing (NGS), multi-color fluorescence in situ hybridization (mFISH) techniques, and bioinformatics analysis have been carried out, with the objective of revealing new information about sex determination and reproduction in S. senegalensis. To that end, several bacterial artificial chromosome (BAC) clones that contain candidate genes involved in such processes (dmrt1, dmrt2, dmrt3, dmrt4, sox3, sox6, sox8, sox9, lh, cyp19a1a, amh, vasa, aqp3, and nanos3) were analyzed and compared with the same region in other related species. Synteny studies showed that the co-localization of dmrt1-dmrt2-drmt3 in the largest metacentric chromosome of S. senegalensis is coincident with that found in the Z chromosome of Cynoglossus semilaevis, which would potentially make this a sex proto-chromosome. Phylogenetic studies show the close proximity of S. senegalensis to Oryzias latipes, a species with an XX/XY system and a sex master gene. Comparative mapping provides evidence of the preferential association of these candidate genes in particular chromosome pairs. By using the NGS and mFISH techniques, it has been possible to obtain an integrated genetic map, which shows that 15 out of 21 chromosome pairs of S. senegalensis have at least one BAC clone. This result is important for distinguishing those chromosome pairs of S. senegalensis that are similar in shape and size. The mFISH analysis shows the following co-localizations in the same chromosomes: dmrt1-dmrt2-dmrt3, dmrt4-sox9-thrb, aqp3-sox8, cyp19a1a-fshb, igsf9b-sox3, and lysg-sox6.

Site-specific design optimization of wind turbines

DEFF Research Database (Denmark)

Fuglsang, P.; Bak, C.; Schepers, J.G.

2002-01-01

This article reports results from a European project, where site characteristics were incorporated into the design process of wind turbines, to enable site-specific design. Two wind turbines of different concept were investigated at six different sites comprising normal flat terrain, offshore...... and complex terrain wind farms. Design tools based on numerical optimization and aeroelastic calculations were combined with a cost model to allow optimization for minimum cost of energy. Different scenarios were optimized ranging from modifications of selected individual components to the complete design...... of a new wind turbine. Both annual energy yield and design-determining loads depended on site characteristics, and this represented a potential for site-specific design. The maximum variation in annual energy yield was 37% and the maximum variation in blade root fatigue loads was 62%. Optimized site...

Site-Specific PEGylation of Therapeutic Proteins

Directory of Open Access Journals (Sweden)

Jonathan K. Dozier

2015-10-01

Full Text Available The use of proteins as therapeutics has a long history and is becoming ever more common in modern medicine. While the number of protein-based drugs is growing every year, significant problems still remain with their use. Among these problems are rapid degradation and excretion from patients, thus requiring frequent dosing, which in turn increases the chances for an immunological response as well as increasing the cost of therapy. One of the main strategies to alleviate these problems is to link a polyethylene glycol (PEG group to the protein of interest. This process, called PEGylation, has grown dramatically in recent years resulting in several approved drugs. Installing a single PEG chain at a defined site in a protein is challenging. Recently, there is has been considerable research into various methods for the site-specific PEGylation of proteins. This review seeks to summarize that work and provide background and context for how site-specific PEGylation is performed. After introducing the topic of site-specific PEGylation, recent developments using chemical methods are described. That is followed by a more extensive discussion of bioorthogonal reactions and enzymatic labeling.

Maternal age-specific risk of non-chromosomal anomalies

DEFF Research Database (Denmark)

Loane, M; Dolk, H; Morris, J K

2009-01-01

OBJECTIVES: To determine the excess risk of non-chromosomal congenital anomaly (NCA) among teenage mothers and older mothers. DESIGN AND SETTING: Population-based prevalence study using data from EUROCAT congenital anomaly registers in 23 regions of Europe in 15 countries, covering a total of 1.7...

Human chromosome-specific changes in a human-hamster hybrid cell line (AL) assessed by fluorescent in situ hybridization (fish)

International Nuclear Information System (INIS)

Geard, Charles R.; Jenkins, Gloria

1995-01-01

Purpose: To quantitatively assess all gamma-ray induced chromosomal changes confined to one human chromosome using fluorescence microscopy and in situ hybridization with a fluorescently labeled human chromosome specific nucleic acid probe. Methods and Materials: Synchronized human-hamster hybrid cells containing human chromosome 11 were obtained by a modified mitotic shake-off procedure. G1 phase cells (> 95%) were irradiated with 137 Cs gamma rays (0, 0.5, 1.0, 1.5, 2.0, 4.0, 6.0, 8.0, and 10.0 Gy) at a dose rate of 1.1 Gy/min and mitotic cells collected 16-20 h later; chromosomal spreads were prepared, denatured, and hybridized with a fluorescein-tagged nucleic acid probe against total human DNA. Chromosomes were examined by fluorescence microscopy and all categories of change involving the human chromosome 11 as target, recorded. Results: Overall, of the 3104 human-hamster hybrid cells examined, 82.1% were euploid, of which 88.6% contained one copy of human chromosome 11, 6.2% contained two copies, and 5.2% contained 0 copies. This is compatible with mitotic nondisjunction in a small fraction of cells. Of the remaining 17.9% of cells, 85.2% were tetraploid cells with two copies of human chromosome 11. For all aberrations involving human chromosome 11 there was a linear relationship between yield and absorbed dose of 0.1 aberrations per chromosome per Gy. The yield of dicentrics, translocations, and terminal deletions that involve one lesion on the human chromosome was linear, while the yield of interstitial deletions that arise from two interacting lesions on the human chromosome was curvilinear. The frequencies of dicentrics and translocations were about equal, while there was a high (40-60%) incidence of incomplete exchanges between human and hamster chromosomes. Conclusions: Fluorescent in situ hybridization (FISH) procedures allow for the efficient detection of a broad range of induced changes in target chromosomes. Symmetrical exchanges induced in G1

PhosphoRice: a meta-predictor of rice-specific phosphorylation sites

Directory of Open Access Journals (Sweden)

Que Shufu

2012-02-01

Full Text Available Abstract Background As a result of the growing body of protein phosphorylation sites data, the number of phosphoprotein databases is constantly increasing, and dozens of tools are available for predicting protein phosphorylation sites to achieve fast automatic results. However, none of the existing tools has been developed to predict protein phosphorylation sites in rice. Results In this paper, the phosphorylation site predictors, NetPhos 2.0, NetPhosK, Kinasephos, Scansite, Disphos and Predphosphos, were integrated to construct meta-predictors of rice-specific phosphorylation sites using several methods, including unweighted voting, unreduced weighted voting, reduced unweighted voting and weighted voting strategies. PhosphoRice, the meta-predictor produced by using weighted voting strategy with parameters selected by restricted grid search and conditional random search, performed the best at predicting phosphorylation sites in rice. Its Matthew's Correlation Coefficient (MCC and Accuracy (ACC reached to 0.474 and 73.8%, respectively. Compared to the best individual element predictor (Disphos_default, PhosphoRice archieved a significant increase in MCC of 0.071 (P Conclusions PhosphoRice is a powerful tool for predicting unidentified phosphorylation sites in rice. Compared to the existing methods, we found that our tool showed greater robustness in ACC and MCC. PhosphoRice is available to the public at http://bioinformatics.fafu.edu.cn/PhosphoRice.

Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.

Science.gov (United States)

Bisht, M S; Mukai, Y

2000-12-01

Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.

Maternal age-specific risk of non-chromosomal anomalies

NARCIS (Netherlands)

Loane, M.; Dolk, H.; Morris, Joan K.

To determine the excess risk of non-chromosomal congenital anomaly (NCA) among teenage mothers and older mothers. Population-based prevalence study using data from EUROCAT congenital anomaly registers in 23 regions of Europe in 15 countries, covering a total of 1.75 million births from 2000 to 2004.

Common chromosomal fragile sites (CFS) may be involved in normal and traumatic cognitive stress memory consolidation and altered nervous system immunity.

Science.gov (United States)

Gericke, G S

2010-05-01

Previous reports of specific patterns of increased fragility at common chromosomal fragile sites (CFS) found in association with certain neurobehavioural disorders did not attract attention at the time due to a shift towards molecular approaches to delineate neuropsychiatric disorder candidate genes. Links with miRNA, altered methylation and the origin of copy number variation indicate that CFS region characteristics may be part of chromatinomic mechanisms that are increasingly linked with neuroplasticity and memory. Current reports of large-scale double-stranded DNA breaks in differentiating neurons and evidence of ongoing DNA demethylation of specific gene promoters in adult hippocampus may shed new light on the dynamic epigenetic changes that are increasingly appreciated as contributing to long-term memory consolidation. The expression of immune recombination activating genes in key stress-induced memory regions suggests the adoption by the brain of this ancient pattern recognition and memory system to establish a structural basis for long-term memory through controlled chromosomal breakage at highly specific genomic regions. It is furthermore considered that these mechanisms for management of epigenetic information related to stress memory could be linked, in some instances, with the transfer of the somatically acquired information to the germline. Here, rearranged sequences can be subjected to further selection and possible eventual retrotranscription to become part of the more stable coding machinery if proven to be crucial for survival and reproduction. While linkage of cognitive memory with stress and fear circuitry and memory establishment through structural DNA modification is proposed as a normal process, inappropriate activation of immune-like genomic rearrangement processes through traumatic stress memory may have the potential to lead to undesirable activation of neuro-inflammatory processes. These theories could have a significant impact on the

CHROMOSOMAL DIFFERENTIATIONS OF THE LAMPBRUSH TYPE FORMED BY THE Y CHROMOSOME IN DROSOPHILA HYDEI AND DROSOPHILA NEOHYDEI

Science.gov (United States)

Hess, Oswald; Meyer, Günther F.

1963-01-01

The nuclei of growing spermatocytes in Drosophila hydei and D. neohydei are characterized by the appearance of phase-specific, paired, loop-shaped structures thought to be similar to the loops in lampbrush chromosomes of amphibian oocytes. In X/O-males of D. hydei spermatogenesis is completely blocked before the first maturation division. No spermatozoa are formed in such testes. In the nuclei of X/O-spermatocytes, paired loop formations are absent. This shows the dependence of these chromosomal functional structures upon the Y chromosome. The basis of this dependence could be shown through an investigation of males with two Y chromosomes. All loop pairs are present in duplicate in XYY males. This proves that the intranuclear formations are structural modifications of the Y chromosome itself. These functional structures are species-specific and characteristically different in Drosophila hydei and D. neohydei. Reciprocal species crosses and a backcross showed that the spermatocyte nuclei of all hybrid males possess the functional structures corresponding to the species which donated the Y chromosome. This shows that the morphological character of the functional structures is also determined by the Y chromosome. PMID:13954225

DbPTM 3.0: an informative resource for investigating substrate site specificity and functional association of protein post-translational modifications.

Science.gov (United States)

Lu, Cheng-Tsung; Huang, Kai-Yao; Su, Min-Gang; Lee, Tzong-Yi; Bretaña, Neil Arvin; Chang, Wen-Chi; Chen, Yi-Ju; Chen, Yu-Ju; Huang, Hsien-Da

2013-01-01

Protein modification is an extremely important post-translational regulation that adjusts the physical and chemical properties, conformation, stability and activity of a protein; thus altering protein function. Due to the high throughput of mass spectrometry (MS)-based methods in identifying site-specific post-translational modifications (PTMs), dbPTM (http://dbPTM.mbc.nctu.edu.tw/) is updated to integrate experimental PTMs obtained from public resources as well as manually curated MS/MS peptides associated with PTMs from research articles. Version 3.0 of dbPTM aims to be an informative resource for investigating the substrate specificity of PTM sites and functional association of PTMs between substrates and their interacting proteins. In order to investigate the substrate specificity for modification sites, a newly developed statistical method has been applied to identify the significant substrate motifs for each type of PTMs containing sufficient experimental data. According to the data statistics in dbPTM, >60% of PTM sites are located in the functional domains of proteins. It is known that most PTMs can create binding sites for specific protein-interaction domains that work together for cellular function. Thus, this update integrates protein-protein interaction and domain-domain interaction to determine the functional association of PTM sites located in protein-interacting domains. Additionally, the information of structural topologies on transmembrane (TM) proteins is integrated in dbPTM in order to delineate the structural correlation between the reported PTM sites and TM topologies. To facilitate the investigation of PTMs on TM proteins, the PTM substrate sites and the structural topology are graphically represented. Also, literature information related to PTMs, orthologous conservations and substrate motifs of PTMs are also provided in the resource. Finally, this version features an improved web interface to facilitate convenient access to the resource.

Nanoparticles for Site Specific Genome Editing

Science.gov (United States)

McNeer, Nicole Ali

Triplex-forming peptide nucleic acids (PNAs) can be used to coordinate the recombination of short 50-60 by "donor DNA" fragments into genomic DNA, resulting in site-specific correction of genetic mutations or the introduction of advantageous genetic modifications. Site-specific gene editing in hematopoietic stem and progenitor cells (HSPCs) could result in treatment or cure of inherited disorders of the blood such as beta-thalassemia. Gene editing in HSPCs and differentiated T cells could help combat HIV/AIDs by modifying receptors, such as CCR5, necessary for R5-tropic HIV entry. However, translation of genome modification technologies to clinical practice is limited by challenges in intracellular delivery, especially in difficult-to-transfect hematolymphoid cells. In vivo gene editing could also provide novel treatment for systemic monogenic disorders such as cystic fibrosis, an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane receptor. Here, we have engineered biodegradable nanoparticles to deliver oligonucleotides for site-specific genome editing of disease-relevant genes in human cells, with high efficiency, low toxicity, and editing of clinically relevant cell types. We designed nanoparticles to edit the human beta-globin and CCR5 genes in hematopoietic cells. We show that poly(lactic-co-glycolic acid) (PLGA) nanoparticles can delivery PNA and donor DNA for site-specific gene modification in human hematopoietic cells in vitro and in vivo in NOD-scid IL2rgammanull mice. Nanoparticles delivered by tail vein localized to hematopoietic compartments in the spleen and bone marrow of humanized mice, resulting in modification of the beta-globin and CCR5 genes. Modification frequencies ranged from 0.005 to 20% of cells depending on the organ and cell type, without detectable toxicity. This project developed highly versatile methods for delivery of therapeutics to hematolymphoid cells and hematopoietic stem cells, and will help to

Savannah River Site's Site Specific Plan

International Nuclear Information System (INIS)

1991-01-01

This Site Specific Plan (SSP) has been prepared by the Savannah River Site (SRS) in order to show the Environmental Restoration and Waste Management activities that were identified during the preparation of the Department of Energy-Headquarters (DOE-HQ) Environmental Restoration and Waste Management Five-Year Plan (FYP) for FY 1992--1996. The SSP has been prepared in accordance with guidance received from DOE-HQ. DOE-SR is accountable to DOE-HQ for the implementation of this plan. The purpose of the SSP is to develop a baseline for policy, budget, and schedules for the DOE Environmental Restoration and Waste Management activities. The plan explains accomplishments since the Fiscal Year (FY) 1990 plan, demonstrates how present and future activities are prioritized, identifies currently funded activities and activities that are planned to be funded in the upcoming fiscal year, and describes future activities that SRS is considering

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

A systematic identification of species-specific protein succinylation sites using joint element features information

Directory of Open Access Journals (Sweden)

Hasan MM

2017-08-01

Full Text Available Md Mehedi Hasan,1 Mst Shamima Khatun,2 Md Nurul Haque Mollah,2 Cao Yong,3 Dianjing Guo1 1School of Life Sciences and the State Key Laboratory of Agrobiotechnology, The Chinese University of Hong Kong, Shatin, New Territory, Hong Kong, People’s Republic of China; 2Laboratory of Bioinformatics, Department of Statistics, University of Rajshahi, Rajshahi, Bangladesh; 3Department of Mechanical Engineering and Automation, Harbin Institute of Technology, Shenzhen Graduate School, Shenzhen, People’s Republic of China Abstract: Lysine succinylation, an important type of protein posttranslational modification, plays significant roles in many cellular processes. Accurate identification of succinylation sites can facilitate our understanding about the molecular mechanism and potential roles of lysine succinylation. However, even in well-studied systems, a majority of the succinylation sites remain undetected because the traditional experimental approaches to succinylation site identification are often costly, time-consuming, and laborious. In silico approach, on the other hand, is potentially an alternative strategy to predict succinylation substrates. In this paper, a novel computational predictor SuccinSite2.0 was developed for predicting generic and species-specific protein succinylation sites. This predictor takes the composition of profile-based amino acid and orthogonal binary features, which were used to train a random forest classifier. We demonstrated that the proposed SuccinSite2.0 predictor outperformed other currently existing implementations on a complementarily independent dataset. Furthermore, the important features that make visible contributions to species-specific and cross-species-specific prediction of protein succinylation site were analyzed. The proposed predictor is anticipated to be a useful computational resource for lysine succinylation site prediction. The integrated species-specific online tool of SuccinSite2.0 is publicly

Chromosomal location and gene paucity of the male specific region on papaya Y chromosome

Czech Academy of Sciences Publication Activity Database

Yu, Q.; Hou, S.; Hobza, Roman; Feltus, F.A.; Wang, X.; Jin, W.; Skelton, R.L.; Blas, A.; Lemke, C.; Saw, J.H.; Moore, P.H.; Alam, M.; Jiang, J.; Paterson, A.H.; Vyskot, Boris; Ming, R.

2007-01-01

Roč. 278, č. 2 (2007), s. 177-185 ISSN 1617-4615 R&D Projects: GA ČR(CZ) GA521/06/0056 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : Carica papaya * repetitive sequences * sex chromosome Subject RIV: BO - Biophysics Impact factor: 2.978, year: 2007

A gene catalogue of the euchromatic male-specific region of the horse Y chromosome: comparison with human and other mammals.

Directory of Open Access Journals (Sweden)

Nandina Paria

Full Text Available Studies of the Y chromosome in primates, rodents and carnivores provide compelling evidence that the male specific region of Y (MSY contains functional genes, many of which have specialized roles in spermatogenesis and male-fertility. Little similarity, however, has been found between the gene content and sequence of MSY in different species. This hinders the discovery of species-specific male fertility genes and limits our understanding about MSY evolution in mammals. Here, a detailed MSY gene catalogue was developed for the horse--an odd-toed ungulate. Using direct cDNA selection from horse testis, and sequence analysis of Y-specific BAC clones, 37 horse MSY genes/transcripts were identified. The genes were mapped to the MSY BAC contig map, characterized for copy number, analyzed for transcriptional profiles by RT-PCR, examined for the presence of ORFs, and compared to other mammalian orthologs. We demonstrate that the horse MSY harbors 20 X-degenerate genes with known orthologs in other eutherian species. The remaining 17 genes are acquired or novel and have so far been identified only in the horse or donkey Y chromosomes. Notably, 3 transcripts were found in the heterochromatic part of the Y. We show that despite substantial differences between the sequence, gene content and organization of horse and other mammalian Y chromosomes, the functions of MSY genes are predominantly related to testis and spermatogenesis. Altogether, 10 multicopy genes with testis-specific expression were identified in the horse MSY, and considered likely candidate genes for stallion fertility. The findings establish an important foundation for the study of Y-linked genetic factors governing fertility in stallions, and improve our knowledge about the evolutionary processes that have shaped Y chromosomes in different mammalian lineages.

A gene catalogue of the euchromatic male-specific region of the horse Y chromosome: comparison with human and other mammals.

Science.gov (United States)

Paria, Nandina; Raudsepp, Terje; Pearks Wilkerson, Alison J; O'Brien, Patricia C M; Ferguson-Smith, Malcom A; Love, Charles C; Arnold, Carolyn; Rakestraw, Peter; Murphy, William J; Chowdhary, Bhanu P

2011-01-01

Studies of the Y chromosome in primates, rodents and carnivores provide compelling evidence that the male specific region of Y (MSY) contains functional genes, many of which have specialized roles in spermatogenesis and male-fertility. Little similarity, however, has been found between the gene content and sequence of MSY in different species. This hinders the discovery of species-specific male fertility genes and limits our understanding about MSY evolution in mammals. Here, a detailed MSY gene catalogue was developed for the horse--an odd-toed ungulate. Using direct cDNA selection from horse testis, and sequence analysis of Y-specific BAC clones, 37 horse MSY genes/transcripts were identified. The genes were mapped to the MSY BAC contig map, characterized for copy number, analyzed for transcriptional profiles by RT-PCR, examined for the presence of ORFs, and compared to other mammalian orthologs. We demonstrate that the horse MSY harbors 20 X-degenerate genes with known orthologs in other eutherian species. The remaining 17 genes are acquired or novel and have so far been identified only in the horse or donkey Y chromosomes. Notably, 3 transcripts were found in the heterochromatic part of the Y. We show that despite substantial differences between the sequence, gene content and organization of horse and other mammalian Y chromosomes, the functions of MSY genes are predominantly related to testis and spermatogenesis. Altogether, 10 multicopy genes with testis-specific expression were identified in the horse MSY, and considered likely candidate genes for stallion fertility. The findings establish an important foundation for the study of Y-linked genetic factors governing fertility in stallions, and improve our knowledge about the evolutionary processes that have shaped Y chromosomes in different mammalian lineages.

De novo formed satellite DNA-based mammalian artificial chromosomes and their possible applications.

Science.gov (United States)

Katona, Robert L

2015-02-01

Mammalian artificial chromosomes (MACs) are non-integrating, autonomously replicating natural chromosome-based vectors that may carry a vast amount of genetic material, which in turn enable potentially prolonged, safe, and regulated therapeutic transgene expression and render MACs as attractive genetic vectors for "gene replacement" or for controlling differentiation pathways in target cells. Satellite-DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian and plant species. These artificially generated accessory chromosomes are composed of predictable DNA sequences, and they contain defined genetic information. SATACs have already passed a number of obstacles crucial to their further development as gene therapy vectors, including large-scale purification, transfer of purified artificial chromosomes into different cells and embryos, generation of transgenic animals and germline transmission with purified SATACs, and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals. SATACs could be used in cell therapy protocols. For these methods, the most versatile target cell would be one that was pluripotent and self-renewing to address multiple disease target cell types, thus making multilineage stem cells, such as adult derived early progenitor cells and embryonic stem cells, as attractive universal host cells.

International workshop on chromosome 3. Final report, April 15, 1991--April 14, 1992

Energy Technology Data Exchange (ETDEWEB)

Gemmill, R.M.

1992-07-01

The Second Workshop on Human Chromosome 3 was held on April 4--5, 1991 at Denver, Colorado. There were 43 participants representing 8 nations. The workshop participants reviewed the current state of the chromosome 3 map, both physical and genetic, and prepared lists of markers and cell lines to be made commonly available. These markers and cell lines should be incorporated into the mapping efforts of diverse groups to permit the integration of data and development of consensus maps at future workshops. Region specific efforts were described for sections of the chromosome harboring genes thought to be involved in certain diseases including Von Hippel-Lindau disease, 3p-syndrome, lung cancer and renal cancer. Selected papers have been processed separately for inclusion in the Energy Science and Technology Database.

HIV integration sites and implications for maintenance of the reservoir.

Science.gov (United States)

Symons, Jori; Cameron, Paul U; Lewin, Sharon R

2018-03-01

To provide an overview of recent research of how HIV integration relates to productive and latent infection and implications for cure strategies. How and where HIV integrates provides new insights into how HIV persists on antiretroviral therapy (ART). Clonal expansion of infected cells with the same integration site demonstrates that T-cell proliferation is an important factor in HIV persistence, however, the driver of proliferation remains unclear. Clones with identical integration sites harbouring defective provirus can accumulate in HIV-infected individuals on ART and defective proviruses can express RNA and produce protein. HIV integration sites differ in clonally expanded and nonexpanded cells and in latently and productively infected cells and this influences basal and inducible transcription. There is a growing number of cellular proteins that can alter the pattern of integration to favour latency. Understanding these pathways may identify new interventions to eliminate latently infected cells. Using advances in analysing HIV integration sites, T-cell proliferation of latently infected cells is thought to play a major role in HIV persistence. Clonal expansion has been demonstrated with both defective and intact viruses. Production of viral RNA and protein from defective viruses may play a role in driving chronic immune activation. The site of integration may determine the likelihood of proliferation and the degree of basal and induced transcription. Finally, host factors and gene expression at the time of infection may determine the integration site. Together these new insights may lead to novel approaches to elimination of latently infected cells.

Tumor-specific chromosome mis-segregation controls cancer plasticity by maintaining tumor heterogeneity.

Directory of Open Access Journals (Sweden)

Yuanjie Hu

Full Text Available Aneuploidy with chromosome instability is a cancer hallmark. We studied chromosome 7 (Chr7 copy number variation (CNV in gliomas and in primary cultures derived from them. We found tumor heterogeneity with cells having Chr7-CNV commonly occurs in gliomas, with a higher percentage of cells in high-grade gliomas carrying more than 2 copies of Chr7, as compared to low-grade gliomas. Interestingly, all Chr7-aneuploid cell types in the parental culture of established glioma cell lines reappeared in single-cell-derived subcultures. We then characterized the biology of three syngeneic glioma cultures dominated by different Chr7-aneuploid cell types. We found phenotypic divergence for cells following Chr7 mis-segregation, which benefited overall tumor growth in vitro and in vivo. Mathematical modeling suggested the involvement of chromosome instability and interactions among cell subpopulations in restoring the optimal equilibrium of tumor cell types. Both our experimental data and mathematical modeling demonstrated that the complexity of tumor heterogeneity could be enhanced by the existence of chromosomes with structural abnormality, in addition to their mis-segregations. Overall, our findings show, for the first time, the involvement of chromosome instability in maintaining tumor heterogeneity, which underlies the enhanced growth, persistence and treatment resistance of cancers.

Chromosome specific DNA hybridization in suspension for flow cytometric detection of chimerism in bone marrow transplantation and leukemia

NARCIS (Netherlands)

G.J.A. Arkesteijn (Ger); C.A.J. Erpelinck (Claudia); A.C.M. Martens (Anton); A. Hagenbeek (Anton)

1995-01-01

textabstractFlow cytometry was used to measure the fluorescence intensity of nuclei that were subjected to fluorescent in situ hybridization in suspension with chromosome specific DNA probes. Paraformaldehyde-fixed nuclei were protein digested with trypsin and hybridized simultaneously with a

Site specific plan

International Nuclear Information System (INIS)

Hutchison, J.; Jernigan, G.

1989-12-01

The Environmental Restoration and Waste Management Five-Year Plan (FYP) covers the period for FY 1989 through FY 1995. The plan establishes a Department of Energy -- Headquarters (DOE-HQ) agenda for cleanup and compliance against which overall progress can be measured. The FYP covers three areas: Corrective Activities, Environmental Restoration, and Waste Management Operations. Corrective Activities are those activities necessary to bring active or standby facilities into compliance with local, state, and federal environmental regulations. Environmental restoration activities include the assessment and cleanup of surplus facilities and inactive waste sites. Waste management operations includes the treatment, storage, and disposal of wastes which are generated as a result of ongoing operations. This Site Specific Plan (SSP) has been prepared by the Savannah River Site (SRS) in order to show how environmental restoration and waste management activities that were identified during the preparation of the FYP will be implemented, tracked, and reported. The SSP describes DOE Savannah River (DOE-SR) and operating contractor, Westinghouse Savannah River Company (WSRC), organizations that are responsible, for undertaking the activities identified in this plan. The SSP has been prepared in accordance with guidance received from DOE-HQ. DOE-SR is accountable to DOE-HQ for the implementation of this plan. 8 refs., 46 figs., 23 tabs

Chromosomal islands of Streptococcus pyogenes and related streptococci: molecular switches for survival and virulence.

Science.gov (United States)

Nguyen, Scott V; McShan, William M

2014-01-01

Streptococcus pyogenes is a significant pathogen of humans, annually causing over 700,000,000 infections and 500,000 deaths. Virulence in S. pyogenes is closely linked to mobile genetic elements like phages and chromosomal islands (CI). S. pyogenes phage-like chromosomal islands (SpyCI) confer a complex mutator phenotype on their host. SpyCI integrate into the 5' end of DNA mismatch repair (MMR) gene mutL, which also disrupts downstream operon genes lmrP, ruvA, and tag. During early logarithmic growth, SpyCI excise from the bacterial chromosome and replicate as episomes, relieving the mutator phenotype. As growth slows and the cells enter stationary phase, SpyCI reintegrate into the chromosome, again silencing the MMR operon. This system creates a unique growth-dependent and reversible mutator phenotype. Additional CI using the identical attachment site in mutL have been identified in related species, including Streptococcus dysgalactiae subsp. equisimilis, Streptococcus anginosus, Streptococcus intermedius, Streptococcus parauberis, and Streptococcus canis. These CI have small genomes, which range from 13 to 20 kB, conserved integrase and DNA replication genes, and no identifiable genes encoding capsid proteins. SpyCI may employ a helper phage for packaging and dissemination in a fashion similar to the Staphylococcus aureus pathogenicity islands (SaPI). Outside of the core replication and integration genes, SpyCI and related CI show considerable diversity with the presence of many indels that may contribute to the host cell phenotype or fitness. SpyCI are a subset of a larger family of streptococcal CI who potentially regulate the expression of other host genes. The biological and phylogenetic analysis of streptococcal chromosomal islands provides important clues as to how these chromosomal islands help S. pyogenes and other streptococcal species persist in human populations in spite of antibiotic therapy and immune challenges.

A method for producing transgenic cells using a multi-integrase system on a human artificial chromosome vector.

Directory of Open Access Journals (Sweden)

Shigeyuki Yamaguchi

Full Text Available The production of cells capable of expressing gene(s of interest is important for a variety of applications in biomedicine and biotechnology, including gene therapy and animal transgenesis. The ability to insert transgenes at a precise location in the genome, using site-specific recombinases such as Cre, FLP, and ΦC31, has major benefits for the efficiency of transgenesis. Recent work on integrases from ΦC31, R4, TP901-1 and Bxb1 phages demonstrated that these recombinases catalyze site-specific recombination in mammalian cells. In the present study, we examined the activities of integrases on site-specific recombination and gene expression in mammalian cells. We designed a human artificial chromosome (HAC vector containing five recombination sites (ΦC31 attP, R4 attP, TP901-1 attP, Bxb1 attP and FRT; multi-integrase HAC vector and de novo mammalian codon-optimized integrases. The multi-integrase HAC vector has several functions, including gene integration in a precise locus and avoiding genomic position effects; therefore, it was used as a platform to investigate integrase activities. Integrases carried out site-specific recombination at frequencies ranging from 39.3-96.8%. Additionally, we observed homogenous gene expression in 77.3-87.5% of colonies obtained using the multi-integrase HAC vector. This vector is also transferable to another cell line, and is capable of accepting genes of interest in this environment. These data suggest that integrases have high DNA recombination efficiencies in mammalian cells. The multi-integrase HAC vector enables us to produce transgene-expressing cells efficiently and create platform cell lines for gene expression.

CERCLA integration with site operations the Fernald experience

International Nuclear Information System (INIS)

Coyle, S.W.; Shirley, R.S.; Varchol, B.D.

1991-01-01

A major transition in the Fernald Environmental Management Project (FEMP) site mission has occurred over the past few years. The production capabilities formally provided by the FEMP are being transferred to private industry through a vendor qualification program. Environmental compliance and site cleanup are now the primary focus. In line with this program, the production of uranium products at the site was suspended in July 1989 in order to concentrate resources on the environmental mission. Formal termination of the FEMP production mission was accomplished on June 19, 1991. Environmental issues such as stored inventories of process residues materials and equipment are being addressed under the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA). The diversity of these hazards complicates the strategic planning for an integrated site cleanup program. The FEMP is one of the first Department of Energy (DOE) facilities to transition from an active production mission guided by Defense Programs (DP) to an environmental mission guided by Environmental Management (EM) under Leo Duffy. Westinghouse Environmental Management Company of Ohio (WEMCO) has been charged with integrating all site activities to carry out the cleanup. A new management structure has been formulated, and an integration approach initiated. Analyses are under way to evaluate all site activities such as waste management, safe shutdown, product material disposition and routine environmental monitoring in view of CERCLA requirements. Site activities are being broken down into three categories: (a) CERCLA driven - restoration work required under CERCLA, (b) CERCLA covered - other environmental requirements which must be integrated with CERCLA, and (c) CERCLA exempt (if any). The approach to comply with these categorized activities must be negotiated with state and federal regulatory agencies

Drug delivery systems--2. Site-specific drug delivery utilizing monoclonal antibodies.

Science.gov (United States)

Ranade, V V

1989-10-01

Monoclonal antibodies (MAbs) are purified antibodies produced by a single clone of cells. They are engineered to recognize and bind to a single specific antigen. Accordingly, when administered, MAbs home in on a particular circulating protein or on cells that bear the correct antigenic signature on their surfaces. It is the specificity of MAbs that has made them valuable tools for health professions. Following the discovery of Kohler and Milstein regarding the method of somatic cell hybridization, a number of investigators have successfully adopted this technique to obtain T-lymphocyte hybrid cell lines by fusion of activated T (thymus derived) lymphocytes with a T lymphoma cell line leading to an immortalization of a specific differentiated function. The hybrids thus obtained were subsequently shown to produce homogeneous effector molecules with a wide variety of immune functions such as enhancement or suppression of antibody responses, generation of helper T cells, suppressor T cells and cytotoxic T cells. Study of these regulatory molecules has been further shown to provide a greater insight into the genetic, biochemical and molecular mechanisms responsible for cellular development, and the interaction and triggering of various cell types. The successful application of hybridoma technology has now resulted into several advances in the understanding the mechanism and treatment of diseases, especially cancer and development of vaccines, promotion of organ transplantation and therapy against parasites as well. Since monoclonal antibodies could be made in unlimited supply, they have been used in genetic studies such as mRNA and gene isolation, chromosomal isolation of specific genes, immunoglobulin structure, detection of new or rare immunoglobulin gene products, structural studies of enzymes and other proteins and structural and population studies of protein polymorphisms. In some instances, the monoclonal antibodies have been found to replace conventional antisera

Genome Organization Drives Chromosome Fragility.

Science.gov (United States)

Canela, Andres; Maman, Yaakov; Jung, Seolkyoung; Wong, Nancy; Callen, Elsa; Day, Amanda; Kieffer-Kwon, Kyong-Rim; Pekowska, Aleksandra; Zhang, Hongliang; Rao, Suhas S P; Huang, Su-Chen; Mckinnon, Peter J; Aplan, Peter D; Pommier, Yves; Aiden, Erez Lieberman; Casellas, Rafael; Nussenzweig, André

2017-07-27

In this study, we show that evolutionarily conserved chromosome loop anchors bound by CCCTC-binding factor (CTCF) and cohesin are vulnerable to DNA double strand breaks (DSBs) mediated by topoisomerase 2B (TOP2B). Polymorphisms in the genome that redistribute CTCF/cohesin occupancy rewire DNA cleavage sites to novel loop anchors. While transcription- and replication-coupled genomic rearrangements have been well documented, we demonstrate that DSBs formed at loop anchors are largely transcription-, replication-, and cell-type-independent. DSBs are continuously formed throughout interphase, are enriched on both sides of strong topological domain borders, and frequently occur at breakpoint clusters commonly translocated in cancer. Thus, loop anchors serve as fragile sites that generate DSBs and chromosomal rearrangements. VIDEO ABSTRACT. Published by Elsevier Inc.

Chromosomal localization of the human diazepam binding inhibitor gene

International Nuclear Information System (INIS)

DeBernardi, M.A.; Crowe, R.R.; Mocchetti, I.; Shows, T.B.; Eddy, R.L.; Costa, E.

1988-01-01

The authors have used in situ chromosome hybridization and human-mouse somatic cell hybrids to map the gene(s) for human diazepam binding inhibitor (DBI), an endogenous putative modulator of the γ-aminobutyric acid receptor acting at the allosteric regulatory center of this receptor that includes the benzodiazepine recognition site. In 784 chromosome spreads hybridized with human DBI cDNA, the distribution of 1,476 labeled sites revealed a significant clustering of autoradiographic grains (11.3% of total label) on the long arm of chromosome 2 (2q). Furthermore, 63.5% of the grains found on 2q were located on 2q12-21, suggesting regional mapping of DBI gene(s) to this segment. Secondary hybridization signals were frequently observed on other chromosomes and they were statistically significant mainly for chromosomes 5, 6, 11, and 14. In addition, DNA from 32 human-mouse cell hybrids was digested with BamHI and probed with human DBI cDNA. A 3.5-kilobase band, which probably represents the human DBI gene, was assigned to chromosome 2. Four higher molecular weight bands, also detected in BamHI digests, could not be unequivocally assigned. A chromosome 2 location was excluded for the 27-, 13-, and 10-kilobase bands. These results assign a human DBI gene to chromosome 2 (2q12-21) and indicate that three of the four homologous sequences detected by the human DBI probe are located on three other chromosomes

Hepatitis B virus DNA integration in hepatocellular carcinoma after interferon-induced disappearance of hepatitis C virus.

Science.gov (United States)

Tamori, Akihiro; Nishiguchi, Shuhei; Shiomi, Susumu; Hayashi, Takehiro; Kobayashi, Sawako; Habu, Daiki; Takeda, Tadashi; Seki, Shuichi; Hirohashi, Kazuhiro; Tanaka, Hiromu; Kubo, Shoji

2005-08-01

Hepatocellular carcinoma (HCC) has been reported in patients in whom hepatitis C virus (HCV) was eliminated by interferon (IFN) therapy. We examined the pathogenesis of HCC in patients with sustained viral response. Operable HCC developed in 7 of 342 patients cured of HCV infection by IFN monotherapy. No patient abused alcohol or had diabetes mellitus or obesity. Resected specimens of HCC were histologically evaluated. DNA extracted from HCC was examined by polymerase chain reaction (PCR) to locate hepatitis B virus (HBV) DNA. HBV integration sites in human genome were identified by cassette-ligation-mediated PCR. HBV DNA was not amplified in serum samples from any of the seven patients with HCC and was found in liver in four patients. In the latter four patients, HBV DNA was integrated into the human genome of HCC. In two of these patients, covalently closed circular HBV (cccHBV) was also detected. The patients with HBV DNA integration were free of HCV for more than 3 yr. In two of the three patients without HBV DNA integration, the surrounding liver showed cirrhosis. The liver of HCC with HBV DNA integration had not progressed to cirrhosis. Three of the four tumors with HBV integration had one integration site each, located at chromosomes 11q12, 11q22-23, and 22q11, respectively. The other tumor had two integration sites, situated at chromosomes 11q13 and 14q32. At chromosome 11q12, HBV DNA was integrated into protein-coding genome, the function of which remains unclear. Integrated HBV DNA may play a role in hepatocarcinogenesis after the clearance of HCV by IFN treatment.

X- and Y-chromosome specific variants of the amelogenin gene allow sex determination in sheep (Ovis aries and European red deer (Cervus elaphus

Directory of Open Access Journals (Sweden)

Brenig B

2005-03-01

Full Text Available Abstract Background Simple and precise methods for sex determination in animals are a pre-requisite for a number of applications in animal production and forensics. However, some of the existing methods depend only on the detection of Y-chromosome specific sequences. Therefore, the abscence of a signal does not necessarily mean that the sample is of female origin, because experimental errors can also lead to negative results. Thus, the detection of Y- and X-chromosome specific sequences is advantageous. Results A novel method for sex identification in mammals (sheep, Ovis aries and European red deer, Cervus elaphus is described, using a polymerase chain reaction (PCR and sequencing of a part of the amelogenin gene. A partial sequence of the amelogenin gene of sheep and red deer was obtained, which exists on both X and Y chromosomes with a deletion region on the Y chromosome. With a specific pair of primers a DNA fragment of different length between the male and female mammal was amplified. Conclusion PCR amplification using the amelogenin gene primers is useful in sex identification of samples from sheep and red deer and can be applied to DNA analysis of micro samples with small amounts of DNA such as hair roots as well as bones or embryo biopsies.

Linkage group-chromosome correlations in Sordaria macrospora: Chromosome identification by three dimensional reconstruction of their synaptonemal complex.

Science.gov (United States)

Zickler, D; Leblon, G; Haedens, V; Collard, A; Thuriaux, P

1984-01-01

Reconstruction of serially sectioned zygotene and pachytene nuclei has allowed, by measuring the lengths of synaptonemal complexes, an assignment of the 7 linkage (LG) groups to the 7 chromosomes in the fungus Sordaria macrospora. The 7 LG have been established using 19 mutants showing low second division segregation frequencies. Eight chromosomal rearrangements mapped on the 7 LG were used to identify the chromosomes involved. The following one to one assignment of the 7 LG to specific chromosomes was obtained: LG a: chromosome (chr) 1, LG b: chr5, LG c: chr6, LG d: chr7, LG e: chr4, LG f: chr3 and LG g: chr2 (the chromosome carrying the nucleolus organizer region).

Comparative Hi-C Reveals that CTCF Underlies Evolution of Chromosomal Domain Architecture

Directory of Open Access Journals (Sweden)

Matteo Vietri Rudan

2015-03-01

Full Text Available Topological domains are key architectural building blocks of chromosomes, but their functional importance and evolutionary dynamics are not well defined. We performed comparative high-throughput chromosome conformation capture (Hi-C in four mammals and characterized the conservation and divergence of chromosomal contact insulation and the resulting domain architectures within distantly related genomes. We show that the modular organization of chromosomes is robustly conserved in syntenic regions and that this is compatible with conservation of the binding landscape of the insulator protein CTCF. Specifically, conserved CTCF sites are co-localized with cohesin, are enriched at strong topological domain borders, and bind to DNA motifs with orientations that define the directionality of CTCF’s long-range interactions. Conversely, divergent CTCF binding between species is correlated with divergence of internal domain structure, likely driven by local CTCF binding sequence changes, demonstrating how genome evolution can be linked to a continuous flux of local conformation changes. We also show that large-scale domains are reorganized during genome evolution as intact modules.

Chromosomes, cancer and radiosensitivity

International Nuclear Information System (INIS)

Samouhos, E.

1983-01-01

Some specific chromosomal abnormalities are associated with certain cancers. The earliest description of such a specific association is the one of the Philadelphia chromosome and myelogenous leukemia (1960). Other congenital karyotype abnormalities are associated with specific cancers. Examples of these are Down's syndrome with leukemia and Klinefelter's syndrome with male breast cancer. Genetic diseases of increased chromosome breakage, or of defective chromosome repair, are associated with greatly increased cancer incidence. Three such diseases have been recognized: 1) Fanconi's anemia, associated with leukemias and lymphomas, 2) Bloom's syndrome, associated with acute leukemias and lymphosarcoma, and 3) ataxia telangiectasia, associated with Hodgkin's disease, leukemia, and lymphosarcomas. Ten percent of individuals with ataxia telangiectasia will develop one of these neoplasms. Individuals with certain of these syndromes display an unusually high radiosensitivity. Radiation therapy for cancers has been fatal in patients who received as low as 3000 rad. This remarkable radiosensitivity has been quantitated in cell cultures from such cases. Evidence suggests that the apparent sensitivity may reflect subnormal ability to repair radiation damage. The rapid proliferation of information in this field stems from the interdigitation of many disciplines and specialties, including cytogenetics, cell biology, molecular biology, epidemiology, radiobiology, and several others. This paper is intended for clinicians; it presents a structured analytic scheme for correlating and classifying this multidisciplinary information as it becomes available

The Site Approach - Lessons Learned from the Integrated Safeguards Approach for JNC-1

International Nuclear Information System (INIS)

Kikuchi, M.; Iso, S.; Tomine, K.; Hirato, Y.; Namekawa, M.; Takasugi, N.; Watanabe, M.; Tsutaki, Y.; Asano, T.; Nagatani, T.; Ninagawa, J.; Fujiwara, S.; Takahashi, S.; Kimura, T.; Kodani, Y.; Fukuhara, J.; Miyaji, N.; Kawakami, Y.; Koizumi, A.; Yamazaki, Y.; Nishinosono, S.; Sasaki, K.

2010-01-01

Integrated safeguards approaches for specific sites are recognized important elements in the design of a State-level approach under the concept of grouping facilities. Japan and the IAEA agreed further improvement of integrated safeguards implementation in effective and efficient manner, particularly at large complex nuclear sites in Japan. Japan and the IAEA developed the integrated safeguards approach for specific sites defined at Article 18 of Additional Protocol. In 2008, the IAEA started the three-year test implementation of JNC-1 site approach for improving the effectiveness and efficiency of the safeguards implementation of UDU material handling facilities. Japan and IAEA agreed to adopt the sector concept in order to make clear of subjected nuclear material to be verified. The sector is defined as spatial assignment that treats the same material stratum beyond MBAs in the site. The arrangement of MBAs and related material balance calculations as well as statistical analysis is maintained as a fundamental safeguards measure. At the boundaries of each sector, appropriate unattended NDA system and/or C/S system are installed, and material flows across the boundaries are verified by the system or attendance of resident inspectors. For inventory verification of the nuclear material stayed in sectors, an appropriate numbers of randomly scheduled inspections will be implemented. IAEA can access to the randomly selected sectors within 2 hours after notification. NRTA based on frequent operator's declaration will be performed for achievement of timeliness detection goal. The JNC-1 site approach has been implemented under the enhanced co-operation between the IAEA and SSAC through joint use of equipment and arrangements for DA analysis. Especially, national inspectors are working with IAEA together for coordination with operators. Because NMCC lab analyses all DA samples taken from facilities and the analysis results will be shared by the IAEA, certain numbers of DA

Innovation and Diffusion of Site-specific Crop Management

DEFF Research Database (Denmark)

Pedersen, Søren Marcus; Pedersen, Jørgen Lindgaard

2006-01-01

Site-specific crop management or precision farming is a highly complex managementsystem for site-specific input application of lime, fertilizers and pesticides in arable farming. The Global Positioning System (GPS)is the backbone of the system. To conduct precision farming several technical systems...

A specific insertion of a solo-LTR characterizes the Y-chromosome of Bryonia dioica (Cucurbitaceae).

Science.gov (United States)

Oyama, Ryan K; Silber, Martina V; Renner, Susanne S

2010-06-14

Relatively few species of flowering plants are dioecious and even fewer are known to have sex chromosomes. Current theory posits that homomorphic sex chromosomes, such as found in Bryonia dioica (Cucurbitaceae), offer insight into the early stages in the evolution of sex chromosomes from autosomes. Little is known about these early steps, but an accumulation of transposable element sequences has been observed on the Y-chromosomes of some species with heteromorphic sex chromosomes. Recombination, by which transposable elements are removed, is suppressed on at least part of the emerging Y-chromosome, and this may explain the correlation between the emergence of sex chromosomes and transposable element enrichment. We sequenced 2321 bp of the Y-chromosome in Bryonia dioica that flank a male-linked marker, BdY1, reported previously. Within this region, which should be suppressed for recombination, we observed a solo-LTR nested in a Copia-like transposable element. We also found other, presumably paralogous, solo-LTRs in a consensus sequence of the underlying Copia-like transposable element. Given that solo-LTRs arise via recombination events, it is noteworthy that we find one in a genomic region where recombination should be suppressed. Although the solo-LTR could have arisen before recombination was suppressed, creating the male-linked marker BdY1, our previous study on B. dioica suggested that BdY1 may not lie in the recombination-suppressed region of the Y-chromosome in all populations. Presence of a solo-LTR near BdY1 therefore fits with the observed correlation between retrotransposon accumulation and the suppression of recombination early in the evolution of sex chromosomes. These findings further suggest that the homomorphic sex chromosomes of B. dioica, the first organism for which genetic XY sex-determination was inferred, are evolutionarily young and offer reference information for comparative studies of other plant sex chromosomes.

Comparative physical mapping between wheat chromosome arm 2BL and rice chromosome 4.

Science.gov (United States)

Lee, Tong Geon; Lee, Yong Jin; Kim, Dae Yeon; Seo, Yong Weon

2010-12-01

Physical maps of chromosomes provide a framework for organizing and integrating diverse genetic information. DNA microarrays are a valuable technique for physical mapping and can also be used to facilitate the discovery of single feature polymorphisms (SFPs). Wheat chromosome arm 2BL was physically mapped using a Wheat Genome Array onto near-isogenic lines (NILs) with the aid of wheat-rice synteny and mapped wheat EST information. Using high variance probe set (HVP) analysis, 314 HVPs constituting genes present on 2BL were identified. The 314 HVPs were grouped into 3 categories: HVPs that match only rice chromosome 4 (298 HVPs), those that match only wheat ESTs mapped on 2BL (1), and those that match both rice chromosome 4 and wheat ESTs mapped on 2BL (15). All HVPs were converted into gene sets, which represented either unique rice gene models or mapped wheat ESTs that matched identified HVPs. Comparative physical maps were constructed for 16 wheat gene sets and 271 rice gene sets. Of the 271 rice gene sets, 257 were mapped to the 18-35 Mb regions on rice chromosome 4. Based on HVP analysis and sequence similarity between the gene models in the rice chromosomes and mapped wheat ESTs, the outermost rice gene model that limits the translocation breakpoint to orthologous regions was identified.

The Bacillus anthracis chromosome contains four conserved, excision-proficient, putative prophages

Directory of Open Access Journals (Sweden)

Sozhamannan Shanmuga

2006-04-01

Full Text Available Abstract Background Bacillus anthracis is considered to be a recently emerged clone within the Bacillus cereus sensu lato group. The B. anthracis genome sequence contains four putative lambdoid prophages. We undertook this study in order to understand whether the four prophages are unique to B. anthracis and whether they produce active phages. Results More than 300 geographically and temporally divergent isolates of B. anthracis and its near neighbors were screened by PCR for the presence of specific DNA sequences from each prophage region. Every isolate of B. anthracis screened by PCR was found to produce all four phage-specific amplicons whereas none of the non-B. anthracis isolates, produced more than one phage-specific amplicon. Excision of prophages could be detected by a PCR based assay for attP sites on extra-chromosomal phage circles and for attB sites on phage-excised chromosomes. SYBR-green real-time PCR assays indicated that prophage excision occurs at very low frequencies (2 × 10-5 - 8 × 10-8/cell. Induction with mitomycin C increased the frequency of excision of one of the prophages by approximately 250 fold. All four prophages appear to be defective since, mitomycin C induced culture did not release any viable phage particle or lyse the cells or reveal any phage particle under electron microscopic examination. Conclusion The retention of all four putative prophage regions across all tested strains of B. anthracis is further evidence of the very recent emergence of this lineage and the prophage regions may be useful for differentiating the B. anthracis chromosome from that of its neighbors. All four prophages can excise at low frequencies, but are apparently defective in phage production.

53BP1 nuclear bodies form around DNA lesions generated by mitotic transmission of chromosomes under replication stress

DEFF Research Database (Denmark)

Lukas, Claudia; Savic, Velibor; Bekker-Jensen, Simon

2011-01-01

stress increases the frequency of chromosomal lesions that are transmitted to daughter cells. Throughout G1, these lesions are sequestered in nuclear compartments marked by p53-binding protein 1 (53BP1) and other chromatin-associated genome caretakers. We show that the number of such 53BP1 nuclear bodies...... increases after genetic ablation of BLM, a DNA helicase associated with dissolution of entangled DNA. Conversely, 53BP1 nuclear bodies are partially suppressed by knocking down SMC2, a condensin subunit required for mechanical stability of mitotic chromosomes. Finally, we provide evidence that 53BP1 nuclear...... bodies shield chromosomal fragile sites sequestered in these compartments against erosion. Together, these data indicate that restoration of DNA or chromatin integrity at loci prone to replication problems requires mitotic transmission to the next cell generations....

Innovation and diffusion of site-specific crop management

DEFF Research Database (Denmark)

Pedersen, Søren Marcus; Pedersen, Jørgen Lindgaard

2004-01-01

Site-specific crop management or precision farming (PF) is a highly complex management system for site-specific input application of lime, fertilizers and pesticides in arable farming. The Global Positioning System (GPS) is the backbone of the system. To conduct PF several technical systems...

Evaluating Variability and Uncertainty of Geological Strength Index at a Specific Site

Science.gov (United States)

Wang, Yu; Aladejare, Adeyemi Emman

2016-09-01

Geological Strength Index (GSI) is an important parameter for estimating rock mass properties. GSI can be estimated from quantitative GSI chart, as an alternative to the direct observational method which requires vast geological experience of rock. GSI chart was developed from past observations and engineering experience, with either empiricism or some theoretical simplifications. The GSI chart thereby contains model uncertainty which arises from its development. The presence of such model uncertainty affects the GSI estimated from GSI chart at a specific site; it is, therefore, imperative to quantify and incorporate the model uncertainty during GSI estimation from the GSI chart. A major challenge for quantifying the GSI chart model uncertainty is a lack of the original datasets that have been used to develop the GSI chart, since the GSI chart was developed from past experience without referring to specific datasets. This paper intends to tackle this problem by developing a Bayesian approach for quantifying the model uncertainty in GSI chart when using it to estimate GSI at a specific site. The model uncertainty in the GSI chart and the inherent spatial variability in GSI are modeled explicitly in the Bayesian approach. The Bayesian approach generates equivalent samples of GSI from the integrated knowledge of GSI chart, prior knowledge and observation data available from site investigation. Equations are derived for the Bayesian approach, and the proposed approach is illustrated using data from a drill and blast tunnel project. The proposed approach effectively tackles the problem of how to quantify the model uncertainty that arises from using GSI chart for characterization of site-specific GSI in a transparent manner.

PROSPER: an integrated feature-based tool for predicting protease substrate cleavage sites.

Directory of Open Access Journals (Sweden)

Jiangning Song

Full Text Available The ability to catalytically cleave protein substrates after synthesis is fundamental for all forms of life. Accordingly, site-specific proteolysis is one of the most important post-translational modifications. The key to understanding the physiological role of a protease is to identify its natural substrate(s. Knowledge of the substrate specificity of a protease can dramatically improve our ability to predict its target protein substrates, but this information must be utilized in an effective manner in order to efficiently identify protein substrates by in silico approaches. To address this problem, we present PROSPER, an integrated feature-based server for in silico identification of protease substrates and their cleavage sites for twenty-four different proteases. PROSPER utilizes established specificity information for these proteases (derived from the MEROPS database with a machine learning approach to predict protease cleavage sites by using different, but complementary sequence and structure characteristics. Features used by PROSPER include local amino acid sequence profile, predicted secondary structure, solvent accessibility and predicted native disorder. Thus, for proteases with known amino acid specificity, PROSPER provides a convenient, pre-prepared tool for use in identifying protein substrates for the enzymes. Systematic prediction analysis for the twenty-four proteases thus far included in the database revealed that the features we have included in the tool strongly improve performance in terms of cleavage site prediction, as evidenced by their contribution to performance improvement in terms of identifying known cleavage sites in substrates for these enzymes. In comparison with two state-of-the-art prediction tools, PoPS and SitePrediction, PROSPER achieves greater accuracy and coverage. To our knowledge, PROSPER is the first comprehensive server capable of predicting cleavage sites of multiple proteases within a single substrate

A high-resolution physical map integrating an anchored chromosome with the BAC physical maps of wheat chromosome 6B

Czech Academy of Sciences Publication Activity Database

Kobayashi, F.; Wu, J.Z.; Kanamori, H.; Tanaka, T.; Katagiri, S.; Karasawa, W.; Kaneko, S.; Watanabe, S.; Sakaguchi, T.; Šafář, Jan; Šimková, Hana; Mukai, Y.; Hamada, M.; Saito, M.; Hayakawa, K.; Doležel, Jaroslav; Nasuda, S.; Matsumoto, T.; Handa, H.

2015-01-01

Roč. 16, AUG 12 (2015), s. 595 ISSN 1471-2164 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Centromere * Chromosomal rearrangement * Chromosome 6B Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.867, year: 2015

Site-Specific Infrared Probes of Proteins

Science.gov (United States)

Ma, Jianqiang; Pazos, Ileana M.; Zhang, Wenkai; Culik, Robert M.; Gai, Feng

2015-01-01

Infrared spectroscopy has played an instrumental role in studying a wide variety of biological questions. However, in many cases it is impossible or difficult to rely on the intrinsic vibrational modes of biological molecules of interest, such as proteins, to reveal structural and/or environmental information in a site-specific manner. To overcome this limitation, many recent efforts have been dedicated to the development and application of various extrinsic vibrational probes that can be incorporated into biological molecules and used to site-specifically interrogate their structural and/or environmental properties. In this Review, we highlight some recent advancements of this rapidly growing research area. PMID:25580624

Meiotic recombination analyses of individual chromosomes in male domestic pigs (Sus scrofa domestica.

Directory of Open Access Journals (Sweden)

Nicolas Mary

Full Text Available For the first time in the domestic pig, meiotic recombination along the 18 porcine autosomes was directly studied by immunolocalization of MLH1 protein. In total, 7,848 synaptonemal complexes from 436 spermatocytes were analyzed, and 13,969 recombination sites were mapped. Individual chromosomes for 113 of the 436 cells (representing 2,034 synaptonemal complexes were identified by immunostaining and fluorescence in situ hybridization (FISH. The average total length of autosomal synaptonemal complexes per cell was 190.3 µm, with 32.0 recombination sites (crossovers, on average, per cell. The number of crossovers and the lengths of the autosomal synaptonemal complexes showed significant intra- (i.e. between cells and inter-individual variations. The distributions of recombination sites within each chromosomal category were similar: crossovers in metacentric and submetacentric chromosomes were concentrated in the telomeric regions of the p- and q-arms, whereas two hotspots were located near the centromere and in the telomeric region of acrocentrics. Lack of MLH1 foci was mainly observed in the smaller chromosomes, particularly chromosome 18 (SSC18 and the sex chromosomes. All autosomes displayed positive interference, with a large variability between the chromosomes.

Radiation-induced genomic instability driven by de novo chromosomal rearrangement hot spots

International Nuclear Information System (INIS)

Grosovsky, A.J.; Allen, R.N.; Moore, S.R.

2003-01-01

Genomic instability has become generally recognized as a critical contributor to tumor progression by generating the necessary number of genetic alterations required for expression of a clinically significant malignancy. Our study of chromosomal instability investigates the hypothesis that chromosomal rearrangements can generate novel breakage-prone sites, resulting in instability acting predominantly in cis. Here we present an analysis of the karyotypic distribution of instability associated chromosomal rearrangements in TK6 and derivative human lymphoblasts. Karyotypic analysis performed on a total of 455 independent clones included 183 rearrangements distributed among 100 separate unstable clones. The results demonstrate that the breakpoints of chromosomal rearrangements in unstable clones are non-randomly distributed throughout the genome. This pattern is statistically significant, and incompatible with expectations for random breakage associated with loss or alteration of a trans-acting factor. Furthermore, specific chromosomal breakage hot spots associated with instability have been identified; these occur in several independent unstable clones and are often repeatedly broken and rejoined during the outgrowth of an individual clone. In complimentary studies, genomic instability was generated without any exposure to a DNA-damaging agent, but rather by transfection with alpha heterochromatin DNA. In a prospective analysis, human-hamster hybrid AL cells containing a single human chromosome 11 were transfected with heterochromatic alpha DNA repeats and clones were analyzed by chromosome 11 painting. Transfection with alpha DNA was associated with karyotypic heterogeneity in 40% of clones examined; control transfections with plasmid alone did not lead to karyotypic heterogeneity

Development of a quantitative pachytene chromosome map and its unification with somatic chromosome and linkage maps of rice (Oryza sativa L.).

Science.gov (United States)

Ohmido, Nobuko; Iwata, Aiko; Kato, Seiji; Wako, Toshiyuki; Fukui, Kiichi

2018-01-01

A quantitative pachytene chromosome map of rice (Oryza sativa L.) was developed using imaging methods. The map depicts not only distribution patterns of chromomeres specific to pachytene chromosomes, but also the higher order information of chromosomal structures, such as heterochromatin (condensed regions), euchromatin (decondensed regions), the primary constrictions (centromeres), and the secondary constriction (nucleolar organizing regions, NOR). These features were image analyzed and quantitatively mapped onto the map by Chromosome Image Analyzing System ver. 4.0 (CHIAS IV). Correlation between H3K9me2, an epigenetic marker and formation and/or maintenance of heterochromatin, thus was, clearly visualized. Then the pachytene chromosome map was unified with the existing somatic chromosome and linkage maps by physically mapping common DNA markers among them, such as a rice A genome specific tandem repeat sequence (TrsA), 5S and 45S ribosomal RNA genes, five bacterial artificial chromosome (BAC) clones, four P1 bacteriophage artificial chromosome (PAC) clones using multicolor fluorescence in situ hybridization (FISH). Detailed comparison between the locations of the DNA probes on the pachytene chromosomes using multicolor FISH, and the linkage map enabled determination of the chromosome number and short/long arms of individual pachytene chromosomes using the chromosome number and arm assignment designated for the linkage map. As a result, the quantitative pachytene chromosome map was unified with two other major rice chromosome maps representing somatic prometaphase chromosomes and genetic linkages. In conclusion, the unification of the three rice maps serves as an indispensable basic information, not only for an in-depth comparison between genetic and chromosomal data, but also for practical breeding programs.

Role of the diet in ontogenesis and induction of chromosomal aberrations in population living in the area exposed to radioactive contamination

International Nuclear Information System (INIS)

Ilyinskikh, N.N.; Ilyinskikh, I.N.; Ilyinskikh, E.N.; Semenov, A.G.; Kozlova, S.B.

2005-01-01

The objective of this work is to investigate a role of diet in oncogenesis and induction of chromosomal aberrations in fragility sites in the peripheral blood lymphocytes of people in some areas exposed to radionuclides as a result of an accident in the Siberian Chemical Combine (SCP). The purpose of the present study was to investigate the level of aberrations at fragile sites of chromosomes in peripheral blood lymphocytes of population residing area contaminated with radionuclides following an accident at the Siberian Chemical Plant (SCP). We carried out micronucleus test to screen people with radiation-related cytogenetic effects. Of 1246 examined inhabitants of Samus settlement, 148 showed significantly increased frequency of micronucleated erythrocytes and were selected for chromosome analysis as a radiation-exposed group. Additional analysis was carried out for 40 patients with gastric cancer and atrophic gastritis with stage II-III epithelial dysplasia. Eighty six individuals from non-contaminated area were used as a control group. Chromosomal breaks and exchanges occurred preferentially in chromosomes 3 and 6 among radiation-exposed persons and patients. The regions 3pl4-3p25 and 6p23 were damaged most often. There was a tendency towards preferential involvement at q21-q25 of chromosome 6 in patients with gastric cancer and atrophic gastritis. Specific damage at certain chromosome sites was observed in radiation-exposed population as well as in patients with gastric cancer. Most often this damage was located near oncogene loci which could imply that chromosome damage induced by radiation is likely to be a predisposing factor to the expression of oncogenes and malignant transformation of cells in exposed individuals. (author)

Chromosome-Centric Human Proteome Project Allies with Developmental Biology: A Case Study of the Role of Y Chromosome Genes in Organ Development.

Science.gov (United States)

Meyfour, Anna; Pooyan, Paria; Pahlavan, Sara; Rezaei-Tavirani, Mostafa; Gourabi, Hamid; Baharvand, Hossein; Salekdeh, Ghasem Hosseini

2017-12-01

One of the main goals of Chromosome-Centric Human Proteome Project is to identify protein evidence for missing proteins (MPs). Here, we present a case study of the role of Y chromosome genes in organ development and how to overcome the challenges facing MPs identification by employing human pluripotent stem cell differentiation into cells of different organs yielding unprecedented biological insight into adult silenced proteins. Y chromosome is a male-specific sex chromosome which escapes meiotic recombination. From an evolutionary perspective, Y chromosome has preserved 3% of ancestral genes compared to 98% preservation of the X chromosome based on Ohno's law. Male specific region of Y chromosome (MSY) contains genes that contribute to central dogma and govern the expression of various targets throughout the genome. One of the most well-known functions of MSY genes is to decide the male-specific characteristics including sex, testis formation, and spermatogenesis, which are majorly formed by ampliconic gene families. Beyond its role in sex-specific gonad development, MSY genes in coexpression with their X counterparts, as single copy and broadly expressed genes, inhibit haplolethality and play a key role in embryogenesis. The role of X-Y related gene mutations in the development of hereditary syndromes suggests an essential contribution of sex chromosome genes to development. MSY genes, solely and independent of their X counterparts and/or in association with sex hormones, have a considerable impact on organ development. In this Review, we present major recent findings on the contribution of MSY genes to gonad formation, spermatogenesis, and the brain, heart, and kidney development and discuss how Y chromosome proteome project may exploit developmental biology to find missing proteins.

Termini of human chromosomes display elevated rates of mitotic recombination.

Science.gov (United States)

Cornforth, M N; Eberle, R L

2001-01-01

The strand-specific in situ hybridization technique of CO-FISH was used to probe telomeres of human mitotic cells in order to determine the spontaneous frequency of crossover. This approach allowed the detection of recombinational crossovers occurring anywhere along the length of individual chromosomes, including reciprocal events taking place between sister chromatids. Although the process of sister chromatid exchange (SCE) is the most prominent type of recombination in somatic mammalian cells, our results show that SCEs accounted for less than a third of the recombinational events revealed by CO-FISH. It is concluded that chromosomal regions near the termini of chromosome arms undergo extraordinarily high rates of spontaneous recombination, producing terminal crossovers whose small size precludes detection by standard cytogenetic methods. That similar results were observed for transformed epithelial cells, as well as primary fibroblasts, suggests that the phenomenon is a common characteristic of human cells. These findings are noteworthy because, although telomeric and subtelomeric DNA is known to be preferentially involved in certain types of recombination, the tips of somatic mammalian chromosomes have not previously been identified as preferred sites for crossover. Implications of these results are discussed in terms of limitations imposed on CO-FISH for its proposed use in directional hybridization mapping.

Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

International Nuclear Information System (INIS)

Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira; Kamihira, Masamichi

2012-01-01

Highlights: ► Adeno-associated virus (AAV) is capable of targeted integration in human cells. ► Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. ► A targeted integration system of IDRV DNA using the AAV integration mechanism. ► Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors, therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.

Fluorescent in-situ hybridization of cattle and sheep chromosomes with cloned human fragile-X DNA

DEFF Research Database (Denmark)

Ali, Ahmd; Thomsen, Preben Dybdahl; Babar, M.E.

2009-01-01

An extensive study on spontaneous and 5-Fluorodeoxyuridine induced fragile sites identified Xq31 in cattle (Bos taurus) and (Xq24, Xq26) in sheep (Ovis aries) in addition to several autosomal fragile sites (under publication). A ZOO-FISH study using three cloned human fragile-X probes with CCG....../CGG(n) trinucleotide repeat sequence was carried out to determine homology between human and bovine fragile-X. The hybridisation results showed only a weak signal on a human chromosome that was not an X with all three fragile site probes. No signals were detected in sheep chromosomes. The signal of all three human...... fragile-X probes on cattle chromosomes was however, medium-prominent sub-centromeric signal on two homologues. BrdU administration in 12 h before harvesting identified these homologues to be chromosome number 5. In addition retrospective slides of cattle and sheep chromosomes used for fragile site studies...

Repair of oxidative DNA base damage in the host genome influences the HIV integration site sequence preference.

Directory of Open Access Journals (Sweden)

Geoffrey R Bennett

Full Text Available Host base excision repair (BER proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1 and mutY homolog (MYH as well as DNA polymerase beta (Polβ. While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.

78 FR 14088 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2013-03-04

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act requires that public notice of this meeting be announced in the Federal Register.

Integrative Analysis of CRISPR/Cas9 Target Sites in the Human HBB Gene

Directory of Open Access Journals (Sweden)

Yumei Luo

2015-01-01

Full Text Available Recently, the clustered regularly interspaced short palindromic repeats (CRISPR system has emerged as a powerful customizable artificial nuclease to facilitate precise genetic correction for tissue regeneration and isogenic disease modeling. However, previous studies reported substantial off-target activities of CRISPR system in human cells, and the enormous putative off-target sites are labor-intensive to be validated experimentally, thus motivating bioinformatics methods for rational design of CRISPR system and prediction of its potential off-target effects. Here, we describe an integrative analytical process to identify specific CRISPR target sites in the human β-globin gene (HBB and predict their off-target effects. Our method includes off-target analysis in both coding and noncoding regions, which was neglected by previous studies. It was found that the CRISPR target sites in the introns have fewer off-target sites in the coding regions than those in the exons. Remarkably, target sites containing certain transcriptional factor motif have enriched binding sites of relevant transcriptional factor in their off-target sets. We also found that the intron sites have fewer SNPs, which leads to less variation of CRISPR efficiency in different individuals during clinical applications. Our studies provide a standard analytical procedure to select specific CRISPR targets for genetic correction.

75 FR 65310 - Environmental Management Site-Specific Advisory Board, Nevada

Science.gov (United States)

2010-10-22

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Nevada AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Nevada Test Site. The Federal Advisory... Board is to make recommendations to DOE-EM and site management in the areas of environmental restoration...

Molecular nature of X-ray-induced mutations compared with that of spontaneous ones in human c-hprt gene integrated into mammalian chromosomal DNA

International Nuclear Information System (INIS)

Kimura, Hiroshi; Kato, Takesi.

1992-01-01

X-ray-induced mutations were analysed at molecular levels in comparison with spontaneous mutations. Altered sequences were determined tentatively of 30 independent X-ray-induced mutations in a cDNA of the human hprt gene which was integrated into mammalian chromosome as a part of a shuttle vector. Mutations consisted of base substitutions (37 %), frameshifts (27 %), deletions (27 %) and others (10 %). All these mutational events were distributed randomly over the gene without there being hot spots. The spectrum and distribution of X-ray-induced mutations resembled those of spontaneous mutations. Among base substitutions, transversions were predominant and base substitution mutations occurred more at A:T sites than at G:C sites, which is also the case in spontaneous mutations. Most of the frameshift and deletion mutations induced by X-rays, as well as those spontaneously arising, were characterized by the existence of short direct repeats of several identical bases in a row at the sites of the mutations. A slippage misalignment mechanism in replication well accounts for the generation of these classes of mutations. Judging from the data accumulated so far, it can be concluded that X-ray-induced mutations at molecular levels are similar to those spontaneously occurring. (author)

Site-specific genomic (SSG and random domain-localized (RDL mutagenesis in yeast

Directory of Open Access Journals (Sweden)

Honigberg Saul M

2004-04-01

Full Text Available Abstract Background A valuable weapon in the arsenal available to yeast geneticists is the ability to introduce specific mutations into yeast genome. In particular, methods have been developed to introduce deletions into the yeast genome using PCR fragments. These methods are highly efficient because they do not require cloning in plasmids. Results We have modified the existing method for introducing deletions in the yeast (S. cerevisiae genome using PCR fragments in order to target point mutations to this genome. We describe two PCR-based methods for directing point mutations into the yeast genome such that the final product contains no other disruptions. In the first method, site-specific genomic (SSG mutagenesis, a specific point mutation is targeted into the genome. In the second method, random domain-localized (RDL mutagenesis, a mutation is introduced at random within a specific domain of a gene. Both methods require two sequential transformations, the first transformation integrates the URA3 marker into the targeted locus, and the second transformation replaces URA3 with a PCR fragment containing one or a few mutations. This PCR fragment is synthesized using a primer containing a mutation (SSG mutagenesis or is synthesized by error-prone PCR (RDL mutagenesis. In SSG mutagenesis, mutations that are proximal to the URA3 site are incorporated at higher frequencies than distal mutations, however mutations can be introduced efficiently at distances of at least 500 bp from the URA3 insertion. In RDL mutagenesis, to ensure that incorporation of mutations occurs at approximately equal frequencies throughout the targeted region, this region is deleted at the same time URA3 is integrated. Conclusion SSG and RDL mutagenesis allow point mutations to be easily and efficiently incorporated into the yeast genome without disrupting the native locus.

Dahl (S x R congenic strain analysis confirms and defines a chromosome 5 female-specific blood pressure quantitative trait locus to <7 Mbp.

Directory of Open Access Journals (Sweden)

Victoria L M Herrera

Full Text Available The detection of multiple sex-specific blood pressure (BP quantitative trait loci (QTLs in independent total genome analyses of F2 (Dahl S x R-intercross male and female rat cohorts confirms clinical observations of sex-specific disease cause and response to treatment among hypertensive patients, and mandate the identification of sex-specific hypertension genes/mechanisms. We developed and studied two congenic strains, S.R5A and S.R5B introgressing Dahl R-chromosome 5 segments into Dahl S chromosome 5 region spanning putative BP-f1 and BP-f2 QTLs. Radiotelemetric non-stressed 24-hour BP analysis at four weeks post-high salt diet (8% NaCl challenge, identified only S.R5B congenic rats with lower SBP (-26.5 mmHg, P = 0.002, DBP (-23.7 mmHg, P = 0.004 and MAP (-25.1 mmHg, P = 0.002 compared with Dahl S female controls at four months of age confirming BP-f1 but not BP-f2 QTL on rat chromosome 5. The S.R5B congenic segment did not affect pulse pressure and relative heart weight indicating that the gene underlying BP-f1 does not influence arterial stiffness and cardiac hypertrophy. The results of our congenic analysis narrowed BP-f1 to chromosome 5 coordinates 134.9-141.5 Mbp setting up the basis for further fine mapping of BP-f1 and eventual identification of the specific gene variant accounting for BP-f1 effect on blood pressure.

Dahl (S x R) congenic strain analysis confirms and defines a chromosome 5 female-specific blood pressure quantitative trait locus to <7 Mbp.

Science.gov (United States)

Herrera, Victoria L M; Pasion, Khristine A; Moran, Ann Marie; Ruiz-Opazo, Nelson

2012-01-01

The detection of multiple sex-specific blood pressure (BP) quantitative trait loci (QTLs) in independent total genome analyses of F2 (Dahl S x R)-intercross male and female rat cohorts confirms clinical observations of sex-specific disease cause and response to treatment among hypertensive patients, and mandate the identification of sex-specific hypertension genes/mechanisms. We developed and studied two congenic strains, S.R5A and S.R5B introgressing Dahl R-chromosome 5 segments into Dahl S chromosome 5 region spanning putative BP-f1 and BP-f2 QTLs. Radiotelemetric non-stressed 24-hour BP analysis at four weeks post-high salt diet (8% NaCl) challenge, identified only S.R5B congenic rats with lower SBP (-26.5 mmHg, P = 0.002), DBP (-23.7 mmHg, P = 0.004) and MAP (-25.1 mmHg, P = 0.002) compared with Dahl S female controls at four months of age confirming BP-f1 but not BP-f2 QTL on rat chromosome 5. The S.R5B congenic segment did not affect pulse pressure and relative heart weight indicating that the gene underlying BP-f1 does not influence arterial stiffness and cardiac hypertrophy. The results of our congenic analysis narrowed BP-f1 to chromosome 5 coordinates 134.9-141.5 Mbp setting up the basis for further fine mapping of BP-f1 and eventual identification of the specific gene variant accounting for BP-f1 effect on blood pressure.

Induced and natural break sites in the chromosomes of Hawaiian Drosophila

International Nuclear Information System (INIS)

Tonzetich, J.; Lyttle, T.W.; Carson, H.L.

1988-01-01

Gamma-irradiation of a laboratory strain of the Hawaiian species of Drosophila heteroneura yielded 310 breaks in the five major acrocentric polytene chromosomes. Their map positions conform to the Poisson distribution, unlike most of the 436 natural breaks mapped in 105 closely related species endemic to Hawaii. Genome element E is longer and has more induced breaks than the others. Both in Hawaiian and related species groups, this element shows increased polymorphism and fixation of naturally occurring inversions. The X chromosome (element A) also accumulates many natural breaks; the majority of the resulting aberrations become fixed rather than remain as polymorphisms. Although size may play a small role in initial break distribution, the major effects relative to the establishment of a rearrangement in natural populations are ascribed to the interaction of selection and drift. Nonconformance of the natural breaks to the Poisson distribution appears to be due to the tendency for breaks to accumulate both in the proximal euchromatic portion of each arm and in heterochromatic regions that are not replicated in the polytene chromosomes

Outcomes of hematopoietic cell transplantation using donors or recipients with inherited chromosomally integrated HHV-6.

Science.gov (United States)

Hill, Joshua A; Magaret, Amalia S; Hall-Sedlak, Ruth; Mikhaylova, Anna; Huang, Meei-Li; Sandmaier, Brenda M; Hansen, John A; Jerome, Keith R; Zerr, Danielle M; Boeckh, Michael

2017-08-24

Human herpesvirus 6 (HHV-6) species have a unique ability to integrate into chromosomal telomeres. Mendelian inheritance via gametocyte integration results in HHV-6 in every nucleated cell. The epidemiology and clinical effect of inherited chromosomally integrated HHV-6 (iciHHV-6) in hematopoietic cell transplant (HCT) recipients is unclear. We identified 4319 HCT donor-recipient pairs (8638 subjects) who received an allogeneic HCT and had archived pre-HCT peripheral blood mononuclear cell samples. We screened these samples for iciHHV-6 and compared characteristics of HCT recipients and donors with iciHHV-6 with those of recipients and donors without iciHHV-6, respectively. We calculated Kaplan-Meier probability estimates and Cox proportional hazards models for post-HCT outcomes based on recipient and donor iciHHV-6 status. We identified 60 HCT recipients (1.4%) and 40 donors (0.9%) with iciHHV-6; both recipient and donor harbored iciHHV-6 in 13 HCTs. Thus, there were 87 HCTs (2%) in which the recipient, donor, or both harbored iciHHV-6. Acute graft-versus-host disease (GVHD) grades 2-4 was more frequent when recipients or donors had iciHHV-6 (adjusted hazard ratios, 1.7-1.9; P = .004-.001). Cytomegalovirus viremia (any and high-level) was more frequent among recipients with iciHHV-6 (adjusted HRs, 1.7-3.1; P = .001-.040). Inherited ciHHV-6 status did not significantly affect risk for chronic GVHD, hematopoietic cell engraftment, overall mortality, or nonrelapse mortality. Screening for iciHHV-6 could guide donor selection and post-HCT risk stratification and treatment. Further study is needed to replicate these findings and identify potential mechanisms. © 2017 by The American Society of Hematology.

CasEMBLR: Cas9-Facilitated Multiloci Genomic Integration of in Vivo Assembled DNA Parts in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Jakociunas, Tadas; Rajkumar, Arun Stephen; Zhang, Jie

2015-01-01

, we present a method for marker-free multiloci integration of in vivo assembled DNA parts. By the use of CRISPR/Cas9-mediated one-step double-strand breaks at single, double and triple integration sites we report the successful in vivo assembly and chromosomal integration of DNA parts. We call our...

Site-specific recombination in the chicken genome using Flipase recombinase-mediated cassette exchange.

Science.gov (United States)

Lee, Hong Jo; Lee, Hyung Chul; Kim, Young Min; Hwang, Young Sun; Park, Young Hyun; Park, Tae Sub; Han, Jae Yong

2016-02-01

Targeted genome recombination has been applied in diverse research fields and has a wide range of possible applications. In particular, the discovery of specific loci in the genome that support robust and ubiquitous expression of integrated genes and the development of genome-editing technology have facilitated rapid advances in various scientific areas. In this study, we produced transgenic (TG) chickens that can induce recombinase-mediated gene cassette exchange (RMCE), one of the site-specific recombination technologies, and confirmed RMCE in TG chicken-derived cells. As a result, we established TG chicken lines that have, Flipase (Flp) recognition target (FRT) pairs in the chicken genome, mediated by piggyBac transposition. The transgene integration patterns were diverse in each TG chicken line, and the integration diversity resulted in diverse levels of expression of exogenous genes in each tissue of the TG chickens. In addition, the replaced gene cassette was expressed successfully and maintained by RMCE in the FRT predominant loci of TG chicken-derived cells. These results indicate that targeted genome recombination technology with RMCE could be adaptable to TG chicken models and that the technology would be applicable to specific gene regulation by cis-element insertion and customized expression of functional proteins at predicted levels without epigenetic influence. © FASEB.

Transcription factor binding sites prediction based on modified nucleosomes.

Directory of Open Access Journals (Sweden)

Mohammad Talebzadeh

Full Text Available In computational methods, position weight matrices (PWMs are commonly applied for transcription factor binding site (TFBS prediction. Although these matrices are more accurate than simple consensus sequences to predict actual binding sites, they usually produce a large number of false positive (FP predictions and so are impoverished sources of information. Several studies have employed additional sources of information such as sequence conservation or the vicinity to transcription start sites to distinguish true binding regions from random ones. Recently, the spatial distribution of modified nucleosomes has been shown to be associated with different promoter architectures. These aligned patterns can facilitate DNA accessibility for transcription factors. We hypothesize that using data from these aligned and periodic patterns can improve the performance of binding region prediction. In this study, we propose two effective features, "modified nucleosomes neighboring" and "modified nucleosomes occupancy", to decrease FP in binding site discovery. Based on these features, we designed a logistic regression classifier which estimates the probability of a region as a TFBS. Our model learned each feature based on Sp1 binding sites on Chromosome 1 and was tested on the other chromosomes in human CD4+T cells. In this work, we investigated 21 histone modifications and found that only 8 out of 21 marks are strongly correlated with transcription factor binding regions. To prove that these features are not specific to Sp1, we combined the logistic regression classifier with the PWM, and created a new model to search TFBSs on the genome. We tested the model using transcription factors MAZ, PU.1 and ELF1 and compared the results to those using only the PWM. The results show that our model can predict Transcription factor binding regions more successfully. The relative simplicity of the model and capability of integrating other features make it a superior method

Y chromosome STR typing in crime casework.

Science.gov (United States)

Roewer, Lutz

2009-01-01

Since the beginning of the nineties the field of forensic Y chromosome analysis has been successfully developed to become commonplace in laboratories working in crime casework all over the world. The ability to identify male-specific DNA renders highly variable Y-chromosomal polymorphisms, the STR sequences, an invaluable addition to the standard panel of autosomal loci used in forensic genetics. The male-specificity makes the Y chromosome especially useful in cases of male/female cell admixture, namely in sexual assault cases. On the other hand, the haploidy and patrilineal inheritance complicates the interpretation of a Y-STR match, because male relatives share for several generations an identical Y-STR profile. Since paternal relatives tend to live in the geographic and cultural territory of their ancestors, the Y chromosome analysis has a potential to make inferences on the population of origin of a given DNA profile. This review addresses the fields of application of Y chromosome haplotyping, the interpretation of results, databasing efforts and population genetics aspects.

The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei

NARCIS (Netherlands)

Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.

1990-01-01

The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site

The chromosomal organization of horizontal gene transfer in bacteria.

Science.gov (United States)

Oliveira, Pedro H; Touchon, Marie; Cury, Jean; Rocha, Eduardo P C

2017-10-10

Bacterial adaptation is accelerated by the acquisition of novel traits through horizontal gene transfer, but the integration of these genes affects genome organization. We found that transferred genes are concentrated in only ~1% of the chromosomal regions (hotspots) in 80 bacterial species. This concentration increases with genome size and with the rate of transfer. Hotspots diversify by rapid gene turnover; their chromosomal distribution depends on local contexts (neighboring core genes), and content in mobile genetic elements. Hotspots concentrate most changes in gene repertoires, reduce the trade-off between genome diversification and organization, and should be treasure troves of strain-specific adaptive genes. Most mobile genetic elements and antibiotic resistance genes are in hotspots, but many hotspots lack recognizable mobile genetic elements and exhibit frequent homologous recombination at flanking core genes. Overrepresentation of hotspots with fewer mobile genetic elements in naturally transformable bacteria suggests that homologous recombination and horizontal gene transfer are tightly linked in genome evolution.Horizontal gene transfer (HGT) is an important mechanism for genome evolution and adaptation in bacteria. Here, Oliveira and colleagues find HGT hotspots comprising  ~ 1% of the chromosomal regions in 80 bacterial species.

SITE-94. Discrete-feature modelling of the Aespoe site: 2. Development of the integrated site-scale model

International Nuclear Information System (INIS)

Geier, J.E.

1996-12-01

A 3-dimensional, discrete-feature hydrological model is developed. The model integrates structural and hydrologic data for the Aespoe site, on scales ranging from semi regional fracture zones to individual fractures in the vicinity of the nuclear waste canisters. Hydrologic properties of the large-scale structures are initially estimated from cross-hole hydrologic test data, and automatically calibrated by numerical simulation of network flow, and comparison with undisturbed heads and observed drawdown in selected cross-hole tests. The calibrated model is combined with a separately derived fracture network model, to yield the integrated model. This model is partly validated by simulation of transient responses to a long-term pumping test and a convergent tracer test, based on the LPT2 experiment at Aespoe. The integrated model predicts that discharge from the SITE-94 repository is predominantly via fracture zones along the eastern shore of Aespoe. Similar discharge loci are produced by numerous model variants that explore uncertainty with regard to effective semi regional boundary conditions, hydrologic properties of the site-scale structures, and alternative structural/hydrological interpretations. 32 refs

SITE-94. Discrete-feature modelling of the Aespoe site: 2. Development of the integrated site-scale model

Energy Technology Data Exchange (ETDEWEB)

Geier, J.E. [Golder Associates AB, Uppsala (Sweden)

1996-12-01

A 3-dimensional, discrete-feature hydrological model is developed. The model integrates structural and hydrologic data for the Aespoe site, on scales ranging from semi regional fracture zones to individual fractures in the vicinity of the nuclear waste canisters. Hydrologic properties of the large-scale structures are initially estimated from cross-hole hydrologic test data, and automatically calibrated by numerical simulation of network flow, and comparison with undisturbed heads and observed drawdown in selected cross-hole tests. The calibrated model is combined with a separately derived fracture network model, to yield the integrated model. This model is partly validated by simulation of transient responses to a long-term pumping test and a convergent tracer test, based on the LPT2 experiment at Aespoe. The integrated model predicts that discharge from the SITE-94 repository is predominantly via fracture zones along the eastern shore of Aespoe. Similar discharge loci are produced by numerous model variants that explore uncertainty with regard to effective semi regional boundary conditions, hydrologic properties of the site-scale structures, and alternative structural/hydrological interpretations. 32 refs.

An integrated approach to site selection for nuclear power plants

International Nuclear Information System (INIS)

Hassan, E.M.A.

1975-01-01

A method of analysing and evaluating the large number of factors influencing site selection is proposed, which can interrelate these factors and associated problems in an integrated way and at the same time establish a technique for site evaluation. The objective is to develop an integrated programme that illustrates the complexity and dynamic interrelationships of the various factors to develop an improved understanding of the functions and objectives of siting nuclear power plants and would aim finally at the development of an effective procedure and technique for site evaluation and/or comparative evaluation for making rational site-selection decisions. (author)

NGS-based approach to determine the presence of HPV and their sites of integration in human cancer genome.

Science.gov (United States)

Chandrani, P; Kulkarni, V; Iyer, P; Upadhyay, P; Chaubal, R; Das, P; Mulherkar, R; Singh, R; Dutt, A

2015-06-09

Human papilloma virus (HPV) accounts for the most common cause of all virus-associated human cancers. Here, we describe the first graphic user interface (GUI)-based automated tool 'HPVDetector', for non-computational biologists, exclusively for detection and annotation of the HPV genome based on next-generation sequencing data sets. We developed a custom-made reference genome that comprises of human chromosomes along with annotated genome of 143 HPV types as pseudochromosomes. The tool runs on a dual mode as defined by the user: a 'quick mode' to identify presence of HPV types and an 'integration mode' to determine genomic location for the site of integration. The input data can be a paired-end whole-exome, whole-genome or whole-transcriptome data set. The HPVDetector is available in public domain for download: http://www.actrec.gov.in/pi-webpages/AmitDutt/HPVdetector/HPVDetector.html. On the basis of our evaluation of 116 whole-exome, 23 whole-transcriptome and 2 whole-genome data, we were able to identify presence of HPV in 20 exomes and 4 transcriptomes of cervical and head and neck cancer tumour samples. Using the inbuilt annotation module of HPVDetector, we found predominant integration of viral gene E7, a known oncogene, at known 17q21, 3q27, 7q35, Xq28 and novel sites of integration in the human genome. Furthermore, co-infection with high-risk HPVs such as 16 and 31 were found to be mutually exclusive compared with low-risk HPV71. HPVDetector is a simple yet precise and robust tool for detecting HPV from tumour samples using variety of next-generation sequencing platforms including whole genome, whole exome and transcriptome. Two different modes (quick detection and integration mode) along with a GUI widen the usability of HPVDetector for biologists and clinicians with minimal computational knowledge.

Fluorescence in situ hybridization: an improved method of quantitating chromosome damage and repair

International Nuclear Information System (INIS)

Brown, J.M.; Evans, J.W.

1993-01-01

The authors combined fluorescence in situ hybridization (FISH) with specific full-length chromosome probes using the premature chromosome condensation (PCC) technique chromosome condensation (PCC) technique to simplify scoring chromosome damage and its repair. They have shown the technique works well and enables breaks and exchanges to be readily detected and scored in individual chromosomes. A chromosome 4 full-length specific library has been used in initial studies. (UK)

78 FR 26005 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2013-05-03

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

78 FR 65979 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2013-11-04

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

77 FR 24695 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2012-04-25

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. . 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

77 FR 60688 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2012-10-04

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

77 FR 13104 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2012-03-05

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

77 FR 39235 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2012-07-02

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

78 FR 716 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2013-01-04

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

78 FR 54461 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2013-09-04

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

77 FR 53193 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2012-08-31

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

LCA of contaminated site remediation - integration of site-specific impact assessment of local toxic impacts

DEFF Research Database (Denmark)

Lemming, Gitte; Hauschild, Michael Zwicky; Chambon, Julie Claire Claudia

2011-01-01

impacts have typically been assessed using site-generic characterization models representing a continental scale and excluding the groundwater compartment. Soil contaminants have therefore generally been assigned as emissions to surface soil or surface water compartments. However, such site-generic...... assessments poorly reflect the fate of frequent soil contaminants such as chloroethenes as they exclude the groundwater compartment and assume that the main part escapes to the atmosphere. Another important limitation of the generic impact assessment models is that they do not include the formation......The environmental impacts from remediation can be divided into primary and secondary impacts. Primary impacts cover the local impacts associated with the on-site contamination, whereas the secondary impacts are impacts on the local, regional and global scale generated by the remediation activities...

Murine leukemia virus-derived retroviral vector has differential integration patterns in human cell lines used to produce recombinant factor VIII

Directory of Open Access Journals (Sweden)

Marcela Cristina Correa de Freitas

2014-06-01

Full Text Available OBJECTIVE: Nowadays recombinant factor VIII is produced in murine cells including in Chinese hamster ovary (CHO and baby hamster kidney cells (BHK. Previous studies, using the murine leukemia virus-derived retroviral vector pMFG-FVIII-P140K, modified two recombinant human cell lines, HepG2 and Hek293 to produce recombinant factor VIII. In order to characterize these cells, the present study aimed to analyze the integration pattern of retroviral vector pMFG-FVIII-P140K.METHODS: This study used ligation-mediated polymerase chain reaction to locate the site of viral vector integration by sequencing polymerase chain reaction products. The sequences were compared to genomic databases to characterize respective clones.RESULTS: The retroviral vector presented different and non-random profiles of integration between cells lines. A preference of integration for chromosomes 19, 17 and 11 was observed for HepG2FVIIIdB/P140K and chromosome 9 for Hek293FVIIIdB/P140K. In genomic regions such as CpG islands and transcription factor binding sites, there was no difference in the integration profiles for both cell lines. Integration in intronic regions of encoding protein genes (RefSeq genes was also observed in both cell lines. Twenty percent of integrations occurred at fragile sites in the genome of the HepG2 cell line and 17% in Hek293.CONCLUSION: The results suggest that the cell type can affect the profile of chromosomal integration of the retroviral vector used; these differences may interfere in the level of expression of recombinant proteins.

Sex, rebellion and decadence: the scandalous evolutionary history of the human Y chromosome.

Science.gov (United States)

Navarro-Costa, Paulo

2012-12-01

It can be argued that the Y chromosome brings some of the spirit of rock&roll to our genome. Equal parts degenerate and sex-driven, the Y has boldly rebelled against sexual recombination, one of the sacred pillars of evolution. In evolutionary terms this chromosome also seems to have adopted another of rock&roll's mottos: living fast. Yet, it appears to have refused to die young. In this manuscript the Y chromosome will be analyzed from the intersection between structural, evolutionary and functional biology. Such integrative approach will present the Y as a highly specialized product of a series of remarkable evolutionary processes. These led to the establishment of a sex-specific genomic niche that is maintained by a complex balance between selective pressure and the genetic diversity introduced by intrachromosomal recombination. Central to this equilibrium is the "polish or perish" dilemma faced by the male-specific Y genes: either they are polished by the acquisition of male-related functions or they perish via the accumulation of inactivating mutations. Thus, understanding to what extent the idiosyncrasies of Y recombination may impact this chromosome's role in sex determination and male germline functions should be regarded as essential for added clinical insight into several male infertility phenotypes. This article is part of a Special Issue entitled: Molecular Genetics of Human Reproductive Failure. Copyright © 2012 Elsevier B.V. All rights reserved.

Non-disjunction of chromosome 13

DEFF Research Database (Denmark)

Bugge, Merete; Collins, Andrew; Hertz, Jens Michael

2007-01-01

We performed a molecular study with 21 microsatellites on a sample of 82 trisomy 13 conceptuses, the largest number of cases studied to date. The parental origin was determined in every case and in 89% the extra chromosome 13 was of maternal origin with an almost equal number of maternal MI and MII...... recombination in both maternal MI and MII errors and the former is associated with a significant number of tetrads (33%) that are nullichiasmate, which do not appear to be a feature of normal chromosome 13 meiosis. This study supports the evidence for subtle chromosome-specific influences on the mechanisms...... that determine non-disjunction of human chromosomes, consistent with the diversity of findings for other trisomies. Udgivelsesdato: 2007-Aug-15...

Chromosomal Mapping of Repetitive DNAs in the Grasshopper Abracris flavolineata Reveal Possible Ancestry of the B Chromosome and H3 Histone Spreading

Science.gov (United States)

Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Cabral-de-Mello, Diogo Cavalcanti

2013-01-01

Supernumerary chromosomes (B chromosomes) occur in approximately 15% of eukaryote species. Although these chromosomes have been extensively studied, knowledge concerning their specific molecular composition is lacking in most cases. The accumulation of repetitive DNAs is one remarkable characteristic of B chromosomes, and the occurrence of distinct types of multigene families, satellite DNAs and some transposable elements have been reported. Here, we describe the organization of repetitive DNAs in the A complement and B chromosome system in the grasshopper species Abracris flavolineata using classical cytogenetic techniques and FISH analysis using probes for five multigene families, telomeric repeats and repetitive C0t-1 DNA fractions. The 18S rRNA and H3 histone multigene families are highly variable and well distributed in A. flavolineata chromosomes, which contrasts with the conservation of U snRNA genes and less variable distribution of 5S rDNA sequences. The H3 histone gene was an extensively distributed with clusters occurring in all chromosomes. Repetitive DNAs were concentrated in C-positive regions, including the pericentromeric region and small chromosomal arms, with some occurrence in C-negative regions, but abundance was low in the B chromosome. Finally, the first demonstration of the U2 snRNA gene in B chromosomes in A. flavolineata may shed light on its possible origin. These results provide new information regarding chromosomal variability for repetitive DNAs in grasshoppers and the specific molecular composition of B chromosomes. PMID:23826099

Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration.

Directory of Open Access Journals (Sweden)

Wenli Zhang

Full Text Available We recently developed adenovirus/transposase hybrid-vectors utilizing the previously described hyperactive Sleeping Beauty (SB transposase HSB5 for somatic integration and we could show stabilized transgene expression in mice and a canine model for hemophilia B. However, the safety profile of these hybrid-vectors with respect to vector dose and genotoxicity remains to be investigated. Herein, we evaluated this hybrid-vector system in C57Bl/6 mice with escalating vector dose settings. We found that in all mice which received the hyperactive SB transposase, transgene expression levels were stabilized in a dose-dependent manner and that the highest vector dose was accompanied by fatalities in mice. To analyze potential genotoxic side-effects due to somatic integration into host chromosomes, we performed a genome-wide integration site analysis using linker-mediated PCR (LM-PCR and linear amplification-mediated PCR (LAM-PCR. Analysis of genomic DNA samples obtained from HSB5 treated female and male mice revealed a total of 1327 unique transposition events. Overall the chromosomal distribution pattern was close-to-random and we observed a random integration profile with respect to integration into gene and non-gene areas. Notably, when using the LM-PCR protocol, 27 extra-chromosomal integration events were identified, most likely caused by transposon excision and subsequent transposition into the delivered adenoviral vector genome. In total, this study provides a careful evaluation of the safety profile of adenovirus/Sleeping Beauty transposase hybrid-vectors. The obtained information will be useful when designing future preclinical studies utilizing hybrid-vectors in small and large animal models.

Over-representation of specific regions of chromosome 22 in cells from human glioma correlate with resistance to 1,3-bis(2-chloroethyl)-1-nitrosourea

International Nuclear Information System (INIS)

Hank, Nicole C; Shapiro, Joan Rankin; Scheck, Adrienne C

2006-01-01

Glioblastoma multiforme is the most malignant form of brain tumor. Despite treatment including surgical resection, adjuvant chemotherapy, and radiation, these tumors typically recur. The recurrent tumor is often resistant to further therapy with the same agent, suggesting that the surviving cells that repopulate the tumor mass have an intrinsic genetic advantage. We previously demonstrated that cells selected for resistance to 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) are near-diploid, with over-representation of part or all of chromosomes 7 and 22. While cells from untreated gliomas often have over-representation of chromosome 7, chromosome 22 is typically under-represented. We have analyzed cells from primary and recurrent tumors from the same patient before and after in vitro selection for resistance to clinically relevant doses of BCNU. Karyotypic analyses were done to demonstrate the genetic makeup of these cells, and fluorescent in situ hybridization analyses have defined the region(s) of chromosome 22 retained in these BCNU-resistant cells. Karyotypic analyses demonstrated that cells selected for BCNU resistance were near-diploid with over-representation of chromosomes 7 and 22. In cells where whole copies of chromosome 22 were not identified, numerous fragments of this chromosome were retained and inserted into several marker and derivative chromosomes. Fluorescent in situ hybridization analyses using whole chromosome paints confirmed this finding. Additional FISH analysis using bacterial artificial chromosome probes spanning the length of chromosome 22 have allowed us to map the over-represented region to 22q12.3–13.32. Cells selected for BCNU resistance either in vivo or in vitro retain sequences mapped to chromosome 22. The specific over-representation of sequences mapped to 22q12.3–13.32 suggest the presence of a DNA sequence important to BCNU survival and/or resistance located in this region of chromosome 22

The study of human Y chromosome variation through ancient DNA.

Science.gov (United States)

Kivisild, Toomas

2017-05-01

High throughput sequencing methods have completely transformed the study of human Y chromosome variation by offering a genome-scale view on genetic variation retrieved from ancient human remains in context of a growing number of high coverage whole Y chromosome sequence data from living populations from across the world. The ancient Y chromosome sequences are providing us the first exciting glimpses into the past variation of male-specific compartment of the genome and the opportunity to evaluate models based on previously made inferences from patterns of genetic variation in living populations. Analyses of the ancient Y chromosome sequences are challenging not only because of issues generally related to ancient DNA work, such as DNA damage-induced mutations and low content of endogenous DNA in most human remains, but also because of specific properties of the Y chromosome, such as its highly repetitive nature and high homology with the X chromosome. Shotgun sequencing of uniquely mapping regions of the Y chromosomes to sufficiently high coverage is still challenging and costly in poorly preserved samples. To increase the coverage of specific target SNPs capture-based methods have been developed and used in recent years to generate Y chromosome sequence data from hundreds of prehistoric skeletal remains. Besides the prospects of testing directly as how much genetic change in a given time period has accompanied changes in material culture the sequencing of ancient Y chromosomes allows us also to better understand the rate at which mutations accumulate and get fixed over time. This review considers genome-scale evidence on ancient Y chromosome diversity that has recently started to accumulate in geographic areas favourable to DNA preservation. More specifically the review focuses on examples of regional continuity and change of the Y chromosome haplogroups in North Eurasia and in the New World.

Site-specific, insertional inactivation of incA in Chlamydia trachomatis using a group II intron.

Science.gov (United States)

Johnson, Cayla M; Fisher, Derek J

2013-01-01

Chlamydia trachomatis is an obligate, intracellular bacterial pathogen that has until more recently remained recalcitrant to genetic manipulation. However, the field still remains hindered by the absence of tools to create selectable, targeted chromosomal mutations. Previous work with mobile group II introns demonstrated that they can be retargeted by altering DNA sequences within the intron's substrate recognition region to create site-specific gene insertions. This platform (marketed as TargeTron™, Sigma) has been successfully employed in a variety of bacteria. We subsequently modified TargeTron™ for use in C. trachomatis and as proof of principle used our system to insertionally inactivate incA, a chromosomal gene encoding a protein required for homotypic fusion of chlamydial inclusions. C. trachomatis incA::GII(bla) mutants were selected with ampicillin and plaque purified clones were then isolated for genotypic and phenotypic analysis. PCR, Southern blotting, and DNA sequencing verified proper GII(bla) insertion, while continuous passaging in the absence of selection demonstrated that the insertion was stable. As seen with naturally occurring IncA(-) mutants, light and immunofluorescence microscopy confirmed the presence of non-fusogenic inclusions in cells infected with the incA::GII(bla) mutants at a multiplicity of infection greater than one. Lack of IncA production by mutant clones was further confirmed by Western blotting. Ultimately, the ease of retargeting the intron, ability to select for mutants, and intron stability in the absence of selection makes this method a powerful addition to the growing chlamydial molecular toolbox.

78 FR 40130 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2013-07-03

...This notice announces a meeting of the Environmental Management Site-Specific Advisory Board (EM SSAB), Savannah River Site. The Federal Advisory Committee Act (Pub. L. No. 92-463, 86 Stat. 770) requires that public notice of this meeting be announced in the Federal Register.

78 FR 16260 - Environmental Management Site-Specific Advisory Board, Savannah River Site

Science.gov (United States)

2013-03-14

...On March 4, 2013, the Department of Energy (DOE) published a notice of open meeting announcing a meeting on March 25-26, 2013 of the Environmental Management Site-Specific Advisory Board, Savannah River Site (78 FR 14088). This document makes a correction to that notice.

75 FR 6018 - Environmental Management Site-Specific Advisory Board, Hanford

Science.gov (United States)

2010-02-05

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Hanford AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Hanford (known locally as the Hanford Advisory... and site management in the areas of environmental restoration, waste management, and related...

Two-step interrogation then recognition of DNA binding site by Integration Host Factor: an architectural DNA-bending protein.

Science.gov (United States)

Velmurugu, Yogambigai; Vivas, Paula; Connolly, Mitchell; Kuznetsov, Serguei V; Rice, Phoebe A; Ansari, Anjum

2018-02-28

The dynamics and mechanism of how site-specific DNA-bending proteins initially interrogate potential binding sites prior to recognition have remained elusive for most systems. Here we present these dynamics for Integration Host factor (IHF), a nucleoid-associated architectural protein, using a μs-resolved T-jump approach. Our studies show two distinct DNA-bending steps during site recognition by IHF. While the faster (∼100 μs) step is unaffected by changes in DNA or protein sequence that alter affinity by >100-fold, the slower (1-10 ms) step is accelerated ∼5-fold when mismatches are introduced at DNA sites that are sharply kinked in the specific complex. The amplitudes of the fast phase increase when the specific complex is destabilized and decrease with increasing [salt], which increases specificity. Taken together, these results indicate that the fast phase is non-specific DNA bending while the slow phase, which responds only to changes in DNA flexibility at the kink sites, is specific DNA kinking during site recognition. Notably, the timescales for the fast phase overlap with one-dimensional diffusion times measured for several proteins on DNA, suggesting that these dynamics reflect partial DNA bending during interrogation of potential binding sites by IHF as it scans DNA.

Comprehensive, integrated, remote sensing at DOE sites

International Nuclear Information System (INIS)

Lackey, J.G.; Burson, Z.G.

1985-01-01

The Department of Energy has established a program called Comprehensive, Integrated Remote Sensing (CIRS). The overall objective of the program is to provide a state-of-the-art data base of remotely sensed data for all users of such information at large DOE sites. The primary types of remote sensing provided, at present, consist of the following: large format aerial photography, video from aerial platforms, multispectral scanning, and airborne nuclear radiometric surveys. Implementation of the CIRS Program by EG and G Energy Measurements, Inc. began with field operations at the Savannah River Plant in 1982 and is continuing at that DOE site at a level of effort of about $1.5 m per year. Integrated remote sensing studies were subsequently extended to the West Valley Demonstration Project in this summer and fall of 1984. It is expected that the Program will eventually be extended to cover all large DOE sites on a continuing basis

Isolation of anonymous, polymorphic DNA fragments from human chromosome 22q12-qter

NARCIS (Netherlands)

J.P. Dumanski (Jan); A.H.M. Geurts van Kessel (Ad); M. Ruttledge (Martin); A. Wladis (Andreas); N. Sugawa (Noriaki); V.P. Collins (Peter); M. Nordenskjöld

1990-01-01

textabstractA series of 195 random chromosome 22-specific probes, equivalent to approximately 1% of the size of this chromosome, have been isolated from a chromosome 22-specific bacteriophage lambda genomic library. These probes were mapped to four different regions of chromosome 22 on a panel of

76 FR 5147 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2011-01-28

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

77 FR 59598 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2012-09-28

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

75 FR 13269 - Environmental Management Site-Specific Advisory Board, Hanford

Science.gov (United States)

2010-03-19

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Hanford AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Hanford. The Federal Advisory Committee Act... is to make recommendations to DOE-EM and site management in the areas of environmental restoration...

75 FR 54600 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2010-09-08

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

75 FR 66074 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2010-10-27

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

75 FR 8050 - Environmental Management Site-Specific Advisory Board, Hanford

Science.gov (United States)

2010-02-23

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Hanford AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Hanford. The Federal Advisory Committee Act... is to make recommendations to DOE-EM and site management in the areas of environmental restoration...

75 FR 24686 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2010-05-05

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

76 FR 80355 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2011-12-23

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... make recommendations to DOE-EM and site management in the areas of environmental restoration, waste...

75 FR 9404 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2010-03-02

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

75 FR 56526 - Environmental Management Site-Specific Advisory Board, Portsmouth

Science.gov (United States)

2010-09-16

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Portsmouth AGENCY... Initiative Workshop of the Environmental Management Site-Specific Advisory Board (EM SSAB), Portsmouth. The... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

77 FR 43583 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2012-07-25

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

75 FR 61711 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2010-10-06

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

75 FR 82002 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2010-12-29

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

76 FR 61350 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2011-10-04

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... make recommendations to DOE-EM and site management in the areas of environmental restoration, waste...

76 FR 4645 - Environmental Management Site-Specific Advisory Board, Hanford

Science.gov (United States)

2011-01-26

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Hanford AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Hanford. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management, and...

76 FR 48148 - Environmental Management Site-Specific Advisory Board, Paducah

Science.gov (United States)

2011-08-08

... DEPARTMENT OF ENERGY Environmental Management Site-Specific Advisory Board, Paducah AGENCY... Environmental Management Site-Specific Advisory Board (EM SSAB), Paducah. The Federal Advisory Committee Act... recommendations to DOE-EM and site management in the areas of environmental restoration, waste management and...

Semi-automatic laser beam microdissection of the Y chromosome and analysis of Y chromosome DNA in a dioecious plant, Silene latifolia

International Nuclear Information System (INIS)

Matsunaga, S.; Kawano, S.; Michimoto, T.; Higashiyama, T.; Nakao, S.; Sakai, A.; Kuroiwa, T.

1999-01-01

Silene latifolia has heteromorphic sex chromosomes, the X and Y chromosomes. The Y chromosome, which is thought to carry the male determining gene, was isolated by UV laser microdissection and amplified by degenerate oligonucleotide-primed PCR. In situ chromosome suppression of the amplified Y chromosome DNA in the presence of female genomic DNA as a competitor showed that the microdissected Y chromosome DNA did not specifically hybridize to the Y chromosome, but-hybridized to all chromosomes. This result suggests that the Y chromosome does not contain Y chromosome-enriched repetitive sequences. A repetitive sequence in the microdissected Y chromosome, RMY1, was isolated while screening repetitive sequences in the amplified Y chromosome. Part of the nucleotide sequence shared a similarity to that of X-43.1, which was isolated from microdissected X chromosomes. Since fluorescence in situ hybridization analysis with RMY1 demonstrated that RMY1 was localized at the ends of the chromosome, RMY1 may be a subtelomeric repetitive sequence. Regarding the sex chromosomes, RMY1 was detected at both ends of the X chromosome and at one end near the pseudoautosomal region of the Y chromosome. The different localization of RMY1 on the sex chromosomes provides a clue to the problem of how the sex chromosomes arose from autosomes

CERCLA integration with site operations the Fernald experience

International Nuclear Information System (INIS)

Coyle, S.W.; Shirley, R.S.; Varchol, B.D.

1991-01-01

A major transition in the Fernald Environmental Management Project (FEMP) site mission has occurred over the past few years. The production capabilities formally provided by the FEMP are being transferred to private industry through a vendor qualification program. Environmental compliance and site cleanup are now the primary focus. In line with this program, the production of uranium products at the site was suspended in July 1989 in order to concentrate resources on the environmental mission. Formal termination of the FEMP production mission was accomplished on June 19, 1991. Environmental issues such as stored inventories of process residues materials and equipment are being addressed under the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA). The diversity of these hazards complicates the strategic planning for an integrated site cleanup program. This paper will discuss the programmatic approach which is being implemented to ensure activities such as waste management, site utility and support services, health and safety programs, and Resource Conservation and Recovery Act (RCRA) programs are being integrated with CERCLA. 6 figs., 3 tabs