WorldWideScience

Sample records for site include primers

  1. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  2. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  3. Sellafield Site (including Drigg) emergency scheme manual

    International Nuclear Information System (INIS)

    1987-02-01

    This Scheme defines the organisation and procedures available should there be an accident at the Sellafield Site which results in, or may result in, the release of radioactive material, or the generation of a high radiation field, which might present a hazard to employees and/or the general public. Several categories of emergencies on the Sellafield Site are mentioned; a building emergency which is confined to one building, a Site emergency standby when the effects of a building emergency go outside that building, a Site emergency alert (District Emergency Standby) when a release of activity affects Site operations and could have serious Site effects and a District Emergency Alert when a radioactivity release may interfere with the normal activity of the General Public. A Drigg Emergency Standby situation would operate similarly at the Drigg Site. The detailed arrangements and responsibilities of appointed personnel are set out in this manual. (UK)

  4. Sellafield site (including Drigg) emergency scheme manual

    International Nuclear Information System (INIS)

    1987-02-01

    This Emergency Scheme defines the organisation and procedures available should there be an accident at the Sellafield Site which results in, or may result in, the release of radioactive material, or the generation of a high radiation field, which might present a hazard to employees and/or the general public. This manual covers the general principles of the total emergency scheme and those detailed procedures which are not specific to any single department. (U.K.)

  5. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers.

    Science.gov (United States)

    Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José

    2018-04-01

    Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.

  7. HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

    Science.gov (United States)

    Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

    2016-01-01

    Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

  8. 75 FR 879 - National Semiconductor Corporation Arlington Manufacturing Site Including On-Site Leased Workers...

    Science.gov (United States)

    2010-01-06

    ... engaged in activities related to the production of integrated circuits. The company reports that on-site... Corporation Arlington Manufacturing Site Including On-Site Leased Workers From GCA, CMPA (Silverleaf), Custom..., applicable to workers of National Semiconductor Corporation, Arlington Manufacturing Site, including on-site...

  9. The yeast Ty3 retrotransposon contains a 5'-3' bipartite primer-binding site and encodes nucleocapsid protein NCp9 functionally homologous to HIV-1 NCp7.

    Science.gov (United States)

    Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L

    1998-08-17

    Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs.

  10. PS1-29: Resources to Facilitate Multi-site Collaboration: the PRIMER Research Toolkit

    Science.gov (United States)

    Greene, Sarah; Thompson, Ella; Baldwin, Laura-Mae; Neale, Anne Victoria; Dolor, Rowena

    2010-01-01

    Background and Aims: The national research enterprise has typically functioned in a decentralized fashion, resulting in duplicative or undocumented processes, impeding not only the pace of research, but diffusion of established best practices. To remedy this, many long-standing networks have begun capturing and documenting proven strategies to streamline and standardize various aspects of the research process. The project, “Partnership-driven Resources to IMprove and Enhance Research” (PRIMER), was funded through the Clinical and Translational Science Awards (CTSA) initiative to leverage the collective expertise from two networks: the HMO Research Network and Practice Based Research Networks (PBRNs). Each network has a shared goal of propagating research resources and best practices. Methods: We created and distributed an online survey to 92 CTSA and PBRN representatives in March, 2009 to define critical needs and existing resources that could inform a resource repository. The survey identified barriers and benefits to forming research partnerships, and assessed the perceived utility of various tools that could accelerate the research process. The study team identified, reviewed and organized tools based on the typical research trajectory from design to dissemination. Results: Fifty-five of 92 invitees (59%) completed the survey. Respondents rated the ability to conduct community-relevant research through true academic-community partnerships as the top-rated benefit of multi-site research, followed by the opportunity to accelerate translation of research into practice. The top two perceived barriers to multi-site research were ‘funding opportunities are not adequate (e.g., too few, not enough to support true collaborations), and ‘lack of research infrastructure to support [all] partners (e.g., no IT support, IRB, dedicated research staff). Respondents’ ratings of the utility of various tools and templates was used to guide development of an online

  11. Novel acsF Gene Primers Revealed a Diverse Phototrophic Bacterial Population, Including Gemmatimonadetes, in Lake Taihu (China)

    DEFF Research Database (Denmark)

    Huang, Yili; Zeng, Yanhua; Lu, Hang

    2016-01-01

    Seq sequencing of the 16S rRNA, pufM, and bchY genes was carried out to assess the diversity of local phototrophic communities. In addition, we designed new degenerate primers of aerobic cyclase gene acsF, which serves as a convenient marker for both phototrophic Gemmatimonadetes and phototrophic Proteobacteria...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was ... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...

  12. LNS users primer for accessing government sites on the ARPA network. [MIT. -->. ANL, BNL, LBL, and New York Univ. Courant Inst

    Energy Technology Data Exchange (ETDEWEB)

    Kannel, M.

    1979-06-01

    This primer was developed as part of the study conducted by the Laboratory for Nuclear Science (LNS) on the feasibility of networks for computer resource sharing. The primer is an instructinal guide for the LNS user who would like to access and use computers at other government sites on the ARPA network. The format is a series of scenarios of actual recorded on-line terminal sessions' showing the novice user how to access the foreign site, obtain help documentation, run a simple program, and transfer files to and from the foreign site. Access to the ARPA network in these scenarios is via Multics or the Massachusetts Institute of Technology Terminal Interface Processor. The foreign government sites accessed are the computing facilities at Argonne National Laboratory, Brookhaven National Laboratory, Lawrence Livermore Laboratory, and New York University Courant Institute. This technique of auditing actual terminal sessions as a teaching aid can be extended to include other computing facilities as well as other networks.

  13. Environmental site assessments should include radon gas testing

    International Nuclear Information System (INIS)

    Nardi, M.A.

    1991-01-01

    There are two emerging influences that will require radon gas testing as part of many property transfers and most site assessments. These requirements come from lending regulators and state legislatures. Fannie Mae and others have developed environmental investigation guidelines for the purchase of environmentally contaminated real estate. These guidelines include radon gas testing for many properties. Several states have enacted laws that require environmental disclosure forms be prepared to ensure that the parties involved in certain real estate transactions are aware of the environmental liabilities that may come with the transfer of property. Indiana has recently enacted legislation that would require the disclosure of the presence of radon gas on many commercial real estate transactions. With more lenders and state governments likely to follow this trend, radon gas testing should be performed during all property transfers and site assessment to protect the parties involved from any legal liabilities

  14. Primer on Use of Multi-Spectral and Infra Red Imaging for On-Site Inspections

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, J R

    2010-10-26

    The purpose of an On-Site Inspection (OSI) is to determine whether a nuclear explosion has occurred in violation of the Comprehensive Nuclear Test Ban Treaty (CTBT), and to gather information which might assist in identifying the violator (CTBT, Article IV, Paragraph 35) Multi-Spectral and Infra Red Imaging (MSIR) is allowed by the treaty to detect observables which might help reduce the search area and thus expedite an OSI and make it more effective. MSIR is permitted from airborne measurements, and at and below the surface to search for anomalies and artifacts (CTBT, Protocol, Part II, Paragraph 69b). The three broad types of anomalies and artifacts MSIR is expected to be capable of observing are surface disturbances (disturbed earth, plant stress or anomalous surface materials), human artifacts (man-made roads, buildings and features), and thermal anomalies. The purpose of this Primer is to provide technical information on MSIR relevant to its use for OSI. It is expected that this information may be used for general background information, to inform decisions about the selection and testing of MSIR equipment, to develop operational guidance for MSIR use during an OSI, and to support the development of a training program for OSI Inspectors. References are provided so readers can pursue a topic in more detail than the summary information provided here. The following chapters will provide more information on how MSIR can support an OSI (Section 2), a short summary what Multi-Spectral Imaging and Infra Red Imaging is (Section 3), guidance from the CTBT regarding the use of MSIR (Section 4), and a description of several nuclear explosion scenarios (Section 5) and consequent observables (Section 6). The remaining sections focus on practical aspects of using MSIR for an OSI, such as specification and selection of MSIR equipment, operational considerations for deployment of MISR equipment from an aircraft, and the conduct of field exercises to mature MSIR for an OSI

  15. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    Directory of Open Access Journals (Sweden)

    Veronika Lancíková

    2014-02-01

    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  16. Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

    International Nuclear Information System (INIS)

    Voronin, Yegor A.; Pathak, Vinay K.

    2003-01-01

    Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

  17. Primer on the implementation of a pharmacy intranet site to improve department communication.

    Science.gov (United States)

    Hale, Holly J

    2013-07-01

    The purpose of the article is to describe the experience of selecting, developing, and implementing a pharmacy department intranet site with commentary regarding application to other institutions. Clinical practitioners and supporting staff need an effective, efficient, organized, and user-friendly communication tool to utilize and relay information required to optimize patient care. To create a functional and user-friendly department intranet site, department leadership and staff should be involved in the process from selection of product through implementation. A product that supports both document storage management and communication delivery and has the capability to be customized to provide varied levels of site access is desirable. The designation of an intranet site owner/developer within the department will facilitate purposeful site design and site maintenance execution. A well-designed and up-to-date site along with formal end-user training are essential for staff adoption and continued utilization. Development of a department intranet site requires a considerable time investment by several members of the department. The implementation of an intranet site can be an important step toward achieving improved communications. Staff utilization of this resource is key to its success.

  18. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  19. 76 FR 61741 - Bmc Software, Inc. Including On-Site Leased Workers From COMSYS ITS Including Remote Workers...

    Science.gov (United States)

    2011-10-05

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,540] Bmc Software, Inc... November 23, 2010, applicable to workers of BMC Software, Inc., including on-site leased workers from... BMC Software, inc., including on-site leased workers from Comsys ITS, and including remote workers...

  20. A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Kristensen, K D

    1996-01-01

    , suggesting the involvement of a specific endogenous virus-like sequence in patch repair rescue of the primer binding site mutants. The putative recombination partner RNA was found in virions from psi-2 cells as detected by analysis of glutamine tRNA-initiated cDNA and by sequence analysis of regions...... site to allow correct second-strand transfer in reverse transcription. The system thereby selects for a reverse transcriptase-mediated recombination event in the 5' untranslated region. A panel of sequence differences between the recombination partners in this region has allowed mapping of the site...

  1. 75 FR 16513 - B&C Corporation, JR Engineering Division, Including B&C Distribution Center, Including On-Site...

    Science.gov (United States)

    2010-04-01

    ... Engineering Division, Including B&C Distribution Center, Including On-Site Leased Workers From B&C Services... occurred during the relevant time period at the B&C Distribution Center, Inc. of the B&C Corporation, JR Engineering Division, Barberton, Ohio. The B&C Distribution Center provides distribution and logistical...

  2. 75 FR 66795 - TTM Technologies, Including On-Site Leased Workers From Kelly Services, Aerotek, and an On-Site...

    Science.gov (United States)

    2010-10-29

    ... follows: ``All workers TTM Technologies, including on-site leased workers from Kelly Services and Aerotek... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-64,993] TTM Technologies, Including On-Site Leased Workers From Kelly Services, Aerotek, and an On-Site Leased Worker From Orbotech...

  3. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  4. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  5. 75 FR 41895 - Whirlpool Corporation, Evansville Division, Including On-Site Leased Workers From Andrews...

    Science.gov (United States)

    2010-07-19

    ..., Evansville Division, Including On-Site Leased Workers From Andrews International, Inc., M.H. Equipment, and... 10321). The notice was amended on May 25, 2010 to include on-site leased workers from Andrews... workers of Whirlpool Corporation, Evansville Division, including on-site leased workers from Andrews...

  6. 40 CFR 60.1125 - What must I include in my siting analysis?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 6 2010-07-01 2010-07-01 false What must I include in my siting... § 60.1125 What must I include in my siting analysis? (a) Include an analysis of how your municipal...) Vegetation. (b) Include an analysis of alternatives for controlling air pollution that minimize potential...

  7. 78 FR 19530 - Eastman Kodak Company (GCG), Electrographic Print Solutions, Including On-Site Leased Workers...

    Science.gov (United States)

    2013-04-01

    ... Kodak Company (GCG), Electrographic Print Solutions, Including On-Site Leased Workers From Adecco and Datrose, Spencerport, New York; Eastman Kodak Company, IPS, Including On-Site Leased Workers From Adecco..., 2011, applicable to workers of Eastman Kodak Company (GCG), Electrographic Print Solutions, including...

  8. 78 FR 28642 - Eastman Kodak Company, Electrographic Print Solutions, Including On-Site Leased Workers From...

    Science.gov (United States)

    2013-05-15

    ... Kodak Company, Electrographic Print Solutions, Including On-Site Leased Workers From Adecco and Datrose, Spencerport, New York; Eastman Kodak Company, IPS, Including On-Site Leased Workers From Adecco, Dayton, Ohio... Trade Adjustment Assistance (TAA) filed on behalf of Eastman Kodak Company, Electrographic Print...

  9. 78 FR 12358 - UBS Financial Services, Inc., Wealth Management Americas Operations, Including On-Site Leased...

    Science.gov (United States)

    2013-02-22

    ..., Inc., Wealth Management Americas Operations, Including On-Site Leased Workers From Leafstone... Services, Inc., Wealth Management Americas Operations (UBS), Weehawken, New Jersey. The workers are engaged... to include all leased workers on-site at UBS Financial Services, Inc., Wealth Management Americas...

  10. 75 FR 62423 - Barnstead Thermolyne Corporation, a Subsidiary of Thermo Fisher Scientific, Including On-Site...

    Science.gov (United States)

    2010-10-08

    ... related to the production of scientific laboratory equipment. New information shows that workers leased... Corporation, a Subsidiary of Thermo Fisher Scientific, Including On-Site Leased Workers From Sedona Staffing... Scientific, including on- site leased workers from Sedona Staffing, Dubuque, Iowa. The notice was published...

  11. 75 FR 32221 - Whirlpool Corporation, Evansville Division, Including On-Site Leased Workers from Andrews...

    Science.gov (United States)

    2010-06-07

    ..., Evansville Division, Including On-Site Leased Workers from Andrews International, Inc., Evansville, IN... that workers leased from Andrews International, Inc. were employed on-site at the Evansville, Indiana... findings, the Department is amending this certification to include leased workers from Andrews...

  12. 75 FR 28295 - Cummins Filtration, Including On-Site Leased Workers From Manpower and Spherion Staffing...

    Science.gov (United States)

    2010-05-20

    .... The Department has determined that workers from Spherion Staffing were sufficiently under the control..., Including On-Site Leased Workers From Manpower and Spherion Staffing, Including On-Site Workers From Hagemeyer North America, Lake Mills, IA; Amended Certification Regarding Eligibility To Apply for Worker...

  13. 76 FR 81986 - Honeywell International, Inc., Automation and Control Solutions Division, Including On-Site...

    Science.gov (United States)

    2011-12-29

    ..., Inc., Automation and Control Solutions Division, Including On-Site Leased Workers From Manpower...., Automation and Control Solutions Division. The Department has determined that these workers were sufficiently...., Automation and Control Solutions Division, including on-site leased workers from Manpower, Spherion...

  14. 76 FR 175 - Faurecia Emissions Control Technologies Including On-Site Leased Workers From Adecco Employment...

    Science.gov (United States)

    2011-01-03

    ... Technologies Including On-Site Leased Workers From Adecco Employment Servcies and Emcon Technologies, Troy, MI..., applicable to workers of Faurecia Emissions Control Technologies, Troy, Michigan, including on-site leased workers from Adecco Employment Services, Troy, Michigan. The Department's notice of determination was...

  15. Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

    Science.gov (United States)

    Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

    2017-11-01

    Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

  16. 78 FR 48468 - Delphi Corporation, Electronics and Safety Division, Including On-Site Leased Workers From...

    Science.gov (United States)

    2013-08-08

    ..., Electronics and Safety Division, Including On-Site Leased Workers From Securitas, Bartech, Flint Janitorial... Adjustment Assistance on May 20, 2013, applicable to workers of Delphi Corporation, Electronics and Safety... on- site at the Flint, Michigan location of Delphi Corporation, Electronics and Safety Division. The...

  17. 77 FR 4368 - Abbott Laboratories, Diagnostics Division, Including On-Site Leased Workers From Manpower...

    Science.gov (United States)

    2012-01-27

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-75,201] Abbott Laboratories..., applicable to workers of Abbott Laboratories, Diagnostics Division, including on-site leased workers from... (clerical) were employed on-site at the Irving, Texas location of Abbott Laboratories, Diagnostics Division...

  18. 76 FR 2144 - Quest Diagnostics, Inc. Information Technology Help Desk Services Including On-Site Leased...

    Science.gov (United States)

    2011-01-12

    .... Information Technology Help Desk Services Including On-Site Leased Workers From Modis, West Norriton, PA..., applicable to workers of Quest Diagnostics, Inc., Information Technology Help Desk Services, West Norriton... Quest Diagnostics, Inc., Information Technology Help Desk [[Page 2145

  19. 75 FR 49526 - Halliburton Company, Duncan Mfg., Including On-Site Leased Workers from Express Personnel...

    Science.gov (United States)

    2010-08-13

    ... Company, Duncan Mfg., Including On-Site Leased Workers from Express Personnel, Clayton Personnel Service, and Manpower Planning, Duncan, OK; Halliburton Company, Technology and Engineering Division, Finance... Halliburton Company, Technology and Engineering Division, and Finance and Administration Division, Duncan...

  20. 76 FR 13666 - Pitney Bowes, Inc., Mailing Solutions Management, Global Engineering Group, Including On-Site...

    Science.gov (United States)

    2011-03-14

    ...., Mailing Solutions Management, Global Engineering Group, Including On-Site Leased Workers From Guidant... workers and former workers of Pitney Bowes, Inc., Mailing Solutions Management Division, Engineering... reviewed the certification to clarify the subject worker group's identity. Additional information revealed...

  1. Characterization of a nucleocapsid-like region and of two distinct primer tRNALys,2 binding sites in the endogenous retrovirus Gypsy.

    Science.gov (United States)

    Gabus, Caroline; Ivanyi-Nagy, Roland; Depollier, Julien; Bucheton, Alain; Pelisson, Alain; Darlix, Jean-Luc

    2006-01-01

    Mobile LTR-retroelements comprising retroviruses and LTR-retrotransposons form a large part of eukaryotic genomes. Their mode of replication and abundance favour the notion that they are major actors in eukaryote evolution. The Gypsy retroelement can spread in the germ line of the fruit fly Drosophila melanogaster via both env-independent and env-dependent processes. Thus, Gypsy is both an active retrotransposon and an infectious retrovirus resembling the gammaretrovirus MuLV. However, unlike gammaretroviruses, the Gypsy Gag structural precursor is not processed into Matrix, Capsid and Nucleocapsid (NC) proteins. In contrast, it has features in common with Gag of the ancient yeast TY1 retroelement. These characteristics of Gypsy make it a very interesting model to study replication of a retroelement at the frontier between ancient retrotransposons and retroviruses. We investigated Gypsy replication using an in vitro model system and transfection of insect cells. Results show that an unstructured domain of Gypsy Gag has all the properties of a retroviral NC. This NC-like peptide forms ribonucleoparticle-like complexes upon binding Gypsy RNA and directs the annealing of primer tRNA(Lys,2) to two distinct primer binding sites (PBS) at the genome 5' and 3' ends. Only the 5' PBS is indispensable for cDNA synthesis in vitro and in Drosophila cells.

  2. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  3. 76 FR 14101 - Meadwestvaco Corporation, Consumer and Office Products Division, Including On-Site Leased Workers...

    Science.gov (United States)

    2011-03-15

    ... undated planning and organizing products. The review shows that on August 21, 2008, a certification of..., Consumer and Office Products Division, Including On-Site Leased Workers From Pro-Tel People, Sidney, NY; Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance In accordance with...

  4. 76 FR 73683 - Whirlpool Corporation, Including On-Site Leased Workers From Career Solutions TEC Staffing...

    Science.gov (United States)

    2011-11-29

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,593] Whirlpool Corporation, Including On-Site Leased Workers From Career Solutions TEC Staffing, Andrews International, IBM Corporation... refrigerators and trash compactors. The notice was published in the Federal Register on October 25, 2010 (75 FR...

  5. 76 FR 72978 - Whirlpool Corporation Including On-Site Leased Workers From Career Solutions TEC Staffing...

    Science.gov (United States)

    2011-11-28

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,593] Whirlpool Corporation Including On-Site Leased Workers From Career Solutions TEC Staffing, Andrews International, IBM Corporation... workers are engaged in the production of refrigerators and trash compactors. The notice was published in...

  6. 75 FR 11922 - Apria Healthcare, Including On-Site Leased Workers From Corestaff, Ultimate Staffing (Roth...

    Science.gov (United States)

    2010-03-12

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-71,054C] Apria Healthcare..., 2009, applicable to workers of Apria Healthcare, including on-site leased workers from Corestaff... subject firm. The workers are engaged in activities related to the information technology and patient...

  7. 75 FR 76487 - Haldex Brake Corporation, Commercial Vehicle Systems, Including On-Site Leased Workers of...

    Science.gov (United States)

    2010-12-08

    ..., Commercial Vehicle Systems, Including On-Site Leased Workers of Johnston Integration Technologies, a... Adjustment Assistance In accordance with Section 223 of the Trade Act of 1974, as amended (``Act''), 19 U.S.C... system components. The company reports that workers leased from Johnston Integration Technologies, a...

  8. 77 FR 48550 - Technicolor Creative Services, Post Production Feature Mastering Division Including On-Site...

    Science.gov (United States)

    2012-08-14

    ... Services, Post Production Feature Mastering Division Including On-Site Leased Workers From Ajilon... Services, Post Production Feature Mastering Division, Hollywood, California (subject firm). The worker... the workers meet the eligibility requirements of the Trade Act of 1974. Conclusion After careful...

  9. 78 FR 52982 - Regal Beloit Corporation; Springfield, Missouri Division Including On-site Leased Workers From...

    Science.gov (United States)

    2013-08-27

    ... these workers were sufficiently under the control of the subject firm to be considered leased workers...; Springfield, Missouri Division Including On-site Leased Workers From Penmac Personnel Services and GCA Services Group Springfield, Missouri; Amended Certification Regarding Eligibility to Apply for Worker...

  10. 75 FR 77664 - Honeywell International, Inc., Automation and Control Solutions Division, Including On-Site...

    Science.gov (United States)

    2010-12-13

    ..., Inc., Automation and Control Solutions Division, Including On-Site Leased Workers From Manpower... Solutions Division. The Department has determined that these workers were sufficiently under the control of Honeywell International, Inc., Automation and Control Solutions Division to be considered leased workers...

  11. 78 FR 8587 - Thomson Reuters, Finance Operations & Technology Division, Including On-Site Leased Workers From...

    Science.gov (United States)

    2013-02-06

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,755] Thomson Reuters, Finance Operations & Technology Division, Including On-Site Leased Workers From Adecco; Eagan, MN; Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance In accordance with Section 223 of the Trade Act of 1974, as amended (`...

  12. A Study on Site Selecting for National Project including High Level Radioactive Waste Disposal

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kilyoo [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2016-10-15

    Many national projects are stopped since sites for the projects are not determined. The sites selections are hold by NIMBY for unpleasant facilities or by PYMFY for preferable facilities among local governments. The followings are the typical ones; NIMBY projects: high level radioactive waste disposal, THAAD, Nuclear power plant(NPP), etc. PIMFY projects: South-east new airport, KTX station, Research center for NPP decommission, etc. The site selection for high level radioactive waste disposal is more difficult problem, and thus government did not decide and postpone to a dead end street. Since it seems that there is no solution for site selection for high level radioactive waste disposal due to NIMBY among local governments, a solution method is proposed in this paper. To decide a high level radioactive waste disposal, the first step is to invite a bid by suggesting a package deal including PIMFY projects such as Research Center for NPP decommission. Maybe potential host local governments are asked to submit sealed bids indicating the minimum compensation sum that they would accept the high level radioactive waste disposal site. If there are more than one local government put in a bid, then decide an adequate site by considering both the accumulated PESS point and technical evaluation results. By considering how fairly preferable national projects and unpleasant national projects are distributed among local government, sites selection for NIMBY or PIMFY facilities is suggested. For NIMBY national projects, risk, cost benefit analysis is useful and required since it generates cost value to be used in the PESS. For many cases, the suggested method may be not adequate. However, similar one should be prepared, and be basis to decide sites for NIMBY or PIMFY national projects.

  13. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  14. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  15. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  16. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  17. 76 FR 19466 - Masco Builder Cabinet Group Including On-Site Leased Workers From Reserves Network, Reliable...

    Science.gov (United States)

    2011-04-07

    ... Builder Cabinet Group Including On-Site Leased Workers From Reserves Network, Reliable Staffing, and Third Dimension Waverly, OH; Masco Builder Cabinet Group Including On-Site Leased Workers From Reserves Network... Group including on-site leased workers from Reserves Network, Jackson, Ohio. The workers produce...

  18. Centredale Manor Superfund Site in Rhode Island included on EPA List of Targeted for Immediate Attention

    Science.gov (United States)

    Today, the U.S. Environmental Protection Agency released the list of Superfund sites that Administrator Pruitt has targeted for immediate and intense attention. The Centredale Manor Restoration Project superfund site is one of the 21 sites on the list.

  19. 77 FR 40638 - Syniverse Technologies, Inc., Including On-Site Leased Workers From Insight Global Stone Staffing...

    Science.gov (United States)

    2012-07-10

    ..., Inc., Including On-Site Leased Workers From Insight Global Stone Staffing, and Randstad Formerly Known..., Massachusetts, including on-site leased workers from Insight Global, Stone Staffing, Randstad formerly known as... Insight Global, Stone Staffing, Randstad, formerly known as Sapphire Technologies, were employed on-site...

  20. 75 FR 26793 - Beam Global Spirits & Wine, Including On-Site Leased Workers from Adecco, St. Elizabeth Business...

    Science.gov (United States)

    2010-05-12

    ... & Wine, Including On-Site Leased Workers from Adecco, St. Elizabeth Business Health, Guardsmark, and Lab... 26, 2010, applicable to workers of Beam Global Spirits & Wine, including on-site leased workers from... on-site at the Cincinnati, Ohio location of Beam Global Spirits & Wine. The Department has determined...

  1. 75 FR 3250 - Glaxosmithkline, Including On-Site Temporary and Leased Workers From Kelly Services, Kelly...

    Science.gov (United States)

    2010-01-20

    ... subject firm. The workers are engaged in the production of penicillin-based antibiotics for humans and animals. The company reports that on-site leased workers from Dream Clean, Inc. were employed on-site at...

  2. Telecommunications Primer

    OpenAIRE

    Joseph Becker

    2013-01-01

    A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  3. Telecommunications Primer

    Directory of Open Access Journals (Sweden)

    Joseph Becker

    2013-05-01

    Full Text Available A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  4. 76 FR 27366 - CEVA Freight, LLC, Dell Logistics Division, Including On-Site Leased Workers From Prologistix...

    Science.gov (United States)

    2011-05-11

    ... Logistics Division, Including On-Site Leased Workers From Prologistix, Including Workers Whose Unemployment..., applicable to workers of CEVA Freight, LLC, Dell Logistics Division, including on-site leased workers from... workers employed at CEVA Freight, LLC, Dell Logistics Division, Winston-Salem, North Carolina who were...

  5. 77 FR 21588 - Hart and Cooley, Inc., A Subsidiary of Tomkins, PLC Including On-Site Leased Workers from...

    Science.gov (United States)

    2012-04-10

    ... Subsidiary of Tomkins, PLC Including On- Site Leased Workers from Reliable, Masiello Employment Services..., applicable to workers of Hart and Cooley, Inc., a subsidiary of Tomkins, PLC, including on-site leased... workers. Based on these findings, the Department is amending this certification to include workers leased...

  6. 78 FR 61389 - Sanyo Solar of Oregon, LLC, Wafer Slicing and Quality Control Operations, Including On-Site...

    Science.gov (United States)

    2013-10-03

    ..., LLC, Wafer Slicing and Quality Control Operations, Including On-Site Leased Workers From Brown and... Quality Control Operations, Salem, Oregon, including on-site leased workers from Brown and Dunton, Inc... and included workers who supplied quality control and support functions. The company reports that...

  7. 77 FR 62535 - Hydro Aluminum North America, Inc., Midwest Region, Including On-Site Leased Workers From...

    Science.gov (United States)

    2012-10-15

    ... Aluminum North America, Inc., Midwest Region, Including On- Site Leased Workers From Employment Group, Aerotek, and Manpower, Kalamazoo, Michigan; Hydro Aluminum North America, Inc., Midwest Region, Including... Aluminum North America, Inc., Kalamazoo, Michigan. The subject worker group includes on-site leased workers...

  8. Surface wave site characterization at 27 locations near Boston, Massachusetts, including 2 strong-motion stations

    Science.gov (United States)

    Thompson, Eric M.; Carkin, Bradley A.; Baise, Laurie G.; Kayen, Robert E.

    2014-01-01

    The geotechnical properties of the soils in and around Boston, Massachusetts, have been extensively studied. This is partly due to the importance of the Boston Blue Clay and the extent of landfill in the Boston area. Although New England is not a region that is typically associated with seismic hazards, there have been several historical earthquakes that have caused significant ground shaking (for example, see Street and Lacroix, 1979; Ebel, 1996; Ebel, 2006). The possibility of strong ground shaking, along with heightened vulnerability from unreinforced masonry buildings, motivates further investigation of seismic hazards throughout New England. Important studies that are pertinent to seismic hazards in New England include source-parameter studies (Somerville and others, 1987; Boore and others, 2010), wave-propagation studies (Frankel, 1991; Viegas and others, 2010), empirical ground-motion prediction equations (GMPE) for computing ground-motion intensity (Tavakoli and Pezeshk, 2005; Atkinson and Boore, 2006), site-response studies (Hayles and others, 2001; Ebel and Kim, 2006), and liquefaction studies (Brankman and Baise, 2008). The shear-wave velocity (VS) profiles collected for this report are pertinent to the GMPE, site response, and liquefaction aspects of seismic hazards in the greater Boston area. Besides the application of these data for the Boston region, the data may be applicable throughout New England, through correlations with geologic units (similar to Ebel and Kim, 2006) or correlations with topographic slope (Wald and Allen, 2007), because few VS measurements are available in stable tectonic regions.Ebel and Hart (2001) used felt earthquake reports to infer amplification patterns throughout the greater Boston region and noted spatial correspondence with the dominant period and amplification factors obtained from ambient noise (horizontal-to-vertical ratios) by Kummer (1998). Britton (2003) compiled geotechnical borings in the area and produced a

  9. 77 FR 29362 - Kohler Company, Malvern Division, Including On-Site Leased Workers From Manpower Staffing and Dow...

    Science.gov (United States)

    2012-05-17

    ... Division, Including On-Site Leased Workers From Manpower Staffing and Dow Cleaning Services, Malvern, AR..., and components. The company reports that workers from Dow Cleaning Services were employed on-site at... leased from Dow Cleaning Services working on-site at the Malvern, Arkansas location of Kohler Company...

  10. 77 FR 13352 - Exxonmobil Chemical Company Films Business Division Including on-Site Leased Workers From...

    Science.gov (United States)

    2012-03-06

    ..., Take Care Corporation, Conestoga Rovers and Associates, Phillips Engineering, Rockwell Engineering, Excel Logistics, and American Food and Vending, Calhoun Spotting Service, and Job World working on-site...

  11. 75 FR 76038 - Zach System Corporation a Subdivision of Zambon Company, SPA Including On-Site Leased Workers of...

    Science.gov (United States)

    2010-12-07

    ... Subdivision of Zambon Company, SPA Including On-Site Leased Workers of Turner Industries and Go Johnson, La..., including on-site leased workers from Turner Industries and Go Johnson, La Porte, Texas. The Department's... investigation revealed that Zach System Corporation is a subdivision of Zambon Company, SPA, not Zach System SPA...

  12. 76 FR 16447 - ETHICON, a Subsidiary of Johnson & Johnson Including On-Site Leased Workers From Kelly Temporary...

    Science.gov (United States)

    2011-03-23

    ... workers of ETHICON, A Johnson and Johnson Company, San Angelo, Texas, separated from employment on or... Johnson & Johnson Including On-Site Leased Workers From Kelly Temporary Services, San Angelo, TX; Amended... of ETHICON, a subsidiary of Johnson & Johnson, including on-site leased workers from Kelly Temporary...

  13. 75 FR 76037 - HAVI Logistics, North America a Subsidiary of HAVI Group, LP Including On-Site Leased Workers of...

    Science.gov (United States)

    2010-12-07

    ... Logistics, North America a Subsidiary of HAVI Group, LP Including On-Site Leased Workers of Express Personnel Services and the La Salle Network, Bloomingdale, IL; Havi Logistics, North America, Lisle, IL..., applicable to workers of HAVI Logistics, North America, a subsidiary of HAVI Group, LP, including on-site...

  14. 75 FR 38128 - Ceva Freight, LLC, Dell Logistics Division, Including On-Site Leased Workers From Prologistix and...

    Science.gov (United States)

    2010-07-01

    ... Logistics Division, Including On-Site Leased Workers From Prologistix and Employment Staffing Solutions... 19, 2010, applicable to workers of CEVA Freight, LLC, Dell Logistics Division, including on-site..., North Carolina location of CEVA Freight, LLC, Dell Logistics Division. The Department has determined...

  15. 75 FR 55613 - Dupont Teijin Films Including On-Site Leased Workers From Schenkers Logistics, Inc., Florence, SC...

    Science.gov (United States)

    2010-09-13

    ... Including On-Site Leased Workers From Schenkers Logistics, Inc., Florence, SC; Amended Certification... Teijin Films, including on-site leased workers from Schenkers Logistics, Inc., Florence, South Carolina... leased workers of Schenkers Logistics, Inc., Florence, South Carolina, who became totally or partially...

  16. 75 FR 11921 - Heritage Aviation, Ltd., Including On-Site Leased Workers From Global Technical Services and...

    Science.gov (United States)

    2010-03-12

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-72,924] Heritage Aviation, Ltd., Including On-Site Leased Workers From Global Technical Services and Global, Inc. (Global Employment... from Heritage Aviation, Ltd, including on-site leased workers from Global Technical Services, Grand...

  17. 76 FR 50272 - West, A Thomson Reuters Business, Thomson Reuters Legal Division, Including On-Site Leased...

    Science.gov (United States)

    2011-08-12

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-75,099] West, A Thomson Reuters Business, Thomson Reuters Legal Division, Including On-Site Leased Workers From Adecco, Albuquerque, New... former workers of West, A Thomson Reuters Business, Thomson Reuters Legal Division, including On-Site...

  18. 78 FR 2287 - Daimler Buses North America, Inc., a Subsidiary of Daimler North America Corp, Including On-Site...

    Science.gov (United States)

    2013-01-10

    ... subsidiary of Daimler North America Corp., including on-site leased workers from Noramtec, First Choice... America, Inc., a Subsidiary of Daimler North America Corp, Including On-Site Leased Workers From Noramtec, First Choice Staffing, Staff Works, and Mr. Santo Lamarco From Wurth Revcar Fasteners, Inc., Oriskany...

  19. 75 FR 45166 - Jeld-Wen, Inc., Hawkins Window Division, Including On-Site Leased Workers of Nicolet Staffing...

    Science.gov (United States)

    2010-08-02

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-71,014] Jeld-Wen, Inc., Hawkins Window Division, Including On-Site Leased Workers of Nicolet Staffing, Hawkins, WI; Notice of Negative...., Hawkins Window Division, including on-site leased workers of Nicolet Staffing, Hawkins, Wisconsin. Signed...

  20. 78 FR 21155 - Eastman Kodak Company, IPS-Dayton Location, Including On-site Leased Workers From Adecco, Dayton...

    Science.gov (United States)

    2013-04-09

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,387] Eastman Kodak Company, IPS--Dayton Location, Including On-site Leased Workers From Adecco, Dayton, Ohio; Notice of... and former workers of Eastman Kodak Company, IPS--Dayton Location, including on-site leased workers...

  1. 77 FR 3499 - Sony Electronics, Inc., Including On-Site Leased Workers From Selectremedy Park Ridge, NJ...

    Science.gov (United States)

    2012-01-24

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-71,501M] Sony Electronics, Inc... Electronics, Inc., SEL Headquarters, including on-site leased workers of SelectRemedy, StaffMark, and Payrolling.com , San Diego, California (TA-W-71,501); Sony Electronics, Inc., including on-site leased...

  2. 76 FR 62452 - Avon Products, Inc. Including On-Site Leased Workers From Spherion/Source Right, Springdale, OH...

    Science.gov (United States)

    2011-10-07

    .... Including On-Site Leased Workers From Spherion/Source Right, Springdale, OH; Amended Certification Regarding... workers of the subject firm. The company reports that workers leased from Spherion/Source Right were...., including on-site leased workers from Spherion/Source Right, Springdale, Ohio, who became totally or...

  3. 76 FR 62451 - Avon Products, Inc., Including On-Site Leased Workers From Spherion/Source Right, Springdale...

    Science.gov (United States)

    2011-10-07

    ...., Including On-Site Leased Workers From Spherion/Source Right, Springdale, Ohio; Amended Certification... workers of the subject firm. The company reports that workers leased from Spherion/Source Right were...., including on-site leased workers from Spherion/Source Right, Springdale, Ohio, who became totally or...

  4. 75 FR 5147 - Acushnet Company a Subsidiary of Fortune Brands Including On-Site Leased Workers From Olsten...

    Science.gov (United States)

    2010-02-01

    ...,763B] Acushnet Company a Subsidiary of Fortune Brands Including On-Site Leased Workers From Olsten Staffing Services Fairhaven, MA; Acushnet Company a Subsidiary of Fortune Brands Including On-Site Leased Workers From Olsten Staffing Services New Bedford, MA; Acushnet Company a Subsidiary of Fortune Brands...

  5. 76 FR 2145 - International Paper Company, Franklin Pulp & Paper Mill, Including On-Site Leased Workers From...

    Science.gov (United States)

    2011-01-12

    ... Company, Franklin Pulp & Paper Mill, Including On-Site Leased Workers From Railserve, Franklin, VA..., applicable to workers and former workers of International Paper Company, Franklin Pulp & Paper Mill, Franklin... follows: All workers International Paper Company, Franklin Pulp & Paper Mill, including on-site leased...

  6. 78 FR 12358 - Cardinal Health, Financial Shared Services West, Including On-Site Leased Workers From Aerotek...

    Science.gov (United States)

    2013-02-22

    ... office financial services from India and the Philippines. Based on these findings, the Department is..., Financial Shared Services West, Including On- Site Leased Workers From Aerotek, eXcel Staffing, Experis..., applicable to workers of Cardinal Health, Financial Shared Services West, including on-site leased workers...

  7. De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

    Science.gov (United States)

    Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

    2011-02-10

    Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open

  8. Molecular diversity analysis of Tetradium ruticarpum (WuZhuYu) in China based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers.

    Science.gov (United States)

    Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian

    2018-01-01

    "Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  9. 76 FR 19467 - Weyerhaeuser Company, Corporate Headquarters Including On-Site Leased Workers From Volt Services...

    Science.gov (United States)

    2011-04-07

    ... employed on-site at the Federal Way, Washington location of Weyerhaeuser Company, Corporate Headquarters... Company, Corporate Headquarters to be considered leased workers. Based on these findings, the Department... Federal Way, Washington location of Weyerhaeuser Company, Corporate Headquarters. The amended notice...

  10. 75 FR 70688 - Actel Corporation, Currently Known as Microsemi Corporation, Including On-Site Leased Workers...

    Science.gov (United States)

    2010-11-18

    ..., Accountants, Inc. and Accountant Temps Mountain View, CA; Amended Certification Regarding Eligibility To Apply... on-site leased workers from ATR International, Accountants, Inc., and Accountant Temps, Mountain View... a separate unemployment insurance (UI) tax account under the name Microsemi Corporation. Accordingly...

  11. 75 FR 21353 - Intel Corporation, Fab 20 Division, Including On-Site Leased Workers From Volt Technical...

    Science.gov (United States)

    2010-04-23

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-73,642] Intel Corporation, Fab 20... of Intel Corporation, Fab 20 Division, including on-site leased workers of Volt Technical Resources... Precision, Inc. were employed on-site at the Hillsboro, Oregon location of Intel Corporation, Fab 20...

  12. 75 FR 20390 - Robert Bosch LLC, Including On-Site Leased Workers From Bosch Management Services North America...

    Science.gov (United States)

    2010-04-19

    ...-site leased workers of Bosch Management Services North America, South Haven Community Hospital... leased workers of Bosch Management Services North America, South Haven Community Hospital, Huffmaster Inc..., Including On-Site Leased Workers From Bosch Management Services North America, South Haven Community...

  13. 76 FR 61740 - Geneon Entertainment (USA) Including On-Site Leased Workers From Interplace, Inc., Apple One and...

    Science.gov (United States)

    2011-10-05

    ...) Including On-Site Leased Workers From Interplace, Inc., Apple One and Robert Half Legal Santa Monica, CA...-site leased workers from Interplace, Inc., and Apple One, Santa Monica, California. The workers are... from Interplace, Inc., Apple One and Robert Half Legal, Santa Monica, California, who became totally or...

  14. 75 FR 453 - FLSMidth, Inc., Cement Division, Product Engineering, Including On-Site Leased Workers of Aerotek...

    Science.gov (United States)

    2010-01-05

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-72,048] FLSMidth, Inc., Cement..., Inc., Cement Division, Product Engineering, including on-site leased workers of Aerotek Contract.... were also employed on-site at FLSmidth, Inc., Cement Division, Product Engineering, Bethlehem...

  15. 78 FR 8587 - American Showa, Inc.; Blanchester Plant, Including On-Site Leased Workers From Adecco and Sims...

    Science.gov (United States)

    2013-02-06

    ....; Blanchester Plant, Including On-Site Leased Workers From Adecco and Sims Bros., Inc.; Blanchester, OH; Amended... workers from Sims Bros., Inc. were working on-site at the subject firm during the relevant period and that the services supplied by Sims Bros., Inc. were related to the production of gear boxes (and parts...

  16. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  17. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  18. 77 FR 14832 - Plumchoice, Inc., Including On-Site Leased Workers From Balance Staffing, Insight Global Staffing...

    Science.gov (United States)

    2012-03-13

    ...., Including On-Site Leased Workers From Balance Staffing, Insight Global Staffing, and Technisource..., Insight Global Staffing, and Technisource, Scarborough, Maine. The workers are engaged in activities... leased workers from Balance Staffing, Insight Global Staffing, and Technisource, Scarborough, Maine, who...

  19. 77 FR 70478 - RG Steel Wheeling, LLC, Wheeling Office, A Division Of RG Steel, LLC, Including On-Site Leased...

    Science.gov (United States)

    2012-11-26

    ... Unlimited and Green Energy Initiatives LLC, Including Workers Whose Wages Were Reported Through Severstal..., Wheeling Office, a division of RG Steel, LLC, including on-site leased workers from Pro Unlimited and Green Energy Initiatives, LLC, Wheeling, West Virginia (TA-W-81,880) and Mountain State Carbon, LLC, including...

  20. Improved detection of genetic markers of antimicrobial resistance by hybridization probe-based melting curve analysis using primers to mask proximal mutations: examples include the influenza H275Y substitution.

    Science.gov (United States)

    Whiley, David M; Jacob, Kevin; Nakos, Jennifer; Bletchly, Cheryl; Nimmo, Graeme R; Nissen, Michael D; Sloots, Theo P

    2012-06-01

    Numerous real-time PCR assays have been described for detection of the influenza A H275Y alteration. However, the performance of these methods can be undermined by sequence variation in the regions flanking the codon of interest. This is a problem encountered more broadly in microbial diagnostics. In this study, we developed a modification of hybridization probe-based melting curve analysis, whereby primers are used to mask proximal mutations in the sequence targets of hybridization probes, so as to limit the potential for sequence variation to interfere with typing. The approach was applied to the H275Y alteration of the influenza A (H1N1) 2009 strain, as well as a Neisseria gonorrhoeae mutation associated with antimicrobial resistance. Assay performances were assessed using influenza A and N. gonorrhoeae strains characterized by DNA sequencing. The modified hybridization probe-based approach proved successful in limiting the effects of proximal mutations, with the results of melting curve analyses being 100% consistent with the results of DNA sequencing for all influenza A and N. gonorrhoeae strains tested. Notably, these included influenza A and N. gonorrhoeae strains exhibiting additional mutations in hybridization probe targets. Of particular interest was that the H275Y assay correctly typed influenza A strains harbouring a T822C nucleotide substitution, previously shown to interfere with H275Y typing methods. Overall our modified hybridization probe-based approach provides a simple means of circumventing problems caused by sequence variation, and offers improved detection of the influenza A H275Y alteration and potentially other resistance mechanisms.

  1. 75 FR 76040 - Weyerhaeuser Company Corporate Headquarters Including On-Site Leased Workers From Volt Services...

    Science.gov (United States)

    2010-12-07

    ... Assistance on June 2, 2010, applicable to workers of Weyerhaeuser Company, Corporate Headquarters, including... Weyerhaeuser Company, Corporate Headquarters to be considered leased workers. Based on these findings, the... the Federal Way, Washington location of Weyerhaeuser Company, Corporate Headquarters. The amended...

  2. The surgical care improvement project and prevention of post-operative infection, including surgical site infection.

    Science.gov (United States)

    Rosenberger, Laura H; Politano, Amani D; Sawyer, Robert G

    2011-06-01

    In response to inconsistent compliance with infection prevention measures, the Centers for Medicare & Medicaid Services collaborated with the U.S. Centers for Disease Control and Prevention on the Surgical Infection Prevention (SIP) project, introduced in 2002. Quality improvement measures were developed to standardize processes to increase compliance. In 2006, the Surgical Care Improvement Project (SCIP) developed out of the SIP project and its process measures. These initiatives, published in the Specifications Manual for National Inpatient Quality Measures, outline process and outcome measures. This continually evolving manual is intended to provide standard quality measures to unify documentation and track standards of care. Seven of the SCIP initiatives apply to the peri-operative period: Prophylactic antibiotics should be received within 1 h prior to surgical incision (1), be selected for activity against the most probable antimicrobial contaminants (2), and be discontinued within 24 h after the surgery end-time (3); (4) euglycemia should be maintained, with well-controlled morning blood glucose concentrations on the first two post-operative days, especially in cardiac surgery patients; (6) hair at the surgical site should be removed with clippers or by depilatory methods, not with a blade; (9) urinary catheters are to be removed within the first two post-operative days; and (10) normothermia should be maintained peri-operatively. There is strong evidence that implementation of protocols that standardize practices reduce the risk of surgical infection. The SCIP initiative targets complications that account for a significant portion of preventable morbidity as well as cost. One of the goals of the SCIP guidelines was a 25% reduction in the incidence of surgical site infections from implementation through 2010. Process measures are becoming routine, and as we practice more evidence-based medicine, it falls to us, the surgeons and scientists, to be active

  3. 78 FR 66779 - United States Enrichment Corporation, Paducah Gaseous Diffusion Plant, Including On-Site Leased...

    Science.gov (United States)

    2013-11-06

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-82,862] United States Enrichment..., applicable to workers of United States Enrichment Corporation, Paducah Gaseous Diffusion Plant, including on... were engaged in the production of low enrichment uranium. The company reports that workers leased from...

  4. 78 FR 54487 - Abbott Laboratories; Diagnostic-Hematology; Including On-Site Leased Workers From Manpower...

    Science.gov (United States)

    2013-09-04

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-82,379] Abbott Laboratories... February 22, 2013, applicable to workers of Abbott Laboratories, Diagnostic--Hematology division, including... Clara, California location of Abbott Laboratories, Diagnostic--Hematology Division. The Department has...

  5. 76 FR 45879 - West, a Thomson Reuters Business, Thomson Reuters Legal, Including On-Site Leased Workers From...

    Science.gov (United States)

    2011-08-01

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-73,198] West, a Thomson Reuters Business, Thomson Reuters Legal, Including On-Site Leased Workers From Adecco, Including a Teleworker...-W-73,198 is hereby issued as follows: All workers of West, A Thomson Reuters Business, Thomson...

  6. Cleanup procedures at the Nevada Test Site and at other radioactively contaminated sites including representative costs of cleanup and treatment of contaminated areas

    International Nuclear Information System (INIS)

    Talmage, S.S.; Chilton, B.D.

    1987-09-01

    This review summarizes available information on cleanup procedures at the Nevada Test Site and at other radioactively contaminated sites. Radionuclide distribution and inventory, size of the contaminated areas, equipment, and cleanup procedures and results are included. Information about the cost of cleanup and treatment for contaminated land is presented. Selected measures that could be useful in estimating the costs of cleaning up radioactively contaminated areas are described. 76 refs., 16 tabs

  7. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  8. 76 FR 2145 - Masco Builder Cabinet Group Including On-Site Leased Workers From Reserves Network, Jackson, OH...

    Science.gov (United States)

    2011-01-12

    ...,287B; TA-W-71,287C] Masco Builder Cabinet Group Including On-Site Leased Workers From Reserves Network, Jackson, OH; Masco Builder Cabinet Group, Waverly, OH; Masco Builder Cabinet Group, Seal Township, OH; Masco Builder Cabinet Group, Seaman, OH; Amended Certification Regarding Eligibility To Apply for Worker...

  9. 75 FR 11920 - General Electric Lighting-Ravenna Lamp Plant, Lighting Division, Including On-Site Leased Workers...

    Science.gov (United States)

    2010-03-12

    ... to the production of high intensity discharge lamps. The review shows that on August 24, 2007, a...-Ravenna Lamp Plant, Lighting Division, Including On-Site Leased Workers from Devore Technologies, Ravenna..., 2009, applicable to workers of General Electric Lighting-Ravenna Lamp Plant, Lighting Division...

  10. 75 FR 28657 - Dell Products LP-Parmer North Location, a Subsidiary of Dell, Inc., Including On-Site Leased...

    Science.gov (United States)

    2010-05-21

    ... Spherion Corporation; Round Rock, TX; Dell Products LP--Parmer North One; Austin, TX; Amended Certification... Products LP--Parmer North Location, a Subsidiary of Dell, Inc., Including On-Site Leased Workers From... Act of 1974, as amended (``Act''), 19 U.S.C. 2273, the Department of Labor issued a Certification of...

  11. 75 FR 38127 - Visteon Systems, LLC North Penn Plant Electronics Products Group Including On-Site Leased Workers...

    Science.gov (United States)

    2010-07-01

    ..., North Penn Plant, Electronics Products Group to be covered by this certification. The intent of the... North Penn Plant Electronics Products Group Including On-Site Leased Workers From Ryder Integrated... Certification Regarding Eligibility To Apply for Worker Adjustment Assistance and Alternative Trade Adjustment...

  12. 75 FR 45160 - Ingersoll-Rand/Harrow Products, Inc., Formerly Known as Locknetics Including On-Site Leased...

    Science.gov (United States)

    2010-08-02

    ... account under the name Harrow Products, Inc. Accordingly, the Department is amending this certification to... Products, Inc., Formerly Known as Locknetics Including On-Site Leased Workers From Monroe Staffing Services, Adecco USA, Inc., and Infinistaff, LLC, Bristol, CT; Amended Certification Regarding Eligibility To Apply...

  13. 76 FR 27669 - Penske Logistics LLC, a Subsidiary of General Electric/Penske Corporation Including On-Site...

    Science.gov (United States)

    2011-05-12

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,897] Penske Logistics LLC, a Subsidiary of General Electric/Penske Corporation Including On-Site Leased Workers From Kelly Temporary... workers and former workers of Penske Logistics LLC, a subsidiary of General Electric/Penske Corporation...

  14. 76 FR 17447 - Penske Logistics LLC a Subsidiary of General Electric/Penske Corporation Including On-Site Leased...

    Science.gov (United States)

    2011-03-29

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,897] Penske Logistics LLC a Subsidiary of General Electric/Penske Corporation Including On-Site Leased Workers From Kelly Temporary... (TAA) applicable to workers and former workers of Penske Logistics LLC, a subsidiary of General...

  15. 76 FR 35025 - Nokia, Inc.; a Subsidiary of Nokia Group; Including On-Site Leased Workers From ATC Logistics and...

    Science.gov (United States)

    2011-06-15

    ... of Nokia Group; Including On-Site Leased Workers From ATC Logistics and Electronics and Adecco Fort... workers from ATC Logistics and Electronics, Fort Worth, Texas. The workers supplied planning and materials... ATC Logistics and Electronics, and Adecco, Fort Worth, Texas, who became totally or partially...

  16. 75 FR 49525 - World Color (USA), LLC Formerly Known as Quebecor World World Color Covington Including On-Site...

    Science.gov (United States)

    2010-08-13

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-72,781] World Color (USA), LLC Formerly Known as Quebecor World World Color Covington Including On-Site Leased Workers From Randstad... Adjustment Assistance on May 14, 2010, applicable to workers of World Color (USA), LLC, formerly known as...

  17. 78 FR 42804 - Whirlpool Corporation, Including On-Site Leased Workers From Aerotek/Tek Systems (Subcontractor...

    Science.gov (United States)

    2013-07-17

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-82,346] Whirlpool Corporation, Including On-Site Leased Workers From Aerotek/Tek Systems (Subcontractor of IBM Corporation) and Jones Lang... firm. The workers were engaged in production of refrigerators and trash compactors as well as...

  18. 75 FR 77665 - Whirlpool Corporation, Including On-Site Leased Workers From Career Solutions TEC Staffing and...

    Science.gov (United States)

    2010-12-13

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,593] Whirlpool Corporation, Including On-Site Leased Workers From Career Solutions TEC Staffing and Andrews International, Fort Smith... subject firm. The workers are engaged in the production of refrigerators and trash compactors. The company...

  19. 76 FR 27365 - West, A Thomson Reuters Business, Thomson Reuters Legal Division, Including On-Site Leased...

    Science.gov (United States)

    2011-05-11

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-75,099] West, A Thomson Reuters Business, Thomson Reuters Legal Division, Including On-Site Leased Workers From ADECCO, Albuquerque, NM... Adjustment Assistance (TAA) applicable to workers and former workers of West, A Thomson Reuters Business...

  20. 77 FR 6587 - PHB Die Casting a Subsidiary of PHB, Inc., Including On-Site Leased Workers From Career Concepts...

    Science.gov (United States)

    2012-02-08

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-64,292] PHB Die Casting a... 19, 2008, applicable to workers of PHB Die Casting, a subsidiary of PHB, Inc., including on-site... production of die castings. New information shows that a worker from Burns Industrial Group (BIG Inc) was...

  1. 78 FR 40507 - Eastman Kodak Company, IPS, Including On-Site Leased Workers From Adecco, Dayton, Ohio; Notice of...

    Science.gov (United States)

    2013-07-05

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,813A] Eastman Kodak Company... Eastman Kodak Company, IPS, including on-site leased workers from Adecco, Dayton, Ohio (TA-W-74, 813A). At the request of Eastman Kodak Company, the Department reviewed the certification applicable to workers...

  2. 78 FR 66778 - Eastman Kodak Company, IPS-Dayton Location, Including On-Site Leased Workers From Adecco, Dayton...

    Science.gov (United States)

    2013-11-06

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,387] Eastman Kodak Company... workers of Eastman Kodak Company, IPS-Dayton Location, including on-site leased workers from Adecco, Dayton, Ohio (hereafter referred to as ``Eastman Kodak-IPS- Dayton''). On May 18, 2012, the Department...

  3. 76 FR 32227 - DST Systems, Inc., Including On-Site Leased Workers From Comsys Information Technology Services...

    Science.gov (United States)

    2011-06-03

    ..., Inc., Including On-Site Leased Workers From Comsys Information Technology Services, Megaforce, and Kelly Services Kansas City, MO; DST Technologies, a Wholly Owned Subsidiary of DST Systems, Inc., Boston... Information Technology Services, Megaforce, and Kelly Services, Kansas City, Missouri (subject firm). The...

  4. 77 FR 17525 - Cinram Distribution, LLC, a Subsidiary of Cinram International Income Fund, Including On-Site...

    Science.gov (United States)

    2012-03-26

    ... International Income Fund had their wages reported through a separate unemployment insurance (UI) tax account..., a Subsidiary of Cinram International Income Fund, Including On-Site Leased Workers From Good People..., 2012, applicable to workers of Cinram Distribution, LLC, a subsidiary of Cinram International Income...

  5. 75 FR 20390 - Senco Brands, Inc., fka Senco Products, Inc., Including the On-Site Leased Workers of Manpower...

    Science.gov (United States)

    2010-04-19

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-70,115] Senco Brands, Inc., fka... workers of Senco Brands, Inc., fka Senco Products, Inc., including the on-site leased workers of Manpower... Brands, Inc., fka Senco Products, Inc. The Department has determined that these workers were sufficiently...

  6. 75 FR 11914 - Chrysler, LLC, Mount Elliott Tool and Die, Including On-Site Leased Workers From Modern...

    Science.gov (United States)

    2010-03-12

    ... Elliott Tool and Die, Including On-Site Leased Workers From Modern Professional Services, TAC Automotive... Certification Regarding Eligibility To Apply for Worker Adjustment Assistance and Alternative Trade Adjustment Assistance In accordance with Section 223 of the Trade Act of 1974 (19 U.S.C. 2273), and Section 246 of the...

  7. 76 FR 2710 - Pitney Bowes, Inc., Mailing Solutions Management Division Including On-Site Leased Workers of...

    Science.gov (United States)

    2011-01-14

    ...., Mailing Solutions Management Division Including On-Site Leased Workers of Guidant Group, and Teleworkers... Bowes, Inc., Mailing Solutions Management Division, Engineering Quality Assurance, Shelton, Connecticut... identity of the subject worker group. The worker group consists of workers of Pitney Bowes, Inc., the...

  8. 76 FR 66328 - Callaway Golf Ball Operations, Inc., Including On-Site Leased Workers From Reliable Temp Services...

    Science.gov (United States)

    2011-10-26

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-80,110] Callaway Golf Ball... Golf Ball Operations, Inc., including on-site leased workers from Reliable Temp Services, Inc., and... production of golf balls. The notice was published in the Federal Register on July 8, 2011 (76 FR 40401). At...

  9. 78 FR 42805 - HarperCollins Publishers Distribution Operations Including On-Site Leased Workers From Action...

    Science.gov (United States)

    2013-07-17

    ... Distribution Operations Including On- Site Leased Workers From Action Personnel, CGA Staffing Services, Dynamic... from Action Personnel, CGA Staffing Services, Dynamic Staffing, Kelly Services, and Manpower, Scranton... (Volume 78 FR Pages 28628-28630). At the request of the State Workforce Office, the Department reviewed...

  10. 77 FR 70477 - Verso Paper Corporation, Sartell Mill Division, Including On-Site Leased Workers From Securitas...

    Science.gov (United States)

    2012-11-26

    ..., Sartell Mill Division, Including On-Site Leased Workers From Securitas Security Services, Manpower, Inc..., applicable to workers and former workers of Verso Paper Corporation, Sartell Mill Division, Sartell... to TA-W-81,210 is hereby issued as follows: All workers of Verso Paper Corporation, Sartell Mill...

  11. 75 FR 20386 - Auburn Hosiery Mills, Inc., Currently Known as Delta Galil, Including On-Site Leased Workers From...

    Science.gov (United States)

    2010-04-19

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-71,321] Auburn Hosiery Mills, Inc... Auburn Hosiery Mills, Inc., including on-site leased workers from Quality Personnel, Auburn, Kentucky... related to apparel. Information shows that Auburn Hosiery Mills was merged into its parent company, Delta...

  12. 77 FR 40637 - Smurfit-Stone Container Corporation, Containerboard Mill, Including On-Site Leased Workers From...

    Science.gov (United States)

    2012-07-10

    ... Corporation, Containerboard Mill, Including On-Site Leased Workers From KMW Enterprises and General Security... Assistance on May 6, 2010, applicable to workers of Smurfit-Stone Container Corporation, Containerboard Mill... Ontonagon, Michigan location of Smurfit-Stone Container Corporation, Containerboard Mill, Ontonagon...

  13. 75 FR 69471 - Smurfit-Stone Container Corporation, Containerboard Mill, Including On-Site Leased Workers From...

    Science.gov (United States)

    2010-11-12

    ... Corporation, Containerboard Mill, Including On-Site Leased Workers From KMW Enterprises, Ontonagon, MI... to workers of Smurfit-Stone Container Corporation, Containerboard Mill, Ontonagon, Michigan. The... Ontonagon, Michigan location of Smurfit-Stone Container Corporation, Containerboard Mill. The Department has...

  14. 75 FR 26794 - International Paper Company Franklin Pulp & Paper Mill Including On-Site Leased Workers From...

    Science.gov (United States)

    2010-05-12

    ... Company Franklin Pulp & Paper Mill Including On-Site Leased Workers From Railserve, Franklin, VA; Amended... workers of International Paper Company, Franklin Pulp & Paper Mill, Franklin, Virginia. The notice was... Pulp & Paper Mill. The Department has determined that these workers were sufficiently under the control...

  15. 77 FR 31643 - AI-Shreveport, LLC A Subsidiary of Android Industries Including On-Site Leased Workers From...

    Science.gov (United States)

    2012-05-29

    ... Subsidiary of Android Industries Including On-Site Leased Workers From Career Adventures, Inc. Shreveport..., 2011, applicable to workers of AI-Shreveport, LLC, a subsidiary of Android Industries, Shreveport...- Shreveport, LLC, a subsidiary of Android Industries. The amended notice applicable to TA-W-80,515 is hereby...

  16. 76 FR 79221 - Android Industries Belvidere, LLC, Including On-Site Leased Workers From QPS Employment Group...

    Science.gov (United States)

    2011-12-21

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-73,072] Android Industries..., 2010, applicable to workers of Android Industries Belvidere, LLC, including on-site leased workers from... Belvidere, Illinois location of Android Industries Belvidere, LLC. The Department has determined that these...

  17. 75 FR 11920 - Agilent Technologies, Eesof Division, Including On-Site Leased Workers From Volt and Managed...

    Science.gov (United States)

    2010-03-12

    ... workers of the subject firm. The workers are engaged in the production of electronic design automation software and related services including quality assurance and learning products, marketing, product development, marketing and administration. The company reports that on-site leased workers from Managed...

  18. 77 FR 9969 - Johnson Controls D/B/A Hoover Universal, Inc. Including On-Site Leased Workers from Kelly...

    Science.gov (United States)

    2012-02-21

    ... Johnson Controls, including on-site leased workers from Kelly Services, Sycamore, Illinois. The notice was... amended notice applicable to TA-W-73,074 is hereby issued as follows: ''All workers of Johnston Controls... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-73,074] Johnson Controls D/B/A...

  19. 77 FR 63873 - Johnson Controls, Inc. Including On-Site Leased Workers of Valley Staffing and AZ Quality Hudson...

    Science.gov (United States)

    2012-10-17

    ... workers of Johnson Controls, Inc., including on-site leased workers from Valley Staffing, Hudson..., Wisconsin location of Johnson Controls, Inc. The Department has determined that these workers were sufficiently under the control of the subject firm to be considered leased workers. Based on these findings...

  20. 77 FR 44685 - ConocoPhillips Company, Trainer Refinery, Including On-Site Leased Workers From Shrack, Young...

    Science.gov (United States)

    2012-07-30

    ..., Trainer Refinery, Including On-Site Leased Workers From Shrack, Young, and Associates, Inc., and Project Control Associates, Trainer, PA; Notice of Revised Determination on Reconsideration On April 30, 2012, the... applicable to workers and former workers of ConocoPhillips Company, Trainer Refinery, Trainer, Pennsylvania...

  1. 77 FR 61028 - Hasbro, Inc.; Hasbro Managerial Services, Inc., Including On-Site Leased Workers of Entegee East...

    Science.gov (United States)

    2012-10-05

    ... relevant period and that the subject firm had sufficient control over the leased workers for the Department to determine that there was operational control of the leased workers by the subject firm. The... Managerial Services, Inc., Including On-Site Leased Workers of Entegee East Longmeadow, MA Amended...

  2. 75 FR 66797 - Watts Regulator, Including On-Site Leased Workers From Employment Control, D/B/A Employment...

    Science.gov (United States)

    2010-10-29

    ..., Including On-Site Leased Workers From Employment Control, D/B/A Employment Staffing, Inc., Spindale, NC; Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance In accordance with... a Certification of Eligibility to Apply for Worker Adjustment Assistance on May 27, 2010, applicable...

  3. 75 FR 69470 - JL French Automotive Castings, LLC, Including On-Site Leased Workers From Labor Ready and Seek...

    Science.gov (United States)

    2010-11-12

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-70,143] JL French Automotive... workers of JL French Automotive Castings LLC, including on-site leased workers Labor Ready, Sheboygan... Sheboygan, Wisconsin location of JL French Automotive Castings LLC. The Department has determined that these...

  4. 75 FR 43556 - Badger Meter, Inc., Including On-Site Leased Workers From Sourcepoint Staffing, Seek, and...

    Science.gov (United States)

    2010-07-26

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-73,666] Badger Meter, Inc... of Badger Meter, Inc., including on-site leased workers from Sourcepoint Staffing, Milwaukee... workers are engaged in the production of flow measurement devices and automatic meter reading equipment...

  5. 75 FR 20382 - Chrysler LLC, St. Louis North Assembly Plant, Including On-Site Leased Workers From HAAS TCM, Inc...

    Science.gov (United States)

    2010-04-19

    ...., Diversified Contract Service, Inc. 639, and Logistics Management Services, Inc., Fenton, MO; Amended... Logistics Management Services, Inc. worked on-site at the Chrysler LLC, Fenton, Missouri plant (Logistics... Department is amending this certification to include workers leased from Logistics Management Services, Inc...

  6. 75 FR 20384 - Chrysler LLC, St. Louis North Assembly Plant, Including On-Site Leased Workers From Haas TCM, Inc...

    Science.gov (United States)

    2010-04-19

    .... Diversified Contract Service, Inc. 639, and Logistics Management Services, Inc. Fenton, MO; Amended... Logistics Management Services, Inc. worked on-site at the Chrysler LLC, Fenton, Missouri plant (Logistics... Department is amending this certification to include workers leased from Logistics Management Services, Inc...

  7. 75 FR 22627 - Chrysler LLC, St. Louis North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc...

    Science.gov (United States)

    2010-04-29

    ... North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services, Inc., Corrigan Company and Murphy Company, Fenton, MO... workers from HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services...

  8. 75 FR 11918 - General Electric Kentucky Glass Plant, Lighting, LLC, Including On-Site Leased Workers From the...

    Science.gov (United States)

    2010-03-12

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-72,011] General Electric Kentucky Glass Plant, Lighting, LLC, Including On-Site Leased Workers From the Patty Tipton Company, Aetna Building Maintenance, and Concentra, Lexington, KY; Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance In accordanc...

  9. 76 FR 16447 - Lafarge North America, Inc., a Subsidiary of Lafarge, Including On-Site Leased Workers From...

    Science.gov (United States)

    2011-03-23

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,880] Lafarge North America, Inc., a Subsidiary of Lafarge, Including On-Site Leased Workers From Industrial Services, Incorporated and Summit Building Maintenance, Seattle, WA; Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance In accordance...

  10. 78 FR 37586 - TE Connectivity, CIS-Appliances Division, Including On-Site Leased Workers From Kelly Services...

    Science.gov (United States)

    2013-06-21

    ... supply of administrative support services (in support of production). The worker group includes on-site... components produced by the subject workers. Further, aggregate imports of articles like or directly... reconsideration, the worker supplied new information regarding a possible shift in the production of like or...

  11. 78 FR 21151 - Boise White Paper, LLC, A Subsidiary of Boise Paper Holdings, LLC, Including On-Site Leased...

    Science.gov (United States)

    2013-04-09

    ... Paper, LLC, A Subsidiary of Boise Paper Holdings, LLC, Including On-Site Leased Workers From Guardsmark.... Helens, OR; Boise White Paper, LLC, A Subsidiary of Boise Paper Holdings, LLC, Vancouver, WA; Amended... workers and former workers of Boise White Paper, LLC, a subsidiary of Boise Paper Holdings, LLC, St...

  12. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  13. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  14. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  15. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  16. Full-Length Sequence of Mouse Acupuncture-Induced 1-L (Aig1l Gene Including Its Transcriptional Start Site

    Directory of Open Access Journals (Sweden)

    Mika Ohta

    2011-01-01

    Full Text Available We have been investigating the molecular efficacy of electroacupuncture (EA, which is one type of acupuncture therapy. In our previous molecular biological study of acupuncture, we found an EA-induced gene, named acupuncture-induced 1-L (Aig1l, in mouse skeletal muscle. The aims of this study consisted of identification of the full-length cDNA sequence of Aig1l including the transcriptional start site, determination of the tissue distribution of Aig1l and analysis of the effect of EA on Aig1l gene expression. We determined the complete cDNA sequence including the transcriptional start site via cDNA cloning with the cap site hunting method. We then analyzed the tissue distribution of Aig1l by means of northern blot analysis and real-time quantitative polymerase chain reaction. We used the semiquantitative reverse transcriptase-polymerase chain reaction to examine the effect of EA on Aig1l gene expression. Our results showed that the complete cDNA sequence of Aig1l was 6073 bp long, and the putative protein consisted of 962 amino acids. All seven tissues that we analyzed expressed the Aig1l gene. In skeletal muscle, EA induced expression of the Aig1l gene, with high expression observed after 3 hours of EA. Our findings thus suggest that the Aig1l gene may play a key role in the molecular mechanisms of EA efficacy.

  17. Hydrologic design methodologies for small-scale hydro at ungauged sites. Phase 2A, British Columbia. Primer for Integrated Method for Power Analysis (IMP)

    Energy Technology Data Exchange (ETDEWEB)

    1986-01-01

    This report provides a user's manual for the Integrated Method for Power Analysis (IMP) series of programs, developed to aid in evaluating small-scale hydroelectric power sites in British Columbia. The primary objective of IMP is to address the problem posed by hydroelectric development at sites completely lacking in streamflow records. The province's mountainous terrain, with numerous microclimates, precluded methods of regional analysis based on regression or comparisons with gauged streams; instead, a conceptual model of physical processes on the land and in the atmosphere was used as a basis for developing IMP. The IMP package consists of five basic components: an atmospheric model of annual precipitation and 1-in-10-year 24-h maximum rainfall; a watershed model that will generate a daily series of streamflow data; a flood frequency analysis system that uses site-specific topographical information and information from the atmospheric model to generate the flood frequency curve; a hydroelectric power simulation program which determines the daily energy output for a run-of-river or reservoir storage site; and a graphics analysis package which provides direct visualization of atmospheric and streamflow data, and the results of watershed and power simulation modelling. Within each component of the program, the program requirements and capabilities are discussed. A series of sample screens are shown, illustrating the use of the IMP package for a particular simulation. 18 figs., 2 tabs.

  18. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  19. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  20. Vegetation response to invasive Tamarix control in southwestern U.S. rivers: a collaborative study including 416 sites.

    Science.gov (United States)

    González, Eduardo; Sher, Anna A; Anderson, Robert M; Bay, Robin F; Bean, Daniel W; Bissonnete, Gabriel J; Bourgeois, Bérenger; Cooper, David J; Dohrenwend, Kara; Eichhorst, Kim D; El Waer, Hisham; Kennard, Deborah K; Harms-Weissinger, Rebecca; Henry, Annie L; Makarick, Lori J; Ostoja, Steven M; Reynolds, Lindsay V; Robinson, W Wright; Shafroth, Patrick B

    2017-09-01

    Most studies assessing vegetation response following control of invasive Tamarix trees along southwestern U.S. rivers have been small in scale (e.g., river reach), or at a regional scale but with poor spatial-temporal replication, and most have not included testing the effects of a now widely used biological control. We monitored plant composition following Tamarix control along hydrologic, soil, and climatic gradients in 244 treated and 172 reference sites across six U.S. states. This represents the largest comprehensive assessment to date on the vegetation response to the four most common Tamarix control treatments. Biocontrol by a defoliating beetle (treatment 1) reduced the abundance of Tamarix less than active removal by mechanically using hand and chain-saws (2), heavy machinery (3) or burning (4). Tamarix abundance also decreased with lower temperatures, higher precipitation, and follow-up treatments for Tamarix resprouting. Native cover generally increased over time in active Tamarix removal sites, however, the increases observed were small and was not consistently increased by active revegetation. Overall, native cover was correlated to permanent stream flow, lower grazing pressure, lower soil salinity and temperatures, and higher precipitation. Species diversity also increased where Tamarix was removed. However, Tamarix treatments, especially those generating the highest disturbance (burning and heavy machinery), also often promoted secondary invasions of exotic forbs. The abundance of hydrophytic species was much lower in treated than in reference sites, suggesting that management of southwestern U.S. rivers has focused too much on weed control, overlooking restoration of fluvial processes that provide habitat for hydrophytic and floodplain vegetation. These results can help inform future management of Tamarix-infested rivers to restore hydrogeomorphic processes, increase native biodiversity and reduce abundance of noxious species. © 2017 by the

  1. Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

    Science.gov (United States)

    Altınel, Ahmet

    2017-01-01

    Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

  2. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  3. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  4. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  5. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  6. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  7. Mohawk Tannery Hazardous Waste Site in New Hampshire included on EPA List of Targeted for Immediate Attention

    Science.gov (United States)

    Today, the U.S. Environmental Protection Agency released the list of Superfund sites that Administrator Pruitt has targeted for immediate and intense attention. The former Mohawk Tannery facility (a.k.a. Granite State Leathers) is one of the 21 sites on th

  8. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  9. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  10. 78 FR 52984 - Stone Age Interiors, Inc.; d/b/a Colorado Springs Marble and Granite Including On-Site Leased...

    Science.gov (United States)

    2013-08-27

    ....; d/b/a Colorado Springs Marble and Granite Including On-Site Leased Workers From Express Employment... Colorado Springs Marble and Granite, Colorado Springs, Colorado (hereafter collectively referred to as..., Inc., d/b/a Colorado Springs Marble and Granite, including on-site leased workers from Express...

  11. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  12. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  13. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  14. Preliminary site description Laxemar stage 2.1. Feedback for completion of the site investigation including input from safety assessment and repository engineering

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-09-15

    The Laxemar subarea is the focus for the complete site investigations in the Simpevarp area. The south and southwestern parts of the subarea (the so-called 'focused area') have been designated for focused studies during the remainder of the site investigations. This area, some 5.3 square kilometres in size, is characterised on the surface by an arc shaped body of quartz monzodiorite gently dipping to the north, flanked in the north and south by Aevroe granite. The current report documents work conducted during stage 2.1 of the site-descriptive modelling of the Laxemar subarea. The primary objective of the work performed is to provide feedback to the site investigations at Laxemar to ensure that adequate and timely data and information are obtained during the remaining investigation stage. The work has been conducted in cooperation with the site investigation team at Laxemar and representatives from safety assessment and repository engineering. The principal aim of this joint effort has been to safeguard that adequate data are collected that resolve the remaining issues/uncertainties which are of importance for repository layout and long-term safety. The proposed additional works presented in this report should be regarded as recommended additions and/or modifications in relation to the CSI programme published early 2006. The overall conclusion of the discipline-wise review of critical issues is that the CSI programme overall satisfies the demands to resolve the remaining uncertainties. This is interpreted to be partly a result of the close interaction between the site modelling team, site investigation team and the repository engineering teams, which has been in operation since early 2005. In summary, the performed interpretations and modelling have overall confirmed the version 1.2 results. The exception being Hydrogeology where the new Laxemar 2.1 borehole data suggest more favourable conditions in the south and west parts of the focused area compared

  15. Preliminary site description Laxemar stage 2.1. Feedback for completion of the site investigation including input from safety assessment and repository engineering

    International Nuclear Information System (INIS)

    2006-09-01

    The Laxemar subarea is the focus for the complete site investigations in the Simpevarp area. The south and southwestern parts of the subarea (the so-called 'focused area') have been designated for focused studies during the remainder of the site investigations. This area, some 5.3 square kilometres in size, is characterised on the surface by an arc shaped body of quartz monzodiorite gently dipping to the north, flanked in the north and south by Aevroe granite. The current report documents work conducted during stage 2.1 of the site-descriptive modelling of the Laxemar subarea. The primary objective of the work performed is to provide feedback to the site investigations at Laxemar to ensure that adequate and timely data and information are obtained during the remaining investigation stage. The work has been conducted in cooperation with the site investigation team at Laxemar and representatives from safety assessment and repository engineering. The principal aim of this joint effort has been to safeguard that adequate data are collected that resolve the remaining issues/uncertainties which are of importance for repository layout and long-term safety. The proposed additional works presented in this report should be regarded as recommended additions and/or modifications in relation to the CSI programme published early 2006. The overall conclusion of the discipline-wise review of critical issues is that the CSI programme overall satisfies the demands to resolve the remaining uncertainties. This is interpreted to be partly a result of the close interaction between the site modelling team, site investigation team and the repository engineering teams, which has been in operation since early 2005. In summary, the performed interpretations and modelling have overall confirmed the version 1.2 results. The exception being Hydrogeology where the new Laxemar 2.1 borehole data suggest more favourable conditions in the south and west parts of the focused area compared with the

  16. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  17. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  19. Corrective Action Investigation Plan for Corrective Action Unit 536: Area 3 Release Site, Nevada Test Site, Nevada (Rev. 0 / June 2003), Including Record of Technical Change No. 1

    Energy Technology Data Exchange (ETDEWEB)

    None

    2003-06-27

    This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office's approach to collect the data necessary to evaluate corrective action alternatives (CAAs) appropriate for the closure of Corrective Action Unit (CAU) 536: Area 3 Release Site, Nevada Test Site, Nevada, under the Federal Facility Agreement and Consent Order. Corrective Action Unit 536 consists of a single Corrective Action Site (CAS): 03-44-02, Steam Jenny Discharge. The CAU 536 site is being investigated because existing information on the nature and extent of possible contamination is insufficient to evaluate and recommend corrective action alternatives for CAS 03-44-02. The additional information will be obtained by conducting a corrective action investigation (CAI) prior to evaluating CAAs and selecting the appropriate corrective action for this CAS. The results of this field investigation are to be used to support a defensible evaluation of corrective action alternatives in the corrective action decision document. Record of Technical Change No. 1 is dated 3-2004.

  20. 75 FR 51845 - Chrysler Group, LLC Manufacturing Division St. Louis North Plant Including On-Site Leased Workers...

    Science.gov (United States)

    2010-08-23

    ... produce performance coating solutions for vehicles. The company reports that workers leased from DuPont Performance Coatings, a wholly-owned subsidiary of E.I. DuPont de Nemours Company, OEM, were employed on-site..., C R Associates, Syncreon, Robinson Solutions and Dupont Performance Coatings Fenton, MO; Amended...

  1. 75 FR 11919 - Qimonda 200 MM Facility, Including On-Site Leased Workers From Tokyo Electron America, Nikon...

    Science.gov (United States)

    2010-03-12

    ... Qimonda AG Sandston, VA; Amended Certification Regarding Eligibility To Apply for Worker Adjustment..., Sandston, Virginia. The notice was published in the Federal Register on December 30, 2008 (73 FR 79914... division of Select Staffing were employed on-site at the Sandston, Virginia location of Qimonda 200MM...

  2. 76 FR 29274 - Interstate Electronics Corp., a Subsidiary of L-3 Communications Including On-Site Leased Workers...

    Science.gov (United States)

    2011-05-20

    ... Resources, Systems Pros, Total Tech Services, Triple Crown Consulting, and Ingenium Technology, Inc... Resources, PDS Technical Service, Superior Technical Resources, Systems Pros, Total Tech Services, and... subject firm. The company reports that workers leased from Ingenium Technology, Inc. were employed on-site...

  3. Corrective Action Decision Document for Corrective Action Unit 204: Storage Bunkers, Nevada Test Site, Nevada: Revision 0, Including Errata Sheet

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office

    2004-04-01

    This Corrective Action Decision Document identifies the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office's corrective action alternative recommendation for each of the corrective action sites (CASs) within Corrective Action Unit (CAU) 204: Storage Bunkers, Nevada Test Site (NTS), Nevada, under the Federal Facility Agreement and Consent Order. An evaluation of analytical data from the corrective action investigation, review of current and future operations at each CAS, and a detailed comparative analysis of potential corrective action alternatives were used to determine the appropriate corrective action for each CAS. There are six CASs in CAU 204, which are all located between Areas 1, 2, 3, and 5 on the NTS. The No Further Action alternative was recommended for CASs 01-34-01, 02-34-01, 03-34-01, and 05-99-02; and a Closure in Place with Administrative Controls recommendation was the preferred corrective action for CASs 05-18-02 and 05-33-01. These alternatives were judged to meet all requirements for the technical components evaluated as well as applicable state and federal regulations for closure of the sites and will eliminate potential future exposure pathways to the contaminated media at CAU 204.

  4. 77 FR 19719 - Whirlpool Corporation Including On-Site Leased Workers From Career Solutions TEC Staffing, IBM...

    Science.gov (United States)

    2012-04-02

    ... Logistics, Eurest, Canteen, Kelly Services, Inc., Prodriver, Arkansas Warehouse, Inc., Andrews International... information shows that workers leased from Andrews International employed on-site at the Fort Smith, Arkansas...) tax account under the name U.S. Security. Accordingly, the Department is amending this certification...

  5. 75 FR 11919 - Smith and Nephew, Inc., Wound Management-Largo Division, Including On-Site Leased Workers From...

    Science.gov (United States)

    2010-03-12

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-70,151] Smith and Nephew, Inc... November 5, 2009, applicable to workers of Smith and Nephew, Inc., Wound Management-Largo Division, Largo... workers leased from Adecco were employed on-site at the Largo, Florida location of Smith and Nephew, Inc...

  6. 75 FR 28295 - Federal-Mogul, Including On-Site Leased Workers From Kelly Services, Summerton, SC; Amended...

    Science.gov (United States)

    2010-05-20

    ... workers were sufficiently under the control of the subject firm to be considered leased workers. Based on... On-Site Leased Workers From Kelly Services, Summerton, SC; Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance In accordance with Section 223 of the Trade Act of 1974...

  7. 75 FR 38129 - Freescale Semiconductor, Inc., Hardware/Software Design and Manufacturing A Including On-Site...

    Science.gov (United States)

    2010-07-01

    ... Manufacturing A, Austin, Texas. The notice was published in the Federal Register on May 28, 2010 (75 FR 30070...Logic, Inc., Austin, TX; Amended Certification Regarding Eligibility To Apply for Worker Adjustment..., Design Solutions, Inc., Veriseo, SilconElite and MicroLogic, Inc. were employed on-site at the Austin...

  8. 77 FR 19718 - Ford Motor Company Twin Cities Assembly Plant Vehicle Operations Division Including On-Site...

    Science.gov (United States)

    2012-04-02

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-81,038] Ford Motor Company Twin... February 9, 2012, applicable to workers of Ford Motor Company, Twin Cities Assembly Plant, Vehicle..., and Pacer International were employed on-site at the St. Paul, Minnesota location of Ford Motor...

  9. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  10. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  11. Data Mining of Web-Based Documents on Social Networking Sites That Included Suicide-Related Words Among Korean Adolescents.

    Science.gov (United States)

    Song, Juyoung; Song, Tae Min; Seo, Dong-Chul; Jin, Jae Hyun

    2016-12-01

    To investigate online search activity of suicide-related words in South Korean adolescents through data mining of social media Web sites as the suicide rate in South Korea is one of the highest in the world. Out of more than 2.35 billion posts for 2 years from January 1, 2011 to December 31, 2012 on 163 social media Web sites in South Korea, 99,693 suicide-related documents were retrieved by Crawler and analyzed using text mining and opinion mining. These data were further combined with monthly employment rate, monthly rental prices index, monthly youth suicide rate, and monthly number of reported bully victims to fit multilevel models as well as structural equation models. The link from grade pressure to suicide risk showed the largest standardized path coefficient (beta = .357, p < .001) in structural models and a significant random effect (p < .01) in multilevel models. Depression was a partial mediator between suicide risk and grade pressure, low body image, victims of bullying, and concerns about disease. The largest total effect was observed in the grade pressure to depression to suicide risk. The multilevel models indicate about 27% of the variance in the daily suicide-related word search activity is explained by month-to-month variations. A lower employment rate, a higher rental prices index, and more bullying were associated with an increased suicide-related word search activity. Academic pressure appears to be the biggest contributor to Korean adolescents' suicide risk. Real-time suicide-related word search activity monitoring and response system needs to be developed. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

  12. 75 FR 67770 - Sara Lee Corporation Including On-Site Leased Workers From EDS, Hewitt Packard, Sapphire...

    Science.gov (United States)

    2010-11-03

    ..., Deductions, Collections, Call Center, Information Technology, Accounts Payable, General Accounts, Financial... this certification to include workers providing shared financial and information technology services at..., Deductions, Collections, Call Center, Information Technology, Accounts Payable, General Accounts, Financial...

  13. Inventory of forest and rangeland resources, including forest stress. [Atlanta, Georgia, Black Hills, and Manitou, Colorado test sites

    Science.gov (United States)

    Heller, R. C.; Aldrich, R. C.; Weber, F. P.; Driscoll, R. S. (Principal Investigator)

    1974-01-01

    The author has identified the following significant results. Some current beetle-killed ponderosa pine can be detected on S190-B photography imaged over the Bear Lodge mountains in the Black Hills National Forest. Detections were made on SL-3 imagery (September 13, 1973) using a zoom lens microscope to view the photography. At this time correlations have not been made to all of the known infestation spots in the Bear Lodge mountains; rather, known infestations have been located on the SL-3 imagery. It was determined that the beetle-killed trees were current kills by stereo viewing of SL-3 imagery on one side and SL-2 on the other. A successful technique was developed for mapping current beetle-killed pine using MSS imagery from mission 247 flown by the C-130 over the Black Hills test site in September 1973. Color enhancement processing on the NASA/JSC, DAS system using three MSS channels produced an excellent quality detection map for current kill pine. More importantly it provides a way to inventory the dead trees by relating PCM counts to actual numbers of dead trees.

  14. 78 FR 22909 - Mondelez Global LLC, Business Services Center, Including On-Site Leased Workers From Abacus...

    Science.gov (United States)

    2013-04-17

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-82,339] Mondelez Global LLC... for Worker Adjustment Assistance on February 20, 2013, applicable to workers of Mondelez Global LLC... expense, and administration, including the continuous improvement team. New information obtained by the...

  15. 75 FR 69470 - Tele Atlas North America, Inc., Currently Doing Business as Tom Tom Including Off-Site Workers...

    Science.gov (United States)

    2010-11-12

    ...,839B; TA-W-70,839C] Tele Atlas North America, Inc., Currently Doing Business as Tom Tom Including Off... Business as Tom Tom, Concord, MA; Tele Atlas North America, Inc. Currently Doing Business as Tom Tom, Detroit, MI; Tele Atlas North America, Inc. Currently Doing Business as Tom Tom, Redwood, CA; Amended...

  16. 75 FR 22629 - Kenco Logistic Services, LLC, Electrolux Webster City, Including On-Site Leased Workers From...

    Science.gov (United States)

    2010-04-29

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-72,778] Kenco Logistic Services... January 8, 2010, applicable to workers of Kenco Logistic Services, LLC, Electrolux Webster City, including... logistic services for the Electrolux, Webster City, Iowa. The company reports that workers leased from...

  17. 77 FR 4368 - Advanced Energy Industries, Inc., Including On-Site Leased Workers From Mid Oregon Personnel...

    Science.gov (United States)

    2012-01-27

    ... Unemployment Insurance (UI) Wages Are Reported Through PV Powered, Currently Known as AE Solar Energy, Inc... engaged in activities related to the production of solar invert subcomponents, including thin films processing power conversion and thermal instrumentation products and solar energy inverters. The notice was...

  18. 76 FR 61749 - SpectraWatt, Inc. Including On-Site Leased Workers From Kelly Services Hopewell Junction, NY...

    Science.gov (United States)

    2011-10-05

    ... to the production of solar cells for their application in solar panels. The worker group includes on..., during the period of investigation, imports of articles like or directly competitive with solar cells produced by the subject firm have increased, and that the increased imports of solar cells (or like or...

  19. 78 FR 52974 - Gamesa Technology Corporation, Including On-Site Leased Workers From A & A Wind Pros Inc., ABB...

    Science.gov (United States)

    2013-08-27

    ... Access, Avanti Wind Systems, Inc., Broadwind Services LLC, Electric Power Systems International... facility on Spain and ``increased blade outsourcing of 65%.'' The attachment to the request included a... Services LLC, Electric Power Systems International, Evolution Energy Group LLC, Global Energy Services USA...

  20. A Web Policy Primer.

    Science.gov (United States)

    Levine, Elliott

    2001-01-01

    Sound technology policies can spell the difference between an effective website and an online nightmare. An effective web development policy addresses six key areas: roles and responsibilities, content/educational value, privacy and safety, adherence to copyright laws, technical standards, and use of commercial sites and services. (MLH)

  1. Tree bark suber-included particles: A long-term accumulation site for elements of atmospheric origin

    Science.gov (United States)

    Catinon, Mickaël; Ayrault, Sophie; Spadini, Lorenzo; Boudouma, Omar; Asta, Juliette; Tissut, Michel; Ravanel, Patrick

    2011-02-01

    The deposition of atmospheric elements on and into the bark of 4-year-old Fraxinus excelsior L. was studied. The elemental composition of the suber tissue was established through ICP-MS analysis and the presence of solid mineral particles included in this suber was established and described through SEM-EDX. Fractionation of the suber elements mixture was obtained after ashing at 550 °C through successive water (C fraction) and HNO 3 2 M (D fraction) extraction, leading to an insoluble residue mainly composed of the solid mineral particles (E fraction). The triplicated % weight of C, D and E were respectively 34.4 ± 2.7, 64.8 ± 2.7 and 0.8 ± 0.1% of the suber ashes weight. The main component of C was K, of D was Ca. Noticeable amounts of Mg were also observed in D. The E fraction, composed of insoluble particles, was mostly constituted of geogenic products, with elements such as Si, Al, K, Mg, representing primary minerals. E also contained Ca 3(PO 4) 2 and concentrated the main part of Pb and Fe. Moreover, The SEM-EDX analysis evidenced that this fraction also concentrated several types of fly ashes of industrial origin. The study of the distribution between C, D and E was analysed through ICP-MS with respect to their origin. The origin of the elements found in such bark was either geogenic (clay, micas, quartz…), anthropogenic or biogenic (for instance large amounts of solid Ca organic salts having a storage role). As opposed to the E fraction, the C fraction, mainly composed of highly soluble K+ is characteristic of a biological pool of plant origin. In fraction D, the very high amount of Ca++ corresponds to two different origins: biological or acid soluble minerals such as calcite. Furthermore, the D fraction contains the most part of pollutants of anthropic origin such as Zn, Cu, Ni, Co, Cd. As a whole, the fractionation procedure of the suber samples allows to separate elements as a function of their origin but also gives valuable information on

  2. 78 FR 37586 - Stone Age Interiors, Inc., D/B/A Colorado Springs Marble and Granite, Including On-Site Leased...

    Science.gov (United States)

    2013-06-21

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-82,440] Stone Age Interiors, Inc., D/B/A Colorado Springs Marble and Granite, Including On-Site Leased Workers From Express Employment... Marble and Granite, Colorado Springs, Colorado (subject firm). The negative determination was issued on...

  3. 75 FR 62424 - EDS, an HP Company (Re-Branded as HP-Enterprise Services) Including On-Site Workers From: Abel...

    Science.gov (United States)

    2010-10-08

    ...-Branded as HP--Enterprise Services) Including On-Site Workers From: Abel Personnel Inc., Advantage Tech... February 4, 2010, applicable to workers of EDS, an HP Company (Re- branded as HP--Enterprise Services...-branded as HP-- Enterprise Services). These employees provided various activities related to the supply of...

  4. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  5. Evaluation of Alkyd Primers

    National Research Council Canada - National Science Library

    Marshall, Orange

    2000-01-01

    ...) for them. Alkyd paint systems include a wide range of natural and synthetic oil-based paint systems that have been used worldwide since ancient times to decorate and protect wood and metals. The U.S...

  6. LTBP bridge performance primer.

    Science.gov (United States)

    2013-12-01

    "The performance of bridges is critical to the overall performance of the highway transportation system in the United States. However, many critical aspects of bridge performance are not well understood. The reasons for this include the extreme diver...

  7. An Automation Planning Primer.

    Science.gov (United States)

    Paynter, Marion

    1988-01-01

    This brief planning guide for library automation incorporates needs assessment and evaluation of options to meet those needs. A bibliography of materials on automation planning and software reviews, library software directories, and library automation journals is included. (CLB)

  8. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  9. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  10. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  11. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  12. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  13. PPDS compas-primer

    International Nuclear Information System (INIS)

    Alekhin, S.I.; Bazeeva, V.V.; Grudtsin, S.N.

    1987-01-01

    Catalogue of IHEP data bases on particle physics (PPDS) and short guide for unexperienced user are presented. All data bases are under common data base management system and include bibliographic and factographic ones. Binary search and set of applied programs controlling input and formatting output make using of system easy and convenient. Basic programs are developed in FORTRAN

  14. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  15. Defense Primer: Procurement

    Science.gov (United States)

    2017-02-10

    Usually, incremental funding is used to mitigate peaks and valleys in annual budgets caused by the cost of one item significantly changing the...base defense budget . DOD uses these funds to buy several different types of materiel, including  new items easily recognizable as military...pursues a policy of full funding for procurement, meaning that the total estimated cost of each unit must be funded in the year it is budgeted . In a

  16. Blockchain: A Primer

    OpenAIRE

    Dwyer, Gerald P

    2016-01-01

    The Bitcoin blockchain is the primary innovation in Bitcoin that makes it practical. Blockchains have applications in many contexts other than cryptocurrencies. This note is an introduction to blockchains that requires no prior knowledge, including of Bitcoin. Blockchains are ledgers of transactions kept by a set of participants, none of which is accorded special status as the “correct one.” Instead, agreement is reached by a process of consensus. I show how this works for Bitcoin, discuss ap...

  17. Information Operations Primer

    Science.gov (United States)

    2008-11-01

    Nomination/Assignment/Allotment. • Electronic Warfare (EW) deconfliction via Joint Restricted Frequency List (JRFL) creation and analysis. • JRFL...restricted frequency list . The objectives of defensive IO include the following: 111 ■ Sustain the MAGTF commander‘s freedom of action...estimates and are also applied during the analysis and selection of friendly courses of action. (JP 1-02) Joint restricted frequency list (JRFL) A

  18. The calculus primer

    CERN Document Server

    Schaaf, William L

    2011-01-01

    Comprehensive but concise, this introduction to differential and integral calculus covers all the topics usually included in a first course. The straightforward development places less emphasis on mathematical rigor, and the informal manner of presentation sets students at ease. Many carefully worked-out examples illuminate the text, in addition to numerous diagrams, problems, and answers.Bearing the needs of beginners constantly in mind, the treatment covers all the basic concepts of calculus: functions, derivatives, differentiation of algebraic and transcendental functions, partial different

  19. Algebraic topology a primer

    CERN Document Server

    Deo, Satya

    2018-01-01

    This book presents the first concepts of the topics in algebraic topology such as the general simplicial complexes, simplicial homology theory, fundamental groups, covering spaces and singular homology theory in greater detail. Originally published in 2003, this book has become one of the seminal books. Now, in the completely revised and enlarged edition, the book discusses the rapidly developing field of algebraic topology. Targeted to undergraduate and graduate students of mathematics, the prerequisite for this book is minimal knowledge of linear algebra, group theory and topological spaces. The book discusses about the relevant concepts and ideas in a very lucid manner, providing suitable motivations and illustrations. All relevant topics are covered, including the classical theorems like the Brouwer’s fixed point theorem, Lefschetz fixed point theorem, Borsuk-Ulam theorem, Brouwer’s separation theorem and the theorem on invariance of the domain. Most of the exercises are elementary, but sometimes chal...

  20. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  1. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  2. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  3. Primer on bioproducts

    International Nuclear Information System (INIS)

    Christie, P.; Mitchell, H.; Holmes, R.; Ogilvie, K.B.; Layzell, D.

    2004-11-01

    This document provides a general introduction to biotechnology, bioproducts and alternatives to fossil fuels and petrochemicals. It includes an introduction to the concept of bioproducts, a description of common products that can be manufactured using biomass and an overview of the ways bioproducts are made. It also addresses issues such as risks and benefits of bioproduct technologies and the environmental, social and economic considerations of bioproducts. The possibilities of using biofuels and bioenergy for heat and power, to fuel vehicles and as a fuel for fuel cells were also discussed. Biogas from municipal and farm wastes is currently used to drive some gas turbines for power generation. The role of biochemicals and biomaterials in industrial processes and products was also reviewed along with some domestic and international bioproducts already developed and innovative products under development. The document also explains how plants, animals and other organisms can be used to replace or complement fossil fuels to help generate energy and make chemicals, plastics and other materials. While some reports suggest that bioproducts consume less energy and produce less greenhouse gases than conventional products, other reports suggest that they are rarely superior to conventional products and some may even contribute to the eutrophication of lakes, rivers and other surface waters. figs., 80 refs

  4. Enhanced quantization: a primer

    International Nuclear Information System (INIS)

    Klauder, John R

    2012-01-01

    Although classical mechanics and quantum mechanics are separate disciplines, we live in a world where Planck’s constant ℏ > 0, meaning that the classical and quantum world views must actually coexist. Traditionally, canonical quantization procedures postulate a direct linking of various c-number and q-number quantities that lie in disjoint realms, along with the quite distinct interpretations given to each realm. In this paper we propose a different association of classical and quantum quantities that renders classical theory a natural subset of quantum theory letting them coexist as required. This proposal also shines light on alternative linking assignments of classical and quantum quantities that offer different perspectives on the very meaning of quantization. In this paper we focus on elaborating the general principles, while elsewhere we have published several examples of what this alternative viewpoint can achieve; these examples include removal of singularities in classical solutions to certain models, and an alternative quantization of several field theory models that are trivial when quantized by traditional methods but become well defined and nontrivial when viewed from the new viewpoint. (paper)

  5. Big data a primer

    CERN Document Server

    Bhuyan, Prachet; Chenthati, Deepak

    2015-01-01

    This book is a collection of chapters written by experts on various aspects of big data. The book aims to explain what big data is and how it is stored and used. The book starts from  the fundamentals and builds up from there. It is intended to serve as a review of the state-of-the-practice in the field of big data handling. The traditional framework of relational databases can no longer provide appropriate solutions for handling big data and making it available and useful to users scattered around the globe. The study of big data covers a wide range of issues including management of heterogeneous data, big data frameworks, change management, finding patterns in data usage and evolution, data as a service, service-generated data, service management, privacy and security. All of these aspects are touched upon in this book. It also discusses big data applications in different domains. The book will prove useful to students, researchers, and practicing database and networking engineers.

  6. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  7. Corrective Action Investigation Plan for Corrective Action Unit 204: Storage Bunkers, Nevada Test Site, Nevada (December 2002, Revision No.: 0), Including Record of Technical Change No. 1

    Energy Technology Data Exchange (ETDEWEB)

    NNSA/NSO

    2002-12-12

    The Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit (CAU) 204 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 204 is located on the Nevada Test Site approximately 65 miles northwest of Las Vegas, Nevada. This CAU is comprised of six Corrective Action Sites (CASs) which include: 01-34-01, Underground Instrument House Bunker; 02-34-01, Instrument Bunker; 03-34-01, Underground Bunker; 05-18-02, Chemical Explosives Storage; 05-33-01, Kay Blockhouse; 05-99-02, Explosive Storage Bunker. Based on site history, process knowledge, and previous field efforts, contaminants of potential concern for Corrective Action Unit 204 collectively include radionuclides, beryllium, high explosives, lead, polychlorinated biphenyls, total petroleum hydrocarbons, silver, warfarin, and zinc phosphide. The primary question for the investigation is: ''Are existing data sufficient to evaluate appropriate corrective actions?'' To address this question, resolution of two decision statements is required. Decision I is to ''Define the nature of contamination'' by identifying any contamination above preliminary action levels (PALs); Decision II is to ''Determine the extent of contamination identified above PALs. If PALs are not exceeded, the investigation is completed. If PALs are exceeded, then Decision II must be resolved. In addition, data will be obtained to support waste management decisions. Field activities will include radiological land area surveys, geophysical surveys to identify any subsurface metallic and nonmetallic debris, field screening for applicable contaminants of potential concern, collection and analysis of surface and subsurface soil samples from biased locations

  8. STREAM II-V7: Revision for STREAM II-V6 to include outflow from all Savannah River Site tributaries

    Energy Technology Data Exchange (ETDEWEB)

    Maze, Grace M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-01-01

    STREAM II is the aqueous transport model of the Weather Information Display (WIND) emergency response system at Savannah River Site. It is used to calculate transport in the event of a chemical or radiological spill into the waterways on the Savannah River Site. Improvements were made to the code (STREAM II V7) to include flow from all site tributaries to the Savannah River total flow and utilize a 4 digit year input. The predicted downstream concentrations using V7 were generally on the same order of magnitude as V6 with slightly lower concentrations and quicker arrival times when all onsite stream flows are contributing to the Savannah River flow. The downstream arrival time at the Savannah River Water Plant ranges from no change to an increase of 8.77%, with minimum changes typically in March/April and maximum changes typically in October/November. The downstream concentrations are generally no more than 15% lower using V7 with the maximum percent change in January through April and minimum changes in June/July.

  9. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  10. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  11. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  12. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  13. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  14. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Autism genetic database (AGD: a comprehensive database including autism susceptibility gene-CNVs integrated with known noncoding RNAs and fragile sites

    Directory of Open Access Journals (Sweden)

    Talebizadeh Zohreh

    2009-09-01

    Full Text Available Abstract Background Autism is a highly heritable complex neurodevelopmental disorder, therefore identifying its genetic basis has been challenging. To date, numerous susceptibility genes and chromosomal abnormalities have been reported in association with autism, but most discoveries either fail to be replicated or account for a small effect. Thus, in most cases the underlying causative genetic mechanisms are not fully understood. In the present work, the Autism Genetic Database (AGD was developed as a literature-driven, web-based, and easy to access database designed with the aim of creating a comprehensive repository for all the currently reported genes and genomic copy number variations (CNVs associated with autism in order to further facilitate the assessment of these autism susceptibility genetic factors. Description AGD is a relational database that organizes data resulting from exhaustive literature searches for reported susceptibility genes and CNVs associated with autism. Furthermore, genomic information about human fragile sites and noncoding RNAs was also downloaded and parsed from miRBase, snoRNA-LBME-db, piRNABank, and the MIT/ICBP siRNA database. A web client genome browser enables viewing of the features while a web client query tool provides access to more specific information for the features. When applicable, links to external databases including GenBank, PubMed, miRBase, snoRNA-LBME-db, piRNABank, and the MIT siRNA database are provided. Conclusion AGD comprises a comprehensive list of susceptibility genes and copy number variations reported to-date in association with autism, as well as all known human noncoding RNA genes and fragile sites. Such a unique and inclusive autism genetic database will facilitate the evaluation of autism susceptibility factors in relation to known human noncoding RNAs and fragile sites, impacting on human diseases. As a result, this new autism database offers a valuable tool for the research

  16. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  17. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  18. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  19. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  20. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  1. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  2. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  3. Discovery of candidate disease genes in ENU-induced mouse mutants by large-scale sequencing, including a splice-site mutation in nucleoredoxin.

    Directory of Open Access Journals (Sweden)

    Melissa K Boles

    2009-12-01

    Full Text Available An accurate and precisely annotated genome assembly is a fundamental requirement for functional genomic analysis. Here, the complete DNA sequence and gene annotation of mouse Chromosome 11 was used to test the efficacy of large-scale sequencing for mutation identification. We re-sequenced the 14,000 annotated exons and boundaries from over 900 genes in 41 recessive mutant mouse lines that were isolated in an N-ethyl-N-nitrosourea (ENU mutation screen targeted to mouse Chromosome 11. Fifty-nine sequence variants were identified in 55 genes from 31 mutant lines. 39% of the lesions lie in coding sequences and create primarily missense mutations. The other 61% lie in noncoding regions, many of them in highly conserved sequences. A lesion in the perinatal lethal line l11Jus13 alters a consensus splice site of nucleoredoxin (Nxn, inserting 10 amino acids into the resulting protein. We conclude that point mutations can be accurately and sensitively recovered by large-scale sequencing, and that conserved noncoding regions should be included for disease mutation identification. Only seven of the candidate genes we report have been previously targeted by mutation in mice or rats, showing that despite ongoing efforts to functionally annotate genes in the mammalian genome, an enormous gap remains between phenotype and function. Our data show that the classical positional mapping approach of disease mutation identification can be extended to large target regions using high-throughput sequencing.

  4. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  5. Determination of the scenarios to be included in the assessment of the safety of site for the disposal of radioactive waste in a deep geological formation

    International Nuclear Information System (INIS)

    Escalier des Orres, P.; Devillers, C.; Cernes, A.; Izabel, C.

    1990-01-01

    The procedure for selection and qualification of a site for the disposal of radioactive waste in a deep geological formation began in France in the early eighties. The public authorities, working from a recommendation by the ANDRA, made a pre-selection of four sites, each of which corresponded to a particular type of geological formation - granite, clay, salt and shale. Within two years, one of these sites would be chosen as the location for an underground laboratory, intended to verify whether the site was suitable as a nuclear waste repository and to prepare for its construction. The safety analysis for site qualification makes use of evolutionary scenarios representing the repository and its environment, selected by means of a deterministic method. This analysis defines, with an appropriate level of detail, a 'reference' scenario and 'random events' scenarios. (author)

  6. Determination of the scenarios to be included in the assessment of the safety of site for the disposal of radioactive waste in a deep geological formation

    Energy Technology Data Exchange (ETDEWEB)

    Escalier des Orres, P; Devillers, C; Cernes, A; Izabel, C [Agence Nationale pour la Gestion des Dechets Radioactifs - ANDRA (France)

    1990-07-01

    The procedure for selection and qualification of a site for the disposal of radioactive waste in a deep geological formation began in France in the early eighties. The public authorities, working from a recommendation by the ANDRA, made a pre-selection of four sites, each of which corresponded to a particular type of geological formation - granite, clay, salt and shale. Within two years, one of these sites would be chosen as the location for an underground laboratory, intended to verify whether the site was suitable as a nuclear waste repository and to prepare for its construction. The safety analysis for site qualification makes use of evolutionary scenarios representing the repository and its environment, selected by means of a deterministic method. This analysis defines, with an appropriate level of detail, a 'reference' scenario and 'random events' scenarios. (author)

  7. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  8. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  9. Deriving site-specific soil clean-up values for metals and metalloids: rationale for including protection of soil microbial processes.

    Science.gov (United States)

    Kuperman, Roman G; Siciliano, Steven D; Römbke, Jörg; Oorts, Koen

    2014-07-01

    Although it is widely recognized that microorganisms are essential for sustaining soil fertility, structure, nutrient cycling, groundwater purification, and other soil functions, soil microbial toxicity data were excluded from the derivation of Ecological Soil Screening Levels (Eco-SSL) in the United States. Among the reasons for such exclusion were claims that microbial toxicity tests were too difficult to interpret because of the high variability of microbial responses, uncertainty regarding the relevance of the various endpoints, and functional redundancy. Since the release of the first draft of the Eco-SSL Guidance document by the US Environmental Protection Agency in 2003, soil microbial toxicity testing and its use in ecological risk assessments have substantially improved. A wide range of standardized and nonstandardized methods became available for testing chemical toxicity to microbial functions in soil. Regulatory frameworks in the European Union and Australia have successfully incorporated microbial toxicity data into the derivation of soil threshold concentrations for ecological risk assessments. This article provides the 3-part rationale for including soil microbial processes in the development of soil clean-up values (SCVs): 1) presenting a brief overview of relevant test methods for assessing microbial functions in soil, 2) examining data sets for Cu, Ni, Zn, and Mo that incorporated soil microbial toxicity data into regulatory frameworks, and 3) offering recommendations on how to integrate the best available science into the method development for deriving site-specific SCVs that account for bioavailability of metals and metalloids in soil. Although the primary focus of this article is on the development of the approach for deriving SCVs for metals and metalloids in the United States, the recommendations provided in this article may also be applicable in other jurisdictions that aim at developing ecological soil threshold values for protection of

  10. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  11. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  12. 75 FR 57506 - EDS, an HP Company, A Subsidiary of Hewlett-Packard Company Including On-Site Leased Workers from...

    Science.gov (United States)

    2010-09-21

    .... The workers are engaged in activities related to information technology (IT) outsourcing services. New information shows that workers leased from Compuware Corporation were employed on-site at the Detroit...

  13. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  14. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  15. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  16. Sensitivity of docetaxel-resistant MCF-7 breast cancer cells to microtubule-destabilizing agents including vinca alkaloids and colchicine-site binding agents.

    Directory of Open Access Journals (Sweden)

    Richard C Wang

    Full Text Available One of the main reasons for disease recurrence in the curative breast cancer treatment setting is the development of drug resistance. Microtubule targeted agents (MTAs are among the most commonly used drugs for the treatment of breaset cancer and therefore overcoming taxane resistance is of primary clinical importance. Our group has previously demonstrated that the microtubule dynamics of docetaxel-resistant MCF-7TXT cells are insensitivity to docetaxel due to the distinct expression profiles of β-tubulin isotypes in addition to the high expression of p-glycoprotein (ABCB1. In the present investigation we examined whether taxane-resistant breast cancer cells are more sensitive to microtubule destabilizing agents including vinca alkaloids and colchicine-site binding agents (CSBAs than the non-resistant cells.Two isogenic MCF-7 breast cancer cell lines were selected for resistance to docetaxel (MCF-7TXT and the wild type parental cell line (MCF-7CC to examine if taxane-resistant breast cancer cells are sensitive to microtubule-destabilizing agents including vinca alkaloids and CSBAs. Cytotoxicity assays, immunoblotting, indirect immunofluorescence and live imaging were used to study drug resistance, apoptosis, mitotic arrest, microtubule formation, and microtubule dynamics.MCF-7TXT cells were demonstrated to be cross resistant to vinca alkaloids, but were more sensitive to treatment with colchicine compared to parental non-resistant MCF-7CC cells. Cytotoxicity assays indicated that the IC50 of MCF-7TXT cell to vinorelbine and vinblastine was more than 6 and 3 times higher, respectively, than that of MCF-7CC cells. By contrast, the IC50 of MCF-7TXT cell for colchincine was 4 times lower than that of MCF-7CC cells. Indirect immunofluorescence showed that all MTAs induced the disorganization of microtubules and the chromatin morphology and interestingly each with a unique pattern. In terms of microtubule and chromain morphology, MCF-7TXT cells were

  17. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  18. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  19. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  20. Markers of breast cancer stromal fibroblasts in the primary tumour site associated with lymph node metastasis : a systematic review including our case series

    NARCIS (Netherlands)

    Azevedo Koike Folgueira, Maria Aparecida; Maistro, Simone; Hirata Katayama, Maria Lucia; Roela, Rosimeire Aparecida; Lopes Mundim, Fiorita Gonzales; Nanogaki, Suely; de Bock, Geertruida H.; Brentani, M. Mitzi

    2013-01-01

    CAFs (cancer-associated fibroblasts), the most abundant cell type in breast cancer stroma, produce a plethora of chemokines, growth factors and ECM (extracellular matrix) proteins, that may contribute to dissemination and metastasis. Axillary nodes are the first metastatic site in breast cancer;

  1. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  2. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  3. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  4. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  5. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  6. One-Tube-Only Standardized Site-Directed Mutagenesis: An Alternative Approach to Generate Amino Acid Substitution Collections.

    Directory of Open Access Journals (Sweden)

    Janire Mingo

    Full Text Available Site-directed mutagenesis (SDM is a powerful tool to create defined collections of protein variants for experimental and clinical purposes, but effectiveness is compromised when a large number of mutations is required. We present here a one-tube-only standardized SDM approach that generates comprehensive collections of amino acid substitution variants, including scanning- and single site-multiple mutations. The approach combines unified mutagenic primer design with the mixing of multiple distinct primer pairs and/or plasmid templates to increase the yield of a single inverse-PCR mutagenesis reaction. Also, a user-friendly program for automatic design of standardized primers for Ala-scanning mutagenesis is made available. Experimental results were compared with a modeling approach together with stochastic simulation data. For single site-multiple mutagenesis purposes and for simultaneous mutagenesis in different plasmid backgrounds, combination of primer sets and/or plasmid templates in a single reaction tube yielded the distinct mutations in a stochastic fashion. For scanning mutagenesis, we found that a combination of overlapping primer sets in a single PCR reaction allowed the yield of different individual mutations, although this yield did not necessarily follow a stochastic trend. Double mutants were generated when the overlap of primer pairs was below 60%. Our results illustrate that one-tube-only SDM effectively reduces the number of reactions required in large-scale mutagenesis strategies, facilitating the generation of comprehensive collections of protein variants suitable for functional analysis.

  7. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  8. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  9. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  10. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  11. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  12. Biosafety- A Regulatory Primer for DOE/NNSA Sites

    Energy Technology Data Exchange (ETDEWEB)

    Siegel, Dina Mary [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-04

    The objectives of a biological safety program, and this are to ensure that work with biological materials are conducted in compliance with applicable biosafety standards and ensure that protection of workers, facilities, the public, and the environment.

  13. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  14. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  15. Corrective Action Investigation Plan for Corrective Action Unit 322: Areas 1 and 3 Release Sites and Injection Wells, Nevada Test Site, Nevada: Revision 0, Including Record of Technical Change No. 1

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office

    2003-07-16

    This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office's approach to collect the data necessary to evaluate corrective action alternatives (CAAs) appropriate for the closure of Corrective Action Unit (CAU) 322, Areas 1 and 3 Release Sites and Injection Wells, Nevada Test Site, Nevada, under the Federal Facility Agreement and Consent Order. Corrective Action Unit 322 consists of three Corrective Action Sites (CASs): 01-25-01, AST Release (Area 1); 03-25-03, Mud Plant AST Diesel Release (Area 3); 03-20-05, Injection Wells (Area 3). Corrective Action Unit 322 is being investigated because existing information on the nature and extent of potential contamination is insufficient to evaluate and recommend corrective action alternatives. The investigation of three CASs in CAU 322 will determine if hazardous and/or radioactive constituents are present at concentrations and locations that could potentially pose a threat to human health and the environment. The results of this field investigation will support a defensible evaluation of corrective action alternatives in the corrective action decision document.

  16. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  17. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  18. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  19. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  20. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  1. A Mathematica primer for physicists

    CERN Document Server

    Napolitano, Jim

    2018-01-01

    This book offers the most concise and approachable guide for quickly getting into Mathematica and using it for solving common problems. The author addresses a wide range of problems, including numerical calculations, animation, and visualization tools.

  2. A mathematica primer for physicists

    CERN Document Server

    Napolitano, Jim

    2018-01-01

    This book offers the most concise and approachable guide for quickly getting into Mathematica and using it for solving common problems. The author addresses a wide range of problems, including numerical calculations, animation, and visualization tools.

  3. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  4. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  5. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  6. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  7. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  8. A Primer on Functional Analysis

    Science.gov (United States)

    Yoman, Jerome

    2008-01-01

    This article presents principles and basic steps for practitioners to complete a functional analysis of client behavior. The emphasis is on application of functional analysis to adult mental health clients. The article includes a detailed flow chart containing all major functional diagnoses and behavioral interventions, with functional assessment…

  9. Bright Idea: Solar Energy Primer.

    Science.gov (United States)

    Missouri State Dept. of Natural Resources, Jefferson City.

    This booklet is intended to address questions most frequently asked about solar energy. It provides basic information and a starting point for prospective solar energy users. Information includes discussion of solar space heating, solar water heating, and solar greenhouses. (Author/RE)

  10. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  11. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  12. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  13. A primer on string theory

    CERN Document Server

    Schomerus, Volker

    2017-01-01

    Since its conception in the 1960s, string theory has been hailed as one of the most promising routes we have to unify quantum mechanics and general relativity. This book provides a concise introduction to string theory explaining central concepts, mathematical tools and covering recent developments in physics including compactifications and gauge/string dualities. With string theory being a multidisciplinary field interfacing with high energy physics, mathematics and quantum field theory, this book is ideal for both students with no previous knowledge of the field and scholars from other disciplines who are looking for an introduction to basic concepts.

  14. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  16. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  17. A primer for workers' compensation.

    Science.gov (United States)

    Bible, Jesse E; Spengler, Dan M; Mir, Hassan R

    2014-07-01

    A physician's role within a workers' compensation injury extends far beyond just evaluation and treatment with several socioeconomic and psychological factors at play compared with similar injuries occurring outside of the workplace. Although workers' compensation statutes vary among states, all have several basic features with the overall goal of returning the injured worker to maximal function in the shortest time period, with the least residual disability and shortest time away from work. To help physicians unfamiliar with the workers' compensation process accomplish these goals. Review. Educational review. The streamlined review addresses the topics of why is workers' compensation necessary; what does workers' compensation cover; progression after work injury; impairment and maximum medical improvement, including how to use the sixth edition of American Medical Association's (AMA) Guides to the evaluation of permanent impairment (Guides); completion of work injury claim after impairment rating; independent medical evaluation; and causation. In the "no-fault" workers' compensation system, physicians play a key role in progressing the claim along and, more importantly, getting the injured worker back to work as soon as safely possible. Physicians should remain familiar with the workers' compensation process, along with how to properly use the AMA Guides. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. 'Learning Organizations': a clinician's primer.

    Science.gov (United States)

    O'Connor, Nick; Kotze, Beth

    2008-06-01

    Most clinicians are poorly informed in relation to the key concepts of organizational learning. Yet the paradigm may offer clinicians a powerful method for using their knowledge and skills to respond to the demands of a changing environment through experimentation and learning. The concept is critically examined. Organizational learning principles are presented, including a conceptual framework for assessing health services as Learning Organizations. Barriers to organizational learning and strategies to overcome these are discussed. The seminal works of Argyris and Senge are reviewed and a framework for assessing organizational learning in health services is proposed. Current area health service actions are evaluated against the 'diagnostic' framework for a Learning Organization. Although critical examination reveals a poor empirical basis for the concept, the metaphor of the Learning Organization provides a useful conceptual framework and tools for individuals and organizations to apply in developing knowledge and effecting change. The Clinical Practice Improvement and Root Cause Analysis programs being conducted across NSW area health services meet the criteria for effective organizational learning. Key concepts from organizational learning theory provide a diagnostic framework for evaluating area health services as Learning Organizations and support two current strategies for overcoming barriers to organizational learning.

  19. Current procedural terminology; a primer.

    Science.gov (United States)

    Hirsch, Joshua A; Leslie-Mazwi, Thabele M; Nicola, Gregory N; Barr, Robert M; Bello, Jacqueline A; Donovan, William D; Tu, Raymond; Alson, Mark D; Manchikanti, Laxmaiah

    2015-04-01

    In 1966, The American Medical Association (AMA) working with multiple major medical specialty societies developed an iterative coding system for describing medical procedures and services using uniform language, the Current Procedural Terminology (CPT) system. The current code set, CPT IV, forms the basis of reporting most of the services performed by healthcare providers, physicians and non-physicians as well as facilities allowing effective, reliable communication among physician and other providers, third parties and patients. This coding system and its maintenance has evolved significantly since its inception, and now goes well beyond its readily perceived role in reimbursement. Additional roles include administrative management, tracking new and investigational procedures, and evolving aspects of 'pay for performance'. The system also allows for local, regional and national utilization comparisons for medical education and research. Neurointerventional specialists use CPT category I codes regularly--for example, 36,215 for first-order cerebrovascular angiography, 36,216 for second-order vessels, and 37,184 for acute stroke treatment by mechanical means. Additionally, physicians add relevant modifiers to the CPT codes, such as '-26' to indicate 'professional charge only,' or '-59' to indicate a distinct procedural service performed on the same day. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  20. Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

    Science.gov (United States)

    Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

    2017-07-01

    Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

  1. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  2. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  3. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  4. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  5. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  6. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  7. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  8. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  9. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  10. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  11. Emerging technologies a primer for librarians

    CERN Document Server

    Koerber, Jennifer

    2015-01-01

    Here's a one-stop snapshot of emerging technologies every librarian should know about and examples that illustrate how the technologies are being used in libraries today! The e-book includes videos of interviews with librarians that are using them. The videos are available on a web site for people who purchase the print book. The first four chapters-Audio & Video, Self- and Micro-Publishing, Mobile Technology, and Crowdfunding-all look at older technologies reinvented and reimagined through significant advances in quality, scale, or hardware. Many libraries were already

  12. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  13. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  14. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  15. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  16. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  17. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  18. Time-dependent density functional theory (TD-DFT) coupled with reference interaction site model self-consistent field explicitly including spatial electron density distribution (RISM-SCF-SEDD)

    Energy Technology Data Exchange (ETDEWEB)

    Yokogawa, D., E-mail: d.yokogawa@chem.nagoya-u.ac.jp [Department of Chemistry, Graduate School of Science, Nagoya University, Chikusa, Nagoya 464-8602 (Japan); Institute of Transformative Bio-Molecules (WPI-ITbM), Nagoya University, Chikusa, Nagoya 464-8602 (Japan)

    2016-09-07

    Theoretical approach to design bright bio-imaging molecules is one of the most progressing ones. However, because of the system size and computational accuracy, the number of theoretical studies is limited to our knowledge. To overcome the difficulties, we developed a new method based on reference interaction site model self-consistent field explicitly including spatial electron density distribution and time-dependent density functional theory. We applied it to the calculation of indole and 5-cyanoindole at ground and excited states in gas and solution phases. The changes in the optimized geometries were clearly explained with resonance structures and the Stokes shift was correctly reproduced.

  19. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  20. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  1. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.

    1981-12-01

    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  2. Corrective Action Investigation Plan for Corrective Action Unit 214: Bunkers and Storage Areas Nevada Test Site, Nevada: Revision 0, Including Record of Technical Change No. 1 and No. 2

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office

    2003-05-16

    This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit (CAU) 214 under the Federal Facility Agreement and Consent Order. Located in Areas 5, 11, and 25 of the Nevada Test Site, CAU 214 consists of nine Corrective Action Sites (CASs): 05-99-01, Fallout Shelters; 11-22-03, Drum; 25-99-12, Fly Ash Storage; 25-23-01, Contaminated Materials; 25-23-19, Radioactive Material Storage; 25-99-18, Storage Area; 25-34-03, Motor Dr/Gr Assembly (Bunker); 25-34-04, Motor Dr/Gr Assembly (Bunker); and 25-34-05, Motor Dr/Gr Assembly (Bunker). These sites are being investigated because existing information on the nature and extent of potential contamination is insufficient to evaluate and recommend corrective action alternatives (CAAs). The suspected contaminants and critical analyte s for CAU 214 include oil (total petroleum hydrocarbons-diesel-range organics [TPH-DRO], polychlorinated biphenyls [PCBs]), pesticides (chlordane, heptachlor, 4,4-DDT), barium, cadmium, chronium, lubricants (TPH-DRO, TPH-gasoline-range organics [GRO]), and fly ash (arsenic). The land-use zones where CAU 214 CASs are located dictate that future land uses will be limited to nonresidential (i.e., industrial) activities. The results of this field investigation will support a defensible evaluation of viable corrective action alternatives that will be presented in the corrective action decision document.

  3. THM large spatial-temporal model to simulate the past 2 Ma hydrogeological evolution of Paris Basin including natural tracer transport as part of site characterization for radwaste repository project Cigéo - France

    Science.gov (United States)

    Benabderrahmane, A., Sr.

    2017-12-01

    Hydrogeological site characterization for deep geological high level and intermediate level long lived radioactive waste repository cover a large time scale needed for safety analysis and calculation. Hydrogeological performance of a site relies also on the effects of geodynamic evolution as tectonic uplift, erosion/sedimentation and climate including glaciation on the groundwater flow and solute and heat transfer. Thermo-Hydro-Mechanical model of multilayered aquifer system of Paris Basin is developed to reproduce the present time flow and the natural tracer (Helium) concentration profiles based on the last 2 Ma of geodynamic evolution. Present time geological conceptual model consist of 27 layers at Paris Basin (Triassic-Tertiary) with refinement at project site scale (29 layers from Triassic to Portlandian). Target layers are the clay host formation of Callovo-Oxfrodian age (160 Ma) and the surrounding aquifer layers of Oxfordian and Dogger. Modelled processes are: groundwater flow, heat and solutes (natural tracers) transport, freezing and thawing of groundwater (expansion and retreat of permafrost), deformation of the multilayered aquifer system induced by differential tectonic uplift and the hydro-mechanical stress effect as caused by erosion of the outcropping layers. Numerical simulation considers a period from 2 Ma BP and up to the present. Transient boundary conditions are governed by geodynamic processes: (i) modification of the geometry of the basin and (ii) temperatures along the topography will change according to a series of 15 identical climate cycles with multiple permafrost (glaciation) periods. Numerical model contains 71 layers and 18 million cells. The solution procedure solves three coupled systems of equations, head, temperature and concentrations, by the use of a finite difference method, and by applying extensive parallel processing. The major modelling results related to the processes of importance for site characterization as hydraulic

  4. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  5. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  6. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  7. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  8. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  9. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  10. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  11. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  12. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  13. Corrective Action Investigation Plan for Corrective Action Unit 5: Landfills, Nevada Test Site, Nevada (Rev. No.: 0) includes Record of Technical Change No. 1 (dated 9/17/2002)

    Energy Technology Data Exchange (ETDEWEB)

    IT Corporation, Las Vegas, NV

    2002-05-28

    This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit (CAU) 5 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 5 consists of eight Corrective Action Sites (CASs): 05-15-01, Sanitary Landfill; 05-16-01, Landfill; 06-08-01, Landfill; 06-15-02, Sanitary Landfill; 06-15-03, Sanitary Landfill; 12-15-01, Sanitary Landfill; 20-15-01, Landfill; 23-15-03, Disposal Site. Located between Areas 5, 6, 12, 20, and 23 of the Nevada Test Site (NTS), CAU 5 consists of unlined landfills used in support of disposal operations between 1952 and 1992. Large volumes of solid waste were produced from the projects which used the CAU 5 landfills. Waste disposed in these landfills may be present without appropriate controls (i.e., use restrictions, adequate cover) and hazardous and/or radioactive constituents may be present at concentrations and locations that could potentially pose a threat to human health and/or the environment. During the 1992 to 1995 time frame, the NTS was used for various research and development projects including nuclear weapons testing. Instead of managing solid waste at one or two disposal sites, the practice on the NTS was to dispose of solid waste in the vicinity of the project. A review of historical documentation, process knowledge, personal interviews, and inferred activities associated with this CAU identified the following as potential contaminants of concern: volatile organic compounds, semivolatile organic compounds, polychlorinated biphenyls, pesticides, petroleum hydrocarbons (diesel- and gasoline-range organics), Resource Conservation and Recovery Act Metals, plus nickel and zinc. A two-phase approach has been selected to collect information and generate data to satisfy needed resolution

  14. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    Science.gov (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  15. Site operations

    International Nuclear Information System (INIS)

    House, W.B.; Ebenhack, D.G.

    1989-01-01

    This chapter is a discussion of the management and operations practices used at the Barnwell Waste Management Facility in Barnwell, SC. The following topics are discussed: (1) Waste receiving and inspection, including manifest and certificates of compliance, radiological surveys, disposition of nonconforming items, and decontamination and disposition of secondary waste streams; (2) Waste disposal, including Title 10 CFR 61 requirements, disposal area evaluations, shipment offloading, container emplacement, and radiation protection; (3) Trench closure, including trench backfilling, trench capping, and permanent markers; (4) Site maintenance and stabilization, including trench maintenance, surface water management, and site closure activities; (5) Site monitoring programs, including operational monitoring, and environmental monitoring program; (6) Personnel training and qualifications, including basic training program, safety training program, special skills training, and physical qualifications; (7) Records management, including waste records, personnel training records, personnel dosimetry records, site monitoring records, trench qualification and construction records, and site drawings and stabilization records; (8) Site security; (9) Emergency response plans; and (10) Quality assurance

  16. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  17. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  18. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  19. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  20. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  1. Corrective Action Investigation Plan for Corrective Action Unit 165: Areas 25 and 26 Dry Well and Washdown Areas, Nevada Test Site, Nevada (including Record of Technical Change Nos. 1, 2, and 3) (January 2002, Rev. 0)

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office (NNSA/NV)

    2002-01-09

    This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit (CAU) 165 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 165 consists of eight Corrective Action Sites (CASs): CAS 25-20-01, Lab Drain Dry Well; CAS 25-51-02, Dry Well; CAS 25-59-01, Septic System; CAS 26-59-01, Septic System; CAS 25-07-06, Train Decontamination Area; CAS 25-07-07, Vehicle Washdown; CAS 26-07-01, Vehicle Washdown Station; and CAS 25-47-01, Reservoir and French Drain. All eight CASs are located in the Nevada Test Site, Nevada. Six of these CASs are located in Area 25 facilities and two CASs are located in Area 26 facilities. The eight CASs at CAU 165 consist of dry wells, septic systems, decontamination pads, and a reservoir. The six CASs in Area 25 are associated with the Nuclear Rocket Development Station that operated from 1958 to 1973. The two CASs in Area 26 are associated with facilities constructed for Project Pluto, a series of nuclear reactor tests conducted between 1961 to 1964 to develop a nuclear-powered ramjet engine. Based on site history, the scope of this plan will be a two-phased approach to investigate the possible presence of hazardous and/or radioactive constituents at concentrations that could potentially pose a threat to human health and the environment. The Phase I analytical program for most CASs will include volatile organic compounds, semivolatile organic compounds, Resource Conservation and Recovery Act metals, total petroleum hydrocarbons, polychlorinated biphenyls, and radionuclides. If laboratory data obtained from the Phase I investigation indicates the presence of contaminants of concern, the process will continue with a Phase II investigation to define the extent of contamination. Based on the

  2. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  3. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  4. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  5. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  6. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  7. Molecular mimicry of human tRNALys anti-codon domain by HIV-1 RNA genome facilitates tRNA primer annealing.

    Science.gov (United States)

    Jones, Christopher P; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin

    2013-02-01

    The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNA(Lys3). Host cell tRNA(Lys) is selectively packaged into HIV-1 through a specific interaction between the major tRNA(Lys)-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNA(Lys3) is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNA(Lys) and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNA(Lys3) in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNA(Lys) to increase the efficiency of tRNA(Lys3) annealing to viral RNA.

  8. Site decontamination

    International Nuclear Information System (INIS)

    Bicker, A.E.

    1981-01-01

    Among the several DOE sites that have been radiologically decontaminated under the auspices of the Nevada Operations Office are three whose physical characteristics are unique. These are the Tatum Dome Test Site (TDTS) near Hattiesburg, Mississippi; a location of mountainous terrain (Pahute Mesa) on the Nevada Test Site; and the GNOME site near Carlsbad, New Mexico. In each case the contamination, the terrain, and the climate conditions were different. This presentation includes a brief description of each site, the methods used to perform radiological surveys, the logistics required to support the decontamination (including health physics and sample analysis), and the specific techniques used to reduce or remove the contamination

  9. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  10. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  11. Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

    Directory of Open Access Journals (Sweden)

    Stephen Larson

    2014-03-01

    Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

  12. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  13. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  14. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  15. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  16. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  17. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

    2018-01-01

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  18. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.

    2018-05-23

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  19. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  20. ORIGAMI Automator Primer. Automated ORIGEN Source Terms and Spent Fuel Storage Pool Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Wieselquist, William A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Thompson, Adam B. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bowman, Stephen M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Peterson, Joshua L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-04-01

    Source terms and spent nuclear fuel (SNF) storage pool decay heat load analyses for operating nuclear power plants require a large number of Oak Ridge Isotope Generation and Depletion (ORIGEN) calculations. SNF source term calculations also require a significant amount of bookkeeping to track quantities such as core and assembly operating histories, spent fuel pool (SFP) residence times, heavy metal masses, and enrichments. The ORIGEN Assembly Isotopics (ORIGAMI) module in the SCALE code system provides a simple scheme for entering these data. However, given the large scope of the analysis, extensive scripting is necessary to convert formats and process data to create thousands of ORIGAMI input files (one per assembly) and to process the results into formats readily usable by follow-on analysis tools. This primer describes a project within the SCALE Fulcrum graphical user interface (GUI) called ORIGAMI Automator that was developed to automate the scripting and bookkeeping in large-scale source term analyses. The ORIGAMI Automator enables the analyst to (1) easily create, view, and edit the reactor site and assembly information, (2) automatically create and run ORIGAMI inputs, and (3) analyze the results from ORIGAMI. ORIGAMI Automator uses the standard ORIGEN binary concentrations files produced by ORIGAMI, with concentrations available at all time points in each assembly’s life. The GUI plots results such as mass, concentration, activity, and decay heat using a powerful new ORIGEN Post-Processing Utility for SCALE (OPUS) GUI component. This document includes a description and user guide for the GUI, a step-by-step tutorial for a simplified scenario, and appendices that document the file structures used.

  1. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  2. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  3. Physical and chemical characteristics including total and geochemical forms of phosphorus in sediment from the top 30 centimeters of cores collected in October 2006 at 26 sites in Upper Klamath Lake, Oregon

    Science.gov (United States)

    Simon, Nancy S.; Ingle, Sarah N.

    2011-01-01

    μThis study of phosphorus (P) cycling in eutrophic Upper Klamath Lake (UKL), Oregon, was conducted by the U.S. Geological Survey in cooperation with the U.S. Bureau of Reclamation. Lakebed sediments from the upper 30 centimeters (cm) of cores collected from 26 sites were characterized. Cores were sampled at 0.5, 1.5, 2.5, 3.5, 4.5, 10, 15, 20, 25, and 30 cm. Prior to freezing, water content and sediment pH were determined. After being freeze-dried, all samples were separated into greater than 63-micron (μm) particle-size (coarse) and less than 63-μm particle-size (fine) fractions. In the surface samples (0.5 to 4.5 cm below the sediment water interface), approximately three-fourths of the particles were larger than 63-μm. The ratios of the coarse particle-size fraction (>63 μm) and the fine particle-size fraction (determination of total concentrations of aluminum (Al), calcium (Ca), carbon (C), iron (Fe), poorly crystalline Fe, nitrogen (N), P, and titanium (Ti). Total Fe concentrations were the largest in sediment from the northern portion of UKL, Howard Bay, and the southern portion of the lake. Concentrations of total Al, Ca, and Ti were largest in sediment from the northern, central, and southernmost portions of the lake and in sediment from Howard Bay. Concentrations of total C and N were largest in sediment from the embayments and in sediment from the northern arm and southern portion of the lake in the general region of Buck Island. Concentrations of total C were larger in the greater than 63-μm particle-size fraction than in the less than 63-μm particle-size fraction. Sediments were sequentially extracted to determine concentrations of inorganic forms of P, including loosely sorbed P, P associated with poorly crystalline Fe oxides, and P associated with mineral phases. The difference between the concentration of total P and sum of the concentrations of inorganic forms of P is referred to as residual P. Residual P was the largest fraction of P in all

  4. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  5. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  6. Primer registro de Empidonax fulvifrons en Nicaragua

    Science.gov (United States)

    Francisco J. Muñoz; Wayne J Arendt; Liliana Chavarria; Pablo Somarriba; Aura L. Cruz

    2009-01-01

    English title: First documented report of buff-breasted fl ycatcher Empidonax fulvifrons in Nicargua. A buff-breasted flycatcher (Empidonax fulvifrons) was observed on 4 January 2008 in Loma Fría, Dipilto Municipality, Department of Nueva Segovia. The bird was sited in a pasture with scattered pines (Pinus oocarpa) adjacent to a pine-oak forest. It formed part of a...

  7. Design, Synthesis, and in Vitro Pharmacology of New Radiolabeled γ-Hydroxybutyric Acid Analogues Including Photolabile Analogues with Irreversible Binding to the High-Affinity γ-Hydroxybutyric Acid Binding Sites

    DEFF Research Database (Denmark)

    Sabbatini, Paola; Wellendorph, Petrine; Høg, Signe

    2010-01-01

    γ-Hydroxybutyric acid (GHB) is a psychotropic compound endogenous to the brain. Despite its potential physiological significance, the complete molecular mechanisms of action remain unexplained. To facilitate the isolation and identification of the high-affinity GHB binding site, we herein report ...

  8. Epitaxial phase diagrams of SrTiO3, CaTiO3, and SrHfO3: Computational investigation including the role of antiferrodistortive and A -site displacement modes

    Science.gov (United States)

    Angsten, Thomas; Asta, Mark

    2018-04-01

    Ground-state epitaxial phase diagrams are calculated by density functional theory (DFT) for SrTiO3, CaTiO3, and SrHfO3 perovskite-based compounds, accounting for the effects of antiferrodistortive and A -site displacement modes. Biaxial strain states corresponding to epitaxial growth of (001)-oriented films are considered, with misfit strains ranging between -4 % and 4%. Ground-state structures are determined using a computational procedure in which input structures for DFT optimizations are identified as local minima in expansions of the total energy with respect to strain and soft-mode degrees of freedom. Comparison to results of previous DFT studies demonstrates the effectiveness of the computational approach in predicting ground-state phases. The calculated results show that antiferrodistortive octahedral rotations and associated A -site displacement modes act to suppress polarization and reduce the epitaxial strain energy. A projection of calculated atomic displacements in the ground-state epitaxial structures onto soft-mode eigenvectors shows that three ferroelectric and six antiferrodistortive displacement modes are dominant at all misfit strains considered, with the relative contributions from each varying systematically with the strain. Additional A -site displacement modes contribute to the atomic displacements in CaTiO3 and SrHfO3, which serve to optimize the coordination of the undersized A -site cation.

  9. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  10. Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

    International Nuclear Information System (INIS)

    D. S. Lucas

    2004-01-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

  11. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  12. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  13. Improved primer sequences for the mitochondrial ND1, ND3/4 and ND5/6 segments in salmonid fishes : application to RFLP analysis of Atlantic salmon

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Hansen, Michael Møller; Mensberg, Karen-Lise Dons

    1998-01-01

    New specific primers for the mtDNA segments ND1, ND3/4 and ND5/6 designed from the rainbow trout sequence, improved PCR amplification for salmonid fishes. RFLP analysis revealed restriction site variation for all three segments in Atlantic salmon. Eleven haplotypes were detected in a screening...

  14. A Librarian's Primer on Financial Ratios.

    Science.gov (United States)

    Kerbel, Sandra Sandor

    1982-01-01

    Explains in simple terms the nature and function of a number of basic types of business and industrial financial ratios. An annotated list of five basic sources for ratios is included and a reference list and bibliography are attached. (JL)

  15. A DOS Primer for Librarians: Part II.

    Science.gov (United States)

    Beecher, Henry

    1990-01-01

    Provides an introduction to DOS commands and strategies for the effective organization and use of hard disks. Functions discussed include the creation of directories and subdirectories, enhanced copying, the assignment of disk drives, and backing up the hard disk. (CLB)

  16. Early Identification of Psychosis: A Primer

    OpenAIRE

    Early Psychosis Initiative of British Columbia

    2000-01-01

    This document is an educational resource concerning the early identification of psychosis. Primary topics addressed include: an outline of the importance of early intervention; signs and symptoms of psychosis; and strategies for recognizing psychosis.  

  17. State Bioenergy Primer: Information and Resources for States on Issues, Opportunities, and Options for Advancing Bioenergy

    Energy Technology Data Exchange (ETDEWEB)

    Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.

    2009-09-01

    One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.

  18. Mitochondrial genome of the Komodo dragon: efficient sequencing method with reptile-oriented primers and novel gene rearrangements.

    Science.gov (United States)

    Kumazawa, Yoshinori; Endo, Hideki

    2004-04-30

    The mitochondrial genome of the Komodo dragon (Varanus komodoensis) was nearly completely sequenced, except for two highly repetitive noncoding regions. An efficient sequencing method for squamate mitochondrial genomes was established by combining the long polymerase chain reaction (PCR) technology and a set of reptile-oriented primers designed for nested PCR amplifications. It was found that the mitochondrial genome had novel gene arrangements in which genes from NADH dehydrogenase subunit 6 to proline tRNA were extensively shuffled with duplicate control regions. These control regions had 99% sequence similarity over 700 bp. Although snake mitochondrial genomes are also known to possess duplicate control regions with nearly identical sequences, the location of the second control region suggested independent occurrence of the duplication on lineages leading to snakes and the Komodo dragon. Another feature of the mitochondrial genome of the Komodo dragon was the considerable number of tandem repeats, including sequences with a strong secondary structure, as a possible site for the slipped-strand mispairing in replication. These observations are consistent with hypotheses that tandem duplications via the slipped-strand mispairing may induce mitochondrial gene rearrangements and may serve to maintain similar copies of the control region.

  19. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  20. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  1. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  2. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  3. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  4. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  5. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  6. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  7. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  8. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  9. A project manager's primer on data validation

    International Nuclear Information System (INIS)

    Ramos, S.J.

    1991-01-01

    While carrying out their central responsibility of conducting an environmental investigation in a high- quality, timely, and cost-effective manner, project managers also face a significant challenge due to the many inherent uncertainties associated with characterizing and remediating sites. From all aspects and considerations (health and financial risks; and technical, professional, and legal defensibility/credibility), the project manager must minimize the uncertainty associated with making decisions based on environmental data. A key objective for every project manager is to produce sufficient data of known and acceptable quality. In simple terms, the level of confidence in the gathered data directly relates to: (1) the upfront determination of the types and uses of the data needed (which drives the required quality of the data); (2) the ongoing verification that the prescribed methods by which the data are to be obtained and analyzed are being followed; and (3) the validation of the verified data to determine whether the preestablished data quality objectives have been met, therefore making the data adequate for their intended use(s). This paper focuses on the third clement of the equation for data quality, therefore implying that the first two elements (planning and verification) have been accomplished. The open-quotes Who,close quotes open-quotes What,close quotes open-quotes Why,close quotes open-quotes Whenclose quotes and open-quotes Howclose quotes of data validation are discussed in general terms

  10. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    Science.gov (United States)

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai

    2014-01-01

    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  11. Beyond Your Paycheck: An Employee Benefits Primer.

    Science.gov (United States)

    Stanton, Michael

    1990-01-01

    Discusses fringe benefits and points out that employee benefits in medium and large firms account for more than 27 percent of total compensation. Differentiates among statutory (required by law), compensatory (wages paid for time not worked such as vacation and sick leave), and supplementary (including insurance and pension plans) benefits and…

  12. Nuclear Waste Primer: A Handbook for Citizens.

    Science.gov (United States)

    Weber, Isabelle P.; Wiltshire, Susan D.

    This publication was developed with the intention of offering the nonexpert a concise, balanced introduction to nuclear waste. It outlines the dimensions of the problem, discussing the types and quantities of waste. Included are the sources, types, and hazards of radiation, and some of the history, major legislation, and current status of both…

  13. Building the Digital Library Infrastructure: A Primer.

    Science.gov (United States)

    Tebbetts, Diane R.

    1999-01-01

    Provides a framework for examining the complex infrastructure needed to successfully implement a digital library. Highlights include database development, online public-access catalogs, interactive technical services, full-text documents, hardware and wiring, licensing, access, and security issues. (Author/LRW)

  14. Vaccine supply, demand, and policy: a primer.

    Science.gov (United States)

    Muzumdar, Jagannath M; Cline, Richard R

    2009-01-01

    To provide an overview of supply and demand issues in the vaccine industry and the policy options that have been implemented to resolve these issues. Medline, Policy File, and International Pharmaceutical Abstracts were searched to locate academic journal articles. Other sources reviewed included texts on the topics of vaccine history and policy, government agency reports, and reports from independent think tanks. Keywords included vaccines, immunizations, supply, demand, and policy. Search criteria were limited to English language and human studies. Articles pertaining to vaccine demand, supply, and public policy were selected and reviewed for inclusion. By the authors. Vaccines are biologic medications, therefore making their development and production more difficult and costly compared with "small-molecule" drugs. Research and development costs for vaccines can exceed $800 million, and development may require 10 years or more. Strict manufacturing regulations and facility upgrades add to these costs. Policy options to increase and stabilize the supply of vaccines include those aimed at increasing supply, such as government subsidies for basic vaccine research, liability protection for manufacturers, and fast-track approval for new vaccines. Options to increase vaccine demand include advance purchase commitments, government stockpiles, and government financing for select populations. High development costs and multiple barriers to entry have led to a decline in the number of vaccine manufacturers. Although a number of vaccine policies have met with mixed success in increasing the supply of and demand for vaccines, a variety of concerns remain, including developing vaccines for complex pathogens and increasing immunization rates with available vaccines. New policy innovations such as advance market commitments and Medicare Part D vaccine coverage have been implemented and may aid in resolving some of the problems in the vaccine industry.

  15. Relatively high rates of G:C → A:T transitions at CpG sites were observed in certain epithelial tissues including pancreas and submaxillary gland of adult big blue® mice.

    Science.gov (United States)

    Prtenjaca, Anita; Tarnowski, Heather E; Marr, Alison M; Heney, Melanie A; Creamer, Laura; Sathiamoorthy, Sarmitha; Hill, Kathleen A

    2014-01-01

    With few exceptions, spontaneous mutation frequency and pattern are similar across tissue types and relatively constant in young to middle adulthood in wild type mice. Underrepresented in surveys of spontaneous mutations across murine tissues is the diversity of epithelial tissues. For the first time, spontaneous mutations were detected in pancreas and submaxillary gland and compared with kidney, lung, and male germ cells from five adult male Big Blue® mice. Mutation load was assessed quantitatively through measurement of mutant and mutation frequency and qualitatively through identification of mutations and characterization of recurrent mutations, multiple mutations, mutation pattern, and mutation spectrum. A total of 9.6 million plaque forming units were screened, 226 mutants were collected, and 196 independent mutations were identified. Four novel mutations were discovered. Spontaneous mutation frequency was low in pancreas and high in the submaxillary gland. The submaxillary gland had multiple recurrent mutations in each of the mice and one mutant had two independent mutations. Mutation patterns for epithelial tissues differed from that observed in male germ cells with a striking bias for G:C to A:T transitions at CpG sites. A comprehensive review of lacI spontaneous mutation patterns in young adult mice and rats identified additional examples of this mutational bias. An overarching observation about spontaneous mutation frequency in adult tissues of the mouse remains one of stability. A repeated observation in certain epithelial tissues is a higher rate of G:C to A:T transitions at CpG sites and the underlying mechanisms for this bias are not known. Copyright © 2013 Wiley Periodicals, Inc.

  16. Radiation oncology: a primer for medical students.

    Science.gov (United States)

    Berman, Abigail T; Plastaras, John P; Vapiwala, Neha

    2013-09-01

    Radiation oncology requires a complex understanding of cancer biology, radiation physics, and clinical care. This paper equips the medical student to understand the fundamentals of radiation oncology, first with an introduction to cancer treatment and the use of radiation therapy. Considerations during radiation oncology consultations are discussed extensively with an emphasis on how to formulate an assessment and plan including which treatment modality to use. The treatment planning aspects of radiation oncology are then discussed with a brief introduction to how radiation works, followed by a detailed explanation of the nuances of simulation, including different imaging modalities, immobilization, and accounting for motion. The medical student is then instructed on how to participate in contouring, plan generation and evaluation, and the delivery of radiation on the machine. Lastly, potential adverse effects of radiation are discussed with a particular focus on the on-treatment patient.

  17. Primer on lead-acid storage batteries

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-09-01

    This handbook was developed to help DOE facility contractors prevent accidents caused during operation and maintenance of lead-acid storage batteries. Major types of lead-acid storage batteries are discussed as well as their operation, application, selection, maintenance, and disposal (storage, transportation, as well). Safety hazards and precautions are discussed in the section on battery maintenance. References to industry standards are included for selection, maintenance, and disposal.

  18. A Primer on Endoscopic Electronic Medical Records

    OpenAIRE

    Atreja, Ashish; Rizk, Maged; Gurland, Brooke

    2010-01-01

    Endoscopic electronic medical record systems (EEMRs) are now increasingly utilized in many endoscopy centers. Modern EEMRs not only support endoscopy report generation, but often include features such as practice management tools, image and video clip management, inventory management, e-faxes to referring physicians, and database support to measure quality and patient outcomes. There are many existing software vendors offering EEMRs, and choosing a software vendor can be time consuming and co...

  19. Getting Started: A Social Media Primer.

    Science.gov (United States)

    Ferguson, Dalya M; Kao, Lillian S

    2017-09-01

    Social media use has increased both in the general public and in the surgical profession. A variety of social media platforms have been used, with Twitter being one of the most common and interactive platforms. Common uses by surgeons and scientists for social media include dissemination of information, information exchange, education, research recruitment, community consultation for clinical trials, and hospital or surgeon ratings. As social media use increases, a new language as well as metrics has been developed to track impact and reach of research incorporating social media platforms. All surgeons should be encouraged to familiarize themselves with social media, regardless of whether or not they choose to actively engage in it.

  20. Primer on client-side web security

    CERN Document Server

    De Ryck, Philippe; Piessens, Frank; Johns, Martin

    2014-01-01

    This volume illustrates the continuous arms race between attackers and defenders of the Web ecosystem by discussing a wide variety of attacks. In the first part of the book, the foundation of the Web ecosystem is briefly recapped and discussed. Based on this model, the assets of the Web ecosystem are identified, and the set of capabilities an attacker may have are enumerated. In the second part, an overview of the web security vulnerability landscape is constructed. Included are selections of the most representative attack techniques reported in great detail. In addition to descriptions of the

  1. A primer on endoscopic electronic medical records.

    Science.gov (United States)

    Atreja, Ashish; Rizk, Maged; Gurland, Brooke

    2010-02-01

    Endoscopic electronic medical record systems (EEMRs) are now increasingly utilized in many endoscopy centers. Modern EEMRs not only support endoscopy report generation, but often include features such as practice management tools, image and video clip management, inventory management, e-faxes to referring physicians, and database support to measure quality and patient outcomes. There are many existing software vendors offering EEMRs, and choosing a software vendor can be time consuming and confusing. The goal of this article is inform the readers about current functionalities available in modern EEMR and provide them with a framework necessary to find an EEMR that is best fit for their practice.

  2. Moessbauer spectroscopic study of corrosion products beneath primer coating containing anticorrosive pigments

    International Nuclear Information System (INIS)

    Kumar, A.V.R.; Nigam, R.K.

    1998-01-01

    The phase analysis of the rusts generated beneath the primer containing micaceous iron oxide (MIO) and micaceous iron oxide in combination with red lead (RL), zinc phosphate (ZP), basic lead silicochromate (BLSC) and zinc chromate (ZC) has been carried out by Moessbauer spectroscopy at room temperature. The rust beneath the coating obtained after immersion of the painted panel for six months in 3% NaCl, consists mainly of non-stoichiometric magnetite together with small fractions of γ-, α-FeOOH except in the case of panel painted with RL containing MIO showed only a central doublet indicating the formation of γ-FeOOH and SPM α-FeOOH. Non-stoichiometry of magnetite as calculated from the ratio of B/A sites of the peaks of magnetite in the spectrum has been found depending on the nature of anticorrosive pigment present in the primer coating. The order of non-stoichiometry has been found to be in order of ZC > BLSC > ZP > MIO. (author)

  3. Analysis and radiological assessment of residues containing NORM materials resulting from earlier activities including modelling of typical industrial residues. Pt. 1. Historical investigation of the radiological relevance of NORM residues and concepts for site identification

    International Nuclear Information System (INIS)

    Reichelt, Andreas; Niedermayer, Matthias; Sitte, Beate; Hamel, Peter Michael

    2007-01-01

    Natural radionuclides are part of the human environment and of the raw materials used. Technical processes may cause their accumulation in residues, and the result will be so-called NORM materials (Naturally occurring radioactive material). The amended Radiation Protection Ordinance (StrlSchV 2001) specifies how the public should be protected, but there are also residues dating back before the issuing of the StrlSchV 2001, the so-called NORM residues. The project intended to assess the risks resulting from these residues. It comprises four parts. Part 1 was for clarification of the radiological relevance of NORM residues and for the development of concepts to detect them. The criterion for their radiological relevance was their activity per mass unit and the material volume accumulated through the centuries. The former was calculated from a wide bibliographic search in the relevant literature on radiation protection, while the mass volume was obtained by a detailed historical search of the consumption of materials that may leave NORM residues. These are, in particular, residues from coal and ore mining and processing. To identify concrete sites, relevant data sources were identified, and a concept for identification of concrete NORM residues was developed on this basis. (orig.) [de

  4. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  5. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

    Science.gov (United States)

    Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

    2015-01-01

    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  6. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

    Directory of Open Access Journals (Sweden)

    Alejandro Gonzalez-Martinez

    2015-01-01

    Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  7. Macroecology: A Primer for Biological Oceanography

    Science.gov (United States)

    Li, W. K. W.

    2016-02-01

    Macroecology is the study of ecological patterns discerned at a spatial, temporal, or organization scale higher than that at which the focal entities interact. Such patterns are statistical or emergent manifestations arising from the ensemble of component entities. Although macroecology is a neologism largely based in terrestrial and avian ecology, macroscopic patterns have long been recognised in biological oceanography. Familiar examples include Redfield elemental stoichiometry, Elton trophic pyramids, Sheldon biomass spectrum, and Margalef life-forms mandala. Macroecological regularities can often be found along various continua, such as along body size in power-law scaling or along habitat temperature in metabolic theory. Uniquely in oceanography, a partition of the world ocean continuum into Longhurst biogeochemical provinces provides a spatial organization well-suited for macroecological investigations. In this rational discrete approach, fundamental processes in physical and biological oceanography that differentiate a set of non-overlapping ocean regions also appear to shape the macroecological structure of phytoplankton communities.

  8. A primer for Chiral Perturbative Theory

    International Nuclear Information System (INIS)

    Scherer, Stefan; Schindler, Matthias R.; George Washington Univ., Washington, DC

    2012-01-01

    Chiral Perturbation Theory, as effective field theory, is a commonly accepted and well established working tool, approximating quantum chromodynamics at energies well below typical hadron masses. This volume, based on a number of lectures and supplemented with additional material, provides a pedagogical introduction for graduate students and newcomers entering the field from related areas of nuclear and particle physics. Starting with the the Lagrangian of the strong interactions and general symmetry principles, the basic concepts of Chiral Perturbation Theory in the mesonic and baryonic sectors are developed. The application of these concepts is then illustrated with a number of examples. A large number of exercises (81, with complete solutions) are included to familiarize the reader with helpful calculational techniques. (orig.)

  9. A primer on precision medicine informatics.

    Science.gov (United States)

    Sboner, Andrea; Elemento, Olivier

    2016-01-01

    In this review, we describe key components of a computational infrastructure for a precision medicine program that is based on clinical-grade genomic sequencing. Specific aspects covered in this review include software components and hardware infrastructure, reporting, integration into Electronic Health Records for routine clinical use and regulatory aspects. We emphasize informatics components related to reproducibility and reliability in genomic testing, regulatory compliance, traceability and documentation of processes, integration into clinical workflows, privacy requirements, prioritization and interpretation of results to report based on clinical needs, rapidly evolving knowledge base of genomic alterations and clinical treatments and return of results in a timely and predictable fashion. We also seek to differentiate between the use of precision medicine in germline and cancer. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  10. Policy and System Approach (PSA: A primer

    Directory of Open Access Journals (Sweden)

    Chandrakant Lahariya

    2017-01-01

    Full Text Available A number of public health challenges have emerged at global and national level in the last two decades. The response to these challenges has rarely been swift and often “knee-jerk.” The national and state level program officials responsible for the activities often apportion the blame on weak health systems or fragmented health service delivery mechanisms, amongst other. In India, the viral illnesses (including those due to dengue and chikungunya are becoming the increasing realities. The Public health response of early identification, disease surveillance, reporting and the preventive and curative measures, remains suboptimal. The health challenges which require multidimensional interventions are usuallyattempted to be resolved through piece meal solutions. This article proposes “policy and system approach (PSA,” combining concepts of “Health in all policies” for intersectoral coordination and “health system approach” for intra-sectoral tackling of the emerging and existing health challenges.

  11. The emergence of consensus: a primer

    Science.gov (United States)

    Baronchelli, Andrea

    2018-02-01

    The origin of population-scale coordination has puzzled philosophers and scientists for centuries. Recently, game theory, evolutionary approaches and complex systems science have provided quantitative insights on the mechanisms of social consensus. However, the literature is vast and widely scattered across fields, making it hard for the single researcher to navigate it. This short review aims to provide a compact overview of the main dimensions over which the debate has unfolded and to discuss some representative examples. It focuses on those situations in which consensus emerges `spontaneously' in the absence of centralized institutions and covers topics that include the macroscopic consequences of the different microscopic rules of behavioural contagion, the role of social networks and the mechanisms that prevent the formation of a consensus or alter it after it has emerged. Special attention is devoted to the recent wave of experiments on the emergence of consensus in social systems.

  12. A primer for chiral perturbation theory

    CERN Document Server

    Scherer, Stefan

    2012-01-01

    Chiral Perturbation Theory, as effective field theory, is a commonly accepted and well established working tool, approximating quantum chromodynamics at energies well below typical hadron masses. This volume, based on a number of lectures and supplemented with additional material, provides a pedagogical introduction for graduate students and newcomers entering the field from related areas of nuclear and particle physics. Starting with the the Lagrangian of the strong interactions and general symmetry principles, the basic concepts of Chiral Perturbation Theory in the mesonic and baryonic sectors are developed. The application of these concepts is then illustrated with a number of examples. A large number of exercises (81, with complete solutions) are included to familiarize the reader with helpful calculational techniques.

  13. Image Sharing in Radiology-A Primer.

    Science.gov (United States)

    Chatterjee, Arindam R; Stalcup, Seth; Sharma, Arjun; Sato, T Shawn; Gupta, Pushpender; Lee, Yueh Z; Malone, Christopher; McBee, Morgan; Hotaling, Elise L; Kansagra, Akash P

    2017-03-01

    By virtue of its information technology-oriented infrastructure, the specialty of radiology is uniquely positioned to be at the forefront of efforts to promote data sharing across the healthcare enterprise, including particularly image sharing. The potential benefits of image sharing for clinical, research, and educational applications in radiology are immense. In this work, our group-the Association of University Radiologists (AUR) Radiology Research Alliance Task Force on Image Sharing-reviews the benefits of implementing image sharing capability, introduces current image sharing platforms and details their unique requirements, and presents emerging platforms that may see greater adoption in the future. By understanding this complex ecosystem of image sharing solutions, radiologists can become important advocates for the successful implementation of these powerful image sharing resources. Copyright © 2017 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.

  14. A U.S. Biodefense Strategy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Poulin, D

    2009-05-11

    The anthrax mailings that followed the attacks of September 11, 2001 highlighted the need for a comprehensive national strategy to prevent, prepare for, respond to, and mitigate the effects of biological attacks. The goal of U.S. biodefense strategy is to reduce the likelihood of a future biological event, improve overall U.S. public health security, and minimize the economic and social disruption of a biological incident. Presidential communications, federal legislation, and executive agency planning documents provide the foundation for this strategy. Central to current U.S. biodefense strategy is the 2004 Homeland Security Presidential Directive (HSPD) 10, Biodefense for the 21st Century, which states that ''the United States will use all means necessary to prevent, protect against, and mitigate biological weapons attacks perpetrated against our homeland and our global interests.'' HSPD-10 also sets forth four pillars of U.S. biodefense: {sm_bullet} Threat awareness includes timely, accurate, and relevant intelligence, threat assessment, and the anticipation of future threats. {sm_bullet} Prevention and protection involve continuing and expanding efforts to limit access to agents, technologies, and knowledge to certain groups and countries as well as protecting critical infrastructure from the effects of biological attacks. {sm_bullet} Surveillance and detection provide early warning or recognition of biological attacks to permit a timely response and mitigation of consequences as well as attribution. {sm_bullet} Response and recovery include pre-attack planning and preparedness, capabilities to treat casualties, risk communications, physical control measures, medical countermeasures, and decontamination capabilities.

  15. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  16. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  17. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  18. Fibromyalgia: A Primer for the Anesthesia Community

    Science.gov (United States)

    Brummett, Chad M.; Clauw, Daniel J.

    2012-01-01

    Purpose of the Review The present review is intended to give an overview of fibromyalgia for the anesthesiologist. While the basics of the treatment of fibromyalgia are included, the intent is to provide context to discuss the potential implications in perioperative management. Recent Findings One of the most important changes in the last year is the new criteria established by the American College of Rheumatology for the diagnosis of fibromyalgia. Instead of a combination of self-report and a tender point examination, there is a new self-report questionnaire that is now used diagnose fibromyalgia. This tool incorporates aspects of widespread body pain and some of the known comorbid symptoms. A score of 0-31 is given, which allows for the disease to be viewed as a continuum of sensitivity and symptomatology, instead of as a binary diagnosis. This continuum has been termed “fibromyalgia-ness.” This article also reviews the advances in understanding of the pathophysiology and emerging therapies. Little is known about the impact of fibromyalgia in the perioperative period. Summary The impact of fibromyalgia on anesthesia care is not known. Years of quality research have clearly demonstrated multiple pathophysiologic changes that could impact anesthesia care and future study is needed. PMID:21799404

  19. Electronic medical devices: a primer for pathologists.

    Science.gov (United States)

    Weitzman, James B

    2003-07-01

    Electronic medical devices (EMDs) with downloadable memories, such as implantable cardiac pacemakers, defibrillators, drug pumps, insulin pumps, and glucose monitors, are now an integral part of routine medical practice in the United States, and functional organ replacements, such as the artificial heart, pancreas, and retina, will most likely become commonplace in the near future. Often, EMDs end up in the hands of the pathologist as a surgical specimen or at autopsy. No established guidelines for systematic examination and reporting or comprehensive reviews of EMDs currently exist for the pathologist. To provide pathologists with a general overview of EMDs, including a brief history; epidemiology; essential technical aspects, indications, contraindications, and complications of selected devices; potential applications in pathology; relevant government regulations; and suggested examination and reporting guidelines. Articles indexed on PubMed of the National Library of Medicine, various medical and history of medicine textbooks, US Food and Drug Administration publications and product information, and specifications provided by device manufacturers. Studies were selected on the basis of relevance to the study objectives. Descriptive data were selected by the author. Suggested examination and reporting guidelines for EMDs received as surgical specimens and retrieved at autopsy. Electronic medical devices received as surgical specimens and retrieved at autopsy are increasing in number and level of sophistication. They should be systematically examined and reported, should have electronic memories downloaded when indicated, will help pathologists answer more questions with greater certainty, and should become an integral part of the formal knowledge base, research focus, training, and practice of pathology.

  20. Hormonal emergency contraception: a clinical primer.

    Science.gov (United States)

    Ziebarth, Angela; Hansen, Keith A

    2007-03-01

    Unintended and teenage pregnancies are major public health concerns in the United States. Emergency contraception is used to prevent pregnancy after failure of a contraceptive method or after unprotected intercourse. Expanded use of emergency contraception has the potential to reduce unintended pregnancy and induced abortions, while reducing state and federal healthcare expenditures. The recent approval of Plan B as an over-the-counter medication for individuals over 18 years of age should improve access to this medication. However, there are still widespread misconceptions about the mechanisms and implications of emergency contraception. Expanded access to emergency contraception is associated with increased use, but not associated with decreased efficacy, increased sexual risk-taking behavior, or less consistent use of traditional birth control methods. This review is designed to provide clinicians with information regarding the use of emergency contraception for reproductive age patients. It includes a brief description of methods of use, mechanisms of action, and side effect profiles of the most commonly used methods of emergency contraception, levonorgestrel and the Yuzpe method.

  1. Deep Learning: A Primer for Radiologists.

    Science.gov (United States)

    Chartrand, Gabriel; Cheng, Phillip M; Vorontsov, Eugene; Drozdzal, Michal; Turcotte, Simon; Pal, Christopher J; Kadoury, Samuel; Tang, An

    2017-01-01

    Deep learning is a class of machine learning methods that are gaining success and attracting interest in many domains, including computer vision, speech recognition, natural language processing, and playing games. Deep learning methods produce a mapping from raw inputs to desired outputs (eg, image classes). Unlike traditional machine learning methods, which require hand-engineered feature extraction from inputs, deep learning methods learn these features directly from data. With the advent of large datasets and increased computing power, these methods can produce models with exceptional performance. These models are multilayer artificial neural networks, loosely inspired by biologic neural systems. Weighted connections between nodes (neurons) in the network are iteratively adjusted based on example pairs of inputs and target outputs by back-propagating a corrective error signal through the network. For computer vision tasks, convolutional neural networks (CNNs) have proven to be effective. Recently, several clinical applications of CNNs have been proposed and studied in radiology for classification, detection, and segmentation tasks. This article reviews the key concepts of deep learning for clinical radiologists, discusses technical requirements, describes emerging applications in clinical radiology, and outlines limitations and future directions in this field. Radiologists should become familiar with the principles and potential applications of deep learning in medical imaging. © RSNA, 2017.

  2. Superfund Site Information - Site Sampling Data

    Data.gov (United States)

    U.S. Environmental Protection Agency — This asset includes Superfund site-specific sampling information including location of samples, types of samples, and analytical chemistry characteristics of...

  3. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  4. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  5. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  6. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  7. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  8. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  9. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  10. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  11. Promoting Your Web Site.

    Science.gov (United States)

    Raeder, Aggi

    1997-01-01

    Discussion of ways to promote sites on the World Wide Web focuses on how search engines work and how they retrieve and identify sites. Appropriate Web links for submitting new sites and for Internet marketing are included. (LRW)

  12. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  13. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  14. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  15. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  16. Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

    Science.gov (United States)

    Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

    2015-01-01

    The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

  17. Site selection

    International Nuclear Information System (INIS)

    Olsen, C.W.

    1983-07-01

    The conditions and criteria for selecting a site for a nuclear weapons test at the Nevada Test Site are summarized. Factors considered are: (1) scheduling of drill rigs, (2) scheduling of site preparation (dirt work, auger hole, surface casing, cementing), (3) schedule of event (when are drill hole data needed), (4) depth range of proposed W.P., (5) geologic structure (faults, Pz contact, etc.), (6) stratigraphy (alluvium, location of Grouse Canyon Tuff, etc.), (7) material properties (particularly montmorillonite and CO 2 content), (8) water table depth, (9) potential drilling problems (caving), (10) adjacent collapse craters and chimneys, (11) adjacent expended but uncollapsed sites, (12) adjacent post-shot or other small diameter holes, (13) adjacent stockpile emplacement holes, (14) adjacent planned events (including LANL), (15) projected needs of Test Program for various DOB's and operational separations, and (16) optimal use of NTS real estate

  18. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  19. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  20. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

    Science.gov (United States)

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

    2017-01-01

    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

  1. Comparison of shear bond strength of orthodontic brackets bonded using two different hydrophilic primers: An in vitro study

    Directory of Open Access Journals (Sweden)

    M Kumaraswamy Anand

    2014-01-01

    Full Text Available Context: Salivary control and maintenance of a dry operating field is a prime requisite of orthodontic bonding. Moisture insensitive primer (MIP with a clinical significant bond strength values have a better edge over the conventional hydrophobic bonding systems. Aim: The aim of this study is to investigate the effectiveness of two hydrophilic primers with respect to conventional hydrophobic primer by comparing their shear bond strength (SBS and adhesive-failure locations after contamination with saliva and saliva substitute. Materials and Methods: A total of 150 extracted human premolars were randomly divided into five group s ; Group A (Transbond MIP/saliva substitute, Group B (Opal Primo/saliva substitute, Group C (Transbond MIP/natural saliva, Group D (Opal Primo/natural saliva, control group - Group E (Transbond XT/dry, adhesive-Transbond XT used for all five groups and bonded using stainless steel brackets. Shear forces were applied to the samples with a universal testing machine. SBSs was measured in megapascals. The mode of bond failure was determined using the adhesive remnant index (ARI. Results: The mean SBS produced by Transbond MIP was higher than Opal Primo, which was statistically significant according to one-way analysis of variance. Both the tested groups showed lesser bond strength values than Transbond XT (the control. ARI scores revealed that there was no statistically significant difference in the site of bond failure between study groups. ARI scores were found to be lower for study groups suggesting adhesive failure, compared to higher ARI scores for the control group suggesting cohesive failure. Conclusion: Transbond XT adhesive with Transbond MIP or Opal Primo have clinically acceptable bond strength in wet fields. Opal Primo is a viable option to use as a hydrophilic primer clinically.

  2. Novel acsF Gene Primers Revealed a Diverse Phototrophic Bacterial Population, Including Gemmatimonadetes, in Lake Taihu (China)

    Czech Academy of Sciences Publication Activity Database

    Huang, Y.; Zeng, Y.; Lu, H.; Feng, H.; Zeng, Yo.; Koblížek, Michal

    2016-01-01

    Roč. 82, č. 18 (2016), s. 5587-5594 ISSN 0099-2240 R&D Projects: GA ČR GA13-11281S; GA MŠk(CZ) LO1416 Institutional support: RVO:61388971 Keywords : AEROBIC ANOXYGENIC PHOTOTROPHS * MICROBIAL COMMUNITIES * OPERONS Subject RIV: EA - Cell Biology Impact factor: 3.807, year: 2016

  3. The emerging functionality of endogenous lectins: A primer to the concept and a case study on galectins including medical implications.

    Science.gov (United States)

    Gabius, Hans-Joachim; Wu, Albert M

    2006-01-01

    Biochemistry textbooks commonly make it appear that it is a foregone conclusion that the hardware of biological information storage and transfer is confined to nucleotides and amino acids, the letters of the genetic code. However, the remarkable talents of a third class of biomolecules are often overlooked. For example, one of them far surpasses the building blocks of nucleic acids and proteins in terms of theoretical coding capacity by oligomer formation. Although often exclusively assigned to duties in energy metabolism, carbohydrates as part of cellular glycoconjugates (glycoproteins, proteoglycans, glycolipids) have, in fact, other important tasks. Currently, they are increasingly gaining recognition as an operative high-density information coding system. An elaborate enzymatic machinery enables cells to be versatile enough to produce a glycan profile (glycome) that is as characteristic as a fingerprint. Moreover, swift modifications during dynamic processes, such as differentiation or malignant transformation, are readily possible. The translation of the information presented in oligosaccharide determinants to biological responses is carried out by lectins. Recognition of foreign glycosignatures in innate immunity, regulation of cell-cell/matrix interactions, cell migration or growth, and intra- and intercellular glycan routing etc represent physiologically far-reaching lectin-carbohydrate functionality. The classification of endogenous lectins is guided by sequence alignments and conservation of distinct structural traits. For example, a jelly-roll-like folding pattern and maintenance of key residue positioning involved in stacking and C-H/pi-interactions as well as directional hydrogen bonds to the 1-galactoside ligands are common denominators among galectins. Biochemical and biophysical studies are beginning to unravel the intricacies of the selection of a limited set of endogenous ligands, such as certain integrins or ganglioside GM1, and combined with biological cell experiments, its relevance for cell sociology, e.g. in growth regulation and tumor cell invasion or activated T cell apoptosis. Histopathological monitoring accompanies the biological cell investigations, linking expression of certain family members to tumor progression or suppression. Further insights into the functional consequences of the sugar code's translation are thus expected to have notable repercussions for diagnostic and therapeutic procedures.

  4. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  5. Site Restoration

    Energy Technology Data Exchange (ETDEWEB)

    Noynaert, L.; Bruggeman, A.; Cornelissen, R.; Massaut, V.; Rahier, A

    2001-04-01

    The objectives, the programme, and the achievements of the Site Restoration Department of SCK-CEN in 2000 are summarised. Main activities include the decommissioning of the BR3 PWR-reactor as well as other clean-up activities, projects on waste minimisation and activities related to the management of decommissioning projects. The department provides consultancy and services to external organisations.

  6. Site Restoration

    International Nuclear Information System (INIS)

    Noynaert, L.; Bruggeman, A.; Cornelissen, R.; Massaut, V.; Rahier, A.

    2001-01-01

    The objectives, the programme, and the achievements of the Site Restoration Department of SCK-CEN in 2000 are summarised. Main activities include the decommissioning of the BR3 PWR-reactor as well as other clean-up activities, projects on waste minimisation and activities related to the management of decommissioning projects. The department provides consultancy and services to external organisations

  7. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  8. A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

    Science.gov (United States)

    Shibuta, K; Abe, M; Suzuki, T

    1994-01-01

    The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

  9. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  10. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  11. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  12. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  13. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  14. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  15. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  16. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  17. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  18. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  19. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  20. New seismograph includes filters

    Energy Technology Data Exchange (ETDEWEB)

    1979-11-02

    The new Nimbus ES-1210 multichannel signal enhancement seismograph from EG and G geometrics has recently been redesigned to include multimode signal fillers on each amplifier. The ES-1210F is a shallow exploration seismograph for near subsurface exploration such as in depth-to-bedrock, geological hazard location, mineral exploration, and landslide investigations.

  1. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

    Science.gov (United States)

    Duina, Andrea A; Miller, Mary E; Keeney, Jill B

    2014-05-01

    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

  2. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  3. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  4. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  5. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  6. Analytic device including nanostructures

    KAUST Repository

    Di Fabrizio, Enzo M.; Fratalocchi, Andrea; Totero Gongora, Juan Sebastian; Coluccio, Maria Laura; Candeloro, Patrizio; Cuda, Gianni

    2015-01-01

    A device for detecting an analyte in a sample comprising: an array including a plurality of pixels, each pixel including a nanochain comprising: a first nanostructure, a second nanostructure, and a third nanostructure, wherein size of the first nanostructure is larger than that of the second nanostructure, and size of the second nanostructure is larger than that of the third nanostructure, and wherein the first nanostructure, the second nanostructure, and the third nanostructure are positioned on a substrate such that when the nanochain is excited by an energy, an optical field between the second nanostructure and the third nanostructure is stronger than an optical field between the first nanostructure and the second nanostructure, wherein the array is configured to receive a sample; and a detector arranged to collect spectral data from a plurality of pixels of the array.

  7. Saskatchewan resources. [including uranium

    Energy Technology Data Exchange (ETDEWEB)

    1979-09-01

    The production of chemicals and minerals for the chemical industry in Saskatchewan are featured, with some discussion of resource taxation. The commodities mentioned include potash, fatty amines, uranium, heavy oil, sodium sulfate, chlorine, sodium hydroxide, sodium chlorate and bentonite. Following the successful outcome of the Cluff Lake inquiry, the uranium industry is booming. Some developments and production figures for Gulf Minerals, Amok, Cenex and Eldorado are mentioned.

  8. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  9. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  10. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  11. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  12. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  13. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  14. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  15. The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program

    Directory of Open Access Journals (Sweden)

    Urba Walter J

    2011-01-01

    Full Text Available Abstract The Society for Immunotherapy of Cancer, SITC (formerly the International Society for Biological Therapy of Cancer, iSBTc, aims to improve cancer patient outcomes by advancing the science, development and application of biological therapy and immunotherapy. The society and its educational programs have become premier destinations for interaction and innovation in the cancer biologics community. For over a decade, the society has offered the Primer on Tumor Immunology and Biological Therapy of Cancer™ in conjunction with its Annual Scientific Meeting. This report summarizes the 2010 Primer that took place October 1, 2010 in Washington, D.C. as part of the educational offerings associated with the society's 25th anniversary. The target audience was basic and clinical investigators from academia, industry and regulatory agencies, and included clinicians, post-doctoral fellows, students, and allied health professionals. Attendees were provided a review of basic immunology and educated on the current status and most recent advances in tumor immunology and clinical/translational caner immunology. Ten prominent investigators presented on the following topics: innate immunity and inflammation; an overview of adaptive immunity; dendritic cells; tumor microenvironment; regulatory immune cells; immune monitoring; cytokines in cancer immunotherapy; immune modulating antibodies; cancer vaccines; and adoptive T cell therapy. Presentation slides, a Primer webinar and additional program information are available online on the society's website.

  16. Being Included and Excluded

    DEFF Research Database (Denmark)

    Korzenevica, Marina

    2016-01-01

    Following the civil war of 1996–2006, there was a dramatic increase in the labor mobility of young men and the inclusion of young women in formal education, which led to the transformation of the political landscape of rural Nepal. Mobility and schooling represent a level of prestige that rural...... politics. It analyzes how formal education and mobility either challenge or reinforce traditional gendered norms which dictate a lowly position for young married women in the household and their absence from community politics. The article concludes that women are simultaneously excluded and included from...... community politics. On the one hand, their mobility and decision-making powers decrease with the increase in the labor mobility of men and their newly gained education is politically devalued when compared to the informal education that men gain through mobility, but on the other hand, schooling strengthens...

  17. Effects of bond primers on bending strength and bonding of glass fibers in fiber-embedded maxillofacial silicone prostheses.

    Science.gov (United States)

    Hatamleh, Muhanad M; Watts, David C

    2011-02-01

    To evaluate the effect of three commonly used bond primers on the bending strength of glass fibers and their bond strength to maxillofacial silicone elastomer after 360 hours of accelerated daylight aging. Eighty specimens were fabricated by embedding resin-impregnated fiber bundles (1.5-mm diameter, 20-mm long) into maxillofacial silicone elastomer M511 (Cosmesil). Twenty fiber bundles served as control and did not receive surface treatment with primers, whereas the remaining 60 fibers were treated with three primers (n = 20): G611 (Principality Medical), A-304 (Factor II), and A-330-Gold (Factor II). Forty specimens were dry stored at room temperature (23 ± 1°C) for 24 hours, and the remaining specimens were aged using an environmental chamber under accelerated exposure to artificial daylight for 360 hours. The aging cycle included continuous exposure to quartz-filtered visible daylight (irradiance 760 W/m(2) ) under an alternating weathering cycle (wet for 18 minutes, dry for 102 minutes). Pull-out tests were performed to evaluate bond strength between fiber bundles and silicone using a universal testing machine at 1 mm/min crosshead speed. A 3-point bending test was performed to evaluate the bending strength of the fiber bundles. One-way Analysis of Variance (ANOVA), Bonferroni post hoc test, and an independent t-test were carried out to detect statistical significances (p accelerated daylight aging. Treatment with primer and accelerated daylight aging increased bending strength of glass fibers. © 2011 by The American College of Prosthodontists.

  18. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  19. A primer on industrial ecosystems : a strategy for sustainable industrial development

    Energy Technology Data Exchange (ETDEWEB)

    Cote, R P [Dalhousie Univ., Halifax, NS (Canada). Eco-Efficiency Centre; [Dalhousie Univ., Halifax, NS (Canada). Faculty of Management, School for Resource and Environmental Studies

    2003-07-01

    Industrial ecology incorporates ecological theories, functions and limits into the design of industrial production systems, processes and products. The main objective is to enhance environmental and economic performance through collaboration in managing environmental resource issues such as energy, water and materials. Industrial ecology recognizes the connectedness and synergies of materials, products and infrastructure. As such, it considers the life cycle of products, the design of buildings, infrastructure and industrial parks. By working together, businesses gain a collective benefit which is greater than the total of the individual benefits each company could achieve on its own. Industrial ecology also considers the reuse, recovery and recycling of resources. The benefits include: efficiency of resource use; cost reduction for industrial infrastructure; sustainable development support; and, new opportunities in economic development, technology development, manufacturing, and business management. This primer also presents guidelines for win-win projects in industrial ecology. refs., figs.

  20. An electrochemical study of the corrosion behavior of primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, M. D.; Higgins, R. H.

    1985-01-01

    The corrosion behavior for 2219-T87 aluminum coated with various primers, including those used for the external tank and solid rocket boosters of the Space Shuttle Transportation System, were investigated using electrochemical techniques. Corrosion potential time, polarization resistance time, electrical resistance time, and corrosion rate time measurements were all investigated. It was found that electrical resistance time and corrosion rate time measurement were most useful for studying the corrosion behavior of painted aluminum. Electrical resistance time determination give useful information concerning the porosity of paint films, while corrosion rate time curves give important information concerning overall corrosion rates and corrosion mechanisms. In general, the corrosion rate time curves all exhibited at least one peak during the 30 day test period, which was attributed, according to the proposed mechanisms, to the onset of the hydrogen evolution reaction and the beginning of destruction of the protective properties of the paint film.

  1. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  2. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  3. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  4. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  5. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  6. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  7. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  8. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  9. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  10. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  11. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  12. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  13. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  14. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  15. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  16. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  17. Site Restoration

    Energy Technology Data Exchange (ETDEWEB)

    Noynaert, L.; Bruggeman, A.; Cornelissen, R.; Massaut, V.; Rahier, A

    2002-04-01

    The objectives, the programme, and the achievements of SCK-CEN's Site Restoration Department for 2001 are described. Main activities include the decommissioning of the BR3 PWR-reactor as well as other clean-up activities, projects on waste minimisation and the management of spent fuel and the flow of dismantled materials and the recycling of materials from decommissioning activities based on the smelting of metallic materials in specialised foundries. The department provides consultancy and services to external organisations and performs R and D on new techniques including processes for the treatment of various waste components including the reprocessing of spent fuel, the treatment of tritium, the treatment of liquid alkali metals into cabonates through oxidation, the treatment of radioactive organic waste and the reconditioning of bituminised waste products.

  18. Software-Supported USER Cloning Strategies for Site-Directed Mutagenesis and DNA Assembly

    DEFF Research Database (Denmark)

    Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen

    2015-01-01

    USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER...... cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein...... (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at ....

  19. A systems engineering primer for every engineer and scientist

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, William R.

    2001-12-10

    The Systems Engineering (SE) staff at LBNL has generated the following artifacts to assist projects with implementing a systems approach: (1) The present document that focuses on the what, why, and when of SE. It also provides a simple case-study to illustrate several SE tasks. (2) A web site with primary emphasis on the project life-cycle and workflow, (http://www-eng.LBNL.gov/Systems/index.html). It includes: SE guidelines and principles; A list of in-house tools; Templates; Case studies with ''how to'' examples; and Links to useful SE material. These sources are living documents to be updated as necessary. The viewpoint adopted in this document is that what LBNL engineers and scientists need is a set of principles and guiding practices for developing R and D systems rather than a ''cookbook''. There are many excellent ''how to'' resources such as the ''INCOSE Systems Engineering Handbook'' to guide those in search of more details. The SE staff is another resource available to consult and support projects. This document specifies SE principles and activities that are applicable to all LBNL projects independent of their specific differences. Each project should tailor the SE implementation to meet its individual needs and culture including project-specific resources, procedures, products, and tools.

  20. A systems engineering primer for every engineer and scientist

    International Nuclear Information System (INIS)

    Edwards, William R.

    2001-01-01

    The Systems Engineering (SE) staff at LBNL has generated the following artifacts to assist projects with implementing a systems approach: (1) The present document that focuses on the what, why, and when of SE. It also provides a simple case-study to illustrate several SE tasks. (2) A web site with primary emphasis on the project life-cycle and workflow, (http://www-eng.LBNL.gov/Systems/index.html). It includes: SE guidelines and principles; A list of in-house tools; Templates; Case studies with ''how to'' examples; and Links to useful SE material. These sources are living documents to be updated as necessary. The viewpoint adopted in this document is that what LBNL engineers and scientists need is a set of principles and guiding practices for developing R and D systems rather than a ''cookbook''. There are many excellent ''how to'' resources such as the ''INCOSE Systems Engineering Handbook'' to guide those in search of more details. The SE staff is another resource available to consult and support projects. This document specifies SE principles and activities that are applicable to all LBNL projects independent of their specific differences. Each project should tailor the SE implementation to meet its individual needs and culture including project-specific resources, procedures, products, and tools